WU, Rong-Tsun (No. 155, Sec. 2 Linong Street, Taipei 112, 112, TW)
| C LAIMS What is claimed is: I . Use of a compound of the formula ( 1 ) (I) . characterized in that R is a glycosyl group, for a preparation of a medicament for enhancing erythropoietin formation, wherein the medicament is administered in a therapeutically effective amount to a subject in need thereof. 2. The use of claim I . wherein the glycosyl group is a monosaccharide selected from the group consisting of dihydroxyacetone, glucose, galactose, glyceraldehydes, threose. xylose, mannose. ribose, ribulose, xylulose, tagatose. psicose (allulosej. fructose, sorbose, rhamnose. erythrose. erythrulose. arabinose. lyxose, allose. altrose. gulose, idose and talose. 3. The use of claim I , wherein the compound of the formula H ) is administered for enhancing erythropoietin formation in a tissue and or organ selected from the group consisting of bone marrow, liver, kidney, and any combinations thereof. 4. Use of a compound of the formula (I ) (I) . characterized in that R is a jilycosyl group, for a preparation of a medicament for treating a disease and/or disorder in a subject that would benefit from erythropoietin treatment, wherein the medicament is administered in a therapeutically effective amount. 5. The use of claim 4, wherein the glycosyl group is a monosaccharide selected from the group consisting of dihydrox} acetone, glucose, galactose, glyceraldehydes. threose. xylose, mannose. ribo.se. ribulose. xylulose, tagatose. psicose (alHilose), fructose, sorbose, rhamnosc, ervthrose. erythrulose, arabinose, lyxose. allose. altrosc, gulose. idose and talose. t>. The use of claim 4. wherein the disease and or disorder is at least one selected from anemia, a renal failure, and erythropoiesis deficiency-related diseases. 7. The use of claim 4, wherein the disease and/or disorder would benefit from an erythropoietin-related protective effect. 8. The use of claim 7. wherein the erythropoietin-related protective effect is at least one selected from neuroprotection, cardiovascular protection, renoprotective effect, and protections from tissue ischemia and ischemia/reperfusion injury. °. Use of a compound of the formula (I) (1) , characterized in that R is a glycosyl group, for a preparation of a medicament for enhancing erythropoiesis. wherein the medicament is administered in a therapeutically effective amount to a subject in need thereof. The use of claim 9, wherein the glycosyl group is a monosaccharide selected from the group consisting of dihydroxyacetone. glucose, galactose, glyceraldehydes. threose. xylose, mannose. ribose. ribulose, xylulose, tagatose, psicose (allulose), fructose, sorbose, rhamnose. er\ throse, erythrulose, arabinose. lyxoso, allose. ahrose, gulose, idυse and talose. Use of a compound of the formula (I) (I) . characterized in that R is a glycosyl group, for a preparation of a medicament for enhancing kidney function, wherein the medicament is administered in a therapeutically effective amount to a subject in need thereof. The use of claim I I , wherein the glycosyl group is a monosaccharide selected from the group consisting of dihydroxyacetone. glucose, galactose, glyceraldehydes, threose, xylose, mannose. ribose, ribulose, xylulose, tagatose, psicose (allulose). fructose, sorbose, rhamnose. erythrose. erythrulose, arabinose. lyxose, allose. altrose, gulose, idose and talose. Use of a compound of the formula (I) (I) . characterized in that R is a glycosyl group, for a preparation of a medicament for enhancing expression of hepatocyte growth factor, wherein the medicament is administered in a therapeutically effective amount to a subject in need thereof. The use of claim 13, wherein the glycosyl group is a monosaccharide selected from the group consisting of dihydroxyacetone. glucose, galactose, glyceraldehydes, threose, xylose, mannose. ribose, ribuloso, xylulose, tagatose, psicυse (allulose). fructose, sorbose. rhaninose. erythrose. erythrulose, arabinose. lyxose, allose, altrose. gulose, idose and talose. Use of a compound of the formula ( I ) . characterized in that R is a glycosyl group, for a preparation of a medicament for treating a disease and/or disorder in a subject that would benefit from hepatocyte growth factor treatment, wherein the medicament is administered in a therapeutically effective amount. The use of claim 15. wherein the glycosyl group is a monosaccharide selected from the group consisting of dihydroxyacetone, glucose, galactose, glyceraldehydes, threose, xylose, mannose, ribose, ribulose, xylulose, tagatose, psicose (allulose), fructose, sorbose, rhamnose, er\ throse. erythrulose, arabinose, lyxose. allose. altrose, gulose. idose and talose. The use of claim 15, wherein the disease and/or disorder is at least one selected from ihe group consisting of a liver disease, a kidney disease, a lung disease, a cardiovascular disease, a digestive disease, a nerve disease, a bone disease, a joint disease, a muscular disease, a skin disease, crush syndrome, allergic inflammation, and any combinations thereof. 20 |
TECHNICAL FIELD
The present invention relates generally Io erythropoiesis, and more specifically to enhancement of erythropoiesis. BACKGROUND
Chronic kidney disease (CKD) is a worldwide public health problem with adverse outcomes of kidney failure, cardiovascular disease and premature death (Levey, 2005). Patients with CKD are at high risks for progression to the end stage renal disease and need the dialysis or kidney transplantation to maintain a long-term survival. Anemia, an early symptom of CKD, results from underproduction of endogenous erythropoietin (Epo) by kidney (Zar/ecki et al., 2004). In addition to CKD, anemia is also associated with other diseases, such as cancer, acute and chronic infections, autoimmune, inflammation and chronic rejection after solid-organ transplantation {Weiss and Goodnough, 2005).
