[0001] This application claims the benefit under 35 U.S.C. § 119(e) of United States Provisional Application Serial Number 63/378,842, filed October 7, 2022, and United States Provisional Application Serial Number 63/580,955, filed September 6, 2023, the contents of which are hereby incorporated by reference in their entirety.

FIELD

[0002] The present disclosure relates generally to small molecule modulators of Sterile Alpha and TIR Motif containing 1 (SARM1) protein, and their use as therapeutic agents.

BACKGROUND

[0003] Neurodegenerative diseases are a class of progressive neurological disorders, in which nerve cells malfunction and ultimately die. The degradation of neurons in those suffering from a neurodegenerative disease can present as a wide variety of symptoms, including changes in mood and behavior, agitation, sensory disturbances, motor and cognitive difficulties, and memory loss, which can progress to inability to move or speak, dementia, and ultimately death.

[0004] Axonal degeneration has been identified as an important pathology in most neurodegenerative diseases. Axons are vulnerable to both mechanical injury (Wallerian degeneration) and disease (Wallerian-like degeneration).

[0005] In healthy axons, SARM1 ’s N-terminus interacts with the TIR domain, preventing TIR multimerization and subsequent enzymatic cleavage of NAD ⁴ ". However, under neuronal injury or disease conditions, SARMl’s N-terminus-TIR domain interaction is disrupted, allowing TIR multimerization to occur, followed by a rapid loss of NAD+ and associated axon degeneration.

DESCRIPTION

[0006] Provided herein are compounds, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, that are useful in treating and/or preventing diseases mediated, at least in part, by SARM1.

[0007] In certain embodiments, provided are compounds that inhibit SARM1.

[0008] In another embodiment, provided is a pharmaceutical composition comprising a compound as described herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, and a pharmaceutically acceptable carrier.

[0009] In another embodiment, provided is a method for treating a disease or condition mediated, at least in part, by SARM1, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof.

[0010] The disclosure also provides compositions, including pharmaceutical compositions, kits that include the compounds, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, methods of using (or administering) and making the compounds, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, and intermediates thereof.

[0011] The disclosure further provides compounds, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, or compositions thereof for use in a method of treating a disease, disorder, or condition that is mediated, at least in part, by SARM1. [0012] Moreover, the disclosure provides uses of the compounds, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, or compositions thereof in the manufacture of a medicament for the treatment of a disease, disorder, or condition that is mediated, at least in part, by SARM1.

[0013] The description herein sets forth exemplary embodiments of the present technology. It should be recognized, however, that such description is not intended as a limitation on the scope of the present disclosure but is instead provided as a description of exemplary embodiments.

1. Definitions

[0014] As used in the present specification, the following words, phrases and symbols are generally intended to have the meanings as set forth below, except to the extent that the context in which they are used indicates otherwise.

[0015] A dash that is not between two letters or symbols is used to indicate a point of attachment for a substituent. For example, -C(O)NH ₂ is attached through the carbon atom. A dash at the front or end of a chemical group is a matter of convenience; chemical groups may be depicted with or without one or more dashes without losing their ordinary meaning. A wavy line or a dashed line drawn through a line in a structure indicates a specified point of attachment of a group. Unless chemically or structurally required, no directionality or stereochemistry is indicated or implied by the order in which a chemical group is written or named.

[0016] The prefix “C _u-v ” indicates that the following group has from u to v carbon atoms. For example, “ C _1-6 alkyl” indicates that the alkyl group has from 1 to 6 carbon atoms.

[0017] Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se. In certain embodiments, the term “about” includes the indicated amount + 10%. In other embodiments, the term “about” includes the indicated amount + 5%. In certain other embodiments, the term “about” includes the indicated amount + 1%. Also, to the term “about X” includes description of “X”. Also, the singular forms “a” and “the” include plural references unless the context clearly dictates otherwise. Thus, e.g., reference to “the compound” includes a plurality of such compounds and reference to “the assay” includes reference to one or more assays and equivalents thereof known to those skilled in the art.

[0018] “Alkyl” refers to an unbranched or branched saturated hydrocarbon chain. As used herein, alkyl has 1 to 20 carbon atoms (i.e., C _1-20 alkyl), 1 to 12 carbon atoms (i.e., C _1-12 alkyl), 1 to 8 carbon atoms (i.e., C _1-8 alkyl), 1 to 6 carbon atoms (i.e., C _1-6 alkyl) or 1 to 4 carbon atoms (i.e., C _1-4 alkyl). Examples of alkyl groups include, e.g., methyl, ethyl, propyl, isopropyl, n-butyl, sec -butyl, iso-butyl, tert-butyl, pentyl, 2-pentyl, isopentyl, neopentyl, hexyl, 2-hexyl, 3-hexyl, and 3-methylpentyl. When an alkyl residue having a specific number of carbons is named by chemical name or identified by molecular formula, all positional isomers having that number of carbons may be encompassed; thus, for example, “butyl” includes n-butyl (i.e., -(CH ₂ ) ₃ CH ₃ ), sec-butyl (i.e., -CH(CH ₃ )CH ₂ CH ₃ ), isobutyl (i.e., -CH ₂ CH(CH ₃ ) ₂ ), and tert-butyl (i.e., -C(CH ₃ ) ₃ ); and “propyl” includes n-propyl (i.e., -(CH ₂ ) ₂ CH ₃ ) and isopropyl (i.e., -CH(CH ₃ ) ₂ ).

[0019] Certain commonly used alternative chemical names may be used. For example, a divalent group such as a divalent “alkyl” group, a divalent “aryl” group, a divalent heteroaryl group, etc., may also be referred to as an “alkylene” group or an “alkylenyl” group (for example, methylenyl, ethylenyl, and propylenyl), an “arylene” group or an “arylenyl” group (for example, phenylenyl or napthylenyl, or quinolinyl for heteroarylene), respectively. Also, unless indicated explicitly otherwise, where combinations of groups are referred to herein as one moiety, e.g., arylalkyl or aralkyl, the last mentioned group contains the atom by which the moiety is attached to the rest of the molecule.

[0020] “Alkenyl” refers to an alkyl group containing at least one (e.g., 1-3 or 1) carbon-carbon double bond and having from 2 to 20 carbon atoms (i.e., C _2-20 alkenyl), 2 to 12 carbon atoms (i.e., C _2-12 alkenyl), 2 to 8 carbon atoms (i.e., C _2-8 alkenyl), 2 to 6 carbon atoms (i.e., C _2-6 alkenyl), or 2 to 4 carbon atoms (i.e., C _2-4 alkenyl). Examples of alkenyl groups include, e.g., ethenyl, propenyl, butadienyl (including 1,2- butadienyl and 1,3-butadienyl).

[0021] “Alkynyl” refers to an alkyl group containing at least one (e.g., 1-3, or 1) carbon-carbon triple bond and having from 2 to 20 carbon atoms (i.e., C _2-20 alkynyl), 2 to 12 carbon atoms (i.e., C _2-12 alkynyl), 2 to 8 carbon atoms (i.e., C _2-8 alkynyl), 2 to 6 carbon atoms (i.e., C _2-6 alkynyl), or 2 to 4 carbon atoms (i.e., C _2-4 alkynyl). The term “alkynyl” also includes those groups having one triple bond and one double bond.

[0022] “Alkoxy” refers to the group “alkyl-O-”. Examples of alkoxy groups include, e.g., methoxy, ethoxy, n-propoxy, iso-propoxy, n-butoxy, tert-butoxy, sec-butoxy, n-pentoxy, n-hexoxy, and 1,2-dimethylbutoxy.

[0023] “Alkoxyalkyl” refers to the group “alkyl-O-alkyl”.

[0024] “Alkylthio” refers to the group “alkyl-S-”. “Alkylsulfinyl” refers to the group “alkyl-S(O)-”. “Alkylsulfonyl” refers to the group “alkyl-S(O) ₂ -”. “Alkylsulfonylalkyl” refers to -alkyl-S(O) ₂ -alkyl.

[0025] “Acyl” refers to a group -C(O)R ^y , wherein R ^y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. Examples of acyl include, e.g., formyl, acetyl, cyclohexylcarbonyl, cyclohexylmethyl-carbonyl, and benzoyl.

[0026] “Amido” refers to both a “C-amido” group which refers to the group -C(O)NR ^y R ^z and an “N- amido” group which refers to the group -NR ^y C(O)R ^z , wherein R ^y and R ^z are independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein, or R ^y and R ^z are taken together to form a cycloalkyl or heterocyclyl; each of which may be optionally substituted, as defined herein.

[0027] “Amino” refers to the group -NR ^y R ^z wherein R ^y and R ^z are independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein.

[0028] “Amidino” refers to -C(NR ^y )(NR ^z 2), wherein R ^y and R ^z are independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein.

[0029] “Aryl” refers to an aromatic carbocyclic group having a single ring (e.g., monocyclic) or multiple rings (e.g., bicyclic or tricyclic) including fused systems. As used herein, aryl has 6 to 20 ring carbon atoms (i.e., C _6-20 aryl), 6 to 12 carbon ring atoms (i.e., C _6-12 aryl), or 6 to 10 carbon ring atoms (i.e., C _6-10 aryl). Examples of aryl groups include, e.g., phenyl, naphthyl, fluorenyl, and anthryl. Aryl, however, does not encompass or overlap in any way with heteroaryl defined below. If one or more aryl groups are fused with a heteroaryl, the resulting ring system is heteroaryl regardless of point of attachment. If one or more aryl groups are fused with a heterocyclyl, the resulting ring system is heterocyclyl regardless of point of attachment. If one or more aryl groups are fused with a cycloalkyl, the resulting ring system is cycloalkyl regardless of point of attachment.

[0030] “Arylalkyl” or “Aralkyl” refers to the group “aryl-alkyl-”.

[0031] “Carbamoyl” refers to both an “O-carbamoyl” group which refers to the group -O-C(O)NR ^y R ^z and an “N-carbamoyl” group which refers to the group -NR ^y C(O)OR ^z , wherein R ^y and R ^z are independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein.

[0032] “Carboxyl ester” or “ester” refer to both -OC(O)R ^X and -C(O)OR ^X , wherein R ^x is alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein.

[0033] “Cyanoalkyl” refers to refers to an alkyl group as defined above, wherein one or more (e.g., 1 or 2) hydrogen atoms are replaced by a cyano (-CN) group.

[0034] “Cycloalkyl” refers to a saturated or partially unsaturated cyclic alkyl group having a single ring or multiple rings including fused, bridged, and spiro ring systems. The term “cycloalkyl” includes cycloalkenyl groups (i.e., the cyclic group having at least one double bond) and carbocyclic fused ring systems having at least one sp ³ carbon atom (i.e., at least one non-aromatic ring). As used herein, cycloalkyl has from 3 to 20 ring carbon atoms (i.e., C _3-20 cycloalkyl), 3 to 14 ring carbon atoms (i.e., C _3-12 cycloalkyl), 3 to 12 ring carbon atoms (i.e., C _3-12 cycloalkyl), 3 to 10 ring carbon atoms (i.e., C _3-10 cycloalkyl), 3 to 8 ring carbon atoms (i.e., C _3-8 cycloalkyl), or 3 to 6 ring carbon atoms (i.e., C _3-6 cycloalkyl). Monocyclic groups include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Polycyclic groups include, for example, bicyclo[2.2.1]heptanyl, bicyclo[2.2.2]octanyl, adamantyl, norbornyl, decalinyl, 7,7-dimethyl-bicyclo[2.2.1]heptanyl, and the like. Further, the term cycloalkyl is intended to encompass any non-aromatic ring which may be fused to an aryl ring, regardless of the attachment to the remainder of the molecule. Still further, cycloalkyl also includes “spirocycloalkyl” when there are two positions for substitution on the same carbon atom, for example spiro[2.5]octanyl, spiro[4.5]decanyl, or spiro[5.5]undecanyl.

[0035] “Cycloalkylalkyl” refers to the group “cycloalkyl-alkyl-”.

[0036] “Imino” refers to a group -C(NR ^y )R ^z , wherein R ^y and R ^z are each independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein.

[0037] “Imido” refers to a group -C(O)NR ^y C(O)R ^z , wherein R ^y and R ^z are each independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein.

[0038] “Halogen” or “halo” refers to atoms occupying group VIIA of the periodic table, such as fluoro, chloro, bromo, or iodo.

[0039] “Haloalkyl” refers to an unbranched or branched alkyl group as defined above, wherein one or more (e.g., 1 to 6 or 1 to 3) hydrogen atoms are replaced by a halogen. For example, where a residue is substituted with more than one halogen, it may be referred to by using a prefix corresponding to the number of halogen moieties attached. Dihaloalkyl and trihaloalkyl refer to alkyl substituted with two (“di”) or three (“tri”) halo groups, which may be, but are not necessarily, the same halogen. Examples of haloalkyl include, e.g., trifluoromethyl, difluoromethyl, fluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1 ,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1,2-dibromoethyl, and the like.

[0040] “Haloalkoxy” refers to an alkoxy group as defined above, wherein one or more (e.g., 1 to 6 or 1 to 3) hydrogen atoms are replaced by a halogen.

[0041] “Haloalkoxyalkyl” refers to an alkoxyalkyl group as defined above, wherein one or more (e.g., 1 to 6 or 1 to 3) hydrogen atoms are replaced by a halogen.

[0042] “Hydroxyalkyl” refers to an alkyl group as defined above, wherein one or more (e.g., 1 to 6 or 1 to 3) hydrogen atoms are replaced by a hydroxy group.

[0043] “Heteroalkyl” refers to an alkyl group in which one or more of the carbon atoms (and any associated hydrogen atoms), excluding any terminal carbon atom(s), are each independently replaced with the same or different heteroatomic group, provided the point of attachment to the remainder of the molecule is through a carbon atom. The term “heteroalkyl” includes unbranched or branched saturated chain having carbon and heteroatoms. By way of example, 1, 2 or 3 carbon atoms may be independently replaced with the same or different heteroatomic group. Heteroatomic groups include, but are not limited to, -NR ^y -, -O-, -S-, -S(O)-, -S(O) ₂ -, and the like, wherein R ^y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. Examples of heteroalkyl groups include, e.g., ethers (e.g., -CH ₂ OCH ₃ , -CH(CH ₃ )OCH ₃ , -CH ₂ CH ₂ OCH ₃ , -CH ₂ CH ₂ OCH ₂ CH ₂ OCH ₃ , etc.), thioethers (e.g., -CH ₂ SCH ₃ , -CH(CH ₃ )SCH ₃ , -CH ₂ CH ₂ SCH ₃ ,-CH ₂ CH ₂ SCH ₂ CH ₂ SCH ₃ , etc.), sulfones (e.g., -CH ₂ S(O) ₂ CH ₃ , -CH(CH ₃ )S(O) ₂ CH ₃ , -CH ₂ CH ₂ S(O) ₂ CH ₃ , -CH ₂ CH ₂ S(O) ₂ CH ₂ CH ₂ OCH ₃ , etc.), and amines (e.g., -CH ₂ NR ^y CH ₃ , -CH(CH ₃ )NR ^y CH ₃ , -CH ₂ CH ₂ NR ^y CH ₃ , -CH ₂ CH ₂ NR ^y CH ₂ CH ₂ NR ^y CH ₃ , etc., where R ^y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein). As used herein, heteroalkyl includes 2 to 10 carbon atoms, 2 to

8 carbon atoms, or 2 to 4 carbon atoms; and 1 to 3 heteroatoms, 1 to 2 heteroatoms, or 1 heteroatom.

[0044] “Heteroaryl” refers to an aromatic group having a single ring, multiple rings or multiple fused rings, with one or more ring heteroatoms independently selected from nitrogen, oxygen, and sulfur. As used herein, heteroaryl includes 1 to 20 ring carbon atoms (i.e., C _1-20 heteroaryl), 3 to 12 ring carbon atoms (i.e., C _3-12 heteroaryl), or 3 to 8 carbon ring atoms (i.e., C _3-8 heteroaryl), and 1 to 5 ring heteroatoms, 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom independently selected from nitrogen, oxygen, and sulfur. In certain instances, heteroaryl includes 5-10 membered ring systems, 5-7 membered ring systems, or 5-6 membered ring systems, each independently having 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom independently selected from nitrogen, oxygen, and sulfur. Examples of heteroaryl groups include, e.g., acridinyl, benzimidazolyl, benzothiazolyl, benzindolyl, benzofuranyl, benzothiazolyl, benzothiadiazolyl, benzonaphthofuranyl, benzoxazolyl, benzothienyl (benzothiophenyl), benzotriazolyl, benzo[4,6]imidazo[l,2-a]pyridyl, carbazolyl, cinnolinyl, dibenzofuranyl, dibenzothiophenyl, furanyl, isothiazolyl, imidazolyl, indazolyl, indolyl, indazolyl, isoindolyl, isoquinolyl, isoxazolyl, naphthyridinyl, oxadiazolyl, oxazolyl, 1 -oxidopyridinyl, 1-oxidopyrimidinyl, 1-oxidopyrazinyl, 1-oxidopyridazinyl, phenazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, quinazolinyl, quinoxalinyl, quinolinyl, quinuclidinyl, isoquinolinyl, thiazolyl, thiadiazolyl, thiophenyl (i.e., thienyl), triazolyl, tetrazolyl, and triazinyl. Examples of the fused-heteroaryl rings include, but arc not limited to, benzo [d]thiazolyl, quinolinyl, isoquinolinyl, bcnzo[b]thiophcnyl, indazolyl, benzo [d]imidazolyl, pyrazolo[l,5-a]pyridinyl, and imidazo[l,5-a]pyridinyl, where the heteroaryl can be bound via either ring of the fused system. Any aromatic ring, having a single or multiple fused rings, containing at least one heteroatom, is considered a heteroaryl regardless of the attachment to the remainder of the molecule (i.e., through any one of the fused rings). Heteroaryl does not encompass or overlap with aryl as defined above.

[0045] “Heteroarylalkyl” refers to the group “heteroaryl-alkyl-”.

[0046] “Heterocyclyl” refers to a saturated or partially unsaturated cyclic alkyl group, with one or more ring heteroatoms independently selected from nitrogen, oxygen, and sulfur. The term “heterocyclyl” includes heterocycloalkenyl groups (i.e., the heterocyclyl group having at least one double bond), bridged-heterocyclyl groups, fused-heterocyclyl groups, and spiro-heterocyclyl groups. A heterocyclyl may be a single ring or multiple rings wherein the multiple rings may be fused, bridged, or spiro, and may comprise one or more (e.g., 1 to 3) oxo (=0) or N-oxide (-O") moieties Any non-aromatic ring or fused ring system containing at least one heteroatom and one non-aromatic ring is considered a heterocyclyl, regardless of the attachment (i.e., can be bound through a carbon atom or a heteroatom). Further, the term heterocyclyl is intended to encompass any non-aromatic ring containing at least one heteroatom, which ring may be fused to a cycloalkyl, an aryl, or heteroaryl ring, regardless of the attachment to the remainder of the molecule. For example, fused ring systems such as decahydroquinazolinyl, 1,2,3,4-tetrahydroquinazolinyl, and 5,6,7, 8-tetrahydroquinazolinyl are heterocyclyl, regardless of the attachment to the remainder of the molecule. As used herein, heterocyclyl has 2 to 20 ring carbon atoms (i.e., C _2-20 heterocyclyl), 2 to 12 ring carbon atoms (i.e., C _2-12 heterocyclyl), 2 to 10 ring carbon atoms (i.e., C _2-10 heterocyclyl), 2 to 8 ring carbon atoms (i.e., C _2-8 heterocyclyl), 3 to 12 ring carbon atoms (i.e., C _3-12 heterocyclyl), 3 to 8 ring carbon atoms (i.e., C _3-8 heterocyclyl), or 3 to 6 ring carbon atoms (i.e., C _3-6 heterocyclyl); having 1 to 5 ring heteroatoms, 1 to 4 ring heteroatoms, 1 to 3 ring heteroatoms, 1 to 2 ring heteroatoms, or 1 ring heteroatom independently selected from nitrogen, sulfur, or oxygen. Examples of heterocyclyl groups include, e.g., azetidinyl, azepinyl, benzodioxolyl, benzo[b][l,4]dioxepinyl, 1,4-benzodioxanyl, benzopyranyl, benzodioxinyl, benzopyranonyl, benzofuranonyl, dioxolanyl, dihydropyranyl, hydropyranyl, thienyl[l,3]dithianyl, decahydroisoquinolyl, furanonyl, imidazolinyl, imidazolidinyl, indolinyl, indolizinyl, isoindolinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, oxiranyl, oxetanyl, phenothiazinyl, phenoxazinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, tetrahydropyranyl, trithianyl, tetrahydroquinolinyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, and 1,1-dioxo-thiomorpholinyl. The term “heterocyclyl” also includes “spiroheterocyclyl” when there are two positions for substitution on the same carbon atom. Examples of the spiro-heterocyclyl rings include, e.g., bicyclic and tricyclic ring systems, such as oxabicyclo [2.2.2]octanyl, 2-oxa-7-azaspiro[3.5]nonanyl, 2-oxa-6-azaspiro[3.4]octanyl, and 6-oxa-1- azaspiro[3.3]hcptanyl. Examples of the fuscd-hctcrocyclyl rings include, but arc not limited to, 1, 2,3,4- tetrahydroisoquinolinyl, 4,5,6,7-tetrahydrothieno[2,3-c]pyridinyl, indolinyl, and isoindolinyl, where the heterocyclyl can be bound via either ring of the fused system.

[0047] “Heterocyclylalkyl” refers to the group “heterocyclyl-alkyl-.”

[0048] “Oxime” refers to the group -CR ^y (=NOH) wherein R ^y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein.

[0049] “Sulfonyl” refers to the group -S(O) ₂ R ^y , where R ^y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. Examples of sulfonyl are methylsulfonyl, ethylsulfonyl, phenylsulfonyl, and toluenesulfonyl.

[0050] “Sulfinyl” refers to the group -S(O)R ^y , where R ^y is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein. Examples of sulfinyl are methylsulfinyl, ethylsulfinyl, phenylsulfinyl, and toluenesulfinyl. [0051] “Sulfonamido” refers to the groups -SO ₂ NR ^y R ^z and -NR ^y SO ₂ R ^z , where R ^y and R ^z are each independently hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, heteroalkyl, or heteroaryl; each of which may be optionally substituted, as defined herein.

[0052] The terms “optional” or “optionally” means that the subsequently described event or circumstance may or may not occur and that the description includes instances where said event or circumstance occurs and instances in which it does not. Also, the term “optionally substituted” refers to any one or more (e.g., 1 to 5 or 1 to 3) hydrogen atoms on the designated atom or group may or may not be replaced by a moiety other than hydrogen.

[0053] The term “substituted” used herein means any of the above groups (i.e., alkyl, alkenyl, alkynyl, alkylene, alkoxy, haloalkyl, haloalkoxy, cycloalkyl, aryl, heterocyclyl, heteroaryl, and/or heteroalkyl) wherein at least one (e.g., 1 to 5 or 1 to 3) hydrogen atom is replaced by a bond to a non-hydrogen atom such as, but not limited to alkyl, alkenyl, alkynyl, alkoxy, alkylthio, acyl, amido, amino, amidino, aryl, aralkyl, azido, carbamoyl, carboxyl, carboxyl ester, cyano, cycloalkyl, cycloalkylalkyl, guanadino, halo, haloalkyl, haloalkoxy, hydroxyalkyl, heteroalkyl, heteroaryl, heteroarylalkyl, heterocyclyl, heterocyclylalkyl, -NHNH ₂ , =NNH ₂ , imino, imido, hydroxy, oxo, oxime, nitro, sulfonyl, sulfinyl, alkylsulfonyl, alkylsulfinyl, thiocyanate, -S(O)OH, -S(O) ₂ OH, sulfonamido, thiol, thioxo, N-oxide, or -Si(R ^y ) ₃ , wherein each R ^y is independently hydrogen, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, aryl, heteroaryl, or heterocyclyl.

[0054] In certain embodiments, “substituted” includes any of the above alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl groups in which one or more (e.g., 1 to 5 or 1 to 3) hydrogen atoms are independently replaced with deuterium, halo, cyano, nitro, azido, oxo, alkyl, alkenyl, alkynyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, -NR ^g R ^h , -NR ^g C(O)R ^h , -NR ^g C(O)NR ^g R ^h , -NR ^g C(O)OR ^h , -NR ^g S(O) _1-2 R ^h , -C(O)R ^g , -C(O)OR ^g , -OC(O)OR ^g , -OC(O)R ^g , -C(O)NR ^g R ^h , -OC(O)NR ^g R ^h , -OR ^g , -SR ^g , -S(O)R ^g , -S(O) ₂ R ^g , -OS(O) _1-2 R ^g , -S(O) _1-2 OR ^g , -NR ^g S(O) _1-2 NR ^g R ^h , =NSO ₂ R ^g , =NOR ^g , -S(O) _1-2 NR ^g R ^h , -SF ₅ , -SCF ₃ , or -OCF ₃ . In certain embodiments, “substituted” also means any of the above groups in which one or more (e.g., 1 to 5 or 1 to 3) hydrogen atoms are replaced with -C(O)R ^g , -C(O)OR ^g , -C(O)NR ⁸ R ^h , -CH ₂ SO ₂ R ^g , or -CH ₂ SO ₂ NR ^g R ^h . In the foregoing, R ^g and R ^h are the same or different and independently hydrogen, alkyl, alkenyl, alkynyl, alkoxy, thioalkyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, haloalkyl, heterocyclyl, heterocyclylalkyl, heteroaryl, and/or heteroarylalkyl. In certain embodiments, “substituted” also means any of the above groups in which one or more (e.g., 1 to 5 or 1 to 3) hydrogen atoms are replaced by a bond to an amino, cyano, hydroxy, imino, nitro, oxo, thioxo, halo, alkyl, alkoxy, alkylamino, thioalkyl, aryl, aralkyl, cycloalkyl, cycloalkylalkyl, haloalkyl, heterocyclyl, N-heterocyclyl, heterocyclylalkyl, heteroaryl, and/or heteroarylalkyl, or two of R ^g and R ^h and R ¹ are taken together with the atoms to which they are attached to form a heterocyclyl ring optionally substituted with oxo, halo, or alkyl optionally substituted with oxo, halo, amino, hydroxy, or alkoxy.

[0055] Polymers or similar indefinite structures arrived at by defining substituents with further substituents appended ad infinitum (e.g., a substituted aryl having a substituted alkyl which is itself substituted with a substituted aryl group, which is further substituted by a substituted heteroalkyl group, etc.) are not intended for inclusion herein. Unless otherwise noted, the maximum number of serial substitutions in compounds described herein is three. For example, serial substitutions of substituted aryl groups with two other substituted aryl groups are limited to ((substituted aryl)substituted aryl) substituted aryl. Similarly, the above definitions are not intended to include impermissible substitution patterns (e.g., methyl substituted with 5 fluorines or heteroaryl groups having two adjacent oxygen ring atoms). Such impermissible substitution patterns are well known to the skilled artisan. When used to modify a chemical group, the term “substituted” may describe other chemical groups defined herein.

[0056] In certain embodiments, as used herein, the phrase “one or more” refers to one to five. In certain embodiments, as used herein, the phrase “one or more” refers to one to three.

[0057] Any compound or structure given herein, is also intended to represent unlabeled forms as well as isotopically labeled forms of the compounds. These forms of compounds may also be referred to as “isotopically enriched analogs.” Isotopically labeled compounds have structures depicted herein, except that one or more atoms are replaced by an atom having a selected atomic mass or mass number.

Examples of isotopes that can be incorporated into the disclosed compounds include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine, chlorine, and iodine, such as ² H, ³ H, ¹¹ C, ¹³ C, ¹⁴ C, ¹³ N, ¹⁵ N, ¹⁵ O, ¹⁷ O, ¹⁸ 0, ³¹ P, ³² P, ³⁵ S, ¹⁸ F, ³⁶ C1, ¹²³ I, and ¹²⁵ I, respectively. Various isotopically labeled compounds of the present disclosure, for example those into which radioactive isotopes such as ³ H and ¹⁴ C are incorporated. Such isotopically labelled compounds may be useful in metabolic studies, reaction kinetic studies, detection or imaging techniques, such as positron emission tomography (PET) or single- photon emission computed tomography (SPECT) including drug or substrate tissue distribution assays or in radioactive treatment of patients.

[0058] The term “isotopically enriched analogs” includes “deuterated analogs” of compounds described herein in which one or more hydrogens is/ are replaced by deuterium, such as a hydrogen on a carbon atom. Such compounds exhibit increased resistance to metabolism and are thus useful for increasing the half-life of any compound when administered to a mammal, particularly a human. See, for example, Foster, “Deuterium Isotope Effects in Studies of Drug Metabolism,” Trends Pharmacol. Sci. 5(12) :524- 527 (1984). Such compounds are synthesized by means well known in the art, for example by employing starting materials in which one or more hydrogens have been replaced by deuterium.

[0059] Deuterium labelled or substituted therapeutic compounds of the disclosure may have improved DMPK (drug metabolism and pharmacokinetics) properties, relating to distribution, metabolism, and excretion (ADME). Substitution with heavier isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability, for example increased in vivo half-life, reduced dosage requirements, and/or an improvement in therapeutic index. An ¹⁸ F, ³ H, or ¹¹ C labeled compound may be useful for PET or SPECT or other imaging studies. Isotopically labeled compounds of this disclosure and prodrugs thereof can generally be prepared by carrying out the procedures disclosed in the schemes or in the examples and preparations described below by substituting a readily available isotopically labeled reagent for a non-isotopically labeled reagent. It is understood that deuterium in this context is regarded as a substituent in a compound described herein.

[0060] The concentration of such a heavier isotope, specifically deuterium, may be defined by an isotopic enrichment factor. In the compounds of this disclosure any atom not specifically designated as a particular isotope is meant to represent any stable isotope of that atom. Unless otherwise stated, when a position is designated specifically as “H” or “hydrogen,” the position is understood to have hydrogen at its natural abundance isotopic composition. Accordingly, in the compounds of this disclosure any atom specifically designated as a deuterium (D) is meant to represent deuterium.

[0061] In many cases, the compounds of this disclosure are capable of forming acid and/or base salts by virtue of the presence of amino, and/or carboxyl groups, or groups similar thereto.

[0062] Provided is also a pharmaceutically acceptable salt, isotopically enriched analog, deuterated analog, stereoisomer, mixture of stereoisomers, or prodrugs of the compounds described herein. “Pharmaceutically acceptable” or “physiologically acceptable” refer to compounds, salts, compositions, dosage forms, and other materials which are useful in preparing a pharmaceutical composition that is suitable for veterinary or human pharmaceutical use.

[0063] The term “pharmaceutically acceptable salt” of a given compound refers to salts that retain the biological effectiveness and properties of the given compound and which are not biologically or otherwise undesirable. “Pharmaceutically acceptable salts” or “physiologically acceptable salts” include, for example, salts with inorganic acids, and salts with an organic acid. In addition, if the compounds described herein are obtained as an acid addition salt, the free base can be obtained by basifying a solution of the acid salt. Conversely, if the product is a free base, an addition salt, particularly a pharmaceutically acceptable addition salt, may be produced by dissolving the free base in a suitable organic solvent and treating the solution with an acid, in accordance with conventional procedures for preparing acid addition salts from base compounds. Those skilled in the art will recognize various synthetic methodologies that may be used to prepare nontoxic pharmaceutically acceptable addition salts. Pharmaceutically acceptable acid addition salts may be prepared from inorganic or organic acids. Salts derived from inorganic acids include, e.g., hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like. Salts derived from organic acids include, e.g., acetic acid, propionic acid, gluconic acid, glycolic acid, pyruvic acid, oxalic acid, malic acid, malonic acid, succinic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluene-sulfonic acid, salicylic acid, and the like. Likewise, pharmaceutically acceptable base addition salts can be prepared from inorganic or organic bases. Salts derived from inorganic bases include, by way of example only, sodium, potassium, lithium, aluminum, ammonium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, such as alkyl amines (i.e., NH ₂ (alkyl)), dialkyl amines (i.e., HN(alkyl) ₂ ), trialkyl amines (i.e., N(alkyl) ₃ ), substituted alkyl amines (i.e., NH ₂ (substitutcd alkyl)), di(substituted alkyl) amines (i.e., HN(substituted alkyl) ₂ ), tri(substituted alkyl) amines (i.e., N(substituted alkyl) ₃ ), alkenyl amines (i.e., NH ₂ ( alkenyl)), dialkenyl amines (i.e., HN(alkenyl) ₂ ), trialkenyl amines (i.e., N(alkenyl) ₃ ) , substituted alkenyl amines (i.e., NH ₂ (substituted alkenyl)), di(substituted alkenyl) amines (i.e., HN(substituted alkenyl) ₂ ), tri(substituted alkenyl) amines (i.e., N(substituted alkenyl) ₃ ), mono-, di- or tri- cycloalkyl amines (i.e., NH ₂ (cycloalkyl), HN(cycloalkyl) ₂ , N(cycloalkyl) ₃ ) , mono-, di- or tri- arylamines (i.e., NH ₂ (aryl), HN(aryl) ₂ , N(aryl) ₃ ) , or mixed amines, etc. Specific examples of suitable amines include, by way of example only, isopropylamine, trimethyl amine, diethyl amine, tri(iso-propyl) amine, tri(n-propyl) amine, ethanolamine, 2-dimethylaminoethanol, piperazine, piperidine, morpholine, N-ethylpiperidine, and the like.

[0064] Some of the compounds exist as tautomers. Tautomers are in equilibrium with one another. For example, amide containing compounds may exist in equilibrium with imidic acid tautomers. Regardless of which tautomer is shown and regardless of the nature of the equilibrium among tautomers, the compounds are understood by one of ordinary skill in the art to comprise both amide and imidic acid tautomers. Thus, the amide containing compounds are understood to include their imidic acid tautomers. Likewise, the imidic acid containing compounds are understood to include their amide tautomers.

[0065] The compounds of the disclosure, or their pharmaceutically acceptable salts include an asymmetric center and may thus give rise to enantiomers, diastereomers, and other stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (5)- or, as (D)- or (L)- for amino acids. The present disclosure is meant to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (5)-, or (D)- and (L)- isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, for example, chromatography and/or fractional crystallization. Conventional techniques for the preparation/isolation of individual enantiomers include chiral synthesis from a suitable optically pure precursor or resolution of the racemate (or the racemate of a salt or derivative) using, for example, chiral high pressure liquid chromatography (HPLC). When the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers.

[0066] A “stereoisomer” refers to a compound made up of the same atoms bonded by the same bonds but having different three-dimensional structures, which are not interchangeable. The present disclosure contemplates various stereoisomers, or mixtures thereof, and includes “enantiomers,” which refers to two stereoisomers whose molecules are nonsuperimposeable mirror images of one another.

[0067] “Diastereomers” are stereoisomers that have at least two asymmetric atoms, but which are not mirror-images of each other.

[0068] Relative centers of the compounds as depicted herein are indicated graphically using the “thick bond” style (bold or parallel lines) and absolute stereochemistry is depicted using wedge bonds (bold or parallel lines).

[0069] “Prodrugs” means any compound which releases an active parent drug according to a structure described herein in vivo when such prodrug is administered to a mammalian subject. Prodrugs of a compound described herein are prepared by modifying functional groups present in the compound described herein in such a way that the modifications may be cleaved in vivo to release the parent compound. Prodrugs may be prepared by modifying functional groups present in the compounds in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compounds. Prodrugs include compounds described herein wherein a hydroxy, amino, carboxyl, or sulfhydryl group in a compound described herein is bonded to any group that may be cleaved in vivo to regenerate the free hydroxy, amino, or sulfhydryl group, respectively. Examples of prodrugs include, but are not limited to esters (e.g., acetate, formate, and benzoate derivatives), amides, guanidines, carbamates (e.g., N,N-dimethylaminocarbonyl) of hydroxy functional groups in compounds described herein, and the like. Preparation, selection, and use of prodrugs is discussed in T. Higuchi and V. Stella, “Pro-drugs as Novel Delivery Systems,” Vol. 14 of the A.C.S. Symposium Series; “Design of Prodrugs,” ed. H. Bundgaard, Elsevier, 1985; and in Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987, each of which are hereby incorporated by reference in their entirety.

2. Compounds

[0070] Provided herein are compounds that are inhibitors of SARM1. In certain embodiments, provided is a compound of Formula I: or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, tautomer, mixture of stereoisomers thereof, wherein R ¹ , R ² , R ⁴ , R ⁵ , X ¹ , X ² , X ³ , X ⁴ , X ⁵ , X ⁶ , A ¹ , and A ² are each independently as defined herein.

