COMPOUNDS AND METHODS FOR MODULATING SPLICING

CLAIM OF PRIORITY

This application claims priority to U.S. Application No. 63/238,691, filed on August 30, 2021; U.S. Application No. 63/238,694, filed on August 30, 2021; U.S. Application No. 63/282,906, filed on November 24, 2021; U.S. Application No. 63/283,132, filed on November 24, 2021; U.S. Application No. 63/393,205, filed on July 28, 2022; and U.S. Application No. 63/393,206, filed on July 28, 2022. The disclosure of each of the foregoing applications is incorporated herein by reference in its entirety.

BACKGROUND

Alternative splicing is a major source of protein diversity in higher eukaryotes and is frequently regulated in a tissue-specific or development stage-specific manner. Disease associated alternative splicing patterns in pre-mRNAs are often mapped to changes in splice site signals or sequence motifs and regulatory splicing factors (Faustino and Cooper (2003), Genes Dev 17(4):419-37). Current therapies to modulate RNA expression involve oligonucleotide targeting and gene therapy; however, each of these modalities exhibit unique challenges as currently presented. As such, there is a need for new technologies to modulate RNA expression, including the development of small molecule compounds that target splicing.

SUMMARY

The present disclosure features compounds and related compositions that, inter alia, modulate nucleic acid splicing, e.g., splicing of a pre-mRNA, as well as methods of use thereof. In an embodiment, the compounds described herein are compounds of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (II-d), (Il-e), (Il-f), (Il-g), (Il-h), (Il-i), (Il-j), (Il-k), (II-l), or (II-m)) and pharmaceutically acceptable salts, solvates, hydrates, tautomers, or stereoisomers thereof. The present disclosure additionally provides methods of using the compounds of the invention (e.g., compounds of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (II-a), (II-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II- i), (II-j), (II-k), (II-1), or (II-m), and pharmaceutically acceptable salts, solvates, hydrates, tautomers, stereoisomers thereof), and compositions thereof, e.g., to target, and in embodiments bind or form a complex with, a nucleic acid (e.g., a pre-mRNA or nucleic acid component of a small nuclear ribonucleoprotein (snRNP) or spliceosome), a protein (e.g., a protein component of an snRNP or spliceosome, e.g., a member of the splicing machinery, e.g., one or more of the Ul, U2, U4, U5, U6, Ul 1, U12, U4atac, U6atac snRNPs), or a combination thereof. In another aspect, the compounds described herein may be used to alter the composition or structure of a nucleic acid (e.g., a pre-mRNA or mRNA (e.g., a pre-mRNA and the mRNA which arises from the pre-mRNA), e.g., by increasing or decreasing splicing at a splice site. In some embodiments, increasing or decreasing splicing results in modulating the level of a gene product (e.g., an RNA or protein) produced.

In another aspect, the compounds described herein may be used for the prevention and/or treatment of a disease, disorder, or condition, e.g., a disease, disorder or condition associated with splicing, e.g., alternative splicing. In some embodiments, the compounds described herein (e.g., compounds of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (Il-d), (Il-e), (Il-f), (II-g), (Il-h), (II-i), (Il-j), (Il-k), (II-l), or (Il-m), and pharmaceutically acceptable salts, solvates, hydrates, tautomers, stereoisomers thereof) and compositions thereof are used for the prevention and/or treatment of a proliferative disease, disorder, or condition (e.g., a disease, disorder, or condition characterized by unwanted cell proliferation, e.g., a cancer or a benign neoplasm) in a subject. In some embodiments, the compounds described herein (e.g., compounds of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (Il-d), (Il-e), (Il-f), (II-g), (Il-h), (II-i), (Il-j), (Il-k), (II-l), or (Il-m), and pharmaceutically acceptable salts, solvates, hydrates, tautomers, stereoisomers thereof) and compositions thereof are used for the prevention and/or treatment of a non-proliferative disease, disorder, or condition. In some embodiments, the compounds described herein (e.g., compounds of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (Il-d), (Il-e), (Il-f), (II-g), (Il-h), (II-i), (Il-j), (II- k), (II-l), or (Il-m), and pharmaceutically acceptable salts, solvates, hydrates, tautomers, stereoisomers thereof) and compositions thereof are used for the prevention and/or treatment of a neurological disease or disorder, an autoimmune disease or disorder, immunodeficiency disease or disorder, a lysosomal storage disease or disorder, a cardiovascular disease or disorder, a metabolic disease or disorder, a respiratory disease or disorder, a renal disease or disorder, or an infectious disease in a subject.

In another aspect, the present disclosure features a compound of Formula (I): (I), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A, B, X, Y, Z, L ¹ , L ² , R ² , m, and subvariables thereof are as described herein.

In another aspect, the present disclosure features a compound of Formula (II): (II), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A, B, M, P, W, U, X, Y, Z, L ¹ , L ² , and subvariables thereof are as described herein

In another aspect, the present invention provides pharmaceutical compositions comprising a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I- d), (I-e), (I-f), (I-g), (I-h), or (I-i)), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, and optionally a pharmaceutically acceptable excipient. In an embodiment, the pharmaceutical compositions described herein include an effective amount (e.g., a therapeutically effective amount) of a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (Il-d), (Il-e), (I I-f), (Il-g), (Il-h), (Il-i), (Il-j ), (Il-k), (II-l), or (II-m)), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In another aspect, the present disclosure provides methods for modulating splicing, e.g., splicing of a nucleic acid (e.g., a DNA or RNA, e.g., a pre-mRNA) with a compound of Formula

(I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (Il-a), (II- b), (II-c), (Il-d), (Il-e), (II-f), (II-g), (Il-h), (Il-i), (II-j), (II-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In another aspect, the present disclosure provides compositions for use in modulating splicing, e.g., splicing of a nucleic acid (e.g., a DNA or RNA, e.g., a pre-mRNA) with a compound of Formula (I) or

(II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (Il-d), (Il-e), (Il-f), (Il-g), (Il-h), (Il-i), (Il-j ), (Il-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. Modulation of splicing may comprise impacting any step involved in splicing and may include an event upstream or downstream of a splicing event. For example, in some embodiments, the compound of Formula (I) or (II) binds to a target, e.g., a target nucleic acid (e.g., DNA or RNA, e.g., a precursor RNA, e.g., a pre-mRNA), a target protein, or combination thereof (e.g., an snRNP and a pre-mRNA). A target may include a splice site in a pre-mRNA or a component of the splicing machinery, such as the U1 snRNP. In some embodiments, the compound of Formula (I) or (II) alters a target nucleic acid (e.g., DNA or RNA, e.g., a precursor RNA, e.g., a pre-mRNA), target protein, or combination thereof. In some embodiments, the compound of Formula (I) or (II) increases or decreases splicing at a splice site on a target nucleic acid (e.g., an RNA, e.g., a precursor RNA, e.g., a pre-mRNA) by about 0.5% or more (e.g., about 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 75%, 90%, 95%, or more), relative to a reference (e.g., the absence of a compound of Formula (I) or (II), e.g., in a healthy or diseased cell or tissue). In some embodiments, the presence of a compound of Formula (I) or (II) results an increase or decrease of transcription of a target nucleic acid (e.g., an RNA) by about 0.5% or more (e.g., about 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, 75%, 90%, 95%, or more), relative to a reference (e.g., the absence of a compound of Formula (I) or (II), e.g., in a healthy or diseased cell or tissue).

In another aspect, the present disclosure provides methods for preventing and/or treating a disease, disorder, or condition in a subject by administering a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (Il-d), (Il-e), (Il-f), (II-g), (Il-h), (II-i), (Il-j), (Il-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, or related compositions. In some embodiments, the disease or disorder entails unwanted or aberrant splicing. In some embodiments, the disease or disorder is a proliferative disease, disorder, or condition.

Exemplary proliferative diseases include cancer, a benign neoplasm, or angiogenesis. In other embodiments, the present disclosure provides methods for treating and/or preventing a nonproliferative disease, disorder, or condition. In still other embodiments, the present disclosure provides methods for treating and/or preventing a neurological disease or disorder, autoimmune disease or disorder, immunodeficiency disease or disorder, lysosomal storage disease or disorder, cardiovascular disease or disorder, metabolic disease or disorder, respiratory disease or disorder, renal disease or disorder, or infectious disease. In another aspect, the present disclosure provides methods of down-regulating the expression of (e.g., the level of or the rate of production of) a target protein with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (11-1), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof in a biological sample or subject. In another aspect, the present disclosure provides methods of up-regulating the expression of (e.g., the level of or the rate of production of) a target protein with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I- e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof in a biological sample or subject. In another aspect, the present disclosure provides methods of altering the isoform of a target protein with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-l), or (II-m))) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof in a biological sample or subject. Another aspect of the disclosure relates to methods of inhibiting the activity of a target protein in a biological sample or subject. In some embodiments, administration of a compound of Formula (I) or (II) to a biological sample, a cell, or a subject comprises inhibition of cell growth or induction of cell death.

In another aspect, the present disclosure provides compositions for use in preventing and/or treating a disease, disorder, or condition in a subject by administering a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (II-d), (II-e), (II-f), (II-g), (II-h), (II-i), (II-j), (II-k), (II-I), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, or related compositions. In some embodiments, the disease or disorder entails unwanted or aberrant splicing. In some embodiments, the disease or disorder is a proliferative disease, disorder, or condition. Exemplary proliferative diseases include cancer, a benign neoplasm, or angiogenesis. In other embodiments, the present disclosure provides methods for treating and/or preventing a non-proliferative disease, disorder, or condition. In still other embodiments, the present disclosure provides methods for treating and/or preventing a neurological disease or disorder, autoimmune disease or disorder, immunodeficiency disease or disorder, lysosomal storage disease or disorder, cardiovascular disease or disorder, metabolic disease or disorder, respiratory disease or disorder, renal disease or disorder, or infectious disease.

In another aspect, the present disclosure provides compositions for use in down-regulating the expression of (e.g., the level of or the rate of production of) a target protein with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I- e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (II-d), (II-e), (II-f), (Il-g), (II-h), (II-i), (Il-j), (Il-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof in a biological sample or subject. In another aspect, the present disclosure provides compositions for use in up-regulating the expression of (e.g., the level of or the rate of production of) a target protein with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (Il-d), (Il-e), (I I-f), (Il-g), (II-h), (II-i), (Il-j ), (Il-k), (II-l), or (II-m)) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof in a biological sample or subject. In another aspect, the present disclosure provides compositions for use in altering the isoform of a target protein with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I- e), (I-f), (I-g), (I-h), (Il-a), (Il-b), (II-c), (II-d), (II-e), (II-f), (Il-g), (II-h), (II-i), (Il-j), (Il-k), (II-l), or (II-m))) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof in a biological sample or subject. Another aspect of the disclosure relates to compositions for use in inhibiting the activity of a target protein in a biological sample or subject. In some embodiments, administration of a compound of Formula (I) or (II) to a biological sample, a cell, or a subject comprises inhibition of cell growth or induction of cell death.

In another aspect, the present disclosure features kits comprising a container with a compound of Formula (I) or (II) (e.g., a compound of Formulas (I-a), (I-b), (I-c), (I-d), (I-e), (I- f), (I-g), (I-h), (Il-a), (II-b), (II-c), (II-d), (II-e), (II-f), (Il-g), (II-h), (II-i), (Il-j), (Il-k), (II-l), or (II-m)), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer thereof, or a pharmaceutical composition thereof. In certain embodiments, the kits described herein further include instructions for administering the compound of Formula (I) or (II) or the pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer thereof, or the pharmaceutical composition thereof.

In any and all aspects of the present disclosure, in some embodiments, the compound, target nucleic acid (e.g., DNA, RNA, e.g., pre-mRNA), or target protein described herein is a compound, target nucleic acid (e.g., DNA, RNA, e.g., pre-mRNA), or target protein other than a compound, target nucleic acid (e.g., DNA, RNA, e.g., pre-mRNA), or target protein described one of U.S. Patent No. 8,729,263, U.S. Publication No. 2015/0005289, WO 2014/028459, WO 2016/128343, WO 2016/196386, WO 2017/100726, WO 2018/232039, WO 2018/098446, WO 2019/028440, WO 2019/060917, WO 2019/199972, and WO 2021/174165. In some embodiments, the compound, target nucleic acid (e.g., DNA, RNA, e.g., pre-mRNA), or target protein described herein is a compound, target nucleic acid (e.g., DNA, RNA, e.g., pre-mRNA), or target protein described one of U.S. Patent No. 8,729,263, U.S. Publication No.

2015/0005289, WO 2014/028459, WO 2016/128343, WO 2016/196386, WO 2017/100726, WO 2018/232039, WO 2018/098446, WO 2019/028440, WO 2019/060917, WO 2019/199972, and and WO 2021/174165, each of which is incorporated herein by reference in its entirety.

The details of one or more embodiments of the invention are set forth herein. Other features, objects, and advantages of the invention will be apparent from the Detailed Description, the Examples, and the Claims.

DETAILED DESCRIPTION

Selected Chemical Definitions

Definitions of specific functional groups and chemical terms are described in more detail below. The chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75 ^th Ed., inside cover, and specific functional groups are generally defined as described therein. Additionally, general principles of organic chemistry, as well as specific functional moi eties and reactivity, are described in Thomas Sorrell, Organic Chemistry, University Science Books, Sausalito, 1999; Smith and March, March 's Advanced Organic Chemistry, 5 ^th Edition, John Wiley & Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; and Carruthers, Some Modern Methods of Organic Synthesis, 3 ^rd Edition, Cambridge University Press, Cambridge, 1987.

The abbreviations used herein have their conventional meaning within the chemical and biological arts. The chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts. When a range of values is listed, it is intended to encompass each value and sub-range within the range. For example "C ₁ -C ₆ alkyl" is intended to encompass, C ₁ , C ₂ , C ₃ , C ₄ , C ₅ , C ₆ , C ₁ -C ₆ , C ₁ -C ₅ , C ₁ -C ₄ , C ₁ -C ₃ , C ₁ -C ₂ , C ₂ -C ₆ , C ₂ -C ₅ , C ₂ -C ₄ , C ₂ -C ₃ , C ₃ -C ₆ , C ₃ -C ₅ , C ₃ -C ₄ , C ₄ -C ₆ , c ₄ - C ₅ , and C ₅ -C ₆ alkyl.