Epo is a glycoprotein hormone mainly produced in adult kidney and fetal liver. Epo exerts its effect by binding to erythropoietin receptor (Epo receptor) on cell surface. When cells sense a relatively low oxygen level (such as the hypoxia), Epo is produced and released to regulate proliferation, differentiation, maturation, and survival in erythroid lineage cells (Moritz et al., 1997 and Fisher, 2003). Abnormal Epo levels in bloodstream may be an indicator for bone marrow and renal diseases. Relatively low Epo levels have been seen in patients with CKD, primary polycythemia rubra vera and chemotherapy-induced anemia. Relatively high Epo levels have been seen in secondary polycythemia and renal cancer patients (Eckardt and Kurtz, 2005 and Modges et ciL, 2007).
Besides being produced in kidney and liver tissues, Epo and its receptors have been found in non-erythroid tissues and organs, including brain, eye, heart, lung, gut, pancreas, muscle, uterus and gonads (Eckardt and Kurtz, 1992). Epo-Epo receptor signaling contributes to wound healing responses, angiogenesis and local tissue-protective functions, such as neuroprotections, cardiovascular protections and protections from tissue ischemia and ischemia/reperfusion injury (Paschos et al., 2008 and Arcasoy, 2008). It has been reported that Epo has renoprotective effects by reducing the extent of renal dysfunction and facilitating the recovery from cisplatin-induced acute renal failure ( Sepodes et al..2006 and Arcasoy, 2008 }.
Erythropoiesis-stimulating agents (ESAs) are recommended by the National Kidney Foundation Kidney Disease Outcomes Quality Initiative guidelines to treat anemia of CKD in patients with treatment-responsive anemia. Recombinant human Epo (rHuEpo) has been approved for treating anemia of CKD, anemia in cancer patients receiving chemotherapy, for reducing transfusion requirements during surgery and for treating anemia in zidovudine-treated patients infected with human immunodeficiency virus. A novel erythropoiesis-stimulating protein (NESP), designed from Epo with a longer plasma half-life, has been approved for treating anemia in chronic renal failure (Fisher, 2003). ft has been recommended that intravenous (i.v.) or subcutaneous (s.c.) administration of these ESAs be more than once per week for maintenance therapy. The pain, inconvenience due to frequent injections, and development of anti-Epo antibodies because of inherent antigenicity associated with rHuEpo are of a great concerned (Bunn, 2007). Moreover, ESAs pose safety risks in patients with higher hemoglobin levels and may cause complications such as hypertension, thromboembolism, iron deficiency and severe pure red-cell aplasia (Wish and Coyne, 2007).
Therefore, a heretofore unaddressed need exists in the art to address the aforementioned deficiencies and inadequacies, especially in connection with ervthropoiesis and kidney functions.
SUMMARY OF THE INVENTION In one aspect, the invention relates to use of a compound of formula (I)
, characterized in that R is a giycosyl group, for a preparation of a medicament for enhancing erythropoietin formation. The use includes administering a therapeutically effective amount of the medicament to the subject in need thereof.
The giycosyl group is a monosaccharide selected from the group consisting of dihydroxyacetone, glucose, galactose, glyceraldehydes, threose, xylose, mannose. ribose. ribuiose, xylulose, tagatose, psicose (aliuiose), fructose, sorbose, rhamnose, erythrose, erythruiose. arabinose, lyxose. allose, altrose, gυiose, idose and talose.
The aforementioned compound of the formula (I) is administered for enhancing erythropoietin formation in a tissue and/or organ selected from the group consisting of bone marrow, liver, kidney, and any combinations thereof.
In another aspect, the invention relates to a use of the aforementioned compound of the formula (I) for a preparation of a medicament tor treating a disease and/or disorder that would benefit from erythropoietin treatment. The use includes administering a therapeutically effective amount of the medicament to the subject in need thereof,
The disease and or disorder is at least one selected from anemia, a renal failure, and erythropoiesis deficiency-related diseases. The disease and/or disorder would benefit from an eryihropoieiin-related protective effect.
The erythropoietin-related protective effect is at least one selected from neuroprotection, cardiovascular protection, renoprotective effect, and protections from tissue ischemia and isc hemia/reperfusion inj my .
In another aspect, the invention relates to use of the aforementioned compound of the formula (I) for a preparation of a medicament for enhancing erythropoiesis. The use includes administering a therapeutically effective amount of the medicament to the subject in need thereof.
Further in another aspect, the invention relates to use of the aforementioned compound of the formula (1) for a preparation of a medicament for enhancing kidney function. The use includes administering a therapeutically effective amount of the medicament to the subject in need thereof. Yet in another aspect, the invention relates to use of the aforementioned compound of the formula ( J) for a preparation of a medicament for increasing the expression of hepatocyte growth factor. The use includes administering a therapeutically effective amount of the medicament to the subject in need thereof.
In another aspect, the invention relates to use of the aforementioned compound of the formula (I) for a preparation of a medicament for treating a disease and/or disorder a subject that would benefit from heputocyte growth factor treatment. The use includes administering a therapeutically effective amount of the medicament to the subject in need thereof.
Further in another aspect, the invention relates to a use of the aforementioned compound of the formula (I) lor a preparation of a medicament for treating a disease and or disorder through regulating the expression of hepatocyte growth factor. The use includes administering a therapeutically effective amount of the medicament to the subject in need thereof
The disease and/or disorder is at least one selected from the group consisting of a liver disease, a kidney disease, a lung disease, a cardiovascular disease, a digestive disease, a nerve disease, a bone disease, a joint disease, a muscular disease, a skin disease, crush syndrome, allergic inflammation, and any combinations thereof.
The liver disease is at least one selected from the group consisting of acute hepatitis, liver cirrhosis, fulminant hepatitis, fatty liver and surgical treatments for liver transplantation, partial resection and ischemia. The kidney disease is at least one selected from the group consisting of kidney fibrosis, acute renal failure, chronic renal failure, diabetic nephropathy and surgical treatments for renal transplantation and ischemia.
The chronic renal failure is at least one of nephritic syndrome and obstructive nephropathy. The lung disease is at least one selected from the group consisting of acute pneumonia, pulmonary fibrosis and surgical treatments for lung transplantation, partial resection and ischemia.
