Field of the invention

The invention relates to pharmaceutical treatment of Helicobacter pylori infection. Background of the invention

Helicobacter pylori as a pathogen

Helicobacter pylori is a gram-negative bacterium that colonizes the human gastric and duodenal mucosa of more than half of the world's population. The bacteria are found associated with the mucous layer as well as attached to the gastric epithelium. H. pylori infection is often acquired during childhood and is spread through person-to- person contact or by ingesting contaminated food and water. The bacteria are able to persist in the gastric environment for decades and even throughout the life span of the host. H. pylori infection is the strongest known risk factor for gastroduodenal ulcers, furthermore, and is the first bacterium defined as a causative agent of gastric adenocarcinoma and gastric mucosa-associated lymphoid tissue lymphoma.

H. pylori possesses a number of different colonization and virulence determinants. The urease enzyme, encoded by ureA and ureB, neutralizes gastric acidity by degrading urea at the site of colonisation. The bacterial flagella mediate motility. The VacA cytotoxin and CagA Pathogenicity Island contribute to cytotoxicity and affect epithelial biology. The best-studied H. pylori adhesins are outer membrane proteins that bind carbohydrate structures on host cell glycoprotein. The BabA adhesin binds fucosylated blood group antigen Lewis-b and the sialic acid-binding adhesin (SabA), binds to sialylated carbohydrate structures on gastric epithelial cells. Several other outer membrane proteins, such as HopZ, HopH, AlpA and AlpB, have also been shown to mediate bacterial attachment to host cells.

In order to combat the reactive oxygen species released by the host immune system and to survive in the gastric mucosa, H. pylori is equipped with a number of detoxifying proteins. Among these, alky 1-hy drop eroxide reductase (AhpC, which is coded by ahpC gene) is the most abundant protein. AhpC is a member of 2-Cys peroxiredoxins, and is thioredoxin-dependent. It has been shown that AhpC of H. pylori is more homologous to the human peroxiredoxins family (Prxs) than to eubacterial AhpC. This suggests that a long-term infection may facilitate the recombination of bacterial AhpC with human Prxs genes to form a human like AhpC.

Complement system and CD46

The complement system has a crucial role in eliminating pathogenic organisms. Many bacteria have developed the ability to escape the machinery of the human complement system by interfering with complement regulatory factors. CD46, a human cell surface glycoprotein expressed by virtually all cells except erythrocytes, regulates complement activation by serving as a cofactor in the proteolysis of deposited C3b and C4b by serine protease factor I. CD46 consists of four homologous complement control protein repeats (CCPR-1, -2, -3, and -4), a serine-threonine -proline (STP)-rich domain, a transmembrane hydrophobic domain, a cytoplasmic anchor and a cytoplasmic tail. Four major isoforms of CD46 are expressed by alternative splicing of the STP domain and the choice between one of two cytoplasmic tails (Cyt-1 and Cyt-2) (see Dhiman, N., Jacobson, R.M. & Poland, G.A. Measles virus receptors: SLAM and CD46. Rev Med Virol 14, 217-229 (2004); Gill, D.B. & Atkinson, J.P. CD46 in Neisseria pathogenesis. Trends Mol Med 10, 459-465 (2004); Riley- Vargas, R.C., Gill, D.B., Kemper, C, Liszewski, M.K. & Atkinson, J.P. CD46: expanding beyond complement regulation. Trends Immunol 25, 496-503 (2004)). CD46 is a receptor for adenovirus, human herpes virus 6, pathogenic Neisseria, measles virus and Streptococcus pyogenes. Infection of epithelial cells by S. pyogenes and N. gonorrhoeae triggers shedding of CD46. Although CD46 is expressed in human gastric epithelium of uninfected individuals as well as in H. pylori infected patients with gastric ulcer, duodenal ulcer, and adenocarcinoma (Correa, P. Helicobacter pylori and gastric carcinogenesis. Am J Surg Pathol 19 Suppl 1, S37-43 (1995)), the role of CD46 in H. pylori infection has not yet been elucidated. Current therapies for H. pylori infection

In attempt to efficiently eradicate H. pylori infection, triple therapy is routinely used. Today, the standard triple therapy is amoxicillin, clarithromycin and a proton pump inhibitor such as omeprazole, lansoprazole, pantoprazole or esomeprazole. Protocols with metronidazole are also in use. Generally, the antibiotics used have broad antibacterial spectra and affect the natural gut flora resulting in gastrointestinal side effects. Furthermore, the use of broad-spectrum antibiotics may contribute to the development of antibiotic resistance, which is an alarmingly growing problem. Thus, it is an object of the invention to provide a pharmaceutical treatment of H. pylori infection not having the problems associated with current therapies.

Brief description of the figures

Figure 1: H. pylori induces shedding of CD46 in gastric epithelial AGS cells. (A) Adherence of wild type H. pylori J99, 26695, and HPGAl to AGS cells at 18 h postinfection. Bacteria were added at a multiplicity of infection (MOI) of 100. The results represent means and standard deviations based on triplicate samples from three independent experiments. (B) Infection of gastric epithelial cells triggers loss of CD46. AGS cells were infected with H. pylori J99, 26695, and HPGAl at a MOI of 100 for 18 h. Expression of CD46 in uninfected (black shaded area) and infected AGS cells (un-shaded area) was analyzed by flow cytometry using CD46 specific antibodies. (C) ELISA showing the presence of CD46 in cell supernatants after H. pylori infection. Micro-titer plates were coated with supernatants of uninfected (control) and infected cells for 24 h, and overlaid with polyclonal CD46 antibody (H294) followed by HRP- conjugated anti IgG Results represent triplicate of three independent experiments and error bars represent means ±s.d ( ^* P<0.001).

Figure 2: CD46 binds to H. pylori. (A) Schematic drawing of the extra-cellular region of CD46-BC 1 adapted from Riley -Vargas et al, supra. (B) ELISA analysis of rCD46 binding to bacterial lysates. Microtiter plates were coated with lysates of H. pylori (J99, 26695, HPGA1), and overlaid with 2.5 μg rCD46 or H. pylori lysates respectively for 1 h, stained with CD46 antibody and Alexa 488 conjugated anti-rabbit IgG. (C) Flow cytometry analysis of rCD46-binding to H. pylori strains. Bacteria (10 ⁷ CFU/ml) in log phase were incubated with 30 g/ml rCD46 for 2 h, washed, stained with polyclonal CD46 antibody followed by Alexa 488 conjugated anti-rabbit IgG before analysis by flow cytometry. (D) Interaction between H. pylori J99 and rCD46 can be blocked by CD46 antibody or C3b. rCD46 was pre-incubated with buffer, C3b or with CD46 antibody for 1 h at 37°C, and then incubated for additional 2h with bacteria. As control, bacteria were incubated with or without rCD46. Bacterial suspensions were washed, stained with polyclonal CD46 antibody and Alexa 488 conjugated anti-rabbit IgG and analyzed by flow cytometry. Results represent triplicate of two independent experiments and error bars represent means ±s.d. ( ^* P<0.01,). (E) Microscopic detection of rCD46-binding to H. pylori. Bacteria (10 ⁶ cfu/ml) were incubated with (+CD46) or without (-CD46) 30 g/ml of rCD46 for 2 h, washed, stained with polyclonal CD46 antibody and a secondary anti-IgG antibody before analysis by inverted fluorescence microscopy. Images are representative of one of three separate experiments. (F) Altered H. pylori morphology in response to CD46 binding.