[0071] In certain embodiments, provided is a compound of Formula I: or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, tautomer, mixture of stereoisomers thereof, wherein:

A ¹ is N and A ² is C; or

A ¹ is C and A ² is N; X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ are each independently N, CH, or CR ⁶ ; provided that at least one of X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ is N; R ¹ is halo, cyano, -NO2, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C1-6 haloalkyl, C3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ )2, -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O)2R ¹¹ , -C(O)N(R ¹¹ )2, -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O)2R ¹¹ , -S(O)N(R ¹¹ )2, -S(O)2N(R ¹¹ )2, -NR ¹¹ C(O)N(R ¹¹ )2, -NR ¹¹ S(O)N(R ¹¹ )2, -NR ¹¹ S(O)2N(R ¹¹ )2, -OC(O)N(R ¹¹ )2, or -NR ¹¹ C(O)OR ¹¹ ; wherein each C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl, is independently optionally substituted with one to five Z ¹ ; R ² is -OR ⁷ , -NR ⁸ R ⁹ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, or heterocyclyl; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, or heterocyclyl is independently optionally substituted with one to five Z ¹ ; R ⁴ is hydrogen, halo, cyano, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ )2, -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O)2R ¹¹ , -C(O)N(R ¹¹ )2, -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O)2R ¹¹ , -S(O)N(R ¹¹ )2, -S(O)2N(R ¹¹ )2, -NR ¹¹ C(O)N(R ¹¹ )2, -NR ¹¹ S(O)N(R ¹¹ )2, -NR ¹¹ S(O)2N(R ¹¹ )2, -OC(O)N(R ¹¹ )2, or -NR ¹¹ C(O)OR ¹¹ ; wherein the C1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; R ⁵ is hydrogen, halo, cyano, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ )2, -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O)2R ¹¹ , -C(O)N(R ¹¹ )2, -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O)2R ¹¹ , -S(O)N(R ¹¹ )2, -S(O)2N(R ¹¹ )2, -NR ¹¹ C(O)N(R ¹¹ )2, -NR ¹¹ S(O)N(R ¹¹ )2, -NR ¹¹ S(O)2N(R ¹¹ )2, -OC(O)N(R ¹¹ )2, or -NR ¹¹ C(O)OR ¹¹ ; wherein the C1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; each R ⁶ is independently halo, cyano, -NO ₂ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ )2, -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O)2R ¹¹ , -S(O)N(R ¹¹ )2, -S(O)2N(R ¹¹ )2, -NR ¹¹ C(O)N(R ¹¹ )2, -NR ¹¹ S(O)N(R ¹¹ )2, -NR ¹¹ S(O)2N(R ¹¹ )2, -OC(O)N(R ¹¹ )2, or -NR ¹¹ C(O)OR ¹¹ ; wherein each C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl, is independently optionally substituted with one to five Z ¹ ; R ⁷ is C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; R ⁸ is hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein the C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; R ⁹ is hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; or R ⁸ and R ⁹ together form a heterocyclyl, which may further be independently optionally substituted with one to five Z ¹ ; each R ¹¹ is independently hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1a ; each Z ¹ is independently halo, cyano, -NO ₂ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹² ) ₂ , -OR ¹² , -SR ¹² , -C(O)R ¹² , -C(O)OR ¹² , -S(O)R ¹² , -S(O) ₂ R ¹² , -C(O)N(R ¹² ) ₂ , -NR ¹² C(O)R ¹² , -NR ¹² S(O)R ¹² , -NR ¹² S(O) ₂ R ¹² , -S(O)N(R ¹² ) ₂ , -S(O) ₂ N(R ¹² ) ₂ , -NR ¹² C(O)N(R ¹² ) ₂ , -NR ¹² S(O)N(R ¹² ) ₂ , -NR ¹² S(O) ₂ N(R ¹² ) ₂ , -OC(O)N(R ¹² ) ₂ , or -NR ¹² C(O)OR ¹² ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1a ; each R ¹² is independently hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each Z ^1a is independently halo, cyano, -NO ₂ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹³ ) ₂ , -OR ¹³ , -SR ¹³ , -C(O)R ¹³ , -C(O)OR ¹³ , -S(O)R ¹³ , -S(O) ₂ R ¹³ , -C(O)N(R ¹³ ) ₂ , -NR ¹³ C(O)R ¹³ , -NR ¹³ S(O)R ¹³ , -NR ¹³ S(O) ₂ R ¹³ , -S(O)N(R ¹³ ) ₂ , -S(O) ₂ N(R ¹³ ) ₂ , -NR ¹³ C(O)N(R ¹³ ) ₂ , -NR ¹³ S(O)N(R ¹³ ) ₂ , -NR ¹³ S(O) ₂ N(R ¹³ ) ₂ , -OC(O)N(R ¹³ ) ₂ , or -NR ¹³ C(O)OR ¹³ ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each R ¹³ is independently hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each Z ^1b is independently halo, cyano, -OH, -SH, -NH ₂ , -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -L-C _1-6 alkyl, -L-C _2-6 alkenyl, -L-C _2-6 alkynyl, -L-C _1-6 haloalkyl, -L-C _3-10 cycloalkyl, -L-heterocyclyl, -L-aryl, or -L-heteroaryl; and each L is independently -O-, -NH-, -S-, -S(O)-, -S(O) ₂ -, -N(C _1-6 alkyl)-, -N(C _2-6 alkenyl)-, -N(C _2-6 alkynyl)-, -N(C _1-6 haloalkyl)-, -N(C _3-10 cycloalkyl)-, -N(heterocyclyl)-, -N(aryl)-, -N(heteroaryl)-, -C(O)-, -C(O)O-, -C(O)NH-, -C(O)N(C _1-6 alkyl)-, -C(O)N(C _2-6 alkenyl)-, -C(O)N(C _2-6 alkynyl)-, -C(O)N(C _1-6 haloalkyl)-, -C(O)N(C _3-10 cycloalkyl)-, -C(O)N(heterocyclyl)-, -C(O)N(aryl)-, -C(O)N(heteroaryl)-, -NHC(O)-, -NHC(O)O-, -NHC(O)NH-, -NHS(O)-, or -S(O) ₂ NH-; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, and heteroaryl of Z ^1b and L is further independently optionally substituted with one to five halo, cyano, -OH, -SH, -NH ₂ , -NO ₂ , -SF ₅ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _1-6 alkoxy, C _1-6 haloalkoxy, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl. [0072] In certain embodiments, when R ¹ is fluoro, R ⁴ is hydrogen, and R ² is benzylo , or , wherein th is optionally substituted by one or two fl uoro or one or two methyl; then the moiety is not represented b [0073] In certain embo ompound is not N-[4- rpholinyl)imidazo[1,2- a]pyrimidin-7-yl]pheny ] py o dnecarboxamide, N-[6-[ 5-(acetylamino)-2- methylphenyl]imidazo[1,2-a]pyridin-2-yl]-2-fluoro-cyclopropa necarboxamide, (1S,2S)-N-[6-[5- (acetylamino)-2-methylphenyl]imidazo[1,2-a]pyridin-2-yl]-2-f luoro-cyclopropanecarboxamide, 4-[4- (acetylamino)-2-[3-methyl-8-(methylamino)-1,2,4-triazolo[4,3 -a]pyridin-6-yl]phenoxy]-1- piperidinecarboxylic acid 1,1-dimethylethyl ester, N-[3-[3-methyl-8-(methylamino)-1,2,4-triazolo[4,3- a]pyridin-6-yl]-4-[4-(trifluoromethyl)phenoxy]phenyl]-acetam ide, N-[4-(4-chloro-2-fluorophenoxy)-3- (3-methyl-1,2,4-triazolo[4,3-a]pyridin-6-yl)phenyl]-2,2-dime thyl-propanamide, N-[4-(2,4- difluorophenoxy)-3-(3-methyl-1,2,4-triazolo[4,3-a]pyridin-6- yl)phenyl]-cyclopropanecarboxamide, or N- [4-(2,4-difluorophenoxy)-3-(3-methyl-1,2,4-triazolo[4,3-a]py ridin-6-yl)phenyl]-propanamide. [0074] In certain embodiments, provided is a compound of Formula I: or a pharmaceutically acce nalog, stereoisomer, tautomer, mixture of stereoisomers thereof, wherein: A ¹ is N and A ² is C; or A ¹ is C and A ² is N; X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ are each independently N, CH, or CR ⁶ ; provided that at least one of X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ is N; R ¹ is halo, cyano, -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ ) ₂ , -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O) ₂ R ¹¹ , -S(O)N(R ¹¹ ) ₂ , -S(O) ₂ N(R ¹¹ ) ₂ , -NR ¹¹ C(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O) ₂ N(R ¹¹ ) ₂ , -OC(O)N(R ¹¹ ) ₂ , or -NR ¹¹ C(O)OR ¹¹ ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl, is independently optionally substituted with one to five Z ¹ ; R ² is -OR ⁷ , -NR ⁸ R ⁹ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, or heterocyclyl; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, or heterocyclyl is independently optionally substituted with one to five Z ¹ ; R ⁴ is hydrogen, halo, cyano, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ ) ₂ , -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O) ₂ R ¹¹ , -S(O)N(R ¹¹ ) ₂ , -S(O) ₂ N(R ¹¹ ) ₂ , -NR ¹¹ C(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O) ₂ N(R ¹¹ ) ₂ , -OC(O)N(R ¹¹ ) ₂ , or -NR ¹¹ C(O)OR ¹¹ ; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; R ⁵ is hydrogen, halo, cyano, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ ) ₂ , -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O) ₂ R ¹¹ , -S(O)N(R ¹¹ ) ₂ , -S(O) ₂ N(R ¹¹ ) ₂ , -NR ¹¹ C(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O) ₂ N(R ¹¹ ) ₂ , -OC(O)N(R ¹¹ ) ₂ , or -NR ¹¹ C(O)OR ¹¹ ; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; each R ⁶ is independently halo, cyano, -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ ) ₂ , -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O) ₂ R ¹¹ , -S(O)N(R ¹¹ ) ₂ , -S(O) ₂ N(R ¹¹ ) ₂ , -NR ¹¹ C(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O) ₂ N(R ¹¹ ) ₂ , -OC(O)N(R ¹¹ ) ₂ , or -NR ¹¹ C(O)OR ¹¹ ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl, is independently optionally substituted with one to five Z ¹ ; R ⁷ is C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; R ⁸ is hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; R ⁹ is hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; or R ⁸ and R ⁹ together form a heterocyclyl, which may further be independently optionally substituted with one to five Z ¹ ; each R ¹¹ is independently hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1a ; each Z ¹ is independently halo, cyano, -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹² ) ₂ , -OR ¹² , -SR ¹² , -C(O)R ¹² , -C(O)OR ¹² , -S(O)R ¹² , -S(O) ₂ R ¹² , -C(O)N(R ¹² ) ₂ , -NR ¹² C(O)R ¹² , -NR ¹² S(O)R ¹² , -NR ¹² S(O) ₂ R ¹² , -S(O)N(R ¹² ) ₂ , -S(O) ₂ N(R ¹² ) ₂ , -NR ¹² C(O)N(R ¹² ) ₂ , -NR ¹² S(O)N(R ¹² ) ₂ , -NR ¹² S(O) ₂ N(R ¹² ) ₂ , -OC(O)N(R ¹² ) ₂ , or -NR ¹² C(O)OR ¹² ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1a ; each R ¹² is independently hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each Z ^1a is independently halo, cyano, -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹³ ) ₂ , -OR ¹³ , -SR ¹³ , -C(O)R ¹³ , -C(O)OR ¹³ , -S(O)R ¹³ , -S(O) ₂ R ¹³ , -C(O)N(R ¹³ ) ₂ , -NR ¹³ C(O)R ¹³ , -NR ¹³ S(O)R ¹³ , -NR ¹³ S(O) ₂ R ¹³ , -S(O)N(R ¹³ ) ₂ , -S(O) ₂ N(R ¹³ ) ₂ , -NR ¹³ C(O)N(R ¹³ ) ₂ , -NR ¹³ S(O)N(R ¹³ ) ₂ , -NR ¹³ S(O) ₂ N(R ¹³ ) ₂ , -OC(O)N(R ¹³ ) ₂ , or -NR ¹³ C(O)OR ¹³ ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each R ¹³ is independently hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each Z ^1b is independently halo, cyano, -OH, -SH, -NH ₂ , -NO ₂ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -L-C _1-6 alkyl, -L-C _2-6 alkenyl, -L-C _2-6 alkynyl, -L-C _1-6 haloalkyl, -L-C _3-10 cycloalkyl, -L-heterocyclyl, -L-aryl, or -L-heteroaryl; and each L is independently -O-, -NH-, -S-, -S(O)-, -S(O) ₂ -, -N(C _1-6 alkyl)-, -N(C _2-6 alkenyl)-, -N(C _2-6 alkynyl)-, -N(C _1-6 haloalkyl)-, -N(C _3-10 cycloalkyl)-, -N(heterocyclyl)-, -N(aryl)-, -N(heteroaryl)-, -C(O)-, -C(O)O-, -C(O)NH-, -C(O)N(C _1-6 alkyl)-, -C(O)N(C _2-6 alkenyl)-, -C(O)N(C _2-6 alkynyl)-, -C(O)N(C _1-6 haloalkyl)-, -C(O)N(C _3-10 cycloalkyl)-, -C(O)N(heterocyclyl)-, -C(O)N(aryl)-, -C(O)N(heteroaryl)-, -NHC(O)-, -NHC(O)O-, -NHC(O)NH-, -NHS(O)-, or -S(O) ₂ NH-; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, and heteroaryl of Z ^1b and L is further independently optionally substituted with one to five halo, cyano, -OH, -SH, -NH ₂ , -NO ₂ , -SF ₅ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _1-6 alkoxy, C _1-6 haloalkoxy, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; provided that: a) when R ¹ is fluoro, R ⁴ is hydrogen, and R ² is benzylox , wherein the is optionally substituted by one or two fluoro or one or two methyl; then the moiety is not represented b ; and compound is not N-[ 4-morpholinyl)imidazo[1,2-a]pyrimidin-7-yl]phenyl]- 1-pyrrolidinecarboxamide, N-[6-[5- (acetylamino)-2-methylphenyl]imidazo[1,2-a]pyridin-2-yl]-2-f luoro- cyclopropanecarboxamide, (1S,2S)-N-[6-[5-(acetylamino)-2-methylphenyl]imidazo[1,2-a]p yridin-2-yl]- 2-fluoro-cyclopropanecarboxamide, 4-[4-(acetylamino)-2-[3-methyl-8-(methylamino)-1,2,4-triazol o[4,3- a]pyridin-6-yl]phenoxy]-1-piperidinecarboxylic acid 1,1-dimethylethyl ester, N-[3-[3-methyl-8- (methylamino)-1,2,4-triazolo[4,3-a]pyridin-6-yl]-4-[4-(trifl uoromethyl)phenoxy]phenyl]-acetamide, N- [4-(4-chloro-2-fluorophenoxy)-3-(3-methyl-1,2,4-triazolo[4,3 -a]pyridin-6-yl)phenyl]-2,2-dimethyl- propanamide, N-[4-(2,4-difluorophenoxy)-3-(3-methyl-1,2,4-triazolo[4,3-a] pyridin-6-yl)phenyl]- cyclopropanecarboxamide, or N-[4-(2,4-difluorophenoxy)-3-(3-methyl-1,2,4-triazolo[4,3-a] pyridin-6- yl)phenyl]-propanamide. [0075] In certain embodiments, at least one of A ¹ , X ³ , and X ⁴ is other than N. [0076] In certain embodiments, when X ⁶ is C-N(R ¹¹ ) ₂ , then at least one of A ² , X ¹ , and X ⁵ is other than N. [0077] In certain embodiments, provided is a compound of Formula IA: where A ¹ , A ² , X ¹ , X ² , X ³ , each independently as defined herein. [0078] In certain embodiments, R ⁸ and R ⁹ together form a heterocyclyl, which heterocyclyl may further be independently optionally substituted with one to five Z ¹ . [0079] In certain embodiments, R ² or the moie : [0080] In certain embodiments, each Z is independently halo, cyano, C _1-6 alkyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heteroaryl, -OR ¹² , or -C(O)OR ¹² ; wherein each C _1-6 alkyl, heteroaryl is independently optionally substituted with one to five hydroxy, methoxy, or methyl. [0081] In certain embodiments, R or the moie , which may optionally be fused to a C ₆ aryl; wherein q is 0, 1, 2, or 3; r i or 2; and X is CH ₂ , CHZ ¹ , 1 C(Z ) ₂ , NH, O, or S. [0082] In certain embodiments, Z ¹ is -OR ¹² . In certain embodiments, Z ¹ is (2-methoxyethoxy)methyl. [0083] In certain embodiments, R or the moie , wherein q is 0, 1, 2, 3, 4, or 5; and p is 0, 1, 2, or 3. [0084] In certain embodiments, the moiety ; wherein: q is 0, 1, 2, 3, or 4; p is 0, 1, 2, or 3; Ring B is C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein each C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; and L ¹ is a bond, C _1-4 alkyl, C _2-4 alkenyl, or C _2-4 alkynyl. [0085] In certain embodiments, L ¹ is a bond or C1-4 alkyl. In certain embodiments, L ¹ is a bond or C1-2 alkyl. In certain embodiments, L ¹ is a bond or -CH ₂ -. In certain embodiments, L ¹ is a bond. [0086] In certain embodiments, Ring B is heteroaryl optionally substituted with one to five Z ^1a . In certain embodiments, Ring B is heteroaryl optionally substituted with one to five Z ^1a , and L ¹ is a bond or C _1-2 alkyl. In certain embodiments, Ring B is heteroaryl optionally substituted with one to five Z ^1a , and L ¹ is a bond or CH ₂ . In certain embodiments, Ring B is heteroaryl and L ¹ is a bond. In certain embodiments, Ring B is heteroaryl optionally substituted with one to five Z ^1a , L ¹ is a bond, q is 1, and Z ¹ is C _1-6 alkyl. [0087] In certain embodiments, L ¹ is a bond and Ring B is pyrimidinyl, oxadiazolyl, or triazolyl, wherein the pyrimidinyl, oxadiazolyl, or triazolyl is optionally substituted with one to five Z ^1a . [0088] In certain embodiments, L ¹ is a bond and Ring B is pyrimidinyl optionally substituted with one to five Z ^1a . In certain embodiments, L ¹ is a bond and Ring B is oxadiazolyl optionally substituted with one to five Z ^1a . In certain embodiments, L ¹ is a bond and Ring B is triazolyl optionally substituted with one to five Z ^1a . [0089] In certain embodiments, L ¹ is a bond and Ring B is: is a compound of Formula IIA: or a pharmaceuticall stereoisomer, tautomer, mixture of stereoisomers thereof, wherein: q is 0, 1, 2, 3, or 4; p is 0, 1, 2, or 3; A ¹ is N and A ² is C; or A ¹ is C and A ² is N; X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ are each independently N, CH, or CR ⁶ ; provided that at least one of X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ is N; R ¹ is halo, cyano, -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ ) ₂ , -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O) ₂ R ¹¹ , -S(O)N(R ¹¹ ) ₂ , -S(O) ₂ N(R ¹¹ ) ₂ , -NR ¹¹ C(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O) ₂ N(R ¹¹ ) ₂ , -OC(O)N(R ¹¹ ) ₂ , or -NR ¹¹ C(O)OR ¹¹ ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl, is independently optionally substituted with one to five Z ¹ ; R ⁴ is hydrogen, halo, cyano, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ ) ₂ , -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O) ₂ R ¹¹ , -S(O)N(R ¹¹ ) ₂ , -S(O) ₂ N(R ¹¹ ) ₂ , -NR ¹¹ C(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O) ₂ N(R ¹¹ ) ₂ , -OC(O)N(R ¹¹ ) ₂ , or -NR ¹¹ C(O)OR ¹¹ ; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; R ⁵ is hydrogen, halo, cyano, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ ) ₂ , -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O) ₂ R ¹¹ , -S(O)N(R ¹¹ ) ₂ , -S(O) ₂ N(R ¹¹ ) ₂ , -NR ¹¹ C(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O) ₂ N(R ¹¹ ) ₂ , -OC(O)N(R ¹¹ ) ₂ , or -NR ¹¹ C(O)OR ¹¹ ; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; each R ⁶ is independently halo, cyano, -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ ) ₂ , -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O) ₂ R ¹¹ , -S(O)N(R ¹¹ ) ₂ , -S(O) ₂ N(R ¹¹ ) ₂ , -NR ¹¹ C(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O) ₂ N(R ¹¹ ) ₂ , -OC(O)N(R ¹¹ ) ₂ , or -NR ¹¹ C(O)OR ¹¹ ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl, is independently optionally substituted with one to five Z ¹ ; each R ¹¹ is independently hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1a ; each Z ¹ is independently halo, cyano, -NO ₂ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹² ) ₂ , -OR ¹² , -SR ¹² , -C(O)R ¹² , -C(O)OR ¹² , -S(O)R ¹² , -S(O) ₂ R ¹² , -C(O)N(R ¹² ) ₂ , -NR ¹² C(O)R ¹² , -NR ¹² S(O)R ¹² , -NR ¹² S(O) ₂ R ¹² , -S(O)N(R ¹² ) ₂ , -S(O) ₂ N(R ¹² ) ₂ , -NR ¹² C(O)N(R ¹² ) ₂ , -NR ¹² S(O)N(R ¹² ) ₂ , -NR ¹² S(O) ₂ N(R ¹² ) ₂ , -OC(O)N(R ¹² ) ₂ , or -NR ¹² C(O)OR ¹² ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1a ; each R ¹² is independently hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each Z ^1a is independently halo, cyano, -NO ₂ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹³ ) ₂ , -OR ¹³ , -SR ¹³ , -C(O)R ¹³ , -C(O)OR ¹³ , -S(O)R ¹³ , -S(O) ₂ R ¹³ , -C(O)N(R ¹³ ) ₂ , -NR ¹³ C(O)R ¹³ , -NR ¹³ S(O)R ¹³ , -NR ¹³ S(O) ₂ R ¹³ , -S(O)N(R ¹³ ) ₂ , -S(O) ₂ N(R ¹³ ) ₂ , -NR ¹³ C(O)N(R ¹³ ) ₂ , -NR ¹³ S(O)N(R ¹³ ) ₂ , -NR ¹³ S(O) ₂ N(R ¹³ ) ₂ , -OC(O)N(R ¹³ ) ₂ , or -NR ¹³ C(O)OR ¹³ ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each R ¹³ is independently hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each Z ^1b is independently halo, cyano, -OH, -SH, -NH ₂ , -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -L-C _1-6 alkyl, -L-C _2-6 alkenyl, -L-C _2-6 alkynyl, -L-C _1-6 haloalkyl, -L-C _3-10 cycloalkyl, -L-heterocyclyl, -L-aryl, or -L-heteroaryl; and each L is independently -O-, -NH-, -S-, -S(O)-, -S(O) ₂ -, -N(C _1-6 alkyl)-, -N(C _2-6 alkenyl)-, -N(C _2-6 alkynyl)-, -N(C _1-6 haloalkyl)-, -N(C _3-10 cycloalkyl)-, -N(heterocyclyl)-, -N(aryl)-, -N(heteroaryl)-, -C(O)-, -C(O)O-, -C(O)NH-, -C(O)N(C _1-6 alkyl)-, -C(O)N(C _2-6 alkenyl)-, -C(O)N(C _2-6 alkynyl)-, -C(O)N(C _1-6 haloalkyl)-, -C(O)N(C _3-10 cycloalkyl)-, -C(O)N(heterocyclyl)-, -C(O)N(aryl)-, -C(O)N(heteroaryl)-, -NHC(O)-, -NHC(O)O-, -NHC(O)NH-, -NHS(O)-, or -S(O) ₂ NH-; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, and heteroaryl of Z ^1b and L is further independently optionally substituted with one to five halo, cyano, -OH, -SH, -NH ₂ , -NO ₂ , -SF ₅ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _1-6 alkoxy, C _1-6 haloalkoxy, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl. [0091] In certain embodiments, provided is a compound of Formula IB: where A ¹ , A ² , X ¹ , X ² , X ³ ndependently as defined herein. [0092] In certain embodiments, R ⁷ is C _1-6 alkyl optionally substituted with one to five Z ¹ . [0093] In certain embodiments, R ⁷ is cyclopropylmethyl, 2-phenylethyl, or 2,2,2-trifluoroethyl. [0094] In certain embodiments, R ² is C _1-6 alkyl optionally substituted with one to five Z ¹ . [0095] In certain embodiments, Z ¹ is C _3-10 cycloalkyl optionally substituted with one to five Z ^1a . In certain embodiments, Z ^1a is C _1-6 alkyl optionally substituted with one to five halo. In certain embodiments, Z ¹ is (3-trifluoromethyl)cyclobutyl. [0096] In certain embodiments, R ² is (3-(trifluoromethyl)bicyclo[1.1.1]pentan-1-yl)methyl or (3- (trifluoromethyl)cyclobut-1-yl)methyl. [0097] In certain embodiments, R ² is (3-(trifluoromethyl)bicyclo[1.1.1]pentan-1-yl)methyl. [0098] In certain embodiments, R ² is C _3-10 cycloalkyl optionally substituted with one to five Z ¹ . [0099] In certain embodiments, provided is a compound of Formula IC: where A ¹ , A ² , X ¹ , X ² , X pendently as defined herein; n is 1, 2, 3, 4, or 5; and m is 1, 2, 3, or 4. [0100] In certain embodiments, R ² is cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, or bicyclo[2.2.1]heptan-7-yl, wherein each is optionally substituted with one to five Z ¹ . [0101] In certain embodiments, each Z ¹ is independently halo, C _1-6 haloalkyl, -O-C _1-6 alkyl, C _3-10 cycloalkyl, or heteroaryl. [0102] In certain embodiments, R ² is heterocyclyl optionally substituted with one to five Z ¹ . [0103] In certain embodiments, R ² is 2-azabicyclo[3.1.0]hexan-2-yl, pyrrolidinyl, or tetrahydropyranyl, wherein each is optionally substituted with one to five Z ¹ . [0104] In certain embodiments, R ² is 2-azabicyclo[3.1.0]hexan-2-yl or tetrahydropyranyl, wherein each is optionally substituted with one to five Z ¹ . [0105] In certain embodiments, each Z ¹ is independently halo, -C(O)OR ¹² , C _1-6 alkyl, C _1-6 haloalkyl or heteroaryl, wherein each C _1-6 alkyl is optionally substituted with one to five methoxy. [0106] In certain embodiments, each Z ¹ is independently fluoro, -C(O)OCH3, 2-methoxyethyl, trifluoromethyl, pyridinyl, pyrimidinyl, or pyridazinyl. [0107] In certain embodiments, each Z ¹ is independently C _1-6 haloalkyl or heteroaryl. [0108] In certain embodiments, R ⁴ is hydrogen. [0109] In certain embodiments, R ⁵ is hydrogen or halo. [0110] In certain embodiments, R ⁵ is hydrogen or fluoro. [0111] In certain embodiments, R ¹ is halo, cyano, C _1-6 alkyl, or C _1-6 haloalkyl, wherein each C _1-6 alkyl is optionally substituted with one to five Z ¹ . In certain embodiments, R ¹ is C _1-6 alkyl substituted with one to five cyano. [0112] In certain embodiments, R ¹ is halo, cyano, C _1-6 alkyl, or C _1-6 haloalkyl. [0113] In certain embodiments, R ¹ is chloro, cyano, methyl, trifluoromethyl, or cyanomethyl. [0114] In certain embodiments, R ¹ is chloro, cyano, methyl, or trifluoromethyl. [0115] In certain embodiments, A ¹ is N and A ² is C. [0116] In certain embodiments, the moiet . [0117] In certain embodiments, the moiet . In certain embodiments, X ¹ , X ² , X ³ , X ⁴ , and X ⁵ are each independe t y C o C . ce ta e bodiments, X ¹ , X ² , X ³ , X ⁴ , and X ⁵ are each CH. [0118] In certain embodiments, the moiet . In certain embodiments, X ¹ , X ² , X ³ , X ⁵ , and X ⁶ are each independe diments, X ¹ , X ² , X ³ , X ⁵ , and X ⁶ are each CH. [0119] In certain embodiments, the moiet . In certain embodiments, X ¹ , X ² , X ⁴ , and X ⁵ are each independently ents, X ¹ , X ² , X ⁴ , and X ⁵ are each CH. [0120] In certain embodiments, A ¹ is C and A ² is N. [0121] In certain embodiments, the moiety . [0122] In certain embodiments, the moiety . In certain embodiments, X ¹ , X ² , X ⁴ , X ⁵ , and X ⁶ are each independen ^{1 2 4 5} iments, X , X , X , X , and X ⁶ are each CH. [0123] In certain embodiments, the moiet . In certain embodiments, X ¹ , X ² , X ³ , X ⁴ , and X ⁶ are each independen t y C o C . ce ta e bodiments, X ¹ , X ² , X ³ , X ⁴ , and X ⁶ are each CH. [0124] In certain embodiments, the moiet . In certain embodiments, X ¹ , X ² , X ³ , X ⁴ , and X ⁵ are each independen tly CH or CR . In certain embodiments, X ¹ , X ² , X ³ , X ⁴ , and X ⁵ are each CH. [0125] In certain embodiments, the moiet . In certain embodiments, X ¹ , X ² , X ⁴ , and X ⁶ are each independently ents, X ¹ , X ² , X ⁴ , and X ⁶ are each CH. [0126] In certain embodiments, the moiety . In certain embodiments, X ² , X ⁵ , X ⁴ , and X ⁶ are each independently C nts, X ² , X ³ , X ⁵ , and X ⁶ are each CH. [0127] In certain embodiments, the moie . In certain embodiments, X ¹ , X ² , X ⁴ , and X ⁵ are each independently ents, X ¹ , X ² , X ⁴ , and X ⁵ are each CH. [0128] In certain embodiments, the moiet . In certain embodiments, X ² , X ³ , X ⁴ , and X ⁵ are each independently nts, X ² , X ³ , X ⁴ , ⁵ and X are each CH. [0129] In certain embodiments, the moiety . In certain embodiments, X ² , X ³ , X ⁴ , and X ⁶ are each independently ments, X ² , X ³ , X ⁴ , and X ⁶ are each CH. [0130] In certain embodiments, the moiet . In certain embodiments, X ¹ , X ² , X ⁵ , and X ⁶ are each independently CH or CR . In certain embodiments, X ¹ , X ² , X ⁵ , and X ⁶ are each CH. [0131] In certain embodiments, the moiet . In certain embodiments, X ² , X ⁴ , X ⁵ , and X ⁶ are each independently nts, X ² , X ⁴ , X ⁵ , and X ⁶ are each CH. [0132] In certain embodiments, the moiet . In certain embodiments, X ¹ , X ² , X ³ , and X ⁶ are each independently nts, X ¹ , X ² , X ³ , and X ⁶ are each CH. [0133] In certain embodiments, the moiety . In certain embodiments, X ² , X ³ , and X ⁶ are each independently CH o X ² , X ³ , and X ⁶ are each CH. 1 [0134] In certain embodiments, X is N. [0135] In certain embodiments, X ¹ is CH or CR ⁶ . In certain embodiments, X ¹ is CH. In certain embodiments, X ¹ is CR ⁶ . In certain embodiments, R ⁶ is halo, cyano, -OR ¹¹ , or C _1-6 alkyl optionally substituted with one to five halo. [0136] In certain embodiments, X ² is N. [0137] In certain embodiments, X ² is CH or CR ⁶ . In certain embodiments, X ² is CH. In certain embodiments, X ² is CR ⁶ . In certain embodiments, R ⁶ is halo, cyano, -OR ¹¹ , or C _1-6 alkyl optionally substituted with one to five halo. [0138] In certain embodiments, X ³ is N. [0139] In certain embodiments, X ³ is CH or CR ⁶ . In certain embodiments, X ³ is CH. In certain embodiments, X ³ is CR ⁶ . In certain embodiments, R ⁶ is halo, cyano, -OR ¹¹ , or C _1-6 alkyl optionally substituted with one to five halo. [0140] In certain embodiments, X ⁴ is N. [0141] In certain embodiments, X ⁴ is CH or CR ⁶ . In certain embodiments, X ⁴ is CH. In certain embodiments, X ⁴ is CR ⁶ . In certain embodiments, R ⁶ is halo, cyano, -OR ¹¹ , or C _1-6 alkyl optionally substituted with one to five halo. [0142] In certain embodiments, X ⁵ is N. [0143] In certain embodiments, X ⁵ is CH or CR ⁶ . In certain embodiments, X ⁵ is CH. In certain embodiments, X ⁵ is CR ⁶ . In certain embodiments, R ⁶ is halo, cyano, -OR ¹¹ , or C _1-6 alkyl optionally substituted with one to five halo. [0144] In certain embodiments, X ⁶ is N. [0145] In certain embodiments, X ⁶ is CH or CR ⁶ . In certain embodiments, X ⁶ is CH. In certain embodiments, X ⁶ is CR ⁶ . In certain embodiments, R ⁶ is halo, cyano, -OR ¹¹ , or C _1-6 alkyl optionally substituted with one to five halo. [0146] In certain embodiments, the moiet [0147] In certain embodiments, the moiety is: [0148] In certain embodiments, R ⁶ is halo, cyano, -OR ¹¹ , or C _1-6 alkyl optionally substituted with one to five halo. [0149] In certain embodiments, each Z ¹ is independently halo, cyano, C _1-6 alkyl, C _1-6 haloalkyl, heteroaryl, -OR ¹² , -C(O)R ¹² , -C(O)OR ¹² , or -C(O)N(R ¹² ) ₂ ; wherein each C _1-6 alkyl, C _1-6 haloalkyl, heteroaryl is independently optionally substituted with one to five hydroxy, methoxy, or methyl. [0150] In certain embodiments, each Z ¹ is independently halo, cyano, -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹² ) ₂ , -OR ¹² , -SR ¹² , -C(O)R ¹² , -C(O)OR ¹² , -S(O)R ¹² , -S(O) ₂ R ¹² , -C(O)N(R ¹² ) ₂ , -NR ¹² C(O)R ¹² , -NR ¹² S(O)R ¹² , -NR ¹² S(O) ₂ R ¹² , -S(O)N(R ¹² ) ₂ , -S(O) ₂ N(R ¹² ) ₂ , -NR ¹² C(O)N(R ¹² ) ₂ , -NR ¹² S(O)N(R ¹² ) ₂ , -NR ¹² S(O) ₂ N(R ¹² ) ₂ , -OC(O)N(R ¹² ) ₂ , or -NR ¹² C(O)OR ¹² ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1a ; each R ¹² is independently hydrogen, C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl; wherein each C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl, is independently optionally substituted with one to five Z ^1b ; each Z ^1a is independently halo, cyano, -NO2, C _1-6 alkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹³ ) ₂ , -OR ¹³ , -SR ¹³ , -C(O)R ¹³ , -C(O)OR ¹³ , -S(O)R ¹³ , -S(O) ₂ R ¹³ , -C(O)N(R ¹³ ) ₂ , -NR ¹³ C(O)R ¹³ , -NR ¹³ S(O)R ¹³ , -NR ¹³ S(O) ₂ R ¹³ , -S(O)N(R ¹³ ) ₂ , -S(O) ₂ N(R ¹³ ) ₂ , -NR ¹³ C(O)N(R ¹³ ) ₂ , -NR ¹³ S(O)N(R ¹³ ) ₂ , -NR ¹³ S(O) ₂ N(R ¹³ ) ₂ , -OC(O)N(R ¹³ ) ₂ , or -NR ¹³ C(O)OR ¹³ ; wherein each C _1-6 alkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each R ¹³ is independently hydrogen, C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl; wherein each C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl, is independently optionally substituted with one to five Z ^1b ; each Z ^1b is independently halo, cyano, -OH, -SH, -NH ₂ , -NO ₂ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -L-C _1-6 alkyl, -L-C _1-6 haloalkyl, -L-C _3-10 cycloalkyl, or -L-heterocyclyl; and each L is independently -O-, -NH-, -S-, -S(O)-, -S(O) ₂ -, -N(C _1-6 alkyl)-, -N(C _1-6 haloalkyl)-, -N(C _3-10 cycloalkyl)-, -C(O)-, -C(O)O-, -C(O)NH-, -C(O)N(C _1-6 alkyl)-, -C(O)N(C _1-6 haloalkyl)-, -C(O)N(C _3-10 cycloalkyl)-, -NHC(O)-, -NHC(O)O-, -NHC(O)NH-, -NHS(O)-, or -S(O) ₂ NH-. [0151] In certain embodiments, each Z ¹ is independently halo, cyano, -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹² ) ₂ , -OR ¹² , -SR ¹² , -C(O)R ¹² , -C(O)OR ¹² , -S(O)R ¹² , -S(O) ₂ R ¹² , -C(O)N(R ¹² ) ₂ , -NR ¹² C(O)R ¹² , -NR ¹² S(O)R ¹² , -NR ¹² S(O) ₂ R ¹² , -S(O)N(R ¹² ) ₂ , -S(O) ₂ N(R ¹² ) ₂ , -NR ¹² C(O)N(R ¹² ) ₂ , -NR ¹² S(O)N(R ¹² ) ₂ , -NR ¹² S(O) ₂ N(R ¹² ) ₂ , -OC(O)N(R ¹² ) ₂ , or -NR ¹² C(O)OR ¹² ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1a ; each R ¹³ is independently hydrogen or C _1-6 alkyl; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ^1b ; each Z ^1a is independently halo, -OR ¹³ , or C _1-6 alkyl; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ^1b ; each R ¹³ is independently hydrogen or C _1-6 alkyl; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ^1b ; and each Z ^1b is independently halo or -O-C _1-6 alkyl. [0152] In certain embodiments, provided is a compound of Formula I, or a pharmaceutically acceptable salt, isotopically enriched analog, prodrug, stereoisomer, or a mixture of stereoisomers thereof, wherein: A ¹ is N and A ² is C; or A ¹ is C and A ² is N; X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ are each independently N, CH, or CR ⁶ ; provided that at least one of X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ is N; R ¹ is halo, cyano, C _1-6 alkyl, C _1-6 haloalkyl, or C _3-10 cycloalkyl; R ² is -OR ⁷ , -NR ⁸ R ⁹ , C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl; wherein the C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl is independently optionally substituted with one to five Z ¹ ; R ⁴ is hydrogen, halo, cyano, C _1-6 alkyl, or C _3-10 cycloalkyl; wherein the C _1-6 alkyl or C _3-10 cycloalkyl, is independently optionally substituted with one to five Z ¹ ; R ⁵ is hydrogen, halo, cyano, C _1-6 alkyl, or C _3-10 cycloalkyl; wherein the C _1-6 alkyl or C _3-10 cycloalkyl, is independently optionally substituted with one to five Z ¹ ; each R ⁶ is independently halo, cyano, C _1-6 alkyl, or -OR ¹¹ ; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ¹ ; R ⁷ is C _1-6 alkyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, or heterocyclyl; wherein the C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl, is independently optionally substituted with one to five Z ¹ ; or R ⁸ and R ⁹ together form a heterocyclyl, which may further be independently optionally substituted with one to five Z ¹ ; each R ¹¹ is independently hydrogen, C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl; wherein each hydrogen, C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl is independently optionally substituted with one to five Z ^1a ; each Z ¹ is independently halo, cyano, -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹² ) ₂ , -OR ¹² , -SR ¹² , -C(O)R ¹² , -C(O)OR ¹² , -S(O)R ¹² , -S(O) ₂ R ¹² , -C(O)N(R ¹² ) ₂ , -NR ¹² C(O)R ¹² , -NR ¹² S(O)R ¹² , -NR ¹² S(O) ₂ R ¹² , -S(O)N(R ¹² ) ₂ , -S(O) ₂ N(R ¹² ) ₂ , -NR ¹² C(O)N(R ¹² ) ₂ , -NR ¹² S(O)N(R ¹² ) ₂ , -NR ¹² S(O) ₂ N(R ¹² ) ₂ , -OC(O)N(R ¹² ) ₂ , or -NR ¹² C(O)OR ¹² ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1a ; each R ¹² is independently hydrogen, C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl; wherein each C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl, is independently optionally substituted with one to five Z ^1b ; each Z ^1a is independently halo, cyano, -NO2, C _1-6 alkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹³ ) ₂ , -OR ¹³ , -SR ¹³ , -C(O)R ¹³ , -C(O)OR ¹³ , -S(O)R ¹³ , -S(O) ₂ R ¹³ , -C(O)N(R ¹³ ) ₂ , -NR ¹³ C(O)R ¹³ , -NR ¹³ S(O)R ¹³ , -NR ¹³ S(O) ₂ R ¹³ , -S(O)N(R ¹³ ) ₂ , -S(O) ₂ N(R ¹³ ) ₂ , -NR ¹³ C(O)N(R ¹³ ) ₂ , -NR ¹³ S(O)N(R ¹³ ) ₂ , -NR ¹³ S(O) ₂ N(R ¹³ ) ₂ , -OC(O)N(R ¹³ ) ₂ , or -NR ¹³ C(O)OR ¹³ ; wherein each C _1-6 alkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each R ¹³ is independently hydrogen, C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl; wherein each C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl, is independently optionally substituted with one to five Z ^1b ; each Z ^1b is independently halo, cyano, -OH, -SH, -NH ₂ , -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -L-C _1-6 alkyl, -L-C _1-6 haloalkyl, -L-C _3-10 cycloalkyl, or -L-heterocyclyl; and each L is independently -O-, -NH-, -S-, -S(O)-, -S(O) ₂ -, -N(C _1-6 alkyl)-, -N(C _1-6 haloalkyl)-, -N(C _3-10 cycloalkyl)-, -C(O)-, -C(O)O-, -C(O)NH-, -C(O)N(C _1-6 alkyl)-, -C(O)N(C _1-6 haloalkyl)-, -C(O)N(C _3-10 cycloalkyl)-, -NHC(O)-, -NHC(O)O-, -NHC(O)NH-, -NHS(O)-, or -S(O) ₂ NH-; provided that when R ¹ is fluoro, R ⁴ is hydrogen, and R ² is benzyloxy wherein the is optionally substituted by one or two fluoro or one or two methyl; then the moiety is not represented by . [0153] In certa nts, provided is a comp I, or a pharmaceutically acceptable salt, isotopically enriched analog, prodrug, stereoisomer, or a mixture of stereoisomers thereof, wherein: A ¹ is N and A ² is C; or A ¹ is C and A ² is N; X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ are each independently N, CH, or CR ⁶ ; provided that at least one of X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ is N; R ¹ is halo, cyano, C _1-6 alkyl, C _1-6 haloalkyl, or C _3-10 cycloalkyl; R ² is -OR ⁷ , -NR ⁸ R ⁹ , C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl; wherein the C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl is independently optionally substituted with one to five Z ¹ ; R ⁴ is hydrogen; R ⁵ is hydrogen; each R ⁶ is independently halo, cyano, C _1-6 alkyl, or -OR ¹¹ ; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ¹ ; R ⁷ is C _1-6 alkyl or C _1-6 haloalkyl; wherein the C _1-6 alkyl is independently optionally substituted with one to five Z ¹ ; or R ⁸ and R ⁹ together form a heterocyclyl, which may further be independently optionally substituted with one to five Z ¹ ; each R ¹³ is independently hydrogen or C _1-6 alkyl; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ^1a ; each Z ¹ is independently halo, cyano, -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹² ) ₂ , -OR ¹² , -SR ¹² , -C(O)R ¹² , -C(O)OR ¹² , -S(O)R ¹² , -S(O) ₂ R ¹² , -C(O)N(R ¹² ) ₂ , -NR ¹² C(O)R ¹² , -NR ¹² S(O)R ¹² , -NR ¹² S(O) ₂ R ¹² , -S(O)N(R ¹² ) ₂ , -S(O) ₂ N(R ¹² ) ₂ , -NR ¹² C(O)N(R ¹² ) ₂ , -NR ¹² S(O)N(R ¹² ) ₂ , -NR ¹² S(O) ₂ N(R ¹² ) ₂ , -OC(O)N(R ¹² ) ₂ , or -NR ¹² C(O)OR ¹² ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1a ; each R ¹³ is independently hydrogen or C _1-6 alkyl; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ^1b ; each Z ^1a is independently halo, -OR ¹³ , or C _1-6 alkyl; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ^1b ; each R ¹³ is independently hydrogen or C _1-6 alkyl; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ^1b ; and each Z ^1b is independently halo or -O-C _1-6 alkyl; provided that when R ¹ is fluoro, R ⁴ is hydrogen, and R ² is benzylox , wherein the is optionally substituted by one or two fluoro or one or two methyl; then the moiety is not represented b . [0154] In certa ts, provided is a com I, or a pharmaceutically acceptable salt, isotopically enriched analog, prodrug, stereoisomer, or a mixture of stereoisomers thereof, wherein: A ¹ is N and A ² is C; or A ¹ is C and A ² is N; X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ are each independently N, CH, or CR ⁶ ; provided that at least one of X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ is N; R ¹ is halo, cyano, C _1-6 alkyl, C _1-6 haloalkyl, or C _3-10 cycloalkyl; R ² is -OR ⁷ , -NR ⁸ R ⁹ , C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl; wherein the C _1-6 alkyl, C _3-10 cycloalkyl, or heterocyclyl is independently optionally substituted with one to five Z ¹ ; R ⁴ is hydrogen; R ⁵ is hydrogen; each R ⁶ is independently halo, cyano, C _1-6 alkyl, or -OR ¹¹ ; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ¹ ; R ⁷ is C _1-6 alkyl or C _1-6 haloalkyl; wherein the C _1-6 alkyl is independently optionally substituted with one to five Z ¹ ; or R ⁸ and R ⁹ together form a heterocyclyl, which may further be independently optionally substituted with one to five Z ¹ ; each R ¹³ is independently hydrogen or C _1-6 alkyl; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ^1a ; each Z ¹ is independently halo, cyano, C _1-6 alkyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ¹² , or -C(O)OR ¹² ; wherein each C _1-6 alkyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, is independently optionally substituted with one to five Z ^1a ; each R ¹³ is independently hydrogen or C _1-6 alkyl; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ^1b ; each Z ^1a is independently halo, -OR ¹³ , or C _1-6 alkyl; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ^1b ; each R ¹³ is independently hydrogen or C _1-6 alkyl; wherein each C _1-6 alkyl is independently optionally substituted with one to five Z ^1b ; and each Z ^1b is independently halo or -O-C _1-6 alkyl; provided that when R ¹ is fluoro, R ⁴ is hydrogen, and R ² is benzylox , wherein the is optionally substituted by one or two fluoro or one or two methyl; then the moiety is not represented b . [0155] In certa e bod e ts, provided is a comp om Table 1, or a pharmaceutically acceptable salt, isotopically enriched analog, prodrug, stereoisomer, or a mixture of stereoisomers thereof:

Table 1 E St t E St t Ex. Structure Ex. Structure E St t E St t

[0156] In certain embodiments, provided is a compound selected from Table 2 or a pharmaceutically acceptable salt thereof. Table 2 Structure Structure St t St t