The cardiovascular disease is at least one selected from the group consisting of inflammation-mediated heart disease, angina, cardiac infarction, cardiomyopathy and atherosclerosis obliterans. The inflammation-mediated heart disease may include a cardiac allograft rejection and myocarditis.
The digestive disease is at least one selected from the group consisting of intestinal mucosal injury, inflammatory bowel disease, gastric ulcer and diabetes mellitus.
The nerve disease is at least one selected from the group consisting of cerebrovascular disease, neurodegenerative disease, spinal cord injury, diabetic retinopathy, peripheral neuropathy, spinal canal stenosis and deafness.
The cerebrovascular disease is at least one of transient ischemic attack and stroke. The neurodegenerative disease is at least one selected from the group consisting of amyotrophic lateral sclerosis. Alzheimer ' s disease and Parkinson's disease. The bone disease and joint disease may include osteoarthritis and. or rheumatoid arthritis.
The muscular disease may be muscular dystrophy and. or muscular atrophy The skin disease is at least one selected from the group consisting of skin ulcer, burn and scleroderma.
These and other aspects will become apparent from the following description of the preferred embodiment taken in conjunction with the following drawings, although variations and modifications therein may be affected without departing from the spirit and scope of the novel concepts of the disclosure.
The accompanying drawings illustrate one or more embodiments of the invention and. together with the written description, serve to explain the principles of the invention. Wherever possible, the same reference numbers are used throughout the drawings to refer to the same or like elements of an embodiment.
BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows Compound A enhances hemoglobin levels in bone marrow cells. FIG. 2 shows Compound A activ ates erythroid progenitor cell proliferation using burst- forming units-erythroid ( BPU-E) assay on bone marrow cells.
FI(U. 3 shows Compound A increases the expression of erythropoietin (Epo) in kidney tissue. FIG. 4 shows Compound A increases the expression of erythropoietin (Epo) in hepaiocytes.
FIG. 5 shows Compound A increases the number of red blood cells in a cisplalin-indueed acute renal failure animal model.
FIG. 6 shows Compound A decreases serum blood urea nitrogen levels in a cisplatin- induced acute renal failure animal model. FIG 7 shows Compound A increases ihe number of red blood cells in a eisplaiin-induced acute renal failure animal model at day 23. The horizontal arrow represents Compound Λ treatment (mg Kg. day).
RG. 8 shows Compound A decreases serum blood urea nitrogen levels in a cisplatin- indueed acute renal failure animal model at day 23. The horizontal arrow represents Compound A treatment ( mg. Kg/day ).
FlG. 9 shows Compound A increases the expression of erythropoietin ( . Epo) in a cisplatin- induced acute renal failure animal model. The horizontal arrow represents Compound A treatment (ing'Kg day).
FIG. 10 is a graph showing Compound A increases the expression of hepalocyte growth factor (HGP) in liver tissue in a cisplatin-induced acute renal failure animal model. The horizontal arrow represents Compound A treatment (mg Kg day).
RG. 1 1 shows Compound A activates erythroid progenitor cell proliferation as determined in burst-forming units-crythroid (BFU-E) assay on bone marrow cells in a cisplatin-induced acute renal failure animal model. The horizontal arrow represents treatment with Compound A (mg Kg/day).
DETAILED DESCRIPTION OF THE INVENTION
The terms used in this specification generally have their ordinary meanings in the art, within the context of the invention, and in the specific context where each term is used. Certain terms that are used to describe the invention are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner regarding the description of the invention. For convenience, certain terms may be highlighted, for example using italics and/or quotation marks. The use of highlighting has no influence on the scope and meaning of a term: the scope and meaning of a term is the same, in the same context, whether or not it is highlighted. It will be appreciated that same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein, nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are provided. A recital of one or more synonyms does not exclude the use of other synonyms. The use of examples anywhere in this specification including examples of any iernis discussed herein is illustrative only, and in no way limits the scope and meaning of the invention or of any exemplified term. Likewise, the invention is not limited to various embodiments given in this specification.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the case of conflict, the present document, including definitions will control.
As used herein, "around", "about" or "approximately" shall generally mean within 20 percent, preferably within I O percent, and more preferably within 5 percent of a given value or range. Numerical quantities given herein are approximate, meaning that the term "'around", "about" or "approximately" can be inferred if not expressly stated. Examples
Without intent to limit the scope of the invention, exemplary instruments, apparatus, methods and their related results according to the embodiments of the present invention are given below, Note that titles or subtitles may be used in the examples for convenience of a reader, which in no way should limit the scope of the invention. Moreover, certain theories are proposed and disclosed herein; however, in no way they, whether they are right or wrong, should limit the scope of the invention so long as the invention is practiced according to the invention without regard for any particular theory or scheme of action.