Figure 3: Recombinant CD46 is bactericidal against H. pylori. (A) 10 ⁵ bacteria/ml of H. pylori J99 were incubated with 0, 5, 10, 30, 50 or 100 g/ml of purified rCD46 or purified thioredoxin (Trx) at 37 °C in 10% CO ₂ and 5% O ₂ for 6 h. (B) 10 ⁵ bacteria/ml of H. pylori J99 was incubated with 30 g/ml of rCD46 at 0, 6, and 24 h. Viable bacteria were enumerated by plating serial dilution on Colombia Blood Agar plates. The survival percentage is expressed as colony-forming units (cfu) after rCD46 incubation divided by control cfu without rCD46 ( P<0.006). (C) Permeabilization of bacteria by rCD46 can be blocked by C3b. rCD46 was pre-incubated with buffer or C3b before addition to H. pylori strain J99 for 2 h. Purified thioredoxin (Trx) or buffer without rCD46 were used as negative controls. Bacteria were stained with PI, fixed, and analyzed by flow ctyometry ( ^** P<0.001). (D) Schematic drawing of the CCPl-4 domains of CD46 adapted from Gill et al (Gill, D.B., Spitzer, D., Koomey, M., Heuser, J.E. & Atkinson, J.P. Release of host-derived membrane vesicles following pilus- mediated adhesion of Neisseria gonorrhoeae. Cell Microbiol 7, 1672-1683 (2005)). Marked in dark are positions of four synthesized peptides, P1-P4, within CD46 (CCPl-4). (E) Survival of H. pylori after incubation with the peptides. Bacteria (10 ⁵ CFU/ml) were incubated with 30 μΜ of each peptide for 6 h, serially diluted and spread onto plates for viable counts. (F) Survival of H. pylori (10 ⁵ CFU/ml) after incubation for 6 h with 0, 5, 10, 20 or 30 μΜ of the P3-peptide. Bacteria were serially diluted and spread onto plates for viable counts. Results represent triplicate of three independent experiments and error bars represent means ±s.d. Figure. 4: rCD46 and peptide-P3 inhibit urease activity otH. pylori

(A) Identification the rCD46 binding ligands of H. pylori by affinity chromatography. Two significant bands with molecular weights of 20 and 28 kDa were identified as UreaseA and alkyl hydroperoxide reductase (AhpC code by ahpC gene) by mass spectrometry. (B). Time course inhibition of H. pylori urease activity by rCD46. Urease activity was assayed by adding urea-containing reaction buffer as indicated in methods. (C) Flow cytometry analysis of rCD46-binding to H. pylori J99 and its mutants (AureA and AureA/AahpC). Bacteria (10 ⁷ CFU/ml) were incubated with 30 μg/m\ rCD46 for 2 h, washed, stained with polyclonal CD46 antibody followed by Alexa 488 conjugated anti- rabbit IgG before analysis by flow cytometry. (D) Flow cytometry analysis of peptide binding to H. pylori J99 and its mutants (AureA, AahpC and AureA/AahpC). Bacteria (10 ⁷ CFU/ml) were incubated with 20 μΜ of FITC-P3, FITC-Pl or random peptide (RP) for 2 h, washed, and analyzed by flow cytometry. (E) Effect of CD46 P3-peptide and PI -peptide on urease activity of H. pylori J99. One μg of total protein extract protein of H. pylori J99 was incubated with 30 μΜ of P3 or PI peptide for 0 to 60 min. Urease activity was assayed by adding urea-containing reaction buffer as indicated on methods. Results represent triplicate of three independent experiments and error bars represent means ±s.d. ( ^* P< 0.01 ; ^** P< 0.05 ^*** P< 0.003).

Figure 5: Oral administration of CD46 P3-peptide eliminates H. pylori infection in mouse model. CD46 transgenic mice (10-12 mice per group) were infected orally with 10 ⁸ cfu/ml of H. pylori strain 67:21 once per day for 3 days intervals. At 8 weeks postinfection, mice were treated orally with either 20 μΜ of 100 microliter P3-peptide (+P3) or PBS (-P3) for 2 weeks. Mice stomach tissues were dissected after 2 weeks treatment, homogenized to detect bacterial load or sectioned for immuno staining. (A) Bacterial load, assessed as logio colony forming unit (CFU)/gram of stomach tissue of uninfected control ( · ), PBS-treated (-P3) (♦), P3-treated mice (+P3) (O). Colonization in PBS-treated mice was significantly higher than that in P3-treated mice at 10-week post infection, P<0.001. (B) Immuno staining of CD46 and H. pylori in gastric tissue sections at 10 weeks post infection using either anti-CD46 antibody or anti-H. pylori antibody. (C) Intensity of CD46 in stomach tissue stained with anti- CD46 and analyzed by software Image J. Levels of CD46 in gastric tissues of H. pylori infected CD46 transgenic mice was significantly reduced in infected mice compared to P3-treated mice P<0.01. (D) The cytokine levels of IL-6, TNF and IL-10 in gastric tissue measured by ELISA. The IL-10 level was elevated in P3-treated mice compared to PBS-treated mice (-P3). There was no significant difference in IL-6 and TNF levels between treated and untreated mice. Results represent two independent experiments with number of mice (n) used for each treatment indicated and error bars represent means ±s.d.

Figure 6. Determination of active sites of P3 peptide. Survival of H. pylori after incubation with different variants of peptide P-25. P3-25 had an additional leucine (L) at the N-terminus compared to the original peptide P3. Bacteria (10 ⁵ CFU/ml) were incubated with 30 μΜ of each peptide for 6 h, serially diluted and spread onto plates for viable counts. (A) Peptides covering the N-terminal half (P3- 12), the C-terminal half (P3-13) and the middle part (P3-14) of peptide P3-25. (B) Peptides with

successive C-terminal deletions (P3-15, P3-18, P3-21), and successive N-terminal deletions (P3-16, P3-19, P3-22). As control a random peptide (RP-25) was used.

Results represent triplicate of one experiment.

Definitions The term "amino acid" includes amino-acids that naturally occur in proteins, with no limitation as to whether the amino-acid is from a biological source or a non-biological source (such as chemically synthesized). Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are post-translationally modified by cells, e.g., hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. The term may also include amino acid analogues and amino acid mimetics. In the context of preferable embodiments, the term refers solely to naturally occurring amino-acids.

The term "amino acid analogues " refers to compounds that have the same basic chemical structure as amino acids naturally occurring in proteins, i.e. have an alpha- carbon (by definition bound to a hydrogen, a carboxyl group, an amino group), but differ from natural amino-acids in having a side chain (R group) that does not naturally occur in proteins. In other words, such analogues have non-natural modified R groups but retain the same basic chemical structure of the peptide backbone as a naturally occurring amino acid. Examples include norleucine, homoserine, norleucine, methionine sulfoxide and methionine methyl sulfonium.

The term "amino acid mimetics " refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid. For example, amino- acid mimetics include beta- and gamma amino-acids.

The term "peptide" as used herein refers to peptides with no upper limit with respect to length. In other words, the term also encompasses polypeptides and proteins. In the context of preferable embodiments, the term refers solely to molecules comprised of a linear chain of naturally occurring amino-acids linked by peptide bonds. However, the term may also encompass peptides comprising one or more amino-acid analogues. The term may also encompass peptides comprising one or more amino-acid mimetics. The term may further comprise peptidomimetics and functional derivates.

The term "muteins" refers to variants of a template peptide, in which one or more of the amino acid residues of the template peptide sequence are replaced by different amino acid residues, or are deleted, or one or more amino acid residues are added to the original sequence the template peptide. Peptides having a muteins sequence may be prepared by synthesis and/or by site-directed mutagenesis techniques, or any other known suitable technique (see e.g. Schulz, G.E. et al, Principles of Protein Structure, Springer- Verlag, New York, 1978; or Creighton, T.E., Proteins: Structure and

Molecular Properties, W.H. Freeman & Co., San Francisco, 1983, which are hereby incorporated by reference).

Preferred changes for muteins in accordance with the present invention are what are known as "conservative" substitutions. Conservative amino acid substitutions may include synonymous amino acids within a group which have sufficiently similar physicochemical properties that substitution between members of the group will preserve the biological function of the molecule, Grantham, Science, Vol. 185, pp. 862-864 (1974). It is clear that insertions and deletions of amino acids may also be made in the above-defmed sequences without altering their function, particularly if the insertions or deletions only involve a few amino acids, e.g., under thirty, and preferably under ten, and do not remove or displace amino acids which are critical to a functional conformation, e.g., cysteine residues, Anfmsen, "Principles That Govern The Folding of Protein Chains", Science, VOL. 181, pp. 223-230 (1973). Muteins produced by such deletions and/or insertions are within the scope of the present invention. Preferable synonymous amino acid groups are those defined in Table I, with indications of order of preference by column.

