COMPOSITIONS AND METHODS OF TREATMENT USING EXPANDED- SIZE

DNA ANALOGS CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims priority from U.S. Provisional Application Serial No. 62/377,058, filed August 19, 2016, the contents of which are incorporated by reference herein in its entirety. STATEMENT REGARDING FEDERALLYSPONSORED RESEARCH OR

DEVELOPMENT

This invention was made with government support under Grant No. 4ROOCA160648-03 awarded by The National Institutes of Health National Cancer Institute. The government has certain rights in the invention.

BACKGROUND OF THE INVENTION

Synthetic nucleotide analogs possessing non-canonical structures and properties are widely used for medicinal purposes, biomedical research, high-throughput sequencing, and show promise for synthetic biology applications (Jordheim et al., 2013, Nat Rev Drug Discov 12:447-64; Guo et al., 2008, PNAS 105:9145-50; Chen, 2014, Frong Microbiol 5:305; Krueger et al., 2011, J Am Chem Soc 133 : 18447-51; Liu et al., 2003, Science 302:868-71; Malyshev et al., 2014, Nature 509:385-8). With regard to therapeutic applications, nucleoside and nucleotide analogs have been developed widely as prodrugs to treat cancer and viral infections (Jordheim et al., 2013, Nat Rev Drug Discov 12:447-64). For example, the anti-hepatitis C virus (HCV) nucleotide prodrug sofosbuvir is now widely used to treat HCV patients due to its ability to act as a chain terminator of HCV NS5A polymerase after it is converted into triphosphate form in cells (Jordheim et al., 2013, Nat Rev Drug Discov 12:447-64; Gane et al., 2013, NEJM 368:34-44). Several nucleoside and nucleotide analogs are also used as chemotherapy agents for both hematological malignancies and solid tumors. For example, gemcitabine, a prodrug deoxycytidine analog that inhibits DNA synthesis, is used to treat various carcinomas including pancreatic cancer, non-small cell lung cancer, breast cancer, bladder cancer, and is currently being tested in blood cancers (Jordheim et al., 2013, Nat Rev Drug Discov 12:447-64). Sapacitabine is a newly developed nucleoside analog that exhibits a unique mechanism of action by catalyzing a single-strand break in DNA after its incorporated by the replication machinery (Jordheim et al., 2013, Nat Rev Drug Discov 12:447-64). The single-strand break is subsequently converted into a double- strand break (DSB) during the next round of replication. Since persistent DSBs are lethal to cells deficient in homologous recombination (HR)— the primary DSB repair pathway during S and G2 cell-cycle phases— sapacitabine causes selective killing of cells deficient in HR, which is a proven mechanism of personalized medicine for cancers mutated in integral HR factors such as BRCA1 or BRCA2 (Liu et al., 2012, Chin J Cancer 31 :373-80; Lord et al., 2014, Annu Rev Med 66:455-70). Various other anticancer and anti-viral nucleoside and nucleotide pro-drugs are currently in development to increase bioavailability and reduce toxic side-effects and drug resistance (Jordheim et al., 2013, Nat Rev Drug Discov 12:447-64).

Synthetic nucleotide analogs also show great promise for synthetic biology applications. For example, unnatural nucleotides containing hydrophobic nucleobases or alternatively-H-bonded nucleobases have recently been developed for the purpose of expanding the genetic code (Malyshev et al., 2014, Nature 509:385-8; Zhang et al., 2014, J Am Chem Soc 137:6734-7; Yamashige et al., 2012, NAR, 40:2793-806). Such alternative base pairs can adopt a Watson-Crick-compatible pair geometry within a polymerase active site, and at least one example can be incorporated during multiple rounds of DNA replication in bacteria (Malyshev et al., 2014, Nature 509:385-8; Betz et al., 2012, Nat Chem Biol 8:612-4). Prior to this work, synthetic size-expanded deoxyribonucleoside monophosphates (dxNMPs) and triphosphates (dxNTPs) were developed, which include a benzene ring within the base moiety of each canonical nucleoside (Figure 1A) (Liu et al., 2003, Science 302:868-71). Although dxNMPs significantly expand the width of the helix (Lynch et al., 2006, J Am Chem Soc

128: 14704-11), they retain canonical base pairing interactions and exhibit stronger base stacking interactions, increasing the thermostability of xDNA compared to canonical DNA(Liu et al., 2003, Science 302:868-71; Krueger et al., 2008, J Am Chem Soc 130:3989-99). Despite the increased size, xDNA was also shown to be utilized as genetic information in bacteria, successfully encoding amino acids of green fluorescent protein (Krueger et al., 2011, J Am Chem Soc 133 : 18447-51). In that study, data suggested that error-prone Yfamily bacterial polymerases aided in the synthesis and bypass of the large- sized base pairs. In separate studies, Y-family DNA polymerase Dpo4 was shown to perform relatively efficient nucleotide incorporation opposite template dxNMPs in vitro, in comparison to A family Pol I (Klenow fragment) which exhibits higher fidelity DNA synthesis (Lu et al., 2010, Org Biomol Chem 8:2704-10). Together, these studies demonstrate that certain sterically flexible DNA polymerases can accommodate size- expanded dxNMPs in the template DNA strand.

Although some DNA polymerases can perform DNA synthesis opposite xDNA bases in the template (Krueger et al., 2011, J Am Chem Soc 133 : 18447-51;

Krueger et al., 2008, Nucleic Acids Symp Ser 455-6; Delaney et al., 2009, Agnew Chem Int Ed Engl 48:4524-7), to date the incorporation of dxNMPs into a primer strand by a template-dependent DNA polymerase has not shown. For most polymerases, unfavorable steric interactions would be expected to disfavor dxNTPs as an incoming substrate. The large nucleobase is likely to induce steric hindrance within the active site of DNA polymerases, which may prevent proper positioning of the nucleotide near the 3'- hydroxyl at the primer terminus for the phosphodiester transfer reaction. Interestingly, previous studies have shown efficient utilization of dxNMPs by terminal

deoxynucleotidyl transferase, which unlike common DNA polymerases does not require a template for the nucleotidyl transfer, thus potentially explaining its ability to

accommodate large unnatural nucleotides (Jarchow-Choy et al., 2011, NAR 39: 1586-94). Importantly, error-prone translesion DNA polymerases have been selected throughout evolution to perform replication opposite damaged DNA bases, which often contain bulky adducts (Waters et al., 2009, Microbiol Mol Biol Rev 73 : 134-54; Sale et al., 2012, Nat Rev Mol Cell Biol 13 : 141-52). Furthermore, certain translesion polymerases are also capable of incorporating nucleotides containing structurally altered or enlarged bases that arise from oxidative damage (Shimizu et al., 2003, EMBO Rep 4:269-73 Atafuchi et al., 2010, NAR 38:859-67; Foti et al., 2012, Science 336:315-9). Thus, the possibility exists that certain translesion polymerases may effectively utilize size-expanded nucleotides as substrates for DNA synthesis. In particular, the polymerase domain encoded by human POLQ— referred to herein as DNA polymerase θ (Ροΐθ)— has been characterized as a highly promiscuous enzyme that exhibits translesion synthesis activity and the unique ability to synthesize DNA across a DSB during a process called microhomology- mediated end-joining (MMEJ) or alternative end-joining (alt-EJ) (Kent et al., 2015, Nat Struct Mol biol 22:230-7; Hogg et al., 2011, J Mol Biol 405:642-52; Seki and Wood, 2008, DNA Repair 7: 119-27; Arana et al., 2008, NAR 36:3847-56; Hogg et al., 2012, NAR 40:2611-22). Thus, although Ροΐθ is among the A-family of polymerases, it exhibits low-fidelity DNA synthesis and translesion synthesis activities akin to Y-family polymerases. The translesion synthesis activity of Ροΐθ has been attributed to a unique insertion motif which has also been shown to facilitate MMEJ (Kent et al., 2015, Nat Struct Mol biol 22:230-7; Hogg et al., 2011, J Mol Biol 405:642-52). In the latter activity, Ροΐθ extends minimally paired ssDNA overhangs generated by 5 '-3' exonucleases at DSBs which is necessary for end-joining of the broken DNA ends (Kent et al., 2015, Nat Struct Mol biol 22:230-7).

Intriguingly, several studies strongly indicate Ροΐθ as an ideal cancer drug target. For example, Ροΐθ is highly upregulated in multiple cancer types, and high levels of the polymerase have been shown to correspond to a poor survival rate for breast cancer patients regardless of their specific breast cancer type (Lemee et al., 2010, PNAS

107: 13390-5; Higgins et al., 2010, Oncotarget 1 : 175-84; Allera-Moreau et al., 2012,

Oncogenesis: l :e30). Ροΐθ has also been shown to confer resistance to ionizing radiation and other chemotherapy agents such as the Poly (ADP ribose) polymerase I (PARPl) inhibitor Olaparib, which has recently been approved to treat ovarian cancer patients harboring mutations in integral HR factors BRCA1 or BRCA2 (BRCA) (Higgins et al., 2010, Cancer Res 70:2984-93; Ceccaldi et al., 2015, Nature 517:258-62 -34;

Yousefzadeh et al.,2014, PLoS Genet 10:el004654). Recent studies also show that suppression of POLQ expression causes synthetic lethality in HR deficient cells including, but not limited to, breast and ovarian cancer cell lines. In contrast, loss of Ροΐθ activity has no major effects in normal BRCA proficient cells or mice (Ceccaldi et al., 2015, Nature 517:258-62; Mateos-Gomez et al., 2015, Nature 518:254-7). Thus, inhibition of Ροΐθ or PARPl has similar synthetic lethal effects in HR deficient cells. Since the polymerase domain expressed by POLQ was shown to play a major role in the survival of BRCA deficient cells (Mateos-Gomez et al., 2015, Nature 518:254-7), it is a priority to identify selective drug-like inhibitors of Ροΐθ for the treatment of cancers that are defective in HR due to mutations or epigenetic alterations in BRCA1, BRCA2., or other important HR genes. Furthermore, since Ροΐθ confers radiation resistance onto cancer cells in general, and promotes resistance to other chemotherapy agents that cause genotoxic stress (Higgins et al., 2010, Cancer Res 70:2984-93; Ceccaldi et al., 2015, Nature 517:258-62 -34; Yousefzadeh et al.,2014, PLoS Genet 10:el004654), it is important to identify selective drug inhibitors of Ροΐθ for the treatment of a variety of cancer types.

There is thus a need in the art for compositions and methods for inhibiting DNA polymerase theta (Ροΐθ) and treating cancer. The present invention addresses this unmet need in the art.

SUMMARY OF THE INVENTION

In one aspect, the invention provides a compound represented by one of Formulae (I) to (IV):

or a salt or solvate thereof.

In one embodiment, in Formula (I), A is an optionally substituted 4 to 6 membered aromatic or heteroaromatic ring; each occurrence of X ¹ is independently selected from the group consisting of CR ¹⁹ , and N;

R ¹¹ to R ¹⁵ are each independently selected from the group consisting of H, Fl, CI, Br, I, - R ¹⁹ R ¹¹⁰ , -OH, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci-C ₆ alkenyl, Ci-C ₆ alkynyl, substituted Ci-C ₆ alkynyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, -(Ci-C6)alkyl-substituted phenyl,

-(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and -(Ci-C6)alkyl-substituted heteroaryl;

R ¹⁶ is selected from the group consisting of OH, -N ₃ , F, CI, and H;

each occurrence of R ¹⁷ and R ¹⁸ is independently selected from the group consisting of H, - R ¹⁹ R ¹¹⁰ , -OR ¹⁹ , -O ^" , Ci-Ce alkyl, substituted Ci-Ce alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci- C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl;

X is selected from the group consisting of O, and R ¹⁹ ;

each occurrence of R ¹⁹ is independently is selected from the group consisting of H, Ci-Ce alkyl, substituted Ci-Ce alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, N(R ¹¹⁰ )(R ^{1 U} ), -(Ci-C ₆ )alkyl-phenyl, substituted -(Ci-C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl;

each occurrence of R ¹¹⁰ and R ¹¹¹ is independently is selected from the group consisting of H, Ci-C ₆ alkyl, substituted Ci-C ₆ alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci-Ce)alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl; and

n is an integer from 0-3. In one embodiment, in Formula (II), R ²¹ to R ²⁵ are each independently selected from the group consisting of H, Fl, CI, Br, I, - R ²⁹ R ²¹⁰ , -OH, Ci-Ce alkyl, substituted Ci-C ₆ alkyl, Ci-C ₆ alkenyl, substituted Ci-C ₆ alkenyl, Ci-C ₆ alkynyl, substituted Ci-C ₆ alkynyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl- phenyl, -(Ci-C6)alkyl-substituted phenyl, -(Ci-C6)alkyl-carbocyclyl,

-(Ci-C6)alkyl-heteroaryl, and -(Ci-C6)alkyl-substituted heteroaryl;

R ²⁶ is selected from the group consisting of OH, -N ₃ , F, CI, and H;

each occurrence of R ²⁷ and R ²⁸ is independently selected from the group consisting of H, - R ²⁹ R ²¹⁰ , -OR ²⁹ , -O ^" , Ci-Ce alkyl, substituted Ci-Ce alkyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci- C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl;

X ¹ is selected from the group consisting of O, and R ²⁹ ;

X ² is selected from the group consisting of O, and S;

each occurrence of R ²⁹ and R ²¹⁰ is independently is selected from the group consisting of H, Ci-Ce alkyl, substituted Ci-Ce alkyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci-Ce)alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl; and

n is an integer from 0-3.

In one embodiment, in Formula (III), R ³¹ to R ³⁵ are each independently selected from the group consisting of H, Fl, CI, Br, I, - R ³⁹ R ³¹⁰ , -OH, Ci-Ce alkyl, substituted Ci-C ₆ alkyl, Ci-C ₆ alkenyl, substituted Ci-C ₆ alkenyl, Ci-C ₆ alkynyl, substituted Ci-C ₆ alkynyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-substituted phenyl, -(Ci-C6)alkyl-carbocyclyl,

-(Ci-C6)alkyl-heteroaryl, and -(Ci-C6)alkyl-substituted heteroaryl;

R ³⁶ is selected from the group consisting of OH, -N ₃ , F, CI, and H; each occurrence of R and R is independently selected from the group consisting of H, - R ³⁹ R ³¹⁰ , -OR ³⁹ , -O ^" , Ci-Ce alkyl, substituted Ci-Ce alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci- C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl;

X ¹ is selected from the group consisting of O, and R ³⁹ ;

X ³ is selected from the group consisting of O and S;

each occurrence of R ³⁹ and R ³¹⁰ is independently is selected from the group consisting of H, Ci-Ce alkyl, substituted C1-G5 alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci-Ce)alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl; and

n is an integer from 0-3.

In one embodiment, in Formula (IV), B is an optionally substituted 4 to 6 membered aromatic or heteroaromatic ring;

X is selected from the group consisting of O, and NR ⁴⁹ ;

X ^I is selected from the group consisting of N and CR ⁴⁹ ,

X ² is selected from the group consisting of O, S, NR ⁴⁹ , and C(R ⁴⁹ )(R ⁴¹⁰ )

X ³ is selected from the group consisting of O and S;

R ⁴¹ to R ⁴⁵ are each independently selected from the group consisting of H, Fl, CI, Br, I, - R ⁴⁹ R ⁴¹⁰ , -OH, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci-C ₆ alkenyl, Ci-C ₆ alkynyl, substituted Ci-C ₆ alkynyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, -(Ci-C6)alkyl-substituted phenyl,

-(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and -(Ci-C6)alkyl-substituted heteroaryl;

R ⁴⁶ is selected from the group consisting of OH, -N ₃ , F, CI, and H;

each occurrence of R ⁴⁷ and R ⁴⁸ is independently selected from the group consisting of H, - R ⁴⁹ R ⁴¹⁰ , -OR ⁴⁹ , -O ^" , Ci-Ce alkyl, substituted Ci-Ce alkyl, aiyl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-C6)alkyl-phenyl, substituted -(Ci- C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl;

each occurrence of R ⁴⁹ and R ⁴¹⁰ is independently is selected from the group consisting of H, Ci-Ce alkyl, substituted Ci-C ₆ alkyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci-Ce)alkyl- phenyl,

-(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl; and

n is an integer from 0-3. In one embodiment, R ¹⁸ , R ²⁸ , R ³⁸ , and R ⁴⁸ are each independently selected from the group consisting of H, and phenyl.

In one embodiment, R ¹⁷ , R ²⁷ , R ³⁷ , and R ⁴⁷ are each independently selected from the group consisting of substituted Ci-C ₆ alkyl, and propan-2-yl 2-aminopropanoate.

In one embodiment the compound is selected from the group consisting

, wherein R represents a phosphate prodrug

embodiment, the compound of Formula (I) is a compound of

Formula (la):

wherein in Formula (la):

R ¹¹ to R ¹⁵ are each independently selected from the group consisting of H, Fl, CI, Br, I, - R ¹⁹ R ¹¹⁰ , -OH, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci-C ₆ alkenyl, Ci-C ₆ alkynyl, substituted Ci-C ₆ alkynyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, -(Ci-C6)alkyl-substituted phenyl,

-(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and -(Ci-C6)alkyl-substituted heteroaryl;

R ¹⁶ is selected from the group consisting of OH, -N ₃ , F, CI, and H;

each occurrence of R ¹⁷ and R ¹⁸ is independently selected from the group consisting of H, - R ¹⁹ R ¹¹⁰ , -OR ¹⁹ , -O ^" , Ci-Ce alkyl, substituted Ci-Ce alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci- C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-C ₆ )alkyl- heteroaryl; X is selected from the group consisting of O, and NR ;

each occurrence of R ¹⁹ and R ¹¹⁰ is independently is selected from the group consisting of H, Ci-Ce alkyl, substituted C1-G5 alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci-Ce)alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl; and

n is an integer from 0-3.