The following terms are intended to have the meanings presented therewith below and are useful in understanding the description and intended scope of the present invention.

As used herein, "alkyl" refers to a radical of a straight-chain or branched saturated hydrocarbon group having from 1 to 24 carbon atoms ("C ₁ -C ₂₄ alkyl"). In some embodiments, an alkyl group has 1 to 12 carbon atoms ("C ₁ -C ₁ 2 alkyl"). In some embodiments, an alkyl group has 1 to 8 carbon atoms ("C ₁ -C ₈ alkyl"). In some embodiments, an alkyl group has 1 to 6 carbon atoms (" C ₁ -C ₆ alkyl"). In some embodiments, an alkyl group has 2 to 6 carbon atoms ("C ₂ -C ₆ alkyl"). In some embodiments, an alkyl group has 1 carbon atom ("C ₁ alkyl"). Examples of C ₁ - C ₆ alkyl groups include methyl (C ₁ ), ethyl (C ₂ ), n-propyl (C ₃ ), isopropyl (C ₃ ), n-butyl (C ₄ ), tert- butyl (C ₄ ), sec-butyl (C ₄ ), iso-butyl (C ₄ ), n-pentyl (C ₅ ), 3-pentanyl (C ₅ ), amyl (C ₅ ), neopentyl (C ₅ ), 3-methyl-2-butanyl (C ₅ ), tertiary amyl (C ₅ ), and n-hexyl (C ₆ ). Additional examples of alkyl groups include n-heptyl (C ₇ ), n-octyl (C ₈ ) and the like. Each instance of an alkyl group may be independently optionally substituted, i.e., unsubstituted (an "unsubstituted alkyl") or substituted (a "substituted alkyl") with one or more substituents; e.g., for instance from 1 to 5 substituents, 1 to 3 substituents, or 1 substituent. In certain embodiments, the alkyl group is unsubstituted C ₁ -C ₁₀ alkyl (e.g., -CH ₃ ). In certain embodiments, the alkyl group is substituted C ₁ -C ₆ alkyl.

As used herein, "alkenyl " refers to a radical of a straight-chain or branched hydrocarbon group having from 2 to 24 carbon atoms, one or more carbon-carbon double bonds, and no triple bonds ("C ₂ -C ₂₄ alkenyl"). In some embodiments, an alkenyl group has 2 to 10 carbon atoms ("C ₂ -C ₁₀ alkenyl"). In some embodiments, an alkenyl group has 2 to 8 carbon atoms ("C ₂ -C ₈ alkenyl"). In some embodiments, an alkenyl group has 2 to 6 carbon atoms ("C ₂ -C ₆ alkenyl"). In some embodiments, an alkenyl group has 2 carbon atoms ( "C ₂ alkenyl"). The one or more carbon-carbon double bonds can be internal (such as in 2-butenyl) or terminal (such as in 1- butenyl). Examples of C ₂ -C ₄ alkenyl groups include ethenyl (C ₂ ), 1-propenyl (C ₃ ), 2-propenyl (C ₃ ), 1-butenyl (C ₄ ), 2-butenyl (C ₄ ), butadienyl (C ₄ ), and the like. Examples of C ₂ -C ₆ alkenyl groups include the aforementioned C ₂ -4 alkenyl groups as well as pentenyl (C ₅ ), pentadienyl (C ₅ ), hexenyl (C ₆ ), and the like. Additional examples of alkenyl include heptenyl (C ₇ ), octenyl (C ₈ ), octatrienyl (C ₈ ), and the like. Each instance of an alkenyl group may be independently optionally substituted, i.e., unsubstituted (an "unsubstituted alkenyl") or substituted (a "substituted alkenyl") with one or more substituents e.g., for instance from 1 to 5 substituents, 1 to 3 substituents, or 1 substituent. In certain embodiments, the alkenyl group is unsubstituted C ₁ - C ₁₀ alkenyl. In certain embodiments, the alkenyl group is substituted C ₂ -C ₆ alkenyl.

As used herein, the term "alkynyl" refers to a radical of a straight-chain or branched hydrocarbon group having from 2 to 24 carbon atoms, one or more carbon-carbon triple bonds ("C ₂ -C ₂₄ alkenyl"). In some embodiments, an alkynyl group has 2 to 10 carbon atoms ("C ₂ -C ₁₀ alkynyl"). In some embodiments, an alkynyl group has 2 to 8 carbon atoms ("C ₂ -C ₈ alkynyl"). In some embodiments, an alkynyl group has 2 to 6 carbon atoms ("C ₂ -C ₆ alkynyl"). In some embodiments, an alkynyl group has 2 carbon atoms ("C ₂ alkynyl"). The one or more carbon- carbon triple bonds can be internal (such as in 2-butynyl) or terminal (such as in 1-butynyl). Examples of C ₂ -C ₄ alkynyl groups include ethynyl (C ₂ ), 1-propynyl (C ₃ ), 2-propynyl (C ₃ ), 1- butynyl (C ₄ ), 2-butynyl (C ₄ ), and the like. Each instance of an alkynyl group may be independently optionally substituted, i.e., unsubstituted (an "unsubstituted alkynyl") or substituted (a "substituted alkynyl") with one or more substituents e.g., for instance from 1 to 5 substituents, 1 to 3 substituents, or 1 substituent. In certain embodiments, the alkynyl group is unsubstituted C _2-10 alkynyl. In certain embodiments, the alkynyl group is substituted C ₂ -6 alkynyl.

As used herein, the term "haloalkyl," refers to a non-cyclic stable straight or branched chain, or combinations thereof, including at least one carbon atom and at least one halogen selected from the group consisting of F, Cl, Br, and I. The halogen(s) F, Cl, Br, and I may be placed at any position of the haloalkyl group. Exemplary haloalkyl groups include, but are not limited to: -CF ₃ , -CCI ₃ , -CH ₂ -CF ₃ , -CH ₂ -CCI ₃ , -CH ₂ -CBr ₃ , -CH ₂ -CI ₃ , -CH ₂ -CH ₂ -CH(CF ₃ )-CH ₃ , - CH ₂ - CH ₂ -CH(Br)-CH ₃ , and -CH ₂ -CH=CH-CH ₂ -CF ₃ . Each instance of a haloalkyl group may be independently optionally substituted, i.e., unsubstituted (an "unsubstituted haloalkyl") or substituted (a "substituted haloalkyl") with one or more substituents e.g., for instance from 1 to 5 substituents, 1 to 3 substituents, or 1 substituent

As used herein, the term "heteroalkyl," refers to a non-cyclic stable straight or branched chain, or combinations thereof, including at least one carbon atom and at least one heteroatom selected from the group consisting of O, N, P, Si, and S, and wherein the nitrogen and sulfur atoms may optionally be oxidized, and the nitrogen heteroatom may optionally be quatemized. The heteroatom(s) O, N, P, S, and Si may be placed at any position of the heteroalkyl group. Exemplary heteroalkyl groups include, but are not limited to: -CH ₂ -CH ₂ -O-CH ₃ , -CH ₂ -CH ₂ -NH- CH ₃ , -CH ₂ -CH ₂ -N(CH ₃ )-CH ₃ , -CH ₂ -S-CH ₂ -CH ₃ , -CH ₂ -CH ₂ , -S(O)-CH ₃ , -CH ₂ -CH ₂ -S(O) ₂ -CH ₃ , - CH=CH-O-CH ₃ , -Si(CH ₃ ) ₃ , -CH ₂ -CH=N-OCH ₃ , -CH=CH-N(CH ₃ )-CH ₃ , -O-CH ₃ , and -O-CH ₂ - CH ₃ . Up to two or three heteroatoms may be consecutive, such as, for example, -CH ₂ -NH-OCH ₃ and -CH ₂ -O-Si(CH ₃ ) ₃ . Where "heteroalkyl" is recited, followed by recitations of specific heteroalkyl groups, such as -CH ₂ O, -NR ^C R ^D , or the like, it will be understood that the terms heteroalkyl and -CH ₂ O or -NR ^C R ^D are not redundant or mutually exclusive. Rather, the specific heteroalkyl groups are recited to add clarity. Thus, the term "heteroalkyl" should not be interpreted herein as excluding specific heteroalkyl groups, such as -CH ₂ O, -NR ^C R ^D , or the like. Each instance of a heteroalkyl group may be independently optionally substituted, i.e., unsubstituted (an "unsubstituted heteroalkyl") or substituted (a "substituted heteroalkyl") with one or more substituents e.g., for instance from 1 to 5 substituents, 1 to 3 substituents, or 1 substituent

As used herein, "aryl" refers to a radical of a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared in a cyclic array) having 6-14 ring carbon atoms and zero heteroatoms provided in the aromatic ring system ("C ₆ -C ₁₄ aryl"). In some embodiments, an aryl group has six ring carbon atoms ("C ₆ aryl"; e.g., phenyl). In some embodiments, an aryl group has ten ring carbon atoms ("C ₁₀ aryl"; e.g., naphthyl such as 1-naphthyl and 2-naphthyl). In some embodiments, an aryl group has fourteen ring carbon atoms ("C ₁₄ aryl"; e.g., anthracyl). An aryl group may be described as, e.g., a C ₆ -C ₁₀ -membered aryl, wherein the term "membered" refers to the non-hydrogen ring atoms within the moiety. Aryl groups include phenyl, naphthyl, indenyl, and tetrahydronaphthyl. Each instance of an aryl group may be independently optionally substituted, i.e., unsubstituted (an "unsubstituted aryl") or substituted (a "substituted aryl") with one or more substituents. In certain embodiments, the aryl group is unsubstituted C ₆ -C ₁₄ aryl. In certain embodiments, the aryl group is substituted C ₆ -C ₁₄ aryl.

As used herein, "heteroaryl" refers to a radical of a 5-10 membered monocyclic or bicyclic 4n+2 aromatic ring system (e.g., having 6 or 10 it electrons shared in a cyclic array) having ring carbon atoms and 1-4 ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen and sulfur ("5-10 membered heteroaryl"). In heteroaryl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. Heteroaryl bicyclic ring systems can include one or more heteroatoms in one or both rings. "Heteroaryl" also includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is either on the aryl or heteroaryl ring, and in such instances, the number of ring members designates the number of ring members in the fused (aryl/heteroaryl) ring system. Bicyclic heteroaryl groups wherein one ring does not contain a heteroatom (e.g, indolyl, quinolinyl, carbazolyl, and the like) the point of attachment can be on either ring, i.e., either the ring bearing a heteroatom (e.g, 2-indolyl) or the ring that does not contain a heteroatom (e.g., 5-indolyl). A heteroaryl group may be described as, e.g., a 6-10-membered heteroaryl, wherein the term "membered" refers to the non-hydrogen ring atoms within the moiety. Each instance of a heteroaryl group may be independently optionally substituted, i.e., unsubstituted (an "unsubstituted heteroaryl") or substituted (a "substituted heteroaryl") with one or more substituents e.g., for instance from 1 to 5 substituents, 1 to 3 substituents, or 1 substituent

Exemplary 5-membered heteroaryl groups containing one heteroatom include, without limitation, pyrrolyl, furanyl and thiophenyl. Exemplary 5-membered heteroaryl groups containing two heteroatoms include, without limitation, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary 5-membered heteroaryl groups containing three heteroatoms include, without limitation, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary 5-membered heteroaryl groups containing four heteroatoms include, without limitation, tetrazolyl. Exemplary 6-membered heteroaryl groups containing one heteroatom include, without limitation, pyridinyl. Exemplary 6-membered heteroaryl groups containing two heteroatoms include, without limitation, pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary 6- membered heteroaryl groups containing three or four heteroatoms include, without limitation, triazinyl and tetrazinyl, respectively. Exemplary 7-membered heteroaryl groups containing one heteroatom include, without limitation, azepinyl, oxepinyl, and thiepinyl. Exemplary 5,6- bicyclic heteroaryl groups include, without limitation, indolyl, isoindolyl, indazolyl, benzotri azolyl, benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolizinyl, and purinyl. Exemplary 6,6-bicyclic heteroaryl groups include, without limitation, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl. Other exemplary heteroaryl groups include heme and heme derivatives.

