OR NEURODEGENERATIVE DISORDERS

This application claims priority to US Provisional Patent Application no. 62/398,892, filed September 23, 2016, which is herein incorporated by reference in its entirety.

FIELD OF INVENTION

The present invention relates generally to methods and compositions for treating neurological or neurodegenerative diseases or conditions. More specifically, the present invention relates to compositions comprising whey protein isolate and/or concentrate, and their use in increasing reelin (RELN) levels and/or in restoring other imbalances or abnormalities of gene expression linked with a neuropsychiatric or neurodegenerative disorder in a subject in need thereof.

BACKGROUND Neuropsychiatric and neurodegenerative disorders represent a significant and ongoing concern for public health and wellbeing. Millions of individuals have suffered, or will suffer from, some form of mental disorder during their lifetime. These diseases and conditions are highly complex, and as a result successful treatment can be quite challenging. Schizophrenia (SCZ), for example, is a complex neuropsychiatric condition including disordered thought and behavior that afflicts approximately 1% of the population ¹ . Alzheimer's disease (AD), as another example, affects millions of people worldwide and has only limited treatment options available.

While the majority of neuropsychiatric and neurodegenerative disorders are believed to stem from diseases of the nervous system, their root causes and mechanisms of disease progression have proven complex and difficult to treat. Even still, a number neuropsychiatric and neurodegenerative disorders have been linked or attributed at least in part to imbalances or genetic abnormalities arising in connection with environmental factors, gene mutations, and/or dysregulation of expression of particular genes.

Indeed, a host of prenatal and early postnatal stressors have been implicated as risk factors or triggers for human neurodevelopmental disorders ² ' ³ such as SCZ ^4,5 , autism ^6,7 and attention deficit-hyperactivity disorder (ADHD) ⁸ . Candidate perinatal stressors include exposure to noxious chemicals during pregnancy, maternal infection (bacterial, viral, or parasitic) and attendant immune activation, and maternal psychotrauma and associated activation of the hypothalamic-pituitary-adrenal axis. While the etiopathogenesis of SCZ, as with many other neuropsychiatric and neurodegenerative disorders, remains incompletely understood, there is evidence suggesting that many genetic and perinatal risk factors converge on limited neurodevelopmental pathways to elicit the disease.

Alzheimer's disease is another particularly relevant example of a complex neurodegenerative disease which affects millions worldwide, and for which treatment has proven difficult. Hallmarks of AD include amyloid plaques (insoluble deposits of amyloid beta peptide) and neurofibrillary tangles containing hyper-phosphorylated tau protein. Treatment options are limited, and are generally not curative.

Substantial research efforts have been directed toward the identification of genes which are linked with neuropsychiatric and neurodegenerative disorders, and toward the identification of therapeutic agents capable of restoring such genes to healthy expression and/or activity levels. Although certain genes believed to be involved in the onset and/or progression of particular neuropsychiatric and neurodegenerative disorders have been identified, treatment options successfully taking advantage of these gene targets are still lacking.

Reelin (RELN; human NCBI Gene ID: 5649; human mRNA and amino acid sequences shown in Figure 11 as SEQ ID NO: l and SEQ ID NO: 2, respectively; mouse NCBI Gene ID: 19699; mouse genome ID: gi:372099105; mouse mRNA and amino acid sequences shown in Figure 11 as SEQ ID NO: 23 and SEQ ID NO: 24, respectively) is an example of a gene which has been linked to a variety of different neuropsychiatric and neurodegenerative disorders. According to the NCBI, RELN may be involved in schizophrenia, autism, bipolar disorder, and major depression. RELN expression levels are significantly reduced in both schizophrenia and Alzheimer's disease, for example. Reelin overexpression may protect against, or rescue, certain aspects of Alzheimer's disease (see Pujadas, L., et al., 2013, Reelin delays amyloid-beta fibril formation and rescues cognitive deficits in a model of Alzheimer's disease, Nature Communications, DOI: 10.1038/ncomms4443), for example.

Reelin is secreted by specific cells within the central nervous system, and plays a key role in patterning and layering of the cerebral cortex and other regions of the brain during development. In adults, Reelin is thought to be a central regulator of synapse formation and critical neuronal processes required for learning and memory. Alzheimer's disease is the most prevalent cognitive disorder in adults and is characterized by substantial deficits in learning and memory. The entorhinal cortex layer II neurons are one of the first populations to die in AD, resulting in a severe loss of synaptic contacts to the dentate gyrus. Many of the entorhinal cortex layer II neurons express Reelin, and these Reelin-expressing cells are significantly reduced in the brains of human amyloid precursor protein (hAPP) transgenic mice expressing the Swedish and Indiana mutant form of the hAPP gene (J20 strain). Similar loss of Reelin-expressing entorhinal cortex layer II neurons is also observed in the brains of patients with AD (Chin, J., et al., 2007, J Neurosci, 27(11): 2727-2733; Herring, A., et al., 2012, J Ah Dis, 30(4): 963-979). In a transgenic rat model of AD (McGill-R-Thyl-APP strain). Reelin-expressing neurons of the entorhinal cortex layer II were found to selectively express increased levels of soluble intracellular Αβ early in disease, prior to the deposition of amyloid plaques (Kobro-Flatmoen, A., et al., 2016, Neurobiol Dis 93 : 172-183). Collectively, these studies suggest that Reelin- expressing neurons of entorhinal cortex layer II play a central role in the early pathogenic changes in AD, and that loss of these Reelin-expressing cells and their synaptic projections to the hippocampus are early markers of disease (Krstic, D., et al., 2013, Neuroscience 246: 108-116). Alternative, additional, and/or improved methods and compositions for restoring healthy levels of gene products linked to neuropsychiatric and neurodegenerative disorders, such as RELN, are highly desirable. SUMMARY OF INVENTION

Methods and compositions for treating neurological, neuropsychiatry, or neurodegenerative diseases or conditions in a subject in need thereof are provided. It has been found that, as described in detail herein, compositions comprising whey protein isolate and/or whey protein concentrate allow for restoration of reelin (RELN) levels in the brain of a subject in need thereof. The provided methods and compositions are not limited to increasing or restoring RELN levels, and may also, or alternatively, be used to correct a number of other neurological conditions, imbalances, dysregulations, or abnormalities occurring in a subject. Subjects suffering from neuropsychiatric or neurodegenerative diseases may particularly benefit from treatment with such compositions, however other subjects may also benefit from such treatment with whey protein isolate and/or concentrate compositions as described herein.

In an embodiment, there is provided herein a method for increasing reelin (RELN) levels in the brain a subject in need thereof, said method comprising: administering a composition comprising whey protein isolate and/or whey protein concentrate to the subj ect.

In another embodiment of the above method, the method may further comprise a step of: measuring an initial RELN level of the subject and comparing the measured initial RELN level to a healthy RELN level, wherein the subject is identified as having a reduced RELN level in need of increase when the measured initial RELN level is less than the healthy RELN level.

In still another embodiment of the above method or methods, administration of the composition comprising whey protein isolate and/or whey protein concentrate may increase expression levels of GAD67, a gene acting downstream of RELN.

In still another embodiment of the above method or methods, the subject in need thereof may be a subject suffering from a neuropsychiatric or neurodegenerative disorder. In yet another embodiment of the above method or methods, the subject in need thereof may be a subject suffering from schizophrenia.

In another embodiment of the above method or methods, the subject in need thereof may be a subject sufferning from Alzheimer's disease (AD). In still another embodiment of the above method or methods, the subject in need thereof may be a subject suffering from a neurological disorder characterized by enhanced expression of heme oxygenase-1 and/or increased oxidative stress in brain such as Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia, amyotrophic lateral sclerosis, other motor neuron disorders, Down's syndrome, Creutzfeldt- Jakob disease, other prion diseases, multiple sclerosis, cerebral ischemia, cerebral hemorrhage, traumatic brain injury, spinal cord injury, cerebral malaria, schizophrenia, bipolar disease with psychosis, or autism.

In yet another embodiment of the above method or methods, the reelin (RELN) levels may be neuronal reelin (RELN) levels.

In another embodiment, there is provided herein a method for treating, preventing, or ameliorating symptoms of a neuropsychiatric disease or a neurodegenerative disorder in a subject in need thereof, said method comprising: administering a composition comprising whey protein isolate and/or whey protein concentrate to the subject.

In another embodiment of the above method, the composition comprising whey protein isolate and/or whey protein concentrate may be administered to increase reelin (RELN) levels in the brain of the subject.

In still another embodiment of the above method, the method may further comprise a step of: measuring an initial RELN level of the subject and comparing the measured initial RELN level to a healthy RELN level, wherein the subject is identified as being particularly susceptible to treatment when the measured initial RELN level is less than the healthy RELN level.

In yet another embodiment of the above method or methods, the neuropsychiatric disease or neurodegenerative disorder may be schizophrenia or Alzheimer's disease (AD).

In still another embodiment of the above method or methods, the neuropsychiatric disease or neurodegenerative disorder may be a neurological disorder characterized by enhanced expression of heme oxygenase- 1 and/or increased oxidative stress in brain such as Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia, amyotrophic lateral sclerosis, other motor neuron disorders, Down's syndrome, Creutzfeldt- Jakob disease, other prion diseases, multiple sclerosis, cerebral ischemia, cerebral hemorrhage, traumatic brain injury, spinal cord injury, cerebral malaria, schizophrenia, bipolar disease with psychosis, or autism.

In yet another embodiment of the above method or methods, the reelin (RELN) levels may be neuronal reelin (RELN) levels.

In another embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate for increasing reelin (RELN) levels, such as but not limited to neuronal reelin levels, in a subject in need thereof.

In yet another embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate in the manufacture of a medicament for increasing reelin (RELN) levels, such as but not limited to neuronal reelin levels, in a subject in need thereof.

In another embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate for treating, preventing, or ameliorating symptoms of a neuropsychiatric disease or a neurodegenerative disorder in a subject in need thereof.

In still another embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate in the manufacture of a medicament for treating, preventing, or ameliorating symptoms of a neuropsychiatric disease or a neurodegenerative disorder in a subject in need thereof.

In another embodiment, there is provided herein a method for restoring serotonin levels; normalizing MnSOD mRNA levels; augmenting glutathione (GSH) levels in brain cells; augmenting whole brain GSH/glutathione disulfide (GSSG) ratios; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1 -related dysregulation of miR-128 expression; improving HMOX1 -related changes in brain dopamine, dopamine metabolites, serotonin, norephinephrine, and epinephrine; restoring deficient DOP AC/DA ratios; augmenting norepinephrine and dopamine concentrations in the prefrontal cortex; and/or correcting prefrontal cortex hypodopaminergia in a subject in need thereof, said method comprising: administering a composition comprising whey protein isolate and/or whey protein concentrate to the subject.

In yet another embodiment, there is provided herein a method for augmenting GSH reserves in the brain; normalizing brain MnSOD mRNA levels; restoration of redox homeostasis; normalization of brain dopamine, serotonin, norepinephrine, and/or epinephrine levels; normalization of brain DOP AC/DA ratios; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1 -related dysregulation of miR-128 expression; and/or ameliorating hyperlocomotion and/or stereotypic behaviour; or any combination thereof; in a subject in need thereof, said method comprising: administering a composition comprising whey protein isolate and/or whey protein concentrate to the subject.

In another embodiment of the above method or methods, the subject may be a subject suffering from, or may be at risk of developing, a neuropsychiatric or neurodegenerative disorder.

In yet another embodiment of the above method, the neuropsychiatric or neurodegenerative disorder may be schizophrenia or Alzheimer's disease (AD).

In still another embodiment of the above method or methods, the neuropsychiatric or neurodegenerative disorder may be a neurological disorder characterized by enhanced expression of heme oxygenase- 1 and/or increased oxidative stress in brain such as Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia, amyotrophic lateral sclerosis, other motor neuron disorders, Down's syndrome, Creutzfeldt- Jakob disease, other prion diseases, multiple sclerosis, cerebral ischemia, cerebral hemorrhage, traumatic brain injury, spinal cord injury, cerebral malaria, schizophrenia, bipolar disease with psychosis, or autism.

In yet another embodiment of the above method or methods, the composition comprising whey protein isolate and/or whey protein concentrate may be administered for restoring serotonin levels; normalizing MnSOD mRNA levels; augmenting glutathione (GSH) levels in brain cells; augmenting whole brain GSH/glutathione disulfide (GSSG) ratios; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1 -related dysregulation of miR-128 expression; improving HMOX1 -related changes in brain dopamine, dopamine metabolites, serotonin, norephinephrine, and epinephrine; restoring deficient DOP AC/DA ratios; augmenting norepinephrine and dopamine concentrations in the prefrontal cortex; and/or correcting prefrontal cortex hypodopaminergia in the subject.

In still another embodiment of the above method or methods, the composition comprising whey protein isolate and/or whey protein concentrate may be administered for augmenting GSH reserves in the brain; normalizing brain MnSOD mRNA levels; restoration of redox homeostasis; normalization of brain dopamine, serotonin, norepinephrine, and/or epinephrine levels; normalization of brain DOP AC/DA ratios; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1 -related dysregulation of miR-128 expression; and/or ameliorating hyperlocomotion and/or stereotypic behaviour; or any combination thereof; in the subject. In an embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate for restoring serotonin levels; normalizing MnSOD mRNA levels; augmenting glutathione (GSH) levels in brain cells; augmenting whole brain GSH/glutathione disulfide (GSSG) ratios; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOXl-related dysregulation of miR-128 expression; improving HMOX1 -related changes in brain dopamine, dopamine metabolites, serotonin, norepinephrine, and epinephrine; restoring deficient DOPAC/DA ratios; augmenting norepinephrine and dopamine concentrations in the prefrontal cortex; and/or correcting prefrontal cortex hypodopaminergia in a subject in need thereof. In still another embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate for augmenting GSH reserves in the brain; normalizing brain MnSOD mRNA levels; restoration of redox homeostasis; normalization of brain dopamine, serotonin, norepinephrine, and/or epinephrine levels; normalization of brain DOPAC/DA ratios; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1 -related dysregulation of miR-128 expression; and/or ameliorating hyperlocomotion and/or stereotypic behaviour; or any combination thereof; in a subject in need thereof.

In yet another embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate in the manufacture of a medicament for restoring serotonin levels; normalizing MnSOD mRNA levels; augmenting glutathione (GSH) levels in brain cells; augmenting whole brain GSH/glutathione disulfide (GSSG) ratios; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1 -related dysregulation of miR-128 expression; improving HMOX1 -related changes in brain dopamine, dopamine metabolites, serotonin, norephinephrine, and epinephrine; restoring deficient DOPAC/DA ratios; augmenting norepinephrine and dopamine concentrations in the prefrontal cortex; and/or correcting prefrontal cortex hypodopaminergia in a subject in need thereof.

In another embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate in the manufacture of a medicament for augmenting GSH reserves in the brain; normalizing brain MnSOD mRNA levels; restoration of redox homeostasis; normalization of brain dopamine, serotonin, norepinephrine, and/or epinephrine levels; normalization of brain DOPAC/DA ratios; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOXl -related dysregulation of miR-128 expression; and/or ameliorating hyperlocomotion and/or stereotypic behaviour; or any combination thereof; in a subject in need thereof. In another embodiment, there is provided herein a method for increasing GAD67 levels, such as but not limited to neuronal GAD67 levels, in a subject in need thereof, said method comprising: administering a composition comprising whey protein isolate and/or whey protein concentrate to the subject. In still another embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate for increasing GAD67 levels, such as but not limited to neuronal GAD67 levels, in a subject in need thereof.

In yet another embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate in the manufacture of a medicament for increasing GAD67 levels, such as but not limited to neuronal GAD67 levels, in a subject in need thereof.

In another embodiment of the above methods or uses, the RELN levels may be levels in the prefrontal cortex of the brain.

In still another embodiment of the above methods or uses, the subject may be a mammal, such as a human.

In another embodiment, there of provided herein a method for inducing or restoring RELN expression and/or signalling in the entorhinal cortex and/or hippocampus of a subject in need thereof, said method comprising: administering a composition comprising whey protein isolate and/or whey protein concentrate to the subject.

In yet another embodiment of the above method, the subject may have or may be at risk of developing schizophrenia or Alzheimer's Disease.

In still another embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate for inducing or restoring RELN expression and/or signalling in the entorhinal cortex and/or hippocampus of a subject in need thereof. In yet another embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate in the manufacture of a medicament for inducing or restoring RELN expression and/or signalling in the entorhinal cortex and/or hippocampus of a subject in need thereof In another embodiment of the above uses, the subject may have or may be at risk of developing schizophrenia or Alzheimer's Disease.

In another embodiment, there is provided herein a method for treating, preventing, or ameliorating symptoms of Alzheimer's Disease in a subject in need thereof, said method comprising: administering a composition comprising whey protein isolate and/or whey protein concentrate to the subject.

In another embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate for treating, preventing, or ameliorating symptoms of Alzheimer's Disease in a subject in need thereof. In still another embodiment, there is provided herein a use of a composition comprising whey protein isolate and/or whey protein concentrate in the manufacture of a medicament for treating, preventing, or ameliorating symptoms of Alzheimer's Disease in a subject in need thereof.

In another embodiment of the above methods or uses, the composition maybe for preserving or restoring cognitive function in the subject. In yet another embodiment of the above methods or uses, the composition may be administered in an amount sufficient to provide at least one of: an increase in RELN levels in the entorhinal cortex; an increase in RELN levels in the dentate gyrus; an increase in RELN levels in the CA1 region; an increase in RELN levels in the CA3 region; a correction in a deficit in cortical GSH levels; a restoration of GAD67 expression in the hippocampal-entorhinal cortex sub- region; a restoration of p-CREB levels in the hippocampal-entorhinal cortex sub-region; an increase in RELN levels in layer II of the entorhinal cortex; a prevention of loss of RELN positive neurons in the entorhinal cortex; or a restoration of GAD67 expression in the dentate gyrus and/or CA3 region of the hippocampus; or any combination thereof.

In still another embodiment of the above methods or uses, the subject may be a mammal, such as a human.