In one embodiment, the compound of Formula (IV) is a compound of

Formula (IVa):

wherein in Formula (IVa):

R ⁴¹ to R ⁴⁵ are each independently selected from the group consisting of H, Fl, CI, Br, I, - R ⁴⁹ R ⁴¹⁰ , -OH, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci- C ₆ alkenyl, Ci-C ₆ alkynyl, substituted Ci-C ₆ alkynyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, -(Ci-C6)alkyl-substituted phenyl, -(Ci-C ₆ )alkyl- carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and -(Ci-C6)alkyl-substituted heteroaryl;

R ⁴⁶ is selected from the group consisting of OH, -N ₃ , F, CI, and H;

each occurrence of R ⁴⁷ and R ⁴⁸ is independently selected from the group consisting of H, - R ⁴⁹ R ⁴¹⁰ , -OR ⁴⁹ , -O ^" , Ci-Ce alkyl, substituted Ci-Ce alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci- C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl;

X is selected from the group consisting of O, and NR ⁴⁹ ; each occurrence of R ⁴⁹ and R ⁴¹⁰ is independently is selected from the group consisting of H, C1-G5 alkyl, substituted C1-G5 alkyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci-Ce)alkyl- phenyl, -(Ci-Ce)alkyl- carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl; and n is an integer from 0-3.

In one aspect, the invention provides a composition comprising a compound of one of Formula (I) to (IV). In one embodiment, the composition further comprises a pharmaceutically acceptable carrier.

In another aspect, the invention provides a method of inhibiting Ροΐθ in a subject in need thereof. In one embodiment, the method comprises administering to the subject a therapeutically effective amount of a composition comprising at least one compound represented by one of Formulae (I) to (IV).

In another aspect, the invention provides a method of treating cancer in a subject. In one embodiment, the method comprises administering effective amount of a composition comprising a compound represented by one of Formulae (I) to (IV).

In one embodiment, the method further comprises administering to the subject at least one additional therapeutic agent. In one embodiment, the therapeutic agent is selected from the group consisting of a chemotherapy, chemotherapeutic agent, radiation therapy, hormonal therapy, and any combination thereof. In one embodiment, the therapeutic agent is selected from the group consisting of Olaparib and cisplatin.

In one embodiment, the cancer is resistant to at least one chemotherapy. In one embodiment, the cancer is breast cancer. BRIEF DESCRIPTION OF THE DRAWINGS

The following detailed description of preferred embodiments of the invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings. Figure 1, comprising Figure 1 A through Figure IE, depicts results from experiments demonstrating that purified Ροΐθ effectively incorporates dxNMPs. Figure 1 A depicts the structures of dxNTPs. Figure IB depicts a denaturing gel showing Ροΐθ primer extension in the presence of dCTP and dxCTP. Figure 1C depicts a denaturing gel showing Ροΐθ primer extension in the presence of dGTP and dxGTP. Figure ID depicts a denaturing gel showing Ροΐθ primer extension in the presence of dATP and dxATP. Figure IE depicts a denaturing gel showing Ροΐθ primer extension in the presence of dTTP and dxTTP.

Figure 2, comprising Figure 2A through Figure 2H, depicts results from experiments demonstrating Y-family polymerases exhibit a limited ability to incorporate dxNMPs. Figure 2A depicts a denaturing gel showing Ροΐκ primer extension in the presence of dCTP and dxCTP. Figure 2B depicts a denaturing gel showing Ροΐκ primer extension in the presence of dGTP and dxGTP. Figure 2C depicts a denaturing gel showing Ροΐκ primer extension in the presence of dATP and dxATP. Figure 2D depicts a denaturing gel showing Ροΐκ primer extension in the presence of dTTP and dxTTP.

Figure 2E depicts a denaturing gel showing Ροΐη primer extension in the presence of dCTP and dxCTP. Figure 2F depicts a denaturing gel showing Ροΐη primer extension in the presence of dGTP and dxGTP. Figure 2G depicts a denaturing gel showing Ροΐη primer extension in the presence of dATP and dxATP. Figure 2H depicts a denaturing gel showing Ροΐη primer extension in the presence of dTTP and dxTTP.

Figure 3, comprising Figure 3 A through Figure 3F, depicts results from experiments demonstrating X-family polymerase β fails to incorporate dxNMPs. Figure 3 A depicts a denaturing gel showing primer extension by Pol β in the presence of dCTP and dxCTP. Figure 3B depicts a denaturing gel showing primer extension by Pol β in the presence of dGTP and dxGTP. Figure 3C depicts a denaturing gel showing primer extension by Pol β in the presence of dATP and dxATP. Figure 3D depicts a denaturing gel showing primer extension by Pol β in the presence of dTTP and dxTTP. Figure 3E depicts a denaturing gel showing primer extension on a template containing a small gap by Pol β in the presence of dCTP and dxCTP. Figure 3F depicts a denaturing gel showing primer extension on a template containing a small gap by Pol β in the presence of dGTP and dxGTP. Figure 4, comprising Figure 4A through Figure 4E, depicts results from experiments demonstrating B-family and A-family replicative polymerases fail to stably incorporate dxNMPs. Figure 4A depicts a denaturing gel showing primer extension in the presence of Ροΐδ or Ροΐε, dT, dA, dC, and dxG, with or without dGTP rescue. Figure 4B depicts a denaturing gel showing primer extension in the presence of Ροΐδ or Ροΐε, dT, dA, dG, and dxC, with or without dCTP rescue. Figure 4C depicts a model of Ροΐδ and Ροΐε activities. Ροΐδ and Ροΐε exonuclease activities are stimulated by the presence of a complementary dxNTP (dxGTP). However, the subsequent addition of the respective canonical dNTP (dGTP) rescues their ability to perform replication. Figure 4D depicts a denaturing gel showing primer extension by Pola in the presence of dCTP and dxCTP (left panel), and dGTP and dxGTP (right panel). Figure 4E depicts a denaturing gel showing primer extension by Ροΐγ in the presence of dCTP and dxCTP (left panel), and dGTP and dxGTP (right panel).

Figure 5, comprising Figure 5A through Figure 5F, depicts results from experiments demonstrating Ροΐθ is inhibited after multiple dx MP incorporation events. Figure 5 A depicts a denaturing gel showing Ροΐθ primer-template extension in the presence of the indicated nucleotides and primer-template sequence. Figure 5B depicts a denaturing gel showing Ροΐθ primer-template extension in the presence of a mixture of dNTPs or dxNTPs and the indicated primer-template sequence. Figure 5C depicts a denaturing gel showing Ροΐθ primer-template extension in the presence of a mixture of dNTPs or dxNTPs and the indicated primer-template sequence. Figure 5D depicts a denaturing gel showing Ροΐθ primer-template extension in the presence of a mixture of dNTPs and dxNTPs and the indicated primer-template sequence. Figure 5E depicts a model of Ροΐθ activity. Ροΐθ becomes arrested after incorporating two consecutive dxGMPs probably due to steric hindrance within its active site. Figure 5F depicts a denaturing gel showing Ροΐθ primer-template extension in the presence of the indicated concentrations of dNTPs and dxGTP. Ροΐθ becomes arrested in the presence of increasing concentrations of dxGTP.

Figure 6, comprising Figure 6A through Figure 6E, depicts results from experiments demonstrating Ροΐθ exhibits a relatively high efficiency of dxGMP incorporation. Figure 6A depicts denaturing gels showing a time course of Ροΐθ primer extension in the presence of the indicated expanded-size dxNTP. Figure 6B depicts a plot showing relative velocities of Ροΐθ incorporation of dx MPs. Figure 6C depicts plots showing relative velocity of Ροΐθ incorporation of the indicated nucleotide. Figure 6D depicts Hanes-Woolf plots of Ροΐθ steady-state incorporation of the indicated nucleotide. Each data point represents an average from three separate experiments. Relative Km, Vmax and Vmax / Km are indicated. Figure 6E depicts a denaturing gel showing Ροΐθ primer extension in the presence of the indicated nucleotides and a schematic illustrating the ability of dxGTP to compete with dGTP during Ροΐθ primer extension.

Figure 7 depicts results from experiments demonstrating X-family polymerases fail to efficiently incorporate dxNMPs. Shown are denaturing gels showing primer extension by the indicated polymerase in the presence of the indicated nucleotide and primer-template sequence.

Figure 8 depicts the chemical structures of xA nucleotide, nucleoside and prodrug nucleotide analogs.

Figure 9 depicts the chemical structures of xG nucleotide nucleoside and prodrug nucleotide analogs.

Figure 10 depicts the chemical structures of xC and xT nucleotide nucleoside and prodrug nucleotide analogs.

DETAILED DESCRIPTION

The present invention relates to the unexpected discovery that size- expanded DNA (xDNA) deoxyribonucleoside monophosphate analogs (dxNMPs) are selectively and efficiently incorporated by Ροΐθ, and inhibit the DNA synthesis activity of Ροΐθ. Thus, the present invention is directed to methods and compositions for inhibiting Ροΐθ in vitro and in vivo. Ροΐθ is essential for the survival of cancer cells, accordingly, the present invention also provides methods and compositions for treating cancer with dxNMP based nucleoside and nucleotide analogs.

Definitions

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice of and/or for the testing of the present invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used according to how it is defined, where a definition is provided.

It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice of and/or for the testing of the present invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used according to how it is defined, where a definition is provided.

It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

"About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or in some instances ±10%, or in some instances ±5%, or in some instances ±1%, or in some instances ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.

A "disease" is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.

In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health. The term "anti-tumor effect" as used herein, refers to a biological effect which can be manifested by a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in the number of metastases, an increase in life expectancy, or amelioration of various physiological symptoms associated with the cancerous condition. An "anti-tumor effect" can also be manifested by the ability of the peptides, polynucleotides, cells and antibodies of the invention in prevention of the occurrence of tumor in the first place.

As used herein, the term "cancer" refers to any of various types of malignant neoplasms, most of which invade surrounding tissues, may metastasize to several sites and are likely to recur after attempted removal and to cause death of the patient unless adequately treated. As used herein, neoplasia comprises cancer.

Representative cancers include, for example, squamous-cell carcinoma, basal cell carcinoma, adenocarcinoma, hepatocellular carcinomas, and renal cell carcinomas, cancer of the bladder, bowel, breast, cervix, colon, esophagus, head, kidney, liver, lung, neck, ovary, pancreas, prostate, and stomach; leukemias, including non-acute and acute leukemias, such as acute myelogenous leukemia, acute lymphocytic leukemia, acute promyelocytic leukemia (APL), acute T-cell lymphoblastic leukemia, T-lineage acute lymphoblastic leukemia (T-ALL), adult T-cell leukemia, basophilic leukemia, eosinophilic leukemia, granulocytic leukemia, hairy cell leukemia, leukopenic leukemia, lymphatic leukemia, lymphoblastic leukemia, lymphocytic leukemia, megakaryocyte leukemia, micromyeloblastic leukemia, monocytic leukemia, neutrophilic leukemia and stem cell leukemia; benign and malignant lymphomas, particularly Burkitt's lymphoma and Non-Hodgkin's lymphoma; benign and malignant melanomas; myeloproliferative diseases; sarcomas, including Ewing's sarcoma, hemangiosarcoma, Kaposi's sarcoma, liposarcoma, myosarcomas, peripheral neuroepithelioma, synovial sarcoma, gliomas, astrocytomas, oligodendrogliomas, ependymomas, gliobastomas, neuroblastomas, ganglioneuromas, gangliogliomas, medulloblastomas, pineal cell tumors, meningiomas, meningeal sarcomas, neurofibromas, and Schwannomas; bowel cancer, breast cancer, prostate cancer, cervical cancer, uterine cancer, lung cancer, ovarian cancer, testicular cancer, thyroid cancer, astrocytoma, esophageal cancer, pancreatic cancer, stomach cancer, liver cancer, colon cancer, melanoma; carcinosarcoma, Hodgkin's disease, Wilms' tumor and teratocarcinomas, among others, which may be treated by one or more compounds of the present invention. A more complete list of cancers that may be treated using compounds of the present invention may be found at the website cancer dot gov/cancertopics/alphalist, relevant portions of which are incorporated by reference herein.

"Effective amount" or "therapeutically effective amount" are used interchangeably herein, and refer to an amount of a compound, formulation, material, or composition, as described herein effective to achieve a particular biological result. Such results may include, but are not limited to, the inhibition of virus infection as determined by any means suitable in the art.

The term "inhibit," as used herein, means to suppress or block an activity or function by at least about ten percent relative to a control value. Preferably, the activity is suppressed or blocked by 50% compared to a control value, more preferably by 75%, and even more preferably by 95% or more.

In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).

In one aspect, the terms "co-administered" and "co-administration" as relating to a subject refer to administering to the subject a compound useful within the invention, or salt thereof, along with a compound that may also treat any of the diseases contemplated within the invention. In one embodiment, the co-administered compounds are administered separately, or in any kind of combination as part of a single therapeutic approach. The co-administered compound may be formulated in any kind of

combinations as mixtures of solids and liquids under a variety of solid, gel, and liquid formulations, and as a solution.

As used herein, the term "pharmaceutically acceptable" refers to a material, such as a carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively non-toxic, i.e., the material may be administered to an individual without causing an undesirable biological effect or interacting in a deleterious manner with any of the components of the composition in which it is contained.

As used herein, the language "pharmaceutically acceptable salt" refers to a salt of the administered compound prepared from pharmaceutically acceptable non-toxic acids, including inorganic acids, organic acids, solvates, hydrates, or clathrates thereof. Examples of such inorganic acids are hydrochloric, hydrobromic, hydroiodic, nitric, sulfuric, phosphoric, acetic, hexafluorophosphoric, citric, gluconic, benzoic, propionic, butyric, sulfosalicylic, maleic, lauric, malic, fumaric, succinic, tartaric, amsonic, pamoic, p-tolunenesulfonic, and mesylic. Appropriate organic acids may be selected, for example, from aliphatic, aromatic, carboxylic and sulfonic classes of organic acids, examples of which are formic, acetic, propionic, succinic, camphorsulfonic, citric, fumaric, gluconic, isethionic, lactic, malic, mucic, tartaric, para-toluenesulfonic, glycolic, glucuronic, maleic, furoic, glutamic, benzoic, anthranilic, salicylic, phenylacetic, mandelic, embonic (pamoic), methanesulfonic, ethanesulfonic, pantothenic, benzenesulfonic (besylate), stearic, sulfanilic, alginic, galacturonic, and the like. Furthermore, pharmaceutically acceptable salts include, by way of non-limiting example, alkaline earth metal salts (e.g., calcium or magnesium), alkali metal salts (e.g., sodium-dependent or potassium), and ammonium salts.

As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it may perform its intended function. Typically, such constructs are carried or transported from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation, including the compound useful within the invention, and not injurious to the patient. Some examples of materials that may serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; surface active agents; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffer solutions; and other non-toxic compatible substances employed in pharmaceutical formulations. As used herein, "pharmaceutically acceptable carrier" also includes any and all coatings, antibacterial and antifungal agents, and absorption delaying agents, and the like that are compatible with the activity of the compound useful within the invention, and are physiologically acceptable to the patient. Supplementary active compounds may also be incorporated into the compositions. The "pharmaceutically acceptable carrier" may further include a pharmaceutically acceptable salt of the compound useful within the invention. Other additional ingredients that may be included in the pharmaceutical compositions used in the practice of the invention are known in the art and described, for example in

Remington's Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference.

An "effective amount" of a delivery vehicle is that amount sufficient to effectively bind or deliver a compound.

As used herein, the term "alkyl," by itself or as part of another substituent means, unless otherwise stated, a straight or branched chain hydrocarbon having the number of carbon atoms designated (i.e. Ci-6 means one to six carbon atoms) and including straight, branched chain, or cyclic substituent groups. Examples include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, neopentyl, hexyl, and cyclopropylmethyl.

As used herein, the term "substituted alkyl" means alkyl as defined above, substituted by one, two or three substituents selected from the group consisting of halogen, -OH, alkoxy, - H2, amino, azido, -N(CH ₃ ) ₂ , -C(=0)OH, trifluoromethyl, -C≡N, -C(=0)0(Ci-C ₄ )alkyl, -C(=0) H ₂ , -SO2 H2, -C(= H) H ₂ , and -NO2. Examples of substituted alkyls include, but are not limited to, 2,2-difluoropropyl,

2-carboxycyclopentyl and 3-chloropropyl.

As used herein, the term "heteroalkyl" by itself or in combination with another term means, unless otherwise stated, a stable straight or branched chain alkyl group consisting of the stated number of carbon atoms and one or two heteroatoms selected from the group consisting of O, N, and S, and wherein the nitrogen and sulfur atoms may be optionally oxidized and the nitrogen heteroatom may be optionally quaternized. The heteroatom(s) may be placed at any position of the heteroalkyl group, including between the rest of the heteroalkyl group and the fragment to which it is attached, as well as attached to the most distal carbon atom in the heteroalkyl group. Examples include: -O-CH2-CH2-CH3, -CH2-CH2-CH2-OH, -CH2-CH2- H-CH3,

-CH2-S-CH2-CH3, and -CH2CH2-S(=0)-CH3. Up to two heteroatoms may be consecutive, such as, for example, -CH2- H-OCH3, or -CH2-CH2-S-S-CH3

As used herein, the term "alkoxy" employed alone or in combination with other terms means, unless otherwise stated, an alkyl group having the designated number of carbon atoms, as defined above, connected to the rest of the molecule via an oxygen atom, such as, for example, methoxy, ethoxy, 1-propoxy, 2-propoxy (isopropoxy) and the higher homologs and isomers.