TABLE I Preferred groups of synonymous amino-acids

Ami no- Preferable More preferable Most preferable acid synonymous group synonymous group synonymous group

Ser Ser, Thr, Gly, Asn Ser Ser

Arg Arg, Gin, Lys, Glu, His, Lys, Arg Arg

His

Leu He, Phe, Tyr, Met, Val, Leu, lie, Phe, Met Leu, lie, Met

Leu

Pro Gly, Ala, Thr, Pro Ala, Pro Pro

Thr Pro, Ser, Ala, Gly, Thr Thr His, Gin, Thr

Ala Gly, Thr, Pro, Ala Pro, Ala Ala

Val Met, Tyr, Phe, He, Val, Met, lie Val

Leu, Val

Gly Ala, Thr, Pro, Ser, Gly Gly Gly

He Met, Tyr, Phe, Val, lie, Met, Phe, Val, Leu lie, Met, Leu

Leu, lie

Phe Tip, Met, Tyr, He, Val, Met, Tyr, He, Leu, Phe Phe

Leu, Phe

Tyr Trp, Met, Phe, He, Phe, Tyr Tyr

Val, Leu, Tyr

Cys Ser, Thr, Cys Cys, Ser Cys, Ser

His Glu, Lys, Gin, Thr, His, Gin, Arg His

Arg, His

Gin Glu, Lys, Asn, His, Glu, Gin, His Gin

Thr, Arg, Gin

Asn Gin, Asp, Ser, Asn Asp, Asn Asn

Lys Glu, Gin, His, Arg, Lys, Arg Lys

Lys

Asp Glu, Asn, Asp Asp, Asn Asp

Glu Asp, Lys,Asn, Gin, Glu, Gin Glu

His, Arg, Glu

Met Phe, lie, Val, Leu, Met Met, Phe, lie, Val, Leu Met, lie, Leu

Trp Trp Trp Trp

Examples of production of amino acid substitutions in proteins which can be used for obtaining muteins of human CD46 for use in the present invention include any known method steps, such as presented in US patents RE 33,653, 4,959,314, 4,588,585 and 4,737,462, to Market al; 5,1 16,943 to Koths et al, 4,965,195 to Namen et al; 4,879,1 11 to Chong et al; and 5,017,691 to Lee et al; and lysine substituted proteins presented in US patent No. 4,904,584 (Shaw et al).

The term "percent sequence identity" refers to the degree of similarity between two or more sequences or subsequences, as measured using one of the following sequence comparison algorithms or by visual inspection. Two sequences can be compared over their full-length (e.g., the length of the shorter of the two, if they are of substantially different lengths) or over a subsequence such as at least at least about 10, about 20, about 30, about 50 or about 100 contiguous amino acid residues.

For determination of percent sequence identity between native sequence and a variant, the native sequence acts as reference sequence, to which test (variant) sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP,

BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by visual inspection (see generally Ausubel et al, Current Protocols In Molecular Biology, Greene

Publishing and Wiley-Interscience, New York (supplemented through 1999). Each of these references and algorithms is incorporated by reference herein in its entirety. When using any of the aforementioned algorithms, the default parameters for

"Window" length, gap penalty, etc., are used.

One example of algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al, J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information

(http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al, supra). These initial neighbourhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm

parameters W, T, and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a wordlength (W) of 1 1, the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915 (1989)) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands. For determining the percent identity between sequences, the BLAST algorithm with its default parameters is preferred. In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two amino acid sequences would occur by chance.

The term "peptidomimetic" refers to synthetic or semi- synthetic compounds that are functionally peptide analogues but at least partially have a non-peptide structure.

Peptidomimetics are commonly used in the pharmaceutical industry as non-peptide drugs with properties analogous to those of a template peptide. See (Fauchere, J. Adv. Drug Res. 15:29 (1986); Veber and Freidinger TINS p. 392 (1985); and Evans et al. J. Med. Chem. 30: 1229 (1987), which are incorporated herein by reference).

Peptidomimetics that are structurally similar to therapeutically useful peptides may be used to produce an equivalent or enhanced therapeutic or prophylactic effect.

Generally, peptidomimetics are structurally similar to a template peptide (i.e. a peptide that has a biological or pharmacological activity, such as those disclosed in the present invention), but have one, more than one or all peptide linkages of the peptide backbone (such as they occur in the template peptide) replaced by a non-natural linkage. Such linkage may preferably be selected from the group consisting of -CH ₂ NH-, -CH ₂ S-, - CH ₂ -CH ₂ -, -CH=CH- (cis and trans), -COCH ₂ -, -CH(OH)CH ₂ -, and -CH ₂ SO-. The mimetic can be either entirely composed of amino-acid analogues or mimetics (see above), or be a chimeric polymer of naturally occurring amino acids and amino-acid analogues or mimetics. The peptidomimetic can additionally incorporate natural amino acid substitutions (in relation to the template peptide) in a manner explained below in the context of muteins. In other words, a peptidomimetic may also be based on a mutein of the template peptide. The term 'Junctional derivative " of a peptide is understood as being a peptide prepared by chemically, physically or enzymatically modifying the functional groups which occur as side chains on the residues or the N- or C-terminal groups, by means known in the art. These derivatives may, for example, include polyethylene glycol side-chains, labels such as fluorescent labels (e.g FITC), carbohydrate side chains and similar additions. Other derivatives include aliphatic esters of the carboxyl groups, amides of the carboxyl groups by reaction with ammonia or with primary or secondary amines, N-acyl derivatives of free amino groups of the amino acid residues formed with acyl moieties (e.g. alkanoyl or carbocyclic aroyl groups) or O-acyl derivatives of free hydroxyl groups (for example that of seryl or threonyl residues) formed with acyl moieties.

The term "antibacterial activity " encompasses both bactericidal activity and bacteriostatic activity.

Summary of the invention

In a first aspect, the invention provides a peptide with antibacterial activity against Helicobacter pylori, having structure according to Formula (I):

X _a -Z _A -PPP-X _b -EVF-Z _B -X _c (I) wherein

X _a denotes a sequence of any amino acid residues having length of a residues and is optional; X _b denotes a sequence of any amino acid residues having length of b residues;

X _c denotes a sequence of any amino acid residues having length of c residues and is optional; a is an integer from 0 to 50; b is an integer from 6 to 20; c is an integer from 0 to 50;

Z _A denotes the amino-acid sequence CT (residues 128-129 of SEQ ID NO: 1) and is optional; and Z _B denotes the amino-acid sequence EYLD (residues 148-151 of SEQ

ID NO: 1 ; SEQ ID NO: 20) and is optional; with the provisos that at least one of Z _A and Z _B is present; and the molecular weight of the peptide is less than 6000 Da. Specifically, Z _A may present but Z _B absent. Alternatively, Z _B may be present but Z _A absent. In yet another alternative, both Z _A and Z _B may be present.

The residues denoted by X _b between the PPP and EVF-motifs function essentially as a spacer. The length of the space should correspond to an amino-acid chain of 6-20 residues. Preferably, b is from 8 to 16, more preferably b is from 10 to 14, even more

preferably, b is from 1 1 to 13, most preferably b is 12.

The spacer denoted by X _b may have a sequence with similarity to the corresponding native human CD46 sequence KIKNGKHTFSEV. The spacer may have a sequence identity to KIKNGKHTFSEV of at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least at least 85%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity or any interval % identity created by a combination of any two of the above mentioned figures e.g. 70% - 99% or 80 %- 99% identity.

X _b may denote an amino-acid sequence having 70 % - 100% identity with the sequence: KIKNGKHTFSEV (residues 131-144 of SEQ ID NO: 1 ; SEQ ID NO: 21), more preferably the identity is 80-100%, even more preferably 90-100 %, yet more preferably 95-100%; most preferably X _b denotes an amino-acid sequence having the sequence: KIKNGKHTFSEV (SEQ ID NO: 21).

Preferably, a and c are both 0-25, more preferably a and c are both 0-10, yet more preferably a and c are both 0-2, most preferably a and c are both 0 (meaning that X _a and X _c are both absent).

Most preferably, the peptide comprises the sequence:

CTPPPKIKNGKHTFSEVEVFEYLD (residues 128-151 of SEQ ID NO: 1 ; SEQ ID NO: 18).

In a second aspect, there is provided a peptide with antibacterial activity against Helicobacter pylori selected from the group consisting of: peptides comprising the sequence as set forth in amino-acids 190-216 of SEQ ID NO: 1 ; peptides comprising at least 8 amino-acid residues having a sequence identical to amino-acids 190-216 of SEQ ID NO: 1 or a subsequence thereof; and peptides comprising at least 10 amino-acid residues having a sequence with at least 50 % (meaning 50-100 %) identity with amino-acids 190-216 of SEQ ID NO: 1 or a subsequence thereof; with the proviso that the molecular weight of the peptide is less than 6000 Da. The antibacterial activity mentioned above may be bactericidal activity.

The peptide of the first or the second aspect preferably only comprises naturally occurring amino-acid residues and having a fully native peptide backbone linking the amino-acid residues. The peptide of the first or the second aspect may comprise zero, one, two, three, four or more amino-acid analogues or amino-acid mimetics.

The peptide of the first or the second aspect may comprise a backbone comprising zero, one, two, three, four or more non-natural linkages. The non-natural linkages may comprise a linkage selected from the group consisting of -CH ₂ NH-, -CH ₂ S-, -CH ₂ - CH ₂ -, -CH=CH- (cis or trans), -COCH ₂ -, -CH(OH)CH ₂ -, and -CH ₂ SO-.

The peptide of the first or the second aspect may have a modified terminus (N- terminus or C-terminus).