BRIEF DESCRIPTION OF DRAWINGS FIGURE 1 shows results of prepulse inhibition studies. (A.) Casein-treated (control) GFAP.HMOX1 transgenic (TG) and wild-type (WT) male (top panel) and female (bottom panel) mice. (B.) Immunocal-treated TG and WT male (top panel) and female (bottom panel) mice. (C.) Comparison of Immunocal- and casein-treated WT mice (top panel, males; bottom panel, females). (D.) Comparison of Immunocal- and casein-treated TG mice (top panel, male; bottom panel, female);

FIGURE 2 shows results of locomotor activity studies. (A.) Male; (B.) Female. Total distance (top panels); STRCNT-stereotypy count, STRNO-stereotypy number, and MOVNO-movement number (middle panels); RESTFME-rest time, STRTFME-stereotypy time, and MOVTFME- movement time (bottom panels). *P<0.05, **P<0.01, ***P<0.001, relative to WT controls;

FIGURE 3 shows results of whole brain glutathione concentration studies. (A.) Casein treatment (control); (B.) Immunocal treatment; (C.) Comparison of Immunocal- and casein-treated WT mice; (D.) Comparison of Immunocal- and casein-treated TG mice. Top panels, male and female mice; middle panels, males; bottom panels, females. *P<0.05, **P<0.01, ***P<0.001, relative to WT preparations;

FIGURE 4 shows results of sub-regional brain glutathione concentration studies. (A.) PFC, HC, and STM of casein-treated (control) group. (B.) PFC, HC, and STM of Immunocal -treated group. (C.) Comparison of Immunocal- and casein-treated WT mice. (D.) Comparison of Immunocal- and casein-treated TG mice. *P<0.05, **P<0.01, ***P<0.001, relative to WT preparations;

FIGURE 5 shows results of studies of glutathione levels in remaining brain tissue after removal of the PFC, HC, and STM. (A.) Casein-treated (control) group; (B.) Immunocal-treated group; (C.) Comparison of Immunocal- and casein-treated WT mice. (D.) Comparison of Immunocal- and casein-treated GFAP.HMOX1 mice.*P<0.05, **P<0.01, ***P<0.001, relative to WT preparations;

FIGURE 6 shows results of studies of content of brain DA and metabolites. (A.) DA and metabolites. (B.) Ratio of DA to DOPAC or HVA. Number of animals per group are indicated in the bars. *P<0.05, **P<0.01, relative to WT preparations.

FIGURE 7 shows results of studies of content of brain serotonin (5-HT), serotonin metabolite (5- HIAA), norepinephrine (NE) and epinephrine (E). (A.) Serotonin and metabolites; (B.) Norepinephrine and epinephrine. Number of animals per group are indicated in the bars. *P<0.05, relative to WT preparations;

FIGURE 8 shows results of studies of brain histomorphology. (A.) Six-micron thick coronal sections (bregma - 4.52 mm) stained with H & E. Note dilatation of lateral ventricles in the GFAP.HMOX1 preparations. (B.) Morphometries of hippocampus and dentate gyrus. *P<0.05, relative to WT preparations; FIGURE 9 shows results of studies of brain mRNA profiles. (A.) MnSOD. (B.) Neuronal reelin (RELN). (C.) GAD67. (D.) Nrxn 1. E. Nlgn 2. *P<0.05, **P<0.01, ***P<0.001, relative to WT preparations;

FIGURE 10 shows results of studies of brain miRNA profiles. (A.) mmu-miR-137-5p. (B.) mmu-miR-137-3p. (C.) mmu-miR-181a. (D.) mmu-miR-138. (E.) mmu-miR-128-l-5p. (F.) mmu-miR-128-3p. (G.) mmu-miR-200c. *P<0.05, **P<0.01, ***P<0.001, relative to WT preparations;

FIGURE 11 provides the sequences of certain nucleic acids and amino acids referred to herein;

FIGURE 12 shows distinct pathways of APP proteolytic processing. APP processing has two different pathways once it has been inserted into a lipid membrane. The non-amyloidogenic pathway utilizes a-secretase to produce soluble amyloid-beta precursor protein-alpha (sAPP _a ) and C-terminal fragment 83 (CTF83). γ-secretase then cleaves the CTF83 into a soluble p3 fragment and the amyloid precursor protein intracellular domain (AICD). The amyoidogenic pathway utilizes processing by β-secretase, which produces the soluble amyloid-beta precursor protein-beta (βΑΡΡ ) and C-terminal fragment 99 or 89 (CTF99/89), depending on tissue type, γ- secretase then cleaves CTF99/89 into Αβ ₄ ο or Αβ ₄₂ , which become extracellular, and the AICD. Figure adapted from Miiller et al. (2008);

FIGURE 13 shows the canonical Reelin signaling pathway. Reelin binds to one of two cell surface receptors, VLDLR or Apoer2, and induces tyrosine phosphorylation of the adapter protein, Dabl, via Src family kinase (SFK) activity. Phosphorylated Dabl acts as a docking site to initiate multiple downstream signaling cascades. Figure adapted from Wasser and Herz (2017);

FIGURE 14 shows results of studies in which Immunocal® treatment increased Reelin expression in vitro in hippocampal-entorhinal cortex slices. A) Brain slices were incubated for 24h in either control medium alone (Con) or containing recombinant Reelin (recRln). Following incubation, slices were lysed and DABl was immunoprecipitated (IP). The immune complexes were resolved by SDS-PAGE and immunoblotted (IB) for phosphotyrosine (PY) followed by stripping and reprobing for DABl . B) Brain slices were incubated for 24h in either Con medium or containing Immunocal® (ICAL). Protein lysates were IB for Reelin;

FIGURE 15 shows results of studies in which Immunocal® treatment increased Reelin mRNA expression in vitro in hippocampal-entorhinal cortex slices. Brain slices were incubated for 24h in either control medium (Con), medium containing Immunocal® (ICAL), recombinant Reelin protein (Rln), or a combination of the two. Total RNA was extracted from the slices, cDNA was prepared and subjected to qPCR using primers and probes for rat Reelin and GAPDH (as a control housekeeping gene). Data are expressed as the AACt levels of the Reelin transcript normalized to GAPDH. **p<0.01 compared to Con; #p<0.05 versus Rln alone (n=5 independent rat brain slice preparations); FIGURE 16 shows results of studies in which Immunocal® treatment increased Reelin expression in vitro in hippocampal-entorhinal cortex slices. Brain slices were incubated for 24h in either control medium alone (Con) or containing Immunocal® (ICAL). Following treatment, free floating slices were stained for Reelin (shown in green) and NeuN (shown in red). Images shown represent specific brain regions including entorhinal cortex (A), dentate gyrus (B), and CA1 region of hippocampus (C). z-stacked images were captured on a laser scanning confocal microscope using identical laser intensities and exposure times for each tissue slice;

FIGURE 17 depicts Barnes maze apparatus employed for cognitive testing. During the acquisition phase of testing, the mouse is placed in one of the four quadrants as indicated, and allowed 90 seconds to explore the maze and find the escape pod, as indicated by the line and filled arrows. During the probe phase, the mouse is placed in the center of the maze and the time it takes for the mouse to find the escape pod or the hole to either side of the escape pod is recorded;

FIGURE 18 shows cyto-architecture of the hippocampal-entorhinal cortex region of mouse brain. A control (non-carrier) mouse brain was co-stained for Reelin (shown in green), NeuN (shown in red), and Draq (a nuclear marker, shown in blue). The cartoon at top left shows the cyto-architecture of this region schematically;

FIGURE 19 shows results of studies in which Immunocal® treatment preserved brain GSH in

J20 AD model mice. Brain (cortical) tissue was harvested from 5 month-old hemizygous J20 AD mice (either untreated (Unt) or treated with Immunocal® (ICAL) for 2 months) and non-carrier control mice. Tissue was extracted and reduced GSH was measured by HPLC with electrochemical detection. Values are normalized to protein content and represent the mean±SEM for n=3 mice per group. Statistical differences were calculated by one-way ANOVA with a post hoc Tukey's test. * significantly different than non-carrier at p<0.05. ##significantly different than Hemi (Unt) at p<0.01;

FIGURE 20 shows results of studies in which Immunocal® treatment rescued Reelin expression and increased GAD67 expression in J20 AD model mice. Brain tissue was harvested from 5 month-old hemizygous J20 AD mice (either untreated (Unt) or treated with Immunocal® (ICAL) for 2 months) and non-carrier control mice. Tissue was micro-dissected to enrich for the hippocampal-entorhinal cortex sub-region. Brain lysates were resolved by SDS-PAGE and immunoblotted for (A) Reelin (Rln) and (B) GAD67. The Reelin blot was stripped and reprobed for OPAL The graph shows the densitometric analysis of the 180 kDa Reelin bands in arbitrary units (n=3 mice per group). Statistical differences were calculated by one-way ANOVA with a post hoc Tukey' s test;

FIGURE 21 shows results of studies in which Immunocal® treatment preserved brain p-CREB in J20 AD model mice. Brain tissue was harvested from 5 month-old hemizygous J20 AD mice (either untreated (Unt) or treated with Immunocal® (ICAL) for 2 months) and non-carrier control mice. Tissue was micro-dissected to enrich for the hippocampal-entorhinal cortex sub- region. Brain lysates were resolved by SDS-PAGE and immunoblotted for CREB phosphorylated on Serl33 (p-CREB). Brain lysates from two mice per treatment group are shown;

FIGURE 22 shows results of studies in which Immunocal® treatment rescued Reelin expression in entorhinal cortex layer II of J20 AD model mice. Brain tissue was harvested from 5 month-old hemizygous (Hemi) J20 AD mice (either untreated (Unt) or treated with Immunocal® (ICAL) for 2 months) and non-carrier control mice. Formalin-fixed sections were co-stained with antibodies to Reelin (Rln, shown in green) and NeuN (shown in red), along with Draq (nuclear stain, shown in blue). The demarcated areas in the middle panels encompass an approximation of layer II of entorhinal cortex and are represented in the lower panels. The mean fluorescence intensity (per pixel area) of Reelin staining in this region was calculated using Adobe Photoshop. The untreated hemizygous J20 AD mouse showed an approximately 30% reduction in Reelin staining in layer II of entorhinal cortex compared to the non-carrier control. This deficit was prevented by treatment with Immunocal®. Similar results were observed in four independent sets of mice consisting of a non-carrier control, hemizygous untreated and hemizygous Immunocal®- treated;

FIGURE 23 shows results of studies in which Immunocal® treatment increased Reelin expression in dentate gyrus of J20 AD model mice. Brain tissue was harvested from 5 month-old hemizygous (Hemi) J20 AD mice (either untreated (Unt) or treated with Immunocal® (ICAL) for 2 months) and non-carrier control mice. Formalin-fixed sections were co-stained with antibodies to Reelin (Rln, shown in green) and NeuN (shown in red), along with Draq (nuclear stain, shown in blue);

FIGURE 24 shows results of studies in which Immunocal® treatment rescued Reelin expression in hippocampus CA1 of J20 AD model mice. Brain tissue was harvested from 5 month-old hemizygous (Hemi) J20 AD mice (either untreated (Unt) or treated with Immunocal® (ICAL) for 2 months) and non-carrier control mice. Formalin-fixed sections were co-stained with antibodies to Reelin (Rln, shown in green) and NeuN (shown in red), along with Draq (nuclear stain, shown in blue);

FIGURE 25 shows results of studies in which Immunocal® treatment preserved Reelin expression in hippocampus CA3 of J20 AD model mice. Brain tissue was harvested from 5 month-old hemizygous (Hemi) J20 AD mice (either untreated (Unt) or treated with Immunocal® (ICAL) for 2 months) and non-carrier control mice. Formalin-fixed sections were co-stained with antibodies to Reelin (Rln, shown in green) and NeuN (shown in red), along with Draq (nuclear stain, shown in blue); FIGURE 26 shows results of studies in which Immunocal® treatment increased GAD67 expression in dentate gyrus of J20 AD model mice. Brain tissue was harvested from 5 month-old hemizygous (Hemi) J20 AD mice (either untreated (Unt) or treated with Immunocal® (ICAL) for 2 months) and non-carrier control mice. Formalin-fixed sections were co-stained with antibodies to GAD67 (shown in green) and NeuN (shown in red), along with Draq (nuclear stain, shown in blue);

FIGURE 27 shows results of studies in which Immunocal® treatment preserved GAD67 expression in hippocampus CA3 of J20 AD model mice. Brain tissue was harvested from 5 month-old hemizygous (Hemi) J20 AD mice (either untreated (Unt) or treated with Immunocal® (ICAL) for 2 months) and non-carrier control mice. Formalin-fixed sections were co-stained with antibodies to GAD67 (shown in green) and NeuN (shown in red), along with Draq (nuclear stain, shown in blue);

FIGURE 28 shows results of studies in which Immunocal® treatment enhanced co-staining of Reelin and phospho-DABl in hippocampus CA1 of J20 AD model mice. Brain tissue was harvested from 5 month-old hemizygous (Hemi) J20 AD mice (either untreated (Unt) or treated with Immunocal® (ICAL) for 2 months) and non-carrier control mice. Formalin-fixed sections were co-stained with antibodies to Reelin (shown in green) and phospho-DABl (pTyr232; shown in red), along with Draq (nuclear stain, shown in blue); and FIGURE 29 shows results of studies in which Immunocal® treatment improved cognitive performance in the Barnes maze in J20 AD model mice. Following two months of Immunocal® treatment from 3 months-old to 5 months-old, hemizygous, female J20 AD mice were subjected to the Barnes maze to test spatial learning and memory. A) The delay in seconds for mice to find the escape pod during days 5 and 6 of the acquisition phase (combined) is shown. ##significantly different than hemizygous untreated (Hemi Unt) at p<0.01. B) The delay in seconds for mice to find the escape pod during the probe phase (day 7) is shown. * significantly different than non- carrier control at p<0.05. #significantly different than Hemi Unt at p<0.05. ICAL=Immunocal® treated, NC=non-carrier. All statistical comparisons were made by one-way ANOVA with a post-hoc Tukey's test (n=4 mice per group).

DETAILED DESCRIPTION

Described herein are methods for increasing reelin (RELN) levels and/or in restoring other imbalances or abnormalities of gene expression in a subject in need thereof, as well as compositions for use in such methods. Methods and compositions provided herein may be used in the treatment of neuropsychiatric or neurodegenerative disorders, such as schizophrenia and Alzheimer's disease, for example. Compositions described herein may comprise whey protein isolate and/or whey protein concentrate, which is a source of the glutathione precursor cysteine. The provided methods and compositions are not limited to increasing or restoring RELN levels, and may alternatively or additionally be used to correct a number of other neurological dysregulations or abnormalities occurring in a subject in need thereof as described in detail herein. It will be appreciated that embodiments and examples are provided herein for illustrative purposes intended for those skilled in the art, and are not meant to be limiting in any way. One or more illustrative embodiments have been described by way of example. It will be understood to persons skilled in the art that a number of variations and modifications can be made without departing from the scope of the invention as defined in the claims. In an embodiment, there is provided herein a method for increasing or restoring reelin (RELN) levels in the brain of a subject in need thereof, said method comprising: administering a composition comprising whey protein isolate and/or whey protein concentrate to the subject.

As will be understood, in certain embodiments, a subject in need thereof may include any subject for which increasing or restoring reelin (RELN) levels (and/or other gene expression imbalances or abnormalities as described in further detail hereinbelow) in the brain may be beneficial or desirable. By way of example, in certain embodiments, the subject may include a subject exhibiting at least one symptom or characteristic of a disease or disorder associated with low RELN levels. In certain embodiments, the subject may be a subject exhibiting at least one symptom or characteristic of a neuropsychiatric or neurodegenerative disorder such as schizophrenia or Alzheimer's disease, for example. By way of example, in certain embodiments, a subject in need of treatment may be determined as simply a subject exhibiting one or more symptoms of a disease or disorder for which the compositions described herein may prevent, ameliorate, reduce, or treat as further described hereinbelow.

As will be understood, an increase in RELN levels may refer to any increase in RELN gene expression in brain cells of the subject in need thereof. In certain embodiments, the RELN levels may be, for example, neuronal RELN levels, although RELN levels in other brain cells is also contemplated. In certain embodiments, the increase in RELN levels may be sufficient to restore RELN levels to, near, or above those of a healthy control subject or group. Gene expression may refer to the production of a polypeptide from the nucleic acid sequence of a gene. As well, gene expression may include both transcription and translation processes, and so an increase in RELN levels may refer to any increase in the production of a nucleic acid sequence such as a RELN mRNA (i.e. transcription), production of a RELN protein (i.e. translation), or both. In certain embodiments, RELN expression may include expression of full-length RELN protein (388kDa), RELN cleavage product(s) (including, for example, 310kDa and/or 180kDa cleavage products), or any combination thereof. Increases in gene expression may be determined with reference to wild-type, healthy, baseline, or untreated levels, or levels measured at a previous time point, for example, as would be understood by a person of skill in the art.

Without wishing to be bound by theory, it will be understood that effective gene expression levels of a particular gene may also be considered increased if the rate of protein turnover/degradation of the expression product of the gene can be slowed or prevented.

Regardless of the underlying mechanism, references herein to increasing levels of a particular gene may include any suitable increase in mRNA levels and/or protein levels and/or activity levels of the gene as compared to wild-type, healthy, baseline, or untreated levels, or levels measured at a previous time point, or with reference to another suitable comparator level selected by the skilled person to suit a particular application.

As will also be understood, in additional embodiments, increases in RELN levels may refer to increases in signalling pathway activation, either as a result of increased RELN gene expression, or as a result of other factors resulting in increased pathway activation. In certain embodiments, a RELN level increase may be accompanied by, signalled by, or phenotypically represented by increased mRNA expression levels of GAD67, a gene acting downstream of RELN. It will be understood that increases in neuronal RELN levels may occur generally throughout the brain of the subject, or may be limited to certain regions of the brain. In certain embodiments, RELN levels may be generally increased throughout the brain, or may be increased in particular brain regions such as the prefrontal cortex (PFC), the striatum (STM), the substantia nigra (SN), or the entorhinal cortex layer II, for example. In certain embodiments, a RELN level increase in a brain region may be accompanied by, signalled by, or phenotypically linked with increased mRNA expression levels of GAD67, a gene acting downstream of RELN. For example, GAD67 expression levels may be increased in the STM and/or the SN following treatment. In certain embodiments, neuronal RELN levels may be increased. Compositions comprising whey protein isolate and/or whey protein concentrate may comprise any suitable composition comprising whey protein isolate and/or whey protein concentrate which may serve as a glutathione precursor by providing an enriched source of bioavailable cysteine after administration. As will be understood, whey proteins may generally be considered as a group a milk proteins which remain soluble in "milk serum" or whey after precipitation of caseins at pH 4.6 and 20°C. Major whey proteins in cow's milk, for example, may include beta- lactoglobulin (PL), alpha-lactalbumin (aL), immunoglobulin, and serum albumin (SA). The product of industrial separation of this protein mixture from whey is typically referred to as whey protein isolate (WPI; also known as whey protein concentrate, WPC).

Compositions may, optionally, additionally comprise one or more pharmaceutically acceptable excipients, diluents, and/or carriers, one or more vitamins, essential amino acids, or minerals, one or more antioxidants, one or more additional glutathione precursors, and/or one or more nutritional diet supplement components, for example.

Compositions may also include, and/or be used in simultaneous or sequential combination with, one or more other drugs, pharmaceutical compositions, or therapies used in the treatment or management of neuropsychiatric diseases or neurodegenerative disorders known to the person of skill in the art, as will be selectable by the skilled person to suit the particular subject and/or application. By way of example, drugs used in the treatment of schizophrenia may include antipsychotics such as amisulpride, olanzapine, risperidone, and clozapine, and neuroleptics for controlling psychosis in schizophrenia. Drugs used in the treatment of Alzheimer's disease may include acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine, and donepezil, and/or MDA receptor antagonists such as memantine. Drugs used in the treatment of Parkinson's disease may include 1-dopa replacement therapy, for example.