As used herein, the term "halo" or "halogen" alone or as part of another substituent means, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom.

As used herein, the term "cycloalkyl" refers to a mono cyclic or polycyclic non-aromatic radical, wherein each of the atoms forming the ring (i.e. skeletal atoms) is a carbon atom. In one embodiment, the cycloalkyl group is saturated or partially

unsaturated. In another embodiment, the cycloalkyl group is fused with an aromatic ring. Cycloalkyl groups include groups having from 3 to 10 ring atoms. Illustrative examples of cycloalkyl groups include, but are not limited to, the following

Monocyclic cycloalkyls include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Dicyclic cycloalkyls include, but are not limited to, tetrahydronaphthyl, indanyl, and tetrahydropentalene. Polycyclic cycloalkyls include adamantine and norbornane. The term cycloalkyl includes "unsaturated nonaromatic carbocyclyl" or "nonaromatic unsaturated carbocyclyl" groups, both of which refer to a nonaromatic carbocycle as defined herein, which contains at least one carbon double bond or one carbon triple bond.

As used herein, the term "heterocycloalkyl" or "heterocyclyl" refers to a heteroalicyclic group containing one to four ring heteroatoms each selected from O, S and N. In one embodiment, each heterocycloalkyl group has from 4 to 10 atoms in its ring system, with the proviso that the ring of said group does not contain two adjacent O or S atoms. In another embodiment, the heterocycloalkyl group is fused with an aromatic ring. In one embodiment, the nitrogen and sulfur heteroatoms may be optionally oxidized, and the nitrogen atom may be optionally quaternized. The heterocyclic system may be attached, unless otherwise stated, at any heteroatom or carbon atom that affords a stable structure. A heterocycle may be aromatic or non-aromatic in nature. In one embodiment, the heterocycle is a heteroaryl.

An example of a 3-membered heterocycloalkyl group includes, and is not limited to, aziridine. Examples of 4-membered heterocycloalkyl groups include, and are not limited to, azetidine and a beta lactam. Examples of 5-membered heterocycloalkyl groups include, and are not limited to, pyrrolidine, oxazolidine and thiazolidinedione. Examples of 6-membered heterocycloalkyl groups include, and are not limited to, piped dine, morpholine and piperazine. Other non-limiting examples of heterocycloalkyl

Examples of non-aromatic heterocycles include monocyclic groups such as aziridine, oxirane, thiirane, azetidine, oxetane, thietane, pyrrolidine, pyrroline, pyrazolidine, imidazoline, dioxolane, sulfolane, 2,3-dihydrofuran, 2,5-dihydrofuran, tetrahydrofuran, thiophane, piperidine, 1,2,3, 6-tetrahydropyridine, 1,4-dihydropyridine, piperazine, morpholine, thiomorpholine, pyran, 2,3-dihydropyran, tetrahydropyran, 1,4-dioxane, 1,3-dioxane, homopiperazine, horn opiperi dine, 1,3-dioxepane,

4,7-dihydro-l,3-dioxepin, and hexamethyleneoxide.

As used herein, the term "aromatic" refers to a carbocycle or heterocycle with one or more polyunsaturated rings and having aromatic character, i.e. having (4n + 2) delocalized π (pi) electrons, where n is an integer.

As used herein, the term "aryl," employed alone or in combination with other terms, means, unless otherwise stated, a carbocyclic aromatic system containing one or more rings (typically one, two or three rings), wherein such rings may be attached together in a pendent manner, such as a biphenyl, or may be fused, such as naphthalene. Examples of aryl groups include phenyl, anthracyl, and naphthyl.

As used herein, the term "aryl-(Ci-C3)alkyl" means a functional group wherein a one- to three-carbon alkylene chain is attached to an aryl group, e.g., -CH ₂ CH2-phenyl. Preferred is aryl-CH ₂ - and aryl-CH(CH ₃ )-. The term "substituted aryl-(Ci-C ₃ )alkyl" means an aryl-(Ci-C ₃ )alkyl functional group in which the aryl group is substituted. Similarly, the term "heteroaryl-(Ci-C ₃ )alkyl" means a functional group wherein a one to three carbon alkylene chain is attached to a heteroaryl group, e.g., -CH ₂ CH ₂ -pyridyl. The term "substituted heteroaryl-(Ci-C ₃ )alkyl" means a

heteroaryl-(Ci-C ₃ )alkyl functional group in which the heteroaryl group is substituted.

As used herein, the term "heteroaryl" or "heteroaromatic" refers to a heterocycle having aromatic character. A polycyclic heteroaryl may include one or more rings that are partially saturated. Examples include the following moieties:

H H H

O U D % J )

Examples of heteroaryl groups also include pyridyl, pyrazinyl, pyrimidinyl (particularly 2- and 4-pyrimidinyl), pyridazinyl, thienyl, furyl, pyrrolyl (particularly 2-pyrrolyl), imidazolyl, thiazolyl, oxazolyl, pyrazolyl (particularly 3- and 5-pyrazolyl), isothiazolyl, 1,2,3-triazolyl, 1,2,4-triazolyl, 1,3,4-triazolyl, tetrazolyl, 1,2,3-thiadiazolyl, 1,2,3-oxadiazolyl, 1,3,4-thiadiazolyl and 1,3,4-oxadiazolyl.

Examples of polycyclic heterocycles and heteroaryls include indolyl (particularly 3-, 4-, 5-, 6- and 7-indolyl), indolinyl, quinolyl, tetrahydroquinolyl, isoquinolyl (particularly 1- and 5-isoquinolyl), 1,2,3,4-tetrahydroisoquinolyl, cinnolinyl, quinoxalinyl (particularly 2- and 5-quinoxalinyl), quinazolinyl, phthalazinyl,

1,8-naphthyridinyl, 1,4-benzodioxanyl, coumarin, dihydrocoumarin, 1,5-naphthyridinyl, benzofuryl (particularly 3-, 4-, 5-, 6- and 7-benzofuryl), 2,3-dihydrobenzofuryl,

1,2-benzisoxazolyl, benzothienyl (particularly 3-, 4-, 5-, 6-, and 7-benzothienyl), benzoxazolyl, benzothiazolyl (particularly 2-benzothiazolyl and 5-benzothiazolyl), purinyl, benzimidazolyl (particularly 2-benzimidazolyl), benzotriazolyl, thioxanthinyl, carbazolyl, carbolinyl, acridinyl, pyrrolizidinyl, and quinolizidinyl. As used herein, the term "substituted" means that an atom or group of atoms has replaced hydrogen as the substituent attached to another group. The term "substituted" further refers to any level of substitution, namely mono-, di-, tri-, tetra-, or penta-substitution, where such substitution is permitted. The substituents are

independently selected, and substitution may be at any chemically accessible position. In one embodiment, the substituents vary in number between one and four. In another embodiment, the substituents vary in number between one and three. In yet another embodiment, the substituents vary in number between one and two.

As used herein, the term "optionally substituted" means that the referenced group may be substituted or unsubstituted. In one embodiment, the referenced group is optionally substituted with zero substituents, i.e., the referenced group is unsubstituted. In another embodiment, the referenced group is optionally substituted with one or more additional group(s) individually and independently selected from groups described herein.

In one embodiment, the substituents are independently selected from the group consisting of oxo, halogen, -CN, - H2, -OH, - H(CH3), -N(CH3)2, alkyl

(including straight chain, branched and/or unsaturated alkyl), substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, fluoro alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted alkoxy, fluoroalkoxy, -S-alkyl, S(=0)2alkyl, -C(=0) H[substituted or unsubstituted alkyl, or substituted or unsubstituted phenyl], -C(=0)N[H or alkyl] ₂ , -OC(=0)N[substituted or unsubstituted alkyl] ₂ ,

- HC(=0) H[substituted or unsubstituted alkyl, or substituted or unsubstituted phenyl], - HC(=0)alkyl, -N[substituted or unsubstituted alkyl]C(=0)[substituted or unsubstituted alkyl], - HC(=0) [substituted or unsubstituted alkyl], -C(OH) [substituted or

unsubstituted alkyl]2, and -C( H2)[substituted or unsubstituted alkyl]2. In another embodiment, by way of example, an optional substituent is selected from oxo, fluorine, chlorine, bromine, iodine, -CN, -NH2, -OH, -NH(CH ₃ ), -N(CH ₃ ) ₂ , -CH ₃ , -CH ₂ CH ₃ , -CH(CH ₃ ) ₂ , -CF ₃ , -CH ₂ CF ₃ , -OCH ₃ , -OCH ₂ CH ₃ , -OCH(CH ₃ ) ₂ , -OCF ₃ , - OCH ₂ CF ₃ , -S(=0) ₂ -CH ₃ , -C(=0)NH ₂ , -C(=0)-NHCH ₃ , -NHC(=0)NHCH ₃ , -C(=0)CH ₃ , -ON(0) ₂ , and -C(=0)OH. In yet one embodiment, the substituents are independently selected from the group consisting of Ci-6 alkyl, -OH, Ci-6 alkoxy, halo, amino, acetamido, oxo and nitro. In yet another embodiment, the substituents are independently selected from the group consisting of Ci-6 alkyl, Ci-6 alkoxy, halo, acetamido, and nitro. As used herein, where a substituent is an alkyl or alkoxy group, the carbon chain may be branched, straight or cyclic, with straight being preferred.

As used herein, an "instructional material" includes a publication, a recording, a diagram, or any other medium of expression which can be used to

communicate the usefulness of the compositions and methods of the invention. The instructional material of the kit of the invention may, for example, be affixed to a container which contains the nucleic acid, peptide, and/or composition of the invention or be shipped together with a container which contains the nucleic acid, peptide, and/or composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.

"Parenteral" administration of an immunogenic composition includes, e.g., subcutaneous (s.c), intravenous (i.v.), intramuscular (i.m.), or intrasternal injection, or infusion techniques.

The terms "subject," "patient," "individual," and the like are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. In certain non-limiting embodiments, the patient, subject or individual is a human.

As used herein, the term "treatment" or "treating" is defined as the application or administration of a therapeutic agent, i.e., a compound of the invention (alone or in combination with another pharmaceutical agent), to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient (e.g., for diagnosis or ex vivo applications), who has a disease or disorder contemplated herein, a sign or symptom of a disease or disorder contemplated herein or the potential to develop a disease or disorder contemplated herein, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect a diseaser or disorder contemplated herein, at least one sign or symptom of a disease or disorder contemplated herein or the potential to develop a disease or disorder contemplated herein. Such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics.

Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

Description

The present invention is based on the unexpected discovery that size- expanded DNA (xDNA), also referred to as expanded-size DNA, analogs are efficiently used by Ροΐθ as substrates and inhibit the DNA synthesis activity of Ροΐθ. For example, size-expanded dxNMPs, which contain a benzene ring within the base moiety of each nucleoside inhibit Ροΐθ after two consecutive or closely spaced dxNMP incorporation events. Further, kinetics experiments reveal Ροΐθ efficiency for dxGMP incorporation closely approaches that of native dGMP. Because functionally related Y-family translesion polymerases exhibit a severely reduced ability to incorporate dxNMPs, and X- , A- and B-family polymerases fail to incorporate them, xDNA nucleotides, xDNA nucleotide analogs and xDNA nucleotide and nucleoside prodrugs are selective inhibitors of Ροΐθ. Accordingly, the present invention provides methods and compositions for inhibiting Ροΐθ in vitro and in vivo. In one embodiment, the method comprises administering to a subject an effective amount of a composition comprising an xDNA, an xDNA analog, an xDNA prodrug, or a combination thereof.

Ροΐθ is highly expressed in cancer cells, confers resistance to ionizing radiation and chemotherapy agents, promotes the survival of cancer cells deficient in homologous recombination (HR). High Ροΐθ expression levels also correspond to a poor clinical outcome for cancer patients. Accordingly, another aspect of the invention provides a method of treating cancer in a subject by administering a composition of the invention. In one embodiment, the method comprises administering a composition comprising an xDNA, an xDNA analog, an xDNA prodrug, or a combination thereof. In some embodiments, the cancer is resistant to at least one radiation or chemotherapy agent. In some embodiments, the cancer is breast cancer. In some embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is prostate cancer.

Compounds

In one aspect, the invention provides compounds useful for treating cancer. The compounds of the present invention may be synthesized using techniques well-known in the art of organic synthesis. The starting materials and intermediates required for the synthesis may be obtained from commercial sources or synthesized according to methods known to those skilled in the art.

In one embodiment, the compound of the invention is a compound of Formula (I), or a salt thereof:

wherein in Formula (I):

A is an optionally substituted 4 to 6 membered aromatic or heteroaromatic ring;

each occurrence of X ¹ is independently selected from the group consisting of CR ¹⁹ , and N;

R ¹¹ to R ¹⁵ are each independently selected from the group consisting of H, Fl, CI, Br, I, - R ¹⁹ R ¹¹⁰ , -OH, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci-C ₆ alkenyl, Ci-C ₆ alkynyl, substituted Ci-C ₆ alkynyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, -(Ci-C6)alkyl-substituted phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and -(Ci-C6)alkyl-substituted heteroaryl;

R ¹⁶ is selected from the group consisting of OH, -N ₃ , F, CI, and H;

each occurrence of R ¹⁷ and R ¹⁸ is independently selected from the group consisting of H, - R ¹⁹ R ¹¹⁰ , -OR ¹⁹ , -O ^" , Ci-Ce alkyl, substituted Ci-Ce alkyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci- C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl;

X is selected from the group consisting of O, and R ¹⁹ ;

each occurrence of R ¹⁹ is independently is selected from the group consisting of H, N(R ¹¹⁰ )(R ^{1 U} ), Ci-Ce alkyl, substituted Ci-Ce alkyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci-Ce)alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl;

each occurrence of R ¹¹⁰ and R ¹¹¹ is independently is selected from the group consisting of H, Ci-Ce alkyl, substituted Ci-Ce alkyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci-Ce)alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl; and

n is an integer from 0-3.

In one embodiment, A is benzene.

In one embodiment, two occurrences of X ¹ are N.

In one embodiment, the compound of Formula (I) is represented by

Formula (la)

Fl, CI, Br, I, - R ¹⁹ R ¹¹⁰ , -OH, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci-C ₆ alkenyl, Ci-C ₆ alkynyl, substituted Ci-C ₆ alkynyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, -(Ci-C6)alkyl-substituted phenyl,

-(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and -(Ci-C6)alkyl-substituted heteroaryl;

R ¹⁶ is selected from the group consisting of OH, -N ₃ , F, CI, and H;

each occurrence of R and R is independently selected from the group consisting of H, - R ¹⁹ R ¹¹⁰ , -OR ¹⁹ , -O ^" , Ci-Ce alkyl, substituted Ci-Ce alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci- C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl;

X is selected from the group consisting of O, and R ¹⁹ ;

each occurrence of R ¹⁹ and R ¹¹⁰ is independently is selected from the group consisting of H, Ci-Ce alkyl, substituted C1-G5 alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci-Ce)alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl; and

n is an integer from 0-3.

In one embodiment, R ¹³ is selected from the group consisting of OH and H ₂ . In one embodiment, R ¹⁴ is - R ¹⁹ R ¹¹⁰ . In one embodiment, R ¹⁹ is H. In one embodiment, R ¹¹⁰ is H.

In one embodiment, R ¹⁷ is a substituted Ci-C ₆ alkyl. In one embodiment, R ¹⁷ is propan-2-yl 2-aminopropanoate.

In one embodiment, R ¹⁸ is H. In one embodiment, R ¹⁸ is phenyl.

In one embodiment, the compound of Formula (I) is selected from the

In one embodiment, the compound of the invention is a compound of Formula (II), or a salt thereof:

wherein in Formula (II): R ²¹ to R ²⁵ are each independently selected from the group consisting of H, Fl, CI, Br, I, - R ²⁹ R ²¹⁰ , -OH, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci-C ₆ alkenyl, Ci-C ₆ alkynyl, substituted Ci-C ₆ alkynyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, -(Ci-C6)alkyl-substituted phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and -(Ci-C6)alkyl-substituted heteroaryl;

R ²⁶ is selected from the group consisting of OH, -N ₃ , F, CI, and H;

each occurrence of R ²⁷ and R ²⁸ is independently selected from the group consisting of H, - R ²⁹ R ²¹⁰ , -OR ²⁹ , -O ^" , Ci-Ce alkyl, substituted Ci-Ce alkyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci- C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl;

X ¹ is selected from the group consisting of O, and R ²⁹ ;

X ² is selected from the group consisting of O, and S;

each occurrence of R ²⁹ and R ²¹⁰ is independently is selected from the group consisting of H, Ci-Ce alkyl, substituted C1-G5 alkyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci-Ce)alkyl- phenyl,

-(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl; and

n is an integer from 0-3.

In one embodiment, X ² is O.

In R ²⁴ is - R ²⁹ R ²¹⁰ one embodiment, R ²⁹ is H. In one embodiment, R ²¹⁰ is

H.

In one embodiment, R ²⁷ is a substituted Ci-C ₆ alkyl. In one embodiment, R ²⁷ is propan-2-yl 2-aminopropanoate.