In a third aspect, there is provided the peptide of the first or the second aspect for use as a medicament, preferably for use in the treatment of Helicobacter pylori infection. In a related fourth aspect, there is provided a use of the peptide of the first or the second aspect in the manufacture of a medicament, preferably a medicament for the treatment of Helicobacter pylori infection. In a related fifth aspect, there is provided a method of treatment comprising administering a peptide of the first or the second aspect to a patient, such a patient in need thereof, preferably a patient in need of treatment of Helicobacter pylori infection.

The peptide of the third aspect is preferably for use in oral administration. The medicament of the fourth aspect is preferably for oral administration. The

administration in the method of the fifth aspect is preferably oral. In a sixth aspect, a pharmaceutical composition comprising a peptide according to the first, second or third aspect is also provided.

In a seventh aspect, medicament comprising an effective variant of human CD46 polypeptide (SEQ ID NO: 1) for use in the treatment of Helicobacter pylori infection is provided. In an eight aspect, a use of an effective variant of human CD46 polypeptide (SEQ ID NO: 1) in the manufacture of a medicament for the treatment of Helicobacter pylori infection is provided.

In a ninth aspect, a method of treatment for Helicobacter pylori infection is provided, comprising the step of administering an effective variant of human CD46 polypeptide (SEQ ID NO: 1) to a subject in need thereof, such as a subject infected with Helicobacter pylori, preferably orally.

The effective variant may be a peptide comprising amino-acids 128-151 of SEQ ID NO: 1, or an effective variant thereof. The effective variant may also be a peptide comprising amino-acids 190-216 of SEQ ID NO: 1, or an effective variant thereof.

The effective variant may have a molecular weight of less than 6000 Da.

The effective variant may be human CD46 polypeptide (SEQ ID NO: 1).

The effective variant may have bactericidal effect on Helicobacter pylori. The effective variant may have bactericidal effect on Helicobacter pylori achieving in vitro at least 50 % reduction (meaning 50 %-100 % reduction) in bacterial survival at 1 mM concentration, more preferably at 100 μΜ, even more preferably at 30 μΜ, yet more preferably at 7 μΜ, most preferably at 1 μΜ.

The effective variant may have Helicobacter pylori urease (UreA) inhibiting activity. The effective variant may have Helicobacter pylori urease (UreA) inhibiting activity in vitro achieving at least 50 % inhibition (meaning 50 % - 100 %) inhibition at 1 mM concentration, more preferably at 100 μΜ, even more preferably at 30 μΜ, yet more preferably at 7 μΜ, most preferably at 1 μΜ.

The medicament may further comprise a pharmaceutically acceptable stabilizer, carrier, excipient or diluent. The medicament may be for oral administration.

Preferably, the effective variant of the above aspects comprises a peptide having a sequence of at least 10 amino-acid residues, more preferably 15 amino-acid residues, most preferably at least 20 amino-acid residues, wherein said sequence is preferably identical to human CD46 (SEQ ID NO: 1) or a subsequence thereof. Preferably, the effective variant of the above aspects comprises a peptide having a sequence of at least 10 amino-acid residues, more preferably 15 amino-acid residues, most preferably at least 20 amino-acid residues, wherein said sequence corresponds to a mutein of human CD46 (SEQ ID NO: 1) or a subsequence thereof. Preferably, said mutein exhibits at least 50 % sequence identity with SEQ ID NO: 1, more preferably at least 60 %, even more preferably at least 70 %, yet more preferably at least 80 %, most preferably 90 %.

Preferably, the above-mentioned effective variant has a native peptide backbone.

Preferably, said peptide is a peptidomimetic. Preferably, said variant comprises amino- acid analogues or mimetics, although it may also only comprise naturally occurring amino-acids. Preferably, said variant is a functional derivate, such as having a label, such as covalently attached fluorescent label.

Detailed description of the invention

The inventors have identified a novel mechanism that contributes to Helicobacter, pylori pathogenesis which enabled the inventors to devise a novel therapy for

Helicobacter /?y/on-infection. This insight was gained by

1) Finding that H. pylori induces down-regulation of CD46 in a biologically relevant in vitro and in vivo models of microbial gastric epithelial cell interaction and CD46 transgenic mice (Example 1)

2) Identifying of a possible interaction between CD46/peptide and two H. pylori proteins UreA and AhpC (Examples 2)

3) Discovering that both rCD46 and certain peptides derived from CD46, such as P3 peptide inhibit growth as well as urease activity of H. pylori (Examples 3-5), and

4) Demonstrating that the P3 peptide eradicate bacteria from the stomach in an in vivo experimental model (Example 6).

The invention thus provides a medicament comprising human CD46 (SEQ ID NO: 1) or an effective variant thereof, for use in the treatment of Helicobacter pylori infection. In other words, the use of human CD46 (SEQ ID NO: 1) or an effective variant thereof for the manufacture of a medicament for the treatment of Helicobacter pylori infection is disclosed. In yet other words, the invention discloses a method of treatment for Helicobacter pylori infection comprising administering human CD46 (SEQ ID NO: 1) or an effective variant thereof to a subject in need thereof. The skilled person immediately realises that many variants of the human CD46 protein are effective and are made available without undue burden by the teachings of the present invention. Mere routine work by the skilled is required to synthesize and test said variants for effectiveness. The term effective variant comprises variants of human CD46 having effect in the treatment of Helicobacter pylori infection. In order to be an "effective variant" in the scope of the present invention, the variant needs to possess certain functional and structural characteristics which are elaborated below.

Functional characteristics of effective variants of human CD46 The effective variant may be a variant having bactericidal effect on Helicobacter pylori. The effective variant may have bactericidal effect on Helicobacter pylori achieving in vitro at least 50 % reduction (meaning 50 % - 100 % reduction) in bacterial survival at 1 mM concentration, more preferably at 100 μΜ, even more preferably at 30 μΜ, yet more preferably at 7 μΜ, most preferably at 1 μΜ. The bactericidal effect may be determined by the skilled person without undue burden e.g. by the methods disclosed in Examples 4 or 6.

Alternatively or additionally, the effective variant may have Helicobacter pylori urease (UreA) inhibiting activity. The effective variant may have Helicobacter pylori urease (UreA) inhibiting activity in vitro achieving at least 50 % inhibition (meaning 50 %- 100 % inhibition) at 1 mM concentration, more preferably at 100 μΜ, even more preferably at 30 μΜ, yet more preferably at 7 μΜ, most preferably at 1 μΜ. The Helicobacter pylori urease (UreA) inhibiting activity may be determined by the skilled person without undue burden e.g. by the method disclosed in Example 5.

Structural characteristics of effective variants of human CD46 The term "effective" in the context below is to be understood as possessing the functional characteristics of effective variants of human CD46 polypeptide (SEQ ID NO: 1) as set forth above.

The term "effective variants" encompasses: a) effective fragments of human CD46 polypeptide comprising subsequences of human CD46; b) effective muteins of human CD46 polypeptide or effective fragments thereof as defined in (a); c) effective fusion proteins of human CD46 polypeptide comprising human

CD46 or effective fragments thereof as defined in (a) or effective muteins thereof as defined in (b); d) effective peptidomimetics of human CD46 or effective variants thereof as defined in (a), (b) or (c); and e) effective functional derivatives of human CD46 or effective variants thereof as defined in (a), (b), (c) or (d).

Preferably, the effective variant comprises a peptide comprising a sequence of at least 10 amino-acid residues, more preferably 15 amino-acid residues, most preferably at least 20 amino-acid residues, wherein said sequence is identical to human CD46 (SEQ ID NO: 1) or a subsequence thereof.

Also preferably, the effective variant comprises a peptide comprising a sequence of at least 10 amino-acid residues, more preferably 15 amino-acid residues, most preferably at least 20 amino-acid residues, wherein said sequence corresponds to a mutein of human CD46 (SEQ ID NO: 1) or a subsequence thereof. Preferably, the effective variant has a molecular weight less than 6000 Da.

Examples of possible muteins of SEQ ID NO: 1 effective in the treatment of

Helicobacter pylori infection comprise sequences having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least at least 85%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity or any interval % identity created by a combination of any two of the above mentioned figures e.g. 70% - 99% or 80 %- 99% identity. Preferably, the mutein sequence exhibits at least 50 % (50 %-100 %) sequence identity with SEQ ID NO: 1, more preferably at least 60 %, (60 %-100 %) even more preferably at least 70 %, (70 %-100 %), yet more preferably 80 %, (80 %-100 %) and most preferably 90 % (90 %-100 %).

The above-mentioned effective variant peptide may preferably have a native peptide backbone or be a peptidomimetic. Said peptide may preferably solely comprise naturally occurring amino-acids, or comprise one, two, three, four or more amino-acid analogues or mimetic s.

Pharmaceutical compositions and administration

The medicament of the invention may further comprise a pharmaceutically acceptable stabilizer, carrier, excipient or diluent. In other words, the medicament may be a pharmaceutical composition.