Example 1 Purification of Compound A Two kilograms of dry Polygonum multiflorum were ground in a pulverizer and the ground material was immersed in 2 liters of S5°ό (y v) ethanol overnight to form a reaction solution. The reaction solution was collected, and another 2 liters of 85% iv.v) ethanol were added to the ground Polygonum multiflorum residue for further extraction according to the aforementioned procedure. The ethanol extraction was repeated for additional three times. The collected solution was filtrated using a gas-extracting apparatus {with Whatman #l filter papers), and followed by concentration in a rolavapor ( Buchi ) ai 40 'C to a six-fold reduction in volume. The concentrated filtrates were pooled together and partitioned 5 times with '/-hexane/Η 2 O= l : I (total 5 liters). The aqueous phase was collected and further partitioned 6 times with ethyl acetate water. EtOAc /Η 2 O= l : I (total 6.5 liters), to obtain EtOAc layer. Six EtOAc layers were pooled together and concentrated, and the concentrate was dried in Freeze Dryer (Kingmech, Taiwan) to obtain the EtOAc extract (called "PoMuEPe' ). The PoMuEPe was chrαmatographed on a Diaion' HP-200 column (4.8 x60 cm; Mitsubishi Chemical) with a Methanol: HbO !!! 50:50 solvent system at a flow rate of 2 ml min. Fractions were collected, concentrated, dried and assayed for the ability to enhance hemoglobin formation. Fractions exhibiting activities were collected and called PoMuEPeD9. PoMuEPeD9 was chroma lographed on a Sephadex™ L H 20 column (2.6 - 100 cm: GE Healthcare Life Science) with a Methanol:H:O=100:0 solvent system at a flow rate of 1 ml. min. Fractions were collected, concentrated, dried and assayed for their abilities in enhancing hemoglobin formation. Fractions showing bioactivity were collected and called PoMuEPeD9 Ll 1. The chemical structure of the major component in PoMuI-PeD9H, 1 1 was determined by nuclear magnetic resonance (NMK) spectroscopy (Bruker) and liquid chromatography Mass spectrometry (LC MS, Bruker ). Il was identified that the major component was 2,3.5.4 ' - telrahydroxystilbene 2-O-//-D-glucopyranoside. called "Compound A. " having the formula:
. wherein R. is a glucosyl group. Example 2
Compound A Enhances Hemoglobin Formation
( " 57BL"6JNarl mice. 8- 10 weeks of age, were purchased from the National Laboratory Animal Center (NLAC, Taiwan). Acute hemolytic anemia was induced by a single intraperitoneal (i.p.) injection of phenylhydra/ine hydrochloride (Sigma-Aldrich) at a dose of 100 mg ' kg in a phosphate buffered saline (PBS). Six days after the injection, bone marrow cells were isolated from mice and cultured according to the procedure described in Worthington et al.,. ( 1987 ) and Rosenthal et al., ( 1987) with minor modifications. The cell suspension was adjusted to a density of about 6 - 10* cells/ml in MEM alpha medium (α-MEM. Gibcoj containing 1% (v/v) bovine serum albumin (BSA, Sigma-Aldrich ) 7.5 μM of 2-mercaptoethanol (Sigma-ΛIdiϊch), 1.4 mM of L- glutamine ( Sigma-Aldrich), 10 μM of ferric chloride (FeCU, Sigma-Aldrich) and 50 mU/ml of EPO ( Recormon Epoetin. Roche). The cells were plated at approximately 1 ,5 s - 1 O* cells well in 96- well plates (Costar), and cultured in a humidified 37°C incubator containing 5% CO;-95?Ό air.
In the next day, different concentrations of compound A {0, 0. 1 , 0.5, 2.5, 12.5 and 20 μg'ml ) were added to the cells, respectively, and incubated for 4 days. T he relative levels of hemoglobin were determined using DAF-based hemoglobin coiorimetry assay according to Kaiho and Mi/uno ( 1985) and Wonhington ( 1987} with minor modifications. In brief, cells were washed with PBS and lysecl in Nonidet™ P 40 (NP-40. .Sigma-Aldrich) (0.01% (wv). 50 μhvcll). Cells were then incubated with 4.5-diaminoΩuorescein (DAF. Sigma-Aldrich) ( 100 μg rnl. 100 μl well), and 30% hydrogen peroxide (Sigma- Aldrich) (6 μl/well) for 5 10 min. The absorbance at 610 nm was measured by Victor 2 1420 Muliilabie C ounter (Wallac. PerkinElmer). Results were expressed as relative index ± S.E. (11=6). Statistical significance was evaluated by Student's / test (**P<0.0l versus control group (0 μg /ml)). It was found that compound A at concentrations between about 0.1 to about 20 μg/ml significantly enhanced hemoglobin formation (FIG. 1 ).
Example 3 Compound A Activates Eiylhroid Progenitor Cells in Cell Culture
To investigate the effect of "Compound A" on erythroid progenitor cells, burst- fbrming- units-erythroid ( BFU-E-! ) assay was conducted according to the procedures described in Corazza el al. {2004} and Jin et <//. (2003) with modifications. Briefly, ό-week-old C.57BL OJNarl mice were purchased from the National Laboratory 1 Animal Center (NLAC, Taiwan). Bone marrow cells were isolated from the mice, and the cell suspension was adjusted to about 8.3 x i 0* cells ml in o-MlϊM containing I 5°ό (v-v) FBS (fetal bovine serum. GibcoK 1% (\ v) BSA (Sigma-Aldrich), O.S ή 'o (w/v) meihylcellulose (Sigma-Aldrich), H) μM 2-mercaploethaπol (Sigma-Aldrich). 2 U/nU liipo {Recormon Epoetin. Roche), and 10 ng ml IL-3 (Sigma-Aldrich). Cells were plated at approximately 7.5 * ! O 4 cells well in 24- well plates ( Falcon). They were incubated with different concentrations of Compound A (O 1 0.1 , 0.5. 2.5 and 12.5 μg/ml), respectively, for 9 days in a humidified 37 ' 'C incubator containing 5% CO;-95 < ?Ό air. The colonies were stained with 3-(4,5- dimethylthia2ol-2-yl) -2.5-diphenyl-tetrazolium bromide (5Oμg/5Oμl well) (MTT: Sigma-Aldrich). Plates were photographed while colonies of more than 50 cells were counted. Results were expressed as mean ± S.fc. (n=3). Statistical significance was evaluated by Student's / test (*!>* • • 0.05 and **P 0.01 versus control group (i.e., 0 concentration)). Compound A at concentrations of 0.5- 12.5 μg/ml significantly increased the number of BFU-ΪΪ colonies of bone marrow cells ( HG. 2). The results indicated that Compound A enhanced erythropoiesis by increasing hemoglobin formation and activating erythroid progenitor cells.