In one embodiment, R ²⁸ is H. In one embodiment, R ²⁸ is phenyl. In one embodiment, the compound of formula (II) is

In one embodiment, the compound of the invention is a compound of Formula (III), or a salt thereof:

R ³¹ to R ³⁵ are each independently selected from the group consisting of H, Fl, CI, Br, I, - R ³⁹ R ³¹⁰ , -OH, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci-C ₆ alkenyl, Ci-C ₆ alkynyl, substituted Ci-C ₆ alkynyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, -(Ci-C6)alkyl-substituted phenyl,

-(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and -(Ci-C6)alkyl-substituted heteroaryl;

R ³⁶ is selected from the group consisting of OH, -N ₃ , F, CI, and H;

each occurrence of R ³⁷ and R ³⁸ is independently selected from the group consisting of H, - R ³⁹ R ³¹⁰ , -OR ³⁹ , -O ^" , Ci-Ce alkyl, substituted Ci-Ce alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci- C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-C ₆ )alkyl- heteroaryl;

X ¹ is selected from the group consisting of O, and NR ³⁹ ;

X ³ is selected from the group consisting of O and S;

each occurrence of R ³⁹ and R ³¹⁰ is independently is selected from the group consisting of H, Ci-Ce alkyl, substituted Ci-Ce alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-C6)alkyl-phenyl, substituted -(Ci-Ce)alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl; and

n is an integer from 0-3.

In one embodiment, R ³⁴ is H.

In one embodiment, R ³⁵ is H.

In one embodiment R ³⁷ is a substituted Ci-C ₆ alkyl. In one embodiment R ²⁷ is propan-2-yl 2-aminopropanoate.

In one embodiment R ³⁸ is H. In one embodiment R ³⁸ is phenyl.

In one embodiment, the compound of formula (III) is

In one embodiment, the compound of the invention is a compound of Formula (IV), or a salt thereof:

wherein in Formula (IV):

B is an optionally substituted 4 to 6 membered aromatic or heteroaromatic ring;

X is selected from the group consisting of O, and R ⁴⁹ ;

X ^I is selected from the group consisting of N and CR ⁴⁹ ,

X ² is selected from the group consisting of O, S, NR ⁴⁹ , and C(R ⁴⁹ )(R ⁴¹⁰ )

X ³ is selected from the group consisting of O and S;

R ⁴¹ to R ⁴⁵ are each independently selected from the group consisting of H, Fl, CI,

Br, I, - R ⁴⁹ R ⁴¹⁰ , -OH, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci- C ₆ alkenyl, Ci-Ce alkynyl, substituted C1-G5 alkynyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, -(Ci-C6)alkyl-substituted phenyl, -(Ci-Ce)alkyl- carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and -(Ci-C6)alkyl-substituted heteroaryl;

is selected from the group consisting of OH, -N ₃ , F, CI, and H;

each occurrence of R ⁴⁷ and R ⁴⁸ is independently selected from the group consisting of H, - R ⁴⁹ R ⁴¹⁰ , -OR ⁴⁹ , -O ^" , Ci-Ce alkyl, substituted Ci-Ce alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci- C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl;

each occurrence of R ⁴⁹ and R ⁴¹⁰ is independently is selected from the group consisting of H, C1-G5 alkyl, substituted C1-G5 alkyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci-Ce)alkyl- phenyl, -(Ci-Ce)alkyl- carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl; and

n is an integer from 0-3.

In one embodiment, B is selected from the group consisting of benzene, pyridine, cyclobutadiene, furan, and thiophene, wherein B is optionally substituted.

In one embodiment, the compound of Formula (IV) is a compound of

Formula (IVa), or a salt thereof:

wherein in Formula (IVa):

R ⁴¹ to R ⁴⁵ are each independently selected from the group consisting of H, Fl, CI, Br, I, - R ⁴⁹ R ⁴¹⁰ , -OH, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkenyl, substituted Ci- C ₆ alkenyl, Ci-Ce alkynyl, substituted Ci-C ₆ alkynyl, aiyl, substituted aiyl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-C6)alkyl-phenyl, -(Ci-C6)alkyl-substituted phenyl, -(Ci-Ce)alkyl- carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and -(Ci-C6)alkyl-substituted heteroaryl;

R ⁴⁶ is selected from the group consisting of OH, -N ₃ , F, CI, and H;

each occurrence of R ⁴⁷ and R ⁴⁸ is independently selected from the group consisting of H, - R ⁴⁹ R ⁴¹⁰ , -OR ⁴⁹ , -O ^" , Ci-Ce alkyl, substituted Ci-Ce alkyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci- C ₆ )alkyl- phenyl, -(Ci-C6)alkyl-carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl;

X is selected from the group consisting of O, and R ⁴⁹ ;

each occurrence of R ⁴⁹ and R ⁴¹⁰ is independently is selected from the group consisting of H, Ci-Ce alkyl, substituted Ci-Ce alkyl, aryl, substituted aryl, carbocyclyl, phenyl, substituted phenyl, heteroaryl, substituted heteroaryl, heterocyclyl, substituted heterocyclyl, -(Ci-Ce)alkyl-phenyl, substituted -(Ci-Ce)alkyl- phenyl, -(Ci-Ce)alkyl- carbocyclyl, -(Ci-C6)alkyl-heteroaryl, and substituted -(Ci-Ce)alkyl- heteroaryl; and n is an integer from 0-3.

In one embodiment, R ⁴⁴ is H.

In one embodiment, each occurrence of R ⁴⁵ is H.

In one embodiment, R ⁴⁷ is a substituted Ci-C ₆ alkyl. In one embodiment, R is propan-2-yl 2-aminopropanoate.

In one embodiment, R ⁴⁸ is H. In one embodiment, R ⁴⁸ is phenyl.

In one embodiment, the compound of Formula (IV) is selected from the

group consisting of,

Preparation of the Compounds of the Invention

Compounds of Formulae (I) to (IV) may be prepared by the general schemes described herein, using the synthetic method known by those skilled in the art. The following examples illustrate non-limiting embodiments of the invention.

The compounds of the invention may possess one or more stereocenters, and each stereocenter may exist independently in either the R or S configuration. In one embodiment, compounds described herein are present in optically active or racemic forms. It is to be understood that the compounds described herein encompass racemic, optically-active, regioisomeric and stereoisomeric forms, or combinations thereof that possess the therapeutically useful properties described herein. In one embodiment, the sugar moiety of the compound of the invention comprises the stereochemistry of

Preparation of optically active forms is achieved in any suitable manner, including by way of non-limiting example, by resolution of the racemic form with recrystallization techniques, synthesis from optically-active starting materials, chiral synthesis, or chromatographic separation using a chiral stationary phase. In one embodiment, a mixture of one or more isomer is utilized as the therapeutic compound described herein. In another embodiment, compounds described herein contain one or more chiral centers. These compounds are prepared by any means, including

stereoselective synthesis, enantioselective synthesis and/or separation of a mixture of enantiomers and/ or diastereomers. Resolution of compounds and isomers thereof is achieved by any means including, by way of non-limiting example, chemical processes, enzymatic processes, fractional crystallization, distillation, and chromatography.

The methods and formulations described herein include the use of N oxides (if appropriate), crystalline forms (also known as polymorphs), solvates, amorphous phases, and/or pharmaceutically acceptable salts of compounds having the structure of any compound of the invention, as well as metabolites and active metabolites of these compounds having the same type of activity. Solvates include water, ether (e.g., tetrahydrofuran, methyl tert-butyl ether) or alcohol (e.g., ethanol) solvates, acetates and the like. In one embodiment, the compounds described herein exist in solvated forms with pharmaceutically acceptable solvents such as water, and ethanol. In another embodiment, the compounds described herein exist in unsolvated form.

In one embodiment, the compounds of the invention may exist as tautomers. All tautomers are included within the scope of the compounds presented herein.

In one embodiment, compounds described herein are prepared as prodrugs. A "prodrug" refers to an agent that is converted into the parent drug in vivo. In one embodiment, upon in vivo administration, a prodrug is chemically converted to the biologically, pharmaceutically or therapeutically active form of the compound. In another embodiment, a prodrug is enzymatically metabolized by one or more steps or processes to the biologically, pharmaceutically or therapeutically active form of the compound.

In one embodiment, sites on, for example, the aromatic ring portion of compounds of the invention are susceptible to various metabolic reactions. Incorporation of appropriate substituents on the aromatic ring structures may reduce, minimize or eliminate this metabolic pathway. In one embodiment, the appropriate substituent to decrease or eliminate the susceptibility of the aromatic ring to metabolic reactions is, by way of example only, a deuterium, a halogen, or an alkyl group.

Compounds described herein also include isotopically-labeled compounds wherein one or more atoms is replaced by an atom having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes suitable for inclusion in the compounds described herein include and are not limited to 2H, 3H, 11C, 13C, 14C, 36C1, 18F, 1231, 1251, 13N, 15N, 150, 170, 180, 32P, and 35S. In one embodiment, isotopically-labeled compounds are useful in drug and/or substrate tissue distribution studies. In another embodiment, substitution with heavier isotopes such as deuterium affords greater metabolic stability (for example, increased in vivo half-life or reduced dosage requirements). In yet another embodiment, substitution with positron emitting isotopes, such as 11C, 18F, 150 and 13N, is useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy. Isotopically-labeled compounds are prepared by any suitable method or by processes using an appropriate isotopically-labeled reagent in place of the non- labeled reagent otherwise employed.

In one embodiment, the compounds described herein are labeled by other means, including, but not limited to, the use of chromophores or fluorescent moieties, bioluminescent labels, or chemiluminescent labels.

The compounds described herein, and other related compounds having different substituents are synthesized using techniques and materials described herein and as described, for example, in Fieser & Fieser's Reagents for Organic Synthesis, Volumes 1-17 (John Wiley and Sons, 1991); Rodd's Chemistry of Carbon Compounds, Volumes 1- 5 and Supplemental (Elsevier Science Publishers, 1989); Organic Reactions, Volumes 1- 40 (John Wiley and Sons, 1991), Larock's Comprehensive Organic Transformations (VCH Publishers Inc., 1989), March, Advanced Organic Chemistry 4th Ed., (Wiley 1992); Carey & Sundberg, Advanced Organic Chemistry 4th Ed., Vols. A and B (Plenum 2000, 2001), and Green & Wuts, Protective Groups in Organic Synthesis 3rd Ed., (Wiley 1999) (all of which are incorporated by reference in their entirety). General methods for the preparation of compound as described herein are modified by the use of appropriate reagents and conditions, for the introduction of the various moieties found in the formula as provided herein.

Compounds described herein are synthesized using any suitable procedures starting from compounds that are available from commercial sources, or are prepared using procedures described herein.

In one embodiment, reactive functional groups, such as hydroxyl, amino, imino, thio or carboxy groups, are protected in order to avoid their unwanted

participation in reactions. Protecting groups are used to block some or all of the reactive moieties and prevent such groups from participating in chemical reactions until the protective group is removed. In another embodiment, each protective group is removable by a different means. Protective groups that are cleaved under totally disparate reaction conditions fulfill the requirement of differential removal.

In one embodiment, protective groups are removed by acid, base, reducing conditions (such as, for example, hydrogenolysis), and/or oxidative conditions. Groups such as trityl, dimethoxytrityl, acetal and t-butyldimethylsilyl are acid labile and are used to protect carboxy and hydroxy reactive moieties in the presence of amino groups protected with Cbz groups, which are removable by hydrogenolysis, and Fmoc groups, which are base labile. Carboxylic acid and hydroxy reactive moieties are blocked with base labile groups such as, but not limited to, methyl, ethyl, and acetyl, in the presence of amines that are blocked with acid labile groups, such as t-butyl carbamate, or with carbamates that are both acid and base stable but hydrolytically removable.

In one embodiment, carboxylic acid and hydroxy reactive moieties are blocked with hydrolytically removable protective groups such as the benzyl group, while amine groups capable of hydrogen bonding with acids are blocked with base labile groups such as Fmoc. Carboxylic acid reactive moieties are protected by conversion to simple ester compounds as exemplified herein, which include conversion to alkyl esters, or are blocked with oxidatively-removable protective groups such as 2,4

dimethoxybenzyl, while co-existing amino groups are blocked with fluoride labile silyl carbamates.

Allyl blocking groups are useful in the presence of acid- and base- protecting groups since the former are stable and are subsequently removed by metal or pi-acid catalysts. For example, an allyl-blocked carboxylic acid is deprotected with a palladium-catalyzed reaction in the presence of acid labile t-butyl carbamate or base- labile acetate amine protecting groups. Yet another form of protecting group is a resin to which a compound or intermediate is attached. As long as the residue is attached to the resin, that functional group is blocked and does not react. Once released from the resin, the functional group is available to react.

Typically blocking/protecting groups may be selected from:

ally? n Cbz a!Eoc ME

Boc PMB tFilyi ac«tyS

Other protecting groups, plus a detailed description of techniques applicable to the creation of protecting groups and their removal are described in Greene & Wuts, Protective Groups in Organic Synthesis, 3rd Ed., John Wiley & Sons, New York, NY, 1999, and Kocienski, Protective Groups, Thieme Verlag, New York, NY, 1994, which are incorporated herein by reference for such disclosure. Compositions

As described elsewhere herein, the invention is based, in part, on the discovery that Ροΐθ efficiently incorporates expanded-size DNA (xDNA)

deoxyribonucleoside monophosphate analogs (dxNMPs) and that consecutive or closely spaced incorporation of two dxNMPs inhibits the DNA synthesis activity of Ροΐθ which is essential for the proliferation of cancer cells. Therefore, xDNA nucleosides and nucleotides, xDNA nucleoside and nucleotide analogs and xDNA nucleotide and nucleoside prodrugs are useful therapeutics for treating cancer.

In one embodiment, the invention provides an inhibitor of Ροΐθ. In various embodiments, the present invention includes compositions for inhibiting the DNA synthesis activity of Ροΐθ in a subject, a tissue, or an organ in need thereof. In one embodiment, the composition comprises an expanded-size DNA (xDNA) or an analog thereof. xDNA which include a benzene ring within the base moiety of each canonical nucleoside. In one embodiment, the xDNA binds to Ροΐθ. In one embodiment, Ροΐθ catalyzes the incorporation of a first xDNA. In one embodiment, the composition comprises at least one compound represented by one of Formulae (I) to (IV).

Ροΐθ is highly upregulated in multiple cancer types and corresponds to a poor survival rate for breast cancer patients. Ροΐθ has also been shown to confer resistance to ionizing radiation and other chemotherapy agents such as Olaparib.

Accordingly, in one embodiment, the invention provides a generic concept for inhibiting Ροΐθ as an anti-cancer therapy. In one embodiment, the composition comprises an expanded-size DNA (xDNA) or an analog thereof. xDNA which include a benzene ring within the base moiety of each canonical nucleoside. In one embodiment, the xDNA binds to Ροΐθ. In one embodiment, Ροΐθ catalyzes the incorporation of a first xDNA nucleotide. In one embodiment, the composition comprises at least one compound represented by one of Formulae (I) to (IV).

Methods The invention provides methods of treating or preventing cancer, or of treating and preventing metastasis of tumors. Related aspects of the invention provide methods of inhibiting Ροΐθ in a subject, a tissue, or an organ in need thereof.

One aspect of the invention provides a method of treating cancer in an individual in need thereof, the method comprising administering to the individual an effective amount of a composition comprising at least one compound of Formulae (I) to (IV). The invention further provides a method of inhibiting Ροΐθ in an individual in need thereof, the method comprising administering to the individual an effective amount of any one of the compositions described herein.

In one embodiment, the invention provides a method of treating cancer in a subject comprising administering to the subject an effective amount of a composition comprising at least one compound of Formulae (I) to (IV). In one embodiment, the cancer is resistant to at least radiation or chemotherapy agent. In one embodiment, the cancer is breast cancer. In one embodiment, the cancer is ovarian cancer. In one embodiment, the cancer is ovarian cancer.

The disclosed compounds can be used to slow the rate of primary tumor growth. The disclosed compounds can also be used to prevent, abate, minimize, control, and/or lessen tumor metastasis in humans and animals. The disclosed compounds when administered to a subject in need of treatment can be used to stop the spread of cancer cells. As such, the compounds disclosed herein can be administered as part of a combination therapy with one or more drugs or other pharmaceutical agents. When used as part of the combination therapy, the decrease in metastasis and reduction in primary tumor growth afforded by the disclosed compounds allows for a more effective and efficient use of any pharmaceutical or drug therapy being used to treat the patient. In addition, control of metastasis by the disclosed compound affords the subject a greater ability to concentrate the disease in one location.