As used herein, "cycloalkyl" refers to a radical of a non-aromatic cyclic hydrocarbon group having from 3 to 10 ring carbon atoms ("C ₃ -C ₁₀ cycloalkyl") and zero heteroatoms in the non-aromatic ring system. In some embodiments, a cycloalkyl group has 3 to 8 ring carbon atoms ("C ₃ -C ₈ cycloalkyl"). In some embodiments, a cycloalkyl group has 3 to 6 ring carbon atoms ("C ₃ -C ₆ cycloalkyl"). In some embodiments, a cycloalkyl group has 3 to 6 ring carbon atoms ("C ₃ -C ₆ cycloalkyl"). In some embodiments, a cycloalkyl group has 5 to 10 ring carbon atoms ("C ₅ -C ₁₀ cycloalkyl"). A cycloalkyl group may be described as, e.g., a C ₄ -C ₇ -membered cycloalkyl, wherein the term "membered" refers to the non-hydrogen ring atoms within the moiety. Exemplary C ₃ -C ₆ cycloalkyl groups include, without limitation, cyclopropyl (C ₃ ), cyclopropenyl (C ₃ ), cyclobutyl (C ₄ ), cyclobutenyl (C ₄ ), cyclopentyl (C ₅ ), cyclopentenyl (C ₅ ), cyclohexyl (C ₆ ), cyclohexenyl (C ₆ ), cyclohexadienyl (C ₆ ), and the like. Exemplary C ₈ -C ₈ cycloalkyl groups include, without limitation, the aforementioned C ₃ -C ₆ cycloalkyl groups as well as cycloheptyl (C ₇ ), cycloheptenyl (C ₇ ), cycloheptadienyl (C ₇ ), cycloheptatrienyl (C ₇ ), cyclooctyl (C ₈ ), cyclooctenyl (C ₈ ), cubanyl (C ₈ ), bicyclo[l. l.l]pentanyl (C ₅ ), bicyclo[2.2.2]octanyl (C ₈ ), bicyclo[2.1.1]hexanyl (C ₆ ), bicyclo[3.1.1]heptanyl (C ₇ ), and the like. Exemplary C ₃ -C ₁₀ cycloalkyl groups include, without limitation, the aforementioned C ₈ -C ₈ cycloalkyl groups as well as cyclononyl (C ₉ ), cyclononenyl (C ₉ ), cyclodecyl (C ₁₀ ), cyclodecenyl (C ₁₀ ), octahydro- 1 H -indenyl (C ₉ ), decahydronaphthalenyl (C ₁₀ ), spiro[4.5]decanyl (C ₁₀ ), and the like. As the foregoing examples illustrate, in certain embodiments, the cycloalkyl group is either monocyclic ("monocyclic cycloalkyl") or contain a fused, bridged or spiro ring system such as a bicyclic system ("bicyclic cycloalkyl") and can be saturated or can be partially unsaturated. "Cycloalkyl" also includes ring systems wherein the cycloalkyl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is on the cycloalkyl ring, and in such instances, the number of carbons continue to designate the number of carbons in the cycloalkyl ring system. Each instance of a cycloalkyl group may be independently optionally substituted, i.e., unsubstituted (an "unsubstituted cycloalkyl") or substituted (a "substituted cycloalkyl") with one or more substituents. In certain embodiments, the cycloalkyl group is unsubstituted C ₃ -C ₁₀ cycloalkyl. In certain embodiments, the cycloalkyl group is a substituted C ₃ -C ₁₀ cycloalkyl. "Heterocyclyl" as used herein refers to a radical of a 3- to 16-membered non-aromatic ring system having ring carbon atoms and 1 to 8 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon ("3-16 membered heterocyclyl"). In heterocyclyl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. A heterocyclyl group can either be monocyclic ("monocyclic heterocyclyl") or a fused, bridged or spiro ring system such as a bicyclic system ("bicyclic heterocyclyl"), and can be saturated or can be partially unsaturated. Heterocyclyl bicyclic ring systems can include one or more heteroatoms in one or both rings. "Heterocyclyl" also includes ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more cycloalkyl groups wherein the point of attachment is either on the cycloalkyl or heterocyclyl ring, or ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more aryl or heteroaryl groups, wherein the point of attachment is on the heterocyclyl ring, and in such instances, the number of ring members continue to designate the number of ring members in the heterocyclyl ring system. A heterocyclyl group may be described as, e.g., a 3-7-membered heterocyclyl, wherein the term "membered" refers to the nonhydrogen ring atoms, i.e., carbon, nitrogen, oxygen, sulfur, boron, phosphorus, and silicon, within the moiety. Each instance of heterocyclyl may be independently optionally substituted, i.e., unsubstituted (an "unsubstituted heterocyclyl") or substituted (a "substituted heterocyclyl") with one or more substituents. In certain embodiments, the heterocyclyl group is unsubstituted 3-16 membered heterocyclyl. In certain embodiments, the heterocyclyl group is substituted 3- 16 membered heterocyclyl.

Exemplary 3-membered heterocyclyl groups containing one heteroatom include, without limitation, azirdinyl, oxiranyl, thiorenyl. Exemplary 4-membered heterocyclyl groups containing one heteroatom include, without limitation, azetidinyl, oxetanyl and thietanyl. Exemplary 5-membered heterocyclyl groups containing one heteroatom include, without limitation, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl and pyrrolyl-2, 5-dione. Exemplary 5-membered heterocyclyl groups containing two heteroatoms include, without limitation, dioxolanyl, oxasulfuranyl, disulfuranyl, and oxazolidin-2-one. Exemplary 5-membered heterocyclyl groups containing three heteroatoms include, without limitation, triazolinyl, oxadiazolinyl, and thiadiazolinyl. Exemplary 6-membered heterocyclyl groups containing one heteroatom include, without limitation, piperidinyl (e.g., 2,2,6,6-tetramethylpiperidinyl), tetrahydropyranyl, dihydropyridinyl, pyri dinonyl (e.g., l-methylpyridin2-onyl), and thianyl. Exemplary 6-membered heterocyclyl groups containing two heteroatoms include, without limitation, piperazinyl, morpholinyl, pyridazinonyl (2-methylpyridazin-3-onyl), pyrimidinonyl (e.g., l-methylpyrimidin-2-onyl, 3- methylpyrimidin-4-onyl), dithianyl, dioxanyl. Exemplary 6-membered heterocyclyl groups containing two heteroatoms include, without limitation, triazinanyl. Exemplary 7-membered heterocyclyl groups containing one heteroatom include, without limitation, azepanyl, oxepanyl and thiepanyl. Exemplary 8-membered heterocyclyl groups containing one heteroatom include, without limitation, azocanyl, oxecanyl and thiocanyl. Exemplary 5-membered heterocyclyl groups fused to a C ₆ aryl ring (also referred to herein as a 5,6-bicyclic heterocyclyl ring) include, without limitation, indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, benzoxazolinonyl, and the like. Exemplary 5-membered heterocyclyl groups fused to a heterocyclyl ring (also referred to herein as a 5,5-bicyclic heterocyclyl ring) include, without limitation, octahydropyrrolopyrrolyl (e.g., octahydropyrrolo[3,4-c]pyrrolyl), and the like. Exemplary 6-membered heterocyclyl groups fused to a heterocyclyl ring (also referred to as a 4,6-membered heterocyclyl ring) include, without limitation, diazaspirononanyl (e.g., 2,7- diazaspiro[3.5]nonanyl). Exemplary 6-membered heterocyclyl groups fused to an aryl ring (also referred to herein as a 6,6-bicyclic heterocyclyl ring) include, without limitation, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and the like. Exemplary 6-membered heterocyclyl groups fused to a cycloalkyl ring (also referred to herein as a 6,7-bicyclic heterocyclyl ring) include, without limitation, azabicyclooctanyl (e.g., (l,5)-8-azabicyclo[3.2.1]octanyl).

Exemplary 6-membered heterocyclyl groups fused to a cycloalkyl ring (also referred to herein as a 6,8-bicyclic heterocyclyl ring) include, without limitation, azabicyclononanyl (e.g., 9- azabicyclo[3.3.1]nonanyl).

The terms "alkylene," "alkenylene," "alkynylene," "haloalkylene," "heteroalkylene," "cycloalkylene," or "heterocyclylene," alone or as part of another substituent, mean, unless otherwise stated, a divalent radical derived from an alkyl, alkenyl, alkynyl, haloalkylene, heteroalkylene, cycloalkyl, or heterocyclyl respectively. For example, the term "alkenylene," by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from an alkene. An alkylene, alkenylene, alkynylene, haloalkylene, heteroalkylene, cycloalkylene, or heterocyclylene group may be described as, e.g., a C ₁ -C ₆ -membered alkylene, C ₂ -C ₆ -membered alkenylene, C ₂ -C ₆ -membered alkynylene, C ₁ -C ₆ -membered haloalkylene, C ₁ - C ₆ -membered heteroalkylene, C ₈ -C ₈ -membered cycloalkylene, or C ₈ -C ₈ -membered heterocyclylene, wherein the term "membered" refers to the non-hydrogen atoms within the moiety. In the case of heteroalkylene and heterocyclylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like). Still further, no orientation of the linking group is implied by the direction in which the formula of the linking group is written. For example, the formula - C(O) ₂ R'- may represent both -C(O) ₂ R'- and -R'C(O) ₂ -.

As used herein, the terms "cyano" or "-CN" refer to a substituent having a carbon atom joined to a nitrogen atom by a triple bond, e.g., C =N.

As used herein, the terms "halogen" or "halo" refer to fluorine, chlorine, bromine or iodine.

As used herein, the term "hydroxy" refers to -OH.

As used herein, the term "nitro" refers to a substitutent having two oxygen atoms bound to a nitrogen atom, e.g., -NO ₂ .

As used herein, the term "nucleobase" as used herein, is a nitrogen-containing biological compounds found linked to a sugar within a nucleoside — the basic building blocks of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The primary, or naturally occurring, nucleobases are cytosine (DNA and RNA), guanine (DNA and RNA), adenine (DNA and RNA), thymine (DNA) and uracil (RNA), abbreviated as C, G, A, T, and U, respectively. Because A, G, C, and T appear in the DNA, these molecules are called DNA-bases; A, G, C, and U are called RNA-bases. Adenine and guanine belong to the double-ringed class of molecules called purines (abbreviated as R). Cytosine, thymine, and uracil are all pyrimidines. Other nucleobases that do not function as normal parts of the genetic code, are termed non-naturally occurring. In an embodiment, a nucleobase may be chemically modified, for example, with an alkyl (e.g., methyl), halo, -O-alkyl, or other modification.

As used herein, the term "nucleic acid" refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and polymers thereof in either single- or double-stranded form. The term "nucleic acid" includes a gene, cDNA, pre-mRNA, or an mRNA. In one embodiment, the nucleic acid molecule is synthetic (e.g, chemically synthesized) or recombinant. Unless specifically limited, the term encompasses nucleic acids containing analogues or derivatives of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g, degenerate codon substitutions), alleles, orthologs, SNPs, and complementarity sequences as well as the sequence explicitly indicated.

As used herein, "oxo" refers to a carbonyl, i.e., -C(O)-.

The symbol " as used herein in relation to a compound of Formula (I) or (II) refers to an attachment point to another moiety or functional group within the compound.

Alkyl, alkenyl, alkynyl, haloalkyl, heteroalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl groups, as defined herein, are optionally substituted. In general, the term "substituted", whether preceded by the term "optionally" or not, means that at least one hydrogen present on a group (e.g., a carbon or nitrogen atom) is replaced with a permissible substituent, e.g, a substituent which upon substitution results in a stable compound, e.g., a compound which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, or other reaction. Unless otherwise indicated, a "substituted" group has a substituent at one or more substitutable positions of the group, and when more than one position in any given structure is substituted, the substituent is either the same or different at each position. The term "substituted" is contemplated to include substitution with all permissible substituents of organic compounds, such as any of the substituents described herein that result in the formation of a stable compound. The present disclosure contemplates any and all such combinations in order to arrive at a stable compound. For purposes of this invention, heteroatoms such as nitrogen may have hydrogen substituents and/or any suitable substituent as described herein which satisfy the valencies of the heteroatoms and results in the formation of a stable moiety.

Two or more substituents may optionally be joined to form aryl, heteroaryl, cycloalkyl, or heterocyclyl groups. Such so-called ring-forming substituents are typically, though not necessarily, found attached to a cyclic base structure. In one embodiment, the ring-forming substituents are attached to adjacent members of the base structure. For example, two ring- forming substituents attached to adjacent members of a cyclic base structure create a fused ring structure. In another embodiment, the ring-forming substituents are attached to a single member of the base structure. For example, two ring-forming substituents attached to a single member of a cyclic base structure create a spirocyclic structure. In yet another embodiment, the ringforming substituents are attached to non-adjacent members of the base structure.

The compounds provided herein may exist in one or more particular geometric, optical, enantiomeric, diasteriomeric, epimeric, stereoisomeric, tautomeric, conformational, or anomeric forms, including but not limited to: cis- and trans-forms; E- and Z-forms; endo- and exo-forms; R-, S-, and meso-forms; D- and L-forms; d- and 1-forms; (+) and (-) forms; keto-, enol-, and enolate-forms; syn- and anti-forms; synclinal- and anticlinal-forms; α- and β-forms; axial and equatorial forms; boat-, chair-, twist-, envelope-, and half chair-forms; and combinations thereof, hereinafter collectively referred to as "isomers" (or "isomeric forms").

Compounds described herein can comprise one or more asymmetric centers, and thus can exist in various isomeric forms, e.g., enantiomers and/or diastereomers. For example, the compounds described herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer. In an embodiment, the stereochemistry depicted in a compound is relative rather than absolute. Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high-pressure liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers can be prepared by asymmetric syntheses. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, Stereochemistry of Carbon Compounds (McGraw-Hill, NY, 1962); and Wilen, Tables of Resolving Agents and Optical Resolutions p. 268 (E.L. Eliel, Ed., Univ, of Notre Dame Press, Notre Dame, IN 1972). This disclosure additionally encompasses compounds described herein as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers.

As used herein, a pure enantiomeric compound is substantially free from other enantiomers or stereoisomers of the compound (i.e., in enantiomeric excess). In other words, an "S" form of the compound is substantially free from the "R" form of the compound and is, thus, in enantiomeric excess of the "R" form. The term "enantiomerically pure" or "pure enantiomer" denotes that the compound comprises more than 75% by weight, more than 80% by weight, more than 85% by weight, more than 90% by weight, more than 91% by weight, more than 92% by weight, more than 93% by weight, more than 94% by weight, more than 95% by weight, more than 96% by weight, more than 97% by weight, more than 98% by weight, more than 99% by weight, more than 99.5% by weight, or more than 99.9% by weight, of the enantiomer. In certain embodiments, the weights are based upon total weight of all enantiomers or stereoisomers of the compound.

In the compositions provided herein, an enantiomerically pure compound can be present with other active or inactive ingredients. For example, a pharmaceutical composition comprising an enantiomerically pure R-compound can comprise, for example, about 90% excipient and about 10% enantiomerically pure R-compound. In certain embodiments, the enantiomerically pure R-compound in such compositions can, for example, comprise, at least about 95% by weight R-compound and at most about 5% by weight S-compound, by total weight of the compound. For example, a pharmaceutical composition comprising an enantiomerically pure S- compound can comprise, for example, about 90% excipient and about 10% enantiomerically pure S-compound. In certain embodiments, the enantiomerically pure S-compound in such compositions can, for example, comprise, at least about 95% by weight S-compound and at most about 5% by weight R-compound, by total weight of the compound.