Example 4 Compound A Enhances Kidney Expression of Kpo
C57BL 6JNarl mice. S- IO weeks of aye, were purchased from the National Laboratory Animal Center (NL AC Taiwan). The kidney slices of mice were prepared as previously described with modi fications < Parrish t / ul.. 1995, Obatomi a <//., 1008 and De Kanter c/ <//.. i 900). Briefly. mice were sacrificed by cervical dislocation and ihe kidneys were excised and immediately kept in gassed (95% O: and 5% CO:) ice-cold sterile K.rebs-ϊ-1 Ii)PHS buffer (pH 7.4) containing 20 inM HEPHS (USB), 128 niM sodium chloride (Sigma-Aldrich). 2.5 mM potassium chloride (Sigma- Aldrich), 2.7 mλl calcium chloride (Sigma-Aldrich), 1 mM magnesium chloride (Sigma-Aldrich) and 16 mM ϋ-glucose f Sigma-Aldrich). The kidneys were decapsulated and cored perpendicular to me coriico-papillary axis. Kidney slices (250 urn) were prepared in microslicer (D. S. K microslicer. DRK 1000. Dosaka EM Co) filled with gassed (95% O; : 5% CO:) ice-cold sterile Krebs-HEIΕS buffer. Kidney slices were collected and stored on ice in gassed (95 0 O O;. 5% CO;) ice-cold sterile Krebs-I IKPES buffer and used within IO min of slice preparations.
Kidney slices were preincubated in a 24-well plate (Falcon) containing 1.0 ml well of gassed (95% 02, 5% CO2) fresh media (DMEM F12 (Gibco. Inviirogen) containing 15 mM HEPES (USB). 20 mM sodium bicarbonate (Siyma-Aldrich)} and 5 % (\/\) FBS (Gibco) for 90- 120 min at 37 . in a 05% 02 : 5% CO2 atmosphere chamber. Afterwards, kidney slices were incubated with different concentrations of Compound A (0. 0,6. 2,5. 10, 40 and 100 μg/ml). respectively, for 16 hr at 3 /X in a 50% 02 . 5% CO2 : 45% N2 atmosphere chamber. Ribonucleic acids (RNA) of kidney slices were extracted by RNA-Bee' M RNA isolation solvent (Tel-test). Total RNA (5 ug) was used to prepare complementary deoxyribonucleic acid (cDNA) vising MMLV reverse transcriptase ( Promeya). The reverse-transcribed cDNA samples were analyzed by real-time PCR using ABI Prism 7700 Sequence Detection System (Applied Biosystems) and the SYBR Green Master Mix kit (Applied Biosystems). Real-time K 1 R primers targeting toward mouse β-actin (SEQ ID NOs: I and 2) and erythropoietin (Epo) (SEQ ID NOs: 3 and 4} (Table 1 ) were used. The real-time PCR condition is as follows: 95 9 Cdenaιuration for 10 min followed by 40 cycles of 95 0 C for 30 sec,58 ; C for 35 sec. and 72''C for 40 sec. The expression level of β-actin was used as an internal reference. Relative gene expression levels were calculated with the 2 ' ^ L l . Results were compared with control group (0 μg ml ) and expressed as relative index. The results indicated that Compound A increased the expression ot ' Epø in kidney tissue ( FIG. 3). Table I
Gene Sequence SEQ ID NO.
. Forward 5 ' - GTGGGCCGC TCTAGGCACCA -.V 1
' "UCm Reverse 5 ' - TCiGCCTrACiGCiTTCAGCiGCiG -3 ! 2 fψo Forward 5"- AATGGAGGTGGAAGAACAGG -.V 3 Reverse 5'- ACCCGA AGC AGTGAAGTGA -.V 4
Forward 5 ' - TGGC ATCGTGG AAGGGCTCA -.V 5
Revoise 5 ' • GG A AG A ATGGG A GTTGCTGT -3' 6
Forward 5 * - CTTGGCΛ1XrΛCOΛTGTTCΛT -3' 7
' Reverse 5 ' - TGGTCK ' TG AC TCiC ATI TCTCA -3 * 8
Kxampie 5
Compound A Enhances Hepatocytes expression of Epo
C57BL'6JNarl mice. 8-10 weeks of age, were purchased from the National Laboratory Animal Center (NLAC, Taiwan). The hepatocytes were isolated as previously described with modifications {Kreamer c/ .//., 1086). Briefly, mice were anaesthetized with Avertin (2'!b (w/v) 2,2.2-tribromoethanol. i.p.. 400mg Ky body weight) and the liver was perfused in >/ ' «/ through inferior vena cava with a calcium-free Hank's balanced salt solution (HBSS) containing 0.5 mM Ethylene ylycol-bis(2-aminoethylether)- .V f .V,Λ",.V-retraacetic acid (i-GTΛ; Sigma- Aldrich). The flow rate was 1 ml/min with the perfusate exiting via the severed portal vein. After 10 min of perfusion. HBSS containing 0.05% (w Y) collagenase (Type II; Worthinglon Biochemical Corporation) and I m.M calcium chloride fSigma-Λldrich) was introduced into the perfusion apparatus. The perfusion was continued for another 10 min at the same (low rate. The partially digested liver was removed, placed in a oO-mni culture dish (BD Falcon) containing HBSS. and gently minced to open the liver capsula. The minced liver suspension was filtered through a nylon mesh (about 300 μm pore size), eentrifugated at 50^g for i min to obtain a cell pellet. The percoll (GE Healthcare) medium of a density of 1.06 g. ml was prepared. The cell pellet was suspended in DMEM medium (Gibco/lnvitrouen). centrifυged with the percoll medium at 50 v u for 10 min at 4' 1 C. washed once with DMEM medium and followed by centrifugation at 50 ^g for 2 min to obtain hepatocytes. The isolated hepatocytes were plated in 6-well plates (Costar) at approximately 6* IO J cells/well ' 2 ml/well > in DMHM medium (Gibco. Im itrogen) containing 10% FΪΪS ((iibco) in a humidified 37 0 C incubator containing 5 ϋ /o CO;-9S*Ό air. After S hr. the medium was removed, and the cells were incubated with different concentrations of compound A (0. 0. 1. 0.5. 2.5 and 12.5 μg/ml). respectively, for 24 hours. The RNA of hepatocyte was extracted by RNA-Bee 1 M RNA isolation solvent (Tel-test) for reverse transcription, and the transcripts analyzed by PCR as previously described. The results indicated that Compound A enhanced the expression of Epo in hepatocytes (FIG. 4).