3. Methods [0157] “Treatment” or “treating” is an approach for obtaining beneficial or desired results including clinical results. Beneficial or desired clinical results may include one or more of the following: a) inhibiting the disease or condition (e.g., decreasing one or more symptoms resulting from the disease or condition, and/or diminishing the extent of the disease or condition); b) slowing or arresting the development of one or more clinical symptoms associated with the disease or condition (e.g., stabilizing the disease or condition, preventing or delaying the worsening or progression of the disease or condition, and/or preventing or delaying the spread (e.g., metastasis) of the disease or condition); and/or c) relieving the disease, that is, causing the regression of clinical symptoms (e.g., ameliorating the disease state, providing partial or total remission of the disease or condition, enhancing effect of another medication, delaying the progression of the disease, increasing the quality of life, and/or prolonging survival. [0158] “Prevention” or “preventing” means any treatment of a disease or condition that causes the clinical symptoms of the disease or condition not to develop. Compounds may, in certain embodiments, be administered to a subject (including a human) who is at risk or has a family history of the disease or condition. [0159] “Subject” refers to an animal, such as a mammal (including a human), that has been or will be the object of treatment, observation or experiment. The methods described herein may be useful in human therapy, and/or veterinary applications. In certain embodiments, the subject is a mammal. In certain embodiments, the subject is a human. [0160] The term “therapeutically effective amount” or “effective amount” of a compound described herein or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof means an amount sufficient to effect treatment when administered to a subject, to provide a therapeutic benefit such as amelioration of symptoms or slowing of disease progression. For example, a therapeutically effective amount may be an amount sufficient to decrease a symptom of a disease or condition of as described herein. The therapeutically effective amount may vary depending on the subject, and disease or condition being treated, the weight and age of the subject, the severity of the disease or condition, and the manner of administering, which can readily be determined by one of ordinary skill in the art. [0161] The methods described herein may be applied to cell populations in vivo or ex vivo. “In vivo” means within a living individual, as within an animal or human. In this context, the methods described herein may be used therapeutically in an individual. “Ex vivo” means outside of a living individual. Examples of ex vivo cell populations include in vitro cell cultures and biological samples including fluid or tissue samples obtained from individuals. Such samples may be obtained by methods well known in the art. Exemplary biological fluid samples include blood, cerebrospinal fluid, urine, and saliva. In this context, the compounds and compositions described herein may be used for a variety of purposes, including therapeutic and experimental purposes. For example, the compounds and compositions described herein may be used ex vivo to determine the optimal schedule and/or dosing of administration of a compound of the present disclosure for a given indication, cell type, individual, and other parameters. Information gleaned from such use may be used for experimental purposes or in the clinic to set protocols for in vivo treatment. Other ex vivo uses for which the compounds and compositions described herein may be suited are described below or will become apparent to those skilled in the art. The compounds may be further characterized to examine the safety or tolerance dosage in human or non- human subjects. Such properties may be examined using commonly known methods to those skilled in the art. [0162] In certain embodiments, provided are compounds, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, that inhibit the activity of Sterile Alpha and TIR Motif containing 1 (SARM1) protein. In certain embodiments, the compounds provided herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, inhibits SARM1. [0163] In certain methods, uses and compositions provided herein, the compound is a compound of Formula I: or a pharmaceutically acce ptable salt, isotopically enriched analog, stereoisomer, tautomer, mixture of stereoisomers thereof, wherein: A ¹ is N and A ² is C; or A ¹ is C and A ² is N; X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ are each independently N, CH, or CR ⁶ ; provided that at least one of X ¹ , X ² , X ³ , X ⁴ , X ⁵ , and X ⁶ is N; R ¹ is hydrogen, halo, cyano, -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ ) ₂ , -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O) ₂ R ¹¹ , -S(O)N(R ¹¹ ) ₂ , -S(O) ₂ N(R ¹¹ ) ₂ , -NR ¹¹ C(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O) ₂ N(R ¹¹ ) ₂ , -OC(O)N(R ¹¹ ) ₂ , or -NR ¹¹ C(O)OR ¹¹ ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl, is independently optionally substituted with one to five Z ¹ ; R ² is -OR ⁷ , -NR ⁸ R ⁹ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; R ⁴ is hydrogen, halo, cyano, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ ) ₂ , -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O) ₂ R ¹¹ , -S(O)N(R ¹¹ ) ₂ , -S(O) ₂ N(R ¹¹ ) ₂ , -NR ¹¹ C(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O) ₂ N(R ¹¹ ) ₂ , -OC(O)N(R ¹¹ ) ₂ , or -NR ¹¹ C(O)OR ¹¹ ; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; R ⁵ is hydrogen, halo, cyano, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ ) ₂ , -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O) ₂ R ¹¹ , -S(O)N(R ¹¹ ) ₂ , -S(O) ₂ N(R ¹¹ ) ₂ , -NR ¹¹ C(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O) ₂ N(R ¹¹ ) ₂ , -OC(O)N(R ¹¹ ) ₂ , or -NR ¹¹ C(O)OR ¹¹ ; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; each R ⁶ is independently halo, cyano, -NO ₂ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ ) ₂ , -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O) ₂ R ¹¹ , -S(O)N(R ¹¹ ) ₂ , -S(O) ₂ N(R ¹¹ ) ₂ , -NR ¹¹ C(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O) ₂ N(R ¹¹ ) ₂ , -OC(O)N(R ¹¹ ) ₂ , or -NR ¹¹ C(O)OR ¹¹ ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl, is independently optionally substituted with one to five Z ¹ ; R ⁷ is C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; R ⁸ is hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; R ⁹ is hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ¹ ; or R ⁸ and R ⁹ together form a heterocyclyl, which may further be independently optionally substituted with one to five Z ¹ ; each R ¹¹ is independently hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1a ; each Z ¹ is independently halo, cyano, -NO ₂ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹² ) ₂ , -OR ¹² , -SR ¹² , -C(O)R ¹² , -C(O)OR ¹² , -S(O)R ¹² , -S(O) ₂ R ¹² , -C(O)N(R ¹² ) ₂ , -NR ¹² C(O)R ¹² , -NR ¹² S(O)R ¹² , -NR ¹² S(O) ₂ R ¹² , -S(O)N(R ¹² ) ₂ , -S(O) ₂ N(R ¹² ) ₂ , -NR ¹² C(O)N(R ¹² ) ₂ , -NR ¹² S(O)N(R ¹² ) ₂ , -NR ¹² S(O) ₂ N(R ¹² ) ₂ , -OC(O)N(R ¹² ) ₂ , or -NR ¹² C(O)OR ¹² ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1a ; each R ¹² is independently hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each Z ^1a is independently halo, cyano, -NO ₂ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹³ ) ₂ , -OR ¹³ , -SR ¹³ , -C(O)R ¹³ , -C(O)OR ¹³ , -S(O)R ¹³ , -S(O) ₂ R ¹³ , -C(O)N(R ¹³ ) ₂ , -NR ¹³ C(O)R ¹³ , -NR ¹³ S(O)R ¹³ , -NR ¹³ S(O) ₂ R ¹³ , -S(O)N(R ¹³ ) ₂ , -S(O) ₂ N(R ¹³ ) ₂ , -NR ¹³ C(O)N(R ¹³ ) ₂ , -NR ¹³ S(O)N(R ¹³ ) ₂ , -NR ¹³ S(O) ₂ N(R ¹³ ) ₂ , -OC(O)N(R ¹³ ) ₂ , or -NR ¹³ C(O)OR ¹³ ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each R ¹³ is independently hydrogen, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl is independently optionally substituted with one to five Z ^1b ; each Z ^1b is independently halo, cyano, -OH, -SH, -NH ₂ , -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -L-C _1-6 alkyl, -L-C _2-6 alkenyl, -L-C _2-6 alkynyl, -L-C _1-6 haloalkyl, -L-C _3-10 cycloalkyl, -L-heterocyclyl, -L-aryl, or -L-heteroaryl; and each L is independently -O-, -NH-, -S-, -S(O)-, -S(O) ₂ -, -N(C _1-6 alkyl)-, -N(C _2-6 alkenyl)-, -N(C _2-6 alkynyl)-, -N(C _1-6 haloalkyl)-, -N(C _3-10 cycloalkyl)-, -N(heterocyclyl)-, -N(aryl)-, -N(heteroaryl)-, -C(O)-, -C(O)O-, -C(O)NH-, -C(O)N(C _1-6 alkyl)-, -C(O)N(C _2-6 alkenyl)-, -C(O)N(C _2-6 alkynyl)-, -C(O)N(C _1-6 haloalkyl)-, -C(O)N(C _3-10 cycloalkyl)-, -C(O)N(heterocyclyl)-, -C(O)N(aryl)-, -C(O)N(heteroaryl)-, -NHC(O)-, -NHC(O)O-, -NHC(O)NH-, -NHS(O)-, or -S(O) ₂ NH-; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, and heteroaryl of Z ^1b and L is further independently optionally substituted with one to five halo, cyano, -OH, -SH, -NH ₂ , -NO ₂ , -SF ₅ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _1-6 alkoxy, C _1-6 haloalkoxy, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl. [0164] In certain embodiments, R ¹ is halo, cyano, -NO2, C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _1-6 haloalkyl, C _3-10 cycloalkyl, heterocyclyl, aryl, heteroaryl, -N(R ¹¹ ) ₂ , -OR ¹¹ , -SR ¹¹ , -C(O)R ¹¹ , -C(O)OR ¹¹ , -S(O)R ¹¹ , -S(O) ₂ R ¹¹ , -C(O)N(R ¹¹ ) ₂ , -NR ¹¹ C(O)R ¹¹ , -NR ¹¹ S(O)R ¹¹ , -NR ¹¹ S(O) ₂ R ¹¹ , -S(O)N(R ¹¹ ) ₂ , -S(O) ₂ N(R ¹¹ ) ₂ , -NR ¹¹ C(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O)N(R ¹¹ ) ₂ , -NR ¹¹ S(O) ₂ N(R ¹¹ ) ₂ , -OC(O)N(R ¹¹ ) ₂ , or -NR ¹¹ C(O)OR ¹¹ ; wherein each C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, heterocyclyl, aryl, or heteroaryl, is independently optionally substituted with one to five Z ¹ . [0165] In certain embodiments, R ² is -OR ⁷ , -NR ⁸ R ⁹ , C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, or heterocyclyl; wherein the C _1-6 alkyl, C _2-6 alkenyl, C _2-6 alkynyl, C _3-10 cycloalkyl, or heterocyclyl is independently optionally substituted with one to five Z ¹ ; [0166] In certain embodiments, when R ¹ is fluoro, R ⁴ is hydrogen, and R ² is benzylo , or , wherein the is optionally substituted by one or two fluoro or one or two methyl; then the moiety is not represented by . [0167] In certain embo ompound is not N-[4-c morpholinyl)imidazo[1,2- a]pyrimidin-7-yl]phenyl]-1-pyrrolidinecarboxamide (CAS No.2080411-04-5), N-[6-[5-(acetylamino)-2- methylphenyl]imidazo[1,2-a]pyridin-2-yl]-2-fluoro-cyclopropa necarboxamide (CAS No.2479976-73-1), (1S,2S)-N-[6-[5-(acetylamino)-2-methylphenyl]imidazo[1,2-a]p yridin-2-yl]-2-fluoro- cyclopropanecarboxamide (CAS No.2479974-28-0), 4-[4-(acetylamino)-2-[3-methyl-8-(methylamino)- 1,2,4-triazolo[4,3-a]pyridin-6-yl]phenoxy]-1-piperidinecarbo xylic acid 1,1-dimethylethyl ester (CAS No. 2569003-03-6), N-[3-[3-methyl-8-(methylamino)-1,2,4-triazolo[4,3-a]pyridin- 6-yl]-4-[4- (trifluoromethyl)phenoxy]phenyl]-acetamide (CAS No.2569002-87-3), N-[4-(4-chloro-2- fluorophenoxy)-3-(3-methyl-1,2,4-triazolo[4,3-a]pyridin-6-yl )phenyl]-2,2-dimethyl-propanamide (CAS No.2413866-36-9), N-[4-(2,4-difluorophenoxy)-3-(3-methyl-1,2,4-triazolo[4,3-a] pyridin-6-yl)phenyl]- cyclopropanecarboxamide (CAS No.2413866-26-7), or N-[4-(2,4-difluorophenoxy)-3-(3-methyl-1,2,4- triazolo[4,3-a]pyridin-6-yl)phenyl]-propanamide (CAS No.2413866-25-6). [0168] In certain embodiments, at least one of A ¹ , X ³ , and X ⁴ is other than N. [0169] In certain embodiments, when X ⁶ is C-N(R ¹¹ ) ₂ , then at least one of A ² , X ¹ , and X ⁵ is other than N. [0170] In certain embodiments, provided is a method of inhibiting SARM1 activity comprising contacting a cell with an effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof. The inhibiting can be in vitro or in vivo. [0171] In certain embodiments, provided is a compound as disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, for use in inhibiting SARM1 activity (e.g., in vitro or in vivo). [0172] In certain embodiments, the present disclosure provides use of a compound as disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, in the manufacture of a medicament for inhibiting SARM1 activity (e.g., in vitro or in vivo). [0173] In certain embodiments, provided is a compound as disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, for inhibiting NADase activity of SARM1. In certain embodiments, provided is a method of inhibiting SARM1 NADase activity and/or treating a neurodegenerative or neurological disease or disorder in a subject in need thereof, comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, to the subject. [0174] In certain embodiments, provided is a method for treating a disease or condition mediated, at least in part, by SARM1, comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof to a subject in need thereof. [0175] In certain embodiments, provided is a method of treating axonal degeneration in a subject in need thereof, comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, to the subject. In certain embodiments, the compound, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, inhibits axonal degeneration, including axonal degeneration that results from reduction or depletion of NAD+. In certain embodiments, the compound, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, prevents an axon distal to an axonal injury from degenerating. [0176] In certain embodiments, provided is a method for treating degradation of a peripheral nervous system neuron or a portion thereof, comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof. [0177] In certain embodiments, provided is a method for treating degeneration of a central nervous system neuron or a portion thereof, comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof. [0178] In certain embodiments, the treating comprises reducing one or more symptoms or features of neurodegeneration. [0179] In certain embodiments, provided is a method for inhibiting axon degeneration, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof. [0180] In certain embodiments, provided is a method for treating a neurodegenerative or neurological disease or disorder, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof. [0181] In certain embodiments, provided is a method for treating a neurodegenerative or neurological disease or disorder associated with axonal degeneration, axonal damage, axonopathy, a demyelinating disease, a central pontine myelinolysis, a nerve injury disease or disorder, a metabolic disease, a mitochondrial disease, metabolic axonal degeneration, axonal damage resulting from traumatic axonal injury (TAI) (see Ziogas et al., J. Neuroscience, 2018, 38(16):4031-4032 and WO2020191257), a leukoencephalopathy or a leukodystrophy, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof. [0182] In certain embodiments, provided is a compound as disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, for use in treating a disease or condition mediated, at least in part, by SARM1 in a subject in need thereof. [0183] In certain embodiments, provided is a compound as disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, for use in inhibiting axon degeneration in a subject in need thereof. [0184] In certain embodiments, the present disclosure provides use of a compound as disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof in the manufacture of a medicament for inhibiting axon degeneration in a subject in need thereof. [0185] In certain embodiments, the present disclosure provides use of a compound as disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof in the manufacture of a medicament for treating a neurodegenerative or neurological disease or disorder, such as a disease or disorder associated with axonal degeneration, axonal damage, axonopathy, a demyelinating disease, a central pontine myelinolysis, a nerve injury disease or disorder, a metabolic disease, a mitochondrial disease, metabolic axonal degeneration, axonal damage resulting from traumatic axonal injury (TAI), a leukoencephalopathy or a leukodystrophy. [0186] In certain embodiments, the disease or condition is an acute condition. In certain embodiments, the disease or condition is a chronic condition. [0187] In certain embodiments, the disease or condition is characterized by axonal degeneration in the central nervous system, the peripheral nervous system, the optic nerve, the cranial nerves, or a combination thereof. [0188] In certain embodiments, the disease or condition is or comprises acute injury to the central nervous system, such as, but not limited to, injury to the spinal cord and/or traumatic brain injury (TBI). In certain embodiments, the disease or condition is or comprises a chronic injury to the central nervous system, such as, but not limited to, injury to the spinal cord, traumatic brain injury (TBI), and/or traumatic axonal injury (TAI). In certain embodiments, the disease or condition is or comprises chronic traumatic encephalopathy (CTE). [0189] In certain embodiments, the disease or condition is a chronic condition affecting the central nervous system, such as, but not limited to, Parkinson’s disease (see, e.g., Sajadi, A., et al. Curr. Biology. 2004, 14, 326-330; and Hasbani, D.M., et al. Exp. Neurology.2006, 202, 93-99), amyotrophic lateral sclerosis (see, e.g., White, M.A., et al. Acta Neuropath. Comm.2019, 7(1), 166), multiple sclerosis, Huntington disease, or Alzheimer’s disease. [0190] In certain embodiments, the disease or condition is an acute peripheral neuropathy. In certain embodiments, the disease or condition is chemotherapy-induced peripheral neuropathy (CIPN). See, e.g., Geisler, S., et al. Brain.2016, 139, 3092-3108; Turkiew, E., et al. J. Peripher. Nerv. Syst.2017, 22, 162- 171; Geisler, S., et al. JCI Insight.2019, 4(17), e129920; and Cetinkaya-Fisgin, A., et al. Sci. Rep.2020, 21889. Chemotherapy-induced peripheral neuropathy (CIPN), an example of an acute peripheral neuropathy, can be associated with various drugs, such as, but not limited to, thalidomide, epothilones (e.g., ixabepilone), taxanes (e.g., paclitaxel and docetaxel), vinca alkaloids (e.g., vinblastine, vinorelbine, vincristine, and vindesine), proteasome inhibitors (e.g., bortezomib), or platinum-based drugs (e.g., cisplatin, oxaliplatin, and carboplatin). [0191] In certain embodiments, the disease or condition is a chronic condition affecting the peripheral nervous system, such as, but not limited to, diabetic neuropathy, HIV neuropathy, Charcot Marie Tooth disease, or amyotrophic lateral sclerosis. [0192] In certain embodiments, the disease or condition is glaucoma (see, e.g., Ko, K.W., et al. J. Cell Bio.2020, 219(8), e201912047). [0193] In certain embodiments, the disease or condition is an acute condition affecting the optic nerve, such as, but not limited to, diabetic optic neuropathy, acute optic neuropathy (AON) or acute angle closure glaucoma. [0194] In certain embodiments, the disease or condition is a chronic condition affecting the optic nerve, such as, but not limited to, diabetic optic neuropathy, Leber’s congenital amaurosis, Leber’s hereditary optic neuropathy (LHON), primary open angle glaucoma, or autosomal dominant optic atrophy. [0195] In certain embodiments, the disease or condition is associated with retinal degeneration. In certain embodiments, the disease or condition is Leber congenital amaurosis, such as Leber congenital amaurosis type 9 (LCA9) (see, e.g., Sasaki, Y., et al. eLife.2020, 9, e62027.) [0196] In certain embodiments, one or more compounds and/or compositions as described herein are useful, for example, to treat one or more neurodegenerative diseases, disorders or conditions selected from the group consisting of neuropathies or axonopathies. In certain embodiments, one or more compounds and/or compositions as described herein are useful, for example to treat a neuropathy or axonopathy associated with axonal degeneration. In certain embodiments, a neuropathy associated with axonal degeneration is a hereditary or congenital neuropathy or axonopathy. In certain embodiments, a neuropathy associated with axonal degeneration results from a de novo or somatic mutation. In certain embodiments, a neuropathy associated with axonal degeneration is selected from a list contained herein. In certain embodiments, a neuropathy or axonopathy is associated with axonal degeneration, including, but not limited to Parkinson’s disease, Alzheimer’s disease, herpes infection, diabetes, amyotrophic lateral sclerosis, a demyelinating disease, ischemia, stroke, chemical injury, thermal injury, or AIDS. [0197] In certain embodiments, one or more compounds or compositions as described herein is characterized that, when administered to a population of subjects, reduces one or more symptoms or features of neurodegeneration. For example, in certain embodiments, a relevant symptom or feature may be selected from the group consisting of extent, rate, and/or timing of neuronal disruption. In certain embodiments, neuronal disruption may be or comprise axonal degradation, loss of synapses, loss of dendrites, loss of synaptic density, loss of dendritic arborization, loss of axonal branching, loss of neuronal density, loss of myelination, loss of neuronal cell bodies, loss of synaptic potentiation, loss of action-potential potentiation, loss of cytoskeletal stability, loss of axonal transport, loss of ion channel synthesis and turnover, loss of neurotransmitter synthesis, loss of neurotransmitter release and reuptake capabilities, loss of axon-potential propagation, neuronal hyperexcitability, and/or neuronal hypoexcitability. In certain embodiments, neuronal disruption is characterized by an inability to maintain an appropriate resting neuronal membrane potential. In certain embodiments, neuronal disruption is characterized by the appearance of inclusion bodies, plaques, and/or neurofibrillary tangles. In certain embodiments, neuronal disruption is characterized by the appearance of stress granules. In certain embodiments, neuronal disruption is characterized by the intracellular activation of one or more members of the cysteine-aspartic protease (Caspase) family. In certain embodiments, neuronal disruption is characterized by a neuron undergoing programed cell death (e.g. apoptosis, pyroptosis, ferroapoptosis, and/or necrosis) and/or inflammation. [0198] In certain embodiments, the neurodegenerative or neurological disease or disorder is associated with axonal degeneration, axonal damage, axonopathy, a demyelinating disease, a central pontine myelinolysis, a nerve injury disease or disorder, a metabolic disease, a mitochondrial disease, metabolic axonal degeneration, axonal damage resulting from a leukoencephalopathy or a leukodystrophy. In certain embodiments, the neurodegenerative or neurological disease or disorder is spinal cord injury, stroke, multiple sclerosis, progressive multifocal leukoencephalopathy, congenital hypomyelination, encephalomyelitis, acute disseminated encephalomyelitis, central pontine myelolysis, osmotic hyponatremia, hypoxic demyelination, ischemic demyelination, adrenoleukodystrophy, Alexander’s disease, Niemann-Pick disease, Pelizaeus Merzbacher disease, periventricular leukomalacia, globoid cell leukodystrophy (Krabbe’s disease), Wallerian degeneration, optic neuritis, transverse myelitis, amyotrophic lateral sclerosis (ALS, Lou Gehrig’s disease), Huntington’s disease, Alzheimer’s disease, Parkinson’s disease, Tay-Sacks disease, Gaucher’s disease, Hurler Syndrome, traumatic brain injury (TBI), traumatic axonal injury (TAI), post radiation injury, neurologic complications of chemotherapy (e.g., chemotherapy induced peripheral neuropathy, CIPN), neuropathy, acute ischemic optic neuropathy, vitamin B12 deficiency, isolated vitamin E deficiency syndrome, Bassen-Kornzweig syndrome, retinal degeneration, glaucoma, retinitis pigmentosa, traumatic optic injury, Leber’s hereditary optic atrophy (neuropathy), Leber congenital amaurosis (e.g., Leber congenital amaurosis type 9 (LCA9)), neuromyelitis optica, metachromatic leukodystrophy, acute hemorrhagic leukoencephalitis, trigeminal neuralgia, Bell’s palsy, cerebral ischemia, multiple system atrophy, traumatic glaucoma, tropical spastic paraparesis human T-lymphotropic virus 1 (HTLV-1) associated myelopathy, west Nile virus encephalopathy, La Crosse virus encephalitis, Bunyavirus encephalitis, pediatric viral encephalitis, essential tremor, Charcot-Marie-Tooth disease, motor neuron disease, spinal muscular atrophy (SMA), hereditary sensory and autonomic neuropathy (HSAN), adrenomyeloneuropathy, progressive supra nuclear palsy (PSP), Friedreich’s ataxia, hereditary ataxias, noise induced hearing loss, congenital hearing loss, Lewy Body Dementia, frontotemporal dementia, amyloidosis, diabetic neuropathy, HIV neuropathy, enteric neuropathies and axonopathies, Guillain-Barre syndrome, severe acute motor axonal neuropathy (AMAN), Creutzfeldt-Jakob disease, transmissible spongiform encephalopathy, spinocerebellar ataxias, pre-eclampsia, hereditary spastic paraplegias, spastic paraparesis, familial spastic paraplegia, French settlement disease, Strumpell-Lorrain disease, or non-alcoholic steatohepatitis (NASH). [0199] In certain embodiments, the present disclosure provides inhibitors of SARM1 activity for treatment of neurodegenerative or neurological diseases or disorders that involve axon degeneration or axonopathy. The present disclosure also provides methods of using inhibitors of SARM1 activity to treat, prevent or ameliorate axonal degeneration, axonopathies and neurodegenerative or neurological diseases or disorders that involve axonal degeneration. In certain embodiments, the present disclosure provides a method for inhibiting axon degeneration, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof. [0200] In certain embodiments, the present disclosure provides methods of treating neurodegenerative or neurological diseases or disorders related to axonal degeneration, axonal damage, axonopathies, demyelinating diseases, central pontine myelinolysis, nerve injury diseases or disorders, metabolic diseases, mitochondrial diseases, metabolic axonal degeneration, axonal damage resulting from a leukoencephalopathy or a leukodystrophy. [0201] In certain embodiments, neuropathies and axonopathies include any disease or condition involving neurons and/or supporting cells, such as for example, glia, muscle cells or fibroblasts, and, in particular, those diseases or conditions involving axonal damage. Axonal damage can be caused by traumatic injury or by non-mechanical injury due to diseases, conditions, or exposure to toxic molecules or drugs. The result of such damage can be degeneration or dysfunction of the axon and loss of functional neuronal activity. Disease and conditions producing or associated with such axonal damage are among a large number of neuropathic diseases and conditions. Such neuropathies can include peripheral neuropathies, central neuropathies, or combination thereof. Furthermore, peripheral neuropathic manifestations can be produced by diseases focused primarily in the central nervous systems and central nervous system manifestations can be produced by essentially peripheral or systemic diseases. [0202] In certain embodiments, a peripheral neuropathy may involve damage to the peripheral nerves, and/or can be caused by diseases of the nerves or as the result of systemic illnesses. Some such diseases include diabetes, uremia, infectious diseases such as AIDS or leprosy, nutritional deficiencies, vascular or collagen disorders such as atherosclerosis, or autoimmune diseases such as systemic lupus erythematosus, scleroderma, sarcoidosis, rheumatoid arthritis, and polyarteritis nodosa. In certain embodiments, peripheral nerve degeneration results from traumatic (mechanical) damage to nerves as well as chemical or thermal damage to nerves. Such conditions that injure peripheral nerves include compression or entrapment injuries such as glaucoma, carpal tunnel syndrome, direct trauma, penetrating injuries, contusions, fracture or dislocated bones; pressure involving superficial nerves (ulna, radial, or peroneal) which can result from prolonged use of crutches or staying in one position for too long, or from a tumor; intraneural hemorrhage; ischemia; exposure to cold or radiation or certain medicines or toxic substances such as herbicides or pesticides. In particular, the nerve damage can result from chemical injury due to a cytotoxic anticancer agent such as, for example, taxol, cisplatinin, a proteasome inhibitor, or a vinca alkaloid such as vincristine. Typical symptoms of such peripheral neuropathies include weakness, numbness, paresthesia (abnormal sensations such as burning, tickling, pricking or tingling) and pain in the arms, hands, legs and/or feet. In certain embodiments, a neuropathy is associated with mitochondrial dysfunction. Such neuropathies can exhibit decreased energy levels, i.e., decreased levels of NAD and ATP. [0203] In certain embodiments, peripheral neuropathy is a metabolic and endocrine neuropathy which includes a wide spectrum of peripheral nerve disorders associated with systemic diseases of metabolic origin. These diseases include, for example, diabetes mellitus, hypoglycemia, uremia, hypothyroidism, hepatic failure, polycythemia, amyloidosis, acromegaly, porphyria, a disorder of lipid/glycolipid metabolism, a nutritional/vitamin deficiency, or a mitochondrial disorder. The common hallmark of these diseases is involvement of peripheral nerves by alteration of the structure or function of myelin and axons due to metabolic pathway dysregulation. [0204] In certain embodiments, neuropathies include optic neuropathies such as glaucoma, retinal ganglion degeneration such as those associated with retinitis pigmentosa and outer retinal neuropathies, optic nerve neuritis and/or degeneration including that associated with multiple sclerosis, traumatic injury to the optic nerve which can include, for example, injury during tumor removal, hereditary optic neuropathies such as Kjer’s disease and Leber’s hereditary optic neuropathy (LHON), ischemic optic neuropathies, such as those secondary to giant cell arteritis, metabolic optic neuropathies such as neurodegenerative diseases including Leber’s neuropathy, nutritional deficiencies such as deficiencies in vitamins B12 or folic acid, and toxicities such as due to ethambutol or cyanide, neuropathies caused by adverse drug reactions and neuropathies caused by vitamin deficiency. Ischemic optic neuropathies also include non-arteritic anterior ischemic optic neuropathy. [0205] In certain embodiments, neurodegenerative diseases that are associated with neuropathy or axonopathy in the central nervous system include a variety of diseases. Such diseases include those involving progressive dementia such as, for example, Alzheimer’s disease, senile dementia, Pick’s disease, and Huntington’s disease, central nervous system diseases affecting muscle function such as, for example, Parkinson’s disease, motor neuron diseases and progressive ataxias such as amyotrophic lateral sclerosis, demyelinating diseases such as, for example multiple sclerosis, viral encephalitides such as, for example, those caused by enteroviruses, arboviruses, and herpes simplex virus, and prion diseases. Mechanical injuries such as glaucoma or traumatic injuries to the head and spine can also cause nerve injury and degeneration in the brain and spinal cord. In addition, ischemia and stroke as well as conditions such as nutritional deficiency and chemical toxicity such as with chemotherapeutic agents can cause central nervous system neuropathies. [0206] In certain embodiments, the present disclosure provides a method of treating a neuropathy or axonopathy associated with axonal degeneration. In certain embodiments, a neuropathy or axonopathy associated with axonal degeneration can be any of a number of neuropathies or axonopathies such as, for example, those that are hereditary or congenital or associated with Parkinson’s disease, Alzheimer’s disease, Herpes infection, diabetes, amyotrophic lateral sclerosis, a demyelinating disease, ischemia or stroke, chemical injury, thermal injury, and AIDS. In addition, neurodegenerative diseases not mentioned above as well as a subset of the above mentioned diseases can also be treated with the methods of the present disclosure. Such subsets of diseases can include Parkinson’s disease or Alzheimer’s disease. [0207] In certain embodiments, the present methods comprise administering an effective amount of a compound and/or composition as described herein (e.g., a compound of Formula I) to a subject in need thereof. In some such embodiments, the subject is at risk of developing a condition characterized by axonal degeneration. In certain embodiments, the subject has a condition characterized by axonal degeneration. In certain embodiments, the subject has been diagnosed with a condition characterized by axonal degeneration. In certain embodiments, the subject is at risk of developing a condition characterized by axonal degeneration. In certain embodiments, the subject is identified as being at risk of axonal degeneration, e.g., based on the subject’s genotype, a diagnosis of a condition associated with axonal degeneration, and/or exposure to an agent and/or a condition that induces axonal degeneration. [0208] In certain embodiments, the subject is at risk of developing a neurodegenerative disorder. In certain embodiments, the subject is elderly. In certain embodiments, the subject is known to have a genetic risk factor for neurodegeneration. In certain embodiments, the subject has a family history of neurodegenerative disease. In certain embodiments, the subject expresses one or more copies of a known genetic risk factor for neurodegeneration. In certain embodiments, the subject is drawn from a population with a high incidence of neurodegeneration. In certain embodiments, the subject has a hexanucleotide repeat expansion in chromosome 9 open reading frame 72. In certain embodiments, the subject has one or more copies of the ApoE4 allele. [0209] In certain embodiments, a neurodegenerative disease, disorder or condition may be or comprise a traumatic neuronal injury. In certain embodiments, a traumatic neuronal injury is blunt force trauma, a closed-head injury, an open head injury, exposure to a concussive and/or explosive force, a penetrating injury in to the brain cavity or innervated region of the body. In certain embodiments, a traumatic neuronal injury is a force which causes the axons to deform, stretch, crush or sheer. In certain embodiments, the disease or disorder is a traumatic brain injury (TBI). [0210] In certain embodiments, the subject has engaged, or engages, in an activity identified as a risk factor for neuronal degradation, e.g., a contact sport or occupations with a high chance for traumatic neuronal injury or TBI. [0211] In certain embodiments, provided is a method of treating a neurodegenerative disease, disorder or condition comprising administering to a patient in need thereof, a compound as described herein, and one or more of a DLK inhibitor or a NAMPT inhibitor. In certain embodiments, provided is a combination therapy comprising a compound as described herein and a DLK inhibitor and/or a NAMPT inhibitor. In certain embodiments, provided is a combination therapy comprising a compound as described herein, a DLK inhibitor, and one or more additional therapeutic agents. In certain embodiments, provided is a combination therapy comprising a compound as described herein, a NAMPT inhibitor, and one or more additional therapeutic agents. In certain embodiments, provided is a combination therapy comprising a compound as described herein, a DLK inhibitor, a NAMPT inhibitor and one or more additional therapeutic agents. [0212] In certain embodiments, the DLK inhibitor is a small molecule, a polypeptide, a peptide fragment, a nucleic acid (e.g., a siRNA, an antisense oligonucleotide, a micro-RNA, or an aptamer), an antibody, a dominant-negative inhibitor, or a ribozyme. In certain embodiments, the DLK inhibitor is a small molecule. In certain embodiments, the DLK inhibitor is a siRNA. In certain embodiments, the DLK inhibitor is an antisense oligonucleotide. In certain embodiments, the DLK inhibitor is a polypeptide. In certain embodiments, a DLK inhibitor is a peptide fragment. In certain embodiments, a DLK inhibitor is a nucleic acid. In certain embodiments, a DLK inhibitor is an antisense oligonucleotide. [0213] Exemplary DLK inhibitors are provided in WO2013174780, WO2014111496, WO2014177524, WO2014177060, WO2015091889, WO2016142310, US20180057507, WO2018107072, WO2019241244, WO2020168111, and CN104387391A, which are hereby incorporated by reference in their entirety. [0214] In certain embodiments, the NAMPT inhibitor is a small molecule, a polypeptide, a peptide fragment, a nucleic acid (e.g., a siRNA, an antisense oligonucleotide, a micro-RNA, or an aptamer), an antibody, a dominant-negative inhibitor, or a ribozyme. In certain embodiments, the NAMPT inhibitor is a small molecule. In some embodiments, the NAMPT inhibitor is a siRNA. In some embodiments, the NAMPT inhibitor is an antisense oligonucleotide. In certain embodiments, the NAMPT inhibitor is a polypeptide. In some embodiments, a NAMPT inhibitor is a peptide fragment. In certain embodiments, a NAMPT inhibitor is a nucleic acid. In some embodiments, a NAMPT inhibitor is an antisense oligonucleotide. [0215] In certain embodiments, a NAMPT inhibitor prevents the formation of nicotinamide mononucleotide (NMN). In certain embodiments, inhibition of NAMPT inhibits the mammalian NAD+ salvage pathway. [0216] In certain embodiments, the provided is a composition comprising a compound as described herein, formulated for use in administering to a subject in combination with a DLK inhibitor and/or a NAMPT inhibitor. [0217] In certain embodiments, the provided is a composition comprising a compound as described herein, for use in combination with a DLK inhibitor and/or a NAMPT inhibitor. In certain embodiments, such compositions are pharmaceutical compositions that include at least one pharmaceutically acceptable carrier, diluent or excipient. [0218] In certain embodiments, the subject may be a subject who has received, is receiving, or has been prescribed, a chemotherapy associated with peripheral neuropathy. Examples of chemotherapeutic agents include, but not limited to, thalidomide, epothilones (e.g., ixabepilone), taxanes (e.g., paclitaxel and docetaxel), vinca alkaloids (e.g., vinblastine, vinorelbine, vincristine, and vindesine), proteasome inhibitors (e.g., bortezomib), platinum-based drugs (e.g., cisplatin, oxaliplatin, and carboplatin). [0219] In certain embodiments, SARM1 inhibition as described herein may be utilized in combination with one or more other therapies to treat a relevant disease, disorder, or condition. In certain embodiments, dosing of a SARM1 inhibitor is altered when utilized in combination therapy as compared with when administered as monotherapy; alternatively or additionally, a therapy that is administered in combination with SARM1 inhibition as described herein is administered according to a regimen or protocol that differs from its regimen or protocol when administered alone or in combination with one or more therapies other than SARM1 inhibition. In certain embodiments, compositions which comprise an additional therapeutic agent, that additional therapeutic agent and a provided compound may act synergistically. In certain embodiments, one or both therapies utilized in a combination regimen is administered at a lower level or less frequently than when it is utilized as monotherapy. [0220] In certain embodiments, a compound, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, or composition provided herein is administered in combination with a NAD ⁺ or a NAD ⁺ precursor (e.g., nicotinamide riboside (NR), nicotinic acid (NA), nicotinic acid riboside (NaR), nicotinamide (NAM), nicotinamide mononucleotide (NMN), nicotinic acid mononucleotide (NaMN), tryptophan (TRP), nicotinic acid adenine dinucleotide (NAAD), or vitamin B3). [0221] In certain embodiments, provided is a compound as disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, for use in inhibiting sterile alpha and TIR motif-containing protein 1 (SARM1) activity (e.g., in vitro or in vivo). [0222] In certain embodiments, the present disclosure provides use of a compound as disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, in the manufacture of a medicament for inhibiting sterile alpha and TIR motif-containing protein 1 (SARM1) activity (e.g., in vitro or in vivo) and supplementing axonal NAD ⁺ levels. [0223] Axonal degeneration has been associated with various types of neurodegenerative diseases, being recognized as an important indicator of disease progression, and an interesting target for the therapeutic treatment of these diseases. Similarly, axonal degeneration is also observed in those with traumatic brain injuries and peripheral neuropathies. [0224] In certain embodiments, provided is a method for treating a disease or condition mediated, at least in part, by SARM1, comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, in combination with NAD ⁺ or a NAD ⁺ precursor (e.g., NR, NA, NaR, NAM, NMN, NaMN, TRP, NAAD, or vitamin B ₃ ). [0225] In certain embodiments, the present disclosure provides use of a compound as disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, in combination with NAD ⁺ or a NAD ⁺ precursor (e.g., NR, NA, NaR, NAM, NMN, NaMN, TRP, NAAD, or vitamin B3), in the manufacture of a medicament for treating or preventing a neurodegenerative disease in a subject in need thereof. [0226] In certain embodiments, provided is a method for treating any disease caused by SARM1 activity, comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, in combination with NAD ⁺ or a NAD ⁺ precursor (e.g., NR, NA, NaR, NAM, NMN, NaMN, TRP, NAAD, or vitamin B3). [0227] In certain embodiments, the disease or condition may be a disease or condition of the central nervous system, and/or may be caused by or associated with a pathogen or traumatic injury. It will be appreciated that these general embodiments defined according to broad categories of diseases, disorders and conditions are not mutually exclusive. [0228] In certain embodiments, provided is a method for treating a neurodegenerative disease, comprising administering to a subject in need thereof a therapeutically effective amount of a compound disclosed herein, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, in combination with NAD ⁺ or a NAD ⁺ precursor (e.g., NR, NA, NaR, NAM, NMN, NaMN, TRP, NAAD, or vitamin B3). [0229] Other embodiments include use of the presently disclosed compounds in therapy. 4. Kits [0230] Provided herein are also kits that include a compound of the disclosure, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, and suitable packaging. In certain embodiments, a kit further includes instructions for use. In one aspect, a kit includes a compound of the disclosure, or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, and a label and/or instructions for use of the compounds in the treatment of the indications, including the diseases or conditions, described herein. [0231] Provided herein are also articles of manufacture that include a compound described herein or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof in a suitable container. The container may be a vial, jar, ampoule, preloaded syringe, or intravenous bag. 5. Pharmaceutical Compositions and Modes of Administration [0232] Compounds provided herein are usually administered in the form of pharmaceutical compositions. Thus, provided herein are also pharmaceutical compositions that contain one or more of the compounds described herein, or a pharmaceutically acceptable salt, stereoisomer, mixture of stereoisomers, or prodrug thereof, and one or more pharmaceutically acceptable vehicles selected from carriers, adjuvants, and excipients. Suitable pharmaceutically acceptable vehicles may include, for example, inert solid diluents and fillers, diluents, including sterile aqueous solution and various organic solvents, permeation enhancers, solubilizers, and adjuvants. Such compositions are prepared in a manner well known in the pharmaceutical art. See, e.g., Remington’s Pharmaceutical Sciences, Mace Publishing Co., Philadelphia, Pa.17th Ed. (1985); and Modern Pharmaceutics, Marcel Dekker, Inc.3rd Ed. (G.S. Banker & C.T. Rhodes, Eds.). [0233] The pharmaceutical compositions may be administered in either single or multiple doses. The pharmaceutical composition may be administered by various methods including, for example, rectal, buccal, intranasal, and transdermal routes. In certain embodiments, the pharmaceutical composition may be administered by intra-arterial injection, intravenously, intraperitoneally, parenterally, intramuscularly, subcutaneously, orally, topically, or as an inhalant. [0234] One mode for administration is parenteral, for example, by injection. The forms in which the pharmaceutical compositions described herein may be incorporated for administration by injection include, for example, aqueous or oil suspensions, or emulsions, with sesame oil, corn oil, cottonseed oil, or peanut oil, as well as elixirs, mannitol, dextrose, or a sterile aqueous solution, and similar pharmaceutical vehicles. [0235] Oral administration may be another route for administration of the compounds described herein. Administration may be via, for example, capsule or enteric coated tablets. In making the pharmaceutical compositions that include at least one compound described herein or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof, the active ingredient is usually diluted by an excipient and/or enclosed within such a carrier that can be in the form of a capsule, sachet, paper or other container. When the excipient serves as a diluent, it can be in the form of a solid, semi-solid, or liquid material, which acts as a vehicle, carrier or medium for the active ingredient. Thus, the compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments containing, for example, up to 10% by weight of the active compound, soft and hard gelatin capsules, sterile injectable solutions, and sterile packaged powders. [0236] Some examples of suitable excipients include, e.g., lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methyl cellulose. The formulations can additionally include lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying and suspending agents; preserving agents such as methyl and propylhydroxy- benzoates; sweetening agents; and flavoring agents. [0237] The compositions that include at least one compound described herein or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof can be formulated so as to provide quick, sustained or delayed release of the active ingredient after administration to the subject by employing procedures known in the art. Controlled release drug delivery systems for oral administration include osmotic pump systems and dissolutional systems containing polymer-coated reservoirs or drug-polymer matrix formulations. Another formulation for use in the methods disclosed herein employ transdermal delivery devices (“patches”). Such transdermal patches may be used to provide continuous or discontinuous infusion of the compounds described herein in controlled amounts. The construction and use of transdermal patches for the delivery of pharmaceutical agents is well known in the art. Such patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents. [0238] For preparing solid compositions such as tablets, the principal active ingredient may be mixed with a pharmaceutical excipient to form a solid preformulation composition containing a homogeneous mixture of a compound described herein or a pharmaceutically acceptable salt, isotopically enriched analog, stereoisomer, mixture of stereoisomers, or prodrug thereof. When referring to these preformulation compositions as homogeneous, the active ingredient may be dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective unit dosage forms such as tablets, pills, and capsules. [0239] The tablets or pills of the compounds described herein may be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action, or to protect from the acid conditions of the stomach. For example, the tablet or pill can include an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former. The two components can be separated by an enteric layer that serves to resist disintegration in the stomach and permit the inner component to pass intact into the duodenum or to be delayed in release. A variety of materials can be used for such enteric layers or coatings, such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, cetyl alcohol, and cellulose acetate. [0240] Compositions for inhalation or insufflation may include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders. The liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as described herein. In certain embodiments, the compositions are administered by the oral or nasal respiratory route for local or systemic effect. In other embodiments, compositions in pharmaceutically acceptable solvents may be nebulized by use of inert gases. Nebulized solutions may be inhaled directly from the nebulizing device or the nebulizing device may be attached to a facemask tent, or intermittent positive pressure breathing machine. Solution, suspension, or powder compositions may be administered, in one embodiment, orally or nasally, from devices that deliver the formulation in an appropriate manner. [0241] The amount of the compound in a pharmaceutical composition or formulation can vary within the full range employed by those skilled in the art. Typically, the formulation will contain, on a weight percent (wt %) basis, from about 0.01-99.99 wt % of a compound of this disclosure based on the total formulation, with the balance being one or more suitable pharmaceutical excipients. In one embodiment, the compound is present at a level of about 1-80 wt %. Representative pharmaceutical formulations are described below. Formulation Example 1 - Tablet formulation [0242] The following ingredients are mixed intimately and pressed into single scored tablets. Quantity per Formulation Example 2 - Capsule formulation [0243] The following ingredients are mixed intimately and loaded into a hard-shell gelatin capsule. Quantity per Ingredient capsule, mg Formul [0244] The following ingredients are mixed to form a suspension for oral administration. Ingredient Amount compound of this disclosure 1.0 g Formula tion Example 4 - Injectable formulation [0245] The following ingredients are mixed to form an injectable formulation. Ingredient Amount Formulation Example 5 - Suppository Formulation [0246] A suppository of total weight 2.5 g is prepared by mixing the compound of this disclosure with Witepsol® H-15 (triglycerides of saturated vegetable fatty acid; Riches-Nelson, Inc., New York), and has the following composition: Ingredient Amount compound of this disclosure 500 mg [0247] The specific dose level of a compound of the present application for any particular subject will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, drug combination and the severity of the particular disease in the subject undergoing therapy. For example, a dosage may be expressed as a number of milligrams of a compound described herein per kilogram of the subject’s body weight (mg/kg). Dosages of between about 0.1 and 150 mg/kg may be appropriate. In certain embodiments, about 0.1 and 100 mg/kg may be appropriate. In other embodiments a dosage of between 0.5 and 60 mg/kg may be appropriate. In certain embodiments, a dosage of from about 0.0001 to about 100 mg per kg of body weight per day, from about 0.001 to about 50 mg of compound per kg of body weight, or from about 0.01 to about 10 mg of compound per kg of body weight may be appropriate. Normalizing according to the subject’s body weight is particularly useful when adjusting dosages between subjects of widely disparate size, such as occurs when using the drug in both children and adult humans or when converting an effective dosage in a non-human subject such as dog to a dosage suitable for a human subject. 