A pharmaceutically acceptable carrier, diluent, or excipient may include any suitable carrier, diluent, or excipient known to the person of skill in the art. Examples of pharmaceutically acceptable excipients may include, but are not limited to, cellulose derivatives, sucrose, and starch. The person of skill in the art will recognize that pharmaceutically acceptable excipients may include suitable fillers, binders, lubricants, buffers, glidants, and disentegrants known in the art (see, for example, Remington: The Science and Practice of Pharmacy (2006); herein incorporated by reference in its entirety). Examples of pharmaceutically acceptable carriers, diluents, and excipients may be found in, for example, Remington's Pharmaceutical Sciences (2000 - 20th edition) and in the United States Pharmacopeia: The National Formulary (USP 24 NF19) published in 1999.

In certain embodiments, a whey protein isolate or a whey protein concentrate as described herein may include any suitable extract, isolate, concentrate, or other product which is obtainable from whey protein. As will be understood, whey protein comprises a mixture of milk proteins that remain soluble in milk serum or whey after precipitation of caseins, for example. Whey is often encountered as a by-product of cheese or casein manufacture. Major whey protein components may include, for example but without wishing to be limiting, beta-lactoglobulin, alpha- lactalbumin, immunoglobulin, and serum albumin. Although bovine milk is commonly used for obtaining whey protein, it will be understood that other sources of milk are also contemplated. Whey protein isolate (WPI) is generally considered in the field as having >90% protein, while whey protein concentrate (WPC) may have protein concentrations below 90%; however, for the present purposes, WPI and WPC may be considered as generally interchangeable unless otherwise explicitly specified.

In particular embodiments, a whey protein isolate or whey protein concentrate as described herein is preferably an undenatured whey protein isolate or whey protein concentrate.

Undenatured isolates and concentrates are those in which one or more of the protein component(s) obtainable from whey protein remain substantially undenatured (i.e. tertiary protein structure is substantially maintained and/or disulfide bonds between cysteine residues remain substantially intact) in the whey protein isolate or whey protein concentrate.

Whey proteins contain sulfur-containing amino acids such as cysteine (Cys). These Cys amino acid residues may occur as free residues (i.e. -SH; reduced), or two Cys residues may form intramolecular disulfide bonds (S-S; oxidized) so as to produce cystine dimers. Such disulfide bonds play a role in protein folding. In certain embodiments, undenatured whey protein isolates or whey protein concentrates as described herein may include those having at least about 2 wt% cystine dimer. Examples of undenatured whey protein isolates and whey protein concentrates may include those having about 2 wt% cystine dimer, or more than about 2 wt% cystine dimer. For example, the wt% of cystine dimer may be about 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, or 4.0 wt%, or the wt% cystine dimer may fall within a range spanning between any two such values, or a range bounded at the lower end by any such value.

Whey protein isolates and whey protein concentrates may be obtained using any suitable technique(s) as will be known to the person of skill in the art having regard to the teachings herein. Such techniques may include ultrafiltration using membranes, ion exchange methods, and membrane methods, for example. Discussions of suitable techniques may be found in, for example, Advanced Dairy Chemistry, McSweeney and Mahony (Ed.), Volume IB: Proteins: Applied Aspects, 4th Edition, Springer, ISBN: 978-1-4939-2799-9 (herein incorporated by reference in its entirety).

Examples of suitable compositions comprising whey protein isolate and/or whey protein concentrate are described in Canadian patent nos. 1,333,471, 1,338,682, 2,142,277, and

2,090,186, each of which is herein incorporated by reference in its entirety. CA 2, 142,277, for example, provides detailed preparation processes and analytical characterization of particularly preferred compositions comprising whey protein isolate, including the composition known as

Immunocal®. This exemplary whey protein isolate composition as described in CA 2, 142,277 may be characterized by having a solubility index of about 99.5% at pH 4.6; about 58% PL

(beta-lactoglobulin) protein composition, about 11% aL (alpha-lactalbumin) protein composition, about 10% serum albumin (i.e. BSA) protein composition, and about 22% immunoglobulin (i.e. Ig) protein composition. A process for preparing such a composition is also described in detail in CA 2,142,277. Immunocal® (Natural Product Number (NPN) 80004370 issued with Health Canada) is now a commercially available whey protein isolate composition available from Immunotec®. Further description of whey protein isolates and concentrates may be found in Example 2 below.

In an embodiment, compositions as described herein may be administered orally. For example, compositions as described herein may be reconstituted in, or may comprise, a liquid carrier (for example, water or juice), allowing for straightforward oral administration. The person of skill in the art having regard to the teachings herein will be able to select a suitable administration to suit a particular subj ect and/or particular therapeutic application.

In certain non-limiting embodiments, it is contemplated that compositions as described herein may be administered orally in an amount suitable for achieving a desired effect. In certain non- limiting embodiments, compositions as described herein may be administered orally in a dosage of about 20-40 grams per day, for example, and may be administered once or more than once daily, for example.

Compositions as described herein may, in certain embodiments, be used in combination with a nucleic acid or expression vector which can cause overexpression of RELN or a functional RELN mimic, or may be used in combination with RELN protein or a functional RELN protein mimic, in order to increase effective RELN levels in the subject. The nucleic acid and amino acid sequences of human RELN are provided in Figure 11 as SEQ ID NOs. 1 and 2, respectively. Murine RELN sequences are also shown in Figure 11, and homologs in other species are available from the national center for biotechnology information (NCBI).

In a further embodiment of the methods described above, the methods may further comprise an additional step of: measuring an initial RELN level of the subject and comparing the measured initial RELN level to a healthy RELN level, wherein the subject is identified as having a reduced RELN level in need of increase when the measured RELN level is less than the healthy RELN level.

As will be understood, a healthy RELN level may be a RELN level as determined in a wild type, control, or healthy subject or a group of healthy subjects, or as determined from the subject at a previous time point where the subject was healthy, for example. The healthy level may be a specific or approximate threshold level, or may be a range spanning between upper and lower thresholds.

It will be understood that such a step of measuring may be performed either before or after administration of the composition comprising the whey protein isolate and/or whey protein concentrate, or both. Where the step of measuring is performed before the administration, the measuring step may be considered as a screening step, allowing for the identification of subjects in need of the treatment, of subjects who may particularly benefit from the treatment, and/or of subjects belonging to a patient subpopulation which may be particularly susceptible to the treatment. Where the step of measuring is performed after the administration, the measuring step may be considered as a step of determining treatment efficacy, allowing for the identification of subjects in need of a subsequent, repeated, or adjusted treatment, of subjects who may particularly benefit from a repeated treatment, and/or of subjects belonging to a patient subpopulation which may be particularly susceptible to the treatment.

As will be recognized, the RELN level of the subject may be measured using any suitable method capable of identifying a reduced neuronal RELN level. RELN levels generally representative of whole-brain RELN levels may be determined, or RELN levels in particular brain regions may be determined. In certain embodiments, neuronal RELN levels may be determined. Methods for measuring RELN levels may include those quantitating RELN mRNA levels, RELN protein levels, or both, in the brain or in relevant brain region(s). Methods may involve PCR, ELISA, mass spectrometry, and/or neuroimaging methods, among others. While direct monitoring of Reelin levels in brain parenchyma of living humans may be challenging, indirect monitoring may be possible by analyzing cerebrospinal fluid (CSF), which may be used to correlate with brain tissue concentrations by, for example, immunoassay and/or mass spectrometry. In certain embodiments, neuronal RELN levels of the subject may be determined through analysis of a sample obtained from the subject, such as a biopsy sample, or a fluid sample such as a blood sample or cerebrospinal fluid sample. In certain embodiments, it is contemplated herein that neuronal RELN levels of the subject may be measured by determining RELN levels in neuronal exosomes circulating in bodily fluids such as blood. As will be understood, neuronal exosomes carry particular cell surface markers allowing their isolation, at which point RELN levels may be quantitated using techniques such as ELISA or others.

In certain embodiments, it is contemplated that reelin expression levels may be ascertained or estimated by determining reelin expression levels in neural -derived exosomes isolated from human plasma, for example. Such plasma exosomes may be enriched in neural sources by, for example, anti-human L1CAM antibody immunoabsorption. By way of example, reelin and other extracted exosomal proteins may be quantified by ELISA and normalized with the exosomal marker, CD 81 (Goetzl et al., Neurology, 85:40-47, 2015; herein incorporated by reference in its entirety). In certain embodiments of the above methods, the subject in need of treatment may be any subject having a reduced RELN level which is below that of a healthy subject or healthy control group. The reduced RELN level may occur generally throughout the brain tissue of the subject, or may be localized to particular regions such as the prefrontal cortex, the striatum, the substantia nigra, and/or the entorhinal cortex layer II, for example. The RELN level may be, for example, a neuronal RELN level. In certain further embodiments, the subject in need of treatment may be a subject suffering from, or at risk of developing, a neuropsychiatric or neurodegenerative disorder. The neuropsychiatric or neurodegenerative disorder may be, for example, schizophrenia, Alzheimer's disease, bipolar disease with psychosis, Parkinson's disease (PD), or another such disease or condition. In certain embodiments, a neuropsychiatic or neurodegenerative disorder may include neurological disorders characterized by enhanced expression of heme oxygenase-1 and/or increased oxidative stress in brain. Such diseases may include, but are not limited to,

Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia, amyotrophic lateral sclerosis, other motor neuron disorders, Down's syndrome, Creutzfeldt- Jakob disease, other prion diseases, multiple sclerosis, cerebral ischemia, cerebral hemorrhage, traumatic brain injury, spinal cord injury, cerebral malaria, schizophrenia, bipolar disease with psychosis, and/or autism.

In still another embodiment, there is provided herein a method for treating, preventing, or ameliorating/reducing the symptoms of, a neuropsychiatric disease or a neurodegenerative disorder in a subject in need thereof, said method comprising: administering a composition comprising whey protein isolate and/or whey protein concentrate to the subject.

As will be understood, the composition comprising whey protein isolate and/or whey protein concentrate, which has already been described in detail hereinabove, may be administered to increase reelin (RELN) levels, for example neuronal RELN levels, in the subject, or to restore RELN levels in the subject to or above a healthy level, or to within a healthy range as determined by measuring RELN levels in a healthy subject, or in a group of healthy subjects, for example.

In a further embodiment, the method may further comprise a step of: measuring an initial RELN level of the subject and comparing the measured RELN level to a healthy RELN level, wherein the subject is identified as having a reduced RELN level in need of increase when the measured initial RELN level is less than the healthy RELN level.

It will be understood that such a step of measuring may be performed either before or after administration of the composition comprising the whey protein isolate and/or whey protein concentrate, or both. Where the step of measuring is performed before the administration, the measuring step may be considered as a screening step, allowing for the identification of subjects in need of the treatment, of subjects who may particularly benefit from the treatment, and/or of subjects belonging to a patient subpopulation which may be particularly susceptible to the treatment. Where the step of measuring is performed after the administration, the measuring step may be considered as a step of determining treatment efficacy, allowing for the identification of subjects in need of a subsequent, repeated, or adjusted treatment, of subjects who may particularly benefit from a repeated treatment, and/or of subjects belonging to a patient subpopulation which may be particularly susceptible to the treatment. Examples of methods for measuring neuronal RELN levels have already been described hereinabove. As will be understood, neuropsychiatry and neurodegenerative disorders may be characterized by multiple imbalances or abnormalities in gene expression. Without wishing to be bound by theory or considered limiting in any manner, the results presented herein suggest that treatment with a composition comprising whey protein isolate may not only increase or restore RELN levels, but may also, or alternatively, be used to at least partially alleviate or otherwise restore several imbalances or abnormalities in gene expression which are believed to be involved in certain neuropsychiatnc and neurodegenerative disorders. As such, in certain alternative, or additional embodiments, the compositions comprising whey protein isolate as described herein may be administered for restoring serotonin levels; normalizing MnSOD mRNA levels; restoring GAD67 levels; augmenting GSH reserves in the brain; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1 -related disregulation of miR-128 expression; improving HMOX1 -related changes in brain dopamine, dopamine metabolites, serotonin, norepinephrine, and epinephrine; restoring deficient DOPAC/DA ratios; augmenting norepinephrine and dopamine concentrations in the prefrontal cortex; and/or correcting prefrontal cortex hypodopaminergia in the subject. As well, in certain further alternative or additional embodiments, the compositions comprising whey protein isolate as described herein may be administered for augmenting GSH reserves in the brain; normalizing brain MnSOD mRNA levels; restoration of redox homeostasis; normalization of brain dopamine, serotonin, norepinephrine, and/or epinephrine levels; normalization of brain DOPAC/DA ratios; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1- related dysregulation of miR-128 expression; and/or ameliorating hyperlocomotion and/or stereotypic behaviour; or any combination thereof; in the subject.

As will be understood, the neuropsychiatric disease or neurodegenerative disorder may be, for example, schizophrenia or Alzheimer's disease, wherein one or more of these imbalances or abnormalities in gene expression may be occurring. In certain embodiments, it is contemplated that a neuropsychiatic or neurodegenerative disorder may include neurological disorders characterized by enhanced expression of heme oxygenase-1 and/or increased oxidative stress in brain. Such diseases may include, but are not limited to, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia, amyotrophic lateral sclerosis, other motor neuron disorders, Down's syndrome, Creutzfeldt- Jakob disease, other prion diseases, multiple sclerosis, cerebral ischemia, cerebral hemorrhage, traumatic brain injury, spinal cord injury, cerebral malaria, schizophrenia, bipolar disease with psychosis, and/or autism.

In certain embodiments, compositions comprising whey protein isolate and/or whey protein concentrate as described herein may be used for increasing reelin (RELN) levels (such as, for example, neuronal RELN levels) in a subject in need thereof, or may be used in the manufacture of a medicament for increasing reelin (RELN) levels in a subject in need thereof, for example. Alternatively, or in addition, such compositions may be used for treating, preventing, or ameliorating the symptoms of, a neuropsychiatric disease or a neurodegenerative disorder, or may be used in the manufacture of a medicament for treating, preventing, or ameliorating the symptoms of a neuropsychiatric disease or a neurodegenerative disorder, in a subject in need thereof, for example.

In still other embodiments, compositions comprising whey protein isolate and/or whey protein concentrate as described herein may be for use in restoring serotonin levels; augmenting GSH reserves in the brain; normalizing MnSOD mRNA levels; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1 -related dysregulation of miR-128 expression; improving HMOX1 -related changes in brain dopamine, dopamine metabolites, serotonin, norephinephrine, and epinephrine; restoring deficient DOP AC/DA ratios; augmenting norepinephrine and dopamine concentrations in the prefrontal cortex; and/or correcting prefrontal cortex hypodopaminergia in a subject in need thereof, or in the manufacture of a medicament for achieving such a result.

In still other embodiments, compositions comprising whey protein isolate and/or whey protein concentrate as described herein may be for use in augmenting GSH reserves in the brain; normalizing brain MnSOD mRNA levels; restoration of redox homeostasis; normalization of brain dopamine, serotonin, norepinephrine, and/or epinephrine levels; normalization of brain DOP AC/DA ratios; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1 -related dysregulation of miR-128 expression; and/or ameliorating hyperlocomotion and/or stereotypic behaviour; or any combination thereof; in a subject in need thereof, or in the manufacture of a medicament for achieving such a result. It will be understood that compositions as described herein may be administered as part of a treatment regimen including other drugs, pharmaceutical compositions, or therapies used in the treatment of neuropsychiatric diseases or neurodegenerative disorders. Compositions as described herein may be for administration simultaneously, sequentially, in combination with, or separately from such other drugs, pharmaceutical compositions, or therapies. Compositions as described herein may be for use in treating a neuropsychiatric or neurodegenerative disease or disorder, or may be for use as part of a preventative strategy for preventing or delaying onset of a neuropsychiatric or neurodegenerative disease or disorder such as schizophrenia or Alzheimer's disease, or both.

In certain embodiments, compositions as described herein may be for use in treating neurological disorders characterized by enhanced expression of heme oxygenase-1 and/or increased oxidative stress in brain. Such diseases may include, but are not limited to, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia, amyotrophic lateral sclerosis, other motor neuron disorders, Down's syndrome, Creutzfeldt- Jakob disease, other prion diseases, multiple sclerosis, cerebral ischemia, cerebral hemorrhage, traumatic brain injury, spinal cord injury, cerebral malaria, schizophrenia, bipolar disease with psychosis, and/or autism.

In still another embodiment, there is provided herein a method for restoring serotonin levels; normalizing MnSOD mRNA levels; augmenting GSH reserves in the brain; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1 -related dysregulation of miR-128 expression; improving HMOX1 -related changes in brain dopamine, dopamine metabolites, serotonin, norephinephrine, and epinephrine; restoring deficient DOP AC/DA ratios; augmenting norepinephrine and dopamine concentrations in the prefrontal cortex; and/or correcting prefrontal cortex hypodopaminergia in a subject in need thereof, said method comprising: administering a composition comprising whey protein isolate and/or whey protein concentrate to the subject.

In certain embodiments of the above method, the subject may be a subject suffering from, or at risk of developing, a neuropsychiatric or neurodegenerative disorder such as, for example, schizophrenia or Alzheimer's disease.

In certain embodiments of the above method, the subject may be suffering from, or at risk of developing, a neurological disorder characterized by enhanced expression of heme oxygenase-1 and/or increased oxidative stress in brain. Such diseases may include, but are not limited to, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia, amyotrophic lateral sclerosis, other motor neuron disorders, Down's syndrome, Creutzfeldt- Jakob disease, other prion diseases, multiple sclerosis, cerebral ischemia, cerebral hemorrhage, traumatic brain injury, spinal cord injury, cerebral malaria, schizophrenia, bipolar disease with psychosis, and/or autism. In yet another embodiment, there is provided herein a method for augmenting GSH reserves in the brain; normalizing brain MnSOD mRNA levels; restoration of redox homeostasis; normalization of brain dopamine, serotonin, norepinephrine, and/or epinephrine levels; normalization of brain DOP AC/DA ratios; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1 -related dysregulation of miR-128 expression; and/or ameliorating hyperlocomotion and/or stereotypic behaviour; or any combination thereof; in a subject in need thereof, said method comprising: administering a composition comprising whey protein isolate and/or whey protein concentrate to the subject.

In certain embodiments of the above method, the subject may be a subject suffering from, or at risk of developing, a neuropsychiatric or neurodegenerative disorder such as, for example, schizophrenia or Alzheimer's disease. In certain embodiments of the above method, the subject may be suffering from, or at risk of developing, a neurological disorder characterized by enhanced expression of heme oxygenase-1 and/or increased oxidative stress in brain. Such diseases may include, but are not limited to, Alzheimer's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia, amyotrophic lateral sclerosis, other motor neuron disorders, Down's syndrome, Creutzfeldt- Jakob disease, other prion diseases, multiple sclerosis, cerebral ischemia, cerebral hemorrhage, traumatic brain injury, spinal cord injury, cerebral malaria, schizophrenia, bipolar disease with psychosis, and/or autism.

As will be understood, compositions comprising whey protein isolate and/or whey protein concentrate as described herein may serve as a glutathione precursor by providing an enriched source of bioavailable cysteine following administration. Several neuropsychiatric and neurodegenerative disorders have been linked to oxidative stress and/or glutathione (GSH) deficits in brain tissue. As discussed in detail herein, treatment with a composition comprising whey protein isolate has been observed to restore GSH homeostasis in the CNS of a mouse disease model, and to augment GSH reserves in the brains of wild-type animals. These results demonstrate that compositions as described herein may be used to augment GSH stores and antioxidant defenses in the healthy and diseased brain.