The medicament (or the pharmaceutical composition) is preferably formulated for oral administration. Oral administration is an unusual way of administering peptide drugs since such drugs are usually broken down by the digestive system before being taken up. In the case of Helicobacter pylori- infection, the inventors have shown that the medicament of the invention may in fact be administered orally (see Example 6). Oral administration is preferred for reasons of convenience but in this case also has the benefit of not having to expose the entire body to high concentrations of the drug in order to achieve effective concentration in the mucous lining of the stomach where the infection to be treated primarily resides. The medicament (or the pharmaceutical composition) is preferably a known oral dosage form, including tablets, pills, capsules, powders, granules, solutions,

suspensions, mixtures and the like.

Regarding dosing regime, the skilled person can by routine experimentation determine the effective dose for treatment of Helicobacter pylori- infection. The effective dose may vary depending on the dosage form, the size of the subject, the severity of the infection and the specific bacterial strain infecting the subject.

Preferably, the effective dose is 0.01-1,000,000 nmol/kg, more preferably, 0.1-100,000 nmol/kg, even more preferably 1-10,000 nmol/kg, most preferably 100-1000 nmol/kg. Novel peptides and uses thereof

The present invention also discloses a peptide selected from the group consisting of: a) Peptides comprising the sequence as set forth in amino-acids 128-151 of SEQ ID NO: 1 ; b) Peptides comprising the sequence as set forth in amino-acids 190-216 of SEQ ID NO: 1 ; c) Peptides comprising at least 8 amino-acid residues having a sequence identical to amino-acids 128-151 of SEQ ID NO: 1 or a subsequence thereof; d) Peptides comprising at least 8 amino-acid residues having a sequence identical to amino-acids 190-216 of SEQ ID NO: 1 or a subsequence thereof; e) Peptides comprising at least 10 amino-acid residues having a sequence with at least 50 % identity with amino-acids 128-151 of SEQ ID NO: 1 or a subsequence thereof; and f) Peptides comprising at least 10 amino-acid residues having a sequence with at least 50 % identity with amino-acids 190-216 of SEQ ID NO: 1 or a subsequence thereof.

Preferably, the length of the identical sequence in c) and/or d) above is at least 10 amino-acids, more preferably at least 12 amino-acids, even more preferably at least 14 amino-acids, yet more preferably at least 16 amino-acids and most preferably at least 20 amino-acids. The maximum length of the identical sequence is 23 and 26 for c) and d), respectively.

Preferably, the length of the partially identical sequence in e) and/or f) above is at least 12 amino-acids, more preferably at least 14 amino-acids, even more preferably at least 16 amino-acids, yet more preferably at least 20 amino-acids, most preferably at least 23 amino-acids. The maximum length of the partially identical sequence is 23 and 26 for e) and f), respectively.

Preferably, the peptide has a molecular weight less than 6000 Da. Preferably, the partially identical sequence in e) and/or f) above exhibits at least 50 % (50 %-100 %) sequence identity with said amino-acids of SEQ ID NO: 1, more preferably at least 60 %, (60 %-100 %) even more preferably at least 70 %, (70 %-100 %), yet more preferably 80 %, (80 %-100 %) and most preferably 90 % (90 %-100 %). Said peptide is also disclosed for use as a medicament, preferably for use in the treatment of Helicobacter pylori infection.

Also disclosed are pharmaceutical compositions comprising said peptide.

While the invention has been described in relation to certain disclosed embodiments, the skilled person may foresee other embodiments, variations, or combinations which are not specifically mentioned but are nonetheless within the scope of the appended claims.

All references cited herein are hereby incorporated by reference in their entirety. The expression "comprising" as used herein should be understood to include, but not be limited to, the stated items. The invention will now be described by way of the following non-limiting examples.

Examples

For detailed descriptions of the methods used in the examples below, the reader is referred to relevant descriptions under the title "Materials and methods".

Example 1: H. pylori induces shedding of CD46 from human gastric epithelial cells

The interaction between human CD46 and H. pylori, was studied using AGS gastric epithelial cells, which express high levels of CD46, and three H. pylori wild-type strains, J99, HPAG1 and 26695. At 18 h post infection, all three strains adhered to AGS cells (Fig. 1A). To determine if infection of gastric epithelial cells by H. pylori resulted in modulation of CD46 expression, AGS cells were incubated with H. pylori strains at a MOI of 100 or medium alone for 18 h. Analysis by flow cytometry revealed that H. pylori infection led to more than 90% reduction of CD46 at the cell surface of all three H. pylori strains (Fig. IB). ELISA assay demonstrated higher amounts of CD46 in supernatants collected from infected cells as compared to uninfected controls (P< 0.01), (Fig. 1C). These data argue that H. pylori infection promotes shedding of CD46 from human gastric epithelial AGS cells.

Example 2: H. pylori binds to recombinant CD46 (rCD46) Since CD46 is released from gastric epithelial cells after H. pylori infection, the inventors hypothesized that H. pylori might bind CD46. The inventors generated and purified recombinant thioredoxin-CD46 fusion protein (rCD46) (Fig. 2A). The binding of rCD46 to the bacteria was assessed by three different methods; ELISA, flow cytometry and fluorescence microscopy. ELISA using H. pylori lysates and CD46 antibodies demonstrated that all strains bound to rCD46 (Fig. 2B). The binding was specific to H. pylori since lysates of E. coli or thioredoxin alone bound at much reduced levels (data not shown). In contrast, no interaction between rCD46 and Campylobacter jejuni was detected (data not shown). Flow cytometry analysis demonstrated that all three H. pylori strains bound to rCD46 even though the levels of binding varied slightly between the strains (Fig. 2C). Furthermore, changes of pH in the growth medium did not affect the interaction between H. pylori and rCD46 (data not shown). These data demonstrate that the interaction between H. pylori and rCD46 is specific.

After deposition at the cell surface, C3b binds CD46 with high affinity. To further confirm the specificity of the CD46-H. pylori interaction, a competition assay using C3b was designed. Strain J99 was selected for these studies since it showed a strong rCD46 binding (Fig. 2D). Recombinant CD46 was pre-incubated with C3b or anti- CD46 antibody for 1 h before incubation with bacteria for additional 2 h. Flow cytometry analysis showed that both C3b and CD46 antibody significantly blocked binding of rCD46 to H. pylori. These data confirm that C3b and H. pylori recognize overlapping or closely linked CD46-domains. The sites for C3b binding in CD46 have been mapped to the C-terminal complement control protein domains CCP-3 and CCP- 4, and the results here support that H. pylori also binds to these domains (Fig. 2D). Binding of rCD46 to H. pylori was also demonstrated by immunofluorescence microscopy using an anti-CD46 antibody (Fig. 2E). Unexpectedly, CD46 binding resulted in altered bacterial morphology, loss of the bacterial spiral shape, increased bacterial aggregation and bacterial lysis (Fig. 2F).

Example 3: CD46 inhibits growth otH. pylori The bactericidal effect of rCD46 on H. pylori was further evaluated by incubating H. pylori J99 with 0 to 100 g of rCD46 for 6 h. Treatment with rCD46 impaired bacterial survival in a dose dependent manner, whereas the control protein thioredoxin (Trx) had no bactericidal effect (Fig. 3A). Bacterial survival over time was investigated by incubating H. pylori with rCD46 for 0, 6, and 24 h. Clearly, bacterial survival decreased by longer incubation time (Fig. 3B). Thus, rCD46 inhibits growth of H. pylori in a dose and time dependent manner.

To understand the mechanisms behind the bactericidal effect of rCD46, H. pylori was preincubated with rCD46 for 2 h, stained with propidium iodide (PI) and analyzed by flow cytometry. PI is normally not cell permeable and stains only DNA of non- viable bacteria. Bacteria pretreated with rCD46 showed positive PI staining, suggesting permeabilization of membranes (Fig. 3C). Pi-staining was not observed for bacteria incubated with thioredoxin, or when rCD46 was pre-incubated with C3b (P<0.001). These data demonstrate that rCD46 binding to H. pylori leads to bacterial membrane leakage, and that C3b can block this bactericidal effect. Example 4: A 24 amino acid peptide of CD46 inhibits growth otH. pylori

To identify CD46 domain(s) with inhibiting activity against H. pylori, four peptides CCP1 (PI : 37-56), CCP2 (P2: 81-104), CCP3 (P3: 128-151, and CCP4 (P4: 190-216 (Intervals indicated corresponding to SEQ ID NO : 1) (Fig. 3D), corresponding to hydrophilic, potentially exposed CCPs regions of CD46 were synthesized. H. pylori was mixed with each peptide for 6 h and the bactericidal effect was evaluated. PI and P2 had no detectable effect on bacterial survival (Fig. 3E), while both peptides P3 and P4 inhibited bacterial growth. P3 was the most efficient inhibitor and 80% of bacteria were killed. To investigate the kinetics of P3-mediated bactericidal effects, the inventors incubated bacteria with P3 for 6 h at different concentrations. Peptide P3 displayed a dose dependent bactericidal effect with 40% killing at 5 μΜ, 50% killing at 7 μΜ, and 80% at 30 μΜ (Fig. 3F). These data suggest that a contact point between H. pylori and CD46 is positioned within the CCP-3 region of CD46, which is also the previously reported binding region to C3b. Taken together, a 24 amino acid peptide P3 with ability to inhibit growth of H. pylori was identified.