7. Synthesis of the Compounds [0248] The compounds may be prepared using the methods disclosed herein and routine modifications thereof, which will be apparent given the disclosure herein and methods well known in the art. Conventional and well-known synthetic methods may be used in addition to the teachings herein. The synthesis of typical compounds described herein may be accomplished as described in the following examples. If available, reagents and starting materials may be purchased commercially, e.g., from Sigma Aldrich or other chemical suppliers. [0249] It will be appreciated that where typical process conditions (i.e., reaction temperatures, times, mole ratios of reactants, solvents, pressures, etc.) are given, other process conditions can also be used unless otherwise stated. Optimum reaction conditions may vary with the particular reactants or solvent used, but such conditions can be determined by one skilled in the art by routine optimization procedures. [0250] Additionally, conventional protecting groups (“PG”) may be necessary to prevent certain functional groups from undergoing undesired reactions. Suitable protecting groups for various functional groups as well as suitable conditions for protecting and deprotecting particular functional groups are well known in the art. For example, numerous protecting groups are described in Wuts, P. G. M., Greene, T. W., & Greene, T. W. (2006). Greene’s protective groups in organic synthesis. Hoboken, N.J., Wiley- Interscience, and references cited therein. For example, protecting groups for alcohols, such as hydroxy, include silyl ethers (including trimethylsilyl (TMS), tert-butyldimethylsilyl (TBDMS), tri-iso- propylsilyloxymethyl (TOM), and triisopropylsilyl (TIPS) ethers), which can be removed by acid or fluoride ion, such as NaF, TBAF (tetra-n-butylammonium fluoride), HF-Py, or HF-NEt ₃ . Other protecting groups for alcohols include acetyl, removed by acid or base, benzoyl, removed by acid or base, benzyl, removed by hydrogenation, methoxyethoxymethyl ether, removed by acid, dimethoxytrityl, removed by acid, methoxymethyl ether, removed by acid, tetrahydropyranyl or tetrahydrofuranyl, removed by acid, and trityl, removed by acid. Examples of protecting groups for amines include carbobenzyloxy, removed by hydrogenolysis p-methoxybenzyl carbonyl, removed by hydrogenolysis, tert-butyloxycarbonyl, removed by concentrated strong acid (such as HCl or CF ₃ COOH), or by heating to greater than about 80 °C, 9-fluorenylmethyloxycarbonyl, removed by base, such as piperidine, acetyl, removed by treatment with a base, benzoyl, removed by treatment with a base, benzyl, removed by hydrogenolysis, carbamate group, removed by acid and mild heating, p-methoxybenzyl, removed by hydrogenolysis, 3,4-dimethoxybenzyl, removed by hydrogenolysis, p-methoxyphenyl, removed by ammonium cerium(IV) nitrate, tosyl, removed by concentrated acid (such as HBr or H ₂ SO4) and strong reducing agents (sodium in liquid ammonia or sodium naphthalenide), troc (trichloroethyl chloroformate), removed by Zn insertion in the presence of acetic acid, and sulfonamides (Nosyl & Nps), removed by samarium iodide or tributyltin hydride. [0251] Furthermore, the compounds of this disclosure may contain one or more chiral centers. Accordingly, if desired, such compounds can be prepared or isolated as pure stereoisomers, i.e., as individual enantiomers or diastereomers or as stereoisomer-enriched mixtures. All such stereoisomers (and enriched mixtures) are included within the scope of this disclosure, unless otherwise indicated. Pure stereoisomers (or enriched mixtures) may be prepared using, for example, optically active starting materials or stereoselective reagents well-known in the art. Alternatively, racemic mixtures of such compounds can be separated using, for example, chiral column chromatography, chiral resolving agents, and the like. [0252] The starting materials for the following reactions are generally known compounds or can be prepared by known procedures or obvious modifications thereof. For example, many of the starting materials are available from commercial suppliers such as Aldrich Chemical Co. (Milwaukee, Wisconsin, USA), Bachem (Torrance, California, USA), Emka-Chemce or Sigma (St. Louis, Missouri, USA). Others may be prepared by procedures or obvious modifications thereof, described in standard reference texts such as Fieser and Fieser’s Reagents for Organic Synthesis, Volumes 1-15 (John Wiley, and Sons, 1991), Rodd’s Chemistry of Carbon Compounds, Volumes 1-5, and Supplementals (Elsevier Science Publishers, 1989) organic Reactions, Volumes 1-40 (John Wiley, and Sons, 1991), March’s Advanced Organic Chemistry, (John Wiley, and Sons, 5th Edition, 2001), and Larock’s Comprehensive Organic Transformations (VCH Publishers Inc., 1989). General Synthesis [0253] Scheme I illustrates general methods which can be employed for the synthesis of compounds described herein, where each A ¹ , A ² , X ¹ , X ² , X ³ , X ⁴ , X ⁵ , X ⁶ , R ¹ , R ² , R ⁴ , and R ⁵ are independently as defined herein; LG is a leaving group (e.g., halo, alkoxy, etc.); and each R ⁵⁰ is independently -OH, -O-alkyl, or together with the boron atom to which they are attached form a cyclic boronic ester. Scheme I [0254] h compound I-2 under suitable coupling reaction conditions, followed by optional functionalization or deprotection when required. Alternatively, compounds of Formula I can be prepared by contacting compound I-3 with compound I-4 under suitable coupling reaction conditions, followed by optional functionalization or deprotection when required. Alternatively, compounds of Formula I can be prepared by contacting compound I-5 with compound I-6 under suitable coupling reaction conditions, such as in the presence of a palladium catalyst (e.g., Pd(dppf)Cl ₂ ) and a base, followed by optional functionalization or deprotection when required. Upon each reaction completion, each of the intermediate or final compounds can be recovered, and optionally purified, by conventional techniques such as neutralization, extraction, precipitation, chromatography, filtration and the like. [0255] Further derivatization of the compound provided by the steps outlined in Scheme I, or any intermediate, provides additional compounds of Formula I. It should be understood that any of the compounds or intermediates shown in Scheme I may be prepared using traditional methods or purchased from commercial sources. In addition, any of the intermediates or any product obtained by the process outlined in Scheme I can be derivatized at any step to provide various compounds of Formula I. In certain embodiments, the various substituents of the compounds or intermediates as used in Scheme I are as defined for Formula I. [0256] For example, compounds I-1 and I-5 can be prepared according to Scheme II below according to similar procedures as described in Scheme I, where A ¹ , A ² , X ¹ , X ² , X ³ , X ⁴ , X ⁵ , X ⁶ , R ¹ , R ² , R ⁴ , and R ⁵ are each independently as defined herein; X is a leaving group (e.g., halo); LG is a leaving group (e.g., halo, alkoxy, etc.); and each R ⁵⁰ are independently -OH, -O-alkyl, or together with the boron atom to which they are attached form a cyclic boronic ester. Scheme II [0257] Upon each reaction completion, each of the intermediate or final compounds can be recovered, and optionally purified, by conventional techniques such as neutralization, extraction, precipitation, chromatography, filtration and the like. [0258] It should be understood that any of the compounds or intermediates shown in Scheme II may be prepared using traditional methods or purchased from commercial sources. In addition, any of the intermediates or any product obtained by the process outlined in Scheme II can be derivatized at any step to provide various compounds of Formula I. In certain embodiments, the various substituents of the compounds or intermediates as used in Scheme II are as defined for Formula I. [0259] In certain embodiments, provided is a process for providing a compound of Formula I, comprising contacting a compound of Formula I-1: 1 with a compound of Formula I-2: I-2 under conditions sufficient to provide a co Formula I; wherein A ¹ , A ² , X ¹ , X ² , X ³ , X ⁴ , X ⁵ , X ⁶ , R ¹ , R ² , R ⁴ , and R ⁵ are each independently as defined herein, and LG is a leaving group. [0260] In certain embodiments, provided is a process for providing a compound of Formula I, comprising contacting a compound of Formula I-5: -5 with a compound of Formula I-6: 6 [0261] under conditions sufficient to pro Formula I; wherein A ¹ , A ² , X ¹ , X ² , X ³ , X ⁴ , 5 ⁶ R ¹ , R ² , R ⁴ X , X , , and R ⁵ are each independently as defined herein, LG is a leaving group, and each R ⁵⁰ is independently -OH, C _1-6 alkoxy, or two R ⁵⁰ together with the boron atom to which they are attached form a cyclic boronic ester. [0262] In certain embodiments, LG is halo, C _1-6 alkoxy, benzyloxy, or 4-OCH ₃ -benzyloxy. EXAMPLES [0263] The following examples are included to demonstrate specific embodiments of the disclosure. It should be appreciated by those skilled in the art that the techniques disclosed in the examples which follow represent techniques to function well in the practice of the disclosure, and thus can be considered to constitute specific modes of its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure. General Experimental Methods [0264] All solvents used were commercially available and were used without further purification. Reactions were typically run using anhydrous solvents under an inert atmosphere of nitrogen. [0265] NMR Spectroscopy: ¹ H Nuclear magnetic resonance (NMR) spectroscopy was carried out using a Bruker Avance III equipped with a BBFO 300 MHz probe operating at 300 MHz or one of the following instruments: a Bruker Avance 400 instrument equipped with probe DUAL 400 MHz S1, a Bruker Avance 400 instrument equipped with probe 6 S1400 MHz 5mm ¹ H- ¹³ C ID, a Bruker Avance III 400 instrument with nanobay equipped with probe Broadband BBFO 5 mm direct, a Bruker Mercury Plus 400 NMR spectrometer equipped with a Bruker 400 BBO probe operating at 400 MHz. All deuterated solvents contained typically 0.03% to 0.05% v/v tetramethylsilane, which was used as the reference signal (set at δ 0.00 for both ¹ H and ¹³ C). In certain cases, ¹ H Nuclear magnetic resonance (NMR) spectroscopy was carried out using a Bruker Advance 400 instrument operating at 400 MHz using the stated solvent at around room temperature unless otherwise stated. In all cases, NMR data were consistent with the proposed structures. Characteristic chemical shifts (δ) are given in parts-per-million using conventional abbreviations for designation of major peaks: e.g. s, singlet; d, doublet; t, triplet; q, quartet; dd, doublet of doublets; dt, doublet of triplets; br, broad. [0266] Thin Layer Chromatography: Where thin layer chromatography (TLC) has been used it refers to silica gel TLC using silica gel F254 (Merck) plates, Rf is the distance travelled by the compound divided by the distance travelled by the solvent on a TLC plate. Column chromatography was performed using an automatic flash chromatography system over silica gel cartridges or in the case of reverse phase chromatography over C18 cartridges. Alternatively, thin layer chromatography (TLC) was performed on Alugram® (Silica gel 60 F254) from Mancherey-Nagel and UV was typically used to visualize the spots. Additional visualization methods were also employed in some cases. In these cases the TLC plate was developed with iodine (generated by adding approximately 1 g of I ₂ to 10 g silica gel and thoroughly mixing), ninhydrin (available commercially from Aldrich), or Magic Stain (generated by thoroughly mixing 25 g (NH ₄ ) ₆ Mo ₇ O ₂₄ .4H ₂ O, 5 g (NH ₄ ) ₂ Ce(IV)(NO ₃ ) ₆ in 450 mL water and 50 mL concentrated H ₂ SO4) to visualize the compound. [0267] Liquid Chromatography-Mass Spectrometry and HPLC Analysis: HPLC analysis was performed on Shimadzu 20AB HPLC system with a photodiode array detector and Luna-C18(2) 2.0×50 mm, 5 µm column at a flow rate of 1.2 mL/min with a gradient solvent Mobile phase A (MPA, H ₂ O+0.037 % (v/v) TFA): Mobile phase B (MPB, ACN+0.018 % (v/v) TFA) (0.01 min, 10% MPB; 4 min, 80% MPB; 4,9 min, 80% MPB; 4.92 min, 10% MPB; 5.5 min, 10% MPB). LCMS was detected under 220 and 254 nm or used evaporative light scattering (ELSD) detection as well as positive electrospray ionization (MS). Semi-preparative HPLC was performed by either acidic or neutral conditions. Acidic: Luna C18100 × 30 mm, 5 μm; MPA: HCl/H ₂ O=0.04%, or formic acid/H ₂ O=0.2% (v/v); MPB: ACN. Neutral: Waters Xbridge 150 × 25, 5 μm; MPA: 10 mM NH ₄ HCO ₃ in H ₂ O; MPB: ACN. Gradient for both conditions: 10% of MPB to 80% of MPB over 12 min at a flow rate of 20 mL/min, then 100% MPB over 2 min, 10% MPB over 2 min, UV detector. SFC analysis was performed on Thar analytical SFC system with a UV/Vis detector and series of chiral columns including AD, AS-H, OJ, OD, AY and IC, 4.6 × 100 mm, 3 µm column at a flow rate of 4 mL/min with a gradient solvent Mobile phase A (MPA, CO ₂ ): Mobile phase B (MPB, MeOH+0.05 % (v/v) IPA) (0.01 min, 10% MPB; 3 min, 40% MPB; 3.5 min, 40% MPB; 3.56-5 min, 10% MPB). SFC preparative was performed on Thar 80 preparative SFC system with a UV/Vis detector and series of chiral preparative columns including AD-H, AS-H, OJ-H, OD-H, AY-H and IC-H, 30×250 mm, 5 ^m column at a flow rate of 65 mL/min with a gradient solvent Mobile phase A (MPA, CO2): Mobile phase B (MPB, MeOH+0.1 % (v/v) NH ₃ H ₂ O) (0.01 min, 10% MPB; 5 min, 40% MPB; 6 min, 40% MPB; 6.1-10 min, 10% MPB). LC-MS data were also collected using an UPLC-MS Acquity ^TM system equipped with PDA detector and coupled to a Waters single quadrupole mass spectrometer operating in alternated positive and negative electrospray ionization mode. The column used was a Cortecs UPLC C18, 1.6 µm, 2.1 × 50 mm. A linear gradient was applied, starting at 95% A (A: 0.1% formic acid in water) and ending at 95% B (B: 0.1% formic acid in MeCN) over 2.0 min with a total run time of 2.5 min. The column temperature was at 40 ºC with the flow rate of 0.8 mL/min. Intermediate 1 Methyl-6-azabicyclo[3.1.1]heptane [0268] Methy ure of N-(3- methylcyclohexyl)picolinamide (20 g, 91.62 mmol) in 1,1,2,2-tetrachloroethane (300 mL) was added AgOAc (45.88 g, 274.86 mmol), benzoquinone (4.95 g, 45.81 mmol), Na ₃ PO ₄ (45 g, 274.86 mmol), 1,2,3,4,5-pentafluoro-6-iodo-benzene (269 g, 916.20 mmol) and Pd(OAc) ₂ (2.06 g, 9.16 mmol) at 25 °C under N ₂ . The mixture was stirred at 145 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 5:1 to 1:1) to give the titled compound. LCMS: m/z = 217.10 [M+H] ⁺ . [0269] 3-Methyl-6-azabicyclo[3.1.1]heptane: To a mixture of (3-methyl-6-azabicyclo[3.1.1]heptan-6- yl)(pyridin-2-yl)methanone (2.7 g, 12.48 mmol) in EtOH (50 mL) was added NaOH (4.99 g, 124.84 mmol) at 25 °C under N ₂ . The mixture was stirred at 90 °C for 4 h. The reaction mixture was concentrated under reduced pressure (water pump, below 35 ^o C) to give a mixture containing the product, NaOH and the sodium salt of the acid. The mixture was stirred in DCM (20 mL) and filtered through a celite pad. The filtrate was concentrated under reduce pressure (water pump, below 35 ^o C). The work-up procedure was repeated 2–3 times or until the concentrated residue contained no solids to give the titled compound as a 10:1 mixture of cis and trans isomers. LCMS: m/z = 112.2 [M+H] ⁺ . Intermediate 2 trans-3-Methyl-6-azabicyclo[3.1.1]heptane methylcyclohexyl)picolinamide and N-(cis-3-methylcyclohexyl)picolinamide was purified by prep- HPLC (column: Phenomenex luna C18250 × 100 mm × 15 μm; mobile phase: A: 10 mM TFA in water, B: MeCN; B in A: 40%-70%, over 20 min) to provide the separated cis and trans isomers. The first eluting peak was concentrated under reduced pressure, adjusted to pH = 7-8 with sat. aq. NaHCO ₃ solution and extracted with DCM (3 × 500 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound as a colorless oil. LCMS: m/z = 219.2 [M+H] ⁺ . [0271] (trans-3-Methyl-6-azabicyclo[3.1.1]heptan-6-yl)(pyridin-2-yl )methanone To a mixture of N- (cis-3-methylcyclohexyl)picolinamide (10 g, 27.49 mmol) in 1,1,2,2-tetrachloroethane (300 mL) was added AgOAc (22.94 g, 137.43 mmol), benzoquinone (2.48 g, 22.90 mmol), Na ₃ PO ₄ (22.53 g, 137.43 mmol), 1,2,3,4,5-pentafluoro-6-iodo-benzene (134.66 g, 458.10 mmol) and Pd(OAc) ₂ (2.06 g, 9.16 mmol) at 25 °C under N ₂ . The mixture was stirred at 145 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 5:1 to 1:1) to give the titled compound as a brown oil. LCMS: m/z = 217.0 [M+H] ⁺ . [0272] trans-3-Methyl-6-azabicyclo[3.1.1]heptane: To a mixture of (trans-3-methyl-6- azabicyclo[3.1.1]heptan-6-yl)(pyridin-2-yl)methanone (1.2 g, 5.55 mmol) in EtOH (15 mL) was added NaOH (2.22 g, 55.48 mmol) at 25 °C under N ₂ . The mixture was stirred at 90 °C for 4 h. The reaction mixture was concentrated under reduced pressure (water pump, below 35 °C) to give a mixture containing the product, NaOH and the sodium salt of the acid. The mixture was stirred in DCM (20 mL) and filtered through a celite pad. The filtrate was concentrated under reduce pressure (water pump, below 35 °C). The work-up procedure was repeated 2–3 times or until the concentrated residue contained no solids to give the titled compound as a brown syrup as the free base. TFA was added and the mixture was stirred for 0.5 h at 20 °C before concentrating under reduced pressure to give the TFA salt. LCMS: m/z = 112.2 [M+H] ⁺ . Intermediate 3 cis-3-Methyl-6-azabicyclo[3.1.1]heptane [0273] N-(trans-3-methylcyclohexyl)picolinamide: A mixture of N-(trans-3- methylcyclohexyl)picolinamide and N-(cis-3-methylcyclohexyl)picolinamide was purified by prep- HPLC (column: Phenomenex luna C18250 × 100 mm × 15 μm; mobile phase: A: 10 mM TFA in water, B: MeCN; B in A: 40%-70%, over 20 min) to provide the separated cis and trans isomers. The second eluting peak was concentrated under reduced pressure, adjusted to pH = 7-8 with sat. aq. NaHCO ₃ solution and extracted with DCM (3 × 300 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to provide the titled compound as a colorless oil. LCMS: m/z = 219.2 [M+H] ⁺ . [0274] (cis-3-Methyl-6-azabicyclo[3.1.1]heptan-6-yl)(pyridin-2-yl)m ethanone To a mixture of N- (trans-3-methylcyclohexyl)picolinamide (6 g, 27.49 mmol) in 1,1,2,2-tetrachloroethane (200 mL) was added AgOAc (13.76 g, 82.46 mmol), benzoquinone (1.49 g, 13.74 mmol), Na ₃ PO ₄ (13.52 g, 82.46 mmol), 1,2,3,4,5-pentafluoro-6-iodo-benzene (80.80 g, 274.86 mmol) and Pd(OAc) ₂ (1.23 g, 5.50 mmol) at 25 °C under N ₂ . The mixture was stirred at 145 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 5:1 to 1:1) to give the titled compound as a brown oil. LCMS: m/z = 217.0 [M+H] ⁺ . [0275] cis-3-Methyl-6-azabicyclo[3.1.1]heptane: To a mixture of (cis-3-methyl-6- azabicyclo[3.1.1]heptan-6-yl)(pyridin-2-yl)methanone (2.4 g, 11.1 mmol) in EtOH (30 mL) was added NaOH (4.44 g, 111 mmol) at 25 °C under N ₂ . The mixture was stirred at 90 °C for 4 h. The reaction mixture was concentrated under reduced pressure (water pump, below 35 ^o C) to give a mixture containing the product, NaOH and the sodium salt of the acid. The mixture was stirred in DCM (20 mL) and filtered through a celite pad. The filtrate was concentrated under reduce pressure (water pump, below 35 ^o C). The work-up procedure was repeated 2–3 times or until the concentrated residue contained no solids to give the titled compound as the free base. TFA was added and the mixture was stirred for 0.5 h at 20 ^o C before concentrating under reduced pressure to give the TFA salt. LCMS: m/z = 112.2 [M+H] ⁺ . Intermediate 4 cis-3-Fluoro-6-azabicyclo[3.1.1]heptane trifluoroacetate [0276] trans-tert-Butyl 3-(benzyloxy)-6-azabicyclo[3.1.1]heptane-6-carboxylate: To a solution of trans-3-(benzyloxy)-6-azabicyclo[3.1.1]heptane (5.8 g, 28.53 mmol) in 1,4-dioxane (20 mL) was added aq. NaOH (50 mL, 2 M) and Boc ₂ O (12.45 g, 57.06 mmol) at 0 °C. The mixture was stirred at 20 °C for 12 h. The reaction mixture was diluted with H ₂ O (50 mL) and extracted with MTBE (3 × 50 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:MTBE = 100:1 to 3:1) to give the titled compound. LCMS: m/z = 248.2 [M- tBu+H] ⁺ . [0277] trans-tert-Butyl 3-hydroxy-6-azabicyclo[3.1.1]heptane-6-carboxylate: To a solution of trans- tert-butyl 3-(benzyloxy)-6-azabicyclo[3.1.1]heptane-6-carboxylate (3.55 g, 11.70 mmol) in MeOH (50 mL) was added Pd/C (2 g, 10% on carbon) at 25 °C under Ar. The suspension was degassed and purged with H ₂ three times. The mixture was stirred at 30 °C for 12 h under H ₂ (50 psi). The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 158.2 [M-tBu+H] ⁺ . [0278] cis-tert-Butyl 3-fluoro-6-azabicyclo[3.1.1]heptane-6-carboxylate: To a solution of trans-tert- butyl 3-hydroxy-6-azabicyclo[3.1.1]heptane-6-carboxylate (110 mg, 0.09 mmol) in DCM (2 mL) was added DAST (166 mg, 0.19 mmol) at 0 °C under N ₂ . The mixture was stirred at 0 °C for 2 h. The reaction mixture was adjusted to pH = 7-8 with sat. aq. NaHCO ₃ and extracted with DCM (3 × 5 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound. LCMS: m/z = 160.2 [M-tBu+H] ⁺ . [0279] cis-3-Fluoro-6-azabicyclo[3.1.1]heptane trifluoroacetate: To a solution of cis-tert-butyl 3- fluoro-6-azabicyclo[3.1.1]heptane-6-carboxylate (30 mg, 0.14 mmol) in DCM (3 mL) was added TFA (1.54 g, 14 mmol, 1 mL) at 20 °C. The mixture was stirred at 20 °C for 2 h. The reaction mixture was concentrated under reduced pressure to give the titled compound. The material was used directly in the next step. Intermediate 5 cis-3-Methoxy-6-azabicyclo[3.1.1]heptane [0280] N-(trans-3-methoxycyclohexyl)picolinamide: To a mixture of trans-3- methoxycyclohexanamine hydrochloride (2 g, 12.07 mmol) and picolinic acid (1.78 g, 14.49 mmol) in DCM (50 mL) was added TEA (1.83 g, 18.11 mmol), DMAP (147.49 mg, 1.21 mmol) and EDCI (3.47 g, 18.11 mmol) at 0 °C under N ₂ . The mixture was stirred at 25 °C for 16 h. The reaction mixture was diluted with H ₂ O (20 mL), the organic layer was separated and the aqueous layer was extracted with DCM (3 × 10 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 5:1 to 3:1) to give the titled compound. LCMS: m/z = 235.1 [M+H] ⁺ . [0281] (cis-3-methoxy-6-azabicyclo[3.1.1]heptan-6-yl)(pyridin-2-yl) methanone: To a mixture of N- ((1S,3S)-3-methoxycyclohexyl)picolinamide (1.6 g, 6.83 mmol) in 1,1,2,2-tetrachloroethane (50 mL) was added AgOAc (3.42 g, 20.49 mmol), benzoquinone (369 mg, 3.41 mmol), Na ₃ PO ₄ (3.36 g, 20.49 mmol), 1,2,3,4,5-pentafluoro-6-iodo-benzene (20.07 g, 68.29 mmol) and Pd(OAc) ₂ (307 mg, 1.37 mmol) at 25 °C under N ₂ . The mixture was stirred at 140 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 5:1 to 1:1) to give the titled compound. LCMS: m/z = 232.9 [M+H] ⁺ . [0282] cis-3-Methoxy-6-azabicyclo[3.1.1]heptane: To a mixture of (cis -3-methoxy-6- azabicyclo[3.1.1]heptan-6-yl)(pyridin-2-yl)methanone (270 mg, 1.16 mmol) in EtOH (5 mL) was added NaOH (465 mg, 11.62 mmol) at 25 °C. The mixture was stirred at 90 °C for 4 h before concentrating under reduced pressure. The resulting residue was slurried in DCM (20 mL), filtered and the filtrate was concentrated under reduce pressure. The work up was repeated for three times to give the titled compound. The material was used directly in the next step. Intermediate 6 trans-6-Azabicyclo[3.1.1]heptan-3-ol [0283] N-(ci (benzyloxy)cyclohexanamine hydrochloride (61.5 g, 254.39 mmol) and picolinic acid (37.58 g, 305.27 mmol) in EtOAc (400 mL) was added TEA (102.97 g, 1.02 mol, 141.63 mL), followed by T3P (242.82 g, 381.58 mmol, 50% solution in EtOAc) at 0 °C under N ₂ . The mixture was stirred at 25 °C for 12 h. The reaction mixture was diluted with H ₂ O (1 L) and extracted with EtOAc (3 × 300 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 3:1 to 1:1) to give the titled compound. LCMS: m/z = 311.0 [M+H] ⁺ . [0284] (trans-3-(Benzyloxy)-6-azabicyclo[3.1.1]heptan-6-yl)(pyridin -2-yl)methanone: To a solution of N-(cis-3-(benzyloxy)cyclohexyl)picolinamide (39 g, 125.58 mmol) in 1,1,2,2-tetrachloroethane (500 mL) was added benzoquinone (6.79 g, 62.79 mmol), AgOAc (62.79 g, 376.74 mmol), Na ₃ PO ₄ (61.62 g, 376.74 mmol), 1,2,3,4,5-pentafluoro-6-iodo-benzene (369.33 g, 1.26 mol) and Pd(OAc) ₂ (2.81 g, 12.48 mmol) at 20 °C under N ₂ . The mixture was stirred at 140 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (EtOAc) to give the titled compound. The material was used directly in the next step. [0285] trans-3-(Benzyloxy)-6-azabicyclo[3.1.1]heptane: To a mixture of (trans-3-(benzyloxy)-6- azabicyclo[3.1.1]heptan-6-yl)(pyridin-2-yl)methanone (13 g, 42.16 mmol) in EtOH (130 mL) was added NaOH (16.86 g, 421.57 mmol) at 20 °C under N ₂ . The mixture was stirred at 90 °C for 12 h. The reaction mixture was concentrated under reduced pressure, slurried in DCM (100 mL), filtered through a celite pad and the filtrate was concentrated under reduced pressure. This workup was repeated for 2-3 times to give the titled compound. LCMS: m/z = 204.3 [M+H] ⁺ . [0286] trans-6-Azabicyclo[3.1.1]heptan-3-ol: To a solution of trans-3-(benzyloxy)-6- azabicyclo[3.1.1]heptane (200 mg, 0.98 mmol) in MeOH (20 mL) was added Pd/C (50 mg, 10% purity) at 25 °C under N ₂ . The suspension was degassed and purged with H ₂ for 3 times. The mixture was stirred under H ₂ (50 psi) at 30 °C for 12 h. The mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 114.2 [M+H] ⁺ . Intermediate 7 cis-3-methyl-N-(4-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxab orolan-2-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide [0287] To a mix ture of triphosgene (32 mg, 0.10 mmol) in THF (1.5 mL) was added TEA (65 mg, 0.64 mmol) and 4-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)anil ine (50 mg, 0.21 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 1 h. Then cis-3-methyl-6-azabicyclo[3.1.1]heptane trifluoroacetate (56 mg, 0.25 mmol) and TEA (39 mg, 0.39 mmol) was added to the reaction solution. The reaction solution was stirred at 20 °C for 1 h. The reaction solution was diluted with H ₂ O (2 mL) and extracted with EtOAc (3 × 2 mL). The organic layers were combined, dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by prep-TLC (SiO2, PE:EtOAc = 1:1) to give the titled compound. LCMS: m/z = 371.2 [M+H] ⁺ . Intermediate 8 N-(4-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)p henyl)-6-azabicyclo[3.1.1]heptane-6- carboxamide O O H [0288] To a dry r ound bottom flask containing triphosgene (636 mg, 2.1 mmol) was added DCM (5 mL) and the resulting solution was cooled to 0 °C. A solution of 4-methyl-3-(4,4,5,5-tetramethyl-1,3,2- dioxaborolan-2-yl)aniline (500 mg, 2.1 mmol) and triethylamine (0.9 mL, 6.4 mmol) in DCM (5 mL) was added dropwise. The reaction mixture was allowed to warm from 0 °C to room temperature over 2 h followed by concentrating the reaction mixture in vacuo. The resulting residue was taken up in DCM (10.8 mL) and to that mixture was added 6-azabicyclo[3.1.1]heptane hydrochloride (315 mg, 2.4 mmol) followed by triethylamine (0.9 mL, 6.4 mmol). The reaction mixture was stirred at room temperature for 4 h. The reaction was cooled to 0 °C and quenched dropwise with sat. aq. NaHCO ₃ (10 mL). The reaction was extracted with DCM (3 x 20 mL), dried over Na ₂ SO ₄ , filtered and concentrated in vacuo. Diethyl ether was added to the crude product and the solid was collected by filtration to afford the titled compound which was used directly in the next step. LCMS: m/z = 357.2 [M+H] ⁺ . Intermediate 9 3-methyl-6-azabicyclo[3.1.1]heptane-3-carbonitrile trifluoroacetate CN CN CN N N A [0 is- te rt-butyl 3-cyano-6-azabicyclo[3.1.1]heptane-6-carboxylate (30 mg, 0.13 mmol) in THF (2 mL) was added LDA (0.081 mL, 2 M) at –78 °C under N ₂ . The mixture was stirred at –78 °C for 1 h before adding CH ₃ I (23 mg, 0.16 mmol) in THF (2 mL) at –78 °C and stirring for 1 h. The reaction mixture was poured into aq. sat. NH ₄ Cl (5 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound. LCMS: m/z = 181.2 [M-t-Bu+H] ⁺ . [0290] 3-methyl-6-azabicyclo[3.1.1]heptane-3-carbonitrile trifluoroacetate: To a solution of tert- butyl 3-cyano-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (30 mg, 0.13 mmol) in DCM (2 mL) was added TFA (1.54 g, 0.014 mmol) at 25 °C under N ₂ . The mixture was stirred at 25 °C for 2 h. The reaction mixture was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 137.2 [M+H] ⁺ . Intermediate 10 cis-6-azabicyclo[3.1.1]heptane-3-carbonitrile trifluoroacetate OH OMs CN CN N solution of trans-tert-butyl 3-hydroxy-6-azabicyclo[3.1.1]heptane-6-carboxylate (200 mg, 0.94 mmol) in DCM (2 mL) was added TEA (285 mg, 2.81 mmol) and MsCl (161 mg, 1.41 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 2 h. The reaction mixture was diluted with H ₂ O (2 mL) and extracted with DCM (3 × 3 mL). The combined organic layers were washed with brine (3 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound. LCMS: m/z = 236.1 [M-t-Bu+H] ⁺ . [0292] cis-tert-butyl 3-cyano-6-azabicyclo[3.1.1]heptane-6-carboxylate: To a solution of trans-tert- butyl 3-((methylsulfonyl)oxy)-6-azabicyclo[3.1.1]heptane-6-carboxy late (215 mg, 0.74 mmol) in DMF (5 mL) was added NaCN (109 mg, 2.21 mmol) at 20 °C. The mixture was stirred at 65 °C for 12 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound. LCMS: m/z = 167.2 [M-t-Bu+H] ⁺ . [0293] cis-6-azabicyclo[3.1.1]heptane-3-carbonitrile trifluoroacetate: To a solution of cis-tert-butyl 3-cyano-6-azabicyclo[3.1.1]heptane-6-carboxylate (130 mg, 0.59 mmol) in DCM (3 mL) was added TFA (7.95 g, 69.76 mmol) at 20 °C. The mixture was stirred at 20 °C for 2 h. The reaction mixture was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 123.2 [M+H] ⁺ . Intermediate 11 2-(6-azabicyclo[3.1.1]heptan-1-yl)-5-methyl-1,3,4-oxadiazole N N HN Boc Boc [0294] te rt-butyl 1-(acetamidocarbamoyl)-6-azabicyclo[3.1.1]heptane-6-carboxyl ate: To a solution of N,N-diisopropylethylamine (0.43 mL, 2.49 mmol) in EtOAc (1.2 mL) at –20 °C was added acethydrazide (67.55 mg, 0.91 mmol). Subsequently, 6-tert-butoxycarbonyl-6-azabicyclo[3.1.1]heptane- 1-carboxylic acid (200.0 mg, 0.83 mmol) was added and then the reaction was warmed to –10 °C and stirred for 1 h. T3P (791.23 mg, 1.24mmol, 50% purity) was added dropwise and stirred for an additional 15 min. The reaction was concentrated and the residue was taken up in EtOAc and H ₂ O. The organic layer was washed with brine, dried over anhydrous Na ₂ SO ₄ and concentrated under reduced pressure to give the titled compound. [0295] tert-butyl 1-(5-methyl-1,3,4-oxadiazol-2-yl)-6-azabicyclo[3.1.1]heptane -6-carboxylate: To a solution of tert-butyl 1-(acetamidocarbamoyl)-6-azabicyclo[3.1.1]heptane-6-carboxyl ate (166.0 mg, 0.56 mmol) in MeCN (1.9 mL) at 0 °C was added TEA (0.23 mL, 1.67 mmol) and then p-toluenesulfonyl chloride (117.08 mg, 0.61 mmol). The reaction was stirred at room temperature for another 1 h. The resulting solution was concentrated under reduced pressure. To the resulting residue was added diethyl ether followed by sonication. The mixture was concentrated to dryness and used directly in the next step. [0296] 2-(6-azabicyclo[3.1.1]heptan-1-yl)-5-methyl-1,3,4-oxadiazole : To a solution of tert-butyl 1-(5- methyl-1,3,4-oxadiazol-2-yl)-6-azabicyclo[3.1.1]heptane-6-ca rboxylate (2080.0 mg, 7.45 mmol) in DCE (37.2 mL) was added trifluoroacetic acid (5.7 mL, 74.46 mmol). The reaction was stirred at room temperature for 2 h. After 2 h, the reaction was heated to 50 °C and stirred overnight. After stirring overnight, the reaction was cooled and concentrated under reduced pressure. The residue was purified by HPLC to give the titled compound. LCMS: m/z = 180.1 [M+H] ⁺ . Intermediate 12 6-azabicyclo[3.1.1]heptane-1-carbonitrile trifluoroacetic acetate [0297] t- butoxycarbonyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (333.51 mg, 1.38 mmol) at –20 °C in THF (2.3 mL) was added TEA (0.58 mL, 4.15 mmol). Subsequently, ethyl chloroformate (0.13 mL, 1.38 mmol) was added and the reaction was warmed to –10 °C and stirred for 1 h. After 1 h, NH3 (1.97 mL, 13.82 mmol, 7N in MeOH) was added dropwise and stirred for an additional 15 min. The reaction was then concentrated and taken up in EtOAc and H ₂ O. The organic layer was washed with brine, dried over anhydrous Na ₂ SO ₄ and concentrated to give the desired compound. [0298] tert-butyl 1-cyano-6-azabicyclo[3.1.1]heptane-6-carboxylate To a solution of tert-butyl 1- carbamoyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (285.0 mg, 1.19 mmol) in THF (11.8 mL) at 0 °C was added TEA (0.33mL, 2.37mmol) and then trifluoroacetic anhydride (0.16 mL, 1.19 mmol) dropwise. The reaction was stirred at 0 °C and allowed to warm to room temperature overnight. The reaction was concentrated under reduced pressure and then taken up in EtOAc and H ₂ O. The organic layer was washed successively with aq. sat. NaHCO ₃ and brine. The organics were dried over anhydrous Na ₂ SO ₄ and concentrated to give the titled product. [0299] 6-azabicyclo[3.1.1]heptane-1-carbonitrile trifluoroacetic acetate: To a solution of tert-butyl 1-cyano-6-azabicyclo[3.1.1]heptane-6-carboxylate (250.0 mg, 1.12 mmol) in DCE (5.6 mL) was added trifluoroacetic acid (0.86 mL, 11.25 mmol). The reaction was heated to 50 °C and stirred overnight. After stirring overnight, the reaction was cooled and concentrated to give the titled compound. LCMS: m/z = 123.1 [M+H] ⁺ . Intermediate 13 6-chloropyrazolo[1,5-a]pyrazine-4-carbonitrile [0300] To a soluti on o py [ ]py ( g ol) in DMF (7 mL) was added Zn(CN) ₂ (187 mg, 1.60 mmol) and Pd(PPh3)4 (184 mg, 0.15 mmol) at 20 °C under N ₂ . The mixture was stirred at 120 °C for 12 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by prep- TLC (SiO ₂ , PE:EtOAc = 1:1) to give the titled compound. Intermediate 14 cis-6-(trifluoromethyl)tetrahydro-2H-pyran-2-carboxylic acid To a solution of 6-((benzyloxy)methyl)tetrahydro-2H-pyran-2-one (4 g, 18.16 mmol) and TMSCF3 (2.84 g, 19.98 mmol) in THF (24 mL) was added TBAF (0.18 mmol, 0.18 mL, 1 M in THF) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 12 h. The mixture was diluted with H ₂ O (50 mL) and extracted with EtOAc (3 × 30 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 1:0 to 10:1) to give the titled compound. [0302] 6-((benzyloxy)methyl)-2-(trifluoromethyl)tetrahydro-2H-pyran -2-ol: To a solution of ((6- ((benzyloxy)methyl)-2-(trifluoromethyl)tetrahydro-2H-pyran-2 -yl)oxy)trimethylsilane (3.9 g, 10.76 mmol) in THF (40 mL) was added TBAF (21.52 mol, 21.52 mL, 1 M in THF) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 12 h. The reaction mixture was concentrated under reduced pressure to give the titled compound. [0303] 6-((benzyloxy)methyl)-2-(trifluoromethyl)tetrahydro-2H-pyran -2-yl ethyl oxalate: To a solution of 6-((benzyloxy)methyl)-2-(trifluoromethyl)tetrahydro-2H-pyran -2-ol (3 g, 10.33 mmol) in DCM (30 mL) was added pyridine (2.45 g, 31 mmol) and ethyl 2-chloro-2-oxo-acetate (2.82 g, 20.67 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 12 h. The reaction mixture was diluted with H ₂ O (40 mL) and extracted with EtOAc (3 × 20 mL). The combined organic layers were washed with brine (40 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc =1:0 to 10:1) to give the titled compound. [0304] 2-((benzyloxy)methyl)-6-(trifluoromethyl)tetrahydro-2H-pyran : To a solution of 6- ((benzyloxy)methyl)-2-(trifluoromethyl)tetrahydro-2H-pyran-2 -yl ethyl oxalate (2.1 g, 5.38 mmol) in toluene (40 mL) was added AIBN (265 mg, 1.61 mmol) and tributylstannane (3.13 g, 10.76 mmol) under N ₂ . The mixture was stirred at 130 °C for 12 h. The reaction mixture was diluted with H ₂ O (50 mL) and extracted with EtOAc (3 × 30 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 1:0 to 10:1) to give the titled compound. [0305] (6-(trifluoromethyl)tetrahydro-2H-pyran-2-yl)methanol: To a solution of 2- ((benzyloxy)methyl)-6-(trifluoromethyl)tetrahydro-2H-pyran (0.9 g, 3.28 mmol) in MeOH (18 mL) was added HCl/MeOH (4 M, 2.7 mL) and 10% Pd/C (0.3 g). The mixture was stirred at 20 °C for 12 h under H ₂ (15 psi). The reaction mixture was filtered and concentrated under reduced pressure to give the titled compound. [0306] cis-6-(trifluoromethyl)tetrahydro-2H-pyran-2-carboxylic acid: To a solution of (6- (trifluoromethyl)tetrahydro-2H-pyran-2-yl)methanol (0.02 g, 0.11 mmol) in DCM (0.5 mL), MeCN (0.5 mL) and H ₂ O (1 mL) was added NaIO ₄ (70 mg, 0.33 mmol) and RuCl ₃ (0.45 mg, 0.01 mmol) under N ₂ . The mixture was stirred at 20 °C for 2 h. The reaction mixture was diluted with H ₂ O (3 mL) and extracted with DCM (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound. Intermediate 15 trans-5-(trifluoromethyl)tetrahydro-2H-pyran-2-carboxylic acid C ^F3 [0307] To mg, 0.27 mmol) in DCM (0.5 mL), H ₂ O (1 mL) and MeCN (0.5 mL) was added NaIO ₄ (174 mg, 814.53 mmol) at 0 °C, then RuCl ₃ (1 mg, 0.005 mmol) was added at 0 °C. The mixture was stirred at 20 °C for 1 h. The reaction mixture was diluted with H ₂ O (2 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound. Intermediate 16 3-(7-(2-methoxyethoxy)pyrrolo[2,1-f][1,2,4]triazin-2-yl)-4-m ethylaniline O [0308] 3- Cs ₂ CO ₃ (645 mg, 1.98 mmol), CuI (19 mg, 0.1 mmol), 1,10-phenanthroline (36 mg, 0.2 mmol) were taken up into a microwave tube in 2-methoxyethanol (8 mL) under N ₂ . The sealed tube was heated at 130 °C for 3 h under microwave irradiation. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were washed with brine (3 × 10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 3:1 to 1:1) to give the titled compound. LCMS: m/z = 299.0 [M+H] ⁺ . Intermediate 17 trans-3-fluoro-6-azabicyclo[3.1.1]heptane [0309] t mixture of trans-tert-butyl 3-hydroxy-6-azabicyclo[3.1.1]heptane-6-carboxylate (400 mg, 1.88 mmol) and 4-nitrobenzoic acid (407 mg, 2.44 mmol) in THF (8 mL) was added PPh3 (738 mg, 2.81 mmol) and DIAD (569 mg, 2.81 mmol) at 0 °C under N ₂ . The mixture was stirred at 25 °C for 16 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was slurried with EtOAc and filtered. The filter cake was dried under reduced pressure to give the titled compound. [0310] cis-tert-butyl 3-hydroxy-6-azabicyclo[3.1.1]heptane-6-carboxylate: To a mixture of trans-tert- butyl 3-((4-nitrobenzoyl)oxy)-6-azabicyclo[3.1.1]heptane-6-carboxy late (320 mg, 0.88 mmol) in THF (4 mL) and H ₂ O (1 mL) was added LiOH•H ₂ O (185 mg, 4.42 mmol) at 25 °C. The mixture was stirred at 25 °C for 12 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound. [0311] trans-tert-butyl 3-fluoro-6-azabicyclo[3.1.1]heptane-6-carboxylate: A mixture of cis-tert- butyl 3-hydroxy-6-azabicyclo[3.1.1]heptane-6-carboxylate (200 mg, 0.93 mmol) in DAST (2 mL) was stirred at 0 °C for 2 h under N ₂ . The reaction mixture was quenched by addition of aq. sat. Na ₂ CO ₃ until pH = 7 and extracted with DCM (3 × 10 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressures to give the titled compound. [0312] trans-3-fluoro-6-azabicyclo[3.1.1]heptane: The mixture of trans-tert-butyl 3-fluoro-6- azabicyclo[3.1.1]heptane-6-carboxylate (240 mg, 1.11 mmol) in TFA (1.5 mL) and DCM (1 mL) was stirred at 20 °C for 2 h. The reaction mixture was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 116.2 [M+H] ⁺ . i 18 [0313] To a mixture of MeCN (20 mL) was added SelectFluor (3.46 g, 9.77 mmol) at 25 °C under N ₂ . The mixture was stirred at 80 °C for 2 h. The reaction mixture was diluted with H ₂ O (20 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 10:1 to 3:1) to give the titled compound. LCMS: m/z = 172.1 [M+H] ⁺ . Intermediate 19 4-chloro-3-(pyrazolo[1,5-a]pyrazin-6-yl)aniline N [0314] To a mixture of 4-chloro-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)anil ine (150 mg, 0.59 mmol) and 6-chloropyrazolo[1,5-a]pyrazine (91 mg, 0.59 mol) in 1,4-dioxane (1 mL) and H ₂ O (0.1 mL) was added K ₃ PO ₄ (377 mg, 1.77 mmol) and XPhos Pd G2 (47 mg, 0.06 mmol) at 25 °C under N ₂ . The mixture was stirred at 100 °C for 12 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by prep-TLC (SiO ₂ , EtOAc) to give the titled compound. LCMS: m/z = 245.1 [M+H] ⁺ . Intermediate 20 6-chloro-3-fluoropyrazolo[1,5-a]pyrazine [0315] To a mixture of 6-chloropyrazolo[1,5-a]pyrazine (150 mg, 0.98 mmol) in MeCN (5 mL) was added SelectFluor (692 mg, 1.95 mmol) at 20 °C under N ₂ . The mixture was stirred at 80 °C for 16 h. The reaction mixture was diluted with H ₂ O (5 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by prep-TLC (SiO2, PE:EtOAc = 1:1) to give the titled compound. LCMS: m/z = 172.1 [M+H] ⁺ . Intermediate 21 6-bromopyrazolo[1,5-a]pyridine-4-carbonitrile and 4-bromopyrazolo[1,5-a]pyridine-6-carbonitrile [0316] T (5 mL) was added Cu CN (114 mg, 1.27 mmol) at 20 °C under N ₂ . The mixture was stirred at 180 °C for 3 h. The reaction mixture was filtered through a celite pad. The filtrate was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by prep-TLC (SiO2, PE:EtOAc = 1:1) to give the titled compounds. LCMS = 221.8, 223.8 [M+H] ⁺ . Intermediate 22 6-chloropyrazolo[1,5-a]pyrazine-4-carbonitrile N N N [0 317] 6-chloro-4-vinylpyrazolo[1,5-a]pyrazine: To a mixture of 4,6-dichloropyrazolo[1,5-a]pyrazine (500 mg, 2.66 mmol) and potassium vinyltrifluoroborate (356 mg, 2.66 mmol) in 1,4-dioxane (5 mL) and H ₂ O (0.5 mL) was added K ₂ CO ₃ (735 mg, 5.32 mmol) and Pd(dppf)Cl ₂ (195 mg, 0.27 mmol) at 20 °C under N ₂ . The mixture was stirred at 30 °C for 2 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound. LCMS: m/z = 180.1 [M+H] ⁺ . [0318] 6-chloropyrazolo[1,5-a]pyrazine-4-carbaldehyde: To a mixture of 6-chloro-4-vinyl- pyrazolo[1,5-a]pyrazine (900 mg, 5.01 mmol) in THF (40 mL) and H ₂ O (20 mL) was added NaIO ₄ (3.22 g, 15.03 mmol), potassium osmate (VI) dihydrate (184.63 mg, 0.50 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 12 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 5:1 to 3:1) to give the titled compound. LCMS: m/z = 182.1 [M+H] ⁺ . [0319] 6-chloropyrazolo[1,5-a]pyrazine-4-carbaldehyde oxime: To a mixture of 6- chloropyrazolo[1,5-a]pyrazine-4-carbaldehyde (35 mg, 0.19 mmol) in EtOH (1 mL) was added NH ₂ OH•HCl (20 mg, 0.29 mmol) and NaOAc (47 mg, 0.58 mmol) at 20 °C under N ₂ . The mixture was stirred at 90 °C for 3 h. The reaction mixture was diluted with H ₂ O (2 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound. LCMS: m/z = 197.2 [M+H] ⁺ . [0320] 6-chloropyrazolo[1,5-a]pyrazine-4-carbonitrile: To a mixture of 6-chloropyrazolo[1,5- a]pyrazine-4-carbaldehyde oxime (20 mg, 0.10 mmol) in DCM (2 mL) was added Burgess reagent (73 mg, 0.31 mmol) at 20 °C under N ₂ . The mixture was stirred at 20 °C for 3 h. The reaction mixture was concentrated under reduced pressure. The resulting residue was purified by prep-TLC (SiO ₂ , PE:EtOAc = 3:1) to give the titled compound. LCMS: m/z = 179.1 [M+H] ⁺ . Intermediate 23 trans-2-(pyridin-2-yl)cyclobutanecarboxylic acid O O O ^O _O O N O oxabicyclo[3.2.0]heptane-2,4-dione (5 g, 39.65 mmol) and benzyl alcohol (8.57 g, 79.30 mmol, 8.25 mL) in THF (50 mL) was added DMAP (484.37 mg, 3.96 mmol) at 20°C under N ₂ . The mixture was stirred at 20 °C for 12 h. The mixture was poured into aq. sat. NaHCO ₃ (50 ml) and extracted with EtOAc (3 × 10 mL). The combined organic phases were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound. [0322] cis-1-benzyl 2-(1,3-dioxoisoindolin-2-yl) cyclobutane-1,2-dicarboxylate: To a mixture of cis- 2-((benzyloxy)carbonyl)cyclobutanecarboxylic acid (2 g, 8.54 mmol) and 2-hydroxyisoindoline-1,3- dione (1.80 g, 11.01 mmol) in DCM (100 mL) was added DMAP (104.31 mg, 0.85 mmol) at 0 °C under N ₂ . To the mixture was added dropwise DCC (1.94 g, 9.39 mmol) at 0 °C, then stirred at 25 °C for 16 h. The mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:MTBE = 7:1 to 5:1) to give the titled compound. [0323] trans-benzyl 2-(pyridin-2-yl)cyclobutanecarboxylate: To a mixture of cis-1-benzyl 2-(1,3- dioxoisoindolin-2-yl) cyclobutane-1,2-dicarboxylate (1.44 g, 3.80 mmol) and 2-bromopyridine (400 mg, 2.53 mmol) in DMA (8 mL) was added diethyl 2,6-dimethyl-1,4-dihydropyridine-3,5-dicarboxylate (1.28 g, 5.06 mmol), NiBr2•dtbbpy (247 mg, 0.51 mmol) and NaHCO ₃ (851 mg, 10.13 mmol) at 25 °C under N ₂ . The reaction was irradiated for 12 h under 390 nm purple lamp. The mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 10 mL). The combined organic phases were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 5:1 to 1:1) to give the titled compound. LCMS: m/z = 268.1 [M+H] ⁺ . [0324] trans-2-(pyridin-2-yl)cyclobutanecarboxylic acid: To a solution of trans-benzyl 2-(2- pyridyl)cyclobutanecarboxylate (100 mg, 0.37 mmol) in MeOH (2 mL) was added 10% Pd/C (10 mg) under N ₂ . The suspension was degassed under vacuum and purged with H ₂ several times. The mixture was stirred at 20°C for 2 h under H ₂ (15 psi). The mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 178.0 [M+H] ⁺ . Intermediate 24 3-chloropyrrolo[1,2-a]pyrazine [ 03 5] ,3 d c o opy oo[ , a]py a e: o a so ut o o py o o[ , a]py a e ,3 do ( .5 g, 16.65 mmol) in POCl3 (33.00 g, 215.22 mmol) was added DIEA (2.15 g, 16.65 mmol) at 20 °C under N ₂ . The mixture was stirred at 100 °C for 12 h. The mixture was stirred at 120 °C for 6 h. The reaction mixture was concentrated under reduced pressure. The resulting residue was poured into H ₂ O (40 mL) at 20 °C. The aqueous phase was adjusted to pH = 7 by aq. sat. Na ₂ CO ₃ and extracted with EtOAc (3 × 20 mL). The organic layers were washed with brine (30 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 100:1 to 5:1) to give the titled compound. LCMS: m/z = 187.1, 189.1 [M+H] ⁺ . [0326] 3-chloropyrrolo[1,2-a]pyrazine: To a solution of 1,3-dichloropyrrolo[1,2-a]pyrazine (370 mg, 1.98 mmol) in THF (2 mL) was added Zn (517 mg, 7.91 mmol) and AcOH (713 mg, 11.87 mmol) at 0 °C under N ₂ . The mixture was stirred at 70 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The crude product was triturated with MTBE and collected by filtration. The solid was dried under reduced pressure to give the titled compound. LCMS: m/z = 153.1 [M+H] ⁺ .