In some embodiments, a diastereomerically pure compound can be present with other active or inactive ingredients. For example, a pharmaceutical composition comprising a diastereometerically pure exo compound can comprise, for example, about 90% excipient and about 10% diastereometerically pure exo compound. In certain embodiments, the diastereometerically pure exo compound in such compositions can, for example, comprise, at least about 95% by weight exo compound and at most about 5% by weight endo compound, by total weight of the compound. For example, a pharmaceutical composition comprising a diastereometerically pure endo compound can comprise, for example, about 90% excipient and about 10% diastereometerically pure endo compound. In certain embodiments, the diastereometerically pure endo compound in such compositions can, for example, comprise, at least about 95% by weight endo compound and at most about 5% by weight exo compound, by total weight of the compound. In some embodiments, an isomerically pure compound can be present with other active or inactive ingredients. For example, a pharmaceutical composition comprising a isomerically pure exo compound can comprise, for example, about 90% excipient and about 10% isomerically pure exo compound. In certain embodiments, the isomerically pure exo compound in such compositions can, for example, comprise, at least about 95% by weight exo compound and at most about 5% by weight endo compound, by total weight of the compound. For example, a pharmaceutical composition comprising an isomerically pure endo compound can comprise, for example, about 90% excipient and about 10% isomerically pure endo compound. In certain embodiments, the isomerically pure endo compound in such compositions can, for example, comprise, at least about 95% by weight endo compound and at most about 5% by weight exo compound, by total weight of the compound.

In certain embodiments, the active ingredient can be formulated with little or no excipient or carrier.

Compound described herein may also comprise one or more isotopic substitutions. For example, H may be in any isotopic form, including ¹ H, ² H (D or deuterium), and ³ H (T or tritium); C may be in any isotopic form, including ¹² C, ¹³ C, and ¹⁴ C; O may be in any isotopic form, including ¹⁶ O and ¹⁸ O; N may be in any isotopic form, including ¹⁴ N and ¹⁵ N; F may be in any isotopic form, including ¹⁸ F, ¹⁹ F, and the like.

The term "pharmaceutically acceptable salt" is meant to include salts of the active compounds that are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein. When compounds of the present disclosure contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salt, or a similar salt. When compounds of the present invention contain relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable acid addition salts include those derived from inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like, as well as the salts derived from organic acids like acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic, suberic, fumaric, lactic, mandelic, phthalic, benzenesulfonic, p-tolylsulfonic, citric, tartaric, methanesulfonic, and the like. Also included are salts of amino acids such as arginate and the like, and salts of organic acids like glucuronic or galactunoric acids and the like (see, e.g., Berge et al, Journal of Pharmaceutical Science 66: 1-19 (1977)). C ₆ rtain specific compounds of the present invention contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts. These salts may be prepared by methods known to those skilled in the art. Other pharmaceutically acceptable carriers known to those of skill in the art are suitable for the present invention.

In addition to salt forms, the present disclosure provides compounds in a prodrug form. Prodrugs of the compounds described herein are those compounds that readily undergo chemical changes under physiological conditions to provide the compounds of the present invention. Additionally, prodrugs can be converted to the compounds of the present invention by chemical or biochemical methods in an ex vivo environment. For example, prodrugs can be slowly converted to the compounds of the present invention when placed in a transdermal patch reservoir with a suitable enzyme or chemical reagent.

The term "solvate" refers to forms of the compound that are associated with a solvent, usually by a solvolysis reaction. This physical association may include hydrogen bonding. Conventional solvents include water, methanol, ethanol, acetic acid, DMSO, THF, diethyl ether, and the like. The compounds of Formula (I) or (II) may be prepared, e.g., in crystalline form, and may be solvated. Suitable solvates include pharmaceutically acceptable solvates and further include both stoichiometric solvates and non-stoichiometric solvates. In certain instances, the solvate will be capable of isolation, for example, when one or more solvent molecules are incorporated in the crystal lattice of a crystalline solid. "Solvate" encompasses both solution-phase and isolable solvates. Representative solvates include hydrates, ethanolates, and methanolates.

The term "hydrate" refers to a compound which is associated with water. Typically, the number of the water molecules contained in a hydrate of a compound is in a definite ratio to the number of the compound molecules in the hydrate. Therefore, a hydrate of a compound may be represented, for example, by the general formula R x H ₂ O, wherein R is the compound and wherein x is a number greater than 0. A given compound may form more than one type of hydrates, including, e.g, monohydrates (x is 1), lower hydrates (x is a number greater than 0 and smaller than 1, e.g, hemihydrates (R-0.5 H ₂ O)), and polyhydrates (x is a number greater than 1, e.g., dihydrates (R-2 H ₂ O) and hexahydrates (R-6 H ₂ O)).

The term "tautomer" refers to compounds that are interchangeable forms of a particular compound structure, and that vary in the displacement of hydrogen atoms and electrons. Thus, two structures may be in equilibrium through the movement of π electrons and an atom (usually H). For example, enols and ketones are tautomers because they are rapidly interconverted by treatment with either acid or base. Another example of tautomerism is the aci- and nitro- forms of phenylnitromethane that are likewise formed by treatment with acid or base. Tautomeric forms may be relevant to the attainment of the optimal chemical reactivity and biological activity of a compound of interest.

Other Definitions

The following definitions are more general terms used throughout the present disclosure.

The articles "a" and "an" refer to one or more than one (e.g., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element. The term "and/or" means either "and" or "or" unless indicated otherwise.

The term "about" is used herein to mean within the typical ranges of tolerances in the art. For example, "about" can be understood as about 2 standard deviations from the mean. In certain embodiments, about means ±10%. In certain embodiments, about means ±5%. When about is present before a series of numbers or a range, it is understood that "about" can modify each of the numbers in the series or range. "Acquire" or "acquiring" as used herein, refer to obtaining possession of a value, e.g., a numerical value, or image, or a physical entity (e.g., a sample), by "directly acquiring" or "indirectly acquiring" the value or physical entity. "Directly acquiring" means performing a process (e.g., performing an analytical method or protocol) to obtain the value or physical entity. "Indirectly acquiring" refers to receiving the value or physical entity from another party or source (e.g., a third-party laboratory that directly acquired the physical entity or value). Directly acquiring a value or physical entity includes performing a process that includes a physical change in a physical substance or the use of a machine or device. Examples of directly acquiring a value include obtaining a sample from a human subject. Directly acquiring a value includes performing a process that uses a machine or device, e.g., mass spectrometer to acquire mass spectrometry data.

The terms "administer," "administering," or "administration," as used herein refers to implanting, absorbing, ingesting, injecting, inhaling, or otherwise introducing an inventive compound, or a pharmaceutical composition thereof.

As used herein, the terms "condition," "disease," and "disorder" are used interchangeably.

An "effective amount" of a compound of Formula (I) or (II) refers to an amount sufficient to elicit the desired biological response, i.e., treating the condition. As will be appreciated by those of ordinary skill in this art, the effective amount of a compound of Formula (I) or (II) may vary depending on such factors as the desired biological endpoint, the pharmacokinetics of the compound, the condition being treated, the mode of administration, and the age and health of the subject. An effective amount encompasses therapeutic and prophylactic treatment. For example, in treating cancer, an effective amount of an inventive compound may reduce the tumor burden or stop the growth or spread of a tumor.

A "therapeutically effective amount" of a compound of Formula (I) or (II) is an amount sufficient to provide a therapeutic benefit in the treatment of a condition or to delay or minimize one or more symptoms associated with the condition. In some embodiments, a therapeutically effective amount is an amount sufficient to provide a therapeutic benefit in the treatment of a condition or to minimize one or more symptoms associated with the condition. A therapeutically effective amount of a compound means an amount of therapeutic agent, alone or in combination with other therapies, which provides a therapeutic benefit in the treatment of the condition. The term "therapeutically effective amount" can encompass an amount that improves overall therapy, reduces or avoids symptoms or causes of the condition, or enhances the therapeutic efficacy of another therapeutic agent.

The terms "peptide," "polypeptide," and "protein" are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprised therein. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. "Prevention," "prevent," and "preventing" as used herein refers to a treatment that comprises administering a therapy, e.g., administering a compound described herein (e.g., a compound of Formula (I) or (II)) prior to the onset of a disease, disorder, or condition in order to preclude the physical manifestation of said disease, disorder, or condition. In some embodiments, "prevention," "prevent," and "preventing" require that signs or symptoms of the disease, disorder, or condition have not yet developed or have not yet been observed. In some embodiments, treatment comprises prevention and in other embodiments it does not.

A "subject" to which administration is contemplated includes, but is not limited to, humans (i.e., a male or female of any age group, e.g., a pediatric subject (e.g., infant, child, adolescent) or adult subject (e.g., young adult, middle-aged adult, or senior adult)) and/or other non-human animals, for example, mammals (e.g., primates (e.g., cynomolgus monkeys, rhesus monkeys); commercially relevant mammals such as cattle, pigs, horses, sheep, goats, cats, and/or dogs) and birds (e.g., commercially relevant birds such as chickens, ducks, geese, and/or turkeys). In certain embodiments, the animal is a mammal. The animal may be a male or female and at any stage of development. A non-human animal may be a transgenic animal.

As used herein, the terms "treatment," "treat," and "treating" refer to reversing, alleviating, delaying the onset of, or inhibiting the progress of one or more of a symptom, manifestation, or underlying cause of a disease, disorder, or condition (e.g., as described herein), e.g., by administering a therapy, e.g., administering a compound described herein (e.g., a compound of Formula (I) or (II)). In an embodiment, treating comprises reducing, reversing, alleviating, delaying the onset of, or inhibiting the progress of a symptom of a disease, disorder, or condition. In an embodiment, treating comprises reducing, reversing, alleviating, delaying the onset of, or inhibiting the progress of a manifestation of a disease, disorder, or condition. In an embodiment, treating comprises reducing, reversing, alleviating, reducing, or delaying the onset of, an underlying cause of a disease, disorder, or condition. In some embodiments, "treatment," "treat," and "treating" require that signs or symptoms of the disease, disorder, or condition have developed or have been observed. In other embodiments, treatment may be administered in the absence of signs or symptoms of the disease or condition, e.g., in preventive treatment. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and/or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example, to delay or prevent recurrence. Treatment may also be continued after symptoms have resolved, for example, to delay or prevent recurrence. In some embodiments, treatment comprises prevention and in other embodiments it does not.

A "proliferative disease" refers to a disease that occurs due to abnormal extension by the multiplication of cells (Walker, Cambridge Dictionary of Biology, Cambridge University Press: Cambridge, UK, 1990). A proliferative disease may be associated with: 1) the pathological proliferation of normally quiescent cells; 2) the pathological migration of cells from their normal location (e.g., metastasis of neoplastic cells); 3) the pathological expression of proteolytic enzymes such as the matrix metalloproteinases (e.g., collagenases, gelatinases, and elastases); 4) the pathological angiogenesis as in proliferative retinopathy and tumor metastasis; or 5) evasion of host immune surveillance and elimination of neoplastic cells. Exemplary proliferative diseases include cancers (i.e., "malignant neoplasms"), benign neoplasms, and angiogenesis.

A "non-proliferative disease" refers to a disease that does not primarily extend through the abnormal multiplication of cells. A non-proliferative disease may be associated with any cell type or tissue type in a subject. Exemplary non-proliferative diseases include neurological diseases or disorders (e.g., a repeat expansion disease); autoimmune disease or disorders; immunodeficiency diseases or disorders; lysosomal storage diseases or disorders; inflammatory diseases or disorders; cardiovascular conditions, diseases, or disorders; metabolic diseases or disorders; respiratory conditions, diseases, or disorders; renal diseases or disorders; and infectious diseases.

Compounds

The present disclosure features a compound of Formula (I): (I), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; X, Y, and Z are each independently C(R ^3a ), C(R ^3a )(R ^3b ), N, N(R ^3c ), or O, wherein at least one of X, Y, and Z is N, N(R ^3c ), or O, and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each of L ¹ and L ² is independently absent, C ₁ -C ₆ -alkylene, C ₁ - C ₆ -heteroalkylene, -O-, -C(O)-, -N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkyleneheteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^c , - C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3- 7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, or -OR ^A ; R ^3a and R ^3b are each independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; or each of R ^3a and R ^3b , together with the carbon atom to which they are attached, form an oxo group; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, C ₁ -C ₆ alkylene-cycloalkyl, heterocyclyl, C ₁ -C ₆ alkylene-heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, heteroaryl, C ₁ -C ₆ alkylene-heteroaryl, or -C(O)R ^D wherein each alkyl, alkylene, alkenyl, alkynyl, heteoalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁸ ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ - haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, - C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ⁸ is C ₁ -C ₆ -alkyl, C ₂ - C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , -SR ^E , or -S(O) _x R ^D ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ - C ₆ alkylene-heteroaryl, -C(O)R ^D , or -S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ heteroalkyl, cycloalkyl, heterocyclyl, or -OR ^A ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D and R ^E is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ - C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; m is 0, 1, or 2; and x is 0, 1, or 2.

In another aspect, the present disclosure features a compound of Formula (II): (II), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; M and P are each independently C(R ² ) or N; U and W are each independently C or N; X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ), O, or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising U, W, X, Y, and Z may be single or double bonds as valency permits; each of L ¹ and L ² is independently absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ - heteroalkylene, -O-, -C(O)-, -N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ - C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, or - OR ^A ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^c ,-NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)OR ^D , or - S(O) _X R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ - heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, C ₁ -C ₆ alkylene-cycloalkyl, heterocyclyl, C ₁ -C ₆ alkylene-heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, heteroaryl, C ₁ -C ₆ alkylene-heteroaryl, or - C(O)R ^D wherein each alkyl, alkylene, alkenyl, alkynyl, heteoalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁸ ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ - C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, -C(O)R ^D , or - S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl, -OR ^A , -C(O)NR ^B R ^c , -C(O)R ^D , -C(O)OR ^D , or - S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ⁷ is C ₁ - C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2

As generally described herein for Formulas (I) and (II), A and B, are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ . In some embodiments, each of A and B are independently a monocyclic ring, e.g., monocyclic cycloalkyl, monocyclic heterocyclyl, monocyclic aryl, or monocyclic heteroaryl. The monocyclic ring may be saturated, partially unsaturated, or fully unsaturated (e.g., aromatic). In some embodiments, A or B are independently a monocyclic ring comprising between 3 and 10 ring atoms (e.g., 3, 4, 5, 6, 7, 8, 9, or 10 ring atoms). In some embodiments, A is a 4-membered monocyclic ring. In some embodiments, B is a 4-membered monocyclic ring. In some embodiments, A is a 5-membered monocyclic ring. In some embodiments, B is a 5-membered monocyclic ring. In some embodiments, A is a 6-membered monocyclic ring. In some embodiments, B is a 6-membered monocyclic ring. In some embodiments, A is a 7-membered monocyclic ring. In some embodiments, B is a 7-membered monocyclic ring. In some embodiments, A is an 8-membered monocyclic ring. In some embodiments, B is an 8-membered monocyclic ring. In some embodiments, A or B are independently a monocyclic ring optionally substituted with one or more R ¹ .