Mapping experiments using different fragments and variants of P3 peptide (SEQ ID NOs 22-32) were performed to further pinpoint the sequence motifs crucial for antibacterial effect. Some shorter variants such as P3-21 (SEQ ID NO: 27) and P3-22 (SEQ ID NO: 29) exhibited antibacterial effect albeit they were less effective than the parent P3 (SEQ ID NO: 18) (see Fig. 6).

The antibacterial activity of P3-21 was lost when the EVF-sequence (corresponding to residues 19-21 of P3-25) was removed (compare P3-21 to P3-18 [SEQ ID NO: 28]). It was also apparent that P3-22 lost all antibacterial activity upon removal of the PPP motif (corresponding to residues 4-6 of P3-25). Thus it could be concluded that the presence of both PPP and EVF motifs was essential for antibacterial activity.

Comparison of P3 and P3-25 makes it evident that the N-terminal L on P3-25 is not needed for the antibacterial effect since both these peptides were equally potent. In contrast, comparison of P3-22 to P3-25 shows that the CT-motif (residues 2-3 of P3- 25) significantly contributed to improved antibacterial activity. Likewise, comparison of P3-21 to P3-25 revealed that the C-terminal EYLF-motif (residues 22-25 P3-25) significantly contributed to improved antibacterial activity.

It is to be noted that both P3-15 (SEQ ID NO: 26) and P3-19 (SEQ ID NO: 30)had no measurable antibacterial activity despite comprising the N-terminal CTPPP or the C- terminal EVFEYLD motifs, respectively. This observation further supports the conclusion that both PPP and EVF-motifs are essential.

Example 5:rCD46 and peptide P3 inhibits urease activity of//, pylori

In order to find bacterial ligands that bind to CD46, a pull-down assay was performed. Whole bacterial extracts were passed through Talon affinity columns pre-conjugated with rCD46. The eluted fractions were separated by SDS-PAGE and stained with Commassie brilliant blue (Fig. 4A). Two significant bands of molecular weights 21 kDa and 26 kDa were identified by mass spectrometry as UreA and alkyl hydroperoxide reductase (AhpC encoded by the ahpC gene). The urease of H. pylori is an important virulence factor for the development of gastric infections and induction of damage at the gastric mucosa. The enzyme is composed of two subunits, UreA and UreB, and is found in the cytoplasm, the periplasm and in the membranes. Inhibition of urease activity is known to be lethal to H. pylori. Since rCD46 is bactericidal against H. pylori by binding to the bacteria, we tested if rCD46 could block urease activity. To determine this, total protein extract of H. pylori J99 was incubated with or without rCD46 and analyzed for urease activity. Pre-incubation with rCD46 for 20 min resulted in more than 95% inhibition of urease activity compared to the control (Fig. 4B).

AhpC encoded by ahpC acts as a peroxide reductase in reducing organic hydroperoxides and as a molecular chaperone for prevention of protein misfolding under oxidative stress. To further confirm that UreA and AhpC are ligands of CD46, the inventors generated a AureA mutant of strain J99 and a double AureA/AahpC mutant, but the inventors were unable to generate a single AahpCA mutant (see under Materials and Methods). The AureA mutant was significantly impaired in ability to bind rCD46, while the interaction between the double mutant and rCD46 was completely abolished, suggesting that UreA/ AhpC play an important role in interaction with CD46 (Fig. 4C). To verify that also the P3 peptide binds UreA and AhpC, P3- FITC and Pl-FITC were incubated with wild-type J99, AureA, AahpC and AureA/AahpC and analyzed by flow cytometry. The PI peptide and a random peptide did not bind to wild-type or mutants, whereas the P3 peptide bound to H. pylori in a similar pattern as rCD46, i .e. AureA bound 47%, AahpC bound 55% as compared to P3 and AureA/AahpC did not bind (Fig. 4D). To further strengthen the data, the inventors complemented the ureA and ahpC mutants, which then regained the ability to bind peptide P3. Since rCD46 and the P3-peptide had comparable bacterial killing patterns, the inventors tested if the P3-peptide could also inhibit urease activity. The P3 peptide, but not the PI peptide, inhibited urease activity of J99 (Fig. 4E). These data argue that rCD46 and peptide P3 inhibit an essential virulence property, i. e. urease activity, most likely by directly targeting UreA.

Example 6: Oral administration of P3 peptide eliminate H. pylori infection in mice

Since urease activity is essential for bacterial survival at the acidic gastric mucosa, it was next evaluated whether inhibition of urease activity by the peptide P3 might have an impact on H. pylori colonization in vivo. H. pylori strain 67:21 was used for the in vivo experiments, since this strain colonizes the gastric mucosa of mice. Strain 67:21 exhibited similar binding and interaction with rCD46 and peptide P3 as compared to J99 (data not shown). In addition, a ureA mutant in strain 67:21 demonstrated reduced binding to P3, similar to the ureA mutant of strain J99. CD46 transgenic mice were infected orally with H. pylori strain 67:21 once per day for 3 days. At 8 weeks post infection, colonization of H. pylori was confirmed before treatment. The mice were orally fed with 20 μg P3 peptide once per day for 2 weeks, and the control group mice were fed with H ₂ O in the same way. The number of viable bacterial in the stomach tissue was determined by viable counts. The non-treated mice showed high bacterial loads, whereas H. pylori could not be detected in P3-treated mice, indicating that treatment with peptide P3 cleared H. pylori from the mouse stomach (Fig. 5A). To evaluate the impact of the P3 peptide in the H. pylori induced CD46 shedding, tissue sections obtained from stomach of treated, non-treated and control mice were examined by immuno-staining with H. pylori and CD46 antibodies. H. pylori was present at the gastric surface mucosa in non-treated mice; however, P3-treated and control mice showed no detectable H. pylori (Fig. 5B). The intensity of CD46 in non- treated mice was significantly (P< 0.01) lower than that P3 treated mice (Fig. 5C). The host response elicited by H. pylori was further investigated by measuring cytokine responses, including IL-6, TNF-oc, and IL-10, in gastric mucosa by ELISA. The level of IL-10 in P3-treated mice was higher than non-treated mice, whereas IL-6 and TNF- levels did not differ significantly between the groups. The finding that there were significantly increased IL-10 levels in the gastric tissues of treated mice, suggests that P3 supplementation may reduce inflammation response (Fig. 5D). Taken together, the data reveal that CD46 peptide P3 show an in vivo bactericidal effect and that supplementation of P3 can enhance anti-inflammatory response in host.

Materials and methods

Bacterial strains, cell lines, and growth condition

H. pylori strains J99 (ATCC 700392) and 266995 (ATCC 700824) were from American Type Cell Collection (ATCC). H. pylori HPGA1 has been previously described (Oh, J.D., et al. The complete genome sequence of a chronic atrophic gastritis Helicobacter pylori strain: evolution during disease progression. Proc Natl Acad Sci U S A 103, 9999-10004 (2006)). The bacteria were grown on Columbia blood agar plate (Becton Dickinson) supplemented with 8% horse blood (SVA) and 8% horse serum (SVA) at 37°C in a 10% CO ₂ and 5% O ₂ atmosphere. To prepare liquid cultures, bacteria were collected from blood agar and suspended into brucella broth (Becton Dickinson) containing 8% horse serum and 5ml/L isovitox (Becton Dickinson) and incubated for 24 h. The concentration of bacteria was determined by measuring the optical density at 600 nm using a spectrophotometer (Bio-rad). The human gastric cell line AGS (ATCC C L-1739) was obtained from American Type Cell Collection (ATCC). Cells were maintained in RPMI (Gibco) supplemented with 10% heat- inactivated fetal bovine serum (FBS, Sigma), 2 mM L-glutamine (Invitrogen).

Adherence assay AGS cells were grown without antibiotics in a 24-well cell culture plate and the cell medium was changed prior to infection. H. pylori strains were grown overnight in brucella broth, washed with PBS, re-suspended in cell medium and added to the AGS cells to achieve multiplicity of infection MOI of 100: 1, and allowed the bacteria to adhere for 18 h. The cells were washed three times with PBS to remove unbound bacteria. The cells were then incubated with 1% saponin for 5 min, serially diluted and spread on Columbia blood agar plates. Colony forming units were enumerated 3-5 days after plating.