Kxampic 6 Compound A Enhances Kidney Function in a Cisplatin-induced Acute Renal Failure Animal Model The ciϊccts of Compound A treatment on cisplalin- induced acute renal failure animal model were investigated. C5?BL/6JNarl mice < 8- week-old) were purchased from the National Laboratory Animal Center (NLAC. Taiwan). Cisplatin (cis-Diammineplaiinum ( I!) dichloride. Sigma-Aldrieh) was dissolved in normal saline (0.9 % (w V) sodium chloride, Sigma-Aldrich) at a concentration of I ing/ml, and injected into mice imraperiioneally (i.p.) according to the following schedule: day I . 7 mg/kg; day 5, 6 mg/kg; and day 9, 6 mg kg. For eisplatin-untreated normal mice group, normal saline injections of corresponding volumes were gven i.p. in parallel. At day 13. serum samples were collected and blood urea nitrogen (Bl 1 N) contents were assayed. Cisplatin-injected mice with BUN levels more than 100 my'dl and the cisplatin-untreated normal mice were further divided into 5 groups. 6 mice per group, and fed for 2 weeks; ( I ) Normal group: Mice were injected with normal saline and followed by feeding with a standard diet C LabDiet * J : (2) Control group: Mice were injected with cisplatin and followed by feeding with a standard diet. (3) Compound A IO mg/kg/day group: Mice were injected with cisplatin and followed by feeding with Compound A at the dose of IO mg/kg/day: (4) Compound A 30 mg/kg/day group. Mice were injected with cisplatin and followed by Compound A at the dose of 30 mg/kg day: (5) Compound A 90 mg/ka day group: Mice were injected with cisplatin and followed by Compound A treatment at the dose of 90 mg/kg/day.
Blood samples were collected from the retro-orbital sinus of mice at day 0, 5, 10. 13, I S. 23 and 28. Red blood cell (RBC) concentrations were determined by complete blood cell count using Sysmex' Kx-21 hematology analyzer. Blood urea nitrogen {BUN ) levels were determined by urease G1..DI1 method (Urea FS. DiaSys). Results were expressed as mean t. S. E. (π ::: 5-6). Statistical significance was evaluated by Student ' s / test («£P < 0.01 versus normal group and **P -0.01 versus control group). The results indicated that Compound A treatment at concentrations of 30-90 mg/kg/day increased the number of red blood cells ( llBCs) and decreased serum BUN levels (FlG.5). At day 23, Compound A at concentrations between 30 -90 mg/kg/day significantly increased the number of RBCs (FIG. 7) while decreasing serum BUN levels (FIG.8). The horizontal arrow in FlGs. 7 and 8 represents Compound A treatment (mg Kg day). The data indicated that the Compound A treatment enhanced renal functions and reduced anemia in a cisplatin-induced acute renal failure animal model. The results were in agreement with the ability of the Compound A in enhancing erylhropoiesis.
Example 7
Compound A Increases Liver Expressions of Hpo and 1 lepatocyte Growth Factor in a Cisplatin- induced Acute Renal Failure Animal Model Av the end of the EXAMPLE 6 (i.e.. day 2S). mice were sacrificed, kidney and liver tissues were removed, and bone marrow cells were isolated. RNA from tissues arid bone marrow cells were extracted by RNA-Bee RNA isolation solvent (Tel-test). Total RNA (5 μy) was vised to prepare cDNA using M MI. V reverse transcriptase (Prornega). The reverse-transcribed cDNA samples were analyzed by PCR using ABI GeneAmp™ system 2700 ( Applied Biosystems) and the SVBR Green Master Mix kit (Applied Biosyslems) using primers targeting toward mouse glvceraldehyde 3-phosphatc dehydrogenase (GAPDH) (SEQ ID NOs: 5 and (>}, erythropoietin (Fpo) (SKQ ID NOs: 3 and 4) and hepatocyte growth factor (UGF) (SKQ ID NOs: 7 and 8) (Table 1 ). The real-time PCR condition is as follows: 95''C denaturation for IO min followed by 40 cycles of 05-C for 30 sec. 5S 0 C for 35 sec. and 72°C for 40 sec. The expression level of GAPDH was used as an internal reference. Relative gene expression levels were calculated with the 2 1 ^ 0 . Results were expressed as relative index ± S. E. (n ::: 5-6). Statistical significance was evaluated by Student ' s / test («# P< () .()! versus normal group and * P<0.05, ** P 0.0! versus control group). The results indicated that Compound A at concentrations of 30-90 mg/kg/day significantly increased the expression of Fpo in liver in a cisplatiu-iπduced acute renal failure animal model as compared to the untreated control group i FIG. 9). Livers and kidneys are two major organs that make Fpo. C ompound A was found to enhance the expression olΕpo in kidney tissue (FIG. 3). hepatocytes (FKJ, 4) and liver tissue (TlG. 9). The results were in agreement with the ability of Compound A in enhancing the expression of Epo. Moreover, compound A ( 10-90 mg/Kg day) treatment also enhanced the expression of I KJT 1 in liver tissue ( FKJ. 10). The horizontal arrow in FIGs. 9 and 10 represents Compound A treatment (ing Kg day).
Kxiimpie 8
Compound A Activates Erythroid Progenitor Cell in a Cisplatin-induccd Acute Renal Failure
Animal Model Based on EXAMPLE 7, the isolated bone marrow cells were cultured for 12 days in a humidified 37 0 C incubator containing 5% COi-95% air for burst-forming-units-erythroid (BFU-E) assay as described above. Results were expressed as relative index ± S.E. (n- 5-OV Statistical significance was evaluated by Student's / test (sM? P- -0.01 versus normal group and * P ' 0.05, ** P - 0.01 versus control group), it was found that Compound A at concentrations of 10- 90 tng kg day significantly increased the number of BFU-F colonies of bone marrow cells (FIG. 11 ). The horizontal arrow in FI(U. 1 1 represents Compound A treatment (my Kg. day). The results indicated that Compound A activated erythroid progenitor cell and enhanced erythropoiesis.