Intermediate 25 (4S,7S) 4,5,6,7-tetrahydro-4,7-methanopyrazolo[1,5-a]pyrazine hydrochloride [0327] (2S,4R) tert butyl 4 ((tert butyldimethylsilyl)oxy) 2 ((Z) 3 (dimethylamino)acryloyl)pyrrolidine-1-carboxylate: A solution of tert-butyl (2S,4R)-2-acetyl-4-[tert- butyl(dimethyl)silyl]oxy-pyrrolidine-1-carboxylate (3.6 g, 10.48 mmol) in DMF•DMA (40 mL) was stirred at 120 °C for 16 h. The mixture was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 399.2 [M+H] ⁺ . [0328] (2S,4R)-tert-butyl 4-((tert-butyldimethylsilyl)oxy)-2-(1H-pyrazol-5-yl)pyrrolid ine-1- carboxylate: To a solution of tert-butyl (2S,4R)-4-[tert-butyl(dimethyl)silyl]oxy-2-[(Z)-3- (dimethylamino)prop-2-enoyl]pyrrolidine-1-carboxylate (4.1 g, 10.29 mmol) in EtOH (40 mL) was added N ₂ H ₄ •H ₂ O (566 mg, 11.31 mmol). The mixture was stirred at 80 °C for 3 h. The mixture was concentrated under reduced pressure. The residue was diluted with H ₂ O (30 mL) and extracted with EtOAc (3 × 15 mL). The combined organics were washed with brine (15 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduce pressure to give the titled compound. LCMS: m/z = 268.2 [M–Boc+H] ⁺ . [0329] (2S,4R)-tert-butyl 4-hydroxy-2-(1H-pyrazol-5-yl)pyrrolidine-1-carboxylate: To a solution of tert-butyl (2S,4R)-4-[tert-butyl(dimethyl)silyl]oxy-2-(1H-pyrazol-5-yl) pyrrolidine-1-carboxylate (3.3 g, 8.98 mmol) in THF (50 mL) was added N,N-diethylethanamine•3HF (7.24 g, 44.89 mmol). The mixture was stirred at 50 °C for 2 h. The mixture was poured into aq. sat. NaHCO ₃ (100 mL) and extracted with EtOAc (3 × 15 mL), the combined organics were washed with brine (50 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (DCM:MeOH = 10:1 to 5:1) to give the titled compound. LCMS: m/z = 254.2 [M+H] ⁺ . [0330] (2S,4R)-tert-butyl 4-((methylsulfonyl)oxy)-2-(1H-pyrazol-5-yl)pyrrolidine-1-car boxylate): To a solution of (2S,4R)-tert-butyl 4-hydroxy-2-(1H-pyrazol-5-yl)pyrrolidine-1-carboxylate (400 mg, 1.58 mmol) in DCM (10 mL) was added MsCl (217 mg, 1.90 mmol) and TEA (240 mg, 2.37 mmol). The mixture was stirred at 0 °C for 1 h. The mixture was diluted with H ₂ O (10 mL) and extracted with DCM (3 × 5 mL). The combined organics were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduce pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 1:1 to 0:1) to give the titled compound. LCMS: m/z = 232.1 [M–Boc+H] ⁺ . [0331] (4S,7S)-tert-butyl 6,7-dihydro-4,7-methanopyrazolo[1,5-a]pyrazine-5(4H)-carboxy late: To a solution of (2S,4R)-tert-butyl 4-((methylsulfonyl)oxy)-2-(1H-pyrazol-5-yl)pyrrolidine-1-car boxylate (340 mg, 1.03 mmol) in DMF (1.5 mL) was added Cs ₂ CO ₃ (670 mg, 2.05 mmol). The mixture was stirred at 80 °C for 2 h. The mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 10 mL), the combined organics were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduce pressure. The residue was purified by silica gel column chromatography (PE:MTBE = 3:1 to 0:1) to give the titled compound. LCMS: m/z = 236.2 [M+H] ⁺ . [0332] (4S,7S)-4,5,6,7-tetrahydro-4,7-methanopyrazolo[1,5-a]pyrazin e hydrochloride: A solution of (2S,4R) tert-butyl 2,3,8-triazatricyclo[5.2.1.0 ^2,6 ]deca-3,5-diene-8-carboxylate (100 mg, 0.425 mmol) in HCl/EtOAc (4N, 3 mL) was stirred at 20 °C for 2 h. The mixture was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 136.3 [M+H] ⁺ . Intermediate 26 4-amino-5-fluoro-2-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)benzon itrile [0333] To a solu 30 mg, 2.02 mmol) in DMF (5 mL) was added CuCN (542.15 mg, 6.05 mmol) and CuBr (28.94 mg, 0.202 mmol) at 20 °C under N ₂ . The mixture was stirred at 80 °C for 12 h. The reaction mixture was diluted with H ₂ O (30 mL) and extracted with EtOAc (3 × 30 mL). The combined organic layers were washed with brine (3 × 20 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 10:1 to 3:1) to give the titled compound. LCMS: m/z = 254.1 [M+H] ⁺ . Intermediate 27 trans-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid O [0334] cis-1-amino-3-methylcyclohexanecarbonitrile: The mixture of 3-methylcyclohexanone (53 g, 0.47 mol), TMSCN (61 g, 0.61 mol) and diiodozinc (15 g, 47.25 mmol) was stirred at 20 °C for 1 h. Then a solution of NH3 (7 M, 25.47 mL) in MeOH, made from bubbling NH3 into MeOH (200 mL) for 30 min at –78 °C, was added to the above mixture. The mixture was stirred at 20 °C for 16 h before concentrating under reduced pressure. The resulting residue was triturated with DCM (500 mL) at 20 °C for 20 min, filtered and the filtrate was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 139.2 [M+H] ⁺ . [0335] cis-1-amino-3-methylcyclohexanecarboxylic acid hydrochloride: A solution of cis-1-amino-3- methylcyclohexanecarbonitrile (47 g, 0.70 mol) in HCl (10 N, 970 mL) was stirred at 100 °C for 12 h. The reaction mixture was filtered and the filter cake was dried under reduced pressure to give the titled compound. LCMS: m/z = 158.2 [M+H] ⁺ . [0336] cis-methyl 1-amino-3-methylcyclohexanecarboxylate hydrochloride: To a mixture of cis-1- amino-3-methylcyclohexanecarboxylic acid hydrochloride (94 g, 0.49 mol) in MeOH (940 mL) was added dropwise SOCl ₂ (106 mL, 1.46 mol) at 0 °C under N ₂ . The mixture was then stirred at 75 °C for 12 h. The reaction mixture was concentrated under reduced pressure. The resulting residue was triturated with MTBE (1.5 L) at 20 °C for 30 min, filtered and the filter cake was dried under reduced pressure to give the titled compound. LCMS: m/z = 172.2 [M+H] ⁺ . [0337] cis-methyl 3-methyl-1-(picolinamido)cyclohexanecarboxylate: To a mixture of cis-methyl 1- amino-3-methylcyclohexanecarboxylate hydrochloride (79 g, 0.38 mol) and picolinic acid (61 g, 0.49 mol) in DCM (1.5 L) was added DIEA (147 g, 1.14 mol), DMAP (4.7 g, 0.038 mol) and EDCI (109 g, 0.57 mol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 12 h, diluted with H ₂ O (700 mL) and extracted with DCM (2 × 400 mL). The combined organic layers were washed with brine (600 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 1:0 to 3:1) to give the titled compound. LCMS: m/z = 277.0 [M+H] ⁺ . [0338] trans-methyl 3-methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptane-1-carboxyla te: To a mixture of cis-methyl 3-methyl-1-(picolinamido)cyclohexanecarboxylate (39 g, 141 mmol), AgOAc (70.68 g, 423 mmol), Na ₃ PO ₄ (69.42 g, 423 mmol) and benzoquinone (7.62 g, 70.56 mmol) in 1,1,2,2- tetrachloroethane (720 mL) was added Pd(OAc) ₂ (6.33 g, 28.23 mmol) and 1,2,3,4,5-pentafluoro-6-iodo- benzene (414.87 g, 1411.35 mmol) at 20 °C under N ₂ . The mixture was stirred at 140 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 100:1 to 1:1) to give the titled compound. LCMS: m/z = 275.0 [M+H] ⁺ . [0339] trans-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid: To a solution of trans-methyl 3- methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptane-1-carboxylate (7.4 g, 26.98 mmol) in EtOH (100 mL) was added NaOH (10.79 g, 270 mmol) at 25 °C under N ₂ . The mixture was stirred at 90 °C for 12 h. The reaction mixture was concentrated under reduced pressure to remove EtOH. The residue was diluted with H ₂ O (15 mL) and the pH was adjusted to 6-7 with HCl (6 N) and then lyophilized to give the titled compound. LCMS: m/z = 156.2 [M+H] ⁺ . Intermediate 28 2-fluoro-5-(imidazo[1,2-a]pyrazin-6-yl)-4-methylaniline O N N [0340] To a solution of 2 fluoro 4 methyl 5 (4,4,5,5 tetramethyl 1,3,2 dioxaborolan 2 yl)aniline (200 mg, 0.79 mmol) in 1,4-dioxane (4 mL) and H ₂ O (0.4 mL) was added 6-chloroimidazo[1,2-a]pyrazine (146 mg, 0.95 mmol), K ₂ CO ₃ (330 mg, 2.39 mmol) and Pd(dppf)Cl ₂ (58 mg, 0.07 mmol) at 20 °C under N ₂ . The mixture was stirred at 100°C for 12 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 1:1 to 0:1) to give the titled compound. LCMS: m/z = 243.2 [M+H] ⁺ . Intermediate 29 cis-5-(trifluoromethyl)tetrahydro-2H-pyran-2-carboxylic acid C ^F [ ] ( y ) y py y ) (benzyloxymethyl)-5-(trifluoromethyl)tetrahydropyran (100 mg, 0.36 mmol) in MeOH (2 mL) was added HCl/MeOH (0.5 mL, 4 M) and 10% Pd/C (25 mg). The reaction mixture was degassed and purged with H ₂ (15 psi) for 3 times and then stirred at 20 °C for 16 h under H ₂ (15 psi). The mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure to give the titled compound. [0342] cis-5-(trifluoromethyl)tetrahydro-2H-pyran-2-carboxylic acid: To a solution of (cis-5- (trifluoromethyl)tetrahydro-2H-pyran-2-yl)methanol (60 mg, 0.33 mmol) in DCM (0.5 mL), H ₂ O (1 mL) and MeCN (0.5 mL) was added NaIO4 (209 mg, 0.98 mmol) and RuCl3 (1 mg, 0.006 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 1 h. The reaction mixture was diluted with H ₂ O (2 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound. Intermediate 30 [0343] 2 (2 methyl 5 nitrophenyl)pyrrolo[2,1 f][1,2,4]triazine: To a solution of 2 chloropyrrolo[2,1 f][1,2,4]triazine (2 g, 13.02 mmol) in 1,4-dioxane (30 mL) and H ₂ O (3 mL) was added 4,4,5,5- tetramethyl-2-(2-methyl-5-nitrophenyl)-1,3,2-dioxaborolane (5.14 g, 19.54 mmol), K ₂ CO ₃ (4.50 g, 32.56 mmol) and Pd(dppf)Cl ₂ (952 mg, 1.30 mmol) at 20 °C under N ₂ . The mixture was stirred at 100 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 10:1 to 9:1) to give the titled compound. LCMS: m/z = 255.0 [M+H] ⁺ . [0344] 7-bromo-2-(2-methyl-5-nitrophenyl)pyrrolo[2,1-f][1,2,4]triaz ine: To a solution of 2-(2- methyl-5-nitrophenyl)pyrrolo[2,1-f][1,2,4]triazine (1.25 g, 4.92 mmol) in MeCN (25 mL) was added NBS (700 mg, 3.93 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 12 h. The reaction mixture was filtered. The filter cake was triturated with EtOAc (20 mL), and the solid was collected by filtration and dried under reduced pressure to give the titled compound. LCMS: m/z = 333.1, 335.0 [M+H] ⁺ . [0345] 3-(7-bromopyrrolo[2,1-f][1,2,4]triazin-2-yl)-4-methylaniline : To a solution of 7-bromo-2-(2- methyl-5-nitrophenyl)pyrrolo[2,1-f][1,2,4]triazine (400 mg, 1.20 mmol) in EtOH (8 mL) and H ₂ O (2 mL) was added Fe (335 mg, 6.00 mmol) and NH ₄ Cl (321 mg, 6.00 mmol) at 20 °C under N ₂ . The mixture was stirred at 80 °C for 2 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 5:1 to 3:1) to give the titled compound. LCMS: m/z = 302.9, 304.9 [M+H] ⁺ . Intermediate 31 2 (5 amino 2 methylphenyl)pyrrolo[21 f][124]triazine 7 carbonitrile [0346] 2-(2-methyl-5-nitrophenyl)pyrrolo[2,1-f][1,2,4]triazine-7-ca rbonitrile: To a solution of 7- bromo-2-(2-methyl-5-nitrophenyl)pyrrolo[2,1-f][1,2,4]triazin e (500 mg, 1.50 mmol) in NMP (8 mL) was added CuCN (403 mg, 4.50 mmol) at 20 °C under N ₂ . The mixture was stirred at 140 °C for 12 h, diluted with H ₂ O (50 mL) and filtered. The filter cake was dissolved in EtOAc (20 mL), filtered and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 3:1 to 1:1) to give the titled compound. LCMS: m/z = 280.1 [M+H] ⁺ . [0347] 2-(5-amino-2-methylphenyl)pyrrolo[2,1-f][1,2,4]triazine-7-ca rbonitrile: To a solution of 2- (2-methyl-5-nitrophenyl)pyrrolo[2,1-f][1,2,4]triazine-7-carb onitrile (60 mg, 0.21 mmol) in EtOH (2 mL) and H ₂ O (0.5 mL) was added Fe (60 mg, 1.07 mmol) and NH ₄ Cl (57 mg, 1.07 mmol) at 20 °C. The mixture was stirred at 80 °C for 2 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 250.1 [M+H] ⁺ . Intermediate 32 3-(7-(difluoromethyl)pyrrolo[2,1-f][1,2,4]triazin-2-yl)-4-me thylaniline [0348] 2-(2-methyl-5-nitrophenyl)pyrrolo[2,1-f][1,2,4]triazine-7-ca rbaldehyde: DMF (10 mL) was added to a solution of POCl ₃ (3.32 g, 21.63 mmol) at 0 °C and the mixture was stirred at 0 °C for 0.5 h. The reaction mixture was warmed to 20 °C.2-(2-methyl-5-nitrophenyl)pyrrolo[2,1-f][1,2,4]triazine (550 mg, 2.16 mmol) was added and the reaction mixture was heated at 95° C for 5 h. The reaction mixture was poured into H ₂ O, adjusted to pH = 7 by adding aq. sat. NaHCO ₃ and extracted with DCM (3 × 20 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressures. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 10:1 to 1:1) to give the titled compound. LCMS: m/z = 283.2 [M+H] ⁺ . [0349] 7-(difluoromethyl)-2-(2-methyl-5-nitrophenyl)pyrrolo[2,1-f][ 1,2,4]triazine: To a solution of 2-(2-methyl-5-nitrophenyl)pyrrolo[2,1-f][1,2,4]triazine-7-ca rbaldehyde (500 mg, 1.77 mmol) in DCM (10 mL) was added DAST (856 mg, 5.31 mmol) at 20 °C under N ₂ . The mixture was stirred at 20 °C for 12 h. The reaction mixture was poured into H ₂ O, adjusted to pH = 7 by adding aq. sat. NaHCO ₃ and extracted with DCM (3 × 10 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressures. The resulting residue was purified by prep-TLC (SiO ₂ , PE:EtOAc = 5:1) to give the titled compound. LCMS: m/z = 305.1 [M+H] ⁺ . [0350] 3-(7-(difluoromethyl)pyrrolo[2,1-f][1,2,4]triazin-2-yl)-4-me thylaniline: To a solution of 7- (difluoromethyl)-2-(2-methyl-5-nitrophenyl)pyrrolo[2,1-f][1, 2,4]triazine (100 mg, 0.32 mmol) in EtOH (4 mL) and H ₂ O (1 mL) was added Fe (91 mg, 1.64 mmol) and NH ₄ Cl (87 mg, 1.64 mmol) at 25 °C. The mixture was stirred at 70 °C for 2 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by prep-TLC (SiO ₂ , PE:EtOAc = 1:1) to give the titled compound. LCMS: m/z = 274.9 [M+H] ⁺ . Intermediate 33 cis-3-cyclopropyl-6-azabicyclo[3.1.1]heptane [0351] N-(3-cyclopropylcyclohexyl)picolinamide: To a mixture of 3-cyclopropylcyclohexanamine hydrochloride and picolinic acid (3.01 g, 24.42 mmol) in DCM (40 mL) was added DMAP (229 mg, 1.88 mmol), TEA (5.70 g, 56.35 mmol) and EDCI (5.40 g, 28.17 mmol) at 0 °C under N ₂ . The mixture was stirred at 25 °C for 12 h. The reaction mixture was diluted with H ₂ O (30 mL) and extracted with DCM (3 × 15 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by prep-HPLC (Welch Xtimate C 18250 × 70 mm × 10 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 45%-75%, 20 min) to give the titled compound. LCMS: m/z = 245.0 [M+H] ⁺ . [0352] cis-3-cyclopropyl-6-azabicyclo[3.1.1]heptan-6-yl)(pyridin-2- yl)methanone: To a mixture of N-(3-cyclopropylcyclohexyl)picolinamide (1.6 g, 6.55 mmol) in 1,1,2,2-tetrachloroethane (60 mL) was added Na ₃ PO ₄ (3.22 g, 19.65 mmol), benzoquinone (354 mg, 3.27 mmol), AgOAc (3.28 g, 19.65 mmol), 1,2,3,4,5-pentafluoro-6-iodo-benzene (19.25 g, 65.48 mmol) and Pd(OAc) ₂ (294 mg, 1.31 mmol) at 25 °C under N ₂ . The mixture was stirred at 145 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 3:1 to 1:2) to give the titled compound. LCMS: m/z = 243.0 [M+H] ⁺ . [0353] cis-3-cyclopropyl-6-azabicyclo[3.1.1]heptane: To a mixture of cis-3-cyclopropyl-6- azabicyclo[3.1.1]heptan-6-yl)(pyridin-2-yl)methanone (250 mg, 1.03 mmol) in EtOH (3 mL) was added NaOH (413 mg, 10.32 mmol) at 20 °C under N ₂ . The mixture was stirred at 90 °C for 12 h. The reaction mixture was concentrated under reduced pressure (water bath, below 35 °C) to give a mixture containing the product, NaOH and the sodium salt of the acid. The mixture was stirred in DCM (20 mL) and filtered through a celite pad. The filtrate was concentrated under reduce pressure (water bath, below 35 °C) to give the titled compound. LCMS: m/z = 138.2 [M+H] ⁺ . Intermediate 33 1-(pyrimidin-2-yl)-6-azabicyclo[3.1.1]heptane trifluoroacetate azabicyclo[3.1.1]heptane-1-carboxylate (5 g, 32.22 mmol) in DCM (50 mL) and MeOH (10 mL) was added TEA (6.52 g, 64.44 mmol), Boc ₂ O (14.06 g, 64.44 mmol), and DMAP (393 mg, 3.22 mmol) at 0 °C under N ₂ . The mixture was then stirred at 25 °C for 3 h. The reaction mixture was diluted with aq. sat. NH ₄ Cl (10 mL) and extracted with DCM (3 × 10 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 5:1 to 1:1) to give the titled compound. [0355] tert-butyl 1-carbamoyl-6-azabicyclo[3.1.1]heptane-6-carboxylate: A mixture of 6-tert-butyl 1-methyl 6-azabicyclo[3.1.1]heptane-1,6-dicarboxylate (5 g, 19.58 mmol) in 25% NH ₃ •H ₂ O (30 mL) was stirred at 25 °C for 12 h. The reaction mixture was diluted with H ₂ O (15 mL) and the solid was collected by filtration and dried under reduced pressure to give the titled compound. LCMS: m/z = 185.2 [M-t- Bu+H] ⁺ . [0356] tert-butyl 1-cyano-6-azabicyclo[3.1.1]heptane-6-carboxylate: To a mixture of tert-butyl 1- carbamoyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (1.3 g, 5.41 mmol) in THF (10 mL) was added methoxycarbonyl-(triethylammonium)sulfonyl-azanide (3.87 g, 16.23 mmol) at 25 °C under N ₂ . The mixture was stirred at 65 °C for 3 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 5:1 to 1:1) to give the titled compound. [0357] tert-butyl 1-(imino(methoxy)methyl)-6-azabicyclo[3.1.1]heptane-6-carbox ylate: To a mixture of tert-butyl 1-cyano-6-azabicyclo[3.1.1]heptane-6-carboxylate (500 mg, 2.25 mmol) in MeOH (8 mL) was added NaOMe (405 mg, 2.25 mmol, 30% purity in MeOH) at 0 °C under N ₂ . The mixture was stirred at 25 °C for 12 h and this solution was used directly in the next step. [0358] tert-butyl 1-carbamimidoyl-6-azabicyclo[3.1.1]heptane-6-carboxylate: To a mixture of tert- butyl 1-(imino(methoxy)methyl)-6-azabicyclo[3.1.1]heptane-6-carbox ylate (500 mg, 1.97 mmol) in MeOH (8 mL) was added NH ₄ Cl (126.20 mg, 2.36 mmol) at 25 °C under N ₂ . The mixture was stirred at 80 °C for 5 h. The reaction mixture was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 240.3 [M+H] ⁺ . [0359] tert-butyl 1-(pyrimidin-2-yl)-6-azabicyclo[3.1.1]heptane-6-carboxylate: To a mixture of tert- butyl 1-carbamimidoyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (500 mg, 2.09 mmol) and (Z)-3- (dimethylamino)acrylaldehyde (311 mg, 3.13 mmol) in EtOH (10 mL) was added K ₂ CO ₃ (578 mg, 4.18 mmol) at 25 °C under N ₂ . The mixture was stirred at 90 °C for 12 h and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 1:1 to 0:1) to give the titled compound. LCMS: m/z = 276.3 [M+H] ⁺ . [0360] 1-(pyrimidin-2-yl)-6-azabicyclo[3.1.1]heptane trifluoroacetate: A mixture of tert-butyl 1- pyrimidin-2-yl-6-azabicyclo[3.1.1]heptane-6-carboxylate (200 mg, 0.73 mmol) in DCM (3 mL) and TFA (1 mL) was stirred at 25 °C for 2 h. The reaction mixture was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 176.2 [M+H] ⁺ . Intermediate 34 N-(2-fluoro-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborol an-2-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide [0361] To a mixture of triphosgene (142 mg, 0.48 mmol) in THF (35 mL) was added TEA (363 mg, 3.58 mmol) and 2-fluoro-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan- 2-yl)aniline (300 mg, 1.19 mmol) at 0 °C under N ₂ . The mixture was stirred at 25 °C under N ₂ for 1 h before adding 6- azabicyclo[3.1.1]heptane (173.17 mg, 1.30 mmol) and TEA (218 mg, 2.16 mmol). The mixture was stirred at 25 °C for 16 h, diluted with H ₂ O (30 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 5:1 to 3:1) to give the titled compound. LCMS: m/z = 375.3 [M+H] ⁺ . Intermediate 35 azabicyclo[3.1.1]heptane-1-carboxylic acid: To a mixture of CDI (1.74 g, 10 mmol) in DCM (70 mL) was added a solution of 4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)aniline (2 g, 8.92 mmol) in DCM (70 mL) at –20 °C under N ₂ . The mixture was stirred at 20 °C for 12 h. Then a solution of DIPEA (3.17 g, 24.50 mmol) and 6-azabicyclo[3.1.1]heptane-1-carboxylic acid (1.98 g, 9.80 mmol) in DCM (20 mL) was added to the above solution at 20 °C. The mixture was stirred at 20 °C for 4 h before concentrating under reduced pressure. The resulting residue was purified by prep-HPLC (Waters Xbridge BEH C18 250 × 70 mm × 10 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 15%-40%, over 18 min) to give the titled compound. LCMS: m/z = 392.2 [M+H] ⁺ . [0363] N ⁶ -(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl )-6-azabicyclo[3.1.1]heptane-1,6- dicarboxamide: To a mixture of 6-((4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)car bamoyl)-6- azabicyclo[3.1.1]heptane-1-carboxylic acid (1 g, 2.55 mmol) in DMF (15 mL) was added DIPEA (660 mg, 5.11 mmol), NH ₄ Cl (1.37 g, 25.55 mmol) and HATU (1.94 g, 5.11 mmol) at 20 °C under N ₂ . The mixture was stirred at 20 °C for 12 h. The reaction mixture was diluted with H ₂ O (40 mL) and extracted with DCM:i-PrOH (v:v = 3:1) (3 × 15 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:(EtOAc:EtOH = 3:1) = 1:0 to 1:1) to give the titled compound. LCMS: m/z = 391.2 [M+H] ⁺ . Intermediate 36 [0364] To a solution of 3-(7-bromopyrrolo[2,1-f][1,2,4]triazin-2-yl)-4-methylaniline (200 mg, 0.66 mmol) in MeOH (5 mL) was added Cs ₂ CO ₃ (430 mg, 1.32 mmol), 1,10-phenanthroline (24 mg, 0.131 mmol) and CuI (13 mg, 0.07 mmol) at 20 °C under N ₂ . The mixture was stirred at 100 °C for 3 h under microwave irradiation. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 10:1 to 1:1) to give the titled compound. LCMS: m/z = 255.1 [M+H] ⁺ . Intermediate 37 trans-6-((2-fluoro-4-methyl-5-(pyrrolo[2,1-f][1,2,4]triazin- 2-yl)phenyl)carbamoyl)-3-methyl-6- bi l [311]h t 1 b li id [0 365] To a solution of triphosgene (245 mg, 0.83 mmol) in THF (20 mL) was added 2-fluoro-4-methyl- 5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)aniline (400 mg, 1.65 mmol) and TEA (501 mg, 0.69 mmol) at 0 °C under N ₂ . The mixture was stirred at 0 °C for 3 h. Then trans-3-methyl-6-azabicyclo[3.1.1]heptane-1- carboxylic acid (305 mg, 1.97 mmol) and TEA (498 mg, 4.92 mmol) were added to the above mixture at 25 °C. The mixture was stirred at 25 °C for 12 h and concentrated under reduced pressure. The resulting residue was purified by prep-HPLC (Waters Xbridge BEH C18250 × 70 mm × 10 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 15%-45%, 20 min) to give the titled compound. LCMS: m/z = 424.2 [M+H] ⁺ . Intermediate 38 2-fluoro-4-methyl-5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)anili ne [0366] To a solution of 2-chloropyrrolo[2,1-f][1,2,4]triazine (2 g, 13.02 mmol) in 1,4-dioxane (20 mL) and H ₂ O (2 mL) at 20 °C under N ₂ was added 2-fluoro-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2- dioxaborolan-2-yl)aniline (3.60 g, 14.33 mmol), K ₂ CO ₃ (5.40 g, 39.07 mmol) and Pd(dppf)Cl ₂ (953 mg, 1.30 mmol). The reaction mixture was stirred at 100 °C for 2 h under N ₂ , filtered and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (EtOAc) and subsequently by prep-HPLC (Xtimate C18250 × 80 mm × 10 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 25%-60%, 27 min) to give the titled compound. LCMS: m/z = 243.2 [M+H] ⁺ . Intermediate 39 of methyl 6-picolinoyl-6-azabicyclo[3.1.1]heptane-1-carboxylate (600 mg, 2 mmol) and CaCl ₂ (1.02 g, 9 mmol) in MeOH (25 mL) was added NaBH ₄ (523 mg, 14 mmol) in portions at 0 °C under N ₂ . The mixture was stirred at 20 °C for 3 h. The reaction mixture was quenched by addition of aq. sat. NH ₄ Cl (15 mL) and extracted with EtOAc (2 × 20 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound. LCMS: m/z = 233.2 [M+H] ⁺ . [0368] (1-(methoxymethyl)-6-azabicyclo[3.1.1]heptan-6-yl)(pyridin-2 -yl)methanone: To a mixture of (1-(hydroxymethyl)-6-azabicyclo[3.1.1]heptan-6-yl)(pyridin-2 -yl)methanone (450 mg, 2 mmol) in THF (8 mL) was added NaH (116 mg, 3 mmol, 60% purity) at 0 °C under N ₂ . The mixture was stirred at 0 °C for 30 min, then a solution of MeI (330 mg, 2 mmol) in THF (2 mL) was added at 0 °C. The reaction mixture was stirred at 20 °C for 12 h. The reaction mixture was quenched by addition of aq. sat. NH ₄ Cl (15 mL) and extracted with EtOAc (3 × 15 mL). The combined organic layers were washed with brine (2 × 10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 1:0 to 1:1) to give the titled compound. LCMS: m/z = 247.2 [M+H] ⁺ . [0369] 1-(methoxymethyl)-6-azabicyclo[3.1.1]heptane: To a mixture of (1-(methoxymethyl)-6- azabicyclo[3.1.1]heptan-6-yl)(pyridin-2-yl)methanone (400 mg, 1 mmol) in EtOH (8 mL) was added NaOH (650 mg, 16 mmol) at 20 °C. The mixture was stirred at 90 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 142.3 [M+H] ⁺ . Intermediate 40 6-((4-methyl-3-(pyrrolo[1,2-a]pyrimidin-3-yl)phenyl)carbamoy l)-6-azabicyclo[3.1.1]heptane-1- carboxylic acid [0370] To a solution of CDI (697 mg, 4.30 mmol) in DCM (20 mL) was added a solution of 4-methyl-3- (pyrrolo[1,2-a]pyrimidin-3-yl)aniline (800 mg, 3.58 mmol) in DCM (20 mL) at –20 °C under N ₂ . The mixture was stirred at –20 °C for 3 h. Then 6-azabicyclo[3.1.1]heptane-1-carboxylic acid (2.94 g, 4.16 mmol) and DIPEA (1.34 g, 10.40 mmol) were added to the above mixture at 25 °C. The mixture was stirred at 25 °C for 12 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (Phenomenex C1880 × 40 mm × 3 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 10%-30%, 8 min) to give the titled compound. LCMS: m/z = 391.2 [M+H] ⁺ . Intermediate 41 4-methyl-3-(pyrrolo[1,2-a]pyrazin-3-yl)aniline [0371] To a so xane (4 mL) and H ₂ O (0.4 mL) was added 4-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)anil ine (164 mg, 0.71 mmol), K ₃ PO ₄ (499 mg, 2.35 mmol) and XPhos Pd G2 (37 mg, 0.05 mmol) at 20 °C under N ₂ . The mixture was stirred at 90 °C for 6 h. The reaction mixture was filtered through a celite pad and the filtrate was diluted with H ₂ O (5 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 10:1 to 5:1) to give the titled compound. LCMS: m/z = 223.9 [M+H] ⁺ . Intermediate 42 4-methyl-3-(pyrrolo[1,2-a]pyrimidin-2-yl)aniline O O [0372] Ethyl 2-(5-amino-2-methylphenyl)pyrrolo[1,2-a]pyrimidine-8-carboxy late: To a solution of ethyl 2-chloropyrrolo[1,2-a]pyrimidine-8-carboxylate (770 mg, 3.43 mmol) and 4-methyl-3-(4,4,5,5- tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (959 mg, 4.11 mmol) in 1,4-dioxane (14 mL) and H ₂ O (1.4 mL) was added K ₂ CO ₃ (1.18 g, 8.57 mmol) and Pd(dppf)Cl ₂ (250.8 mg, 0.34 mmol) at 20 °C under N ₂ . The reaction mixture was stirred at 100 °C for 12 h and then concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 1:1 to 0:1) to give the titled compound. LCMS: m/z = 296.0 [M+H] ⁺ . [0373] 2-(5-amino-2-methylphenyl)pyrrolo[1,2-a]pyrimidine-8-carboxy lic acid: To a solution of ethyl 2-(5-amino-2-methylphenyl)pyrrolo[1,2-a]pyrimidine-8-carboxy late (250 mg, 0.85 mmol) in EtOH (7.5 mL) and H ₂ O (2.5 mL) was added NaOH (169 mg, 4.23 mmol) at 20 °C. The mixture was stirred at 80 °C for 2 h. The reaction mixture was concentrated under reduced pressure to remove EtOH and the resulting residue was diluted with H ₂ O (5 mL), adjusted to pH = 7~8 with aq. HCl, the precipitate was collected by filtration and dried under reduced pressure to give the titled compound. LCMS: m/z = 268.0 [M+H] ⁺ . [0374] 4-methyl-3-(pyrrolo[1,2-a]pyrimidin-2-yl)aniline: To a solution of 2-(5-amino-2- methylphenyl)pyrrolo[1,2-a]pyrimidine-8-carboxylic acid (170 mg, 0.64 mmol) in DMF (3 mL) was added CuO (25 mg, 0.32 mmol) at 20 °C under N ₂ . The mixture was stirred at 160 °C for 6 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 1:1 to 0:1) to give the titled compound. LCMS: m/z = 224.0 [M+H] ⁺ . Intermediate 43 (1R,3R,5R)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl) phenyl)-2-azabicyclo[3.1.0]hexane-3- carboxamide [0375] (1R,3R,5R)-tert-butyl 3-((4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)car bamoyl)-2- azabicyclo[3.1.0]hexane-2-carboxylate: To a mixture of 4-methyl-3-pyrrolo[2,1-f][1,2,4]triazin-2-yl- aniline (300 mg, 1.34 mmol) and (1R,3R,5R)-2-tert-butoxycarbonyl-2-azabicyclo[3.1.0]hexane-3 - carboxylic acid (253 mg, 1.11 mmol) in DCM (3 mL) was added HATU (508 mg, 1.34 mmol) and TEA (564 mg, 5.57 mmol). The mixture was stirred at 20 °C for 2 h and then concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 1:0 to 1:1) to give the titled compound. LCMS: m/z = 434.3 [M+H] ⁺ . [0376] (1R,3R,5R)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl) phenyl)-2- azabicyclo[3.1.0]hexane-3-carboxamide: The solution of (1R,3R,5R)-tert-butyl 3-((4-methyl-3- (pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)carbamoyl)-2-azabi cyclo[3.1.0]hexane-2-carboxylate (200 mg, 0.46 mmol) in HCl/EtOAc (2 mL, 4 M) was stirred at 0 °C for 1 h. The reaction mixture was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 334.2 [M+H] ⁺ . Intermediate 44 (1S,3S,5S)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl) phenyl)-2-azabicyclo[3.1.0]hexane-3- carboxamide [ ] ( , , ) y (( y (py [ , f][ , , ] y )p y) y ) azabicyclo[3.1.0]hexane-2-carboxylate: To a solution of 4-methyl-3-pyrrolo[2,1-f][1,2,4]triazin-2-yl- aniline (300 mg, 1.34 mmol) and (1S,3S,5S)-2-tert-butoxycarbonyl-2-azabicyclo[3.1.0]hexane-3 - carboxylic acid (253 mg, 1.11 mmol) in DCM (3 mL) was added HATU (635 mg, 1.67 mmol) and TEA (564 mg, 5.57 mmol) at 20 °C under N ₂ . The mixture was stirred at 20 °C for 2 h and then concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 10:1 to 1:1) to give the titled compound. LCMS: m/z = 434.2 [M+H] ⁺ . [0378] (1S,3S,5S)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl) phenyl)-2- azabicyclo[3.1.0]hexane-3-carboxamide: A solution of (1S,3S,5S)-tert-butyl 3-((4-methyl-3- (pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)carbamoyl)-2-azabi cyclo[3.1.0]hexane-2-carboxylate (200 mg, 0.46 mmol) in HCl/EtOAc (2 mL, 4 M) was stirred at 20 °C for 1 h. The reaction mixture was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 334.1 [M+H] ⁺ . Intermediate 45 3-(imidazo[1,2-a]pyrazin-6-yl)-4-methylaniline N N [0379] To a sol ution of 6-chloroimidazo[1,2-a]pyrazine (2 g, 13.02 mmol) and 4-methyl-3-(4,4,5,5- tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (3.64 g, 15.63 mmol) in 1,4-dioxane (30 mL) and H ₂ O (3 mL) was added K ₂ CO ₃ (4.50 g, 32.56 mmol) and Pd(dppf)Cl ₂ (953 mg, 1.30 mmol) at 25 °C under N ₂ . The mixture was stirred at 100 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 1:1 to 0:1) to give the titled compound. LCMS: m/z = 225.2 [M+H] ⁺ . Intermediate 46 [0380] 4-chloro-2-fluoro-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan- 2-yl)aniline: To a solution of 5- bromo-4-chloro-2-fluoroaniline (3 g, 13.37 mmol) in 1,4-dioxane (60 mL) was added bis(pinacolato)diboron (5.09 g, 20.05 mmol), KOAc (3.94 g, 40.10 mmol) and Pd(dppf)Cl ₂ (978 mg, 1.34 mmol) at 25 °C under N ₂ . The mixture was stirred at 100 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 15:1 to 10:1) to give the titled compound. LCMS: m/z = 272.3 [M+H] ⁺ . [0381] 4-chloro-2-fluoro-5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)anili ne: To a solution of 4-chloro-2- fluoro-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)anilin e (1.06 g, 3.91 mmol) in 1,4-dioxane (16 mL) and H ₂ O (1.6 mL) was added 2-chloropyrrolo[2,1-f][1,2,4]triazine (400 mg, 2.60 mmol), K ₂ CO ₃ (1.08 g, 7.81 mmol) and Pd(dppf)Cl ₂ (191 mg, 0.26 mmol) at 20 °C under N ₂ . The reaction mixture was stirred at 100 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 3:1 to 1:1) to give the titled compound. LCMS: m/z = 263.1 [M+H] ⁺ . [0382] trans-6-((4-chloro-2-fluoro-5-(pyrrolo[2,1-f][1,2,4]triazin- 2-yl)phenyl)carbamoyl)-3-methyl- 6-azabicyclo[3.1.1]heptane-1-carboxylic acid: To a solution of triphosgene (282 mg, 0.95 mmol) in THF (8 mL) was added TEA (578 mg, 5.72 mmol) and 4-chloro-2-fluoro-5-(pyrrolo[2,1-f][1,2,4]triazin- 2-yl)aniline (500 mg, 1.90 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 1 h before adding trans-3-methyl-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (2.37 g, 2.29 mmol, 15% purity) followed by TEA (578 mg, 5.72 mmol). The reaction mixture was stirred at 20 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The resulting residue was purified by prep-HPLC (column: Waters Xbridge BEH C18250 × 70 mm × 10 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water; B: MeCN; B% in A: 5%-50%, over 18 min) to give the titled compound. LCMS: m/z = 444.1 [M+H] ⁺ .