Flow cytometry assay AGS cells were grown in a 6-well dish to 80-90% confluent and the cell media changed to fresh medium prior to infection. Bacteria were prepared as described previously and were added with MOI of 100: 1. At 18 h post infection cells were collected by trypsinization, washed twice with PBS, centrifuged for 5 min at lOOOxg. The pellets were re-suspended in PBS containing polyclonal antibody against CD46 (H-294, Saint Cruse, diluted 1 :200) and incubated 45 min at 4°C. Cells were washed in PBS and re-suspended in secondary anti-rabbit IgG antibody (Alexa 488, Invitrogen, diluted 1 :400) in PBS and incubated 45 min on ice. Cells were washed twice in PBS, fixed with 4% paraformaldehyde, washed and analyzed by flow cytometry. Data were further processed by Cellquest Pro software (Becton Dickinson). Flow cytometry of rCD46 binding. H. pylori at log phase were pre-incubated with rCD46 for 2 h at 37°C at final concentration of 30 g/ml. Unbound rCD46 was removed by washing with PBS and rCD46 binding was analyzed as above. For the interaction between FITC-P3 peptide (30 μΜ) and H. pylori was conducted and analyzed as rCD46 binding.

Preparation of cell culture supernatants AGS cells were grown in a 6-well dish to 80-90% confluent and the cell media was changed 24 h prior to infection. Bacteria were prepared as described previously and were added at MOI of 100: 1. The supernatants of infected and non- infected cells were collected at 24 h, concentrated, and re-suspended in 100 mM bicarbonate buffer (pH 9.5). Subsequently, 100 μΐ of each suspension was added into wells of an ELISA plate (Nunc, oskilde, Danmark) and incubated overnight at 4°C. Wells were blocked with 5% skim milk, and washed with PBS. CD46 was identified by incubation with a polyclonal antibody against CD46 (H-294, Santa Cruz Biotechnologies, diluted 1 :5000 followed by horseradish peroxidase (HRP)-conjugated goat anti-rabbit antibody (170- 6515, BioRad, diluted 1 :4000). After adding substrate was added and the A ₄₅₀ was measured. Experiments were repeated twice in triplicates and the mean and standard deviation were calculated.

Purification of rCD46 and affinity chromatography

Recombinant CD46 comprising amino-acids 1-293 of SEQ ID NO: 1 was expressed in E. coli and purified. Briefly, a fusion protein composed of the thioredoxin and the extracellular region of CD46 was purified over a column according the manual (GE healthcare, Sweden).

The complete extracellular region of the CD46-BC1 isoform was PCR amplified with forward primer 5 '-CACCTGTGAGGAGCCACCAACATT-3 ' (SEQ ID NO: 2) and reverse primer 5 ' - ATCCAAACTGTCAAGTATTCCTTCCTC-3 ' (SEQ ID NO: 3), and ligated into TOPO expression vector pET102D. The recombinant trx-CD46-6xhis protein was produced by BL21 (DE3) E.coli strain and purified with Talon metal affinity resin according to the manual. Briefly, the cells were cultured for 4 to 6 h at 37°C in LB medium with 200 g/ml ampicillin. At OD ₆₀ o=0.6-0.8, the culture was induced by 0.5 mM IPTG for additional 4 h. Bacteria were harvested and incubated for 20 min RT in lysis buffer containing 50 mM Tris, 50 mM NaCl, 10 mM MgCl ₂ , 5 mM imidazole and lysozyme 5 mg/ml. The mixture were incubated in 0.1 mM PMSF and 1 U/ml DNase at RT for 5 min, sonicated and centrifuged at 15 000 g for 1 h. Protein was purified over a Talon resin column, and eluted with 200mM imidazole. The thioredoxin control protein was produced by BL21 (DE3) host cell contain pET32a+ vector and purified. Protein purity was checked on an SDS-PAGE gel.

Affinity chromatography

Cell extract of H. pylori strain J99 (10 ⁸ bacteria/ml) was prepared as described previously (Nagata, K., Satoh, Η., Iwahi, T., Shimoyama, T. & Tamura, T. Potent inhibitory action of the gastric proton pump inhibitor lansoprazole against urease activity of Helicobacter pylori: unique action selective for H. pylori cells. Antimicrob Agents Chemother 37, 769-774 (1993)). Cell extract was loaded onto an affinity Talon column conjugated with rCD46, after washing the fractions were eluted according to rCD46 purification method. Protein fractions were separated by a 12% SDS-PAGE and stained with Coomassie blue. Two bands of molecular weight of 20 and 28kDa were excised from the gel and identified by mass spectroscopy.

ELISA analysis of the interaction between rCD46 and H. pylori

H. pylori was grown overnight in brucella broth and cells were harvested by centrifugation, washed three times with PBS, and re-suspended in 100 mM bicarbonate buffer (pH 9.5) to achieve 10 ⁷ cfu/ml. Subsequently, 100 μΐ of each suspension was aliquated into wells of an ELISA plate (Nunc, oskilde, Danmark) and incubated overnight at 4°C. Wells were blocked with 5% skim milk, washed with PBS, and incubated with 100 μΐ of recombinant CD46 (2.5 g/ml) for 1 h, followed incubation with the polyclonal antibody against CD46 (H-294, Santa Cruz Biotechnologies, diluted 1 :5000). Incubation with primary antibody was followed by horseradish peroxidase (HRP)-conjugated goat anti-rabbit antibody (170-6515, BioRad, diluted 1 :4000). After washing with PBS, substrate was added and the absorbance at 450 nm was determined. Experiments were repeated twice in triplicate and the mean and standard deviation were calculated.

Fluorescence microscopy

For microscopic analysis, rCD46 was incubated with H. pylori strains and stained according to the procedure for flow cytometry. The images were taken with a CCD camera at 63 x magnification with an inverted fluorescent microscope (Zeiss Cellobserver Axiovert). Images were further processed by cellvision software and adobe photoshop software.

Bactericidal assay

H. pylori J99 on agar plates were suspended in brucella broth and diluted approximately 10 ⁵ cfu/ml. Two hundred microliter of the bacterial suspension was incubated with rCD46 (final concentration of (30 g/ml) for 0, 6 or 24 h with slight shaking. Thioredoxin and PBS were used as control. Bacteria were serial diluted and plated on Columbia Blood Agar plates and incubated for 4-7 days before enumerization. H. pylori was incubated with (30 μΜ) of CD46 domains (CCPl-4), or in other experiment, H. pylori was incubated with various concentrations of various CD46-derived synthetic peptide and the growth of the bacterium was monitored as above.

Competition Assay

H. pylori strains were grown overnight and diluted to approximately 10 ⁶ cfu/ml. rCD46 (final concentration of 30 g/ml) was pre-incubated for 1 h with 2.5 g/ml of C3b (Calbiochem, CA, USA), or with 2 g/ml of CD46 antibody (H-294, Santa Cruz Biotechnologies) followed additional 2 h incubation with H. pylori. As control H. pylori was incubated with final concentration of (30 g/ml) of rCD46 alone. The samples were fixed, stained with CD46 antibody and analyzed by flow cytometry as previously.

To evaluate bacterial permeabilization, rCD46 (30 g/ml) was pre-incubated with 2.5 g/ml of C3b for 1 h, followed additional 2 h incubation with H. pylori. Bacteria were stained with PI according manufactures protocol (BD Biosciences) and analyzed by flow cytometry (FACSAria). The untreated population and/or thioredoxin were used to define the basal level of dead cells. The percentage of permeabilized cells was then determined by subtracting the percentage of cells in the untreated population from percentage in the treated population.

Urease activity assay

To measure the urease activity, we used as described previously. ⁴⁰ Briefly, strain J99 grown over night to 10 ⁸ cfu/ml. Bacteria were harvested, washed and re-suspended with ice-cold de-gassed 20 mM of sodium phosphate (pH 6.8). The suspension was sonicated for 3 min in 30 s pulses with ice cooling, centrifuged at 10 000 g for 20 min to remove cell debris. The supernatant was used for the urease activity assay. One μg of protein was incubated with final concentration of (30 g/ml) of rCD46 or P3- peptide for 2 h at 37°C. After incubation, 100 μΐ of 50 mM phosphate buffer pH 6.8 containing 50 mM urea, 0.02% phenol red was added to each well. The colour change was monitored at 560 nm with micro-plate reader. Percentage inhibition was determined by the following equation: % inhibition = [activity without rCD46] - [activity with rCD46] / [activity without rC46] x 100. Peptide synthesis of CD46 domains

CD46 domains corresponding to the region (amino acids in relation to SEQ ID NO: 1) 32-56 in CCP-1, 81-105 in CCP-2, 128-151 in CCP-3, 190-216 in CCP-4, FITC-32- 56, CCP1, and N-terminal FITC-CCP-1 128-151 in CCP-3 were synthesized by Peptide 2.0, Inc (http://www.peptide20.com). A variant of peptide P3 (P3-25) with an additional leucine (L) at the N-terminus was also synthesized. Various derivatives of P3-25 were synthesized and had the amino acid sequences shown in Figure 6. All the peptides were 90-95% pure. Peptides were re-suspended in PBS and stored at -20°C prior to use. Peptides were subsequently diluted in brucella broth or water to the working concentration.