As such, in certain embodiments, there is provided herein a method for augmenting glutathione (GSH) levels in brain cells, or augmenting whole brain GSH/glutathione disulfide (GSSG) ratios, of a subject in need thereof, said method comprising: administering a composition comprising whey protein isolate and/or whey protein concentrate to the subject.

As will be understood, in certain embodiments, such augmentation of glutathione (GSH) levels, or GSH/GSSG ratios, in the subject may accompany an increase or restoration of RELN levels or other imbalances or abnormalities in gene expression achieved using any of the other methods as described hereinabove. In additional embodiments, compositions as described herein may be used simultaneously, or sequentially, with other glutathione precursor compounds or compositions. In still another embodiment, there is provided herein a kit comprising a composition comprising whey protein isolate and/or whey protein concentrate as described hereinabove, and one or more of a pharmaceutically acceptable excipient, diluent, carrier, vitamin, essential amino acid, mineral, antioxidant, glutathione precursor, nutritional diet supplement component, or drug, pharmaceutical composition, or therapy used in the treatment of a neuropsychiatric disease or neurodegenerative disorder.

Such kits may additionally, or alternatively, comprise instructions for use of the kit in the treatment of a neuropsychiatric disease or neurodegenerative disorder, or for use of the kit in increasing or restoring RELN levels (for example, but not limited to, neuronal RELN levels); augmenting GSH reserves in the brain; restoring serotonin levels; normalizing MnSOD mRNA levels; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1 -related dysregulation of miR-128 expression; improving HMOX1 -related changes in brain dopamine, dopamine metabolites, serotonin, norepinephrine, and epinephrine; restoring deficient DOP AC/DA ratios; augmenting noepinrephrine and dopamine concentrations in the prefrontal cortex; and/or correcting prefrontal cortex hypodopaminergia in a subject in need thereof.

In further embodiments, such kits may additionally, or alternatively, comprise instructions for use of the kit in the treatment of a neuropsychiatric disease or neurodegenerative disorder, or for use of the kit in augmenting GSH reserves in the brain; normalizing brain MnSOD mRNA levels; restoration of redox homeostasis; normalization of brain dopamine, serotonin, norepinephrine, and/or epinephrine levels; normalization of brain DOP AC/DA ratios; restoring GAD67 levels; reversing reduction of Nrxnl; reversing reduction of Nlgn2; preventing HMOX1- related dysregulation of miR-128 expression; and/or ameliorating hyperlocomotion and/or stereotypic behaviour; or any combination thereof; in a subject in need thereof In yet another embodiment, there is provided herein a method for measuring reelin (RELN) levels in a subject, said method comprising: isolating or enriching a neuronal exosome sample from a bodily fluid sample obtained from the subject using one or more neuronal exosome-specific cell surface markers; and measuring a RELN level of the neuronal exosome sample.

In an embodiment of the method above, the bodily fluid sample may be a cerebrospinal fluid (CSF) sample, whole blood sample, plasma sample, or another processed or unprocessed blood sample obtained from the subject. In still another embodiment, the step of isolating or enriching may involve a pull-down type assay targeting the one more neuronal exosome-specific cell surface markers, or another suitable isolating method. In still another embodiment, the RELN level may be measured by quantitating RELN mRNA levels, protein levels, or both, and may be determined using a suitable PCR assay, immunoassay such as ELISA, mass spectrometry, or another suitable assay for quantitating RELN. As will be understood, neuronal exosomes carry particular cell surface markers allowing their isolation. Neuronal exosomes may be isolated/enriched by, for example, anti-human LICAM antibody immunoabsorption techniques. By way of example, reelin and other extracted exosomal proteins may be quantified by ELISA and normalized with the exosomal marker, CD81 (Goetzl et al., Neurology, 85:40-47, 2015; herein incorporated by reference in its entirety).

EXAMPLE 1 - Amelioration of Deficits in GFAP.HMOX1 Mouse Model of Schizophrenia

The following example describes experimental results obtained from treating wild type mice, and a mouse model of schizophrenia, with Immunocal®, a composition comprising whey protein isolate. Under the experimental conditions used, a number of beneficial effects were observed in the animals, indicating the potential such compositions may possess in the treatment of neuropsychiatric or neurodegenerative disorders and/or in restoring neuronal imbalances or gene expression abnormalities.

Schizophrenia is a neuropsychiatric disorder that features neural oxidative stress and glutathione (GSH) deficits. Oxidative stress is augmented in brain tissue of GFAP.HMOX1 transgenic mice which exhibit schizophrenia-relevant characteristics. The whey protein isolate, Immunocal®, serves as a GSH precursor upon oral administration. In this Example, GFAP.HMOX1 transgenic mice were treated daily with Immunocal between the ages of 5 and 6.5 months. Immunocal attenuated many of the behavioral, neurochemical and redox abnormalities observed in GFAP. HMOXl mice. In addition to restoring GSH homeostasis in the CNS of the transgenic mice, the whey protein augmented GSH reserves in the brains of wild-type animals. These results demonstrate that whey protein consumption augments GSH stores and antioxidant defenses in the healthy and diseased mammalian brain. Furthermore, administration of Immunocal was found to increase reelin (RELN) levels in the animal models tested, a particularly interesting experimental finding. Results obtained indicate that whey protein supplementation may constitute a safe and effective modality for the management of schizophrenia and other neuropsychiatric and neurodegenerative disorders. The HMOXl gene coding for the 32 kDa stress protein, heme oxygenase-1 (HO-1) is exquisitely sensitive to induction by stressors implicated in the development of SCZ ⁹ . We previously demonstrated that the accumulation of heme-derived ferrous iron and carbon monoxide accruing from transfection of HMOXl in cultured rat astrocytes promotes mitochondrial damage and predisposes co-cultured neuronal elements to oxidative injury. Our laboratory recently engineered a conditional GFAP.HMOX1 transgenic mouse that selectively over-expresses human HO-1 in the astrocytic compartment under temporal control by the Tet-Off system. After 48 weeks of continuous HMOXl induction, these mice exhibit a set of robust behavioural (some sex-specific), neurochemical, neuropathological and developmental features reminiscent of human SCZ and animal models of the disease. Specific abnormalities documented in the GFAP. HMOXl mice germane to SCZ include hyperlocomotion, behavioral stereotypy and impaired prepulse inhibition to acoustic startle; increased basal ganglia dopamine (DA) and serotonin concentrations; suppressed neuronal reelin immunoreactivity; dysgenesis of the hippocampal dentate gyrus ⁹ ; and ventriculomegaly (unpublished results). As in the HMOXl - transfected glial cultures (vide supra), pathological deposition of redox-active iron, oxidative mitochondrial damage and mitophagy are clearly demonstrable in the brains of GFAP.HMOX1 mice ⁹ ' ¹⁰ . Depletion of the intracellular antioxidant tripeptide, glutathione (GSH) and oxidative stress have been documented in SCZ-affected human neural tissues ^11"13 . Moreover, administration of glutathione precursors has been shown to improve symptomatology in animal models of SCZ and in patients with the disease ¹⁴ . The delivery of the amino acids, cysteine and cystine is believed to be the rate-limiting factor for the synthesis of intracellular glutathione in brain and other tissues. Immunocal® is an un- denatured bovine whey protein isolate which serves as a glutathione precursor by providing an enriched source of bioavailable cysteine after oral administration. Immunocal has been tested in human clinical trials for its role in the management of diverse conditions including HIV/ AIDS, cancer and cystic fibrosis, and the optimization of sports performance in healthy subjects ^15"18 .

As part of the studies described herein, experiments were performed in order to ascertain, among other things, whether (i) GSH concentrations and GSH:GSSG ratios are deficient in salient brain regions of GFAP.HMOX1 mice by 6.5 months of age; (ii) whether Immunocal treatment augments brain GSH stores and alleviates SCZ-like abnormalities in these animals; and (iii) whether Immunocal treatment is able to restore neuronal levels of RELN and/or other imbalnances or abnormalities of gene expression in these animal models of neuropsychiatric or neurodegenerative disorders.

Materials and Methods The GFAP.HMOX1 mouse: Transgenic (TG) mice (FVB strain) were generated expressing GFAP.tTA.TRE.Flag.hHO-1 final constructs, as previously described ⁹ . Incorporation of the Glial Fibrillary Acidic Protein (GFAP) promoter selectively targets human HMOX1 gene expression to the astrocytic compartment. To permit conditional expression of the transgene during select periods of neuroembryogenesis, perinatal and mature life, a tetracycline-suppressible ('tet-off ) promoter element was included in the experimental design ¹⁰ .

Whey protein (Immunocal) supplementation: Immunocal® is a dietary natural health product with an NPN 80004370 issued by Natural Health Product Directorate (NHPD) Health Canada. It is a natural source of the glutathione precursor, cysteine. Immunocal is fat-free, contains less than 1% lactose and has a high protein biological value (>110 BV) providing all essential amino acids. It has been tested in experimental animals ^19"21 and human clinical trials ^22"24 and is marketed worldwide for enhancement of the immune system.

Experimental protocols have been approved by the Animal Care Committee of McGill

University in accordance with the guidelines of the Canadian Council on Animal Care. Mice were kept at a room temperature of 21 ± 1°C with a 12 h light/dark schedule. All the mice were bred and cared for in the Animal Care Facilities at the Lady Davis Institute for Medical Research. Male and female heterozygous GFAP.FDVIOXl (continuously expressing the FDVIOX1 transgene) and wild-type (WT) mice at 5 months of age were treated daily with Immunocal at 33 mg/ml drinking water vs. drinking water containing 33 mg/ml casein (control). Daily drinking volume per mouse was recorded. After 4-6 weeks of treatment, all animals were assessed for the behavioral, neurochemical and neuropathological endpoints described below. Fur texture, body weight and survival rates were monitored as indices of general health.

Behavioral tests: GFAP.FDVIOXl mice and their WT littermates were transferred to the Neurophenotyping Centre of the Douglas Mental Health University Institute (Montreal) for behavioral analyses. The animals were tested for locomotor activity 25 and startle response [prepulse inhibition (PPI)] ²⁶ .

Surgical procedures: (1) Mouse brains were fixed by transcardial perfusion as previously described ²⁷ with minor modifications ⁹ . Briefly, the animals were deeply anesthetized with rodent mixture containing ketamine, xylazine, acepromazine and saline and perfused with 200 ml of ice-cold saline followed by 250 ml of cold 4% paraformaldehyde in 0.1M PBS, pH 7.4, for light- microscopic analysis, or cold 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer, pH 7.5, containing 0.1% CaC12 for transmission electron microscopy (TEM). The brains were removed and immersed in the same fixatives for 24 h at 4°C. For histomorphology, brains were embedded in paraffin. For RNA and protein expression assays, mouse brains were frozen in dry ice immediately after transcardial perfusion with 200 ml of ice-cold PBS and stored at -80°C.(2) For HPLC and glutathione assays, animals were decapitated and brains were removed and frozen in 2-methylbutane at -40°C and stored at -80°C until use ²⁸ .

Glutathione assay: An HPLC method was utilized to measure reduced (GSH) and oxidized (GSSG) glutathione concentrations in brain hemispheres ²⁹ . GSH and GSSG levels were determined in four sub-regions: prefrontal cortex (PFC), hippocampus (HC), striatum (STM) and the remainder of the hemisphere (excluding cerebellum; REM).

Neurotransmitter measurement: Brains were cut in 400-500 micron serial sections using a cryostat and selected regions (PFC, HC, STM, and substantia nigra (SN)) were dissected using 0.5-2.0 mm micropunches ³⁰ ' ³¹ . Tissues were homogenized in 0.25 M perchloric acid and centrifuged at 4°C (10,000 rpm, 15 min), and supernatants were collected. The concentrations of monoamines [i.e., dopamine (DA), norepinephrine (NE), epinephrine (E), and 5- hydroxytryptamine (5-HT)] and monoamine metabolites [i.e., 3,4-dihydroxyphenylacetic acid (DOPAC), homovanillic acid (HVA), and 5-hydroxyindoleacetic acid (5-HIAA)] were determined using HPLC with electrochemical detection (HPLC-EC), in the laboratory of Dr. A. Gratton (Douglas Hospital, Montreal), as previously described ⁹ ' ³² . mRNA and miRNA expression: Total RNA extraction, polyadenylation, and cDNA synthesis - Total RNA from each dissected brain region was extracted in Trizol according to the manufacturer's instructions (Invitrogen). Two and half micrograms of total RNA were subjected to RT-qPCR using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher) and anchored-oligo-dT18 primer. miRNA polyadenylation was performed followed by cDNA synthesis using 2 μg of polyadenylated total RNA with miScript II RT Kit (Qiagen). mRNA and miRNA RT-qPCR - The Applied Biosystems 7500 Fast Real-Time PCR System (Applied Biosystems by Life Technologies) was used to quantify mRNA and miRNA with EvaGreen RT-qPCR Mastermix-Low ROX reagent (Diamed) according to manufacturer's instructions. Twenty nanograms (ng) and 2.5 ng of cDNA were quantified for mRNA and miRNA, respectively, using the above reagent (Diamed) via RT-qPCR. The forward (F) and reverse (R) primer sequences used to detect mouse mRNA were a) provided by OriGene Technologies (Rockville, MD), which were designed to span an exon-intron boundary and the possible contaminating genomic DNA was not amplified because the primer cannot anneal to the template ³³ , b) designed with Primer Express Software Version 3.0 (Applied Biosystems by Life Technologies) and validated by published study, c) validated by published study. Additional checks of melting curve for each reaction was always carried out to assess contamination of genomic DNA or poor primer design (primer dimer formation) (Applied Biosystems by Life Technologies). Primer sequences were as follows: (1) manganese superoxide dismutase (MnSOD) : 5'-GCTGCACCACAGCAAGCA-3' (F) (SEQ ID NO: 3) and 5 '-TCGGTGGCGTTGAGATTGT-3 ' (R) (SEQ ID NO: 4);

(2) Reelin (Reln) : 5'-GCCACGCCACAATGGAA-3' (F) (SEQ ID NO: 5) and 5'- CGACCTCC ACATGGTCCAA-3 ' (R) (SEQ ID NO: 6); (3) Glutamate Decarboxylase 1 (Brain, 67 kDa; Gad-l/67) ^a : 5'- CGCTTGGCTTTGGAACCGAC AA-3 ' (F) (SEQ ID NO: 7) and 5'- GAATGCTCCGTAAAC AGTCGTGC-3 ' (R) (SEQ ID NO: 8);

(4) Neurexin 1 (Nrxnl) ³ : 5'-ACCGTGCCTTAGCAATCCTTGC-3' (F) (SEQ ID NO: 9) and 5 '- GTCGTAGCTCAAAACCGTTGCC-3 ' (R) (SEQ ID NO: 10); (5) Neuroligin 2 (Nlgn 2) ^a : 5 ' -CGATGTC ATGCTC AGCGC AGT A-3 ' (F) (SEQ ID NO: 11) and 5'-CCACACTACCTCTTCAAAGCGG-3' (R) (SEQ ID NO: 12);

(6) As an internal reference, P-Actin ^c mRNA was used and probed using a pair of primers [5'- C AGC AGATGTGGATC AGC AAG-3 ' (F) (SEQ ID NO: 13) and 5'- GC ATTTGCGGTGGACGAT-3 ' (R)] ³⁴ (SEQ ID NO: 14). Mature DNA sense sequences (obtained from miRBase; http://microrna.sanger.ac.uk/) were used as forward primers to detect miRNA. The miRNA primer sequences used were mmu-miR-137- 5p (5'-acgggtattcttgggtggataat-3') (SEQ ID NO: 15), mmu-miR-137-3p (5'- ttattgcttaagaatacgcgtag-3 ') (SEQ ID NO: 16), mmu-miR-181a (5'-aacattcaacgctgtcggtgagt-3') (SEQ ID NO: 17), mmu-miR-128-l-5p (5'-cggggccgtagcactgtctga-3') (SEQ ID NO: 18), mmu- miR-128-3p (5'-tcacagtgaaccggtctcttt-3') (SEQ ID NO: 19), mmu-miR-138 (5'- agctggtgttgtgaatcaggccg-3') (SEQ ID NO: 20), and mmu-miR-200c (5'-taatactgccgggtaatgatgga- 3') (SEQ ID NO: 21).

As a reference sequence, mouse small nucleolar RNA 202 (snoRNA-202) was probed using an internal forward primer (5'-agtacttttgaacccttttcca-3') ³⁵ . (SEQ ID NO: 22) mRNA and miRNA expression fold changes between groups were calculated using the ΔΔΟΐ method relative to controls following normalization with levels of snoRNA-202 ³⁶ . Data mining for candidate targets of lead miRNAs - microRNA target predictions were adduced from the literature or the following databases: miRBase website (http://microrna. sanger.ac.uk) 37; TargetScan (http://www. targetscan.org), RNA22 (http://cbcsrv.watson.ibm.com/ rna22_targets.html) and PicTar (http://pictar.mdcberlin.de). Neuromorphological analysis: Coronal brain sections (4 μιη) were deparaffinized in toluene and rehydrated in a series of graded alcohol solutions followed by H ₂ 0. Sections were stained with hematoxylin and eosin (H&E). The preparations were examined using a Leica DM LB2 microscope. Bregma coordinates were identified using the mouse brain atlas of Paxinos and Franklin ³⁸ . The lateral ventricles of left and right hemispheres were examined at +0.50mm from bregma. The width and height of the hippocampus and the length of the dentate gyrus granule cell layer were measured at -1.55mm to -1.99mm from bregma with the aid of an ocular grid by a single investigator unaware of the tissue source.

Statistical analyses: Data are expressed as means ± SEM. For locomotor activity, analyses were performed in cases with more than two groups using a genotype (TG and WT) by treatment (Immunocal and casein) ANOVA followed by Newman-Keuls post hoc comparisons to assess significant main effects within groups. For PPI assessment of WT and TG mice (with Immunocal or casein), two-way ANOVA was used to analyze serial intensity tests considering two factors (genotype and intensity). For GSH assay and quantitative hippocampal pathology, the comparison was made between two genotypes for each item using Student's t test (one or two- tailed with 95% confidence intervals). Fold changes in TG mice versus WT mice for qPCR assays were analyzed with paired Student's t test (two-tailed). Unless stated otherwise in the figure legends, statistical significance was set at P<0.05.

Results

Toxicity: Immunocal exposure resulted in no overt toxicity as evidenced by normal body weights, fur texture and survival rates relative to age-matched, casein-treated (current study) and untreated 9 FVB control mice (data not shown). Behavior:

Prepulse inhibition (Figure 1) - PPI occurred in male and female WT mice treated with casein (controls), although the effect was less robust in the females (Fig. 1 A) as previously reported in rodents ⁹ and humans ³⁹ . Relative to casein-treated WT animals, PPI was significantly attenuated in male TG mice (Fig. 1A). We observed a trend towards impairment of PPI in casein-treated female TG mice (P=0.06, relative to WT subjects, Fig. 1A), particularly following exposure to high pre-pulse levels, as noted in an earlier report ⁴⁰ . Impairment of PPI was significantly ameliorated in female TG mice receiving Immunocal treatment (P<0.0001 relative to casein- treated TG group, Fig. ID). In male mice, no significant differences in PPI rescue could be evinced between the Immunocal and casein-treated TG mice because the baseline PPI level of WT mice exposed to Immunocal was lower (albeit not statistically significantly) than that of the WT-casein group (Fig. 1C), whereas the PPI levels of the TG-Immunocal and TG-casein groups were comparable (Fig. ID).