In some embodiments, A or B are independently a bicyclic ring, e.g., bicyclic cycloalkyl, bicyclic heterocyclyl, bicyclic aryl, or bicyclic heteroaryl. The bicyclic ring may be saturated, partially unsaturated, or fully unsaturated (e.g., aromatic). In some embodiments, A or B are independently a bicyclic ring comprising a fused, bridged, or spiro ring system. In some embodiments, A or B are independently a bicyclic ring comprising between 4 and 18 ring atoms (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 ring atoms). In some embodiments, A is a 6-membered bicyclic ring. In some embodiments, B is a 6-membered bicyclic ring. In some embodiments, A is a 7-membered bicyclic ring. In some embodiments, B is a 7-membered bicyclic ring. In some embodiments, A is an 8-membered bicyclic ring. In some embodiments, B is an 8-membered bicyclic ring. In some embodiments, A is a 9-membered bicyclic ring. In some embodiments, B is a 9-membered bicyclic ring. In some embodiments, A is a 10- membered bicyclic ring. In some embodiments, B is a 10-membered bicyclic ring. In some embodiments, A is an 11 -membered bicyclic ring. In some embodiments, B is an 11 -membered bicyclic ring. In some embodiments, A is a 12-membered bicyclic ring. In some embodiments, B is a 12-membered bicyclic ring. In some embodiments, A or B are independently a bicyclic ring optionally substituted with one or more R ¹ .

In some embodiments, A or B are independently a tricyclic ring, e.g., tricyclic cycloalkyl, tricyclic heterocyclyl, tricyclic aryl, or tricyclic heteroaryl. The tricyclic ring may be saturated, partially unsaturated, or fully unsaturated (e.g., aromatic). In some embodiments, A or B are independently a tricyclic ring that comprises a fused, bridged, or spiro ring system, or a combination thereof. In some embodiments, A or B are independently a tricyclic ring comprising between 6 and 24 ring atoms (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 ring atoms). In some embodiments, A is an 8-membered tricyclic ring. In some embodiments, B is an 8-membered tricyclic ring. In some embodiments, A is a 9- membered tricyclic ring. In some embodiments, B is a 9-membered tricyclic ring. In some embodiments, A is a 10-membered tricyclic ring. In some embodiments, B is a 10-membered tricyclic ring. In some embodiments, A or B are independently a tricyclic ring optionally substituted with one or more R ¹ .

In some embodiments, A or B are independently monocyclic cycloalkyl, monocyclic heterocyclyl, monocyclic aryl, or monocyclic heteroaryl. In some embodiments, A or B are independently bicyclic cycloalkyl, bicyclic heterocyclyl, bicyclic aryl, or bicyclic heteroaryl. In some embodiments, A or B are independently tricyclic cycloalkyl, tricyclic heterocyclyl, tricyclic aryl, or tricyclic heteroaryl. In some embodiments, A is monocyclic heterocyclyl. In some embodiments, B is monocyclic heterocyclyl. In some embodiments, A is bicyclic heterocyclyl. In some embodiments, B is bicyclic heterocyclyl. In some embodiments, A is monocyclic heteroaryl. In some embodiments, B is monocyclic heteroaryl. In some embodiments, A is bicyclic heteroaryl. In some embodiments, B is bicyclic heteroaryl.

In some embodiments, A or B are independently a nitrogen-containing heterocyclyl, e.g., heterocyclyl comprising one or more nitrogen atom. The one or more nitrogen atom of the nitrogen-containing heterocyclyl may be at any position of the ring. In some embodiments, the nitrogen-containing heterocyclyl is monocyclic, bicyclic, or tricyclic. In some embodiments, A or B are independently heterocyclyl comprising at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 nitrogen atoms. In some embodiments, A is heterocyclyl comprising 1 nitrogen atom. In some embodiments, B is heterocyclyl comprising 1 nitrogen atom. In some embodiments, A is heterocyclyl comprising 2 nitrogen atoms. In some embodiments, B is heterocyclyl comprising 2 nitrogen atoms. In some embodiments, A is heterocyclyl comprising 3 nitrogen atoms. In some embodiments, B is heterocyclyl comprising 3 nitrogen atoms. In some embodiments, A is heterocyclyl comprising 4 nitrogen atoms. In some embodiments, B is heterocyclyl comprising 4 nitrogen atoms. In some embodiments, A or B are independently a nitrogen-containing heterocyclyl comprising one or more additional heteroatoms, e.g., one or more of oxygen, sulfur, boron, silicon, or phosphorus. In some embodiments, the one or more nitrogen of the nitrogen-containing heterocyclyl is substituted, e.g., with R ¹ .

In some embodiments, A or B are independently a nitrogen-containing heteroaryl, e.g., heteroaryl comprising one or more nitrogen atom. The one or more nitrogen atom of the nitrogen-containing heteroaryl may be at any position of the ring. In some embodiments, the nitrogen-containing heteroaryl is monocyclic, bicyclic, or tricyclic. In some embodiments, A or B are independently heteroaryl comprising at least 1, at least 2, at least 3, at least 4, at least 5, or at least 6 nitrogen atoms. In some embodiments, A is heteroaryl comprising 1 nitrogen atom. In some embodiments, B is heteroaryl comprising 1 nitrogen atom. In some embodiments, A is heteroaryl comprising 2 nitrogen atoms. In some embodiments, B is heteroaryl comprising 2 nitrogen atoms. In some embodiments, A is heteroaryl comprising 3 nitrogen atoms. In some embodiments, B is heteroaryl comprising 3 nitrogen atoms. In some embodiments, A is heteroaryl comprising 4 nitrogen atoms. In some embodiments, B is heteroaryl comprising 4 nitrogen atoms. In some embodiments, A or B are independently a nitrogen-containing heteroaryl comprising one or more additional heteroatoms, e.g., one or more of oxygen, sulfur, boron, silicon, or phosphorus. In some embodiments, the one or more nitrogen of the nitrogencontaining heteroaryl is substituted, e.g., with R ¹ .

In some embodiments, A is a 6-membered nitrogen-containing heterocyclyl, e.g., a 6- membered heterocyclyl comprising one or more nitrogen. In some embodiments, A is a 6- membered heterocyclyl comprising 1 nitrogen atom. In some embodiments, A is a 6-membered heterocyclyl comprising 2 nitrogen atoms. In some embodiments, A is a 6-membered heterocyclyl comprising 3 nitrogen atoms. In some embodiments, A is a 6-membered heterocyclyl comprising 4 nitrogen atoms. The one or more nitrogen atom of the 6-membered nitrogen-containing heterocyclyl may be at any position of the ring. In some embodiments, A is a 6-membered nitrogen-containing heterocyclyl optionally substituted with one or more R ¹ . In some embodiments, the one or more nitrogen of the 6-membered nitrogen-containing heterocyclyl is substituted, e.g., with R ¹ . In some embodiments, A is a 6-membered nitrogen- containing heterocyclyl comprising one or more additional heteroatoms, e.g., one or more of oxygen, sulfur, boron, silicon, or phosphorus. In some embodiments, B is a 5-membered nitrogen-containing heterocyclyl or heteroaryl, e.g., a 5-membered heterocyclyl or heteroaryl comprising one or more nitrogen. In some embodiments, B is a 5-membered heterocyclyl comprising 1 nitrogen atom. In some embodiments, B is a 5-membered heteroaryl comprising 1 nitrogen atom. In some embodiments, B is a 5-membered heterocyclyl comprising 2 nitrogen atoms. In some embodiments, B is a 5- membered heteroaryl comprising 2 nitrogen atoms. In some embodiments, B is a 5-membered heterocyclyl comprising 3 nitrogen atoms. In some embodiments, B is a 5-membered heteroaryl comprising 3 nitrogen atoms. The one or more nitrogen atom of the 5-membered nitrogen- containing heterocyclyl or heteroaryl may be at any position of the ring. In some embodiments, B is a 5-membered nitrogen-containing heterocyclyl optionally substituted with one or more R ¹ . In some embodiments, B is a 5-membered nitrogen-containing heteroaryl optionally substituted with one or more R ¹ . In some embodiments, the one or more nitrogen of the 5-membered nitrogen-containing heterocyclyl or heteroaryl is substituted, e.g., with R ¹ . In some embodiments, B is a 5-membered nitrogen-containing heterocyclyl or heteroaryl comprising one or more additional heteroatoms, e.g., one or more of oxygen, sulfur, boron, silicon, or phosphorus.

In some embodiments, B is a nitrogen-containing bicyclic heteroaryl (e.g., a 9-membered nitrogen-containing bicyclic heteroaryl), that is optionally substituted with one or more R ¹ . In some embodiments, B is a 9-membered bicyclic heteroaryl comprising 1 nitrogen atom. In some embodiments, B is a 9-membered bicyclic heteroaryl comprising 2 nitrogen atoms. In some embodiments, B is a 9-membered bicyclic heteroaryl comprising 3 nitrogen atoms. In some embodiments, B is a 9-membered bicyclic heteroaryl comprising 4 nitrogen atoms. The one or more nitrogen atom of the 9-membered bicyclic heteroaryl may be at any position of the ring. In some embodiments, B is a 9-membered bicyclic heteroaryl substituted with one or more R ¹ .

In some embodiments, each of A and B are independently selected from:

herein. In an embodiment, A and B are each independently a saturated, partially saturated, or unsaturated (e.g., aromatic) derivative of one of the rings described above. In an embodiment, A and B are each independently a stereoisomer of one of the rings described above. In some embodiments, each of A and B are independently selected from:

each R ¹ is as defined herein. In an embodiment, A and B are each independently a saturated, partially saturated, or unsaturated (e.g., aromatic) derivative of one of the rings described above. In an embodiment, A and B are each independently a stereoisomer of one of the rings described above.

In some embodiments, one of A and B is independently selected from , described herein. In some embodiments, one of A and B is independently selected from , wherein each R ^a is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, halo, cyano, or -OR ^A , and each alkyl, heteroalkyl, and haloalkyl is optionally substituted with one or more R ⁷ . In some embodiments, one of A and B is independently , wherein each R ^la is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, halo, cyano, or -OR ^A , and each alkyl, heteroalkyl, and haloalkyl is optionally substituted with one or more R ⁷ .

In some embodiments, one of A and B is independently a monocyclic heterocyclyl or bicyclic heterocyclyl, each of which is optionally substituted with one or more R ¹ . In some embodiments, one of A and B is independently a nitrogen-containing heterocyclyl optionally substituted with one or more R ¹ . In some embodiments, one of A and B is independently a 4-8 membered heterocyclyl optionally substituted with one or more R ¹ . In some embodiments, one wherein R ¹ is as described herein. In some embodiments, one of A and B is independently selected from wherein R ¹ is as described herein. In some embodiments, one of A and B is , wherein R ¹ is as described herein. In some embodiments, A is selected from

, wherein R ¹ is as described herein. In some embodiments, B is selected from wherein R ¹ is as described herein. In some

A is selected one of A and B is independently selected from,

As generally described herein, for Formulas (I) and (II), L ¹ and L ² each independently may be absent or refer to a C ₁ -C ₆ -alkylene, C ₁ -C ₆ -heteroalkylene, -O-, -C(O)-, -N(R ⁴ )-, - N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )- group, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ .

In some embodiments, L ¹ is absent. In some embodiments, L ¹ is C ₁ -C ₆ -alkylene (e.g., C ₁ -alkylene, C ₂ -alkylene, C ₈ -alkylene, C ₄ -alkylene, C ₈ -alkylene, or C ₆ -alkylene). In some embodiments, L ¹ is unsubstituted C ₁ -C ₆ alkylene. In some embodiments, L ¹ is substituted C ₁ -C ₆ - alkylene, e.g., C ₁ -C ₆ alkylene substituted with one or more R ⁵ . In some embodiments, L ¹ is C ₁ - alkylene substituted with one R ⁵ . In some embodiments, L ¹ is -CH ₂ - (or methylene). In some embodiments, L ¹ is -C(O)- (or carbonyl).

In some embodiments, L ¹ is absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ -heteroalkylene, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ .

In some embodiments, L ¹ is C ₁ -C ₆ heteroalkylene (e.g., C ₁ -heteroalkylene, C ₂ - heteroalkylene, C>, -heteroalkylene, C ₄ -heteroalkylene, C ₈ -heteroalkylene, or C ₆ -heteroalkylene). In some embodiments, L ¹ is unsubstituted C ₁ -C ₆ heteroalkylene. In some embodiments, L ¹ is substituted heteroalkylene, e.g., C ₁ -C ₆ heteroalkylene substituted with one or more R ⁵ . In some embodiments, the heteroalkylene comprises 1 or more heteroatoms. In some embodiments, the heteroalkylene comprises one or more of oxygen, sulfur, nitrogen, boron, silicon, or phosphorus. In some embodiments, L ¹ is -N(R ⁴ )C(O)-. In some embodiments, L ¹ is -C(O)N(R ⁴ )-. In some embodiments, L ¹ is -C(O)N(H)-.

In some embodiments, L ¹ is oxygen. In some embodiments, L ¹ is nitrogen which is optionally substituted with R ⁴ . In some embodiments, L ¹ is nitrogen substituted with R ⁴ . In some embodiments, L ¹ is -N(R ⁴ )-, e.g., -N(CH ₃ )-. In some embodiments, L ¹ is -NH-. In some embodiments, L ¹ is -O-.