Animal and experimental protocol

The hCD46Ge transgenic mouse line (CD46 +/+C57BL/6) was created using B6C3F1 hybrids. All mice were bred under standard conditions in the animal facility at Stockholm University. Animal care and experiments were in accordance with institutional guidelines and have been approved by national ethical committees. Six to eight weeks old mice (n=24) were administered orally with 0.1 ml of H. pylori 67:21 (10 cfu/ml once per day for 3 days interval. Uninfected control mice were (n=10) dosed with 0.1 ml of PBS in a similar way. At 8 weeks post infection, infected mice were divided into two groups; one group was inoculated orally with 100 μΐ 20 μΜ P3- peptide, the other group with 100 μΐ of PBS, once per day for 2 weeks. All mice were anesthetized and sacrificed two weeks after treatment. The abdomen was opened by a midline incision and the stomach was isolated and cut along the greater curvature. The gastric contents were gently washed out with saline. Two longitudinal strips with a width of 3-5 mm were taken: one for H. pylori culture and another for histological evaluation. Stomach tissues were homogenized in Brucella broth, colonization was determined by plating dilutions on blood agar plates containg (200 g/ml) and nalidixic acid (10 g/ml). Plates were incubated for 4 -7 days and H. pylori colonies were identified by their morphology and urease. For histological evaluation, the stomach tissues were fixed in 4% paraformaldehyde and embedded in paraffin. For detection of H. pylori and CD46 level, the tissue sections were incubated with mouse antibody against H. pylori (sc-65454, diluted 1 :50) and rabbit antibody against CD46 (Η94, Santa Cruz, diluted 1 :50) for 60 min, followed Alexa 488 anti-mouse IgG and Alexa 593 conjugated goat anti-rabbit IgG (diluted 1 :50; invitrogen) as a secondary antibodies. Sections were visualized with Carl Zeiss Axio Vision 2.05 image processing and analysis system (Zeiss).

Measurement of interleukin IL-6, IL-10 and TNF-d in stomach tissues

The stomach was homogenized in Brucella broth, and supernatants were collected, aliquoted, and stored in -80 °C, The levels of IL-6, IL-10 and TNF-oc were measured using a commercial ELISA kits from Invitrogen (IL-6, CMC0063, IL-10, CMC0103, and TNF-oc, CMC3013) following manufacturer's instructions. Each sample was measured in duplicate.

Generation of H. pylori AureA mutant

Chloramphenicol resistant gene (CAT) was PCR amplified from pACY184 using primers: Catl (5'-CACTACGCTGGAAAATCAGTAAGTTGGCAGCATCACCCG-3', SEQ ID NO: 4) and Cat2 (5'-TTTAGCACCATGCCAGGCGTTTAAGGGCAC CAATAA-3', SEQ ID NO: 5).

H. pylori J99 genomic DNA was isolated by washing cells scraped from 48 h plates, re-suspending them in 2.0 ml of Qiagen Genomic DNA kit as per manufacture's instructions. Two pairs of wre^-specific primers: Ul (5'-TTGGCGCTGGGGTTTCTAATGT-3') SEQ ID NO: 6, U2 (5'- ACTTATACTGATTTTCCAGCGTAGTGGAGCATCAACTT-3') SEQ ID NO: 7 and U3 (5'-CTTAAACGCCTGGCATGGTGCTAAAAGCATGACAAC-3') SEQ ID NO: 8, U4 (5'- CGCTTGCAAAAGCTGTAGGGAT-3') SEQ ID NO: 9, were used to PCR amplify the up- and downstream regions, respectively of each target gene. PCR products were purified using Qiagen Gel purification kit. The primers were designed with overlapping homologies at the ends. The different PCR fragments were ligated in two steps PCR reactions, five cycles without any primers added followed by 30 cycles with two primers. The construct was introduced into H. pylori J99 by transformation, by scraping cells from 48 h into 0.2 ml brucella broth (Becton Dickinson) and spotting 100 μΐ (lxl 0 ⁸ bacteria/ml) onto Columbia blood agar plates. After incubation with 150 ng of purified DNA product, the transformed cells mixture were spread over the plates and incubated for further 24 h. The cells were then scraped onto selective Columbia blood agar plates containing 15 g of chloramphenicol/ml and incubated for 3 to 7 days. The clones were confirmed by PC , western blot and urease activity test.

H. pylori AureA/AahpC mutant

The alkyl hydroperoxide reductase gene was inactivated with a kanamycin resistance gene and used to transform the AureA deficient mutant of H. pylori J99. The kanamycin resistance gene was amplified from pDONR, P4-P1 with the primers kan- fwd (5 ^, -GCCTGC:CGTTTTGTATTAGTGACCTGTAGAATTCGAGC-3', SEQ ID NO: 10) and kan-rev (5 ~ACCGCCTTGGTGTTAGAAAAACTCATCGAGCATCA AATG-3', SEQ ID NO: 1 1). The upstream region of the ahpC gene was ampli fied with the primers ahpC ups-fwd ( -M VAC i GC!VATGGG TTTAA ! GCC -.} ^* . SEQ ID NO: 12) and ahpC /// v-rev (5 -GGTC ACTAATAC AAAACG G C AG G C GCTTTAA A ATCGG-3', SEQ ID NO: 13). The downstream region of the gene was amplified with the primers ahpC ds-fwd (S'-TGAGTTTTTCTAACACCAAGGCGTTGC AG AGTATCTT-3 SEQ ID NO: 14) and ahpC ώ-rev (5'~ CATTTTTCTGTCCAAATTAAACCG-3', SEQ ID NO: 15). The primers were designed to have overlapping ends, The three different PGR fragments were ligated in a PCR done in one step: (i) 7 cycles without any primers added followed by (ii) 35 cycles with the primers ahpC ups-fwd and ahpC ds-mv. The fragment obtained was incorporated into AureA deficient H. pylori as above by selective plate (10 g/ml kanamycin and 10 g/ml chloramphenicol). Positive transforrnants were confirmed by PCR using the primers ahpC-fwd (5 ^, -CCACAAAGGϊTACCACAAGATCAGG-3 ^, , SEQ ID NO: 16) and ahpC xev (5'-CAGCAATCACTGAGCGTTTTTTAAGG-3', SEQ ID NO: 17). Generation of H. pylori AahpC mutant and its complement. The ahpC gene was inactivated with a kanamycin resistance gene and used to transform H. pylori as described above. For complementation, the complete ahpC gene including downstream regions was amplified with primers (5'- GGGCACCAATAACCGCTGATTGAGTGGAAAGCAT -3' and 5'- AAGATACTCTGCAACGCCTTGGTG-3'; SEQ ID NOs 33 and 34, respectively). A region upstream of aphC was amplified with primers 5'- ATCACTGCTCATGGGTTTAATGCG-3' (SEQ ID NO: 35) and 5'- ACTTACTGATTTTCCTAAAACGGCAGGCGCTTTAAAA-3' (SEQ ID NO: 36), and a chloramphenicol resistant gene from pACY184 was amplifiedusing primers 5'- GCCGTTTTAGGAAAATCAGTAAGTTGGCAGCATCACCCG-3' (SEQ ID NO: 37) and 5'- CTCAATCAGCGGTTATTGGTGCCCTTAAACGCCTGG-3' (SEQ ID NO: 38). The primers were designed to have overlapping ends and fused together by a PCR done in one step as described above. The fragment obtained was incorporated into AahpC deficient H. pylori as above by selective plate with 15 g/ml Chloramphenicol. Positive transformants were confirmed by PCR using ahpC primers (AhpCfwd: 5'- CCATATGTTAGTTACAAAACTTGCC-3'; SEQ ID NO: 39 and AhpCrev: 5'- CTCGAGAAGCTTAATGGAATTTTC -3'; SEQ ID NO: 40).

Statistical analysis

ANOVA one-way analysis was used to assess significance. All experiments were performed in triplicates in sets of at least two independent experiments.