[0383] 2-(4-fluoro-2-methyl-5-nitrophenyl)-4,4,5,5-tetramethyl-1,3, 2-dioxaborolane: To a solution of bis(pinacolato)diboron (2.17 g, 8.55 mmol) and 1-bromo-4-fluoro-2-methyl-5-nitro-benzene (1 g, 4.27 mmol) in 1,4-dioxane (10 mL) was added KOAc (1.26 g, 12.82 mmol) and Pd(dppf)Cl ₂ •CH ₂ Cl ₂ (348 mg, 0.43 mmol) at 20 °C under N ₂ . The mixture was stirred at 100 °C for 3 h, filtered and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 1:0 to 3:1) to give the titled compound. LCMS: m/z = 282.1 [M+H] ⁺ . [0384] 3-(4-fluoro-2-methyl-5-nitrophenyl)pyridazine: A mixture of 2-(4-fluoro-2-methyl-5- nitrophenyl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (1 g, 3.56 mmol), 3-bromopyridazine (679 mg, 4.27 mmol), Pd(dppf)Cl ₂ (260 mg, 0.36 mmol), and K ₂ CO ₃ (1.23 g, 8.89 mmol) in 1,4-dioxane (10 mL) and H ₂ O (1 mL) was stirred at 100 °C for 6 h under N ₂ . The reaction mixture was diluted with H ₂ O (10 mL) at 20 °C and extracted with EtOAc (3 × 10 mL). The combined organic layers were washed with brine (3 × 10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 1:0 to 0:1) to give the titled compound. LCMS: m/z = 234.1 [M+H] ⁺ . [0385] 3-(4-fluoro-2-methyl-5-nitro-phenyl)pyridazin-1-amine mesitylenesulfonate: To a solution of amino 2,4,6-trimethylbenzenesulfonate trifluoroacetate (1 g, 3.04 mmol) in DCM (3 mL) was added 3-(4- fluoro-2-methyl-5-nitro-phenyl)pyridazine (320 mg, 1.37 mmol) at 0 °C under N ₂ . The reaction mixture was stirred at 20 °C for 16 h and then concentrated under reduced pressure to give the titled compound. [0386] Ethyl 6-(4-fluoro-2-methyl-5-nitrophenyl)pyrazolo[1,5-b]pyridazine -3-carboxylate: To a solution of ethyl prop-2-ynoate (809 mg, 8.25 mmol) in MeCN (20 mL) was added DBU (2.51 g, 16.50 mmol) and 3-(4-fluoro-2-methyl-5-nitro-phenyl)pyridazin-1-amine mesitylenesulfonate (3.7 g, 8.25 mmol) at 0 °C. The mixture was stirred at 20 °C for 16 h. The residue was diluted with H ₂ O (20 mL) and extracted with EtOAc (3 × 20 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 1:0 to 3:1) to give the titled compound. LCMS: m/z = 345.0 [M+H] ⁺ . [0387] 6-(4-fluoro-2-methyl-5-nitrophenyl)pyrazolo[1,5-b]pyridazine : A solution of ethyl 6-(4- fluoro-2-methyl-5-nitrophenyl)pyrazolo[1,5-b]pyridazine-3-ca rboxylate (290 mg, 0.84 mmol) in H ₂ O (3 mL) and H ₂ SO ₄ (5.52 g, 56.28 mmol) was stirred at 120 °C for 16 h. The reaction mixture was poured into ice water (5 mL) and the pH was adjust to 7–8 with aq. sat. Na ₂ CO _3. The mixture was extracted with EtOAc (3 × 30 mL) and the combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 1:0 to 1:1) to give the titled compound. LCMS: m/z = 273.1 [M+H] ⁺ [0388] 2-fluoro-4-methyl-5-(pyrazolo[1,5-b]pyridazin-6-yl)aniline: To a solution of 6-(4-fluoro-2- methyl-5-nitrophenyl)pyrazolo[1,5-b]pyridazine (60 mg, 0.22 mmol) in EtOH (3 mL) and H ₂ O (1 mL) was added NH ₄ Cl (58 mg, 1.10 mmol) and Fe (61 mg, 1.10 mmol) at 20 °C. The mixture was stirred at 80 °C for 2 h. The reaction mixture was filtered and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 1:0 to 1:1) to give the titled compound. LCMS: m/z = 243.1 [M+H] ⁺ . Intermediate 48 2-fluoro-5-(imidazo[1,2-a]pyrazin-6-yl)-4-methylaniline [0389] To a mix ture of 2-fluoro-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan- 2-yl)aniline (200 mg, 0.80 mmol) and 6-chloroimidazo[1,2-a]pyrazine (147 mg, 0.96 mmol) in 1,4-dioxane (4 mL) and H ₂ O (0.4 mL) was added K ₂ CO ₃ (331 mg, 2.39 mmol) and Pd(dppf)Cl ₂ (59 mg, 0.08 mmol) at 20 °C under N ₂ . The mixture was stirred at 100 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 5:1 to 3:1) to give the titled compound. Intermediate 49 3-fluoro-4-methyl-5-pyrrolo[2,1-f][1,2,4]triazin-2-yl-anilin e [0390] To a mixture of 3-fluoro-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan- 2-yl)aniline (250 mg, 1 mmol) in 1,4-dioxane (3 mL) and H ₂ O (0.3 mL) was added 2-chloropyrrolo[2,1-f][1,2,4]triazine (139 mg, 0.91 mmol), K ₂ CO ₃ (375 mg, 2.72 mmol) and Pd(dppf)Cl ₂ (66 mg, 0.09 mmol) at 20 °C under N ₂ . The mixture was stirred at 100 °C for 4 h. The reaction mixture was diluted with H ₂ O (5 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by prep-TLC (SiO2, PE:EtOAc = 1:1) to give the titled compound. LCMS: m/z = 243.1 [M+H] ⁺ . Intermediate 50 4-methyl-3-(pyrazolo[1,5-a]pyrazin-6-yl)aniline [ ] py [ , ]py py [ ]py ( mg, 2.66 mmol) in THF (5 mL) was added Zn (348 mg, 5.32 mmol) and HOAc (5 mL) at 0 °C under N ₂ . The mixture was stirred at 80 °C for 4 h. The mixture was adjusted to pH = 7–8 with aq. sat. Na ₂ CO ₃ solution and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 10:1 to 5:1) to provide the titled compound. LCMS: m/z = 154.0 [M+H] ⁺ . [0392] 4-methyl-3-(pyrazolo[1,5-a]pyrazin-6-yl)aniline: To a mixture of 4-methyl-3-(4,4,5,5- tetramethyl-1,3,2-dioxaborolan-2-yl)aniline (90 mg, 0.39 mmol) and 6-chloropyrazolo[1,5-a]pyrazine (71 mg, 0.46 mmol) in 1,4-dioxane (6 mL) and H ₂ O (0.6 mL) was added K ₂ CO ₃ (160 mg, 1.16 mmol) and Pd(dppf)Cl ₂ (28 mg, 0.038 mmol) at 20 °C under N ₂ . The mixture was stirred at 100 °C for 16 h. The reaction mixture was diluted with H ₂ O (5 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by prep-TLC (SiO ₂ , EtOAc) to give the titled compound. LCMS: m/z = 225.1 [M+H] ⁺ . Intermediate 51 3-([1,2,4]triazolo[1,5-a]pyridin-6-yl)-4-methylaniline [0393] To y ( , , , y , , y ) (680 mg, 2.92 mmol) and 6-bromo-[1,2,4]triazolo[1,5-a]pyridine (693 mg, 3.50 mmol) in 1,4-dioxane (10 mL) and H ₂ O (1 mL) was added K ₂ CO ₃ (1.21 g, 8.75 mmol) and Pd(dppf)Cl ₂ (213mg, 0.29 mmol) at 20 °C under N ₂ . The mixture was stirred at 100 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 10:1 to 1:1) to give the titled compound. LCMS: m/z = 224.1 [M+H] ⁺ . Intermediate 52 1-(1-methyl-1H-1,2,4-triazol-3-yl)-6-azabicyclo[3.1.1]heptan e trifluoroacetate and 1-(1-methyl-1H- 1,2,4-triazol-5-yl)-6-azabicyclo[3.1.1]heptane trifluoroacetate N N carboxylate: A solution of tert-butyl 1-carbamoyl-6-azabicyclo[3.1.1]heptane-6-carboxylate (3.2 g, 13.32 mmol) in DMF-DMA (60 mL) was stirred at 80 °C for 2 h. The reaction mixture was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 296.3 [M+H] ⁺ . [0395] tert-butyl 1-(1H-1,2,4-triazol-3-yl)-6-azabicyclo[3.1.1]heptane-6-carbo xylate: To a mixture of tert-butyl (E)-1-(((dimethylamino)methylene)carbamoyl)-6-azabicyclo[3.1 .1]heptane-6-carboxylate (3.48 g, 11.78 mmol) in 1,4-dioxane (60 mL) at 20 °C under N ₂ was added HOAc (1.41 g, 23.56 mmol) and N ₂ H ₄ •H ₂ O (662 mg, 12.96 mmol, 98% purity) in one portion. The reaction mixture was heated to 80 °C and stirred for 2 h. The reaction mixture was diluted with H ₂ O (50 mL) and extracted with EtOAc (3 × 20 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 10:1 to 1:2) to give the titled compound. LCMS: m/z = 265.2 [M+H] ⁺ . [0396] tert-butyl 1-(1-methyl-1H-1,2,4-triazol-3-yl)-6-azabicyclo[3.1.1]heptan e-6-carboxylate and tert- butyl 1-(1-methyl-1H-1,2,4-triazol-5-yl)-6-azabicyclo[3.1.1]heptan e-6-carboxylate: To a mixture of tert- butyl 1-(1H-1,2,4-triazol-3-yl)-6-azabicyclo[3.1.1]heptane-6-carbo xylate (300 mg, 1.13 mmol) in DMF (5 mL) at 0 °C under N ₂ was added NaH (54 mg, 1.36 mmol, 60% in mineral oil) in one portion and the reaction mixture was stirred at 0 °C for 30 min. MeI (242 mg, 1.70 mmol) in DMF (1 mL) was added dropwise into the above solution at 0 °C and the reaction mixture was warmed to 20 °C and stirred for 1 h. The reaction mixture was quenched by addition of H ₂ O (20 mL) and extracted with EtOAc (3 × 15 mL). The combined organic layers were washed with brine (3 × 15 mL), dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated under reduced pressure to give the titled compounds. LCMS: m/z = 279.2 [M+H] ⁺ . [0397] 1-(1-methyl-1H-1,2,4-triazol-3-yl)-6-azabicyclo[3.1.1]heptan e trifluoroacetate and 1-(1-methyl- 1H-1,2,4-triazol-5-yl)-6-azabicyclo[3.1.1]heptane trifluoroacetate: To a mixture of tert-butyl 1-(1- methyl-1H-1,2,4-triazol-3-yl)-6-azabicyclo[3.1.1]heptane-6-c arboxylate and tert-butyl 1-(1-methyl-1H- 1,2,4-triazol-5-yl)-6-azabicyclo[3.1.1]heptane-6-carboxylate (330 mg, 1.19 mmol) in DCM (12 mL) at 0°C under N ₂ was added dropwise TFA (4 mL). The mixture was warmed to 20 °C and stirred for 1 h. The reaction mixture was concentrated under reduced pressure to give the titled compounds. LCMS: m/z = 179.2 [M+H] ⁺ . Intermediate 53 trans-1-((2-methoxyethoxy)methyl)-3-methyl-6-azabicyclo[3.1. 1]heptane O [0398] (t ans ( yd o y et y ) 3 et y 6 a ab cyc o[3. . ] epta 6 y)(py d yl)methanone: To a solution of methyl trans-3-methyl-6-picolinoyl-6-azabicyclo[3.1.1]heptane-1- carboxylate (1 g, 3.65 mmol) and CaCl ₂ (1.62 g, 14.58 mmol) in MeOH (30 mL) at 0 °C under N ₂ was added NaBH ₄ (828 mg, 21.87 mmol). The reaction mixture was warmed to 20 °C for 1 h. The reaction mixture was diluted with aq. sat. NH ₄ Cl (30 mL) and extracted with EtOAc (3 × 15 mL). The combined organic layers were washed with brine (2 × 10 mL), dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 3:1 to 1:1) to give the titled compounds. LCMS: m/z = 247.2 [M+H] ⁺ . [0399] (trans-1-((2-methoxyethoxy)methyl)-3-methyl-6-azabicyclo[3.1 .1]heptan-6-yl)(pyridin-2- yl)methanone: To a solution of (trans-1-(hydroxymethyl)-3-methyl-6-azabicyclo[3.1.1]heptan- 6- yl)(pyridin-2-yl)methanone (500 mg, 2.03 mmol) in DMF (10 mL) at 0 °C under N ₂ was added NaH (122 mg, 3.05 mmol, 60% in mineral oil) and the reaction mixture was stirred at 0 °C for 0.5 h.1-Bromo-2- methoxyethane (1.41 g, 10.15 mmol) was added to above mixture at 0 °C and the reaction mixture was heated to 70 °C and stirred for 16 h. The reaction mixture was diluted with aq. sat. NH ₄ Cl (30 mL) and extracted with EtOAc (3 × 15 mL). The combined organic layers were washed with brine (2 × 10 mL), dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 2:1 to 0:1) to give the titled compound. LCMS: m/z = 305.2 [M+H] ⁺ . [0400] trans-1-((2-methoxyethoxy)methyl)-3-methyl-6-azabicyclo[3.1. 1]heptane: To a solution of (trans-1-((2-methoxyethoxy)methyl)-3-methyl-6-azabicyclo[3.1 .1]heptan-6-yl)(pyridin-2-yl)methanone (160 mg, 0.53 mmol) in EtOH (3 mL) at 25 °C was added NaOH (210 mg, 5.26 mmol). The reaction mixture was heated to 90 °C and stirred for 16 h, filtered through a pad of Celite ^{^} and the filtrate was concentrated under reduced pressure. The resulting residue was diluted with DCM (5 mL), filtered through a pad of Celite ^{^} and concentrated under reduced pressure. This workup was repeated three times to give the titled compound. LCMS: m/z = 200.2 [M+H] ⁺ . Intermediate 54 trans-1-(methoxymethyl)-3-methyl-6-azabicyclo[3.1.1]heptane O [ ] ( ( y y y ) y y [ ] p y)(py yl)methanone: To a solution of methyl (trans-1-(hydroxymethyl)-3-methyl-6-azabicyclo[3.1.1]heptan- 6- yl)(pyridin-2-yl)methanone (1.00 g, 3.65 mmol) and CaCl ₂ (1.62 g, 14.58 mmol) in MeOH (30 mL) at 0 °C under N ₂ was added NaBH ₄ (828 mg, 21.87 mmol). The reaction mixture was warmed to 20 °C and stirred for 1 h. The reaction mixture was diluted with aq. sat. NH ₄ Cl (30 mL) and extracted with EtOAc (3 × 15 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 3:1 to 1:1) to give the titled compound. LCMS: m/z = 247.2 [M+H] ⁺ . [0402] (trans-1-(methoxymethyl)-3-methyl-6-azabicyclo[3.1.1]heptan- 6-yl)(pyridin-2- yl)methanone: To a solution of (trans-1-(hydroxymethyl)-3-methyl-6-azabicyclo[3.1.1]heptan- 6- yl)(pyridin-2-yl)methanone (300 mg, 1.22 mmol) in DMF (12 mL) at 0 °C under N ₂ was added NaH (73 mg, 1.83 mmol, 60% in mineral oil) and the reaction mixture was stirred for 0.5 h. MeI (346 mg, 2.44 mmol) was added dropwise to the above mixture at 0 °C and the reaction mixture was warmed to 20 °C and stirred for 2 h. The reaction mixture was diluted with aq. sat. NH ₄ Cl (20 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were washed with brine (2 × 10 mL), dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 3:1 to 1:1) to give the titled compound. LCMS: m/z = 261.2 [M+H] ⁺ . [0403] trans-1-(methoxymethyl)-3-methyl-6-azabicyclo[3.1.1]heptane: To a solution of (trans-1- (methoxymethyl)-3-methyl-6-azabicyclo[3.1.1]heptan-6-yl)(pyr idin-2-yl)methanone (100 mg, 0.38 mmol) in EtOH (2 mL) at 25 °C was added NaOH (154 mg, 3.84 mmol). The reaction mixture was heated to 90 °C and stirred for 16 h. The reaction mixture was filtered through a pad of Celite ^{^} and the filtrate was concentrated under reduced pressure. The resulting residue was slurried with DCM (5 mL), filtered and the filtrate was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 156.3 [M+H] ⁺ . Intermediate 55 [0404] dimethyl 2-(2-bromo-5-fluoro-4-nitrophenyl)malonate and dimethyl 2-(4-bromo-5-fluoro-2- nitrophenyl)malonate: A suspension of NaH (8.07 g, 202 mmol, 60% in mineral oil) in 1,4-dioxane (200 mL) was cooled to 0 °C under N ₂ . A solution of 1-bromo-2,4-difluoro-5-nitro-benzene (20 g, 84.04 mmol) and dimethyl propanedioate (13.32 g, 101 mmol) in 1,4-dioxane (200 mL) was added dropwise to the NaH suspension at 0 °C. The reaction mixture was stirred at 0 °C for 1 h and then warmed to 25 °C and stirred for 15 h. The reaction mixture was poured into aq. sat. NH ₄ Cl (100 mL) and extracted with EtOAc (3 × 30 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 10:1 to 3:1) to give the titled compounds. [0405] 2-(2-bromo-5-fluoro-4-nitro-phenyl)acetic acid and 2-(4-bromo-5-fluoro-2-nitro- phenyl)acetic acid: A solution of dimethyl 2-(2-bromo-5-fluoro-4-nitro-phenyl)propanedioate and dimethyl 2-(4-bromo-5-fluoro-2-nitro-phenyl)propanedioate (23.7 g, 67.70 mmol) in 8 M HCl (337 mL) was heated to 100 °C and stirred for 12 h. The solid was collected by filtration and dried under reduced pressure to give the titled compounds. [0406] 2-(4-bromo-5-fluoro-2-nitro-phenyl)acetamide and 2-(2-bromo-5-fluoro-4-nitro- phenyl)acetamide: To a solution of 2-(2-bromo-5-fluoro-4-nitro-phenyl)acetic acid and 2-(4-bromo-5- fluoro-2-nitro-phenyl)acetic acid (4.56 g, 16.40 mmol) (1:2) in DCM (60 mL) at 0 °C under N ₂ was added DMF (59.94 mg, 0.82 mmol), followed by (COCl)2 (2.50 g, 19.68 mmol) dropwise. The reaction mixture was stirred at 0 °C for 2 h. The reaction mixture was concentrated under reduced pressure. The resulting residue was added to a separate flask at 0 °C in which a solution of ammonia in DCM was previously prepared by bubbling NH _3(g) (6 g, 371 mmol) into DCM (300 mL) at 0 °C for 20 min. The reaction mixture was stirred at 0 °C for 2 h. The reaction mixture was concentrated under reduced pressure and the resulting residue was purified by silica gel column chromatography (PE:EtOAc = 3:1 to 0:1) to give the titled compounds. LCMS: m/z =277.0, 279.0 [M+H] ⁺ . [0407] 2-(4-amino-2-bromo-5-fluorophenyl)acetamide and 2-(2-amino-4-bromo-5- fluorophenyl)acetamide: To a mixture of 2-(2-bromo-5-fluoro-4-nitro-phenyl)acetamide and 2-(4- bromo-5-fluoro-2-nitro-phenyl)acetamide (1:2) (1 g, 3.61 mmol) in EtOH (20 mL) and H ₂ O (5 mL) at 20 °C was added Fe (1.01 g, 18.05 mmol) and NH ₄ Cl (966 mg, 18.05 mmol). The reaction mixture was heated to 80 °C and stirred for 2 h. The mixture was filtered and the filtrate was concentrated under reduced pressure. The resulting residue was diluted with EtOAc (10 mL), washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated and reduced pressure to give the titled compounds. LCMS: m/z =247.1, 249.1 [M+H] ⁺ . [0408] N-(5-bromo-4-(cyanomethyl)-2-fluorophenyl)-2,2,2-trifluoroac etamide and N-(5-bromo-2- (cyanomethyl)-4-fluorophenyl)-2,2,2-trifluoroacetamide: To a mixture of 2-(4-amino-2-bromo-5-fluoro- phenyl)acetamide and 2-(2-amino-4-bromo-5-fluoro-phenyl)acetamide (510 mg, 2.06 mmol) in 1,4- dioxane (10 mL) at 0 °C was added pyridine (1.14 g, 14.45 mmol) and TFAA (2.17 g, 10.32 mmol). The reaction mixture was warmed to 25 °C and stirred for 2 h. The reaction mixture was poured into H ₂ O (20 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were washed with brine (20 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduce pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 10:1 to 3:1) to give the titled compounds. LCMS: m/z = 325.0, 327.0 [M+H] ⁺ . [0409] N-(4-(cyanomethyl)-2-fluoro-5-(4,4,5,5-tetramethyl-1,3,2-dio xaborolan-2-yl)phenyl)-2,2,2- trifluoroacetamide and N-(2-(cyanomethyl)-4-fluoro-5-(4,4,5,5-tetramethyl-1,3,2-dio xaborolan-2- yl)phenyl)-2,2,2-trifluoroacetamide: A mixture of 4,4,5,5-tetramethyl-2-(4,4,5,5-tetramethyl-1,3,2- dioxaborolan-2-yl)-1,3,2-dioxaborolane (572 mg, 2.25 mmol), N-[5-bromo-4-(cyanomethyl)-2-fluoro- phenyl]-2,2,2-trifluoro-acetamide and N-[5-bromo-2-(cyanomethyl)-4-fluoro-phenyl]-2,2,2-trifluoro- acetamide (610 mg, 1.88 mmol), KOAc (553 mg, 5.63 mmol) and Pd(dppf)Cl ₂ (138 mg, 0.19 mmol) in 1,4-dioxane (10 mL) was degassed and purged with N ₂ three times. The reaction mixture was heated to 100 °C and stirred for 6 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 20:1 to 3:1) to give the titled compounds. LCMS: m/z = 373.1 [M+H] ⁺ . [0410] 2-(4-amino-5-fluoro-2-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phe nyl)acetonitrile: A mixture of N- [4-(cyanomethyl)-2-fluoro-5-(4,4,5,5-tetramethyl-1,3,2-dioxa borolan-2-yl)phenyl]-2,2,2-trifluoro- acetamide (260 mg, 0.70 mmol) and N-[2-(cyanomethyl)-4-fluoro-5-(4,4,5,5-tetramethyl-1,3,2- dioxaborolan-2-yl)phenyl]-2,2,2-trifluoro-acetamide, 2-chloropyrrolo[2,1-f][1,2,4]triazine (118 mg, 0.77 mmol), K ₂ CO ₃ (241 mg, 1.75 mmol) and Pd(dppf)Cl ₂ (51 mg, 0.70 mmol) in 1,4-dioxane (5 mL) and H ₂ O (0.5 mL) was degassed and purged with N ₂ three times. The mixture was heated to 100 °C and stirred for 5 h. The reaction mixture was filtered and concentrated under reduced pressure. The resulting residue was purified by prep-TLC (SiO2, PE:EtOAc= 3:1) to give the titled compound. Example 1 N-(2-fluoro-4-methyl-5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)ph enyl)-6-azabicyclo[3.1.1]heptane-6- i (1) [0411] To a solution of N-[2-fluoro-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborol an-2-yl)phenyl]-6- azabicyclo[3.1.1]heptane-6-carboxamide (50 mg, 0.13 mmol) and 2-chloropyrrolo[2,1-f][1,2,4]triazine (31 mg, 0.2 mmol) in 1,4-dioxane (2 mL) and H ₂ O (0.2 mL) was added K ₂ CO ₃ (55 mg, 0.4 mmol) and Pd(dppf)Cl ₂ (10 mg, 0.01 mol) at 25 °C under N ₂ . The mixture was stirred at 100 °C for 12 h. The reaction mixture was diluted with H ₂ O (3 mL) and extracted with EtOAc (3 × 3 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by prep-HPLC to give the titled compound. ¹ H NMR (400 MHz, CDCl3): δ 9.01 (s, 1H), 8.63 (d, J = 8.8 Hz, 1H), 7.84 (s, 1H), 7.01 (d, J = 12 Hz, 1H), 6.97-6.94 (m, 1H), 6.88 (d, J = 4.4 Hz, 1H), 6.19 (br s, 1H), 4.29-4.24 (m, 2H), 2.60-2.52 (m, 1H), 2.49 (s, 3H), 2.45-2.34 (m, 2H), 2.05- 1.90 (m, 1H), 1.82-1.70 (m, 3H), 1.52 (d, J = 8.8 Hz, 1H). LCMS: m/z = 366.2 [M+H] ⁺ . Example 2 cis-N-(5-([124]triazolo[15-a]pyridin-6-yl)-2-fluoro-4-methyl phenyl)-3-methyl-6- [0412] To a solution of cis-N-(2-fluoro-4-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxab orolan-2- yl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxamide (50 mg, 0.13 mmol) in 1,4-dioxane (2 mL) and H ₂ O (0.2 mL) was added 6-bromo-[1,2,4]triazolo[1,5-a]pyridine (31 mg, 0.15 mmol), K ₂ CO ₃ (54 mg, 0.39 mmol) and Pd(dppf)Cl ₂ (9 mg, 0.01 mmol) at 20 °C under N ₂ . The mixture was stirred at 100 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The resulting residue was purified by prep-HPLC and subsequently purified by prep-TLC (SiO2, PE:EtOAc = 2:1) to give the titled compound. ¹ H NMR (400 MHz, CDCl3): δ 8.55 (s, 1H), 8.37 (s, 1H), 8.16 (d, J = 8.4 Hz, 1H), 7.77 (d, J = 9.2 Hz, 1H), 7.51 (dd, J = 1.6, 9.2 Hz, 1H), 7.03 (d, J = 12.0 Hz, 1H), 6.30 (br s, 1H), 4.31-4.21 (m, 2H), 2.71-2.54 (m, 3H), 2.23 (s, 3H), 2.11-1.96 (m, 1H), 1.44-1.31 (m, 2H), 1.10 (d, J = 8.4 Hz, 1H), 1.05 (d, J = 6.8 Hz, 3H). LCMS: m/z = 380.2 [M+H] ⁺ . Example 3 cis-3-methyl-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-y l)phenyl)-6-azabicyclo[3.1.1]heptane-6- carboxamide (3) [ ] y ( y ( , , , y , , yl)phenyl)-6-azabicyclo[3.1.1]heptane-6-carboxamide (50 mg, 0.14 mmol) and 2-chloropyrrolo[2,1- f][1,2,4]triazine (31 mg, 0.20 mmol) in 1,4-dioxane (2 mL) and H ₂ O (0.2 mL) was added K ₂ CO ₃ (56 mg, 0.41 mmol) and Pd(dppf)Cl ₂ (10 mg, 0.01 mmol) at 20 °C under N ₂ . The mixture was stirred at 100 °C for 16 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC to give the titled compound. ¹ H NMR (400 MHz, CDCl3): δ 9.04 (s, 1H), 7.87 (s, 1H), 7.69-7.67 (m, 1H), 7.67-7.63 (m, 1H), 7.24 (s, 1H), 6.99-6.97 (m, 1H), 6.91-6.89 (m, 1H), 6.12 (s, 1H), 4.23-4.19 (m, 2H), 2.65-2.55 (m, 3H), 2.52 (s, 3H), 2.12-2.05 (m, 1H), 1.35 (dd, J = 9.2, 13.6 Hz, 2H), 1.08 (d, J = 8.4 Hz, 1H), 1.04 (d, J = 6.8 Hz, 3H). LCMS: m/z = 362.3 [M+H] ⁺ . Example 4 N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)-6-a zabicyclo[3.1.1]heptane-6-carboxamide (4) [0414] 6- azabicyclo[3.1.1]heptane-6-carboxamide (30 mg, 0.08 mmol) and 2-chloropyrrolo[2,1-f][1,2,4]triazine (19 mg, 0.13 mmol) in 1,4-dioxane (2 mL) and H ₂ O (0.2 mL) was added K ₂ CO ₃ (35 mg, 0.25 mmol) and Pd(dppf)Cl ₂ (6 mg, 0.01 mmol) at 20 °C under N ₂ . The mixture was stirred at 100 °C for 16 h. The reaction mixture was filtered and the filtrate was concentrated under reduced pressure. The residue was purified by prep-HPLC (Waters Xbridge BEH C18100 × 30 mm × 10 μm; mobile phase: A: NH ₄ HCO ₃ in water, B: MeCN; B% in A: 35%-65%, 8 min) to give the titled compound. ¹ H NMR (400 MHz, CDCl3): δ 9.03 (s, 1H), 7.86 (d, J = 0.8 Hz, 1H), 7.69 (d, J = 2.0 Hz, 1H), 7.65 (dd, J = 2.4, 8.4 Hz, 1H), 7.24 (d, J = 8.4 Hz, 1H), 6.99-6.96 (m, 1H), 6.91-6.87 (m, 1H), 6.08 (s, 1H), 4.23 (br d, J = 6.0 Hz, 2H), 2.59-2.53 (m, 1H), 2.52 (s, 3H), 2.45-2.34 (m, 2H), 2.02-1.88 (m, 1H), 1.82-1.69 (m, 3H), 1.50 (d, J = 8.8 Hz, 1H). LCMS: m/z = 348.2 [M+H] ⁺ . [0415] The following compounds were made via similar procedures as those described herein. LCMS Ex. Structure Name NMR (m/z)