In some embodiments, L ² is absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ -heteroalkylene, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ . In some embodiments, L ² is unsubstituted C ₁ -C ₆ heteroalkylene. In some embodiments, L ² is substituted heteroalkylene, e.g., C ₁ -C ₆ heteroalkylene substituted with one or more R ⁵ . In some embodiments, the heteroalkylene comprises 1 or more heteroatoms. In some embodiments, the heteroalkylene comprises one or more of oxygen, sulfur, nitrogen, boron, silicon, or phosphorus. In some embodiments, L ² is -N(R ⁴ )C(O)-. In some embodiments, L ² is - C(O)N(R ⁴ )-. In some embodiments, L ² is -C(O)N(H)-.

In some embodiments, L ² is nitrogen which is optionally substituted with R ⁴ . In some embodiments, L ² is nitrogen substituted with R ⁴ . In some embodiments, L ² is -N(R ⁴ )-, e.g., - N(CHa)-. In some embodiments, L ² is -NH-.

As generally described herein, for Formula (I), X, Y, and Z each independently refer to C(R ^3a ), C(R ^3a )(R ^3b ), N, or N(R ^3c ), or O. In some embodiments, at least one of X, Y, and Z is either N or N(R ^3c ). In some embodiments, at least one of X, Y, and Z is O. In some embodiments, at least two of X, Y, and Z is N or N(R ^3c ). In some embodiments, X is N. In some embodiments, X is N(R ^3c ). In some embodiments, X is O. In some embodiments, X is C(R ^3a ) (e.g., CH). In some embodiments, X is C(R ^3a )(R ^3b ). In some embodiments, Y is N. In some embodiments, Y is N(R ^3c ). In some embodiments, Y is C(R ^3a ) (e.g., CH). In some embodiments, Y is C(R ^3a )C(R ^3b ). In some embodiments, Z is N. In some embodiments, Z is N(R ^3c ). In some embodiments, Z is C(R ^3a ) (e.g., CH). In some embodiments, Z is C(R ^3a )C(R ^3b ). In some embodiments, two of X, Y, and Z are N, and the other of X, Y, and Z is C(R ^3a ) (e.g., CH). In some embodiments, one of X, Y, and Z is C(R ^3a ) (e.g., CH), and the others of X, Y, and Z are each independently N. In some embodiments, X and Y are each independently N, and Z is C(R ^3a ) (e.g., CH). In some embodiments, X is C(R ^3a ) (e.g., CH), and Y and Z are each independently N.

In some embodiments, X, Y, and Z are each independently N or C(R ^3a ), wherein at least one of X, Y, and Z is N and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits.

In some embodiments, X is C(R ^3a ), Y is C(R ^3a ), and Z is O. In some embodiments, X is C(R ^3a ), Y is C(R ^3a ), Z is O, and y is 0. In some embodiments, X is C(R ^3a ), Y is C(R ^3a ), Z is O, and the bond between X and Y is a double bond. In some embodiments, X is C(R ^3a ), Y is C(R ^3a ), Z is O, and the bond between Y and Z is a single bond.

In some embodiments for Formulas (I) and (II), R ¹ is hydrogen. In some embodiments, R ¹ is C ₁ -C ₆ -alkyl. In some embodiments, R ¹ is C ₂ -C ₆ -alkenyl. In some embodiments, R ¹ is C ₂ - C ₆ -alkynyl. In some embodiments, R ¹ is C ₁ -C ₆ -heteroalkyl. In some embodiments, R ¹ is C ₁ -C ₆ - haloalkyl (e.g., -CF ₃ ). In some embodiments, R ¹ is C ₁ -alkyl (e.g., methyl). In some embodiments, R ¹ is unsubstituted C ₁ -C ₆ -alkyl, unsubstituted C ₂ -C ₆ -alkenyl, unsubstituted C ₂ -C ₆ - alkynyl, unsubstituted C ₁ -C ₆ -heteroalkyl, or unsubstituted C ₁ -C ₆ -haloalkyl. In some embodiments, R ¹ is C ₁ -C ₆ -alkyl substituted with one or more R ⁶ . In some embodiments, R ¹ is C ₂ -C ₆ -alkenyl substituted with one or more R ⁶ . In some embodiments, R ¹ is C ₂ -C ₆ -alkynyl substituted with one or more R ⁶ . In some embodiments, R ¹ is C ₁ -C ₆ -heteroalkyl substituted with one or more R ⁶ . In some embodiments, R ¹ is C ₁ -C ₆ -haloalkyl substituted with one or more R ⁶ . In some embodiments, R ¹ is methyl.

In some embodiments, R ¹ is cycloalkyl (e.g., 3-7 membered cycloalkyl). In some embodiments, R ¹ is heterocyclyl (e.g., 3-7 membered heterocyclyl). In some embodiments, R ¹ is aryl. In some embodiments, R ¹ is C ₁ -C ₆ alkylene-aryl (e.g., benzyl). In some embodiments, R ¹ is C ₁ -C ₆ alkenylene-aryl. In some embodiments, R ¹ is C ₁ -C ₆ alkylene-heteroaryl. In some embodiments, R ¹ is heteroaryl. In some embodiments, R ¹ is unsubstituted cycloalkyl, unsubstituted heterocyclyl, unsubstituted aryl, unsubstituted C ₁ -C ₆ alkylene-aryl, unsubstituted C ₁ -C ₆ alkenylene-aryl, unsubstituted C ₁ -C ₆ alkylene-heteroaryl, or unsubstituted heteroaryl. In some embodiments, R ¹ is cycloalkyl substituted with one or more R ⁶ . In some embodiments, R ¹ is heterocyclyl substituted with one or more R ⁶ . In some embodiments, R ¹ is aryl substituted with one or more R ⁶ . In some embodiments, R ¹ is C ₁ -C ₆ alkylene-aryl substituted with one or more R ⁶ . In some embodiments, R ¹ is C ₁ -C ₆ alkenylene-aryl substituted with one or more R ⁶ . In some embodiments, R ¹ is C ₁ -C ₆ alkylene-heteroaryl substituted with one or more R ⁶ . In some embodiments, R ¹ is heteroaryl substituted with one or more R ⁶ .

In some embodiments, R ¹ is -OR ^A . In some embodiments, R ¹ is -NR ^B R ^C (e.g., NH2 or NMe2). In some embodiments, R ¹ is -NR ^B C(O)R ^D . In some embodiments, R ¹ is-C(O)NR ^B R ^c . In some embodiments, R ¹ is -C(O)R ^D . In some embodiments, R ¹ is -C(O)OR ^D . In some embodiments, R ¹ is-SR ^E . In some embodiments, R ¹ is -S(O) _X R ^D . In some embodiments, R ¹ is halo, e.g., fluoro, chloro, bromo, or iodo. In some embodiments, R ¹ is cyano. In some embodiments, R ¹ is nitro (-NO2). In some embodiments, R ¹ is oxo.

In some embodiments, two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl. In some embodiments, two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered heterocyclyl. In some embodiments, two R ¹ groups, together with the atoms to which they are attached, form a 5- or 6-membered aryl. In some embodiments, two R ¹ groups, together with the atoms to which they are attached, form a 5- or 6-membered heteroaryl. The cycloalkyl, heterocyclyl, aryl, or heteroaryl may be substituted with one or more R ⁶ .

In some embodiments for Formulas (I) and (II), R ² is hydrogen. In some embodiments, R ² is halo (e.g., fluoro, chloro, bromo, or iodo). In some embodiments, R ² is cyano. In some embodiments, R ² is C ₁ -C ₆ -alkyl. In some embodiments, R ² is C ₂ -C ₆ -alkenyl. In some embodiments, R ² is C ₂ -C ₆ -alkynyl. In some embodiments, R ² is -OR ^A (e.g., -OH).

In some embodiments, R ^3a , R ^3b , or both are independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ - heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D . In some embodiments, R ^3a and R ^3b are each independently hydrogen or C ₁ -C ₆ -alkyl. In some embodiments, R ^3a is hydrogen. In some embodiments, R ^3b is hydrogen. In some embodiments, R ^3a is C ₁ -C ₆ -alkyl (e.g., methyl). In some embodiments, R ^3b is C ₁ -C ₆ -alkyl (e.g., methyl). In some embodiments, R ^3a is halo (e.g., fluoro, chloro, bromo, or iodo). In some embodiments, R ^3b is halo (e.g., fluoro, chloro, bromo, or iodo). In some embodiments, R ^3a is cyano. In some embodiments, R ^3b is cyano. In some embodiments, R ^3a is -OR ^A (e.g., -OH). In some embodiments, R ^3b is -OR ^A (e.g., -OH). In some embodiments, R ^3a is -NR ^B R ^C . In some embodiments, R ^3b is -NR ^B R ^C . In some embodiments, R ^3a is -C(O)R ^D . In some embodiments, R ^3b is -C(O)R ^D . In some embodiments, R ^3a is -C(O)OR ^D . In some embodiments, R ^3b is -C(O)OR ^D . In some embodiments, each of R ^3a and R ^3b , together with the carbon atom to which they are attached, form an oxo group.

In some embodiments, R ^3c is hydrogen. In some embodiments, R ^3c is C ₁ -C ₆ -alkyl. In some embodiments, R ^3c is methyl. In some embodiments, R ^3c is not hydrogen. In some embodiments, R ^3c is not methyl. In some embodiments, R ^3c is C ₁ -C ₆ alkyl. In some embodiments, R ^3c is C ₁ -C ₆ substituted with one or more R ⁸ .

In some embodiments, R ⁴ is hydrogen. In some embodiments, R ⁴ is C ₁ -C ₆ alkyl. In some embodiments, R ⁴ is C ₁ -C ₆ haloalkyl (e.g., -CF ₃ or -CHF2). In some embodiments, R ⁴ is methyl.

In some embodiments, R ⁵ is hydrogen. In some embodiments, R ⁵ is C ₁ -C ₆ -alkyl. In some embodiments, R ⁵ is C ₁ -C ₆ -heteroalkyl. In some embodiments, R ⁵ is C ₁ -C ₆ -haloalkyl. In some embodiments, R ⁵ is cycloalkyl. In some embodiments, R ⁵ is halo (e.g., fluoro, chloro, bromo, or iodo). In some embodiments, R ⁵ is cyano. In some embodiments, R ⁵ is oxo. In some embodiments, R ⁵ is -OR ^A . In some embodiments, R ⁵ is -NR ^B R ^C . In some embodiments, R ⁵ is - C(O)R ^D or -C(O)OR ^D .

In some embodiments, R ⁶ is C ₁ -C ₆ -alkyl. In some embodiments, R ⁶ is C ₂ -C ₆ -alkenyl. In some embodiments, R ⁶ is C ₂ -C ₆ -alkynyl. In some embodiments, R ⁶ is C ₁ -C ₆ -heteroalkyl. In some embodiments, R ⁶ is C ₁ -C ₆ -haloalkyl. In some embodiments, R ⁶ is unsubstituted C ₁ -C ₆ - alkyl, unsubstituted C ₂ -C ₆ -alkenyl, unsubstituted C ₂ -C ₆ -alkynyl, unsubstituted C ₁ -C ₆ -haloalkyl, or unsubstituted C ₁ -C ₆ -heteroalkyl. In some embodiments, R ⁶ is C ₁ -C ₆ -alkyl substituted with one or more R ¹¹ . In some embodiments, R ⁶ is C ₂ -C ₆ -alkenyl substituted with one or more R ¹¹ . In some embodiments, R ⁶ is C ₂ -C ₆ -alkynyl substituted with one or more R ¹¹ . In some embodiments, R ⁶ is C ₁ -C ₆ -haloalkyl substituted with one or more R ¹¹ . In some embodiments, R ⁶ is C ₁ -C ₆ -heteroalkyl substituted with one or more R ¹¹ .

In some embodiments, R ⁶ is cycloalkyl. In some embodiments, R ⁶ is heterocyclyl. In some embodiments, R ⁶ is aryl. In some embodiments, R ⁶ is heteroaryl. In some embodiments, R ⁶ is unsubstituted cycloalkyl, unsubstituted heterocyclyl, unsubstituted aryl, or unsubstituted heteroaryl. In some embodiments, R ⁶ is cycloalkyl substituted with one or more R ¹¹ . In some embodiments, R ⁶ is heterocyclyl substituted with one or more R ¹¹ . In some embodiments, R ⁶ is aryl substituted with one or more R ¹¹ . In some embodiments, R ⁶ is heteroaryl substituted with one or more R ¹¹ .

In some embodiments, R ⁶ is halo (e.g., fluoro, chloro, bromo, or iodo). In some embodiments, R ⁶ is cyano. In some embodiments, R ⁶ is oxo. In some embodiments, R ⁶ is - OR ^A . In some embodiments, R ⁶ is -NR ^B R ^C . In some embodiments, R ⁶ is -NR ^B C(O)R ^D . In some embodiments, R ⁶ is -NO2. In some embodiments, R ⁶ is -C(O)NR ^B R ^c . In some embodiments, R ⁶ is -C(O)R ^D . In some embodiments, R ⁶ is -C(O)OR ^D . In some embodiments, R ⁶ is -SR ^E . In some embodiments, R ⁶ is -S(O) _X R ^D .

In some embodiments, R ⁷ is C ₁ -C ₆ -alkyl. In some embodiments, R ⁷ is halo (e.g., fluoro, chloro, bromo, or iodo). In some embodiments, R ⁷ is cyano. In some embodiments, R ⁷ is oxo. In some embodiments, R ⁷ is -OR ^A1 (e.g., -OH).

In some embodiments, R ¹¹ is C ₁ -C ₆ -alkyl. In some embodiments, R ¹¹ is C ₁ -C ₆ - heteroalkyl. In some embodiments, R ¹¹ is C ₁ -C ₆ -haloalkyl (e.g., -CF ₃ ). In some embodiments, R ¹¹ is cycloalkyl. In some embodiments, R ¹¹ is heterocyclyl. In some embodiments, R ¹¹ is aryl. In some embodiments, R ¹¹ is heteroaryl. In some embodiments, R ¹¹ is halo. In some embodiments, R ¹¹ is cyano. In some embodiments, R ¹¹ is oxo. In some embodiments, R ¹¹ is - OR ^A .