The following are non-limiting examples of cancers that can be treated by the disclosed methods and compositions: Acute Lymphoblastic; Acute Myeloid

Leukemia; Adrenocortical Carcinoma; Adrenocortical Carcinoma, Childhood; Appendix Cancer; Basal Cell Carcinoma; Bile Duct Cancer, Extrahepatic; Bladder Cancer; Bone Cancer; Osteosarcoma and Malignant Fibrous Histiocytoma; Brain Stem Glioma, Childhood; Brain Tumor, Adult; Brain Tumor, Brain Stem Glioma, Childhood; Brain Tumor, Central Nervous System Atypical Teratoid/Rhabdoid Tumor, Childhood; Central Nervous System Embryonal Tumors; Cerebellar Astrocytoma; Cerebral

Astrocytotna/Malignant Glioma; Craniopharyngioma; Ependymoblastoma;

Ependymoma; Medulloblastoma; Medulloepithelioma; Pineal Parenchymal Tumors of intermediate Differentiation; Supratentorial Primitive Neuroectodermal Tumors and Pineoblastoma; Visual Pathway and Hypothalamic Glioma; Brain and Spinal Cord Tumors; Breast Cancer; Bronchial Tumors; Burkitt Lymphoma; Carcinoid Tumor;

Carcinoid Tumor, Gastrointestinal; Central Nervous System Atypical Teratoid/Rhabdoid Tumor; Central Nervous System Embryonal Tumors; Central Nervous System

Lymphoma; Cerebellar Astrocytoma Cerebral Astrocytoma/Malignant Glioma,

Childhood; Cervical Cancer; Chordoma, Childhood; Chronic Lymphocytic Leukemia; Chronic Myelogenous Leukemia; Chronic Myeloproliferative Disorders; Colon Cancer; Colorectal Cancer; Craniopharyngioma; Cutaneous T-Cell Lymphoma; Esophageal Cancer; Ewing Family of Tumors; Extragonadal Germ Cell Tumor; Extrahepatic Bile Duct Cancer; Eye Cancer, intraocular Melanoma; Eye Cancer, Retinoblastoma;

Gallbladder Cancer; Gastric (Stomach) Cancer; Gastrointestinal Carcinoid Tumor;

Gastrointestinal Stromal Tumor (GIST); Germ Cell Tumor, Extracranial; Germ Cell Tumor, Extragonadal; Germ Cell Tumor, Ovarian; Gestational Trophoblastic Tumor; Glioma; Glioma, Childhood Brain Stem; Glioma, Childhood Cerebral Astrocytoma;

Glioma, Childhood Visual Pathway and Hypothalamic; Hairy Cell Leukemia; Head and Neck Cancer; Hepatocellular (Liver) Cancer; Histiocytosis, Langerhans Cell; Hodgkin Lymphoma; Hypopharyngeal Cancer; Hypothalamic and Visual Pathway Glioma;

intraocular Melanoma; Islet Cell Tumors; Kidney (Renal Cell) Cancer; Langerhans Cell Histiocytosis; Laryngeal Cancer; Leukemia, Acute Lymphoblastic; Leukemia, Acute

Myeloid; Leukemia, Chronic Lymphocytic; Leukemia, Chronic Myelogenous; Leukemia, Hairy Cell; Lip and Oral Cavity Cancer; Liver Cancer; Lung Cancer, Non-Small Cell; Lung Cancer, Small Cell; Lymphoma, AIDS-Related; Lymphoma, Burkitt; Lymphoma, Cutaneous T-Cell; Lymphoma, Hodgkin; Lymphoma, Non-Hodgkin; Lymphoma, Primary Central Nervous System; Macroglobulinemia, Waldenstrom; Malignant Fibrous Histiocvtoma of Bone and Osteosarcoma; Medulloblastoma; Melanoma; Melanoma, intraocular (Eye); Merkel Cell Carcinoma; Mesothelioma; Metastatic Squamous Neck Cancer with Occult Primary; Mouth Cancer; Multiple Endocrine Neoplasia Syndrome, (Childhood); Multiple Myeloma/Plasma Cell Neoplasm; Mycosis; Fungoides;

Myelodysplastic Syndromes; Myelodysplastic/Myeloproliferative Diseases;

Myelogenous Leukemia, Chronic; Myeloid Leukemia, Adult Acute; Myeloid Leukemia, Childhood Acute; Myeloma, Multiple; Myeloproliferative Disorders, Chronic; Nasal Cavity and Paranasal Sinus Cancer; Nasopharyngeal Cancer; Neuroblastoma; Non-Small Cell Lung Cancer; Oral Cancer; Oral Cavity Cancer; Oropharyngeal Cancer;

Osteosarcoma and Malignant Fibrous Histiocytoma of Bone; Ovarian Cancer; Ovarian Epithelial Cancer; Ovarian Germ Cell Tumor; Ovarian Low Malignant Potential Tumor; Pancreatic Cancer; Pancreatic Cancer, Islet Cell Tumors; Papillomatosis; Parathyroid Cancer; Penile Cancer; Pharyngeal Cancer; Pheochromocytoma; Pineal Parenchymal Tumors of Intermediate Differentiation; Pineoblastoma and Supratentorial Primitive Neuroectodermal Tumors; Pituitary Tumor; Plasma Celt Neoplasm/Multiple Myeloma; Pleuropulmonary Blastoma; Primary Central Nervous System Lymphoma; Prostate Cancer; Rectal Cancer; Renal Cell (Kidney) Cancer; Renal Pelvis and Ureter,

Transitional Cell Cancer; Respiratory Tract Carcinoma Involving the NUT Gene on Chromosome 15; Retinoblastoma; Rhabdomyosarcoma; Salivary Gland Cancer;

Sarcoma, Ewing Family of Tumors; Sarcoma, Kaposi; Sarcoma, Soft Tissue; Sarcoma, Uterine; Sezary Syndrome; Skin Cancer (Nonmelanoma); Skin Cancer (Melanoma); Skin Carcinoma, Merkel Cell; Small Cell Lung Cancer; Small Intestine Cancer; Soft Tissue Sarcoma; Squamous Cell Carcinoma, Squamous Neck Cancer with Occult Primary, Metastatic; Stomach (Gastric) Cancer; Supratentorial Primitive Neuroectodermal Tumors; T-Cell Lymphoma, Cutaneous; Testicular Cancer; Throat Cancer; Thymoma and Thymic Carcinoma; Thyroid Cancer; Transitional Cell Cancer of the Renal Pelvis and Ureter; Trophoblastic Tumor, Gestational; Urethral Cancer; Uterine Cancer, Endometrial; Uterine Sarcoma; Vaginal Cancer; Vulvar Cancer; Waldenstrom

Macroglobulinemia; and Wilms Tumor.

In some embodiments of the method for treating cancer in an subject in need thereof, comprises administering an effective amount of a composition comprising at least one compound of Formulae (I) to (IV) to the subject prior to, concurrently with, or subsequently to the treatment with a complementary therapy for the cancer, such as surgery, chemotherapy, chemotherapeutic agent, radiation therapy, or hormonal therapy or a combination thereof.

Chemotherapeutic agents include cytotoxic agents (e.g., 5-fluorouracil, cisplatin, carboplatin, methotrexate, daunorubicin, doxorubicin, vincristine, vinblastine, oxorubicin, carmustine (BCNU), lomustine (CCNU), cytarabine USP,

cyclophosphamide, estramucine phosphate sodium, altretamine, hydroxyurea, ifosfamide, procarbazine, mitomycin, busulfan, cyclophosphamide, mitoxantrone, carboplatin, cisplatin, interferon alfa-2a recombinant, paclitaxel, teniposide, and streptozoci), cytotoxic alkylating agents (e.g., busulfan, chlorambucil, cyclophosphamide, melphalan, or ethylesulfonic acid), alkylating agents (e.g., asaley, AZQ, BCNU, busulfan, bisulphan, carboxyphthalatoplatinum, CBDCA, CCNU, CHIP, chlorambucil, chlorozotocin, cis- platinum, clomesone, cyanomorpholinodoxorubicin, cyclodisone, cyclophosphamide, dianhydrogalactitol, fluorodopan, hepsulfam, hycanthone, iphosphamide, melphalan, methyl CCNU, mitomycin C, mitozolamide, nitrogen mustard, PCNU, piperazine, piperazinedione, pipobroman, porfiromycin, spirohydantoin mustard, streptozotocin, teroxirone, tetraplatin, thiotepa, triethylenemelamine, uracil nitrogen mustard, and Yoshi- 864), antimitotic agents (e.g., allocolchicine, Halichondrin M, colchicine, colchicine derivatives, dolastatin 10, maytansine, rhizoxin, paclitaxel derivatives, paclitaxel, thiocolchicine, trityl cysteine, vinblastine sulfate, and vincristine sulfate), plant alkaloids (e.g., actinomycin D, bleomycin, L-asparaginase, idarubicin, vinblastine sulfate, vincristine sulfate, mitramycin, mitomycin, daunorubicin, VP-16-213, VM-26, navelbine and taxotere), biologicals (e.g., alpha interferon, BCG, G-CSF, GM-CSF, and interleukin- 2), topoisomerase I inhibitors (e.g., camptothecin, camptothecin derivatives, and morpholinodoxorubicin), topoisomerase II inhibitors (e.g., mitoxantron, amonafide, m- AMSA, anthrapyrazole derivatives, pyrazoloacridine, bisantrene HCL, daunorubicin, deoxydoxorubicin, menogaril, Ν,Ν-dibenzyl daunomycin, oxanthrazole, rubidazone, VM-26 and VP- 16), and synthetics (e.g., hydroxyurea, procarbazine, o,p'-DDD, dacarbazine, CCNU, BCNU, cis-diamminedichloroplatimun, mitoxantrone, CBDCA, levamisole, hexamethylmelamine, all-trans retinoic acid, gliadel and porfimer sodium). Antiproliferative agents are compounds that decrease the proliferation of cells. Antiproliferative agents include alkylating agents, antimetabolites, enzymes, biological response modifiers, miscellaneous agents, hormones and antagonists, androgen inhibitors (e.g., flutamide and leuprolide acetate), antiestrogens (e.g., tamoxifen citrate and analogs thereof, toremifene, droloxifene and roloxifene), Additional examples of specific antiproliferative agents include, but are not limited to levamisole, gallium nitrate, granisetron, sargramostim strontium-89 chloride, filgrastim, pilocarpine, dexrazoxane, and ondansetron.

The inhibitors of the invention can be administered alone or in combination with other anti -tumor agents, including cytotoxic/antineoplastic agents and anti-angiogenic agents. Cytotoxic/anti-neoplastic agents are defined as agents which attack and kill cancer cells. Some cytotoxic/anti-neoplastic agents are alkylating agents, which alkylate the genetic material in tumor cells, e.g., cis-platin, cyclophosphamide, nitrogen mustard, trimethylene thiophosphoramide, carmustine, busulfan, chlorambucil, belustine, uracil mustard, chlomaphazin, and dacabazine. Other cytotoxic/anti-neoplastic agents are antimetabolites for tumor cells, e.g., cytosine arabinoside, fluorouracil, methotrexate, mercaptopuirine, azathioprime, and procarbazine. Other cytotoxi ^antineoplastic agents are antibiotics, e.g., doxorubicin, bleomycin, dactinomycin,

daunorubicin, mithramycin, mitomycin, mytomycin C, and daunomycin. There are numerous liposomal formulations commercially available for these compounds. Still other cytotoxic/anti-neoplastic agents are mitotic inhibitors (vinca alkaloids). These include vincristine, vinblastine and etoposide. Miscellaneous cytotoxic/anti-neoplastic agents include taxol and its derivatives, L-asparaginase, anti-tumor antibodies, dacarbazine, azacytidine, amsacrine, melphalan, VM-26, ifosfamide, mitoxantrone, and vindesine.

Anti-angiogenic agents are well known to those of skill in the art. Suitable anti-angiogenic agents for use in the methods and compositions of the present disclosure include anti-VEGF antibodies, including humanized and chimeric antibodies, anti-VEGF aptamers and antisense oligonucleotides. Other known inhibitors of angiogenesis include angiostatin, endostatin, interferons, interleukin 1 (including alpha and beta) interleukin 12, retinoic acid, and tissue inhibitors of metalloproteinase-1 and -2. (TIMP-1 and -2). Small molecules, including topoisom erases such as razoxane, a topoisomerase II inhibitor with anti-angiogenic activity, can also be used.

Other anti-cancer agents that can be used in combination with the disclosed compounds include, but are not limited to: acivicin; aclarubicin; acodazole hydrochloride; acronine; adozelesin; aldesleukin; altretamine; ambomycin; ametantrone acetate; aminoglutethimide; amsacrine; anastrozole; anthramycin; asparaginase; asperlin; azacitidine; azetepa; azotomycin; batimastat; benzodepa; bicalutamide; bisantrene hydrochloride; bisnafide dimesylate; bizelesin; bleomycin sulfate; brequinar sodium; bropirimine; busulfan; cactinomycin; calusterone; caracemide; carbetimer; carboplatin; carmustine; carubicin hydrochloride; carzelesin; cedefingol; chlorambucil; cirolemycin; cisplatin; cladribine; crisnatol mesylate; cyclophosphamide; cytarabine; dacarbazine; dactinomycin; daunorubicin hydrochloride; decitabine; dexormaplatin; dezaguanine; dezaguanine mesylate; diaziquone; docetaxel; doxorubicin; doxorubicin hydrochloride; droloxifene; droloxifene citrate; dromostanolone propionate; duazomycin; edatrexate; efl ornithine hydrochloride; elsamitrucin; enloplatin; enpromate; epipropidine; epirubicin hydrochloride; erbulozole; esorubicin hydrochloride; estramustine; estramustine phosphate sodium; etanidazole; etoposide; etoposide phosphate; etoprine; fadrozole hydrochloride; fazarabine; fenretinide; floxuridine; fludarabine phosphate; fluorouracil; fluorocitabine; fosquidone; fostriecin sodium; gemcitabine; gemcitabine hydrochloride; hydroxyurea; idarubicin hydrochloride; ifosfamide; ilmofosine; interleukin II (including recombinant interleukin II, or rIL2), interferon alfa-2a; interferon alfa-2b; interferon alfa- nl; interferon alfa-n3; interferon beta-I a; interferon gamma-I b; iproplatin; irinotecan hydrochloride; lanreotide acetate; letrozole; leuprolide acetate; liarozole hydrochloride; lometrexol sodium; lomustine; losoxantrone hydrochloride; masoprocol; maytansine; mechlorethamine hydrochloride; megestrol acetate; melengestrol acetate; melphalan; menogaril; mercaptopurine; methotrexate; methotrexate sodium; metoprine; meturedepa; mitindomide; mitocarcin; mitocromin; mitogillin; mitomalcin; mitomycin; mitosper; mitotane; mitoxantrone hydrochloride; mycophenolic acid; nocodazole; nogalamycin; ormaplatin; oxisuran; paclitaxel; pegaspargase; peliomycin; pentamustine; peplomycin sulfate; perfosfamide; pipobroman; piposulfan; piroxantrone hydrochloride; plicamycin; plomestane; porfimer sodium; porfiromycin; prednimustine; procarbazine hydrochloride; puromycin; puromycin hydrochloride; pyrazofurin; riboprine; rogletimide; safingol; safingol hydrochloride; semustine; simtrazene; sparfosate sodium; sparsomycin;

spirogermanium hydrochloride; spiromustine; spiroplatin; streptonigrin; streptozocin; sulofenur; talisomycin; tecogalan sodium; tegafur; teloxantrone hydrochloride;

temoporfin; teniposide; teroxirone; testolactone; thiamiprine; thioguanine; thiotepa; tiazofurin; tirapazamine; toremifene citrate; trestolone acetate; triciribine phosphate; trimetrexate; trimetrexate glucuronate; triptorelin; tubulozole hydrochloride; uracil mustard; uredepa; vapreotide; verteporfin; vinblastine sulfate; vincristine sulfate;

vindesine; vindesine sulfate; vinepidine sulfate; vinglycinate sulfate; vinleurosine sulfate; vinorelbine tartrate; vinrosidine sulfate; vinzolidine sulfate; vorozole; zeniplatin;

zinostatin; zorubicin hydrochloride. Other anti-cancer drugs include, but are not limited to: 20-epi-l,25 dihy droxy vitamin D3; 5-ethynyluracil; abiraterone; aclarubicin;

acylfulvene; adecypenol; adozelesin; aldesleukin; ALL-TK antagonists; altretamine; ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin; amsacrine;

anagrelide; anastrozole; andrographolide; angiogenesis inhibitors; antagonist D;

antagonist G; antarelix; anti-dorsalizing morphogenetic protein- 1; antiandrogen, prostatic carcinoma; antiestrogen; antineoplaston; antisense oligonucleotides; aphidicolin glycinate; apoptosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-

PTBA; arginine deaminase; asulacrine; atamestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin III derivatives; balanol;

batimastat; BCR/ABL antagonists; benzochlorins; benzoylstaurosporine; beta lactam derivatives; beta-alethine; betaclamycin B; betulinic acid; bFGF inhibitor; bicalutamide; bisantrene; bisaziridinylspermine; bisnafide; bistratene A; bizelesin; breflate;

bropirimine; budotitane; buthionine sulfoximine; calcipotriol; calphostin C; camptothecin derivatives; canarypox IL-2; capecitabine; carboxamide-amino-triazole;

carboxyamidotriazole; CaRest M3; CARN 700; cartilage derived inhibitor; carzelesin; casein kinase inhibitors (ICOS); castanospermine; cecropin B; cetrorelix; chlorins;

chloroquinoxaline sulfonamide; cicaprost; cis-porphyrin; cladribine; clomifene analogues; clotrimazole; collismycin A; collismycin B; combretastatin A4;

combretastatin analogue; conagenin; crambescidin 816; crisnatol; cryptophycin 8;

cryptophycin A derivatives; curacin A; cyclopentanthraquinones; cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor; cytostatin; dacliximab; decitabine; dehydrodidemnin B; deslorelin; dexamethasone; dexifosfamide; dexrazoxane;

dexverapamil; diaziquone; didemnin B; didox; diethylnorspermine; dihydro-5- azacytidine; dihydrotaxol, 9-; dioxamycin; diphenyl spiromustine; docetaxel; docosanol; dolasetron; doxifluridine; droloxifene; dronabinol; duocarmycin SA; ebselen;

ecomustine; edelfosine; edrecolomab; eflornithine; elemene; emitefur; epirubicin;

epristeride; estramustine analogue; estrogen agonists; estrogen antagonists; etanidazole; etoposide phosphate; exemestane; fadrozole; fazarabine; fenretinide; filgrastim;

finasteride; flavopiridol; flezelastine; fluasterone; fludarabine; fluorodaunorunicin hydrochloride; forfenimex; formestane; fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine; ganirelix; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; heregulin; hexamethylene bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifene; idramantone; ilmofosine; ilomastat; imidazoacridones;

imiquimod; immunostimulant peptides; insulin-like growth factor- 1 receptor inhibitor; interferon agonists; interferons; interleukins; iobenguane; iododoxorubicin; ipomeanol, 4-