LCMS Ex. Structure Name NMR (m/z) ] ⁺ ] ⁺ ] ⁺ LCMS Ex. Structure Name NMR ( /) + ⁺

LCMS E St t N NMR

LCMS Ex. Structure Name NMR (m/z)

LCMS Ex Structure Name NMR

LCMS Ex. Structure Name NMR (m/z) 2 ] ⁺ Example 19 6-((4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)car bamoyl)-6-azabicyclo[3.1.1]heptane-1- carboxylic acid (19） N [0416] To a m ixture of CDI (1.74 g, 10 mmol) in DCM (70 mL) was added a solution of 4-methyl-3- (pyrrolo[2,1-f][1,2,4]triazin-2-yl)aniline (2 g, 8.92 mmol) in DCM (70 mL) at -20 °C under N ₂ . The mixture was stirred at 20 °C for 12 h. Then a solution of DIPEA (3.17 g, 24.50 mmol) and 6- azabicyclo[3.1.1]heptane-1-carboxylic acid (1.98 g, 9.80 mmol) in DCM (20 mL) was added to above solution at 20 °C under N ₂ . The mixture was stirred at 20 °C for 4 h. The reaction was concentrated under reduced pressure and the resulting residue was purified by prep-HPLC (Waters Xbridge BEH C18250 × 70 mm × 10 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 15%-40%, over 18 min) to give the titled compound. ¹ H NMR (400 MHz,CD3OD): δ 9.08 (s, 1H), 7.98 (s, 1H), 7.81 (d, J = 2.0 Hz, 1H), 7.48 (dd, J = 2.0, 8.0 Hz, 1H), 7.24 (d, J = 8.0 Hz, 1H), 7.11-7.01 (m, 2H), 4.11 (br s, 1H), 2.55 (br t, J = 8.4 Hz, 1H), 2.49-2.36 (m, 5H), 2.13-1.95 (m, 2H), 1.78 (d, J = 8.8 Hz, 1H), 1.76-1.63 (m, 2H). LCMS: m/z = 392.2 [M+H] ⁺ . Example 20 N-(4-methyl-3-(pyrrolo[1,2-a]pyrimidin-2-yl)phenyl)-6-azabic yclo[3.1.1]heptane-6-carboxamide (20) N N H NH ₂ N N [0417] rolo[1,2- a]pyri midin-2-yl)aniline (30 mg, 0.13 mmol) in DCM (1 mL) at –20 °C under N ₂ . The mixture was stirred at –20 °C for 3 h before TEA (38 mg, 0.38 mmol) and 6-azabicyclo[3.1.1]heptane (37 mg, 0.38 mmol) were added to the reaction mixture at 20 °C. The mixture was stirred at 50 °C for 12 h. The reaction mixture was concentrated under reduced pressure and the resulting residue was purified by prep- HPLC (Waters Xbridge BEH C18100 × 30 mm × 10 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 25%-55%, 10 min) to give the titled compound. ¹ H NMR (400 MHz, CDCl3): δ 8.20 (d, J = 7.6 Hz, 1H), 7.51 (dd, J = 2.0, 8.0 Hz, 1H), 7.45 (d, J = 2.4 Hz, 1H), 7.24-7.19 (m, 2H), 7.00 (t, J = 3.6 Hz, 1H), 6.72 (d, J = 7.2 Hz, 1H), 6.65 (d, J = 4.0 Hz, 1H), 6.06 (s, 1H), 4.27-4.21 (m, 2H), 2.58- 2.51 (m, 1H), 2.44-2.33 (m, 5H), 2.01-1.89 (m, 1H), 1.78-1.70 (m, 3H), 1.50 (d, J = 8.4 Hz, 1H). LCMS: m/z = 347.2 [M+H] ⁺ . Example 21 N-(3-(7-methoxypyrrolo[2,1-f][1,2,4]triazin-2-yl)-4-methylph enyl)-6-azabicyclo[3.1.1]heptane-6- carboxamide (21) O O [0418] p g ( g, ) ( ) ( mg, 0.79 mmol) and 3-(7-methoxypyrrolo[2,1-f][1,2,4]triazin-2-yl)-4-methylanili ne (100 mg, 0.39 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 1 h before 6-azabicyclo[3.1.1]heptane hydrochloride (63 mg, 0.47 mol) and TEA (80 mg, 0.79 mmol) were added to the above mixture. The mixture was stirred at 20 °C for another 1 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by prep-HPLC (Waters Xbridge Prep OBD C18150 × 40 mm × 10 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN, B in A: 30%-70%, 8 min) to give the titled compound. ¹ H NMR (400 MHz, CDCl ₃ ): δ 8.83 (s, 1H), 7.70 (dd, J = 2.4, 8.0 Hz, 1H), 7.54 (d, J = 2.8 Hz, 1H), 7.21 (d, J = 8.4 Hz, 1H), 6.81 (d, J = 4.8 Hz, 1H), 6.39 (d, J = 4.8 Hz, 1H), 6.06 (s, 1H), 4.21 (br d, J = 6.0 Hz, 2H), 4.14 (s, 3H), 2.57-2.52 (m, 1H), 2.50 (s, 3H), 2.45-2.34 (m, 2H), 1.99-1.87 (m, 1H), 1.81-1.68 (m, 3H), 1.49 (d, J = 8.4 Hz, 1H). LCMS: m/z = 378.2 [M+H] ⁺ . Example 22 N-(3-(7-bromopyrrolo[2,1-f][1,2,4]triazin-2-yl)-4-methylphen yl)-6-azabicyclo[3.1.1]heptane-6- carboxamide (22) Br Br [0419] To se a solution of 3- (7-bromopyrrolo[2,1-f][1,2,4]triazin-2-yl)-4-methylaniline (300 mg, 0.99 mmol) in DCM (10 mL) at –20 °C under N ₂ . The mixture was stirred at 20 °C for 2 h before 6-azabicyclo[3.1.1]heptane (143 mg, 1.47 mmol) and TEA (298 mg, 2.59 mmol) were added. The reaction mixture was stirred at 20 °C for 12 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with DCM (3 × 5 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc =3:1 to 1:1) to give the titled compound. ¹ H NMR (400 MHz, CDCl3): δ 8.97 (s, 1H), 7.83 (d, J = 2.0 Hz, 1H), 7.72 (dd, J = 2.0, 8.0 Hz, 1H), 7.31-7.28 (m, 1H), 7.03 (d, J = 4.8 Hz, 1H), 6.96 (d, J = 4.8 Hz, 1H), 6.13 (br s, 1H), 4.27-4.22 (m, 2H), 2.64 (s, 3H), 2.61-2.52 (m, 1H), 2.47-2.37 (m, 2H), 2.04- 1.91 (m, 1H), 1.84-1.74 (m, 3H), 1.52 (d, J = 8.8 Hz, 1H). LCMS: m/z = 426.1, 428.1 [M+H] ⁺ . Example 23 cis-N-(2-fluoro-4-methyl-5-(pyrrolo[2,1-f][1,2,4]triazin-2-y l)phenyl)-3-methoxy-6- azabicyclo[3.1.1]heptane-6-carboxamide (23) N N O [0420] To a sout o o t p osge e ( 5 g, 0.08 o) (3 ) was added uo o methyl- 5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)aniline (40 mg, 0.17 mmol) and TEA (50 mg, 0.50 mmol) at 0 °C under N ₂ . The mixture was stirred at 0 °C for 3 h before cis-3-methoxy-6-azabicyclo[3.1.1]heptane (26 mg, 0.20 mmol) and TEA (50 mg, 0.50 mmol) were added. The mixture was stirred at 20 °C for 12 h. The reaction mixture was diluted with H ₂ O (0.5 mL) and concentrated under reduced pressure. The residue was purified by prep-HPLC (Waters Xbridge BEH C18100 × 30 mm × 10 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 20%-50%, 8 min) to give the titled compound. ¹ H NMR (400 MHz, CDCl3): δ 9.01 (s, 1H), 8.59 (d, J = 8.8 Hz, 1H), 7.86-7.82 (m, 1H), 7.01 (d, J = 12.0 Hz, 1H), 6.96 (dd, J = 2.8, 4.8 Hz, 1H), 6.88 (dd, J = 1.2, 4.4 Hz, 1H), 6.19 (br s, 1H), 4.25 (br d, J = 6.0 Hz, 2H), 3.79-3.63 (m, 1H), 3.33 (s, 3H), 2.79 (br dd, J = 7.2, 14.8 Hz, 2H), 2.58-2.51 (m, 1H), 2.50 (s, 3H), 1.84 (br dd, J = 1.2, 14.9 Hz, 2H), 1.76 (d, J = 8.8 Hz, 1H). LCMS: m/z = 396.2 [M+H] ⁺ . Example 24 1-(methoxymethyl)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazi n-2-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide (24) N N N To a mixtu of 4-methyl-3- (pyrrolo[2, 1-f][1,2,4]triazin-2-yl)aniline (50 mg, 0.22 mmol) in DCM (2 mL) at –20 C under N ₂ . The mixture was stirred at 20 °C for 2 h before a solution of TEA (45 mg, 0.45 mmol) and 1- (methoxymethyl)-6-azabicyclo[3.1.1]heptane (58 mg, 0.25 mmol) in DCM (1 mL) was added. The reaction mixture was stirred at 20 °C for 12 h. The reaction mixture was concentrated under reduced pressure The residue was purified by prep-HPLC (Phenomenex Luna C1875 × 30 mm × 3 μm; mobile phase: A: 10 mM FA in water, B: MeCN; B% in A: 30%-80%, over 8 min) to give the titled compound. ¹ H NMR (400 MHz, CDCl3): δ 9.02 (s, 1H), 8.78 (br s, 1H), 7.84 (s, 1H), 7.77 (d, J = 2.4 Hz, 1H), 7.58 (dd, J = 2.4, 8.4 Hz, 1H), 7.20 (d, J = 8.4 Hz, 1H), 6.96-6.94 (m, 1H), 6.89-6.84 (m, 1H), 4.26-4.14 (m, 1H), 3.67 (d, J = 10.0 Hz, 1H), 3.52 (s, 3H), 3.47 (d, J = 9.6 Hz, 1H), 2.56-2.44 (m, 5H), 2.08 (t, J = 7.6 Hz, 1H), 1.97-1.85 (m, 1H), 1.78-1.68 (m, 1H), 1.67-1.56 (m, 2H), 1.42 (d, J = 8.4 Hz, 1H). LCMS: m/z = 392.2 [M+H] ⁺ . Example 25 Cis-N-(3-(imidazo[1,2-a]pyrazin-6-yl)-4-methylphenyl)-3-meth yl-6-azabicyclo[3.1.1]heptane-6- carboxamide (25) N N [0421] T 1,2- a]pyrazin-6-yl)-4-methylaniline (600 mg, 2.67 mmol) in DCM (21 mL) at –20 °C under N ₂ . The mixture was stirred at –20 °C for 3 h before cis-3-methyl-6-azabicyclo[3.1.1]heptane (411 mg, 3.69 mmol) and TEA (801 mg, 7.92 mmol) were added. The mixture was stirred at 30 °C for 12 h. The reaction mixture was diluted with H ₂ O (120 mL) and extracted with DCM (3 × 40 mL). The combined organic layers were washed with brine (40 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 1:1 to 0:1) and further slurried with EtOAc to give the titled compound. ¹ H NMR (400 MHz, CDCl ₃ ): δ 9.16 (s, 1H), 8.20 (d, J = 1.6 Hz, 1H), 7.84 (d, J = 2 Hz, 1H), 7.72 (s, 1H), 7.62 (d, J = 2.4 Hz, 1H), 7.30-7.28 (m, 1H), 7.24-7.20 (m, 1H), 6.18 (s, 1H), 4.23-4.20 (m, 2H), 2.65-2.55 (m, 3H), 2.36 (s, 3H), 2.11-2.01 (m, 1H), 1.38-1.32 (m, 2H), 1.08 (d, J = 8.4 Hz, 1H), 1.03 (d, J = 8.8 Hz, 3H). LCMS: m/z = 362.2 [M+H] ⁺ . Example 26 N-(2-fluoro-4-methyl-5-(pyrazolo[1,5-b]pyridazin-6-yl)phenyl )-6-azabicyclo[3.1.1]heptane-6- carboxamide (26) N N [0422] To a so A (29 mg, 0.29 mmol) and a so lution of 2-fluoro-4-methyl-5-(pyrazolo[1,5-b]pyridazin-6-yl)aniline (35 mg, 0.15 mmol) in THF (0.5 mL) and at 0 °C. The mixture was stirred at 20 °C for 1 h before a solution of 6- azabicyclo[3.1.1]heptane hydrochloride (28 mg, 0.22 mmol) was added. The mixture was stirred at 20 °C for 16 h. The reaction mixture was quenched by the addition of H ₂ O (1 mL) and concentrated under reduced pressure. The residue was purified by prep-HPLC (Phenomenex C1875 × 30 mm × 3 μm; mobile phase: mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 25%-65%, over 8 min) to give the titled compound. ¹ H NMR (400 MHz, CDCl3): δ 8.34 (d, J = 8.4 Hz, 1H), 8.05 (d, J = 2.4 Hz, 1H), 7.97 (d, J = 9.2 Hz, 1H), 7.19 (d, J = 9.2 Hz, 1H), 7.03 (d, J = 11.6 Hz, 1H), 6.66 (d, J = 2.4 Hz, 1H), 6.21 (br d, J = 2.0 Hz, 1H), 4.35-4.23 (m, 2H), 2.61-2.53 (m, 1H), 2.44 (s, 3H), 2.42-2.33 (m, 2H), 2.04-1.93 (m, 1H), 1.82-1.74 (m, 3H), 1.53 (d, J = 8.8 Hz, 1H). LCMS: m/z = 366.2 [M+H] ⁺ . Example 27 N-(2-fluoro-5-(imidazo[1,2-a]pyrazin-6-yl)-4-methylphenyl)-6 -azabicyclo[3.1.1]heptane-6- carboxamide (27) [0423] T mg, 0.62 mmol) and 2-fluoro-5-imidazo[1,2-a]pyrazin-6-yl-4-methyl-aniline (50 mg, 0.21 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 1 h before 6-azabicyclo[3.1.1]heptane (60.62 mg, 0.29 mmol) and TEA (62.24 mg, 0.62 mmol) were added. The reaction mixture was stirred at 20 °C for 12 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (Waters Xbridge BEH C18100 × 30 mm × 10 μm; mobile phase: A:10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 25%-45%, 8 min) to give the titled compound. ¹ H NMR (400 MHz, CDCl3) δ 9.13 (d, J = 0.8 Hz, 1H), 8.25 (d, J = 8.4 Hz, 1H), 8.21 (d, J = 1.6 Hz, 1H), 7.84 (d, J = 0.8 Hz, 1H), 7.71 (s, 1H), 7.02 (d, J = 12.0 Hz, 1H), 6.22 (br d, J = 2.4 Hz, 1H), 4.27 (br d, J = 6.2 Hz, 2H), 2.62-2.53 (m, 1H), 2.44-2.33 (m, 5H), 2.03-1.91 (m, 1H), 1.83-1.71 (m, 3H), 1.53 (d, J = 8.8 Hz, 1H). LCMS = 366.2 [M + H] ⁺ . Example 28 N-(3-fluoro-4-methyl-5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)ph enyl)-6-azabicyclo[3.1.1]heptane-6- carboxamide (28) [0424] T o-4- methyl-5-pyrrolo[2,1-f][1,2,4]triazin-2-yl-aniline (50 mg, 0.21 mmol) in DCM (1 mL) at –20 °C. The mixture was stirred at 20 °C for 16 h before a solution of 6-azabicyclo[3.1.1]heptane (30 mg, 0.31 mmol) in DCM (1 mL) and TEA (42 mg, 0.41 mmol) was added. The mixture was stirred at 20 °C for an additional 16 h. The reaction mixture was diluted with H ₂ O (3 mL) and extracted with DCM (3 × 3 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by prep-HPLC (Waters Xbridge Prep OBD C18150 × 40 mm × 10 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 35%-65%, 8 min) to give the titled compound. ¹ H NMR (400 MHz, CDCl ₃ ): δ 9.03 (s, 1H), 7.87 (s, 1H), 7.70-7.66 (m, 1H), 7.37 (s, 1H), 7.01-6.99 (m, 1H), 6.99-6.91 (m, 1H), 6.08 (s, 1H), 4.25-4.23 (m, 2H), 2.58-2.54 (m, 1H), 2.41-2.36 (m, 5H), 2.05-1.95 (m, 1H), 1.78-1.72 (m, 3H), 1.52 (d, J = 8.8 Hz, 1H). LCMS: m/z = 366.2 [M+H] ⁺ . Example 29 phenethyl (4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)carbam ate (29) [0425] To 3- pyrrolo[2,1-f][1,2,4]triazin-2-yl-aniline (200 mg, 0.9 mmol) and TEA (180 mg, 1.78 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 1 h before 2-phenylethanol (109 mg, 0.9 mmol) was added. The mixture was stirred at 20 °C for 1 h. The reaction mixture was concentrated under reduced pressure. The residue was diluted with H ₂ O (5 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by prep-HPLC (column: Waters Xbridge Prep OBD C18150 × 40 mm × 10 μm; mobile phase: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 52%-82%, 8 min) to give the titled compound. ¹ H NMR (400 MHz, CDCl ₃ ): δ 9.03 (s, 1H), 7.87 (s, 1H), 7.75 (s, 1H), 7.47 (br s, 1H), 7.32-7.28 (m, 2H), 7.27-7.23 (m, 4H), 6.99-6.98 (m, 1H), 6.91-6.90 (m, 1H), 6.77 (br s, 1H), 4.41 (t, J = 7.2 Hz, 2H), 3.01 (t, J = 7.2 Hz, 2H), 2.53 (s, 3H). LCMS: m/z = 373.2 [M+H] ⁺ . [0426] The following compounds were made via similar procedures as those described herein. LCMS Ex. Structure Name NMR (m/z) ] ⁺ ] ⁺

LCMS Ex. Structure Name NMR (m/z) + ^{+ +} LCMS Ex. Structure Name NMR (m/z) + ^{+ +} LCMS Ex. Structure Name NMR ( /) 2 ] ⁺ 2 ] ⁺ 2 ] ⁺ LCMS Ex Structure Name NMR ] ⁺ ] ⁺ ] ⁺ LCMS Ex. Structure Name NMR (m/z) LCMS Ex. Structure Name NMR ( /) ] ⁺ ] ⁺ LCMS Ex. Structure Name NMR Examples 52 and 53 (1S,5R)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phe nyl)-1-(pyrimidin-2-yl)-6- azabicyclo[3.1.1]heptane-6-carboxamide (52) and (1R,5S)-N-(4-methyl-3-(pyrrolo[2,1- azabicyclo[3.1.1]heptane 6 carboxamide: To a mixture of 4 methyl 3 (pyrrolo[2,1 f][1,2,4]triazin 2 yl)aniline (100 mg, 0.40 mmol) and triphosgene (66 mg, 0.22 mmol) in THF (2 mL) was added TEA (122 mg, 0.12 mmol) at 0 °C under N ₂ . The reaction solution was stirred at 0 °C for 1 h. Then 1- (pyrimidin-2-yl)-6-azabicyclo[3.1.1]heptane trifluoroacetate (138 mg, 0.48 mmol) and TEA (122 mg, 0.12 mmol) were added to the mixture, the mixture was stirred at 25 °C for 1 h. The reaction mixture was diluted with H ₂ O (5 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by prep-TLC (SiO2, EtOAc) to give the titled compound. LCMS: m/z = 426.3 [M+H] ⁺ . [0428] (1S,5R)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phe nyl)-1-(pyrimidin-2-yl)-6- azabicyclo[3.1.1]heptane-6-carboxamide (52) and (1R,5S)-N-(4-methyl-3-(pyrrolo[2,1- f][1,2,4]triazin-2-yl)phenyl)-1-(pyrimidin-2-yl)-6-azabicycl o[3.1.1]heptane-6-carboxamide (53): The N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)-1-( pyrimidin-2-yl)-6-azabicyclo[3.1.1]heptane- 6-carboxamide was separated by SFC (Chiralcel OZ-3, 250 mm × 30 mm, 5 μm; Mobile phase: A: CO2, B: 0.1% NH3H ₂ O in MeOH; B% in A: 50%-50%, 15 min; Flow rate: 80 g/min; Wavelength: 220 nm; Column temperature: 35 °C; System back pressure: 120 bar) to give Example 52 as the first eluting peak isolated as a single enantiomer. ¹ H NMR (400 MHz, CDCl3): δ 10.87 (br s, 1H), 9.05 (s, 1H), 8.83 (d, J = 5.2 Hz, 2H), 7.93-7.82 (m, 2H), 7.73 (dd, J = 2.4, 8.4 Hz, 1H), 7.32 (t, J = 4.8 Hz, 1H), 7.25 (d, J = 8.4 Hz, 1H), 6.98 (dd, J = 2.4, 4.4 Hz, 1H), 6.90 (dd, J = 1.2, 4.4 Hz, 1H), 4.32-4.23 (m, 1H), 2.86-2.67 (m, 2H), 2.62-2.52 (m, 1H), 2.50 (s, 3H), 2.11-1.95 (m, 3H), 1.94-1.83 (m, 1H), 1.78-1.68 (m, 1H). Further elution provided Example 53 as the second eluting peak isolated as a single enantiomer. ¹ H NMR (400 MHz, CDCl3): δ 10.87 (br s, 1H), 9.05 (s, 1H), 8.83 (d, J = 5.2 Hz, 2H), 7.92-7.81 (m, 2H), 7.73 (dd, J = 2.0, 8.0 Hz, 1H), 7.32 (t, J = 5.2 Hz, 1H), 7.25 (d, J = 8.4 Hz, 1H), 6.98 (dd, J = 2.8, 4.8 Hz, 1H), 6.90 (dd, J = 1.2, 4.4 Hz, 1H), 4.40-4.17 (m, 1H), 2.85-2.66 (m, 2H), 2.61-2.52 (m, 1H), 2.50 (s, 3H), 2.12- 1.96 (m, 3H), 1.94-1.81 (m, 1H), 1.77-1.69 (m, 1H). Examples 54 and 55 1S,4R)-N-(2-fluoro-4-methyl-5-(pyrrolo[2,1-f][1,2,4]triazin- 2-yl)phenyl)-3,4-dihydro-1,4- methanoisoquinoline-2(1H)-carboxamide (54) (1R,4S)-N-(2-fluoro-4-methyl-5-(pyrrolo[2,1-f][1,2,4]triazin -2-yl)phenyl)-3,4-dihydro-1,4- methanoisoquinoline-2(1H)-carboxamide (55) [04 9] N ( uo o et y 5 (py oo[ , f][ , , ]t a y )p e y) 3, d yd o , methanoisoquinoline-2(1H)-carboxamide: To a solution of triphosgene (61.25 mg, 0.21 mmol) in THF (2 mL) was added 2-fluoro-4-methyl-5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)anili ne (100 mg, 0.41 mmol) and TEA (83.54 mg, 0.83 mmol) at 0 °C. The mixture was stirred at 20 °C for 1 h. Then 1,2,3,4- tetrahydro-1,4-methanoisoquinoline (72 mg, 0.49 mmol) and TEA (83.54 mg, 0.83 mmol) were added to the reaction solution. The mixture was stirred at 20 °C for 2 h. The reaction mixture was diluted with H ₂ O (2 mL) and extracted with EtOAc (3 × 2 mL). The combined organic layers were dried over Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by prep-TLC (SiO ₂ , PE:EtOAc = 1:1) to give the titled compound. LCMS: m/z = 414.2 [M+H] ⁺ . [0430] (1S,4R)-N-(2-fluoro-4-methyl-5-(pyrrolo[2,1-f][1,2,4]triazin -2-yl)phenyl)-3,4-dihydro-1,4- methanoisoquinoline-2(1H)-carboxamide (54) and (1R,4S)-N-(2-fluoro-4-methyl-5-(pyrrolo[2,1- f][1,2,4]triazin-2-yl)phenyl)-3,4-dihydro-1,4-methanoisoquin oline-2(1H)-carboxamide (55): The mixture of N-(2-fluoro-4-methyl-5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)ph enyl)-3,4-dihydro-1,4- methanoisoquinoline-2(1H)-carboxamide (130 mg, 0.314 mmol) was purified by SFC (REGIS(s,s) WHELK-O1, 250 mm × 30 mm, 5 μm; Mobile phase: A: CO ₂ , B: 0.1% NH ₃ H ₂ O in EtOH; B% in A: 50%, 15 min; Flow rate: 70 mL/min; Wavelength:220 nm; Column temperature: 35 °C; System back pressure: 120 bar) to give Example 54 as the first eluting isolated as a single enantiomer ¹ H NMR (400 MHz, CDCl3): δ 8.99 (s, 1H), 8.57 (d, J = 8.4 Hz, 1H), 7.83 (s, 1H), 7.35 (dd, J = 6.8, 15.2 Hz, 2H), 7.24- 7.10 (m, 2H), 7.01-6.93 (m, 2H), 6.87 (d, J = 4.8 Hz, 1H), 6.32 (br s, 1H), 5.26 (br s, 1H), 3.84-3.68 (m, 2H), 2.91 (d, J = 7.6 Hz, 1H), 2.47 (s, 3H), 2.12-1.94 (m, 2H). Further elution provided Example 55 as the second eluting peak isolated as a single enantiomer ¹ H NMR (400 MHz, CDCl3): δ 8.99 (s, 1H), 8.57 (d, J = 8.4 Hz, 1H), 7.83 (s, 1H), 7.35 (dd, J = 6.8, 15.2 Hz, 2H), 7.24-7.10 (m, 2H), 7.01-6.93 (m, 2H), 6.87 (d, J = 4.8 Hz, 1H), 6.32 (br s, 1H), 5.26 (br s, 1H), 3.84-3.68 (m, 2H), 2.91 (d, J = 7.6 Hz, 1H), 2.47 (s, 3H), 2.12-1.94 (m, 2H). Example 56 N-(4-methyl-3-(pyrrolo[1,2-a]pyrazin-3-yl)phenyl)bicyclo[2.2 .1]heptane-7-carboxamide (56) N N [0431] To a s idine (1 mL) was ad ded bicyclo[2.2.1]heptane-7-carboxylic acid (23 mg, 0.16 mmol) and EDCI (52 mg, 0.27 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 12 h. The reaction mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC to give the titled compound. ¹ H NMR (400 MHz, CDCl ₃ ): δ 8.87 (s, 1H), 7.94 (s, 1H), 7.61 (s, 1H), 7.48-7.43 (m, 2H), 7.27-7.19 (m, 2H), 6.94-6.91 (m, 1H), 6.84-6.81 (m, 1H), 2.53 (br d, J = 12.0 Hz, 3H), 2.39 (s, 3H), 1.88 (br d, J = 7.6 Hz, 2H), 1.69 (br d, J = 7.2 Hz, 2H), 1.33 (br d, J = 6.8 Hz, 4H). LCMS: m/z = 346.2 [M+H] ⁺ . Example 57 cis-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl) -4- (trifluoromethyl)cyclohexanecarboxamide (57) [0432] and cis- 4-(trifluoromethyl)cyclohexanecarboxylic acid (105 mg, 0.5 mmol) in pyridine (2 mL) was added EDCI (128 mg, 0.67 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 16 h. The reaction mixture was diluted with H ₂ O (2 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by prep-TLC (SiO ₂ , PE:EtOAc = 1:1) and subsequently by prep- HPLC to give the titled compound. ¹ H NMR (400 MHz, DMSO-d ₆ ): δ 9.89 (s, 1H), 9.27 (s, 1H), 8.15- 8.12 (m, 1H), 8.07 (d, J = 2.0 Hz, 1H), 7.61 (dd, J = 2.0, 8.0 Hz, 1H), 7.25 (d, J = 8.4 Hz, 1H), 7.09-7.06 (m, 1H), 7.05-7.02 (m, 1H), 2.65 (m, 1H), 2.44 (s, 3H), 2.39-2.24 (m, 1H), 2.04-1.94 (m, 2H), 1.79-1.56 (m, 6H). LCMS: m/z = 403.1 [M+H] ⁺ . Example 58 and 59 cis-3-cyclopropyl-N-(4-methyl-3-(pyrazolo[1,5-a]pyrazin-6-yl )phenyl)cyclobutanecarboxamide (58) and trans-3-cyclopropyl-N-(4-methyl-3-(pyrazolo[1,5-a]pyrazin-6- yl)phenyl)cyclobutanecarboxamide (59) [ ] y p py ( y (py [ , ]py y )p y ) y To a mixture of 4-methyl-3-(pyrazolo[1,5-a]pyrazin-6-yl)aniline (20 mg, 0.089 mmol) and 3- cyclopropylcyclobutanecarboxylic acid (15 mg, 0.11 mmol) in pyridine (1 mL) was added EDCI (34 mg, 0.179 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 3 h. The reaction mixture was concentrated under reduced pressure and the resulting residue was purified by prep-TLC (SiO2, PE:EtOAc = 1:1) to give the titled compound. LCMS: m/z = 347.2 [M+H] ⁺ . cis-3-cyclopropyl-N-(4-methyl-3-(pyrazolo[1,5-a]pyrazin-6-yl )phenyl)cyclobutanecarboxamide (58) and trans-3-cyclopropyl-N-(4-methyl-3-(pyrazolo[1,5-a]pyrazin-6- yl)phenyl)cyclobutanecarboxamide (59): 3-cyclopropyl-N-(4-methyl-3-(pyrazolo[1,5-a]pyrazin-6- yl)phenyl)cyclobutanecarboxamide was separated by DAICEL CHIRALCEL OD 250 mm × 30 mm, 10 μm; Mobile phase: A: CO2, B: 0.1% NH3H ₂ O in MeOH; B % in A%: 33%-33%, Flow rate: 70 g/min; Wavelength: 220 nm; Column temperature: 35 °C; System back pressure:120 bar, 5 min) to give two peaks: cis-3-cyclopropyl-N-(4-methyl-3-(pyrazolo[1,5-a]pyrazin-6-yl )phenyl)cyclobutanecarboxamide Example 58 (peak 1 in SFC) ¹ H NMR (400 MHz, CDCl ₃ ): δ 9.13 (s, 1H), 8.51 (s, 1H), 8.08 (d, J = 2.4 Hz, 1H), 7.65 (s, 1H), 7.57-7.54 (m, 1H), 7.27-7.25 (m, 1H), 7.10 (br s, 1H), 6.84 (d, J = 2.4 Hz, 1H), 2.94-2.86 (m, 1H), 2.39 (s, 3H), 2.27-2.23 (m, 2H), 2.06-2.03 (m, 2H), 2.01-1.89 (m, 1H), 0.83-0.78 (m, 1H), 0.42-0.36 (m, 2H), 0.13-0.08 (m, 2H) LCMS: m/z = 347.2 [M+H] ⁺ and trans-3-cyclopropyl-N-(4- methyl-3-(pyrazolo[1,5-a]pyrazin-6-yl)phenyl)cyclobutanecarb oxamide Example 59 (peak 2 in SFC) ¹ H NMR (400 MHz, CDCl3): δ 9.13 (s, 1H), 8.51 (s, 1H), 8.08 (d, J = 2.4 Hz, 1H), 7.66 (s, 1H), 7.57-7.54 (m, 1H), 7.28-7.25 (m, 1H), 7.12 (br s, 1H), 6.84 (d, J = 2.4 Hz, 1H), 3.11-3.05 (m, 2H), 2.46-2.41 (m, 2H), 2.39 (s, 3H), 2.06-2.03 (m, 3H), 0.91-0.87 (m, 1H), 0.45-0.41 (m, 2H), 0.12-0.08 (m, 2H). LCMS: m/z = 347.2 [M+H] ⁺ . Examples 60 and 61 cis-N-(3-([1,2,4]triazolo[1,5-a]pyridin-6-yl)-4-methylphenyl )-3-cyclopropylcyclobutanecarboxamide (60) and trans-N-(3-([1,2,4]triazolo[1,5-a]pyridin-6-yl)-4-methylphen yl)-3- cyclopropylcyclobutanecarboxamide (61) cyclopropylcyclobutanecarboxamide: To a mixture of 4-methyl-3-([1,2,4]triazolo[1,5-a]pyridin-6- yl)aniline (95 mg, 0.42 mmol) in pyridine (2 mL) was added 3-cyclopropylcyclobutanecarboxylic acid (50 mg, 0.35 mmol) and EDCI (136 mg, 0.71 mmol) at 20 °C under N ₂ . The mixture was stirred at 20 °C for 2 h. The reaction mixture was diluted with H ₂ O (5 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by prep-TLC (SiO2, PE:EtOAc = 3:1) to give the titled compound as a mixture of diastereomers. LCMS: m/z = 347.2 [M+H] ⁺ . [0435] cis-N-(3-([1,2,4]triazolo[1,5-a]pyridin-6-yl)-4-methylphenyl )-3- cyclopropylcyclobutanecarboxamide (60) and trans-N-(3-([1,2,4]triazolo[1,5-a]pyridin-6-yl)-4- methylphenyl)-3-cyclopropylcyclobutanecarboxamide (61): The mixture of isomers was separated by SFC (REGIS (S,S) WHELK-O1250 mm × 30 mm,10 μm; mobile phase: A:CO2, B: 0.1% NH3H ₂ O in IPA; B % in 28%-28%, 9 min; Flow rate: 70 g/min; Wavelength: 220 nm; Column temperature: 35 °C; System back pressure: 120 bar.) to give cis-N-(3-([1,2,4]triazolo[1,5-a]pyridin-6-yl)-4-methylphenyl )-3- cyclopropylcyclobutanecarboxamide Example 60 (peak 1 in SFC). ¹ H NMR (400 MHz, CDCl3): δ 8.54 (s, 1H), 8.38 (s, 1H), 7.78 (br d, J = 9.2 Hz, 1H), 7.59 (br s, 1H), 7.51 (br d, J = 8.8 Hz, 1H), 7.42 (br d, J = 8.0 Hz, 1H), 7.33 (br s, 1H), 7.25 (br d, J = 5.6 Hz, 1H), 2.97-2.81 (m, 1H), 2.25 (s, 3H), 2.30-2.20 (m, 2H), 2.10-1.98 (m, 2H), 1.97-1.85 (m, 1H), 0.88-0.70 (m, 1H), 0.43-0.32 (m, 2H), 0.12-0.6 (m, 2H) LCMS: m/z = 347.2 [M+H] ⁺ and trans-N-(3-([1,2,4]triazolo[1,5-a]pyridin-6-yl)-4-methylphen yl)-3- cyclopropylcyclobutanecarboxamide Example 61 (peak 2 in SFC). ¹ H NMR (400 MHz, CDCl3): δ 8.53 (s, 1H), 8.38 (br s, 1H), 7.76 (br d, J = 9.2 Hz, 1H), 7.58 (br d, J = 13.2 Hz, 2H), 7.50 (br d, J = 8.8 Hz, 1H), 7.42 (br d, J = 8.0 Hz, 1H), 7.23 (br d, J = 8.0 Hz, 1H), 3.13-3.04 (m, 1H), 2.46-2.37 (m, 2H), 2.24 (s, 3H), 2.11 - 1.97 (m, 3H), 0.90-0.79 (m, 1H), 0.43-0.35 (m, 2H), 0.07 (br d, J = 2.0 Hz, 2H). LCMS: m/z = 347.2 [M+H] ⁺ . [0436] The following compounds were, or can be, made via similar procedures as those described herein. LCMS Ex Structure Name NMR LCMS Ex. Structure Name NMR (m/z)

LCMS Ex. Structure Name NMR (m/z)