In some embodiments for Formulas (I) and (II), R ^A is hydrogen. In some embodiments, R ^A is C ₁ -C ₆ alkyl (e.g., methyl). In some embodiments, R ^A is C ₁ -C ₆ haloalkyl. In some embodiments, R ^A is aryl. In some embodiments, R ^A is heteroaryl. In some embodiments, R ^A is C ₁ -C ₆ alkylene-aryl (e.g., benzyl). In some embodiments, R ^A is C ₁ -C ₆ alkylene-heteroaryl. In some embodiments, R ^A is C(O)R ^D . In some embodiments, R ^A is -S(O) _X R ^D .

In some embodiments, R ^B , R ^c , or both are independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ - heteroalkyl, cycloalkyl, heterocyclyl, or -OR ^A . In some embodiments, each of R ^B and R ^c is independently hydrogen. In some embodiments, each of R ^B and R ^c is independently C ₁ -C ₆ alkyl In some embodiments, one of R ^B and R ^c is hydrogen, and the other of R ^B and R ^c is C ₁ -C ₆ alkyl. In some embodiments, R ^B and R ^c together with the atom to which they are attached form a 3-7- membered heterocyclyl ring optionally substituted with one or more of R ⁷ .

In some embodiments, R ^D , R ^E , or both are independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl (e.g., benzyl), or C ₁ -C ₆ alkylene-heteroaryl. In some embodiments, each of R ^D and R ^E is independently hydrogen. In some embodiments, each of R ^D and R ^E is independently C ₁ -C ₆ alkyl. In some embodiments, R ^D is hydrogen. In some embodiments, R ^E is hydrogen. In some embodiments, R ^D is C ₁ -C ₆ alkyl (e.g., methyl). In some embodiments, R ^E is C ₁ -C ₆ alkyl (e.g., methyl). In some embodiments, R ^D is C ₁ -C ₆ heteroalkyl. In some embodiments, R ^E is C ₁ -C ₆ heteroalkyl. In some embodiments, R ^D is C ₁ -C ₆ haloalkyl. In some embodiments, R ^E is C ₁ -C ₆ haloalkyl. In some embodiments, R ^D is cycloalkyl. In some embodiments, R ^E is cycloalkyl. In some embodiments, R ^D is heterocyclyl. In some embodiments, R ^E is heterocyclyl. In some embodiments, R ^D is aryl. In some embodiments, R ^E is aryl. In some embodiments, R ^D is heteroaryl. In some embodiments, R ^E is heteroaryl. In some embodiments, R ^D is C ₁ -C ₆ alkylene-aryl (e.g., benzyl). In some embodiments, R ^E is C ₁ -C ₆ alkylene-aryl (e.g., benzyl). In some embodiments, R ^D is C ₁ -C ₆ alkylene-heteroaryl. In some embodiments, R ^E is C ₁ -C ₆ alkylene-heteroaryl.

In some embodiments, R ^A1 is hydrogen. In some embodiments, R ^A1 is C ₁ -C ₆ -alkyl (e.g., methyl).

In some embodiments, m is 0, 1, or 2. In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, x is 0, 1, or 2. In some embodiments, x is 0. In some embodiments, x is 1. In some embodiments, x is 2. In some embodiments y is 0 or 1. In some embodiments, y is 0.

In some embodiments, the compound of Formula (I) is a compound of Formula (I-a): pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; X, Y, and Z are each independently C(R ^3a ), C(R ^3a )(R ^3b ), N, N(R ^3c ), or O, wherein at least one of X, Y, and Z is N, N(R ^3c ), or O, and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; L ¹ is absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ -heteroalkylene, -O-, -C(O)- , -N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, - OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ - alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, or -OR ^A ; R ^3a and R ^3b are each independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , - NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; or each of R ^3a and R ^3b , together with the carbon atom to which they are attached, form an oxo group; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ - alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, C ₁ -C ₆ alkylene-cycloalkyl, heterocyclyl, C ₁ -C ₆ alkylene-heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, heteroaryl, C ₁ -C ₆ alkylene-heteroaryl, or -C(O)R ^D wherein each alkyl, alkylene, alkenyl, alkynyl, heteoalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁸ ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , - C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ - C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, - OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ⁸ is C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , - NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _x R ^D ;each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, -C(O)R ^D , or - S(O) _X R ^D ; each of R ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ heteroalkyl, cycloalkyl, heterocyclyl, or -OR ^A ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D and R ^E is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; m is 0, 1, or 2; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (I) is a compound of Formula (I-b): (I-b), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; each of L ¹ and L ² is independently absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ -heteroalkylene, -O-, -C(O)-, - N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, - OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ - alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, or -OR ^A ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, C ₁ -C ₆ alkylenecycloalkyl, heterocyclyl, C ₁ -C ₆ alkylene-heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, heteroaryl, C ₁ - C ₆ alkylene-heteroaryl, or -C(O)R ^D wherein each alkyl, alkylene, alkenyl, alkynyl, heteoalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁸ ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ - C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ⁸ is C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ - alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _x R ^D ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkyleneheteroaryl, -C(O)R ^D , or -S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ heteroalkyl, cycloalkyl, heterocyclyl, or -OR ^A ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D and R ^E is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkyl ene-heteroaryl; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; m is 0, 1, or 2; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (I) is a compound of Formula (I-c): (I-C), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ - heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkyl ene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , - NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O)xR ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ - alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, or -OR ^A ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, C ₁ -C ₆ alkylenecycloalkyl, heterocyclyl, C ₁ -C ₆ alkylene-heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, heteroaryl, C ₁ - C ₆ alkylene-heteroaryl, or -C(O)R ^D wherein each alkyl, alkylene, alkenyl, alkynyl, heteoalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁸ ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , - NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _x R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ⁸ is C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , - NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _x R ^D ; each R ¹¹ is independently C ₁ -C ₆ - alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, -C(O)R ^D , or -S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ heteroalkyl, cycloalkyl, heterocyclyl, or -OR ^A ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D and R ^E is independently hydrogen, C ₁ - C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; m is 0, 1, or 2; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (I) is a compound of Formula (I-d): ( I-d), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein B is cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; each R ¹ is independently hydrogen, C ₁ - C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7- membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, or -OR ^A ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, C ₁ -C ₆ alkylene-cycloalkyl, heterocyclyl, C ₁ -C ₆ alkylene- heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, heteroaryl, C ₁ -C ₆ alkylene-heteroaryl, or -C(O)R ^D wherein each alkyl, alkylene, alkenyl, alkynyl, heteoalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁸ ; each R ⁶ is independently C ₁ - C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, - C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ⁸ is C ₁ -C ₆ -alkyl, C ₂ - C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , -SR ^E , or -S(O) _x R ^D ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ - C ₆ alkylene-heteroaryl, -C(O)R ^D , or -S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ heteroalkyl, cycloalkyl, heterocyclyl, or -OR ^A ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D and R ^E is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ - C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; m is 0, 1, or 2; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (I) is a compound of Formula (I-e): pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A is cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; each R ¹ is independently hydrogen, C ₁ - C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7- membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, or -OR ^A ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, C ₁ -C ₆ alkylene-cycloalkyl, heterocyclyl, C ₁ -C ₆ alkylene- heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, heteroaryl, C ₁ -C ₆ alkylene-heteroaryl, or -C(O)R ^D wherein each alkyl, alkylene, alkenyl, alkynyl, heteoalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁸ ; each R ⁶ is independently C ₁ - C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, - C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ⁸ is C ₁ -C ₆ -alkyl, C ₂ - C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , -SR ^E , or -S(O) _x R ^D ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ - C ₆ alkylene-heteroaryl, -C(O)R ^D , or -S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ heteroalkyl, cycloalkyl, heterocyclyl, or -OR ^A ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D and R ^E is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ - C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; m is 0, 1, or 2; p is 0, 1, 2, or 3; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (I) is a compound of Formula (I-f): (I-f), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; L ² is absent, C ₁ -C ₆ - alkylene, C ₁ -C ₆ -heteroalkylene, -O-, -C(O)-, -N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, - C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ - C ₆ -haloalkyl, halo, cyano, -N(R ^B )(R ^C ), or -OR ^A ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; R ^3c is hydrogen, C ₁ -C ₆ - alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, C ₁ -C ₆ alkylene-cycloalkyl, heterocyclyl, C ₁ -C ₆ alkylene-heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, heteroaryl, C ₁ -C ₆ alkylene-heteroaryl, or -C(O)R ^D wherein each alkyl, alkylene, alkenyl, alkynyl, heteoalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁸ ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ - haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, - C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ⁸ is independently C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , -SR ^E , or -S(O) _x R ^D ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ - C ₆ alkylene-heteroaryl, -C(O)R ^D , or -S(O) _X R ^D ; each of R ^B andR ^c is independently hydrogen, C ₁ - C ₆ alkyl, C ₁ -C ₆ heteroalkyl, cycloalkyl, heterocyclyl, or -OR ^A ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D and R ^E is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ - C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, R ² is halo. In some embodiments, R ² is fluoro. In some embodiments, R ² is -OR ^A . In some embodiments, R ² is -N(R ^B )(R ^C ). In some embodiments, the compound of Formula (I) is a compound of Formula (I-g): (I-g), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; L ² is absent, C ₁ -C ₆ - alkylene, C ₁ -C ₆ -heteroalkylene, -O-, -C(O)-, -N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , - C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ - C ₆ -haloalkyl, halo, cyano, -N(R ^B )(R ^C ), or -OR ^A ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; R ^3c is hydrogen, C ₁ -C ₆ - alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, C ₁ -C ₆ alkylene-cycloalkyl, heterocyclyl, C ₁ -C ₆ alkylene-heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, heteroaryl, C ₁ -C ₆ alkylene-heteroaryl, or -C(O)R ^D wherein each alkyl, alkylene, alkenyl, alkynyl, heteoalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁸ ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ - haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, - C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ⁸ is independently C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , -SR ^E , or -S(O) _x R ^D ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ - C ₆ alkylene-heteroaryl, -C(O)R ^D , or -S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ - C ₆ alkyl, C ₁ -C ₆ heteroalkyl, cycloalkyl, heterocyclyl, or -OR ^A ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D and R ^E is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ - C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (I) is a compound of Formula (I-h): pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, wherein A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; L ² is absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ -heteroalkylene, -O-, -C(O)-, -N(R ⁴ )-, -N(R ⁴ )C(O)-, or - C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ - heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkyl ene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , - NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _x R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ - alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -N(R ^B )(R ^C ), or -OR ^A ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or - C(O)OR ^D ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, C ₁ -C ₆ alkylene-cycloalkyl, heterocyclyl, C ₁ -C ₆ alkylene-heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, heteroaryl, C ₁ -C ₆ alkylene-heteroaryl, or -C(O)R ^D wherein each alkyl, alkylene, alkenyl, alkynyl, heteoalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁸ ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , - NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _x R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ⁸ is independently C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, - C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , -SR ^E , or -S(O) _X R ^D ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ - C ₆ alkylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, -C(O)R ^D , or -S(O) _x R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₁ -C ₆ heteroalkyl, cycloalkyl, heterocyclyl, or -OR ^A ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D and R ^E is independently hydrogen, C ₁ - C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments of any one of Formula (I), (I-a), (I-b), (I-c), (I-d), (I-e), (I-f), and (I-g), R ^3c is not hydrogen or methyl. In some embodiments, R ^3c is not hydrogen. In some embodiments, R ^3c is not methyl. In some embodiments, R ^3c is not ethyl. In some embodiments, a compound of Formula (I) is not Compound 143, 207, 208, 209, 210, 211, 212, 228, 229, 230, 231, 234, 235, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 249, 250, 251, 252, 253, 258, 259, 260, 269, 270, 272, 273, 274, 275, 277, 278, 279, 280, 281, 284, 285, 286, or 287. In some embodiments, a compound of Formula (I) is not Compound 284.

In some embodiments, the compound of Formula (I) is selected from a compound in Table 1, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

Table 1: Exemplary compounds of Formula (I)

In some embodiments, a compound of Formula (I) is selected from Compounds 288-363. In some embodiments, a compound of Formula (I) is a compound other than Compound 118, 119, 140, 141, 142, 143, 145, 146, 147, 148, 149, 150, 187, 188, 189, 190, 191, 192, 193, 194, 195,

196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 217, 218,

219, 228, 229, 230, 231, 234, 235, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 249,

250, 251, 252, 253, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269,

270, 271, 272, 273, 274, 275, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, or 287. In some embodiments, a compound of Formula (I) is selected from 141, 143, 190, 198, 202, 207, 208, 209, 210, 228, 229, 234, 237, 239, 240, 242, 243, 246, 250, 251, 252, 255, 258, 260, 266, 269,

272, 275, 277, 278, 279, 284, 285, 288, 293, 293, 294, 296, 298, 301, 302, 306, 310, 312, 314,

315, 350, and 351.