Locomotor activity - Casein-treated male TG mice displayed a robust hyperkinetic profile as reflected in all locomotor measurements, whereas female TG mice exhibited partial hyperlocomotor activity (Fig. 2). Immunocal treatment significantly attenuated the hyperlocomotor activity in male TG mice, as evidenced by changes in total distance, stereotypy count and time, movement time, and rest time (Fig. 2A). Certain measures of locomotor activity were enhanced in Immunocal-treated female WT mice relative to those exposed to casein, thereby masking potential differences in locomotor activity between the Immunocal -exposed TG and WT females (Fig. 2B).

Brain GSH concentrations:

Whole brain measurements revealed no significant differences in GSH concentrations, GSSG concentrations or GSH/GSSG ratios between casein-treated WT and TG mice, and glutathione levels were similar between the males and females (p>0.05 for all comparisons) (Fig. 3A). A sub-regional analysis of the brain samples showed a significant reduction of GSH content in the HC of casein-treated TG mice relative to WT values (p<0.05; Fig. 4A), and a trend towards lower GSH/GSSG ratios in the TG HC and STM compared with WT preparations (Fig. 4A). Glutathione values in the WT and TG PFC were similar (p>0.05, Fig. 4A, B).

Immunocal supplementation significantly augmented whole brain GSH/GSSG ratios in both WT and TG mice compared with casein-treated animals (p<0.01-0.001; Fig. 3C, D). The latter was achieved mainly through marked elevations of GSH concentrations (634.2-676 vs. 188.5-201.1 nmol/mg, P<0.001) accruing from exposure to the whey protein. A significant reduction of brain GSSG content following Immunocal supplementation was observed in WT but not TG brains (WT: 4.9±0.5 vs. 7.7±0.5 nmol/mg, p<0.05; TG: 5.7±0.4 vs. 6.1±0.5 nmol/mg, p>0.05.). There were similar alterations in GSH content and GSH/GSSG ratios between male and female mice (p>0.05), and the diminished GSSG concentrations resulting from Immunocal treatment were observed in both WT males and females, but only in TG males (p<0.05 for each comparison; Fig. 3C, D).

Immunocal treatment diminished the differences in hippocampal GSH content and GSH/GSSG ratio between the WT and TG groups (Fig. 4B). Immunocal treatment significantly elevated striatal GSH/GSSG ratios in TG mice relative to WT preparations (p<0.01, Fig. 4B). Immunocal treatment significantly increased GSH/GSSG ratios in all three brain regions surveyed of both WT and TG mice compared with casein-treated preparations (83.7-117.2 vs. 0.6-4.1, PO.01- 0.001; Fig. 4C, D).

The GSH/GSSG ratio in the remainder of the hemisphere (REM) was greater in the TG mice relative to the WT animals (P<0.01), was not significantly affected by Immunocal exposure (Fig. 5), and likely accounts for the absence of differences in whole brain glutathione concentrations between these groups (Fig. 3 A).

Hippocampal and ventricular pathology:

H&E staining of coronal brain sections revealed markedly enlarged lateral ventricles

(ventriculomegaly) (Fig. 8A) and altered hippocampal cytoarchitectonics (dentate gyrus dysgenesis) (Fig. 8B) in both male and female TG mice, features characteristic of human SCZ neuropathology ^41"43 . A morphometric analysis of the HC showed that the granule cell layer of the dentate gyrus in TG mice was significantly diminished in size compared to WT mice (p<0.05,

Fig. 8B). The ventriculomegaly and dentate gyrus dysgenesis observed in both male and female TG mice were not improved by Immunocal supplementation (Fig. 8). In contradistinction to 12 month old GFAP.HMOX1 TG mice ⁹ , Gallyas-positive (degenerate) neurites were rarely encountered in the Immunocal- or casein-treated 6.5 month-old TG animals.

Neurotransmitters: A) DA and metabolites - Among the casein-treated groups, DOPAC and HVA were significantly increased in the TG HC compared to WT preparations (p<0.05-0.01, Fig. 6A). The ratios of hippocampal DOP AC/DA and HVA/DA were also significantly augmented in the TG mice (p<0.05, Fig. 6B). No significant changes in the levels of DA or DA metabolites were found in PFC, STM and SN of TG brains relative to WT mice (Fig. 6A). The DOP AC/DA ratio was reduced in the TG PFC (p<0.05) without significant alterations in the concentrations of DA or DA metabolites per se (Fig. 6B). All HMOX1 -related changes in brain DA and DA metabolites were attenuated by Immunocal supplementation (Fig. 6A, B). Of note, the DA content of the TG PFC was significantly increased after Immunocal treatment (p<0.05, Fig. 1 A).

B) Serotonin and metabolites - Among the casein-treated animals, serotonin levels were significantly greater in the TG PFC compared to its WT counterpart (p<0.05, Fig. 7A).

Immunocal treatment restored serotonin concentrations in the TG PFC to WT values (Fig. 7A).

C) NE and E - Among the casein-treated mice, levels of NE and E were significantly higher in the TG STM compared to WT STM (p<0.05, Fig. 7B). Concentrations of NE and E in the TG STM were normalized following Immunocal exposure (Fig. 7B). mRNA and miRNA expression levels:

A) Neuronal reelin (RELN), GAD67 andMnSOD - MnSOD mRNA, a marker of oxidative stress, was significantly up-regulated in casein-treated TG PFC, STM, and SN compared to WT preparations (p<0.05-0.01, Fig. 9A). The mRNA expression levels of reelin (RELN; a protein involved in the regulation of neuronal migration and positioning in the developing brain ⁴⁴ ) and GAD67 (a GABA-synthesizing enzyme that is co-regulated with reelin ⁴⁵ ) were significantly reduced in casein-treated TG PFC and STM compared to WT PFC and STM (p<0.05-0.001, Fig. 9B, C). In the GFAP.HMOXl mice, Immunocal treatment normalized the MnSOD mRNA levels in the PFC and STM (but not SN); restored reelin and GAD67 expression in the PFC (p>0.05 relative to casein-treated WT mice; Fig. 9A-C); and augmented GAD67 mRNA levels in the STM and SN (pO.01-0.001 relative to casein-treated WT mice; Fig. 9C). The Immunocal- treated TG mice also exhibited a trend towards recovery of reelin expression in the STM, although reelin mRNA concentrations in this brain region remained significantly (p<0.05) below WT values (Fig. 9B).

B) miR-137, Nrxnland Nlgn2 - Mutations in Nrxnl and Nlgn2 genes have previously been linked to SCZ, autism and intellectual disability ^46"52 . GFAP.FDVIOX1 mice exhibited significant down-regulation of Nrxnl in PFC and STM, and Nlgn2 in PFC, relative to WT values (p<0.05- 0.01, Fig. 9D, E). Administration of Immunocal reversed the reduction of Nrxnl and Nlgn2 in the TG brains (Fig. 9D, E). The TG mice exhibited up-regulation of miR-137, a putative SCZ susceptibility gene ⁵³ and predicted suppressor of Nrxnl (www.targetscan.org), in STM and suppression of miR-137 in the PFC and SN (p<0.01-0.001, Fig. 10A). The differences in neural miR-137 expression between the GFAP.FDVIOXl and WT animals were obviated by Immunocal treatment (Fig. 10A).

C) miR-181a & miR-138 - miR-181a may play important roles in SCZ because it regulates synaptic plasticity, is induced by dopamine signaling in hippocampal neurons ⁵⁴ and is predicted to suppress reelin and sirtl gene expression. In the casein-treated groups, the expression of mmu- miR-181a was significantly up-regulated in the TG PFC and STM relative to their WT counterparts (p<0.05-0.01, Fig. IOC) and correlated inversely with reelin gene expression which it may target (www.targetscan.org). Similarly, mmu-miR-138, a miRNA implicated in several human neuropsychiatric disorders ⁵⁵ ' ⁵⁶ and impacted by HMOX1 transfection in cultured astroglia ⁵⁷ , was up-modulated in the TG STM vs. WT values (p<0.01, Fig. 10D).

D) miR-128 & miR-200c - miR-128 is highly expressed during neuronal differentiation ⁵⁸ and de- regulated in patients with SCZ ⁵⁹ . miR-200c is up-regulated by oxidative stress ⁶⁰ and suppresses reelin ⁶¹ , a protein implicated in the pathogenesis of SCZ. miR-128 was up-regulated in the GFAP.HMOX1 PFC (miR-128-l-5p and miR-128-3p) and STM (miR-128-l-5p), and down- regulated in SN (miR-128-l-5p and miR-128-3p) compared to WT controls (p<0.05-0.001, Fig.

10E, F). Immunocal treatment prevented HMOXl-related dysregulation of miR-128 expression in the TG brains, as evidenced by unaltered levels of miR-128-l-5p between the WT and TG animals and enhancement of miR-128-3p expression in TG SN (Fig. 10E, F). Expression of miR- 200c, an miRNA that targets reelin ⁶¹ , remained unchanged in all three TG brain regions relative to WT controls (Fig. 10G) and was not affected by Immunocal exposure (Fig. 10G). Discussion

In these experiments, the 6.5 month-old GFAP.HMOXl transgenic mice exhibited schizophrenia-relevant behavioral, neuropathological and neurochemical features akin to those previously reported by our laboratory in these mice at 12 months of age ⁹ . Documentation of the full neuroendophenotype at this earlier, 6.5-month time point is significant because it is equivalent to approximately 30 human years ⁶² when first psychotic presentation (diagnosis) of schizophrenia is often manifest ⁶³ . Behavioral abnormalities in the 6.5 month-old GFAP.HMOXl TG mice included hyperkinesia, stereotypy and impaired PPI of the acoustic startle response. As previously noted in the 12 month-old animals ⁹ and in human SCZ ³⁹ , the behavioral deficits were often more prominent in the males (see below). In contrast, there were no sex predilections for the striking neuromorphological anomalies which consisted of dysgenesis of the hippocampal dentate gyrus and enlargement of the lateral ventricles. Dysregulation of neurotransmitter systems in 6.5 month-old GFAP.HMOX1 TG mice included elevated serotonin content in the PFC, augmented norepinephrine and epinephrine concentrations in the STM and a trend towards increased dopamine levels in the HC. Dopamine turnover was accelerated in the HC, as evidenced by significant increases in the DA metabolites, DOPAC and HVA as well as in DOPAC/DA and HVA/DA ratios. These changes in DOPAC and HVA are indicative of enhanced dopaminergic activity in this brain region ^64"67 . By contrast, the DOPAC/DA ratio in the PFC of TG mice was significantly lower than that of WT mice, similar to what has been observed in the isolation-reared rat model of schizophrenia ⁶⁸ . This reduced DA turnover may point to PFC hypodopaminergia which is a characteristic feature ("hypofrontality") of the human schizophrenic brain ⁶⁹ . Altered PFC physiology may contribute to the behavioral sensitization and hyperkinesia observed in psychotic states ⁷⁰ . Furthermore, the cognitive deficits characteristic of SCZ may be due, at least partly, to aberrant catecholaminergic transmission within the lateral PFC and its interactions with related brain regions ⁷¹ . Conceivably, the elevated serotonin content in the GFAP.HMOXl PFC, possibly recapitulating the 5-HT1A receptor increases in PFC of schizophrenic patients ⁷² ' ⁷³ , may have exerted an inhibitory effect on dopamine turnover in this region ⁷⁴ , thereby contributing to the hypodopaminergia.

The 6.5 month-old GFAP.FDVIOX1 TG mice exhibited altered gene expression profiles of key neurodevelopmental proteins implicated in the etiopathogenesis of SCZ including reelin (RELN), GAD67, Nrxnl and Nlgn2. As previously hypothesized ⁹ , abnormal expression of these genes may contribute to the neuroanatomical anomalies and aberrant neurotransmission characteristic of the GFAP.FDVIOXl mice. In addition, neural concentrations of miR-137, miR- 181a, miR-138, and miR-128, miRNAs known or predicted to regulate the expression of these neurodevelopmental genes, and reportedly altered in the brains of persons with SCZ and related disorders ⁴⁶ ' ⁴⁹ ' ⁵² ' ⁵⁹ ' ^{61 75"77} , deviated substantially from WT values. Annotation of the targeted genes relevant to the etiopathogenesis of human neurodevelopmental disorders is provided in Table 1. Of note, 30 predicted targets have been implicated in SCZ whereas 1 -15 gene targets may contribute to autism and other developmental CNS conditions. Among the former, 50 % are purportedly regulated by miR-137, a SCZ susceptibility gene ⁵³ heavily impacted in the GFAP.FDVIOXl basal ganglia and PFC. A smaller proportion (13.3 - 33.3 %) of the putative gene targets are regulated by the other miRNAs surveyed here (i.e. miR-138, -128, -181a, and -200c).

Table 1: Data mining for predicted targets of miRNAs implicated in neurodevelopmental and neuropsychiatric disorders. A) and B): neurodevelopmental and neuropsychiatric disorders listed alphabetically; C) major neuropathology; D) Footnotes for Table 1; E) References cited in Table 1; F) Gene names for Table 1.

MnSOD mRNA expression levels in the PFC, STM and SN of the GFAP.HMOXl mice were significantly augmented in comparison to the WT counterparts. Furthermore, glutathione reserves were depleted in the HC and STM of TG brains, as evidenced by diminished GSH concentrations and/or low GSH:GSSG ratios relative to WT preparations. These finding further corroborate the contention that oxidative stress downstream from sustained or repeated over- expression of HO-1 in astrocytes may be a pivotal player leading to neuronal dysfunction in a host of developmental and degenerative brain disorders ⁷⁸ .

A major finding of these experiments was that Immunocal treatment attenuated many of the behavioural, neurochemical and redox abnormalities characteristic of the GFAP.HMOXl mouse. These observations are consistent with previous reports of symptom amelioration in human SCZ patients and animal models of the disease following the administration of glutathione precursors . In GFAP.HMOX1 mice of both sexes, Immunocal supplementation restored redox homeostasis by significantly increasing GSH concentrations and GSH:GSSG ratios in whole brain and in discrete regions (PFC, HC, STM) implicated in the etiopathogenesis of SCZ. The restoration of brain GSH homeostasis in the GFAP.HMOX1 mice by exposure to Immunocal was sufficient to alleviate cellular oxidative stress as evidenced by normalization of MnSOD mRNA expression in the transgenic PFC and STM. Immunocal also bolstered GSH reserves in the brains of WT animals relative to the casein-treated controls. Thus, by serving as a source of bioavailable cysteine, believed to be the rate-limiting amino acid required for GSH biosynthesis, results herein indicate that whey protein consumption augments GSH stores and antioxidant defenses in the healthy and diseased mammalian CNS.

Immunocal treatment significantly ameliorated the hyperlocomotion and stereotypy in male GFAP.HMOX1 mice and improved PPI in the transgenic females. Without wishing to be bound by theory, these benefits may be attributed to the positive impact of Immunocal exposure on aberrant monoaminergic neurotransmission observed in the TG mice. All HMOX1 -related changes in brain dopamine, dopamine metabolites, serotonin, norepinephrine and epinephrine were improved by Immunocal supplementation. An interesting neurotransmitter profile was observed in the PFC of Immunocal -treated TG mice where Immunocal not only restored excessive serotonin levels and deficient DOP AC/DA ratios to WT values, but also concurrently augmented norepinephrine and dopamine concentrations in this brain region. Without wishing to be bound by theory, it is thought that by normalizing serotonin content in the TG PFC, Immunocal may have released the local dopamine system from serotonergic inhibition (as evidenced by the increased dopamine turnover and enhanced dopamine content) ⁷⁴ , thereby correcting the PFC hypodopaminergia. Additionally, the Immunocal-mediated increase in NE may have exerted an additive effect on DA release in the TG PFC, in keeping with the previously reported positive regulation of DA by NE in rat PFC ⁷⁹ .

Data sets indicate further that these beneficial effects of whey protein supplementation on dopaminergic tone are mediated, at least in part, by correction of deviant mRNA and miRNA expression profiles known to regulate the growth, function and maintenance of catecholaminergic circuitry in the developing mammalian CNS. Noteworthy in this regard is the full or partial normalization of mRNA expression profiles for neural reelin (RELN), GAD67, Nrxnl, Nlgn2 and several of their targeting miRNAs in salient regions of the GFAP.HMOX1 brain. PFC hypodopaminergia is thought to underlie the 'negative' symptoms of schizophrenia (apathy, social withdrawal, etc.) ⁷⁴ . As previously reported ⁹ , the wild-type and GFAP.FDVIOX1 mice exhibited several sex-specific differences on behavioural testing. Thus, PPI was more robust in males than females (as seen in human schizophrenia ³⁹ ) as was hyperlocomotor activity. Interestingly, Immunocal treatment significantly suppressed hyperlocomotion in male GFAP.HMOXl mice, whereas in female WT mice certain indices of locomotor activity were enhanced by whey protein exposure. These results suggest that the development of nutrition-based strategies may allow for the management of neuropsychiatric disorders in a more nuanced, gender-specific fashion.

Immunocal supplementation in these mouse model studies exerted no appreciable effects on the dysgenesis of the hippocampal dentate gyrus and ventriculomegaly which characterize the GFAP.HMOXl mouse ⁹ and human SCZ brain ^81,82 . This outcome is not surprising inasmuch as these midline brain defects are established during neurodevelopment prior to the Immunocal treatment window and are likely to be irreversible. It is hypothesized that these structural anomalies may be obviated by Immunocal treatment of pregnant GFAP.HMOXl dams and prepubertal transgenic pups. Such findings would suggest whey protein supplementation as a potential safe and effective intervention for diminishing the likelihood of SCZ in persons at-risk for this disease ^{83 84} .