; iroplact; irsogladine; isobengazole; isohomohalicondrin B; itasetron; jasplakinolide; kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin; lenograstim; lentinan sulfate; leptolstatin; letrozole; leukemia inhibiting factor; leukocyte alpha interferon; leuprolide+estrogen+progesterone; leuprorelin; levamisole; liarozole; linear polyamine analogue; lipophilic disaccharide peptide; lipophilic platinum compounds; lissoclinamide

7; lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone; lovastatin; loxoribine; lurtotecan; lutetium texaphyrin; lysofylline; lytic peptides; maitansine; mannostatin A; marimastat; masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase inhibitors; menogaril; merbarone; meterelin; methioninase; metoclopramide; MIF inhibitor; mifepristone; miltefosine; mirimostim; mismatched double stranded RNA; mitoguazone; mitolactol; mitomycin analogues; mitonafide; mitotoxin fibroblast growth factor-saporin; mitoxantrone; mofarotene; molgramostim; monoclonal antibody, human chorionic gonadotrophin; monophosphoryl lipid A+myobacterium cell wall sk;

mopidamol; multiple drug resistance gene inhibitor; multiple tumor suppressor 1 -based therapy; mustard anticancer agent; mycaperoxide B; mycobacterial cell wall extract; myriaporone; N-acetyldinaline; N-substituted benzamides; nafarelin; nagrestip; naloxone+pentazocine; napavin; naphterpin; nartograstim; nedaplatin; nemorubicin; neridronic acid; neutral endopeptidase; nilutamide; nisamycin; nitric oxide modulators; nitroxide antioxidant; nitrullyn; 06-benzylguanine; octreotide; okicenone;

oligonucleotides; onapristone; ondansetron; ondansetron; oracin; oral cytokine inducer; ormaplatin; osaterone; oxaliplatin; oxaunomycin; paclitaxel; paclitaxel analogues;

paclitaxel derivatives; palauamine; palmitoylrhizoxin; pamidronic acid; panaxytriol; panomifene; parabactin; pazelliptine; pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin; pentrozole; perflubron; perfosfamide; perillyl alcohol;

phenazinomycin; phenylacetate; phosphatase inhibitors; picibanil; pilocarpine

hydrochloride; pirarubicin; piritrexim; placetin A; placetin B; plasminogen activator inhibitor; platinum complex; platinum compounds; platinum-triamine complex; porfimer sodium; porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2; proteasome inhibitors; protein A-based immune modulator; protein kinase C inhibitor; protein kinase

C inhibitors, microalgal; protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; purpurins; pyrazoloacridine; pyridoxylated hemoglobin polyoxyethylene conjugate; raf antagonists; raltitrexed; ramosetron; ras farnesyl protein transferase inhibitors; ras inhibitors; ras-GAP inhibitor; retelliptine demethylated;

rhenium Re 186 etidronate; rhizoxin; ribozymes; RII retinamide; rogletimide; rohitukine; romurtide; roquinimex; rubiginone B 1 ; ruboxyl; safingol; saintopin; SarCNU;

sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence derived inhibitor 1; sense oligonucleotides; signal transduction inhibitors; signal transduction modulators; single chain antigen binding protein; sizofuran; sobuzoxane; sodium borocaptate; sodium phenylacetate; solverol; somatomedin binding protein; sonermin; sparfosic acid;

spicamycin D; spiromustine; splenopentin; spongistatin 1; squalamine; stem cell inhibitor; stem-cell division inhibitors; stipiamide; stromelysin inhibitors; sulfinosine; superactive vasoactive intestinal peptide antagonist; suradista; suramin; swainsonine; synthetic glycosaminoglycans; tallimustine; tamoxifen methiodide; tauromustine;

tazarotene; tecogalan sodium; tegafur; tellurapyrylium; telomerase inhibitors; temoporfin; temozolomide; teniposide; tetrachlorodecaoxide; tetrazomine; thaliblastine; thiocoraline; thrombopoietin; thrombopoietin mimetic; thymalfasin; thymopoietin receptor agonist; thymotrinan; thyroid stimulating hormone; tin ethyl etiopurpurin; tirapazamine; titanocene bichloride; topsentin; toremifene; totipotent stem cell factor; translation inhibitors; tretinoin; triacetyluridine; triciribine; trimetrexate; triptorelin; tropisetron; turosteride; tyrosine kinase inhibitors; tyrphostins; UBC inhibitors; ubenimex; urogenital sinus-derived growth inhibitory factor; urokinase receptor antagonists; vapreotide;

variolin B; vector system, erythrocyte gene therapy; velaresol; veramine; verdins;

verteporfin; vinorelbine; vinxaltine; vitaxin; vorozole; zanoterone; zeniplatin; zilascorb; and zinostatin stimalamer. In one embodiment, the anti-cancer drug is 5-fluorouracil, taxol, or leucovorin. Administration/Dosage/Formulations

The regimen of administration may affect what constitutes an effective amount. The therapeutic formulations may be administered to the subject either before or after the onset of cancer. Further, several divided dosages may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus injection.

Further, the dosages of the therapeutic formulations may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation.

Administration of the compositions of the present invention to a patient, such as a mammal, (e.g., human), may be carried out using known procedures, at dosages and for periods of time effective to treat cancer in the patient. An effective amount of the therapeutic compound necessary to achieve a therapeutic effect may vary according to factors such as the state of the disease or disorder in the patient; the age, sex, and weight of the patient; and the ability of the therapeutic compound to treat a cancer in the patient. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily. In another example, the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. A non-limiting example of an effective dose range for a therapeutic compound of the invention is from about 1 mg/kg to about 5,000 mg/kg of body weight/per day. One of ordinary skill in the art would be able to assess the relevant factors and make the determination regarding the effective amount of the therapeutic compound without undue experimentation. Actual dosage levels of the active ingredients in the pharmaceutical compositions of this invention may be varied to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without generating excessive side effects in the patient.

In particular, the selected dosage level depends upon a variety of factors including the activity of the particular compound employed, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds or materials used in combination with the compound, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well, known in the medical arts.

A medical professional, e.g., physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start with a dosage of the compound of the invention in the pharmaceutical composition at a level that is lower than the level required to achieve the desired therapeutic effect, and then increase the dosage over time until the desired effect is achieved.

In particular embodiments, it is advantageous to formulate the compound in dosage unit form for ease of administration and uniformity of dosage. "Dosage unit form" as used herein refers to a physically discrete unit containing a predetermined quantity of therapeutic compound calculated to produce the desired therapeutic effect, in association with the required pharmaceutical vehicle. The dosage unit forms of the invention can be selected based upon (a) the unique characteristics of the therapeutic compound and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding/formulating such a therapeutic compound for the treatment of cancer in a patient.

In one embodiment, the compositions of the invention are formulated using one or more pharmaceutically acceptable excipients or carriers. In one

embodiment, the pharmaceutical compositions of the invention comprise a

therapeutically effective amount of a compound of the invention and a pharmaceutically acceptable carrier. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), vegetable oils, and suitable mixtures thereof . The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In some embodiments, it is useful to include isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, in the composition. Prolonged absorption of the injectable compositions can be achieved by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin. In one embodiment, the pharmaceutically acceptable carrier is DMSO, alone or in combination with other carriers.

The therapeutically effective amount or dose of a compound of the present invention depends on the age, sex and weight of the patient, the current medical condition of the patient and the severity of the cancer in the patient being treated. The skilled artisan is able to determine appropriate doses depending on these and other factors.

The dose may be administered in a single dosage or in multiple dosages, for example from 1 to 4 or more times per day. When multiple dosages are used, the amount of each dosage may be the same or different. For example, a dose of 1 mg per day may be administered as two 0.5 mg doses, with about a 12-hour interval between doses.

Doses of the compound of the invention for administration may be in the range of from about 1 mg to about 10,000 mg, from about 20 mg to about 9,500 mg, from about 40 mg to about 9,000 mg, from about 75 mg to about 8,500 mg, from about 150 mg to about 7,500 mg, from about 200 mg to about 7,000 mg, from about 3050 mg to about 6,000 mg, from about 500 mg to about 5,000 mg, from about 750 mg to about 4,000 mg, from about 1 mg to about 3,000 mg, from about 10 mg to about 2,500 mg, from about 20 mg to about 2,000 mg, from about 25 mg to about 1,500 mg, from about 30 mg to about 1,000 mg, from about 40 mg to about 900 mg, from about 50 mg to about 800 mg, from about 60 mg to about 750 mg, from about 70 mg to about 600 mg, from about 80 mg to about 500 mg, and any and all whole or partial increments there between.

In some embodiments, the dose of a compound of the invention is from about 1 mg to about 2,500 mg. In some embodiments, a dose of a compound of the invention used in compositions described herein is less than about 10,000 mg, or less than about 8,000 mg, or less than about 6,000 mg, or less than about 5,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg, or less than about 500 mg, or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, the dosage of a second compound as described elsewhere herein is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg, or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg, or less than about 10 mg, or less than about 5 mg, or less than about 2 mg, or less than about 1 mg, or less than about 0.5 mg, and any and all whole or partial increments thereof.

The compounds for use in the method of the invention may be formulated in unit dosage form. The term "unit dosage form" refers to physically discrete units suitable as unitary dosage for patients undergoing treatment, with each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, optionally in association with a suitable pharmaceutical carrier. The unit dosage form may be for a single daily dose or one of multiple daily doses (e.g., about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form may be the same or different for each dose.

In one embodiment, the compositions of the invention are administered to the patient from about one to about five times per day or more. In various embodiments, the compositions of the invention are administered to the patient, 1-7 times per day, 1-7 times every two days, 1-7 times every 3 days, 1-7 times every week, 1-7 times every two weeks, and 1-7 times per month. . It is readily apparent to one skilled in the art that the frequency of administration of the various combination compositions of the invention will vary from individual to individual depending on many factors including, but not limited to, age, the disease or disorder to be treated, the severity of the disease or disorder to be treated, gender, overall health, and other factors. Thus, the invention should not be construed to be limited to any particular dosing regime and the precise dosage and composition to be administered to any patient is determined by the medical professional taking all other factors about the patient into account.

In the case wherein the patient's status does improve, upon the doctor's discretion the administration of the inhibitor of the invention is optionally given continuously; alternatively, the dose of drug being administered is temporarily reduced or temporarily suspended for a certain length of time (i.e., a "drug holiday"). The length of the drug holiday optionally varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during a drug holiday includes from 10%- 100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

Once improvement of the patient's condition has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, may be reduced to a level at which the improved disease is retained. In some embodiments, a patient may require intermittent treatment on a long- term basis, or upon any recurrence of the disease or disorder.

Toxicity and therapeutic efficacy of such therapeutic regimens are optionally determined in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index, which is expressed as the ratio between LD50 and ED50. The data obtained from cell culture assays and animal studies are optionally used in formulating a range of dosage for use in human. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity. The dosage optionally varies within this range depending upon the dosage form employed and the route of administration utilized. In one embodiment, the present invention is directed to a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of a compound of the invention, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat or prevent cancer in a patient.

Formulations may be employed in admixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for oral, parenteral, nasal, intravenous, subcutaneous, enteral, or any other suitable mode of administration, known to the art. The pharmaceutical preparations may be sterilized and if desired mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, coloring, flavoring and/or aromatic substances and the like. They may also be combined where desired with other active agents, e.g., other analgesic agents.

Routes of administration of any of the compositions of the invention include oral, nasal, rectal, intravaginal, parenteral, buccal, sublingual or topical. The compounds for use in the invention may be formulated for administration by any suitable route, such as for oral or parenteral, for example, transdermal, transmucosal (e.g., sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g., trans- and perivaginally), (intra)nasal and (trans)rectal), intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.

Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral

administration, dry powder or aerosolized formulations for inhalation, compositions and formulations for intravesical administration and the like. It should be understood that the formulations and compositions that would be useful in the present invention are not limited to the particular formulations and compositions that are described herein.

Oral Administration For oral administration, suitable forms include tablets, dragees, liquids, drops, suppositories, or capsules, caplets and gelcaps. The compositions formulated for oral use may be prepared according to any method known in the art and such

compositions may contain one or more agents selected from the group consisting of inert, non-toxic pharmaceutically excipients that are suitable for the manufacture of tablets. Such excipients include, for example an inert diluent such as lactose; granulating and disintegrating agents such as cornstarch; binding agents such as starch; and lubricating agents such as magnesium stearate. The tablets may be uncoated or they may be coated by known techniques for elegance or to delay the release of the active ingredients.

Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert diluent.

For oral administration, the compounds of the invention may be in the form of tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., polyvinylpyrrolidone,

hydroxypropylcellulose or hydroxypropylmethyl cellulose); fillers (e.g., cornstarch, lactose, microcrystalline cellulose or calcium phosphate); lubricants (e.g., magnesium stearate, talc, or silica); disintegrates (e.g., sodium starch glycollate); or wetting agents (e.g., sodium lauryl sulphate). If desired, the tablets may be coated using suitable methods and coating materials such as OP ADR Y™ film coating systems available from Colorcon, West Point, Pa. (e.g., OP ADR Y™ OY Type, OYC Type, Organic Enteric OY- P Type, Aqueous Enteric OY-A Type, OY-PM Type and OP ADR Y™ White,

32K18400). Liquid preparation for oral administration may be in the form of solutions, syrups or suspensions. The liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, methyl cellulose or hydrogenated edible fats); emulsifying agent (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters or ethyl alcohol); and preservatives (e.g., methyl or propyl p-hydroxy benzoates or sorbic acid).

Granulating techniques are well known in the pharmaceutical art for modifying starting powders or other particulate materials of an active ingredient. The powders are typically mixed with a binder material into larger permanent free-flowing agglomerates or granules referred to as a "granulation." For example, solvent-using "wet" granulation processes are generally characterized in that the powders are combined with a binder material and moistened with water or an organic solvent under conditions resulting in the formation of a wet granulated mass from which the solvent must then be evaporated.

Melt granulation involves the use of materials that are solid or semi-solid at room temperature (i.e., having a relatively low softening or melting point range) to promote granulation of powdered or other materials, essentially in the absence of added water or other liquid solvents. The low melting solids, when heated to a temperature in the melting point range, liquefy to act as a binder or granulating medium. The liquefied solid spreads itself over the surface of powdered materials with which it is contacted, and on cooling, forms a solid granulated mass in which the initial materials are bound together. The resulting melt granulation may then be provided to a tablet press or be encapsulated for preparing the oral dosage form. Melt granulation improves the dissolution rate and bioavailability of an active (i.e., drug) by forming a solid dispersion or solid solution.

U.S. Patent No. 5, 169,645 discloses directly compressible wax-containing granules having improved flow properties. The granules are obtained when waxes are admixed in the melt with certain flow improving additives, followed by cooling and granulation of the admixture. In certain embodiments, only the wax itself melts in the melt combination of the wax(es) and additives(s), and in other cases both the wax(es) and the additives(s) melt.

The present invention also includes a multi-layer tablet comprising a layer providing for the delayed release of one or more compounds of the invention, and a further layer providing for the immediate release of a medication for treatment of G- protein receptor-related diseases or disorders. Using a wax/pH-sensitive polymer mix, a gastric insoluble composition may be obtained in which the active ingredient is entrapped, ensuring its delayed release.

Parenteral Administration

For parenteral administration, the compounds of the invention may be formulated for injection or infusion, for example, intravenous, intramuscular or subcutaneous injection or infusion, or for administration in a bolus dose and/or continuous infusion. Suspensions, solutions or emulsions in an oily or aqueous vehicle, optionally containing other formulatory agents such as suspending, stabilizing and/or dispersing agents may be used.

Additional Administration Forms

Additional dosage forms of this invention include dosage forms as described in U.S. Patents Nos. 6,340,475; 6,488,962; 6,451,808; 5,972,389; 5,582,837; and 5,007,790. Additional dosage forms of this invention also include dosage forms as described in U.S. Patent Applications Nos. 20030147952; 20030104062; 20030104053;

20030044466; 20030039688; and 20020051820. Additional dosage forms of this invention also include dosage forms as described in PCT Applications Nos. WO

03/35041; WO 03/35040; WO 03/35029; WO 03/35177; WO 03/35039; WO 02/96404;

WO 02/32416; WO 01/97783; WO 01/56544; WO 01/32217; WO 98/55107; WO

98/11879; WO 97/47285; WO 93/18755; and WO 90/11757.

Controlled Release Formulations and Drug Delivery Systems

In one embodiment, the formulations of the present invention may be, but are not limited to, short-term, rapid-offset, as well as controlled, for example, sustained release, delayed release and pulsatile release formulations.

The term sustained release refers to a drug formulation that provides for gradual release of a drug over an extended period of time, and that may, although not necessarily, result in substantially constant blood levels of a drug over an extended time period. The period of time may be as long as a day, a week, or a month or more and should be a release which is longer that the same amount of agent administered in bolus form. The term delayed release is used herein in its conventional sense to refer to a drug formulation that provides for an initial release of the drug after some delay following drug administration and that mat, although not necessarily, includes a delay of from about 10 minutes up to about 12 hours.