The compound 2.3,5.4 ' -tetrahydroxyslilbene 2-CΛ/M3- glueopyranoside, i.e.. Compound A, has been found in several plants. According to the literatures. Compound A has the following Pharmacol ogi cal effects, stimulating melanogenesis by activating tyrosinase (Guan cf ui ^ 2008), inhibiting lipid peroxidation ( Kinutra c/ <//,. 1983), ba\ ing a protective effect on colitis through alleviating oxygen and nitrogen free radicals level and down-regulating inducible nitric oxide synthase expression (Wang et a!.. 2008), having anti-atherosclerosis effect via its antagonistic effects on oxidation of lipoprotein, proliferation and decrease in nitric oxide content of coronary arterial smooth muscle cells (Liu e( -/'. , 2007), having antiinflammatory function ihat is related to the inhibition of cyclooxygenase-2 enzyme activity and expression (Zhang ef a!.. 2007), and are beneficial for Alzheimer disease and cognitive impairment (Wang ef a!.. 2007).
U.S. Publication No. 20050042314 (entitled "Extracts of Polygonum multiflorum Thunb., and preparation process and uses of the same) discloses that extract products from the root of Pufygommi mulϋflnrum ϊhunh. are biologically active in increasing proliferation, growth and/or differentiation of hemaiocyies and bone marrow cells. The Fleeceflower root contains numerous chemical components, such as emodin. ehrysophanol. physcion. rhein. chi ysophanol enthrone, resveratrol. piceid, 2.3,5.4'-tetrahydroxystilbene-2 -OV'-D-ghicopyranoside, 2,3.5.4'- letrahydroxystilbene-2-O-/r-D-gluco- pyranoside-2"-O-mo-noga!loyl ester. 2,3,5.4'- tetrahydro\ysti1bene-2-Q-/?-D- glucopyranosid-e-3"-O-monogalloyl ester, gallic acid, catechin, epicatechin, 3-O-galloyl(-)-catechin, and 3-O-galloyl(-)epicatechin, 3-O-galloyl-procyanidin B- 2,3.3'-di-0-galloyl-procyanidin B-2, and β-sitosterol. The U.S. Publication No. 20050042314 is silent as to which chemical components) is active. As described above. Compound A has been proved to be biologically active in increasing
Epo production and enhancing erythropoiesis and kidney functions. The giucosyl group in Compound A may be replaced by monosaccharides such as dihvdroxyacetone, galactose, glyceraldehydes. threose. xylose, mannose. ribose, ribulose, xylulose, tagatose, psicose (allulose). fructose, sorbose, rhamπose, erythrose. erythrulose. arabinose, lyxose, allose, ahrose, gulose, idose and talose.
It is well known that Epo stimulates erythropoiesis. and that Epo is required for erythropoiesis (Moritz ei a!., 1991). It has also been reported that Epo has renoprotective effects (Sepodes e-i a ( .< 2006 and Arcasoy, 200S). In addition to increasing Epo production. Compound A enhances erythropoiesis and kidney functions. HGF is a mul afunctional cytokine that is related to cell survival, growth, motility and morphogenesis, tissue regeneration, protection and repair. It has been reported that I KJF activates signal transduction from Epo receptor (Iguchi cV c/Λ. 1999 and Isobe et aL 2006). HGF has been shown to have therapeutic potential for allergic inflammation (llo ef al... 200S), osteoarthritis, rheumatoid arthritis, muscular dystrophy, muscular atrophy, skin ulcer, burn, scleroderma, crush syndrome ( Rinakoshi and Nαkamυra. 2003). cerebrovascular diseases such as transient ischemic attack and stroke, neurodegenerative diseases such as amyotrophic lateral sclerosis, Alzheimer's disease and Parkinson's disease, spinal cord injury, diabetic retinopathy, peripheral neuropathy, spinal canal stenosis, deafness (Funakoshi and Nakamura. 2003 and Takeo ci <//.. 2007). acute hepatitis, liver cirrhosis, fulminant hepatitis, tatty liver, surgical treatments for liver transplantation, partial resection and ischemia (Funakoshi and Nakamura. 2003 and Mizuπo and Nakamυra, 2007), kidney fibrosis, acute renal failure, chronic renal failure such as nephritic syndrome and obstructive nephropathy, surgical treatments for renal transplantation and ischemia, diabetic nephropathy (Matsumoto and Nakamura. 2001 ; Funakoshi and Nakamura. 2003 and Liu. 2004). acute pneumonia, pulmonary fibrosis, surgical treatments for lung transplantation, partial resection and ischemia (Funakoshi and Nakamura. 20031 inflammation-mediated heart diseases such as cardiac allograft rejection and myocarditis, cardiovascular diseases such as angina, cardiac infarction, cardiomyopathy and atherosclerosis obliterans ( Tunakoshi and Nakamura. 2003 and lsobe ei ui. s 2006), intestinal mucosal injury, inflammatory bowel disease (ldo et <*/., 2005). gastric ulcer and diabetes melliuis (Funakoshi and Nakamura, 2003 ).