One study analyzing reelin levels in different brain regions of schizophrenia subjects found a significant decrease in reelin in 5 key brain regions, namely the prefrontal cortex (PFC), the striatum (STM), hippocampus (HC), temporal cortex, and cerebellum, compared to control subjects (Impagnatiello et al., 1998, A decrease of reelin expression as a putative vulnerability factor in schizophrenia, Proc. Natl. Acad. Sci., USA, vol. 95: pp.15718-15723; herein incorporated by reference in its entirety). In GFAP.HMOXl mouse model of schizophrenia, a significant decline in reelin protein immunoreactivity in the PFC, STM (caudate-putamen), and HC has been observed (Song et al. J Neurosci 32: 10841-10853, 2012). As described hereinabove, reelin (RELN) mRNA was analyzed in 3 brain regions relevant to schizophrenia in younger GFAP.HMOX1 mice: the PFC, STM and the substantia nigra (SN). Immunocal treatment induced a statistically significant increase in RELN, as observed in the PFC. Moreover, mRNA expression levels of GAD67, a gene acting downstream of RELN, were significantly increased in the STM and SN after Immunocal treatment. Without wishing to be bound by theory, these data suggest that Immunocal treatment may have salutary effects in schizophrenia and related neurodevelopmental disorders (e.g. autism) by enhancing brain reelin/GAD67 expression. The STM and SN are also key loci of pathology in Parkinson's disease and other extrapyramidal disorders; therefore it is contemplated that Immunocal- mediated upregulation of GAD67 in these regions may ameliorate such conditions as well. Again, without wishing to be bound by theory, upregulation of reelin/GAD67 in the PFC and HC may also benefit Alzheimer's dementia since degeneration in these brain regions is believed to be important, respectively, for the executive dysfunction and memory deficits characteristic of this condition. The role of reelin/GAD67 and Immunocal supplementation in Alzheimer disease could be further investigated in, for example, APPswe/PSlAE9 double-transgenic mice (e.g. J Neurochem 131 : 778-790, 2014; herein incorporated by reference in its entirety) and other established rodent models of Alzheimer disease.

Without wishing to be bound by theory, Immunocal treatment may confer neuroprotection in human neurodegenerative disorders at least in part because (i) the glial HO-1 response is an important transducer of environmental and endogenous stressors into patterns of neural damage (pathological iron deposition, mitochondrial injury, mitophagy, etc.) characteristic of Alzheimer's disease and Parkinson's disease (Schipper HM, Song W. A Heme Oxygenase- 1 Transducer Model of Degenerative and Developmental Brain Disorders. International journal of molecular sciences 2015;16:5400-5419), (ii) central oxidative stress and glutathione deficiency figure prominently in the pathophysiology of the latter conditions (Gu M, Owen AD, Toffa SE, et al. Mitochondrial function, GSH and iron in neurodegeneration and Lewy body diseases. Journal of the neurological sciences 1998; 158:24-29; Jomova K, Vondrakova D, Lawson M, Valko M. Metals, oxidative stress and neurodegenerative disorders. Mol Cell Biochem 2010;345:91-104; Mandal PK, Saharan S, Tripathi M, Murari G. Brain Glutathione Levels - A Novel Biomarker for Mild Cognitive Impairment and Alzheimer's Disease. Biological psychiatry 2015; and Schulz JB, Lindenau J, Seyfried J, Dichgans J. Glutathione, oxidative stress and neurodegeneration. Eur J Biochem 2000;267:4904-4911) and, (iii) as documented herein, Immunocal administered orally markedly improved GSH homeostasis in the brains of GFAP.HMOX1 mice. The results obtained in these experiments indicate that compositions comprising whey protein isolate and/or whey protein concentrate, such as Immunocal®, may be used for treating, ameliorating, or preventing neurological or neurodegenerative diseases or conditions in a subject. It has been found that, as described in detail herein, compositions comprising whey protein isolate and/or whey protein concentrate may be used for restoration of neuronal reelin (RELN) levels. The effects of treatment with such compositions were not limited to increasing or restoring RELN levels, indicating that such compositions may also, or alternatively, be used to correct a number of other neurological imbalances, dysregulations, or abnormalities occurring in a subject as described hereinabove. Subjects suffering from neuropsychiatric or neurodegenerative diseases may particularly benefit from treatment with such compositions, however other subjects may also benefit from such treatment with whey protein isolate.

EXAMPLE 2 - Whey Characteristics and Whey Protein Isolate Production

An example of whey protein isolate production is provided below for illustrative purposes intended for the person of skill in the art. As will be understood, whey may be considered as a by-product of cheese or of casein manufacture. Whey typically contains soluble proteins of milk, so-called whey proteins. Cheese whey, for example, typically contains 5-8 g/1 of proteins (N x 6.38), among which β- lactoglobulin (β-lg) and a-lactalbumin (a-la) are the most abundant (accounting for 50-55% and 15-20%) of total whey proteins, respectively) and bovine serum albumin (BSA), lactoferrin (LF) and immunoglobulins (IgG) are considered as minor whey proteins (accounting each for 3-5%>).

Whey may also comprise protein fragments or polypeptides such as so-called proteose-peptones

(PP-4, PP-5, PP-8f) resulting from proteolysis of milk proteins by lactic starters in cheesemaking or by psychrotrophic bacteria during cold storage of raw milk. These proteinaceous compounds are not completely characterized, and their concentration in whey is highly variable. Finally, non-protein nitrogen (NPN) group may comprise a large number of molecules in whey, among which urea may account for 50-60%.

For illustrative purposes, Table 2 below provides some characteristics of some of the major proteins and polypeptides found in an exemplary whey sample (in this case, bovine sweet whey).

Table 2: Some Characteristics of Major Proteins and Polypeptides in an Exemplary Whey Sample

In this example, whey protein isolate may be obtained from whey, such as the whey exemplified above in Table 2. As will be understood, process steps involved in the manufacture of whey protein isolate (WPI) may lead to compositional differences in terms of protein profile between whey protein isolates. Thus, the specific components and their abundance are not meant to be considered limiting in any manner. Factors influencing whey protein isolate characteristics may include, for example:

[1] Source of the whey proteins: For example, sweet- or acid- whey may be used as starting material for the manufacture of WPI; [2] Pasteurization: For example, the proteins in cheese whey-derived ingredients may be submitted to two (2) pasteurization (i.e. 72-75°C - 12-16 sec.) treatments at a cheese plant where milk is pasteurized (Canada and US regulation) before cheesemaking, or at the ingredient manufacturing plant, or before transportation of drained whey to this plant, in order to reduce bacterial count before membrane processing or ion exchange chromatography; and

[3] Defatting: For example, centrifugal clarification is typically used to reduce the fat content of whey to 0.8-1.2%. However, an additional defatting step is often performed to further decrease the fat content to 0.3-0.5% in order to increase membrane separation performance or to prevent an irreversible fouling or clugging of ion-exchange resins with polar lipids. Defatting typically involves holding whey at 50-55°C for 30 to 90 min. in order to promote aggregation of fat particles (optionally in the presence of added CaCb). The product will thereafter be submitted to centrifugal separation or MF in order to remove the agglomerated material.

In this example, high-protein concentration (>90% dry basis) whey protein isolate may typically be prepared from whey such as that exemplified in Table 2 by either of two methods: membrane processing or ion-exchange chromatography. In membrane processing, microfiltration (MF) and/or ultrafiltration (UF) membranes may be used for concentrating whey. In ion-exchange chromatography, cationic- and/or anionic- exchange chromatography may be used to purify whey proteins.

In this example, obtained samples may be submitted to spray drying conditions. Where a substantially undenatured isolate is to be prepared, the obtained concentrated liquid may be, for example, sprayed in a hot air current (inlet T°: 180-200°C, outlet T°: 80-100°C) circulating in a spray drying tower. A combination of dehydration and gravity may allow the collection of dry particles (4-8% humidity) at the bottom of the spray dryer. Estimates obtained from mathematical modeling of such drying processes suggest that the droplet temperature does not exceed about 80-85°C during the few seconds used for dehydration, providing for an example of low impact spray drying which may not substantially denature whey protein. As will be understood, ingredients having high-protein contents may generally be more difficult to rehydrate (possibly because of their low lactose and minerals content). For certain applications where rapid rehydration of the powder obtained from spray drying is desired, the powder may be submitted to agglomeration. Such steps may involve a final drying of the powder (from 12-15% to 4% humidity) on a fluid bed, generating agglomerated particles having better sinkability in water. In products containing fat (which is generally not the case for high protein ingredients), lecithin may be injected during fluid bed drying. Lecithin may cover fat droplets and improve their wettability. Instantization step(s) may also be used, although such steps are generally uncommon in the manufacture of high-protein ingredients. As a result of the above steps, an example of a whey protein isolate may be prepared from the whey protein starting material exemplified in Table 2 above. It will be understood that this example is provided for illustrative and non-limiting purposes, and that many alternative, substituted, or modified whey protein sources and/or processing steps known to the person of skill in the art having regard to the teachings herein are also contemplated.

EXAMPLE 3 - Effects of Whey Protein Isolate in Cell and Mouse Models of Alzheimer's Disease (AD)

As discussed above, deficits in Reelin expression and/or Reelin signaling play a pathogenic role in several nervous system disorders including schizophrenia and Alzheimer's disease (AD). As described hereinabove, the cysteine-rich whey protein supplement, Immunocal®, rescues Reelin expression, particularly in the prefrontal cortex, of a mouse model of schizophrenia. Given that Reelin expressing neurons of the entorhinal cortex layer II are a highly vulnerable population of cells that are lost very early in AD, the presently described experiments sought to evaluate the effects of whey protein isolate on Reelin expression and signaling in vitro in hippocampal-entorhinal cortex rat brain slices and in vivo in the hAPPSwelnd mutant (J20) mouse model of AD.

As discussed below, incubation of hippocampal-entorhinal cortex slices with Immunocal® increased Reelin expression at the mRNA and protein levels. In addition, immunostaining of slices revealed a striking increase in the intensity and number of neurons staining positively for Reelin within the entorhinal cortex, dentate gyrus and CA1 region of the hippocampus following Immunocal® treatment in vitro. These studies next evaluated the effects of whey protein isolate in vivo by treating hemizygous J20 AD mice from 3 months-old to 5 months-old with Immunocal®. Reelin expression and signaling was then assessed by western blotting and immunofluorescence microscopy and cognitive function using the Barnes maze to test spatial learning and memory. Immunocal® treatment corrected a deficit in cortical GSH levels observed in the brains of untreated hemizygous J20 mice. Western blotting of brain sections micro- dissected to enrich for the hippocampal-entorhinal cortex sub-region revealed a decrease in Reelin and GAD67 expression in untreated hemizygous J20 AD mice compared to non-carrier control mice and this effect was prevented by treatment with Immunocal®. In addition, untreated hemizygous J20 AD mice displayed a marked reduction in p-CREB immunoreactivity in the hippocampal-entorhinal cortex sub-region of the brain and this deficit was essentially rescued by treatment with Immunocal®. In a similar manner, using immunofluorescence microscopy, Reelin expression was diminished in the entorhinal cortex, dentate gyrus and CA1/CA3 regions of the hippocampus in untreated hemizygous J20 AD mice compared to non-carrier control mice. In contrast, Immunocal® treatment largely rescued these deficits in Reelin expression. In particular, Immunocal® treated J20 mice displayed robust Reelin staining in layer II of entorhinal cortex, apparently rescuing the loss of Reelin positive neurons observed in this brain region in untreated J20 AD mice. In parallel with the observed rescue in Reelin expression in J20 mice, Immunocal® also preserved GAD67 expression in the dentate gyrus and CA3 region of the hippocampus and markedly enhanced the co-staining of Reelin and phospho-DABl in the CA1 of these mice. Finally, Immunocal® treatment had a statistically significant positive effect on Barnes maze performance, both during the late stages of the acquisition phase and during the probe phase, in female, hemizygous J20 AD mice. Collectively, these findings indicate that Immunocal® induces Reelin expression in vitro in hippocampal-entorhinal cortex brain slices and rescues Reelin expression and signaling in vivo within the entorhinal cortex and hippocampus in the J20 mouse model of AD. Alzheimer 's Disease: Phenotypic and Pathological Characteristics. Alzheimer's disease (AD) is the leading cause of dementia and cognitive decline with over 5 million patients currently diagnosed in the United States and approximately 500,000 new cases each year. Aging is the most significant risk factor for developing sporadic AD. According to the Alzheimer's Association, approximately 13% of people age 65 and older have AD and this fraction increases to approximately 45% of people over the age of 85. Given the demographic shift to advancing age in our population, there is predicted to be a very significant increase in the number of people diagnosed with AD in the next several decades. By 2025 the number of people age 65 and older suffering with AD is predicted to be approximately 7.7 million and this number is expected to perhaps double by 2050. The average life expectancy once a patient is diagnosed with AD is approximately 8 years and AD has risen to the 6th leading cause of death in the United States. Alzheimer's disease was first described in 1906 by Dr. Alois Alzheimer and is characterized phenotypically by progressive memory loss and cognitive decline. Pathological hallmarks of the disease include amyloid plaques consisting of insoluble deposits of amyloid beta (Αβ) peptide and neurofibrillary tangles containing hyper-phosphorylated tau protein. These plaques and tangles are found throughout the brain parenchyma and are believed to play a significant role in the neuronal loss and atrophy that are characteristic of the AD brain. Of the diverse neuronal cell types that die in AD, hippocampal pyramidal cells, cortical pyramidal cells, and basal forebrain cholinergic neurons are among the most severely affected. The death of these populations of neurons leads to profound synaptic loss and significant neurotransmitter deficits, particularly in cholinergic pathways. Although 3 genes (amyloid precursor protein (APP), presenilin 1 (PS1), and presenilin 2 (PS2)) have been shown to be mutated in early onset, autosomal dominant, familial AD, these inherited forms of the disease make up less than 5% of AD cases, with the remaining 95% of cases being sporadic in nature. Current FDA approved drugs for AD are limited to acetylcholinesterase inhibitors and the NMDA antagonist memantine. These drugs are minimally effective and treat the symptoms of AD while having no effect on the underlying etiology of the disease. As such, current therapies do not significantly delay or halt the progression of AD.

The Amyloid Cascade Hypothesis. The amyloid cascade hypothesis has dominated the field of AD research for the past two decades and is founded on the premise that deposition of Αβ peptide is the initiating event in disease pathogenesis, ultimately leading to neurofibrillary tangle formation, synaptic loss, and neuronal cell demise (Hardy and Higgins, 1992). Throughout the years, the molecular form of Αβ thought to initiate the toxic cascade responsible for AD pathology has shifted from insoluble plaques to protofibrils to soluble oligomers (Klein et al., 2001; Naylor et al., 2008; Ferreira and Klein, 2011; Larson and Lesne, 2012). Regardless of which particular form(s) of Αβ leads to disease pathology, for more than a decade, the amyloidogenic processing of APP to form Αβ has been recognized as a viable molecular target for AD therapeutic development (Vassar, 2001; Evin et al., 2006). The amyloidogenic pathway generates beta amyloid peptide (of which the Αβι-42 form (here referred to simply as Αβ) is commonly regarded as the most likely toxic species) through the sequential cleavage of APP by the beta-site APP cleaving enzyme (BACE; also known as β-secretase) and γ-secretase (Figure 12). Alternatively, the sequential cleavage of APP by a-secretase and γ-secretase is considered non-amyloidogenic and primarily produces a soluble non-aggregating form of APP (sAPPa). Based largely on the amyloid cascade hypothesis and more recent studies showing that soluble Αβ oligomers are intrinsically neurotoxic, selective inhibitors of BACE and γ-secretase have been developed as drugs to decrease the tissue load of Αβ in AD brain (Vassar et al., 2009; D'Onofrio et al., 2012). The development of selective BACE inhibitors that are orally bioavailable and penetrate the blood brain barrier has been slow; however, this class of compounds has recently begun clinical testing in AD (Ghosh et al., 2012). The Merck compound, MK-8931 (verubecestat), initially completed Phase I testing and reportedly was capable of reducing cerebral spinal fluid amyloid levels by up to 90% in rats, monkeys, healthy human volunteers, and AD patients (Menting and Claassen, 2014; Kennedy et al., 2016). A Phase II/III clinical trial of this drug (EPOCH) completed enrollment in early 2016 in a population of patients with mild-to-moderate AD. Unfortunately, in February of 2017, Merck announced that it was terminating the trial after an interim analysis suggested little chance of discerning any positive therapeutic benefit. This was a significant setback for the AD field; however, Merck has continued another trial of verubecestat in patients with prodromal AD (APECS). In a similar manner to the recent failure of BACE inhibitors, γ-secretase inhibitors have been largely disappointing in the clinic. Most notably, two large Phase III clinical trials of the Eli Lilly compound, semagacestat, in mild-to-moderate AD patients were terminated early due to a statistically significant worsening of clinical measures of cognition and ability to perform activities associated with daily living (D'Onofrio et al., 2012). It is presently unclear why this compound failed clinically but it may be an off target effect related to modulation of Notch signaling as Notch is also a substrate for γ-secretase-mediated cleavage. Thus, Notch- sparing γ-secretase inhibitors are currently under development in hopes of circumventing possible toxic effects of this class of drugs (Augelli-Szafran et al., 2010). As a result of these recent clinical disappointments, and due to the observation that brain amyloid load does not necessarily correlate with the severity of cognitive deficits in AD (as well as other findings contrary to an amyloid-centric view), some have begun to question whether the amyloid cascade hypothesis is sufficient to explain the underlying pathogenesis of late onset, sporadic AD (Giannakopoulos et al., 2003; Pimplikar et al., 2010; Castellani and Smith, 2011; Karran et al., 2011; Mullane and Williams, 2013; Karran and De Strooper, 2016; Swerdlow et al., 2017; Tse and Herrup, 2017).

The Complex Role Of Reelin In Alzheimer 's Disease. Reelin is a large glycoprotein secreted by specific cells within the central nervous system that plays a key role in patterning and layering of the cerebral cortex and other regions of the brain during development. In adults, Reelin plays a central role in processes that influence synapse formation and neuronal plasticity required for learning and memory, such as the regulation of dendritic spine architecture and the maintenance of long term potentiation (Niu et al., 2004; Beffertt al., 2006; Kim et al., 2015; Bosch et al., 2016). Alzheimer's disease is the most prevalent cognitive disorder in adults and is characterized by substantial deficits in learning and memory. The pathological basis of AD is complex and is characterized by the formation of senile plaques made up of misfolded Αβ protein and neurofibrillary tangles consisting of hyper-phosphorylated tau protein. Specific populations of neurons in the brain die in AD including most prominently, forebrain cholinergic neurons, hippocampal neurons, and cortical pyramidal neurons. In particular, neurons of the entorhinal cortex project to the hippocampus and are involved in declarative memory formation and consolidation. Entorhinal cortex layer II neurons provide the principal excitatory glutamatergic input to the dentate gyrus of the hippocampus. The entorhinal cortex layer II neurons are one of the first neuronal populations to die in AD, resulting in a severe loss of synaptic contacts to the dentate gyrus. Many of the entorhinal cortex layer II neurons express Reelin and these Reelin- expressing cells are significantly reduced in the brains of human amyloid precursor protein (hAPP) transgenic mice expressing the Swedish and Indiana mutant form of the hAPP gene (J20 strain). In accordance with the loss of these Reelin-expressing entorhinal cortex layer II neurons, Reelin levels in the hippocampus of J20 mice are also significantly reduced, compared to nontransgenic controls (Chin et al., 2007). Similar loss of Reelin-expressing entorhinal cortex layer II neurons is also observed in the brains of patients with AD (Chin et al., 2007; Herring et al., 2012). Finally, in a transgenic rat model of AD (McGill-R-Thyl-APP strain), Reelin- expressing neurons of the entorhinal cortex layer II were found to selectively express increased levels of soluble intracellular Αβ early in disease, prior to the deposition of amyloid plaques (Kobro-Flatmoen et al., 2016). Collectively, these studies suggest that Reelin-expressing neurons of entorhinal cortex layer II play a central role in the early pathogenic changes in AD and loss of these Reelin-expressing cells and their synaptic projections to the hippocampus are early markers of disease (Krstic et al., 2013). Thus deficits in Reelin signaling to the hippocampus likely underlie some of the cognitive deficits observed in patients with AD (Cuchillo-Ibanez et al., 2016; Yu et al., 2016). A Brief Overview Of Reelin Signaling. Reelin is secreted into the extracellular space where it interacts with one of two cell surface receptors on target cells, either the very low density lipoprotein receptor (VLDLR) or the apolipoprotein E receptor-2 (ApoER2). Upon binding its receptor, Reelin induces tyrosine phosphorylation of the adapter protein, Disabled-1 (DAB1), via the nonreceptor tyrosine kinases, Src or Fyn. Phosphorylated DAB1 acts as a docking site to initiate multiple downstream signal transduction cascades such as those involved in cell survival (PI3K/AKT) and regulation of actin assembly (Cdc42/PAK/cofilin) (Fig. 13) (Wasser and Herz, 2017).