For sustained release, the compounds may be formulated with a suitable polymer or hydrophobic material which provides sustained release properties to the compounds. As such, the compounds for use the method of the invention may be administered in the form of microparticles, for example, by injection or in the form of wafers or discs by implantation.

In one embodiment of the invention, the compounds of the invention are administered to a patient, alone or in combination with another pharmaceutical agent, using a sustained release formulation.

The term pulsatile release refers to a drug formulation that provides release of the drug in such a way as to produce pulsed plasma profiles of the drug after drug administration.

The term immediate release refers to a drug formulation that provides for release of the drug immediately after drug administration.

As used herein, short-term refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes and any or all whole or partial increments thereof after drug administration after drug administration.

As used herein, rapid-offset refers to any period of time up to and including about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, about 1 hour, about 40 minutes, about 20 minutes, or about 10 minutes, and any and all whole or partial increments thereof after drug administration.

Those skilled in the art recognize, or are able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures, embodiments, claims, and examples described herein. Such equivalents were considered to be within the scope of this invention and covered by the claims appended hereto. For example, it should be understood, that modifications in reaction conditions, including but not limited to reaction times, reaction size/volume, and experimental reagents, such as solvents, catalysts, pressures, atmospheric conditions, e.g., nitrogen atmosphere, and reducing/oxidizing agents, with art-recognized alternatives and using no more than routine experimentation, are within the scope of the present application.

EXPERIMENTAL EXAMPLES The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out the preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.

Example 1 : DNA Polymerase Θ Specializes in Incorporating Synthetic Expanded-Size (xDNA) Nucleotides

It is described herein that Ροΐθ efficiently and selectively incorporates into DNA large benzo-expanded nucleotide analogs (dxAMP, dxGMP, dxTMP, dxAMP) which exhibit canonical base-pairing and enhanced base stacking. In contrast, functionally related Y-family translesion polymerases exhibit a severely reduced ability to incorporate dxNMPs, and X- and B-family polymerases fail to incorporate them. It is further demonstrated that Ροΐθ is inhibited after two consecutive dxNMP incorporation events, and surprisingly, kinetics experiments reveal Ροΐθ efficiency for dxGMP incorporation approaching that of native dGMP. These data demonstrate a specialized function for Ροΐθ in incorporating synthetic large sized nucleotides and suggest future possibility of the use of dxN nucleoside, dxN prodrugs and dxN analogs as selective inhibitors of Ροΐθ activity.

The materials and methods employed in these experiments described.

Primer extension Primer extension was performed by incubating 90 nM of the indicated polymerase with 100 nM of indicated radio-labeled or cy3-labeled primer-template in the presence of the indicated nucleotides at 37° C in the following buffer: 25 mM TrisHCl pH 8.8, 10 mM MgC12, 0.1 mg/ml BSA, 0.01% P-40, 5 mM DTT, 10% glycerol.

Reactions were performed for 30 min unless noted otherwise. Reactions were terminated by the addition of 2X stop buffer (50 mM EDTA, 90% formamide). DNA products were resolved in denaturing urea polyacrylamide gels and visualized by autoradiography for radio-labeled DNA or fluorescence scanning for cy3 -labeled DNA. Percent extension was determined by dividing the intensity of the bands representing the extension products by the sum of the intensity of the bands representing initial and extended products.

Concentrations of nucleotides used are shown in table 1. Rescue primer extension assays in Figure 4 were performed by two steps of nucleotide addition as indicated in Figure schematic. Each nucleotide addition step was followed by a 5 min time interval.

Reactions without a rescue step were performed for a single 5 min time interval with the indicated nucleotides. All concentrations are listed as final in the reactions

Table 1. Concentrations of nucleotides used in ex eriments

Determination of relative Vmax and K _m for nucleotide incorporation under steady-state conditions

Steady-state kinetics for single nucleotide incorporation for the determination of relative Vmax and Km was performed similar to a previous study (Boosalis et al., 1987, J Biol Chem 262: 14689-96). Conditions for <20% primer extension were first identified to ensure initial rates of extension and that DNA concentrations were not limiting. 100 nM 5' radio-labeled primer-template (RP443/RP444 or RP443/RP445) and 1 nM Ροΐθ were mixed in IX buffer (25 mM TrisHCl pH 8.8, 10 mM MgC12, 0.1 mg/ml BSA, 0.01% NP-40, 5 mM DTT, 10% glycerol) at room temp. Reactions were initiated by the addition of dGTP or dxGTP at indicated concentrations and terminated after 2 min by the addition of 2X stop buffer (50 mM EDTA, 90% formamide). Reaction products were resolved in denaturing urea polyacrylamide gels and visualized by autoradiography. Multiple films were generated under variable exposure times to ensure bands were not overexposed. Percent extension was determined by dividing the intensity of the extended products by the sum of the intensities of the unextended and extended products. Image J was used to quantify the intensities of radio-labeled DNA. Reactions were performed in triplicate and average velocities for each nucleotide concentration were determined. The substrate (nucleotide) concentrations were regarded as constant throughout the reaction. The data were fit to Hanes-Woolf plots which were used to determine the relative Vmax and K _m for each nucleotide.

Proteins

Human Ροΐθ, Ροΐη and Ροΐδ were purified as described (Kent et al., 2015, Nat Struct Mol biol 22:230-7). Exonuclease deficient human Ροΐγ was purified as described(Kasiviswanathan et al., 2012, J Biol Chem 287:9222-9). Human Pols β and μ were purchased from Enzymax.

DNA

Primer-templates were annealed by mixing together a 2: 1 ratio of template strand to primer strand followed by heating to 95-100° C then slowly cooling to room temp. Primer strand was radio-labeled by using bacteriophage T4 polynucleotide kinase (New England Biolabs) in the presence of 32Ρ-γ-ΑΤΡ (Perkin Elmer). In some instances a Cy3 5' labeled RP25 primer strand was used as indicated. The following primer- template pairs (primer/template) are shown in table 2. Table 3 depicts the sequences of the primers and templates.

Table 2. Concentrations of nucleotides used in ex eriments Figure 2 RP25/RP409, RP166/RP167, RP25/RP166, RP25/RP424

Figure 3 RP25/RP409, RP25/RP408, RP25/RP166, RP25/RP424

Figure 4 RP25/RP409, RP25/RP408

Figure 5 RP25/RP409, RP25/RP408

RP25/RP409, RP25/RP408, RP25/RP166,

Figure 6

RP25/RP424, RP443/RP444, RP443/RP445

Table 3. Sequences of primers and templates

RP25 CACAGATTCTGGCAGGCTGCAGATCGC (SEQ ID NO:l)

RP25Cy3 Cy 3 -CACAGATTCTGGCAGGCTGCAGATCGC (SEQ ID NO:2)

RP408 GAGCACGTCCAGGCGATCTGCAGCCTGCCAGAATCTGTG (SEQ ID NO:3)

RP409 GAGCACGTCCACGCGATCTGCAGCCTGCCAGAATCTGTG (SEQ ID NO:4)

RP424 GTCCAGCGATCTGCAGCCTGCCAGAATCTGTG (SEQ ID NO:5)

RP166 CCTGCGATCTGCAGCCTGCCAGAATCTGTG (SEQ ID NO:6)

RP167 CACAGATTCTGGCAGGCTGCAGAT (SEQ ID NO:7)

RP443 CAACGCGGCGA (SEQ ID NO:8)

RP444 ACGTCCAGTCGCCGCGTTG (SEQ ID NO:9)

RP445 ACGTCCACTCGCCGCGTTG (SEQ ID NO: 10)

GCTTGAGACCGCAATACGGATAAGGGCTGAGCACGTCCTG

RP16 (SEQ ID NO: 11)

CGATCTGCAGCCTGCCAGAATCTGTG

Nucleotides

Canonical dNTPs were purchased from Promega. Expanded-size synthesized as described (Jarchow-Choy et al., 2011, NAR 39: 1586-94).

The results of the experiments are now described.

Ροΐθ efficiently incorporates expanded-size dxNMPs

To determine whether Ροΐθ is capable of incorporating size-expanded dxNMPs into DNA, the ability of the purified polymerase domain to perform primer extension in the presence of a single complementary dxNTP in vitro was examined. Size- expanded dxNTPs, which contain a benzene ring within the base moiety of each nucleoside (Figure 1 A), were synthesized as described (Jarchow-Choy et al., 2011, NAR 39: 1586-94). These expanded nucleosides form canonical base pairs and increase the width of double-stranded DNA by 2.4 A (Lynch et al., 2006, J Am Chem Soc 128: 14704- 11). The bases of dxNMPs also exhibit stronger base stacking interactions (Liu et al., 2003, Science 302:868-71). Ροΐθ was incubated with the indicated radio-labeled primer- templates which respectively encode for one of the four different bases immediately downstream from the 3 ' primer terminus under the given experimental conditions (Figures IB-IE). Primer-template extension was then initiated by the addition of either the complementary canonical dNTP or the respective large-sized dxNTP at equimolar concentration. Reactions were terminated after 30 min and radio-labeled DNA products were resolved in denaturing urea polyacrylamide gels and visualized by autoradiography.

Surprisingly, Ροΐθ demonstrated efficient use of all four dxNTPs as substrates for primer-template extension (Figures IB-IE). For example, Ροΐθ exhibited a similar efficiency of primer-template extension in the presence of the complementary dNTP or dxNTP for each template (Figures IB- IE). The slowed mobility of the extended primer in the presence of the dxCTP compared to dCTP is consistent with the slightly higher molecular weight of the size-expanded nucleoside (dxCMP) (Figure IB). Ροΐθ further extends a fraction of the primers due to misincorporation of dxCMP opposite the next template base, adenine (A) (Figure IB). This result is consistent with previous studies showing that Ροΐθ exhibits a high rate of misincorporation (10 ^~2 to 10 ^"3 ) (Arana et al., 2008, NAR 36:3847-56). Interestingly, in the case of dxGTP, Ροΐθ incorporated two consecutive dxGMPs, but only incorporated a single dGMP on the same template under identical conditions (Figure 1C). This suggests that the presence of the incorporated large-sized nucleoside (dxGMP) in the enzyme's active site facilitates the subsequent misincorporation event, possibly due to increased stacking interactions between dxNMPs or to better alignment of the second incipient large pair with the first (Figure 1C). In the case of dxATP, two consecutive incorporation events are also observed (Figure ID, lane 3). On this template the canonical nucleotide (dAMP) is also incorporated twice due to the error-prone nature of Ροΐθ (Figure ID, lane 2). Interestingly, in the presence of dxTTP and dTTP, a different pattern emerged. Here, the canonical nucleotide (dTMP) was incorporated twice, whereas the large-sized nucleotide (dxTMP) was incorporated only once (Figure IE). This suggests that Ροΐθ may exhibit a reduced efficiency of dxTMP incorporation compared to other dxNMPs, which could reflect the somewhat weaker stacking ability of the xT base compared with the other expanded bases (Gao et al., 2006, Agnew Chem Int Ed Engl 44:3118-22). Overall, the results demonstrate that Ροΐθ effectively incorporates all four size-expanded dxNMPs and document the first case of polymerase dependent synthesis of xDNA by incorporation of synthetic size-expanded nucleotides.

Y-family translesion polymerases exhibit a limited ability to incorporate dx MPs

To test whether the expanded nucleotides are selectively processed by Ροΐθ, the ability of other error-prone translesion polymerases to incorporate dXNMPs was examined. The experiments in Figure 1 were repeated using identical conditions; however, Ροΐθ was substituted with Y-family translesion polymerases κ or η. Y-family polymerases perform low-fidelity DNA synthesis (i.e. error rate 10 ^"2 to 10 ^"3 ) on undamaged DNA and accommodate bulky or non-canonical damaged DNA bases within their active sites during translesion synthesis (Waters et al., 2009, Microbiol Mol Biol Rev 73 : 134-54; McCulloch and Kunkel, 2008, Cell Res 18: 148-61). In contrast to the results observed with Ροΐθ in Figure IB, Ροΐκ exhibited a relatively low efficiency of dxCMP incorporation (Figure 2A). For example, Ροΐθ and Ροΐκ respectively exhibited 91% and 32% primer extension in the presence of dxCTP, whereas both enzymes nearly fully incorporated the canonical dCMP under identical conditions (compare Figures IB and 2A). Ροΐκ also exhibited a severely reduced ability to incorporate dxAMP compared to Ροΐθ (compare Figures 2C and ID). Unexpectedly, Ροΐκ failed to perform primer extension in the presence of dxTTP, again using identical conditions as Ροΐθ in Figure 1 (Figure 2D). Although Ροΐκ exhibited the highest efficiency of incorporation (40%) in the presence of dxGMP, this was still significantly lower than Ροΐθ which extended 99% of the primers with dxGMP under identical conditions (compare Figure 2B and Figure 1C).

The ability of Y-family Ροΐη to incorporate dXNMPs was examined using the same conditions. The results show that Ροΐη exhibits a similar low efficiency of dxNMP incorporation as Ροΐκ (Figure 2). Specifically, Ροΐη fails to incorporate size- expanded pyrimidines (dxCMP, dxTTP) (Figures 2E and 2H) and exhibits a severely limited ability to incorporate size expanded purines (dxGMP, dxAMP) (Figures 2F and 2G). Taken together, these results demonstrate that Y family polymerases exhibit a severely limited ability to incorporate dxNMPs compared to Ροΐθ. X-family, A-family and B-family polymerases strongly select against incorporating dxNMPs

Next, the ability of X-family Ροΐβ to incorporate dxNMPs was examined. X-family polymerases perform gap filling during non-homologous end-joining (NHEJ) and base excision repair (BER). Overall, X-family polymerases exhibit a relatively high error rate (10 ^~2 to 10 ^"4 ) compared to B-family replicative polymerases (<10 ^~5 ) which also exhibit exonuclease activity for proofreading misincorporation errors (McCulloch and Kunkel, 2008, Cell Res 18: 148-61; Yamtich and Sweasy, 2010, Biochim Biophys Acta 1804: 1136-50). X-family polymerases, however, are more accurate than Y-family polymerases which exhibit relatively high error rates (10 ^~2 to 10 ^"3 ) on undamaged DNA (McCulloch and Kunkel, 2008, Cell Res 18: 148-61; Yamtich and Sweasy, 2010, Biochim Biophys Acta 1804: 1136-50). Consistent with its higher fidelity than Y-family polymerases, Ροΐβ exhibited a substantially lower efficiency of dxNMP incorporation (0.2 - 12% extension) compared to Pols κ and η (0.5 - 40% extension) (compare Figure 2 and Figure 3). For example, Ροΐβ failed to incorporate dxCMP and dxTTP and showed only a very slight ability to incorporate dxGMP and dxAMP during the 30 minute time course (Figure 3). Because Ροΐβ performs gap filling during base excision repair, its ability to incorporate purine and pyrimidine based dxNMPs was examined on a primer- template substrate containing a small gap with a 5' phosphate on the oligonucleotide downstream from the primer. On this substrate Ροΐβ failed to incorporate dxCMP and showed only a small increase in dxGMP incorporation (Figures 3E and 3F). X-family Ροΐμ also failed to effectively use dxNTPs as substrates like Ροΐβ (Figure 7). Thus, these data demonstrate that X-family polymerases strongly select against size-expanded nucleotides.

Next, the ability of B-family replicative polymerases δ and ε to

incorporate dxNMPs was investigated. These enzymes are responsible for replicating the genome in eukaryotes and therefore exhibit relatively high fidelities of nucleotide incorporation. For example, Ροΐδ and Ροΐε were shown to exhibit error rates less than 10 ^"5 (McCulloch and Kunkel, 2008, Cell Res 18: 148-61). Ροΐδ and Ροΐε possess proofreading activity which contributes to these low error rates. In order to examine the incorporation of dxNMPs by Ροΐδ and Ροΐε it was necessary to devise a slightly different experimental method due to their robust exonuclease activities which are stimulated when one or more nucleotides are omitted from the reaction. Therefore the following primer-template extension assay was developed, which limits the exonuclease activities of Ροΐδ and Ροΐε while detecting their ability to incorporate dxNMPs. Here, all four nucleotides were added to the reaction; however, dGTP was replaced with dxGTP. Thus, in the event that these high-fidelity enzymes are capable of efficient incorporation of dxNMPs, full primer extension and little or no exonuclease activity should be observed. However, if these enzymes are unable to efficiently incorporate dxNMPs, their respective exonuclease activities should be activated at the cytosine template base located immediately downstream from the 3' terminus of the primer. Indeed, the exonuclease activity of Ροΐε was strongly stimulated when dxGTP was added along with dTTP, dATP and dCTP, indicating that Ροΐε is unable to efficiently incorporate dxGMP (Figure 4A, lane 2). The reaction was repeated with dxGTP, dTTP, dATP and dCTP, however, after 5 min an equimolar concentration of dGTP was added for a further 5 minutes. Subsequent addition of dGTP rescued the polymerase activity of Ροΐε as indicated by full extension of the primer (Figure 4A, lane 3); this activity is modeled in Figure 4C. Since the exonuclease function is activated following a misincorporation event or when the correct incoming nucleotide is lacking, these data reflect one of the following scenarios. In the first scenario, Ροΐε efficiently incorporates the complementary size-expanded nucleotide which rapidly triggers its exonuclease activity, resulting in immediate excision of the unnatural nucleotide. In the second more likely scenario, the polymerase fails to efficiently incorporate dx GMP which would also trigger its exonuclease activity since the correct canonical nucleotide (dGTP) is initially withheld from the reaction (Figure 4C). In the case of the first scenario where Ροΐε exhibits dxGMP incorporation activity prior to exonuclease activity, the polymerase is likely to enter into a repetitive cycle of dxGMP incorporation and excision opposite the cytosine template base immediately downstream from the primer. Evidence of this incorporation-excision cycle would be indicated by some detection of dxGMP incorporation. However, a band representative of dxGMP incorporation is not observed. Thus, the data indicate that Ροΐε exhibits little or no ability to incorporate dxGMP under the conditions tested. The assay was repeated with Ροΐδ. In contrast to the results with Ροΐε, Ροΐδ showed slight incorporation of dxGMP (Figure 4A, lane 5). Minor exonuclease digestion of the primer was also observed in this reaction. Thus, although Ροΐδ shows some ability to incorporate dxGMP, its proofreading function is stimulated and probably acts to excise the large-sized nucleotide from the primer like Ροΐε. To determine if the polymerase activity of Ροΐδ can be rescued, dGTP was added after 5 min and the reaction was allowed to proceed for an additional 5 min. Similar to the results obtained with Ροΐε: addition of the canonical nucleotide rescued the polymerase activity of Ροΐδ (Figure 4A, lane 6) (Figure 4C). Hence, these data show that Ροΐδ and Ροΐε are capable of continued DNA synthesis even when dxGTP and dGTP are present at equimolar concentrations, which demonstrates their ability to either select against dxGMP incorporation or effectively proofread a misincorporated dxGMP (Figure 4C). The rescue assay was then repeated with Ροΐδ and Ροΐε, but dxCMP was added as the size-expanded nucleotide instead of dxGMP (Figure 4B). Similar to the results in panel Figure 4A, the addition of the large sized nucleotide (dxCTP) activated the respective proofreading activities of Ροΐε and Ροΐδ, and the subsequent addition of the canonical nucleotide (dCTP) rescued primer extension by both polymerases. Taken together, the results presented in Figure 4 demonstrate that B-family replicative polymerases either strongly select against dxNTPs or efficiently excise these large-sized nucleotides after they are incorporated.