Compound A has a structure based on 3.4',5-t.rihydroxy-trans-stilbene. which is a natural compound possessing numerous biological activities, including renoprotection. \ ia nitric oxide dependent and/or antioxidant mechanisms {Sharma c/ <//., 2006; Shankar et .//.. 2007; Do Λmaral et .//., 2008 and Orallo. 2008). Compound A was found to be superior to 3.4',5-trihydro.vy-ιrans- stilbene in enhancing renal functions and improv ing anemia (data not shown). rliuEpo and NHSP have been used in intravenous (i.v.) or subcutaneous (s.c.) injection for treating anemia of CKD, anemia in cancer patients receiving chemotherapy, anemia in zidovudine- trcatcd patients infected with human immunodeficiency virus (Fisher. 2003}. It has been recommended that the administration be given more than once per week tor maintenance therapy. The cost, the inconvenience due to frequent injections (parenteral administration) and development of anti-Epo antibodies due to inherent antigenicity of rHuEpo all point to a need for developing an improved therapeutic agent. Oral administration of Compound Λ. one of 3.4',5-trihydroxy-trans- stilbene analogs, can increase Epo formation, enhances erythropoiesis and kidney functions, and reduces anemia. The compound 3,4',5-ιrihydroxy-trans-stilbeue has been reported to have renoproteclive effects via nitric oxide dependent and/or antioxidant mechanisms. Compound A is superior to 3,4'.5-t.rihydroxy-trans-stilbene in enhancing erythropoiesis and kidney functions. Moreover. Compound A has the advantages that recombinant Epo does not have: An oral administration of Compound Λ does not pose inherent antigenicity, which recombinant Epo has. In addition, the route of administration of rEPO is inconvenient because it requires frequent injections. Compound A may be beneficial for disorder-associated anemia, such as CKD. cancer, acute and chronic infections, autoimmune, inflammation, chronic rejection after solid-organ transplantation, chemotherapy-induced anemia, and tissue ischemia. The foregoing description of the exemplary embodiments of the invention has been presented only for the purposes of illustration and description and is not intended to be exhaustive or to limit the invention to the precise forms disclosed. Many modifications and variations are possible in light of the above teaching.
The embodiments and examples were chosen and described in order to explain the principles of the invention and their practical application so as to enable others skilled in the art to utilize the invention and various embodiments and with various modifications as are suited to the particular use contemplated. Alternative embodiments will become apparent to those skilled in the art to which the present invention pertains without departing from its spirit and scope. Accordingly, the scope of the present invention is defined by the appended claims rather than the foregoing description and the exemplary embodiments described therein.
Some references, which may include patents, patent applications and various publications, are cited and discussed in the description of this invention. The citation and or discussion of such references is provided merely to clarity the description of the present invention and is not an admission that any such reference is 'prior art" to the invention described herein. All references cited and discussed in this specification are incorporated herein by reference in their entireties and to the same extent as if each reference was individually incorporated by reference.
LIST OF RHFERENCHS
Λrcasoy MO. 2008. Br J Haematol. M I : H-31.
Buna HF. 2007. Blood. 109:868-873.
Corazza F. et ui. 2004. Pedialr Res. 55: 152-158. De Kanter R. et al. 1999. Toxicol in Vitro. 13:737-744.
Do Amaral CL. et al. 2008. Arch Toxicol. 82:363-730.
Ecfcardt KU and Kurt/ A. 1992. Fur J Clin Finest. 89:753-760.
Eckardt KU and Kurtz A. 2005. Eur J Clin linest. 35 Suppl 3: 13- 19.
Fisher JVV. 2003. Exp Biol Med (Maywood). 228: 1 -14. Funakoshi H and Nakamura T. 2003. Clin Chim Acta. 327: 1 -23.
Guan S. vi al. 2008. Phytother Res. 22:660-663.
1 lodges VM. et al. 2007. Cm Rev Oncol Hemaiol. 64: 139-158. ldo A. 2005. J Gastroenterol. 40:925-931.
Iguchi T. et ui. 1999. Stem Cells. 17:82-91. Isobe M. et al. 2006. Trends Cardiovasc Med. 16: 188- 193. ho W. ct al. 2008. InI Arch Allergy Immunol. 146 Suppl 1 .82-87.
Jin M. et a/. 2003. Exp Biol Med (Maywood). 228:759-766.
Kaiho S and Mizuno K. 1985. Anal Biocbem. 149: 1 17-120.
Kimura Y. et a/. 1983. Rama Med. 49:51-54. Kreamer BL. el al. 1986. In Vitro Cell Dev Biol. 22:201 -21 ! . l..evey AS. et al. 2005. Kidney Im. 67:2089-3100.
Liu QL. ct al. 2007. J Asian Nat Prod Res. 9:689-697.
Liu Y. 2004. Am J Physiol Renal Physiol. 287:F7- I6.
Matsumoto K and Nakamura T. 2001. Kidney Im. 59:2023-2038. Mizuno S and Nakamura T " . 2007. Reyen Med. 2: 161-170.
Moritz KM et al. 1997. Am J Physiol. 273:R182 t >-ΪS44.
Obatomi DK . ei ai. 1998. Toxicol in Viiro. 12:725-737.
Orallo F. 2008. Ciirr Med ("hern. 15: 1887-1898.
Parrish AR. et al. 1995. Life Sci. 57: 1887-1901. Paschos N. 2008. Im J Biol Sci. 4: 161 - 168.
Rosenthal A. ct al. 1987. Exp Hematol. 13: 174-184.
Sepodes B. et al. 2006. Transpl Im. 19:919-926.
Shankar S. ct al. 2007. From Biosci. 12:4839-4854.
Sharma S. et ui. 2006. Pharmacology. 76:60-75. Takeo f/ ii/. 2007. Yakugaku Zasshi. 127.1813-1823.
Wang R. et al. 2007. Neuroscience. 149:739-746.
Wang X. a al. 2008. Eur J Pharmacol. 578.339-348.
Weiss G and Goodnough LT. 2005. N Engl J Med. 352: 101 1-1023.
Wish JB and Coyne DW. 2007. Mayo Clin Proc. 82: 1371-1380. Worthington RK. ct al. 1987. Exp I lematol. 15:85-92.
Zarzecki M. ct al. 2004. Pol Arch Med Wewn. 1 12: 121 1- 1219.
Zhang YZ. et al. 2007. J Asian Nat Prod Res. 9:355-363.