The pathway shown in Figure 13 represents the canonical Reelin signaling pathway and is the one most commonly attributed to Reelin' s actions in the central nervous system. However, other (non-canonical) Reelin signaling pathways do exist, as well as additional Reelin receptors (Bock and May, 2016; Lee and D'Arcangelo, 2016).

Modulation Of Reelin Expression And Signaling As A Means Of Altering The Course Of

Alzheimer 's Disease. As noted above, Reelin-expressing cells of the entorhinal cortex layer II are significantly reduced in the brains of hAPP transgenic mice expressing the Swedish and Indiana mutant form of the hAPP gene (J20 strain). In accordance with the loss of these Reelin- expressing entorhinal cortex layer II neurons, Reelin levels in the hippocampus of J20 mice are also significantly reduced, compared to nontransgenic controls. Moreover, further reducing Reelin in these mice by crossing J20 AD model mice with heterozygous reeler mice accelerates amyloid plaque formation and tau pathology (Kocherhans et al., 2010). On the other hand, Reelin overexpression in J20 AD model mice significantly delays Αβ fibril formation and rescues cognitive deficits in these mice (Pujadas et al., 2014). Thus, J20 mice are an established model of familial AD and the disease course of these mice is significantly impacted by alterations in Reelin expression, making this an excellent model system to investigate the effects of Immunocal® on these processes. The whey protein supplement, Immunocal®, is a rich source of the glutathione precursor, cysteine, and is known to boost antioxidant levels in vivo. In addition, as described in detail hereinabove, in a schizophrenia mouse model characterized by low Reelin levels, Immunocal® elevated Reelin in the brain.

Loss of Reelin-expressing entorhinal cortex layer II neurons has also been observed in the brains of patients with AD, and therefor studies investigating whether Immunocal® elevates Reelin expression and signaling in the entorhinal cortex -hippocampus of J20 mice and mitigates cognitive dysfunction in these animals, was performed as described herein..

The present studies have been performed determine if supplementation with a whey protein isolate such as Immunocal® increases Reelin expression in vitro in a hippocampal-entorhinal cortex slice model and in vivo within the brain of an Alzheimer's disease mouse model (J20 strain). In addition, Immunocal® administration to J20 AD model mice studies were performed to determine whether enhanced cognitive function and diminished amyloid load would be observed when compared to untreated mice.

Experimental Methods and Results I. In vitro studies

Experimental model: The effects of Immunocal® on Reelin expression in vitro were investigated. Organotypic hippocampal-entorhinal cortex slices prepared from postnatal day 25 rats were utilized. Brain slices were prepared using a vibrating microtome essentially as described by Leutgeb et al. (2003).

Treatment and analysis of brain slices: Hippocampal-entorhinal cortex slices (~400micron thickness) were cultured in a humidified incubator in tissue culture medium with 5% C0 ₂ /95% air at 37°C. After equilibration overnight, slices were subsequently treated with either culture medium alone or containing Immunocal® (3.3% w/v) for 24h, followed by measurement of Reelin expression assessed at the mRNA level using quantitative real-time polymerase chain reaction (qPCR) and at the protein level using western blotting. In addition, the expression of Reelin within entorhinal cortex layer II neurons was evaluated specifically using immunofluorescence microscopy after co-staining slices for Reelin and NeuN. As a control to assess viability of the slices and functionality of the Reelin signaling pathway, DABl was immunoprecipitated and tyrosine phosphorylation of this adapter protein was measured by western blotting following incubation with recombinant Reelin.

Results: Incubation of hippocampal-entorhinal cortex slices with recombinant Reelin for 24h induced a marked increase in the tyrosine phosphorylation of the adapter protein DABl (Figure 14A). This result demonstrates two points; first, the brain slices were viable under the incubation conditions used and second, the Reelin signaling pathway is intact in the slice culture as addition of recombinant Reelin stimulated (Src/Fyn-dependent) tyrosine phosphorylation of DABl via binding to its cell surface receptors. Next, hippocampal-entorhinal cortex slices were incubated for 24h in either tissue culture medium alone or containing Immunocal®. Immunocal® treatment induced an increase in the full length Reelin protein (388kDa) and in two prominent Reelin cleavage products (310kDa and 180kDa) (Figure 14B). In addition, the Reelin transcript was measured by qPCR after incubation of brain slices in control medium, medium containing Immunocal®, recombinant Reelin, or a combination of the two. Incubation with Immunocal® induced a statistically significant, approximately two-fold increase in Reelin mRNA transcript levels in either the absence or presence of recombinant Reelin protein (Figure 15). Incubation with recombinant Reelin protein alone had no significant effect on the amount of Reelin transcript detected in the slices, although a trend towards decreased Reelin mRNA levels was observed under these conditions.

Next, the effects of Immunocal® treatment on Reelin expression were assessed in hippocampal- entorhinal cortex slices by co-staining for Reelin and NeuN using specific antibodies and immunofluorescence microscopy. Incubation of brain slices with Immunocal® induced a striking increase in Reelin immunoreactivity in the entorhinal cortex, dentate gyrus, and CA1 region of the hippocampus (Figure 16). Some, but not all, of the Reelin positive cells also co-stained for NeuN.

II. In vivo studies

Experimental model: To investigate the effects of Immunocal® on Reelin expression in vivo, the hAPP(Swe/Ind) mutant transgenic mouse model of AD (J20 strain) was utilized. This mouse model is commercially available from Jackson Laboratories (B6.Cg-Tg(PDGFB-APPSwInd) 20Lms/2Mmjax) and displays significant brain pathology, amyloid plaques, and cognitive deficits that recapitulates multiple aspects of AD in humans (Mucke et al., 2000; Karl et al., 2012; Diaz-Hernandez et al., 2012). According to previous reports, these transgenic mice typically show significant cognitive deficits, diminished numbers of Reelin-positive, entorhinal cortex layer II neurons, and decreased Reelin expression in the hippocampus by approximately 4-5 months of age. Amyloid plaques are visible in the brains of these mice by around 12 months of age. All animal studies were conducted in accordance with a protocol approved by the University of Denver Institutional Animal Care and Use Committee.

Studies were performed to determine whether Immunocal® treatment would rescue the Reelin- expressing neurons of the entorhinal cortex layer II and as a result, enhance Reelin expression and signaling in the hippocampus of J20 AD model mice. As well, studies were performed to investigate whether Immunocal® treatment corrects or delays the cognitive deficits observed in J20 AD model mice.

Immunocal® treatment: To perform these studies, three groups of mice were used: hAPP(Swe/Ind) mutant hemizygous mice (J20 strain) treated with Immunocal® (3.3% w/v in drinking water ad libitum, as previously described by Ross et al., 2014), untreated hemizygous J20 mice, and untreated nontransgenic (non-carrier) control mice. Immunocal® treatment was initiated at 3 months-old and continued until the mice were 5 months-old.

Behavioral cognitive testing: During the final week of treatment, mice were evaluated for spatial learning and memory performance using the Barnes maze (Figure 17). The mice were subjected to a six-day acquisition phase followed by a single day of probe testing, as previously described by Mouzon et al. (2012).

Immunostaining and western blotting for Reelin and its signaling pathway components: Following behavioral testing, mice were euthanized and biochemical and immunohistochemical analysis was conducted on brain tissue to evaluate Reelin-expressing neurons in the entorhinal cortex layer II and Reelin expression and signaling in the dentate gyrus, CA1, and CA3 of the hippocampus. For western blotting, brains were micro-dissected to obtain tissue samples enriched for the hippocampal-entorhinal cortex architecture. For immunofluorescence staining of brain tissue, a composite of several sections from a single non-carrier control mouse stained for Reelin, NeuN, and Draq (a nuclear stain) is shown in Figure 18 to demonstrate the type of staining that was obtained and to orient the reader to the architecture of the hippocampal- entorhinal cortex region.

Analysis of brain GSH by HPLC with electrochemical detection (HPLC-ECD): Tissue processing

Cortical tissue was obtained from mice and immediately frozen in liquid nitrogen. For HPLC- ECD analysis, 2.5M perchloric acid was added and the brains were roughly chopped using pointed surgical scissors. Samples were then sonicated 3 times for 15s intervals. Samples were then centrifuged for 5min at 13,000rpm and the supernatant was removed. A 20μΙ. aliquot of the supernatant was used for a BCA protein assay. The remainder of each solution was neutralized with 500μΙ. of 4M KOH and vortexed thoroughly. Samples were then centrifuged for 15min at 13,000rpm, and stored at -80°C until separation and analysis by HPLC-ECD.

HPLC-ECD

GSH in samples and known standards were separated by reversed-phase HPLC on a CI 8 bonded silica column at 35°C (5μιη, 4.6 x 250mm) from Dionex, Inc. (Sunnyvale, CA). Analytes were detected using a CoulArray® detector (model 5600, ESA) on three coulometric array cells in series; electrochemical detectors were set between 0 and 900mV at increments of 75mV. Concentrations were determined with a standard curve of each identified analyte. Mobile phase consisted of 50mM lithium acetate and 1% acetonitrile in water, pH 3.8. The flow rate was set to 0.4mL/min for all samples. CoulArray® software was used for baseline correction and peak analysis. Results: First, the brain levels of reduced GSH in cortical tissue from the mice were measured using HPLC-ECD. Untreated hemizygous J20 mice displayed a statistically significant decrease in cortical GSH at 5 months-old when compared to non-carrier control mice (Figure 19). However, hemizygous J20 mice treated with Immunocal® from 3 months-old to 5 months-old showed a complete preservation of cortical GSH which was statistically significantly greater than the levels observed in untreated hemizygous mice (Figure 19). Thus, Immunocal® treatment corrected a deficit in brain GSH observed in AD model mice.

The expression of Reelin and the glutamic acid decarboxylase protein (GAD67) was next evaluated by western blotting of mouse brain lysates. GAD67 is expressed in GABAergic neurons and its expression is regulated in a manner parallel with Reelin. For example, both Reelin and GAD67 expression are significantly decreased in the prefrontal cortex of patients with schizophrenia and both gene promoters are similarly regulated by drugs that influence epigenetic modifications such as DNA methyltransferase inhibitors and histone deacetylase inhibitors (Guidotti et al., 2000; Kundakovic et al., 2009). Brain lysates enriched for the hippocampal-entorhinal cortex sub-region were immunoblotted for Reelin and GAD67. Reelin expression was significantly reduced in untreated hemizygous J20 AD mice compared to non- carrier controls and Immunocal® treatment largely corrected this deficiency (Figure 20A). Only the 180 kDa cleavage fragment of Reelin was detected in these mouse brain lysates. Quantitative densitometric analysis of the 180 kDa Reelin band revealed an approximate 50% reduction in Reelin protein expression in hemizygous untreated AD mice compared to non-carrier controls, and a complete preservation of Reelin expression in Immunocal®-treated mice (Figure 20A, graph). The Reelin blots were stripped and reprobed for the inner mitochondrial membrane protein, OPA1, initially as a loading control. Interestingly, OPA1 levels were substantially reduced in 5 -month-old hemizygous J20 mice when compared to non-carrier control mice. We have previously shown OPA1 to be susceptible to cleavage and degradation in the brains of old mice and rats (Gray et al., 2013). Nonetheless, Immunocal® treatment did not appear to rescue OPA1 levels in the brains of hemizygous J20 mice as evidenced by both untreated and Immunocal®-treated hemizygous mice displaying equivalent amounts of this mitochondrial protein in brain lysates (Figure 20A). Thus, the changes observed in Reelin expression in these same brain lysates were not due to discrepancies in protein loading. The expression of GAD67 was somewhat variable between untreated hemizygous AD mice and non-carrier control mice; however, Immunocal® treatment of hemizygous mice markedly increased GAD67 protein levels (Figure 20B).

One of the principal transcription factors known to regulate Reelin expression is the cAMP response element-binding protein (CREB) (Grayson et al., 2006). Therefore, the phosphorylation of CREB on Serl33 (p-CREB) which is necessary for its transcriptional activity was evaluated. Brain lysates enriched for the hippocampal-entorhinal cortex sub-region were immunoblotted for p-CREB. Phosphorylation of CREB on Serl33 was relatively high in non-carrier control mice but was dramatically reduced in hemizygous untreated J20 AD mice (Figure 21). Treatment of hemizygous J20 mice with Immunocal® from 3 months-old to 5 months-old resulted in a nearly complete preservation of p-CREB expression in the hippocampal-entorhinal cortex sub-region (Figure 21). Thus, Immunocal® treatment corrected a major deficiency in brain p-CREB observed in AD model mice.

Next, immunofluorescence microscopy was used to evaluate Reelin expression in the entorhinal cortex, dentate gyrus, and CA1/CA3 regions of the hippocampus in J20 AD model mice. The entorhinal cortex of non-carrier control mice showed significant Reelin immunoreactivity, particularly in layer II, the area demarcated in the middle panels of Figure 22 and reproduced in the lower panels. In comparison to the non-carrier control, untreated hemizygous J20 AD mice displayed a marked (-30%) reduction in Reelin immunoreactivity in layer II of entorhinal cortex. The measured reduction in Reelin immunoreactivity is comparable to previously reported reductions in Reelin positive layer II neurons in 6-7 month-old J20 mice (Chin et al., 2007). Intriguingly, treatment with Immunocal® from 3 months-old to 5 months-old essentially rescued this deficit in Reelin expression within layer II of the entorhinal cortex of J20 AD mice (Figure 22). Next, Reelin staining in the dentate gyrus and CA1/CA3 regions of the hippocampus in J20 AD model mice was assessed. In the dentate gyrus, Reelin expression was diffuse and moderate in intensity in non-carrier control mice (Figure 23). Untreated hemizygous J20 AD mice showed a slight overall reduction in Reelin staining in the dentate gyrus, whereas Immunocal®-treated hemizygous J20 mice displayed a striking increase in the intensity of Reelin staining in this brain region (Figure 23).

In the CA1 region of the hippocampus, Reelin expression was very high in non-carrier control mice and was markedly reduced in untreated hemizygous J20 AD mice (Figure 24). Notably, this deficit in Reelin staining was essentially prevented by treatment of hemizygous J20 mice with Immunocal® for 2 months (Figure 24). A very similar effect on Reelin expression was observed in the CA3 region of the hippocampus. In particular, Reelin expressing neurons in the middle section of this sub-region were particularly evident in non-carrier control mice, essentially absent in untreated hemizygous J20 AD mice, and largely preserved in Immunocal®-treated J20 mice (Figure 25). Next, GAD67 staining and Reelin co-staining with phospho-DABl in the dentate gyrus and CA1/CA3 regions of the hippocampus in J20 AD model mice was evaluated. GAD67 staining in the dentate gyrus of non-carrier control mice was relatively diffuse and the overall intensity was somewhat diminished in untreated hemizygous J20 AD mice (Figure 26). In contrast, GAD67 staining was markedly increased in the dentate gyrus of hemizyous J20 mice which had been treated with Immunocal® (Figure 26). A similar pattern of GAD67 staining in the CA3 region of the hippocampus was observed. In particular, there were several prominent GAD67 expressing neurons clearly visible in the middle section of the CA3 region of non-carrier control mice (Figure 27). These GAD67-positive cells were essentially absent from the CA3 of untreated hemizygous J20 AD mice, while Immunocal treatment largely rescued GAD67 expression in this region (Figure 27). Finally, co-staining of Reelin and phospho-DABl (pTyr232; a Src/Fyn phosphorylation site) in the CA1 region of the hippocampus in J20 AD model mice was evaluated. Compared to non-carrier control mice, untreated hemizygous J20 AD mice displayed a subtle decrease in the intensity of Reelin and phospho-DABl co-staining in the CA1 (Figure 28). In contrast, Immunocal® treatment for two months induced a marked increase in Reelin and phospho-DAB 1 co-staining in this region of the hippocampus of hemizygous J20 mice (Figure 28).

Finally, the effects of Immunocal® treatment were evaluated for two months on cognitive function in J20 AD model mice at approximately 5 months of age. In particular, the Barnes maze was utilized to test for spatial learning and memory performance. During the six-day acquisition phase, mice in all groups progressively learned to find the escape pod on the maze. No significant differences were observed between groups in the time delay to find the escape pod on days 1-4 of the acquisition phase. However, on days 5 and 6 of the acquisition phase (combined), the Immunocal®-treated, hemizygous J20 female mice were significantly quicker at finding the escape pod than the untreated hemizygous female group (Figure 29A). Moreover, during the probe phase, the untreated hemizygous female mice were significantly slower than the non- carrier female group at finding the escape pod and this deficit was corrected in the Immunocal® treated hemizygous female group (Figure 29B).

Previous work has shown that deficits in Reelin expression and/or Reelin signaling play a pathogenic role in several nervous system disorders including schizophrenia and AD. Thus, strategies aimed at correcting these deficits are desirable in this field of study. The cysteine-rich, whey protein supplement, Immunocal®, has been shown to elevate glutathione in the brain and spinal cord, and is neuroprotective and therapeutically efficacious in mouse models of schizophrenia and amyotrophic lateral sclerosis (Ross et al., 2014; examples above). As described hereinabove, Immunocal® treatment is shown to rescue Reelin expression at the mRNA and protein level in the prefrontal cortex of a mouse model of schizophrenia. Given that Reelin expressing neurons of the entorhinal cortex layer II are a highly vulnerable population of cells that are lost very early in AD, the effects of Immunocal® on Reelin expression and signaling in vitro in hippocampal -entorhinal cortex rat brain slices and in vivo in the hAPPSwelnd mutant (J20) mouse model of AD was investigated in the experiments provided herein.

Incubation of hippocampal -entorhinal cortex slices with Immunocal® increased Reelin expression at the mRNA and protein levels, as assessed by qPCR and western blotting. In addition, immunostaining of slices revealed a striking increase in the intensity and number of neurons staining positively for Reelin within the entorhinal cortex, dentate gyrus and CA1 region of the hippocampus following Immunocal® treatment in vitro.