LCMS Ex. Structure Name NMR ( /) Example 72 1-cyano-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phe nyl)-6-azabicyclo[3.1.1]heptane-6- carboxamide [0 az abicyclo[3.1.1]heptane 1,6 dicarboxamide (900 mg, 2.31 mmol) in DCM (20 mL) was added TFAA (2.42 g, 11.53 mmol) and TEA (1.17 g, 11.53 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 12 h. The reaction mixture was diluted with H ₂ O (15 mL) and extracted with DCM (2 × 10 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:(EtOAc:EtOH = 3:1) = 1:0 to 1:1) and further purified by prep-HPLC to give the titled compound. 1H NMR (400 MHz, CD3OD): δ 9.10 (s, 1H), 7.98 (s, 1H), 7.82 (d, J = 2.0 Hz, 1H), 7.51 (dd, J = 2.4, 8.4 Hz, 1H), 7.26 (d, J = 8.4 Hz, 1H), 7.08-7.03 (m, 2H), 4.47-4.42 (m, 1H), 2.84-2.73 (m, 2H), 2.45 (s, 3H), 2.31-2.18 (m, 1H), 2.11-1.96 (m, 3H), 1.83-1.71 (m, 2H). LCMS: m/z = 373.1 [M+H] ⁺ . Examples 73 and 74 (1S,3S,5R)-N-(2-fluoro-4-methyl-5-pyrrolo[2,1-f][1,2,4]triaz in-2-ylphenyl)-3-methyl-1-(5-methyl- 1,3,4-oxadiazol-2-yl)-6-azabicyclo[3.1.1]heptane-6-carboxami de and (1R,3R,5S)-N-(2-fluoro-4- methyl-5-pyrrolo[2,1-f][1,2,4]triazin-2-ylphenyl)-3-methyl-1 -(5-methyl-1,3,4-oxadiazol-2-yl)-6- azabicyclo[3.1.1]heptane-6-carboxamide [0438] 1-(2-acetylhydrazinecarbonyl)-N-(2-fluoro-4-methyl-5-(pyrrol o[2,1-f][1,2,4]triazin-2- yl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxamide : To a solution of 6-((2-fluoro-4- methyl-5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)carbamoyl )-3-methyl-6-azabicyclo[3.1.1]heptane-1- carboxylic acid (330 mg, 0.78 mmol) in DMF (5 mL) was added acetylhydrazine (87 mg, 1.17 mmol), DIEA (201 mg, 1.56 mmol) and HATU (593 mg, 1.56 mmol) at 20 °C under N ₂ . The mixture was stirred at 20 °C for 12 h. The reaction mixture was diluted by addition of H ₂ O (15 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:(EtOAc:EtOH = 3:1) = 3:1 to 1:1) to give the titled compound. LCMS: m/z = 480.3 [M+H] ⁺ . [0439] N-(2-fluoro-4-methyl-5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)ph enyl)-3-methyl-1-(5-methyl- 1,3,4-oxadiazol-2-yl)-6-azabicyclo[3.1.1]heptane-6-carboxami de: To a solution of 1-(2- acetylhydrazinecarbonyl)-N-(2-fluoro-4-methyl-5-(pyrrolo[2,1 -f][1,2,4]triazin-2-yl)phenyl)-3-methyl-6- azabicyclo[3.1.1]heptane-6-carboxamide (200 mg, 0.41 mmol) in MeCN (5 mL) was added TsCl (119 mg, 0.63 mmol) and Cs ₂ CO ₃ (544 mg, 1.66 mmol) at 25 °C under N ₂ . The mixture was stirred at 25 °C for 2 h. The reaction mixture was filtered, and the filtrate was concentrated under reduced pressure. The resulting residue was diluted with H ₂ O (5 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (6 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by prep-TLC (SiO2, EtOAc) to give the titled compound as a mixture of enantiomers. LCMS: m/z = 462.3 [M+H] ⁺ . [0440] (1S,3S,5R)-N-(2-fluoro-4-methyl-5-pyrrolo[2,1-f][1,2,4]triaz in-2-ylphenyl)-3-methyl-1-(5- methyl-1,3,4-oxadiazol-2-yl)-6-azabicyclo[3.1.1]heptane-6-ca rboxamide and (1R,3R,5S)-N-(2-fluoro- 4-methyl-5-pyrrolo[2,1-f][1,2,4]triazin-2-ylphenyl)-3-methyl -1-(5-methyl-1,3,4-oxadiazol-2-yl)-6- azabicyclo[3.1.1]heptane-6-carboxamide: The racemic mixture was separated by SFC (DAICEL CHIRALPAK AD (250 mm × 30 mm × 10 μm); mobile phase: A: CO2, B: 0.1% NH3H ₂ O in IPA; B% in A: 50%-50%, 10 min; Flow rate: 70 g/min; Wavelength: 220 nm; Column temperature: 35 °C; System back pressure: 120 bar) to give Example 73 as the first eluting peak isolated as a single enantiomer. ¹ H NMR (400 MHz, CDCl ₃ ): δ 9.01 (s, 1H), 8.55 (d, J = 8.4 Hz, 1H), 7.98-7.87 (m, 1H), 7.86-7.83 (m, 1H), 7.01 (d, J = 11.6 Hz, 1H), 6.96 (dd, J = 2.4, 4.4 Hz, 1H), 6.89-6.87 (m, J = 1.6, 4.8 Hz, 1H), 4.35-4.33 (m, 1H), 2.73-2.67 (m, 1H), 2.58 (s, 3H), 2.48 (s, 3H), 2.46-2.40 (m, 1H), 2.37-2.31 (m, 2H), 2.24-2.18 (m, 1H), 2.15 (d, J = 8.8 Hz, 1H), 1.96 (ddd, J = 3.2, 8.0, 14.4 Hz, 1H), 1.07 (d, J = 6.8 Hz, 3H). Further elution provided Example 74 as the second eluting peak isolated as a single enantiomer. ¹ H NMR (400 MHz, CDCl3): δ 9.01 (s, 1H), 8.55 (d, J = 8.4 Hz, 1H), 7.99-7.87 (m, 1H), 7.84-7.83 (m, 1H), 7.01 (d, J = 11.6 Hz, 1H), 6.96 (dd, J = 2.4, 4.4 Hz, 1H), 6.89-6.87 (m, 1H), 4.35-4.33 (m, 1H), 2.71-2.68 (m, 1H), 2.58 (s, 3H), 2.48 (s, 3H), 2.46-2.39 (m, 1H), 2.37-2.31 (m, 2H), 2.24-2.18 (m, 1H), 2.15 (d, J = 8.4 Hz, 1H), 1.96 (ddd, J = 3.2, 8.0, 14.4 Hz, 1H), 1.06 (d, J = 6.8 Hz, 3H). Example 75 1-(hydroxymethyl)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazi n-2-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide azabicyclo[3.1.1]heptane-1-carboxylate: To a mixture of 6-((4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2- yl)phenyl)carbamoyl)-6-azabicyclo[3.1.1]heptane-1-carboxylic acid (200 mg, 0.51 mmol) in THF (3 mL) and MeOH (1 mL) was added dropwise TMSCHN ₂ (2 M, 0.51 mL) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 2 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (2 × 10 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 1:0 to 1:1) to give the titled compound. LCMS: m/z = 406.2 [M+H] ⁺ . [0442] N-(3-(3,4-dihydropyrrolo[2,1-f][1,2,4]triazin-2-yl)-4-methyl phenyl)-1-(hydroxymethyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide: To a mixture of methyl 6-((4-methyl-3-(pyrrolo[2,1- f][1,2,4]triazin-2-yl)phenyl)carbamoyl)-6-azabicyclo[3.1.1]h eptane-1-carboxylate (190 mg, 0.49 mmol) in MeOH (5 mL) was added CaCl ₂ (219 mg, 1.97 mmol) and NaBH ₄ (112 mg, 2.96 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 2 h. The reaction mixture was quenched by the addition of aq. sat. NH ₄ Cl (10 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to give the titled compound. LCMS: m/z = 380.2 [M+H] ⁺ . [0443] 1-(hydroxymethyl)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazi n-2-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide (75): To a mixture of N-(3-(3,4-dihydropyrrolo[2,1- f][1,2,4]triazin-2-yl)-4-methylphenyl)-1-(hydroxymethyl)-6-a zabicyclo[3.1.1]heptane-6-carboxamide (20 mg, 0.053 mmol) in DCM (1 mL) was added MnO ₂ (46 mg, 0.53 mmol) at 20 °C. The mixture was stirred at 30 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The residue was purified by prep-HPLC to give the titled compound. ¹ H NMR (400 MHz, CDCl3): δ 9.03 (s, 1H), 7.86 (s, 1H), 7.70 (d, J = 2.0 Hz, 1H), 7.59 (dd, J = 2.0, 8.4 Hz, 1H), 7.23 (br d, J = 8.4 Hz, 1H), 6.97 (dd, J = 2.4, 4.4 Hz, 1H), 6.89 (d, J = 4.4 Hz, 1H), 4.24-4.17 (m, 1H), 3.80 (br d, J = 10.8 Hz, 1H), 3.64-3.53 (m, 1H), 2.70-2.60 (m, 1H), 2.51 (s, 3H), 2.32 (br s, 1H), 2.21-2.10 (m, 1H), 2.05-1.93 (m, 1H), 1.84-1.69 (m, 2H), 1.65 (m, 1H), 1.49 (br d, J = 8.4 Hz, 1H). LCMS: m/z = 378.2 [M+H] ⁺ . Example 76 N-(4-methyl-3-(7-methylpyrrolo[2,1-f][1,2,4]triazin-2-yl)phe nyl)-6-azabicyclo[3.1.1]heptane-6- b id [ 0 ] o a sout o o N (3 (7 b o opy o o[ , f][ , , ]t a y) et y p e y) 6 azabicyclo[3.1.1]heptane-6-carboxamide (50 mg, 0.12 mmol) in 1,4-dioxane (2 mL) and H ₂ O (0.2 mL) was added 2,4,6-trimethyl-1,3,5,2,4,6-trioxatriborinane (147 mg, 0.58 mmol, 3.5 M in THF, 50% purity), K ₂ CO ₃ (32 mg, 0.23 mmol) and Pd(dppf)Cl ₂ (9 mg, 0.01 mmol) at 20 °C under N ₂ . The mixture was stirred at 100 °C for 12 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The residue was purified by prep-HPLC (Phenomenex C1880 mm × 40 mm × 30 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water; B: MeCN; B% in A: 35%-55%, over 8 min) to give the titled compound. ¹ H NMR (400 MHz, CDCl3): δ 8.94 (s, 1H), 7.74 (d, J = 2.0 Hz, 1H), 7.69 (dd, J = 2.0, 8.0 Hz, 1H), 7.26-7.24 (m, 1H), 6.85 (d, J = 4.0 Hz, 1H), 6.79 (d, J = 4.0 Hz, 1H), 6.09 (s, 1H), 4.25-4.22 (m, 2H), 2.63 (s, 3H), 2.58 (s, 3H), 2.57-2.51 (m, 1H), 2.45-2.35 (m, 2H), 2.00-1.91 (m, 1H), 1.82-1.71 (m, 3H), 1.50 (d, J = 8.8 Hz, 1H). LCMS: m/z = 362.1 [M+H] ⁺ . Examples 77 and 78 (1S,5R)-1-(5-methyl-1,3,4-oxadiazol-2-yl)-N-(4-methyl-3-(pyr rolo[1,2-a]pyrimidin-3-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide and (1R,5S)-1-(5-methyl-1,3,4-oxadiazol-2-yl)-N-(4- methyl-3-(pyrrolo[1,2-a]pyrimidin-3-yl)phenyl)-6-azabicyclo[ 3.1.1]heptane-6-carboxamide N N [0445] 1-(2-acetylhydrazinecarbonyl)-N-(4-methyl-3-(pyrrolo[1,2-a]p yrimidin-3-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide: To a solution of acetylhydrazine (199 mg, 2.69 mmol) in DMF (5 mL) was added 6-((4-methyl-3-(pyrrolo[1,2-a]pyrimidin-3-yl)phenyl)carbamoy l)-6- azabicyclo[3.1.1]heptane-1-carboxylic acid (700 mg, 1.79 mmol), DIPEA (463 mg, 3.59 mmol) and HATU (1.36 g, 3.59 mmol) at 20 °C under N ₂ . The mixture was stirred at 20 °C for 12 h. The reaction mixture was diluted with H ₂ O (15 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:(EtOAc:EtOH = 3:1) = 3:1 to 1:1) to give the titled compound. LCMS: m/z = 447.3 [M+H] ⁺ . [0446] 1-(5-methyl-1,3,4-oxadiazol-2-yl)-N-(4-methyl-3-(pyrrolo[1,2 -a]pyrimidin-3-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide: To a solution of 1-(2-acetylhydrazinecarbonyl)-N-(4-methyl- 3-(pyrrolo[1,2-a]pyrimidin-3-yl)phenyl)-6-azabicyclo[3.1.1]h eptane-6-carboxamide (300 mg, 0.67 mmol) in MeCN (5 mL) was added TsCl (192 mg, 1.01 mmol) and Cs ₂ CO ₃ (876 mg, 2.69 mmol) at 25 °C under N ₂ . The mixture was stirred at 25 °C for 2 h. The reaction mixture was filtered through a celite pad and the filtrate was concentrated under reduced pressure. The resulting residue was diluted with H ₂ O (5 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (PE:EtOAc = 1:1 to 0:1) to give the titled compound as a mixture of enantiomers. LCMS: m/z = 429.2 [M+H] ⁺ . [0447] (1S,5R)-1-(5-methyl-1,3,4-oxadiazol-2-yl)-N-(4-methyl-3-(pyr rolo[1,2-a]pyrimidin-3- yl)phenyl)-6-azabicyclo[3.1.1]heptane-6-carboxamide and (1R,5S)-1-(5-methyl-1,3,4-oxadiazol-2- yl)-N-(4-methyl-3-(pyrrolo[1,2-a]pyrimidin-3-yl)phenyl)-6-az abicyclo[3.1.1]heptane-6- carboxamide: The racemate was separated by SFC (DAICEL CHIRALCEL OJ (250 mm × 30 mm × 10 μm); Mobile phase: A: CO ₂ , B: 0.1% NH ₃ H ₂ O in EtOH; B% in A: 45%-45%, 7 min; Flow rate: 70 g/min; Wavelength: 220 nm; Column temperature: 40 °C; System back pressure: 100 bar) to give Example 77 as the first eluting peak isolated as a single enantiomer. ¹ H NMR (400 MHz, CDCl ₃ ): δ 8.47 (s, 1H), 8.15 (d, J = 1.2 Hz, 1H), 8.11 (d, J = 2.0 Hz, 1H), 7.49 (d, J = 2.0 Hz, 1H), 7.41 (dd, J = 2.0, 8.0 Hz, 1H), 7.25- 7.20 (m, 2H), 7.02-6.90 (m, 1H), 6.66 (d, J = 4.0 Hz, 1H), 4.36-4.33 (m, 1H), 2.87-2.81 (m, 1H), 2.72- 2.62 (m, 2H), 2.58 (s, 3H), 2.28 (s, 3H), 2.14-2.02 (m, 2H), 1.96-1.88 (m, 2H), 1.83-1.69 (m, 1H). Further elution provided Example 78 as the second eluting peak isolated as a single enantiomer. ¹ H NMR (400 MHz, CDCl3): δ 8.57-8.37 (m, 1H), 8.15 (dd, J = 0.8, 2.0 Hz, 1H), 8.11 (d, J = 2.0 Hz, 1H), 7.49 (d, J = 2.4 Hz, 1H), 7.41 (dd, J = 2.0, 8.0 Hz, 1H), 7.24-7.20 (m, 2H), 7.00 (dd, J = 2.8, 4.0 Hz, 1H), 6.67 (d, J = 4.0 Hz, 1H), 4.39-4.30 (m, 1H), 2.90-2.81 (m, 1H), 2.73-2.61 (m, 2H), 2.58 (s, 3H), 2.28 (s, 3H), 2.14-2.02 (m, 2H), 1.97-1.86 (m, 2H), 1.79-1.71 (m, 1H). Example 79 (1R,3R,5R)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl) phenyl)-2-(pyrimidin-2-yl)-2- azabicyclo[3.1.0]hexane-3-carboxamide [ azabicyclo[3.1.0]hexane-3-carboxamide hydrochloride (200 mg, 0.54 mmol) and 2-chloropyrimidine (62 mg, 0.54 mmol) in DMF (2 mL) was added K ₂ CO ₃ (224 mg, 1.62 mmol) at 20 °C. The mixture was stirred at 80 °C for 16 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (3 × 5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by prep- HPLC (Waters Xbridge 150 × 25 mm × 5 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 25%-65%, over 8 min) to give the titled compound. ¹ H NMR (400 MHz, CDCl3): δ 9.25 (s, 1H), 9.02 (s, 1H), 8.38 (d, J = 4.8 Hz, 2H), 7.85 (d, J = 1.2 Hz, 1H), 7.76 (d, J = 2.4 Hz, 1H), 7.61 (dd, J = 2.4, 8.4 Hz, 1H), 7.23 (d, J = 8.4 Hz, 1H), 6.97 (dd, J = 2.4, 6.8 Hz, 1H), 6.89 (dd, J = 1.6, 4.8 Hz, 1H), 6.61 (t, J = 4.8 Hz, 1H), 5.08 (dd, J = 2.4, 10.4 Hz, 1H), 4.35-4.29 (m, 1H), 2.78 (dd, J = 2.0, 13.2 Hz, 1H), 2.50 (s, 3H), 2.45-2.35 (m, 1H), 1.69-1.61 (m, 1H), 0.92-0.84 (m, 2H). LCMS: m/z = 412.2 [M+H] ⁺ . Example 80 (1S,3S,5S)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl) phenyl)-2-(pyrimidin-2-yl)-2- azabicyclo[3.1.0]hexane-3-carboxamide [0449] pyrrolo[2,1-f][1,2,4]triazin-2-yl-phenyl)-2-azabicyclo[3.1.0 ]hexane-3-carboxamide hydrochloride (150 mg, 0.41 mmol) in DMF (2 mL) was added K ₂ CO ₃ (168 mg, 1.22 mmol) at 20 °C. The mixture was stirred at 80 °C for 16 h. The reaction mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (3 × 5 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by prep-HPLC (Phenomenex C1875 × 30 mm × 3 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B% in A: 30%-60%, over 8 min) to give the titled compound. ¹ H NMR (400 MHz, CDCl ₃ ): δ 9.25 (s, 1H), 9.02 (s, 1H), 8.38 (d, J = 4.8 Hz, 2H), 7.85 (d, J = 1.2 Hz, 1H), 7.76 (d, J = 2.4 Hz, 1H), 7.61 (dd, J = 2.4, 8.0 Hz, 1H), 7.23 (d, J = 8.4 Hz, 1H), 6.97 (dd, J = 2.4, 6.8 Hz, 1H), 6.91-6.86 (m, 1H), 6.61 (t, J = 4.8 Hz, 1H), 5.08 (dd, J = 2.0, 10.4 Hz, 1H), 4.35-4.29 (m, 1H), 2.78 (dd, J = 2.4, 13.2 Hz, 1H), 2.50 (s, 3H), 2.45-2.35 (m, 1H), 1.69-1.61 (m, 1H), 0.92-0.84 (m, 2H). LCMS: m/z = 412.2 [M+H] ⁺ . Examples 81 and 82 (1S,3S,5R)-N-(4-chloro-2-fluoro-5-(pyrrolo[2,1-f][1,2,4]tria zin-2-yl)phenyl)-3-methyl-1-(5-methyl- 1,3,4-oxadiazol-2-yl)-6-azabicyclo[3.1.1]heptane-6-carboxami de and (1R,3R,5S)-N-(4-chloro-2- fluoro-5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)-3-methyl -1-(5-methyl-1,3,4-oxadiazol-2-yl)-6- [0450] 1-(2-acetylhydrazinecarbonyl)-N-(4-chloro-2-fluoro-5-(pyrrol o[2,1-f][1,2,4]triazin-2- yl)phenyl)-3-methyl-6-azabicyclo[3.1.1]heptane-6-carboxamide : To a solution of 6-((4-chloro-2- fluoro-5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)carbamoyl )-3-methyl-6-azabicyclo[3.1.1]heptane-1- carboxylic acid (200 mg, 0.45 mmol) in DMF (5 mL) was added acetylhydrazine (50 mg, 0.68 mmol) , DIEA (116 mg, 0.90 mmol) and HATU (343 mg, 0.90 mmol) at 0 °C under N ₂ . The mixture was stirred at 20 °C for 2 h. The reaction mixture was diluted with H ₂ O (20 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were washed with brine (15 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc =5:1 to 3:1) to give the titled compound. LCMS: m/z = 500.2 [M+H] ⁺ . [0451] N-(4-chloro-2-fluoro-5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)ph enyl)-3-methyl-1-(5-methyl-1,3,4- oxadiazol-2-yl)-6-azabicyclo[3.1.1]heptane-6-carboxamide: To a solution of 1-(2- acetylhydrazinecarbonyl)-N-(4-chloro-2-fluoro-5-(pyrrolo[2,1 -f][1,2,4]triazin-2-yl)phenyl)-3-methyl-6- azabicyclo[3.1.1]heptane-6-carboxamide (150 mg, 0.30 mmol) in MeCN (5 mL) was added TsCl (86 mg, 0.45 mmol) and Cs ₂ CO ₃ at 20 °C under N ₂ . The mixture was stirred at 20 °C for 2 h. The reaction mixture was diluted with H ₂ O (20 mL) and extracted with EtOAc (3 × 10 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by prep-HPLC (column: Waters Xbridge BEH C18100 × 30 mm × 10 μm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water; B: MeCN; B% in A: 40%-70%, over 8 min) to give the titled compound as a mixture of enantiomers. LCMS: m/z = 482.0 [M+H] ⁺ . [0452] (1S,3S,5R)-N-(4-chloro-2-fluoro-5-(pyrrolo[2,1-f][1,2,4]tria zin-2-yl)phenyl)-3-methyl-1-(5- methyl-1,3,4-oxadiazol-2-yl)-6-azabicyclo[3.1.1]heptane-6-ca rboxamide and (1R,3R,5S)-N-(4- chloro-2-fluoro-5-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl) -3-methyl-1-(5-methyl-1,3,4-oxadiazol-2- yl)-6-azabicyclo[3.1.1]heptane-6-carboxamide: The mixture of enantiomers was purified by SFC (DAICEL CHIRALCEL OD (250 mm × 30 mm × 10 μm); Mobile phase: A: CO2, B: 0.1% NH3H ₂ O in EtOH; B% in A: 50%-50%, 12 min; Flow rate: 70 mL/min; Wavelength: 220 nm; Column temperature: 35 °C; System back pressure: 100 bar) to give Example 81 as the first eluting peak isolated as a single enantiomer. ¹ H NMR (400 MHz, CDCl ₃ ): δ 9.03 (s, 1H), 8.65 (d, J = 8.4 Hz, 1H), 8.40 (br s, 1H), 7.88 (s, 1H), 7.27-7.25 (m, 1H), 7.00 (dd, J = 2.4, 4.8 Hz, 1H), 6.91 (dd, J = 1.2, 4.8 Hz, 1H), 4.36-4.33 (m, 1H), 2.68 (t, J = 7.2 Hz, 1H), 2.59 (s, 3H), 2.50-2.39 (m, 1H), 2.37-2.30 (m, 1H), 2.27-2.19 (m, 2H), 2.17 (d, J = 8.4 Hz, 1H), 2.01-1.93 (m, 1H), 1.06 (d, J = 6.8 Hz, 3H). Further elution provided Example 82 as the second eluting peak isolated as a single enantiomer. ¹ H NMR(400 MHz, CDCl3): δ 9.03 (s, 1H), 8.65 (d, J = 8.4 Hz, 1H), 8.40 (br s, 1H), 7.88 (s, 1H), 7.27-7.25 (m, 1H), 7.00 (dd, J = 2.4, 4.8 Hz, 1H), 6.91 (d, J = 4.4 Hz, 1H), 4.36-4.33 (m, 1H), 2.68 (br t, J = 7.2 Hz, 1H), 2.59 (s, 3H), 2.49-2.39 (m, 1H), 2.38-2.30 (m, 1H), 2.28-2.18 (m, 2H), 2.17 (d, J = 8.4 Hz, 1H), 2.01-1.93 (m, 1H), 1.06 (d, J = 6.8 Hz, 3H). Examples 83 and 84 (1S,3S,5R)-3-methyl-1-(3-methyl-1,2,4-oxadiazol-5-yl)-N-(4-m ethyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2- yl)phenyl)-6-azabicyclo[3.1.1]heptane-6-carboxamide and (1R,3R,5S)-3-methyl-1-(3-methyl-1,2,4- oxadiazol-5-yl)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin- 2-yl)phenyl)-6-azabicyclo[3.1.1]heptane- [0453] 3-methyl-1-(3-methyl-1,2,4-oxadiazol-5-yl)-N-(4-methyl-3-(py rrolo[2,1-f][1,2,4]triazin-2- yl)phenyl)-6-azabicyclo[3.1.1]heptane-6-carboxamide: To a solution of 3-methyl-6-((4-methyl-3- (pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)carbamoyl)-6-azabi cyclo[3.1.1]heptane-1-carboxylic acid (300 mg, 0.74 mmol) in DMF (3 mL) was added hydroxyacetimidamide (82 mg, 1.11 mmol), TEA (225 mg, 2.22 mmol) and T3P (1.4 g, 2.22 mmol,50% purity in EtOAc) at 20 °C under N ₂ . The mixture was stirred at 90 °C for 12 h. The mixture was diluted with H ₂ O (10 mL) and extracted with EtOAc (3 × 5 mL). The combined organic layers were washed with brine (10 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The resulting residue was purified by prep-TLC (SiO2, PE:EtOAc = 1:1) to give the titled compound as a mixture of enantiomers. LCMS: m/z = 444.1 [M+H] ⁺ . [0454] (1S,3S,5R)-3-methyl-1-(3-methyl-1,2,4-oxadiazol-5-yl)-N-(4-m ethyl-3-(pyrrolo[2,1- f][1,2,4]triazin-2-yl)phenyl)-6-azabicyclo[3.1.1]heptane-6-c arboxamide and (1R,3R,5S)-3-methyl-1- (3-methyl-1,2,4-oxadiazol-5-yl)-N-(4-methyl-3-(pyrrolo[2,1-f ][1,2,4]triazin-2-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide:The racemate was separated by SFC (250 mm × 30 mm × 10 μm; mobile phase: A: CO ₂ , B: 0.1% NH ₃ H ₂ O in IPA; B% in A: 46%-46%, 11 min; Flow rate: 70 g/min; Wavelength: 220 nm; Column temperature: 35 °C; System back pressure: 120 bar) to give Example 83 as the first eluting peak isolated as a single enantiomer. ¹ H NMR (400 MHz, CDCl3): δ 9.04 (s, 1H), 8.75 (br s, 1H), 7.86 (s, 1H), 7.83 (d, J = 2.0 Hz, 1H), 7.61 (dd, J = 2.0, 8.0 Hz, 1H), 7.25 (d, J = 8.4 Hz, 1H), 6.99-6.95 (m, 1H), 6.89 (d, J = 4.0 Hz, 1H), 4.35-4.27 (m, 1H), 2.74-2.65 (m, 1H), 2.51 (s, 3H), 2.48 (s, 3H), 2.46-2.39 (m, 1H), 2.32-2.27 (m, 1H), 2.26-2.17 (m, 3H), 1.97-1.90 (m, 1H), 1.04 (d, J = 6.4 Hz, 3H). Further elution provided Example 84 as the second eluting peak isolated as a single enantiomer. ¹ H NMR (400 MHz, CDCl ₃ ): δ 9.04 (s, 1H), 8.75 (br s, 1H), 7.86 (s, 1H), 7.83 (d, J = 2.4 Hz, 1H), 7.61 (dd, J = 2.4, 8.4 Hz, 1H), 7.24 (d, J = 8.0 Hz, 1H), 6.96-6.95 (m, 1H), 6.89 (dd, J = 1.2, 4.4 Hz, 1H), 4.36- 4.28 (m, 1H), 2.73-2.66 (m, 1H), 2.51 (s, 3H), 2.48 (s, 3H), 2.46-2.37 (m, 1H), 2.33-2.26 (m, 1H), 2.26- 2.17 (m, 3H), 1.96-1.90 (m, 1H), 1.04 (d, J = 6.8 Hz, 3H). Example 85 (1R,3R,5R)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl) phenyl)-2-(pyridin-2-yl)-2- azabicyclo[3.1.0]hexane-3-carboxamide Cl [0455] tert-butyl (1R,3R,5R)-3-((4-methoxybenzyl)(4-methyl-3-(pyrrolo[2,1-f][1 ,2,4]triazin-2- yl)phenyl)carbamoyl)-2-azabicyclo[3.1.0]hexane-2-carboxylate : To a solution of tert-butyl (1R,3R,5R)-3-((4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl )phenyl)carbamoyl)-2- azabicyclo[3.1.0]hexane-2-carboxylate (1.5 g, 3.46 mmol) in DMF (20 mL) at 0 °C under N ₂ was added NaH (166 mg, 4.15 mmol, 60% in mineral oil) and the reaction mixture was stirred at 0 °C for 1 h. PMBCl (813 mg, 5.19 mmol) was added to the reaction mixture at 0 °C and the reaction mixture was warmed to 25 °C and stirred for 12 h. The reaction mixture was poured into aq. sat. NH ₄ Cl (20 mL) and extracted with EtOAc (3 × 20 mL). The combined organic layers were washed with brine (2 × 20 mL), dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 3:1 to 1:1) to give the titled compound. LCMS: m/z = 554.3 [M+H] ⁺ . [0456] (1R,3R,5R)-N-(4-methoxybenzyl)-N-(4-methyl-3-(pyrrolo[2,1-f] [1,2,4]triazin-2-yl)phenyl)-2- azabicyclo[3.1.0]hexane-3-carboxamide hydrochloride: A solution of tert-butyl (1R,3R,5R)-3-((4- methoxybenzyl)(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl )phenyl)carbamoyl)-2- azabicyclo[3.1.0]hexane-2-carboxylate (1.8 g, 3.25 mmol) in HCl/EtOAc (20 mL, 4 M) was stirred at 25 °C for 1 h. The reaction mixture was concentrated under reduced pressure to give the titled compound. LCMS: m/z = 454.2 [M+H] ⁺ . [0457] (1R,3R,5R)-N-(4-methoxybenzyl)-N-(4-methyl-3-(pyrrolo[2,1-f] [1,2,4]triazin-2-yl)phenyl)-2- (pyridin-2-yl)-2-azabicyclo[3.1.0]hexane-3-carboxamide: To a mixture of (1R,3R,5R)-N-(4- methoxybenzyl)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2 -yl)phenyl)-2-azabicyclo[3.1.0]hexane-3- carboxamide hydrochloride (500 mg, 1.02 mmol) and 2-bromopyridine (483 mg, 3.06 mmol) in toluene (15 mL) at 20 °C under N ₂ was added Pd ₂ (dba) ₃ (93 mg, 0.1 mmol), t-BuONa (490 mg, 5.10 mmol) and SPhos (83 mg, 0.2 mmol). The reaction mixture was heated to 110 °C and stirred for 12 h. The reaction mixture was concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (PE:EtOAc = 3:1 to 1:3) to give the titled compound. LCMS: m/z = 531.3 [M+H] ⁺ . [0458] (1R,3R,5R)-N-(4-methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl) phenyl)-2-(pyridin-2-yl)-2- azabicyclo[3.1.0]hexane-3-carboxamide (85): To a solution of (1R,3R,5R)-N-(4-methoxybenzyl)-N-(4- methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)-2-(pyrid in-2-yl)-2-azabicyclo[3.1.0]hexane-3- carboxamide (140 mg, 0.26 mmol) in DCM (2 mL) at 25 °C was added TFA (2.87 g, 25.21 mmol) and trifluoromethanesulfonic acid (18.67 mg, 0.12 mmol) and the reaction mixture was stirred for 2 h. The reaction mixture was concentrated under reduced pressure and the resulting residue was purified by prep- HPLC (column: Waters Xbridge BEH C18100 × 30 mm × 10 µm; mobile phase: A: 10 mM NH ₄ HCO ₃ in water, B: MeCN; B in A: 35%-75% over 8 min) to give the titled compound. LCMS: m/z = 411.2 [M+H] ⁺ . [0459] The following compounds were, or can be, made via similar procedures as those described herein. Separation conditions are provided as follows: Examples 86 and 87 (1R,3R,5S)-1-(methoxymethyl)-3-methyl-N-(4-methyl-3-(pyrazol o[1,5-a]pyrazin-6-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide and (1S,3S,5R)-1-(methoxymethyl)-3-methyl-N-(4-methyl- 3-(pyrazolo[1,5-a]pyrazin-6-yl)phenyl)-6-azabicyclo[3.1.1]he ptane-6-carboxamide mm × 10 μm; Mobile phase: A: CO ₂ , B: 0.1% NH ₃ H ₂ O in MeOH; B% in A: 20%-20%, 10 min; Flow rate: 70 g/min; Wavelength: 220 nm; Column temperature: 40 °C; System back pressure: 100 bar) to give trans-1-(methoxymethyl)-3-methyl-N-(4-methyl-3-(pyrazolo[1,5 -a]pyrazin-6-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide (Peak 1 in SFC) as Example 86 and trans-1-(methoxymethyl)- 3-methyl-N-(4-methyl-3-(pyrazolo[1,5-a]pyrazin-6-yl)phenyl)- 6-azabicyclo[3.1.1]heptane-6- carboxamide (Peak 2 in SFC) as Example 87. LCMS: m/z = 406.0 [M+H] ⁺ . Examples 88 and 89 (1R,3R,5S)-1-((2-methoxyethoxy)methyl)-3-methyl-N-(4-methyl- 3-(pyrazolo[1,5-a]pyrazin-6- yl)phenyl)-6-azabicyclo[3.1.1]heptane-6-carboxamide and (1S,3S,5R)-1-((2- methoxyethoxy)methyl)-3-methyl-N-(4-methyl-3-(pyrazolo[1,5-a ]pyrazin-6-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide [0461] The mixture of enantiomers was separated by SFC (DAICEL CHIRALPAK IH, 250 mm × 30 mm × 10 μm; Mobile phase: A: CO ₂ , B: 0.1% NH ₃ H ₂ O in MeOH; B% in A: 20%-20%, 10 min; Flow rate: 70 g/min; Wavelength: 220 nm; Column temperature: 40 °C; System back pressure: 100 bar) to give trans-1-(methoxymethyl)-3-methyl-N-(4-methyl-3-(pyrazolo[1,5 -a]pyrazin-6-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide (Peak 1 in SFC) as Example 88 and trans-1-(methoxymethyl)- 3-methyl-N-(4-methyl-3-(pyrazolo[1,5-a]pyrazin-6-yl)phenyl)- 6-azabicyclo[3.1.1]heptane-6- carboxamide (Peak 2 in SFC) as Example 89. LCMS: m/z = 406.0 [M+H] ⁺ . Examples 90 and 91 (1S,5R)-1-(1-methyl-1H-1,2,4-triazol-5-yl)-N-(4-methyl-3-(py rrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)- 6-azabicyclo[3.1.1]heptane-6-carboxamide and (1R,5S)-1-(1-methyl-1H-1,2,4-triazol-5-yl)-N-(4- methyl-3-(pyrrolo[2,1-f][1,2,4]triazin-2-yl)phenyl)-6-azabic yclo[3.1.1]heptane-6-carboxamide N N N mm, 10 μm; Mobile phase: A: CO ₂ , B: 0.1% NH ₃ .H ₂ O in MeOH; B% in A: 46%-46%; Flow rate: 75 g/min; Wavelength: 220 nm; Column temperature: 40 °C; System back pressure: 100 bar) to give 1-(1- methyl-1H-1,2,4-triazol-5-yl)-N-(4-methyl-3-(pyrrolo[2,1-f][ 1,2,4]triazin-2-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide (Peak 1 in SFC) as Example 90. LCMS: m/z = 429.2 [M+H] ⁺ and 1-(1-methyl-1H-1,2,4-triazol-5-yl)-N-(4-methyl-3-(pyrrolo[2, 1-f][1,2,4]triazin-2-yl)phenyl)-6- azabicyclo[3.1.1]heptane-6-carboxamide (Peak 2 in SFC) as Example 91. LCMS: m/z = 429.2 [M+H] ⁺ . [0463] The following compounds were, or can be, made via similar procedures as those described herein. Ex. Structure LCMS Ex. Structure LCMS BIOLOGICAL EXAMPLE 1 Biochemical Assay of the Compounds [0464] Preparation of full-length SARM1 (FL-SARM1) lysate: HEK293T cells (ATCC: CRL-3216) were grown on 150 mm TC-treated dishes to 80-90% confluency in complete DMEM (Thermo Fisher: 11965175) supplemented with 10% HI-FBS (VWR: 10802-772), 1x Pen/Strep (Thermo Fisher: 15140122), 1x NEAA (Thermo Fisher: 1140050), 1x glutamax (Thermo Fisher: 35050061), and 1 mM sodium pyruvate (Thermo Fisher: 11360070)) at 37 °C and 5% CO2. One hour prior to transfection, the media was replaced with fresh, 37 °C complete DMEM (20 mL per one 150 mm dish) supplemented with additional 10mM glucose (Alfa Aesar AAJ60067EQE). Per one 150 mm dish, 30 mg FL-SARM1 (SEQ. ID.1; cloned in-house) plasmid was dissolved in 1 mL DMEM at ambient temperature and were mixed by inverting the tube 8-10 times.90 µL of GenJet™ in vitro DNA transfection reagent (Ver2) was dissolved in 1 mL DMEM at ambient temperature and were mixed by inverting the tube 8-10 times. The plasmid and transfection agent solutions were combined, mixed by 8-10 inversions and incubated for 10 minutes at ambient temperature.2 mL of this transfection mixture was added to each dish containing HEK293T cells as prepared above followed by a gentle mixing of 4-5 horizontal rotations. The dishes were incubated at 37^°C and 5% CO ₂ for 24 h. The dishes were removed from the incubator, the medium was aspirated and the cells were scraped off using cell scrapers in ice-cold 1x PBS (5 mL/dish, Thermo Fisher Scientific 10010023). The collected cells were centrifuged at 300 g for 5 minutes at 4 °C. The supernatant was aspirated and the pellet was frozen at -80 °C until needed. The cell pellet from 30 dishes was dissolved in 30 mL 1x PBS supplemented with 4 tablets of Complete, Mini EDTA-free protease inhibitor cocktail at 4 °C. This mixture was sonicated on ice for 10 minutes at 50% amplitude with a 1 second on/1 second off interval using a Model 120 sonicator (Thermo Fisher Scientific, FB120110). The lysate was centrifuged at 16000 g for 10 minutes at 4 °C. Batches with supernatant possessing NMN- dependent SARM1 activity were selected, pooled, and stored at -80 °C until used in the FL-SARM1 cellular lysate assay described below. [0465] To a white 384-well Proxiplate (PerkinElmer, PE-6008280) was added 50 nL/well of a DMSO solution containing test compounds followed by 7.5 mL/well of a 0.067 mg/mL solution of SARM1 cellular lysate in reaction buffer (DPBS containing CHAPSO (0.1%) and fatty acid free BSA (0.032%)). The plate was centrifuged for 1 minute at 1000 RPM and then placed in an incubator at 23 °C for 15 minutes. To the wells were added 2.5 mL/well of a solution containing 40 mM NAD ⁺ and 4 mM NMN in reaction buffer. The plate was centrifuged for 1 min at 1000 RPM, the plate was sealed and placed in an incubator at 23 °C for 3.5 hours before adding 3.5 mL/well of NAD/NADH-Glo™ solution (preparation as described by Promega using the extended detection protocol). The plate was centrifuged for 1 minute at 1000 RPM and then incubated at 23 °C for 20 minutes.1 mL/well of a 3.625 mM solution of menadione in DMSO was added and the plate was centrifuged for 1 minute at 1000 RPM. Relative light units (RLU) were recorded using an Envision plate reader at a height of 6.5 mm. Percent inhibition was calculated as follows: ĥ inhibition = (sample - low control) / (high control - low control) x 100. [0466] IC ₅₀ values were calculated from an 11 point curve using ½ log dilutions using a four-parameter logistic regression curve fit. Activity of the tested compounds is provided in Table 3 below as follows: +++ = 0.0001 µM < IC50 < 1 mM; ++ = IC501-10 mM; + = IC50 > 10 mM. Table 3 Ex. Activity Activity Ex. Activity Activity Ex. Activity Activity 1 00 2 1 3 004 Ex. Activity Activity Ex. Activity Activity Ex. Activity Activity [ ] p q ( Q ) tggaagggctaattcactcccaaagaagacaagatatccttgatctgtggatctaccaca cacaaggcta cttccctgattagcagaactacacaccagggccaggggtcagatatccactgacctttgg atggtgctac aagctagtaccagttgagccagataaggtagaagaggccaataaaggagagaacaccagc ttgttacacc ctgtgagcctgcatgggatggatgacccggagagagaagtgttagagtggaggtttgaca gccgcctagc atttcatcacgtggcccgagagctgcatccggagtacttcaagaactgctgatatcgagc ttgctacaag ggactttccgctggggactttccagggaggcgtggcctgggcgggactggggagtggcga gccctcagat cctgcatataagcagctgctttttgcctgtactgggtctctctggttagaccagatctga gcctgggagc tctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttc aagtagtgtg tgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtg gaaaatctct agcagtggcgcccgaacagggacttgaaagcgaaagggaaaccagaggagctctctcgac gcaggactcg gcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaat tttgactagc ggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattaga tcgcgatggg aaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatggg caagcaggga gctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaat actgggacag ctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagca accctctatt gtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaag agcaaaacaa aagtaagaccaccgcacagcaagcggccggccgctgatcttcagacctggaggaggagat atgagggaca attggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcac ccaccaaggc aaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgg gttcttggga gcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaatta ttgtctggta tagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaac tcacagtctg gggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaaca gctcctgggg atttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttgg agtaataaat ctctggaacagatttggaatcacacgacctggatggagtgggacagagaaattaacaatt acacaagctt aatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattatt ggaattagat aaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaatta ttcataatga tagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagag ttaggcaggg atattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccga aggaatagaa gaagaaggtggagagagagacagagacagatccattcgattagtgaacggatctcgacgg tatcgccttt aaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagca acagacatac aaactaaagaattacaaaaacaaattacaaaaattcaaaattttcgggtttattacaggg acagcagaga tccagtttatcgatgagtaattcatacaaaaggactcgcccctgccttggggaatcccag ggaccgtcgt taaactcccactaacgtagaacccagagatcgctgcgttcccgccccctcacccgcccgc tctcgtcatc actgaggtggagaagagcatgcgtgaggctccggtgcccgtcagtgggcagagcgcacat cgcccacagt ccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcgg ggtaaactgg gaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatata agtgcagtag tcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgt gtggttcccg cgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacgcccct ggctgcagta cgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgc ttaaggagcc ccttcgcctcgtgcttgagttgaggcctggcttgggcgctggggccgccgcgtgcgaatc tggtggcacc ttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctg ctgcgacgct ttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggt ttttggggcc gcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcga gcgcggccac cgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggcctcgcgc cgccgtgtat cgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatg gccgcttccc ggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgag tcacccacac aaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtaccggg cgccgtccag gcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggtt ttatgcgatg gagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaa ttctccttgg aatttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaa gtttttttct tccatttcaggtgtcgtgaggatctatttccggtgaattcgccaccATGGTCCTGACGCT GCTTCTCTCC GCCTACAAGCTGTGTCGCTTCTTCGCCATGTCGGGCCCACGGCCGGGCGCCGAGCGGGAT TACAAGGACG ACGATGACAAGCTGGCGGTGCCTGGGCCAGATGGGGGCGGTGGCACGGGCCCATGGTGGG CTGCGGGTGG CCGCGGGCCCCGCGAAGTGTCGCCGGGGGCAGGCACCGAGGTGCAGGACGCCCTGGAGCG CGCGCTGCCG GAGCTGCAGCAGGCCTTGTCCGCGCTGAAGCAGGCGGGCGGCGCGCGGGCCGTGGGCGCC GGCCTGGCCG AGGTCTTCCAACTGGTGGAGGAGGCCTGGCTGCTGCCGGCCGTGGGCCGCGAGGTAGCCC AGGGTCTGTG CGACGCCATCCGCCTCGATGGCGGCCTCGACCTGCTGTTGCGGCTGCTGCAGGCGCCGGA GTTGGAGACG CGTGTGCAGGCCGCGCGCCTGCTGGAGCAGATCCTGGTGGCTGAGAACCGAGACCGCGTG GCGCGCATTG GGCTGGGCGTGATCCTGAACCTGGCGAAGGAACGCGAACCCGTAGAGCTGGCGCGGAGCG TGGCAGGCAT CTTGGAGCACATGTTCAAGCATTCGGAGGAGACATGCCAGAGGCTGGTGGCGGCCGGCGG CCTGGACGCG GTGCTGTATTGGTGCCGCCGCACGGACCCCGCGCTGCTGCGCCACTGCGCGCTGGCGCTG GGCAACTGCG CGCTGCACGGGGGCCAGGCGGTGCAGCGACGCATGGTAGAGAAGCGCGCAGCCGAGTGGC TCTTCCCGCT CGCCTTCTCCAAGGAGGACGAGCTGCTTCGGCTGCACGCCTGCCTCGCAGTAGCGGTGTT GGCGACTAAC AAGGAGGTGGAGCGCGAGGTGGAGCGCTCGGGCACGCTGGCGCTCGTGGAGCCGCTTGTG GCCTCGCTGG ACCCTGGCCGCTTCGCCCGCTGTCTGGTGGACGCCAGCGACACAAGCCAGGGCCGCGGGC CCGACGACCT GCAGCGCCTCGTGCCGTTGCTCGACTCTAACCGCTTGGAGGCGCAGTGCATCGGGGCTTT CTACCTCTGC GCCGAGGCTGCCATCAAGAGCCTGCAAGGCAAGACCAAGGTGTTCAGCGACATCGGCGCC ATCCAGAGCC TGAAACGCCTGGTTTCCTACTCTACCAATGGCACTAAGTCGGCGCTGGCCAAGCGCGCGC TGCGCCTGCT GGGCGAGGAGGTGCCACGGCCCATCCTGCCCTCCGTGCCCAGCTGGAAGGAGGCCGAGGT TCAGACGTGG CTGCAGCAGATCGGTTTCTCCAAGTACTGCGAGAGCTTCCGGGAGCAGCAGGTGGATGGC GACCTGCTTC TGCGGCTCACGGAGGAGGAACTCCAGACCGACCTGGGCATGAAATCGGGCATCACCCGCA AGAGGTTCTT TAGGGAGCTCACGGAGCTCAAGACCTTCGCCAACTATTCTACGTGCGACCGCAGCAACCT GGCGGACTGG CTGGGCAGCCTGGACCCGCGCTTCCGCCAGTACACCTACGGCCTGGTCAGCTGCGGCCTG GACCGCTCCC TGCTGCACCGCGTGTCTGAGCAGCAGCTGCTGGAAGACTGCGGCATCCACCTGGGCGTGC ACCGCGCCCG CATCCTCACGGCGGCCAGAGAAATGCTACACTCCCCGCTGCCCTGTACTGGTGGCAAACC CAGTGGGGAC ACTCCAGATGTCTTCATCAGCTACCGCCGGAACTCAGGTTCCCAGCTGGCCAGTCTCCTG AAGGTGCACC TGCAGCTGCATGGCTTCAGTGTCTTCATTGATGTGGAGAAGCTGGAAGCAGGCAAGTTCG AGGACAAACT CATCCAGAGTGTCATGGGTGCCCGCAACTTTGTGTTGGTGCTATCACCTGGAGCACTGGA CAAGTGCATG CAAGACCATGACTGCAAGGATTGGGTGCATAAGGAGATTGTGACTGCTTTAAGCTGCGGC AAGAACATTG TGCCCATCATTGATGGCTTCGAGTGGCCTGAGCCCCAGGTCCTGCCTGAGGACATGCAGG CTGTGCTTAC TTTCAACGGTATCAAGTGGTCCCACGAATACCAGGAGGCCACCATTGAGAAGATCATCCG CTTCCTGCAG GGCCGCTCCTCCCGGGACTCATCTGCAGGCTCTGACACCAGTTTGGAGGGTGCTGCACCC ATGGGTCCAA CCtacccatacgatgttccagattacgctTAAggatcccgcccctctccctccccccccc ctaacgttac tggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccat attgccgtct tttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggt ctttcccctc tcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagctt cttgaagaca aacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcct ctgcggccaa aagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagt tggatagttg tggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccaga aggtacccca ttgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggtt aaaaaaacgt ctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataagcttgc cacaacccac aaggagacgaccttccatgaccgagtacaagcccacggtgcgcctcgccacccgcgacga cgtcccccgg gccgtacgcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgac ccggaccgcc acatcgagcgggtcaccgagctgcaagaactcttcctcacgcgcgtcgggctcgacatcg gcaaggtgtg ggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcggg ggcggtgttc gccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacag atggaaggcc tcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgc ccgaccacca gggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccgg ggtgcccgcc ttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtc accgccgacg tcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgcctagacgc gtctggaaca atcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctc cttttacgct atgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcat tttctcctcc ttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgt ggcgtggtgt gcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcc tttccgggac tttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctg ctggacaggg gctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttcca tggctgctcg cctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctca atccagcgga ccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccc tcagacgagt cggatctccctttgggccgcctccccgcctggaattaattctgcagtcgagacctagaaa aacatggagc aatcacaagtagcaatacagcagctaccaatgctgattgtgcctggctagaagcacaaga ggaggaggag gtgggttttccagtcacacctcaggtacctttaagaccaatgacttacaaggcagctgta gatcttagcc actttttaaaagaaaagaggggactggaagggctaattcactcccaacgaagacaagata tccttgatct gtggatctaccacacacaaggctacttccctgattagcagaactacacaccagggccagg ggtcagatat ccactgacctttggatggtgctacaagctagtaccagttgagccagataaggtagaagag gccaataaag gagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccggagagag aagtgttaga gtggaggtttgacagccgcctagcatttcatcacgtggcccgagagctgcatccggagta cttcaagaac tgctgatatcgagcttgctacaagggactttccgctggggactttccagggaggcgtggc ctgggcggga ctggggagtggcgagccctcagatcctgcatataagcagctgctttttgcctgtactggg tctctctggt tagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctc aataaagctt gccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatc cctcagaccc ttttagtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtat ttataacttg caaagaaatgaatatcagagagtgagaggccttgacattgctagcgtttaccgtcgacct ctagctagag cttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattcc acacaacata cgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacatta attgcgttgc gctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggcc aacgcgcggg gagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctc ggtcgttcgg ctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggg gataacgcag gaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgc tggcgttttt ccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcg aaacccgaca ggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccg accctgccgc ttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcac gctgtaggta tctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttca gcccgaccgc tgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgcca ctggcagcag ccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagt ggtggcctaa ctacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttacctt cggaaaaaga gttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgc aagcagcaga ttacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacg ctcagtggaa cgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagat ccttttaaat taaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttac caatgcttaa tcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactcc ccgtcgtgta gataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgaga cccacgctca ccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggt cctgcaactt tatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccag ttaatagttt gcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggc ttcattcagc tccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggtt agctccttcg gtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcag cactgcataa ttctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaa gtcattctga gaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcg ccacatagca gaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatct taccgctgtt gagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttacttt caccagcgtt tctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacgg aaatgttgaa tactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatga gcggatacat atttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagt gccacctgac gtcgacggatcgggagatcaacttgtttattgcagcttataatggttacaaataaagcaa tagcatcaca aatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatc aatgtatctt atcatgtctggatcaactggataactcaagctaaccaaaatcatcccaaacttcccaccc cataccctat taccactgccaattacctgtggtttcatttactctaaacctgtgattcctctgaattatt ttcattttaa agaaattgtatttgttaaatatgtactacaaacttagtagt [0468] In certain embodiments, provided is a method for determining modulation of Sterile alpha and Toll/interleukin-1 receptor motif-containing 1 (SARM1) by a candidate compound, said method comprising: providing a solution comprising a SARM1 protein and the candidate compound; adding to the solution nicotinamide mononucleotide (NMN) and nicotinamide adenine dinucleotide (NAD ⁺ ); and measuring the amount of NAD ⁺ remaining in solution to determine modulation of SARM1 by the candidate compound. [0469] In certain embodiments, the measuring comprises a fluorescent detection step. [0470] In certain embodiments, the SARM1 protein is a protein comprising at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95%, or at least about 97%, or at least about 99% sequence homology to native SARM1 protein. [0471] In certain embodiments, the SARM1 protein comprises a fluorescent tag. [0472] In certain embodiments, the SARM1 protein is provided using SEQ. ID.1, or a derivative thereof. In certain embodiments, the derivative comprises at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95%, or at least about 97%, or at least about 99% sequence homology to SEQ. ID.1. In certain embodiments, the SARM1 protein is provided using SEQ. ID.1. [0473] In certain embodiments, the candidate compound is an inhibitor of SARM1. [0474] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. [0475] The disclosure illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms “comprising,” “including,” “containing,” etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the claims. [0476] All publications, patent applications, patents, and other references mentioned herein are expressly incorporated by reference in their entirety, to the same extent as if each were incorporated by reference individually. In case of conflict, the present specification, including definitions, will control. [0477] It is to be understood that while the disclosure has been described in conjunction with the above embodiments, that the foregoing description and examples are intended to illustrate and not limit the scope of the disclosure. Other aspects, advantages and modifications within the scope of the disclosure will be apparent to those skilled in the art to which the disclosure pertains.