Next, it was examined whether B-family Pola, which functions as a replicative primase, selected against incorporating size-expanded nucleotides. In contrast to Pols δ and ε, Pola lacks exonuclease activity and therefore may incorporate dxNMPs during a prolonged incubation time of 30 minutes. The results show that Pola fails to incorporate purine and pyrimidine based dxNMPs like Pols δ and ε. These data therefore demonstrate that all three B-family replicative polymerases strongly select against incorporating size-expanded nucleotides.

Because Ροΐθ is an A-family polymerase, the mitochondrial replicative Ροΐγ, which is also an A-family member, may similarly use size-expanded nucleotides as substrates. This could conceivably cause toxicity in patients treated with prodrug chain terminator versions of size-expanded nucleotide or nucleoside analogs. The ability of an exonuclease deficient mutant version of Ροΐγ to incorporate purine and pyrimidine versions of dx MPs was tested (Figure 4E). Remarkably, in contrast to Ροΐθ, the related Pol D fails to use purine and pyrimidine based dxNTPs as substrates under identical conditions (Fig. 4E). Hence, the data presented insofar demonstrate that Ροΐθ exhibits a unique ability to utilize dxNTPs as substrates and suggest that chain terminator versions of size-expanded nucleotides could be developed as specific inhibitors of Ροΐθ.

Ροΐθ is inhibited after multiple dx MP incorporation events Previous studies have demonstrated that Ροΐθ exhibits a relatively high efficiency of mismatch extension (Seki and Wood, 2008, DNA Repair 7: 119-27). This suggests that Ροΐθ may also efficiently extend from a dxNMP located at the 3' primer terminus. To examine this, Ροΐθ was incubated with the primer-template in the presence of dxCTP to allow for nearly full incorporation of the nucleotide (Figure 5 A, left panel, lane 2). To assess whether Ροΐθ is capable of efficiently extending from the incorporated dxCMP, the reaction was repeated, however, all 4 canonical dNTPs were added after the initial 15 min incubation with dxCTP. The result shows that Ροΐθ fully extends the primer after the subsequent addition of canonical nucleotides, demonstrating that the polymerase efficiently extends from the expanded-size nucleotide (dxCMP)(Figure 5A, left panel, lane 3). As a control, Ροΐθ fails to extend from dxCMP in the absence of canonical dNTPs even after 30 min (Figure 5 A, right panel).

Following these results, whether Ροΐθ can extend from multiple consecutively incorporated dxNMPs was examined. To test this, the primer extension reaction was repeated with all 4 dxNMPs. In contrast to the results observed in Figure 5 A, Ροΐθ stalled after a single dxCMP incorporation event and showed a minimal ability to incorporate a second consecutive dxNMP (dxTTP) (Figure 5B). In a different sequence context, Ροΐθ stalled after two consecutive dxNMP incorporation events (Figure 5C). These data demonstrate that two consecutive dxNMP incorporation events strongly inhibit Ροΐθ, presumably due to distortion of the polymerase's active site which may prevent proper positioning of the next incoming nucleotide or suppress forward translocation of the enzyme. Further analysis shows that two consecutive dxNMP incorporation events suppress Ροΐθ activity even in the presence of all four nucleotides (Figure 5D). For example, in Figure 5D Ροΐθ primer extension was analyzed in the presence of a single size-expanded nucleotide mixed with equimolar concentrations of the remaining three canonical nucleotides. Since the template sequence contains two consecutive cytosine bases, a significant population of the polymerase becomes arrested at the second cytosine position when dxGTP is present in the reaction (Figure 5D, lane 3; Fig. 5E). Furthermore, the majority of enzymes fail to reach the end of the template during this particular reaction which is likely due to additional dxGMP incorporation events downstream (Figure 5D, lane 3).

To further examine the ability of multiple dxGMP incorporation events to inhibit Ροΐθ primer extension was performed with increasing amounts (0 - 60 μΜ) of dxGTP in the presence of all four canonical dNTPs at a constant concentration of 5 μΜ (Figure 5F). Remarkably, the results show that dxGTP begins to inhibit Ροΐθ DNA synthesis activity when added at an equimolar concentration (i.e. 5 μΜ) as canonical nucleotides (Figure 5F, lane 3). At higher concentrations, dxGTP prevents Ροΐθ from fully extending the primer (Figure 5F, lanes 4-6). This is likely due to the inability of Ροΐθ to extend the primer after multiple dxGMP incorporation events (Figure 5E). Taken together, these data indicate that chain terminator versions of dxGTP may act as potent inhibitors of Ροΐθ at relatively low concentrations (i.e. <15 μΜ).

Ροΐθ preferentially incorporates purine based dx MPs

Next, the relative velocities of dxNMP incorporation by Ροΐθ under steady-state conditions were examined. The results show that Ροΐθ exhibits a substantially higher rate of incorporating size-expanded nucleotides derived from purine bases (dxGMP, dxAMP) (Figures 6A and 6B). For example, primer extension is nearly completed within 30 seconds in the presence of dxGTP or dxATP. In contrast, full primer extension in the presence of dxCTP or dxTTP under identical conditions requires 5 to 10 minutes. Increased base stacking interactions by dxGMP and dxAMP contribute to their higher rate of incorporation. The relative velocities of incorporation of large-sized and canonical purine and pyrimidine nucleotides were compared under steady-state conditions. Unexpectedly, Ροΐθ showed only a slightly lower velocity for dxGMP incorporation compared to dGMP (Figure 6C, left). In contrast, dxCMP, a pyrimidine analog, was incorporated at a substantially slower rate relative to canonical dCMP (Figure 6C, right). Since Ροΐθ exhibited roughly similar rates of incorporation between dxGMP and dGMP (Fig. 6C), the steady-state kinetics of these nucleotides were further examined. Consistent with the data presented in Figure 6C, Ροΐθ exhibited similar steady- state kinetics for dxGMP (Vmax/K _m = 2.8 x 10 ^"2 min ¹ uM ^"1 ) and dGMP (Vmax/Km = 5.0 x 10 ^"2 min ^"1 uM ^"1 ) (Figure 6D). Thus, these results demonstrate that Ροΐθ incorporates dxGMP with remarkable efficiency despite its large size, and suggest that dxGTP can readily compete with canonical dGTP during Ροΐθ DNA synthesis activity.

To test directly whether dxGTP can compete with canonical dGTP during Ροΐθ replication, primer extension was analyzed in the presence of either dxGTP or dGTP as controls, and a combination of dxGTP and dGTP at various concentrations. The control reaction in the presence of dxGTP reveals a clearly identifiable pattern of Ροΐθ inhibition after two dxGMP incorporation events (Figure 6E, lane 6). The control reaction in the presence of dGTP, however, results in a different pattern. Here, several consecutive dGMPs are incorporated due to multiple misincorporation and mismatch extension events (Figure 6E, lane 2). The differential patterns of dGMP versus dxGMP incorporation allows for the determination of which nucleotide is preferentially incorporated in reactions containing both nucleotides. Next, the reactions were repeated with 100 μΜ dxGTP and increasing amounts of canonical dGTP. As expected from the similar steady- state kinetics of dxGMP and dGMP incorporation, similar amounts of dxGMP and dGMP incorporation events were observed when equimolar concentrations of these nucleotides were added to the reaction (Figure 6E, lane 3). Hence, these data demonstrate the ability of dxGTP to compete with dGTP at equimolar concentrations and suggest the dxGMP structure as a lead for development of cell-permeable prodrug competitive inhibitors of Ροΐθ.

Size-expanded nucleotide analogs as a drug

Recent studies indicate Ροΐθ as a promising drug target for the development of precision medicine in HR deficient cancers, such as breast and ovarian cancers possessing BRCA mutations (Ceccaldi et al., 2015, Nature 517:258-62; Mateos- Gomez et al., 2015, Nature 518:254-7). However, there are currently no reported inhibitors of this polymerase, which appears to promote the survival of HR deficient cells through its role in the repair of DSBs via the alt-EJ pathway (Mateos-Gomez et al., 2015, Nature 518:254-7). Ροΐθ not only effectively incorporates dxNMPs, but uniquely exhibits this novel function compared to all other human polymerases tested from the X, B, A and Y families.

Although Ροΐθ is among the A-family of polymerases, it includes three insertion motifs which alter the activity of the enzyme relative to other A-family DNA polymerase members. For example, insertion loop 2 which lies between the thumb and palm subdomains confers both translesion synthesis and end-joining activities onto the polymerase (Kent et al., 2015, Nat Struct Mol biol 22:230-7; Hogg et al., 2011, J Mol Biol 405:642-52). Although crystal structures of Ροΐθ have recently been solved (Zahn et al., 2014, Nat Struct Mol Biol 22:304-11), it remains unclear how loop 2 or other insertion motifs affect the polymerase's fidelity or ability to utilize non-canonical templates such as DNA end-joining intermediates and ssDNA. The structural studies, however, do identify conserved positively charged residues that contribute to translesion synthesis activity by binding to phosphates at the 3' terminus of the primer (Zahn et al., 2014, Nat Struct Mol Biol 22:304-11). These conserved residues contribute to the processivity of the enzyme which may increase the polymerase's ability to accommodate non-canonical templates and nucleotides by allowing it to remain tightly bound to DNA during catalysis. Regardless of the exact mechanisms by which Ροΐθ synthesizes DNA with substantially reduced fidelity and template requirements compared to other polymerases, the enzyme clearly exhibits unique characteristics that may be exploited for developing selective nucleotide inhibitors.

It is demonstrated herein that Ροΐθ exhibits a unique ability to incorporate expanded-size dxNMPs, and that the polymerase incorporates dxGMP and dGMP with surprisingly similar steady-state kinetics. Functionally similar translesion polymerases from the Y-family (Ροΐκ, Ροΐη), which are also highly error prone, show a severely reduced ability to incorporate dxNMPs compared to Ροΐθ, and in some cases are unable to incorporate particular dxNMPs even after long time intervals. It is further shown herein that X- and B- family polymerases fail to effectively incorporate dxNMPs. Since B- family replicative polymerases δ and ε exhibit proofreading activity, these enzymes can conceivably incorporate a dxNMP then rapidly excise the unnatural nucleotide due to its large base moiety. For example, some evidence was observed for Ροΐδ dxNMP incorporation; however, dx MP incorporation was not detected by Ροΐε. Interestingly, although the respective proofreading functions of Ροΐδ and Ροΐε were activated by the presence of dxNTPs, both enzymes effectively switched to their polymerase activity when equimolar amounts of the respective canonical dNTP were subsequently added to the reaction. These data therefore demonstrate that replicative Pols δ and ε can efficiently perform DNA synthesis in the presence of equimolar amounts of dxNTPs without being inhibited. This observation suggests that prodrug inhibitors derived from dx MPs would have little or no effect on chromosomal replication in non-cancerous proliferating cells which is important for minimizing toxicity. Consistent with this idea, it is demonstrated herein that Pol a, the replicative primase, also failed to incorporate dxNMPs. Ροΐγ which replicates mitochondrial DNA similarly failed to use these size-expanded nucleotides as substrates. Taken together, these data suggest that prodrug chain terminator versions of dxNMPs would not induce toxicity in normal cells which do not rely on Ροΐθ activity for their proliferation.

In contrast to replicative polymerases, it is shown herein that Ροΐθ incorporates dxGMP even when an equimolar amount of dGTP is present in the reaction, which is consistent with its ability to incorporate dGMP and dxGMP with similar kinetics. It is further shown herein that Ροΐθ becomes arrested after multiple dxGMP incorporation events. This suggests that two closely spaced dxNMPs in the primer induce a severe distortion in the polymerase's active site which suppresses further DNA synthesis either due to preventing proper positioning of the next incoming nucleotide or disabling forward translocation of the polymerase.

Since Ροΐθ exhibits similar steady-state kinetics of dxGMP and dxGTP incorporation, the possibility exists that analogs of dxGMP might be developed as selective inhibitors of Ροΐθ. Other human polymerases from the B, X, A, and Y families either fail to incorporate dxGMP or exhibit a markedly reduced ability to incorporate this nucleotide compared to Ροΐθ. Future chain terminator analogs of dxGTP might show enhanced inhibition of Ροΐθ since they would not require multiple adjacent incorporation events. In addition, phosphate prodrug variants of dxG might enable cellular activity against the polymerase which has been shown to promote the survival of HR deficient breast cancer cells (Mateos-Gomez et al., 2015, Nature 518:254-7). Future studies are needed to determine whether Ροΐθ can be targeted by prodrug size-expanded nucleotide analogs for potential applications in HR deficient cells.

Example 2: Use of expanded-size DNA (xDNA) nucleoside and nucleotide analogs to selectively kill recombination-deficient cancer cells

To develop nucleoside or nucleotide inhibitors of Ροΐθ that are specific for this polymerase it is important to first identify nucleotide substrates that are selectively incorporated by Ροΐθ and not by other polymerases, especially replicative polymerases which are important for the proliferation and survival of non-cancerous cells. As described in Example 1, expanded-size DNA (xDNA) deoxynucleoside mono-phosphates (dxNMPs) are efficiently incorporated by Ροΐθ, but are either not incorporated or are very poor substrates for all other human polymerases tested representing every polymerase family (i.e. A, X, Y, B). Moreover, dxGTP inhibits Ροΐθ in vitro and the kinetics of dxGMP and canonical dGMP incorporation by Ροΐθ are similar, which allows dxGTP to compete with dGTP during Ροΐθ DNA synthesis. Thus, these data described herein and elsewhere strongly suggest that prodrug dxNMPs and prodrug chain teminator versions of dxNMPs can be used to inhibit Ροΐθ activity in cells and selectively cancer cells that are hyper-dependent on Ροΐθ such as those deficient in HR. Because recent studies show that Ροΐθ also promotes the survival of cells deficient in the DNA repair pathway non- homologous end-joining (NHEJ), prodrug versions of dxNTPs that inhibit Ροΐθ are also likely to selectively kill cancer cells deficient in NHEJ.

Considering that dxNMPs are efficiently incorporated by Ροΐθ, but not by other human polymerases, and that dxGTP inhibits the activity of Ροΐθ in vitro, prodrug dxNMPs and prodrug chain terminator versions of these dxNMPs will be applicable for inhibiting Ροΐθ DNA synthesis activity in vivo and selective killing of HR-deficient and potentially NHEJ-deficient cancer cells, while sparing normal cells. Synthetic strategies for deoxygenation of the relevant 3' hydroxyl groups are thus well precedented.

Examples of prodrug xDNA nucleoside and nucleotide analogs that are applicable for inhibiting Ροΐθ DNA synthesis activity in cells are illustrated in Figure 7. Some of these nucleotide analogs have been described elsewhere herein. Others represent analogs using similar chemical space that are predicted to inhibit Ροΐθ based on preliminary research. As illustrated, some nucleotide analogs are utilized as prodrug chain terminators due to either their lack of hydroxyl group at the 3' position of their respective sugar moiety or due to an azide or fluoro group at their respective 3' sugar position. Multiple phosphorus-containing prodrug analogs are contemplated, including known analogs such as "ProTides" derivatives. Generic and specific examples are shown in Figures 8-10.

These xDNA based nucleoside and nucleotide prodrugs selectively kill HR-deficient cancer cells. The prodrug nucleoside and nucleotide xDNA analogs selectively kill tumors that are deficient in HR as well as other various types of tumors. These prodrug nucleoside and nucleotide xDNA analogs also increase the efficacy of radiation therapy and other forms of cancer therapy involving but not limited to genotoxic agents since Ροΐθ confers resistance to radiation and various other forms of genotoxic agents and is associated with a poor survival rate for cancer patients.

The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.