The effects of Immunocal® treatment in vivo was next evaluated by treating hemizygous J20 AD mice from 3 months-old to 5 months-old. Reelin expression and signaling was assessed by western blotting and immunofluorescence microscopy and cognitive function using the Barnes maze was also measured to test spatial learning and memory. In the studies described herein, Immunocal® treatment corrected a deficit in cortical GSH levels observed in the brains of untreated hemizygous J20 mice. Western blotting of brain sections micro-dissected to enrich for the hippocampal-entorhinal cortex sub-region revealed a decrease in Reelin and GAD67 expression in untreated hemizygous J20 AD mice compared to non-carrier control mice and these effects were prevented by treatment with Immunocal®. In addition, untreated hemizygous J20 AD mice displayed a marked reduction in p-CREB immunoreactivity in the hippocampal- entorhinal cortex sub-region of the brain and this deficit was essentially rescued by treatment with Immunocal®. In a similar manner, using immunofluorescence microscopy, Reelin expression was diminished in the entorhinal cortex, dentate gyrus and CA1/CA3 regions of the hippocampus in untreated hemizygous J20 AD mice compared to non-carrier control mice. In contrast, Immunocal® treatment largely rescued these deficits in Reelin expression and in some cases, markedly increased the expression of Reelin even above what was observed in the non- carrier control mice. In particular, Immunocal® treated J20 mice displayed robust Reelin staining in layer II of entorhinal cortex, apparently rescuing the loss of Reelin positive neurons observed in this brain region in untreated J20 AD mice. In parallel with the observed rescue of Reelin expression in the hippocampus-entorhinal cortex of J20 mice, Immunocal® also preserved GAD67 expression in the dentate gyrus and CA3 region of the hippocampus and markedly enhanced the co-staining of Reelin and phospho-DABl in the CA1 of these mice. Further, Immunocal® treatment had a statistically significant positive effect on Barnes maze performance, both during the late stages of the acquisition phase and during the probe phase, in female, hemizygous J20 AD mice. Collectively, these findings indicate that treatment with Immunocal® induces Reelin expression in vitro in hippocampal-entorhinal cortex brain slices and rescues Reelin expression and signaling in vivo within the entorhinal cortex and hippocampus of the J20 mouse model of AD in these studies. Table 3: References Cited in Example 3

References cited in Table 3 abvoe, and those cited elsewhere herein, are herein incorporated by reference in their entireties.

REFERENCES

1. Albayrak Y, Akyol ES, Beyazyuz M, Baykal S, Kuloglu M. Neurological soft signs might be endophenotype candidates for patients with deficit syndrome schizophrenia. Neuropsychiatr Dis Treat 2015; 11 :2825-2831. 2. Waxman J, Van Lieshout RJ, Schmidt LA. Early adversity and mental health: linking extremely low birth weight, emotion regulation, and internalizing disorders. Curr Pediatr Rev 2014; 10:208-215.

3. Provencal N, Binder EB. The effects of early life stress on the epigenome: From the womb to adulthood and even before. Experimental neurology 2014;268: 10-20. 4. Do KQ, Cuenod M, Hensch TK. Targeting Oxidative Stress and Aberrant Critical Period Plasticity in the Developmental Trajectory to Schizophrenia. Schizophr Bull 2015;41 :835-846.

5. Meyer U, Feldon J, Schedlowski M, Yee BK. Immunological stress at the maternal -foetal interface: a link between neurodevelopment and adult psychopathology. Brain Behav Immun 2006;20:378-388. 6. Kirsten TB, Chaves-Kirsten GP, Bernardes S, et al. Lipopolysaccharide Exposure Induces Maternal Hypozincemia, and Prenatal Zinc Treatment Prevents Autistic-Like Behaviors and Disturbances in the Striatal Dopaminergic and mTOR Systems of Offspring. PLoS One 2015; 10:e0134565.

7. Galvao MC, Chaves-Kirsten GP, Queiroz-Hazarbassanov N, Carvalho VM, Bernardi MM, Kirsten TB. Prenatal zinc reduces stress response in adult rat offspring exposed to lipopolysaccharide during gestation. Life Sci 2014; 120:54-60.

8. Zappitelli M, Pinto T, Grizenko N. Pre-, peri-, and postnatal trauma in subjects with attention-deficit hyperactivity disorder. Can J Psychiatry 2001;46:542-548.

9. Song W, Zukor H, Lin SH, et al. Schizophrenia-like features in transgenic mice overexpressing human HO-1 in the astrocytic compartment. The Journal of neuroscience : the official journal of the Society for Neuroscience 2012;32: 10841-10853.

10. Song W, Zukor H, Lin SH, et al. Unregulated brain iron deposition in transgenic mice over-expressing HMOX1 in the astrocytic compartment. J Neurochem 2012; 123 :325-336.

11. Koga M, Serritella AV, Sawa A, Sedlak TW. Implications for reactive oxygen species in schizophrenia pathogenesis. Schizophr Res 2015.

12. Magalhaes PV, Dean O, Andreazza AC, Berk M, Kapczinski F. Antioxidant treatments for schizophrenia. Cochrane Database Syst Rev 2016;2:CD008919.

13. Corcoba A, Steullet P, Duarte JM, et al. Glutathione Deficit Affects the Integrity and Function of the Fimbria/Fornix and Anterior Commissure in Mice: Relevance for Schizophrenia. Int J Neuropsychopharmacol 2015.

14. Yao JK, Keshavan MS. Antioxidants, redox signaling, and pathophysiology in schizophrenia: an integrative view. Antioxid Redox Signal 2011; 15:2011-2035.

15. Micke P, Beeh KM, Buhl R. Effects of long-term supplementation with whey proteins on plasma glutathione levels of HIV-infected patients. Eur J Nutr 2002;41 : 12-18. 16. Micke P, Beeh KM, Schlaak JF, Buhl R. Oral supplementation with whey proteins increases plasma glutathione levels of HIV-infected patients. Eur J Clin Invest 2001;31 : 171-178.

17. Kelly KM. Bringing evidence to complementary and alternative medicine in children with cancer: Focus on nutrition-related therapies. Pediatr Blood Cancer 2008;50:490-493; discussion 498. 18. Grey V, Mohammed SR, Smountas AA, Bahlool R, Lands LC. Improved glutathione status in young adult patients with cystic fibrosis supplemented with whey protein. J Cyst Fibros 2003;2: 195-198.

19. Bounous G, Letourneau L, Kongshavn PA. Influence of dietary protein type on the immune system of mice. The Journal of nutrition 1983; 113 : 1415-1421. 20. Wong CW, Watson DL. Immunomodulatory effects of dietary whey proteins in mice. The Journal of dairy research 1995;62:359-368.

21. Low PP, Rutherfurd KJ, Gill HS, Cross ML. Effect of dietary whey protein concentrate on primary and secondary antibody responses in immunized BALB/c mice. International immunopharmacology 2003;3 :393-401.

22. Karelis AD, Messier V, Suppere C, Briand P, Rabasa-Lhoret R. Effect of cysteine-rich whey protein (immunocal(R)) supplementation in combination with resistance training on muscle strength and lean body mass in non-frail elderly subjects: a randomized, double-blind controlled study. The journal of nutrition, health & aging 2015; 19:531-536. 23. Lands LC, Grey VL, Smountas AA. Effect of supplementation with a cysteine donor on muscular performance. Journal of applied physiology 1999;87: 1381-1385.

24. Ross EK, Gray JJ, Winter AN, Linseman DA. Immunocal(R) and preservation of glutathione as a novel neuroprotective strategy for degenerative disorders of the nervous system. Recent patents on CNS drug discovery 2012;7:230-235. 25. Pinna G, Agis-Balboa RC, Zhubi A, et al. Imidazenil and diazepam increase locomotor activity in mice exposed to protracted social isolation. Proc Natl Acad Sci U S A 2006;103 :4275- 4280.

26. Wood GK, Tomasiewicz H, Rutishauser U, et al. NCAM-180 knockout mice display increased lateral ventricle size and reduced prepulse inhibition of startle. Neuroreport 1998;9:461-466.

27. Fenton H, Finch PW, Rubin JS, et al. Hepatocyte growth factor (HGF/SF) in Alzheimer's disease. Brain Res 1998;779:262-270.

28. Laplante F, Srivastava LK, Quirion R. Alterations in dopaminergic modulation of prefrontal cortical acetylcholine release in post-pubertal rats with neonatal ventral hippocampal lesions. J Neurochem 2004;89:314-323. 29. Sanz-Alfayate G, Obeso A, Agapito MT, Gonzalez C. Reduced to oxidized glutathione ratios and oxygen sensing in calf and rabbit carotid body chemoreceptor cells. J Physiol 2001;537:209-220.

30. Palkovits M. Isolated removal of hypothalamic or other brain nuclei of the rat. Brain Res 1973;59:449-450.

31. Kilts CD, Anderson CM. The simultaneous quantification of dopamine, norepinephrine and epinephrine in micropunched rat brain nuclei by on-line trace enrichment HPLC with electrochemical detection: Distribution of catecholamines in the limbic system. Neurochem Int 1986;9:437-445. 32. Gratton A, Hoffer BJ, Gerhardt GA. In vivo electrochemical studies of monoamine release in the medial prefrontal cortex of the rat. Neuroscience 1989;29:57-64.

33. Hibbeler S, Scharsack JP, Becker S. Housekeeping genes for quantitative expression studies in the three-spined stickleback Gasterosteus aculeatus. BMC Mol Biol 2008;9: 18.

34. Mak SK, McCormack AL, Langston JW, Kordower JH, Di Monte DA. Decreased alpha- synuclein expression in the aging mouse substantia nigra. Experimental neurology

2009;220:359-365.

35. Humphreys DT, Hynes CJ, Patel HR, et al. Complexity of murine cardiomyocyte miRNA biogenesis, sequence variant expression and function. PLoS One 2012;7:e30933.

36. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-408.

37. Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ. miRBase: tools for microRNA genomics. Nucleic Acids Res 2008;36:D154-158.

38. Franklin KB J, Paxinos G. Paxinos and Franklin's The mouse brain in stereotaxic coordinates, Fourth edition, ed. Amsterdam: Academic Press, an imprint of Elsevier, 2013.

Aasen I, Kolli L, Kumari V. Sex effects in prepulse inhibition and facilitation of the acoustic startle response: implications for pharmacological and treatment studies. J Psychopharmacol 2005; 19:39-45.

40. Braff DL, Light GA, Ellwanger J, Sprock J, Swerdlow NR. Female schizophrenia patients have prepulse inhibition deficits. Biological psychiatry 2005;57:817-820. 41. Suddath RL, Christison GW, Torrey EF, Casanova MF, Weinberger DR. Anatomical abnormalities in the brains of monozygotic twins discordant for schizophrenia. The New England journal of medicine 1990;322:789-794.

42. Scheibel AB, Conrad AS. Hippocampal dysgenesis in mutant mouse and schizophrenic man: is there a relationship? Schizophr Bull 1993; 19:21-33. 43. Jakob H, Beckmann H. Prenatal developmental disturbances in the limbic allocortex in schizophrenics. J Neural Transm 1986;65:303-326.

44. Magdaleno SM, Curran T. Brain development: integrins and the Reelin pathway. Curr Biol 2001;11 :R1032-1035.

45. Kundakovic M, Chen Y, Guidotti A, Grayson DR. The reelin and GAD67 promoters are activated by epigenetic drugs that facilitate the disruption of local repressor complexes. Mol

Pharmacol 2009;75:342-354.

46. Kirov G, Rujescu D, Ingason A, Collier DA, O'Donovan MC, Owen MJ. Neurexin 1 (NRXN1) deletions in schizophrenia. Schizophr Bull 2009;35:851-854.

47. Kumar RA, Christian SL. Genetics of autism spectrum disorders. Curr Neurol Neurosci Rep 2009;9: 188-197.

48. Morrow EM, Yoo SY, Flavell SW, et al. Identifying autism loci and genes by tracing recent shared ancestry. Science 2008;321 :218-223.

49. Kim HG, Kishikawa S, Higgins AW, et al. Disruption of neurexin 1 associated with autism spectrum disorder. Am J Hum Genet 2008;82: 199-207. 50. Marshall CR, Noor A, Vincent JB, et al. Structural variation of chromosomes in autism spectrum disorder. Am J Hum Genet 2008;82:477-488.

51. Weiss LA, Shen Y, Korn JM, et al. Association between microdeletion and mi crodupli cation at 16pl l .2 and autism. The New England journal of medicine 2008;358:667- 675.

52. Sun C, Cheng MC, Qin R, et al. Identification and functional characterization of rare mutations of the neuroligin-2 gene (NLGN2) associated with schizophrenia. Hum Mol Genet 2011;20:3042-3051.

53. Yin J, Lin J, Luo X, et al. miR-137: a new player in schizophrenia. International journal of molecular sciences 2014; 15:3262-3271.

54. Saba R, Storchel PH, Aksoy-Aksel A, et al. Dopamine-regulated microRNA MiR-181a controls GluA2 surface expression in hippocampal neurons. Mol Cell Biol 2012;32:619-632.

55. Kim AH, Reimers M, Maher B, et al. MicroRNA expression profiling in the prefrontal cortex of individuals affected with schizophrenia and bipolar disorders. Schizophr Res 2010; 124: 183-191.

56. Moreau MP, Bruse SE, David-Rus R, Buyske S, Brzustowicz LM. Altered microRNA expression profiles in postmortem brain samples from individuals with schizophrenia and bipolar disorder. Biological psychiatry 2011;69: 188-193.

57. Lin SH, Song W, Cressatti M, Zukor H, Wang E, Schipper HM. Heme oxygenase-1 modulates microRNA expression in cultured astroglia: implications for chronic brain disorders.

Glia 2015;63 : 1270-1284.

58. Adlakha YK, Saini N. Brain microRNAs and insights into biological functions and therapeutic potential of brain enriched miRNA-128. Mol Cancer 2014; 13 :33.

59. Beveridge NJ, Cairns MJ. MicroRNA dysregulation in schizophrenia. Neurobiol Dis 2012;46:263-271. 60. Magenta A, Cencioni C, Fasanaro P, et al. miR-200c is upregulated by oxidative stress and induces endothelial cell apoptosis and senescence via ZEBl inhibition. Cell Death Differ 2011; 18: 1628-1639.

61. Stary CM, Xu L, Sun X, et al. MicroRNA-200c contributes to injury from transient focal cerebral ischemia by targeting Reelin. Stroke; a journal of cerebral circulation 2015;46:551-556.

62. Flurkey K, Currer JM, Harrison DE. The Mouse in Aging Research. In: Fox JG, ed. The Mouse in Biomedical Research 2nd Edition. Burlington: Elsevier, 2007: 637-672.

63. Szymanski S, Lieberman JA, Alvir JM, et al. Gender differences in onset of illness, treatment response, course, and biologic indexes in first-episode schizophrenic patients. Am J Psychiatry 1995; 152:698-703.

64. Innamorato NG, Jazwa A, Rojo Al, et al. Different susceptibility to the Parkinson's toxin MPTP in mice lacking the redox master regulator Nrf2 or its target gene heme oxygenase-1. PLoS One 2010;5:el l838.

65. Van Der Heyden JC, Rotteveel JJ, Wevers RA. Decreased homovanillic acid concentrations in cerebrospinal fluid in children without a known defect in dopamine metabolism. Eur J Paediatr Neurol 2003;7:31-37.

66. Lambert GW, Eisenhofer G, Jennings GL, Esler MD. Regional homovanillic acid production in humans. Life Sci 1993;53 :63-75.

67. Harrison PJ. The hippocampus in schizophrenia: a review of the neuropathological evidence and its pathophysiological implications. Psychopharmacology (Berl) 2004;174: 151-

162.

68. Robbins TW, Jones GH, Wilkinson LS. Behavioural and neurochemical effects of early social deprivation in the rat. J Psychopharmacol 1996; 10:39-47.

69. Slifstein M, van de Giessen E, Van Snellenberg J, et al. Deficits in prefrontal cortical and extrastriatal dopamine release in schizophrenia: A positron emission tomographic functional magnetic resonance imaging study. JAMA Psychiatry 2015;72:316-324.

70. Wearne TA, Mirzaei M, Franklin JL, Goodchild AK, Haynes PA, Cornish JL. Methamphetamine-induced sensitization is associated with alterations to the proteome of the prefrontal cortex: implications for the maintenance of psychotic disorders. J Proteome Res 2014. 71. Edwards BG, Barch DM, Braver TS. Improving prefrontal cortex function in schizophrenia through focused training of cognitive control. Front Hum Neurosci 2010;4:32.

72. Sumiyoshi T, Stockmeier CA, Overholser JC, Dilley GE, Meltzer HY. SerotoninlA receptors are increased in postmortem prefrontal cortex in schizophrenia. Brain research 1996;708:209-214. 73. Hashimoto T, Nishino N, Nakai H, Tanaka C. Increase in serotonin 5-HT1A receptors in prefrontal and temporal cortices of brains from patients with chronic schizophrenia. Life sciences 1991;48:355-363.

74. Kapur S, Remington G. Serotonin-dopamine interaction and its relevance to schizophrenia. Am J Psychiatry 1996; 153 :466-476. 75. Torrey EF, Barci BM, Webster MJ, Bartko JJ, Meador-Woodruff JH, Knable MB. Neurochemical markers for schizophrenia, bipolar disorder, and major depression in postmortem brains. Biological psychiatry 2005;57:252-260.

76. Wright C, Turner JA, Calhoun VD, Perrone-Bizzozero N. Potential Impact of miR-137 and Its Targets in Schizophrenia. Front Genet 2013;4:58. 77. Abu-Elneel K, Liu T, Gazzaniga FS, et al. Heterogeneous dysregulation of microRNAs across the autism spectrum. Neurogenetics 2008;9: 153-161.

78. Schipper HM, Song W. A Heme Oxygenase- 1 Transducer Model of Degenerative and Developmental Brain Disorders. International journal of molecular sciences 2015; 16:5400-5419.

79. Gresch PJ, Sved AF, Zigmond MJ, Finlay JM. Local Influence of Endogenous Norepinephrine on Extracellular Dopamine in Rat Medial Prefrontal Cortex. Journal of neurochemistry 1995;65: 111-116.

80. Fusar-Poli P, Papanastasiou E, Stahl D, et al. Treatments of Negative Symptoms in Schizophrenia: Meta- Analysis of 168 Randomized Placebo-Controlled Trials. Schizophrenia bulletin 2015;41 :892-899. 81. Tamminga CA, Stan AD, Wagner AD. The hippocampal formation in schizophrenia. Am J Psychiatry 2010; 167: 1178-1193.

82. Walton NM, Zhou Y, Kogan JH, et al. Detection of an immature dentate gyrus feature in human schizophrenia/bipolar patients. Translational psychiatry 2012;2:el35.

83. Brown AS. The environment and susceptibility to schizophrenia. Prog Neurobiol 2011;93 :23-58.

84. King S, St-Hilaire A, Heidkamp D. Prenatal Factors in Schizophrenia. Current Directions in Psychological Science 2010; 19:209-213.

85. Igarashi K, Sun J. The heme-Bachl pathway in the regulation of oxidative stress response and erythroid differentiation. Antioxid Redox Signal 2006;8: 107-118. 86. Nestadt G, Wang Y, Grados MA, et al. Homeobox genes in obsessive-compulsive disorder. Am J Med Genet B Neuropsychiatr Genet 2012; 159B:53-60.

All references cited herein, cited in Tables 1 and 3, and cited elsewhere in the specification are herein incorporated by reference in their entirety.