In some embodiments, a compound of Formula (I) is: a) Compound 288, b) Compound 289, c) Compound 290, d) Compound 291, e) Compound 292, f) Compound 293, g) Compound 294, h) Compound 295, i) Compound 296, j) Compound 297, k) Compound 298, 1) Compound 299, m) Compound 300, n) Compound 301, o) Compound 302, p) Compound 303, q) Compound 304, r) Compound 305, s) Compound 306, t) Compound 307, u) Compound 308, v) Compound 309, w) Compound 310, x) Compound 311, y) Compound 312, z) Compound 313, aa) Compound 314, bb) Compound 315, cc) Compound 316, dd) Compound 317, ee) Compound 318, ff) Compound 319, gg) Compound 320, hh) Compound 321, ii) Compound 322, jj) Compound 323, kk) Compound 324, 11) Compound 325, mm) Compound 326, nn) Compound 327, oo) Compound 328, pp) Compound 329, qq) Compound 330, Compound rr) Compound 331, ss) Compound 332, tt) Compound 333, uu) Compound 334, vv) Compound 335, ww) Compound 336, xx) Compound 337, yy) Compound 338, zz) Compound Compound 339, aaa) Compound 340, bbb) Compound 341, ccc) Compound 342, ddd) Compound 343, eee) Compound 344, fff) Compound 345, ggg) Compound 346, hhh) Compound 347, iii) Compound 348, jjj) Compound 349, kkk) Compound 350, 111) Compound 351, mmm) Compound 352, nnn) Compound 353, ooo) Compound 354, ppp) Compound 355, qqq) Compound 356, rrr) Compound 357, sss) Compound 358, ttt) Compound 359, uuu) Compound 360, vvv) Compound 361, www) Compound 362, or xxx) Compound 363.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., imidazo[1,2-b]pyridazinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 118, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., imidazo[1,2-b]pyridazinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X and Y are each independently C(R ^3a ) (e.g., CH); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h) and (I-i) is Compound 119, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., imidazo[1,2-b]pyridazinyl); L ¹ is absent or -N(R ⁴ )-; and L ² is absent or -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-). In some embodiments, for Formula (I), the compound is selected from Compound 118, 141, 228, 229, 242, 243, 269, and 277.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is N; Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 140, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl);

B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is O; Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 141, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl);

B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 142, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl);

B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 143, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl);

B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 145, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl);

B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is N(R ^3c ) (e.g., NH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 146, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is N(R ^3c ) (e.g., NH); Y is N; Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 147, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,8-dimethylimidazo[1,2-b]pyridazinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 148, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., CH); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 149, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is N; Y is C(R ^3a ) (e.g., CH); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 150, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is O; Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 187, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a )(R ^3b ) (e.g., CH ₂ ); Y is C(R ^3a )(R ^3b ) (e.g., CH ₂ ); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-e), (I-f), and (I-i) is Compound 188, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1- methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is C(R ^3a ) (e g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 189, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2- methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is C(R ^3a ) (e g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 190, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1,2- dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is C(R ^3a ) (e g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 191, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2- ethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is C(R ^3a ) (e g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 192, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,2- dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is C(R ^3a ) (e g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 193, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 4,7- diazaspiro[2.5]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 194, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2, 2,6,6- tetramethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 195, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N- ethyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 196, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N-tert- butyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 197, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N,N- dimethyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 198, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., octahydropyrrolo[1,2-a]pyrazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 199, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1- methylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ¹ is -N(R ⁴ )- (e g., -N(CH ₃ )-); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I) and (I-a) is Compound 200, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 2, 2,6,6- tetramethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ¹ is -N(R ⁴ )- (e.g., -N(CH ₃ )-); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I) and (I-a) is Compound 201 or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N,N- dimethyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 202, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N-tert- butyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 203, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1,3'- bipyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is - C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is C(R ^3a ) (e g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 204, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 2,6- diazaspiro[3.3]heptanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 205, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g 2-methyl-2,6- diazaspiro[3.3]heptanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 206, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1- methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I- f), (I-i), and (I-j) is Compound 207, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 208, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1- methylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I- f), (I-i), and (I-j) is Compound 209, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1- ethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 210, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,6- dimethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 211, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2, 2,6,6- tetramethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 212, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-2-methyl-2H-indazolyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 217, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-2-methylbenzo[d]oxazolyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 218, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-2-methylbenzo[d]thiazolyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 219, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2- methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I- f), (I-i), and (I-j) is Compound 228, 352, 353, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1,2- dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 229, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methyl-2H-indazolyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 230, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-2-methyl-2H-indazolyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 231, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-2-methylbenzo[d]oxazolyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 234, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-2-methylbenzo[d]thiazolyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 235, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,7-dimethylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 237, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,8-dimethylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 238, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2- ethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 239, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,2- dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 240, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 4,7- diazaspiro[2.5]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 241, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 2,6- diazaspiro[3.3]heptanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 242, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 2-methyl-2,6- diazaspiro[3.3]heptanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 243, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2, 2,6,6- tetramethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ¹ is -N(R ⁴ )- (e.g., -N(CH ₃ )-); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 244, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2- methylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ¹ is -N(R ⁴ )- (e g., -N(CH ₃ )-); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 245, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methylimidazo[1,2-a]pyrazinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 246, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4,6-dimethylpyrazolo[l,5-a]pyrazinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 247, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N-tert- butyl)-aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 249, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., octahydropyrrolo[1,2-a]pyrazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 250, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N,N- dimethyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 251, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N - ethyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 252, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 6,8-dimethyl-[1,2,4]triazolo[l,5-a]pyrazinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 253, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., (lR,5S)-3,8- diazabicyclo[3.2.1]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 255, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1- methylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is C(R ^3a ) (e g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 256, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1- ethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is C(R ^3a ) (e g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 257, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N,N- methyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 258, 350, 351, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N-tert- butyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 259, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., (lR,5S)-3,8- diazabicyclo[3.2.1]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 260, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methyl-2H-indazolyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 261, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,7-dimethylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 262, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methylimidazo[1,2-a]pyrazinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 263, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 6,8-dimethyl-[1,2,4]triazolo[l,5-a]pyrazinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-g), and (I-h) is Compound 264, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4,6-dimethylpyrazolo[l,5-a]pyrazinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-g), and (I-h) is Compound 265, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 266, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-methyl-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 267, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is monocyclic heteroaryl (e.g., pyrazolyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), and (I-h) is Compound 268, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 269, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., piperazinyl); B is monocyclic heteroaryl (e.g., pyrazolyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), and (I-e) is Compound 270, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2, 2,6,6- tetramethylpiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is C(R ^3a ) (e.g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), (I-e), (I-f), (I-h), and (I-i) is Compound 271, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1,3'- bipyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is - C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 272, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 6,8-dimethylimidazo[1,2-a]pyrazinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 273, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2, 2,6,6- tetramethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 274, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridinyl); L ² is - C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 275, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2- methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I- f), (I-i), and (I-j) is Compound 277, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N,N- dimethyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 278, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., (lR,5S)-3,8- diazabicyclo[3.2.1]octanyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 279, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), and (I-e) is Compound 280, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heteroaryl (e.g., 2,8- dimethylimidazo[1,2-b]pyridazinyl); B is monocyclic heterocyclyl (e.g., piperidinyl); L ² is - C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), and (I-e is Compound 281, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heteroaryl (e.g., 2,8- dimethylimidazo[1,2-b]pyridazinyl); B is monocyclic heterocyclyl (e.g., piperidinyl); L ² is - C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is C(R ^3a ) (e g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), and (I-e) is Compound 282, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is bicyclic heteroaryl (e.g., 8-fluoro-2- methylimidazo[1,2-a]pyridinyl); B is monocyclic heterocyclyl (e.g., piperidinyl); L ² is - C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is C(R ^3a ) (e g., C(CH ₃ )); Z is O; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-c), and (I-e) is Compound 283, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₂ CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 284, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 285, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., NH); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 286, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1- methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-chloro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., NH); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 287, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₂ CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 288, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., (lR,5S)-3,8- diazabicyclo[3.2.1]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₂ CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 289, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH(CH ₃ ) ₂ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 290, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₂ CH ₂ OH)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 291, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e.g, N(CH ₂ CH ₂ OCH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 292, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,8-dimethylimidazo[l,2-a]pyrazinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 293, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[l,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); ¥ is N(R ^3c ) wherein R ^3c is C ₁ -C ₆ -cycloalkyl (e.g., cyclopropyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 294, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[l,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); ¥ is N(R ^3c ) wherein R ^3c is heterocyclyl (e.g., oxetane); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I- e), (I-f), (I-i), and (I-j) is Compound 295, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N- cyclopropyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[l,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 296, 371, 372, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[l,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., C(CH ₃ )); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 297, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N- methyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 298, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 1,6- diazaspiro[3.4]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 299, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; R ² is C ₁ -C ₆ alkyl (e.g., CH ₃ ); y is 0; and m is 1. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 300, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 1,7- diazaspiro[3.5]nonanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 301, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₂ CH ₂ CH ₂ OCH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 302, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; R ² is halo (e.g., F); y is 0; and m is 1. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 303, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is tetrahydro-2H-pyranyl; Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 304, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g, NCH ₂ CH ₂ F); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 305, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,6- dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g, NCH ₂ CH ₂ OCH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I- d), (I-e), (I-f), (I-i), and (I-j) is Compound 306, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N- ethyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g, NCH ₂ CH ₂ OCH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 307, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is C ₁ -C ₆ alkyl substituted with R ⁸ _; R ⁸ is heterocyclyl (e.g., oxetanyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 308, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g, NCH ₂ C(O)N(CH ₃ ) ₂ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 309, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N- ethyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g, NCH ₂ CH ₂ OCH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 310, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₃ )); Z is N; R ² is -OR ^A (e g., OCH ₃ ); y is 0; and m is 1. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 311, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g, NCH ₂ CH ₂ CH ₂ CH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 312, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is C ₁ -C ₆ -alkyl substituted with R ⁸ ; R ⁸ is heteroaryl (e.g, pyridyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 313, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-cyano-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 314, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 7-fluoro-6-methoxy-2-methyl-2H-indazolyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 315, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₂ CF ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 316, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is C ₁ -C ₆ alkyl substituted with R ⁸ ; R ⁸ is heterocyclyl (e.g., oxiranyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 317, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is C ₁ -C ₆ alkyl substituted with R ⁸ ; R ⁸ is heteroaryl (e.g., pyrimidyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 318, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 7-fluoro-2-methyl-2H-indazolyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 319, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,7-dimethyl-2H-indazolyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 320, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 1,2,4-trimethyl-lH-benzo[d]imidazolyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 321, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2,8-dimethylimidazo[1,2-b]pyridazinyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 322, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof. In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-methoxy-2-methylimidazo[1,2-a]pyrazinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 323, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methyl-2H-indazolyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 324, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 6-hydroxy-2,7-dimethyl-2H-indazolyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 325, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,6- dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 326, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3- methanaminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 327, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N- acyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 328, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₂ CH(OH)CH ₂ (OH))); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 329, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N,N- diethyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₂ CH ₂ OCH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 330, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₂ COOH)); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 331, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 4-fluoro-1,2-dimethyl-lH-benzo[d]imidazolyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 332, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 7-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 333, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,6- dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 2,8-dimethylimidazo[1,2-a]pyrazinyl); L ² is - C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 334, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4- methanaminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 335, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-methyl-4 aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I- f), (I-i), and (I-j) is Compound 336, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₂ CH ₂ C ₁ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 337, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is C ₁ -C ₆ alkyl substituted with R ⁸ ; R ⁸ is heterocyclyl (e.g., oxetanyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 338, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₂ C(O)CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 339, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is C ₁ -C ₆ alkyl substituted with R ⁸ ; R ⁸ is heteroaryl (e.g., IH-indazolyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 340, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is C ₁ -C ₆ alkyl substituted with R ⁸ ; R ⁸ is heteroaryl (e.g., pyrazolyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 341, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 2-methylimidazo[1,2-a]pyrazin-8(7H)-I); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 342, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridinyl); L ² is - C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 343, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 6-methoxy-2,7-dimethyl-2H-indazolyl); L ² is -C(O)N(R ⁴ )- (e.g., - C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 344, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N- cyclopropyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 345, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-fluoro-3-(N- methylamino)pyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 346, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl) substituted with -N(R ^B )(R ^C ) (e.g., -NH(CH ₂ -py)); B is bicyclic heteroaryl (e.g., 8-fluoro-2- methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 347, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 2,7- diazaspiro[3.5]nonanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 348, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 1,8- diazaspiro[4.5]decanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ )); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 349, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₂ C(CH ₃ ) ₂ (OH))); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 354, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is cycloalkyl (e.g., cyclobutyl) substituted with R ⁸ ; R ⁸ is OR ^A (e.g., OH) ; Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 355, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is heterocyclyl (e.g., tetrahydrofuranyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 356, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e.g, NCH ₂ CH(OH)CH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 357, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl);

B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is C ₁ -C ₆ alkyl substituted with R ⁸ ; one R ⁸ is cycloalkyl (e.g., cyclobutyl) and one R ⁸ is -OR ^A (e.g., -OH); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 358, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-hydroxy-2-methylimidazo[1,2-a]pyrazinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., NCH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 359, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl);

B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e.g, NCH ₃ ); Z is N; R ² is OR ^A (e g., OH); y is 0; and m is 1. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 360, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl);

B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., NCH ₃ ); Z is N; R ² is halo (e.g., F); y is 0; and m is 1. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 361, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl);

B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e.g, NCH ₃ ); Z is N; R ² is -N(R ^B )(R ^C ) (e.g, - NH(CH ₃ )); y is 0; and m is 1. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 362, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is C ₁ -C ₆ alkyl (e.g., vinyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 363, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ CF ₂ CH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 364, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is cycloalkyl (e.g., cyclobutyl) substituted with R ⁸ ; R ⁸ is heterocyclyl (e.g., oxetanyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 365, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is C ₁ -C ₆ alkyl substituted with R ⁸ ; R ⁸ is heteroaryl (e.g., oxazolyl); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 366, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., N(CH ₂ CH(CH ₃ )OCH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 367, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ); R ^3c is C ₁ -C ₆ alkyl substituted with R ⁸ ; R ⁸ is heteroaryl (e.g., lH-1,2,3-triazolyl) substituted with C ₁ -C ₆ alkyl; Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 368, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl) substituted with -NR ^B R ^C (e.g., -NHCH ₂ CH ₂ OH); B is bicyclic heteroaryl (e.g., 8-fluoro-2- methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 369, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., piperidinyl) substituted with -NR ^B R ^C (e.g., -NH2) and haloalkyl (e.g., -CF ₃ ) ; B is bicyclic heteroaryl (e.g., 8- fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 370, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., pyrrolidinyl) substituted with -NR ^B R ^C (e.g., -NHC(CH ₂ CH ₂ )CH ₂ F); B is bicyclic heteroaryl (e.g., 8-fluoro-2- methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., N(CH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 373, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N- methyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., NCH ₂ CH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I- a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 374, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3-(N,N- dimethyl)aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., NCH ₂ CH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I- a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 375, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N- cyclopropyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., NCH ₂ CH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I- a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 376, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 2,6- dimethylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., NCH ₂ CH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I- e), (I-f), (I-i), and (I-j) is Compound 377, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 1- methylpiperazinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e g., -C(O)N(H)-); X is C(R ^3a ) (e g., CH); Y is N(R ^3c ) (e g., NCH ₂ CH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 378, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is bicyclic heterocyclyl (e.g., 4,7- diazaspiro[2.5]octanyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., NCH ₂ CH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I- a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 379, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 4-(N- ethyl)aminopiperidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2- a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g., CH); Y is N(R ^3c ) (e.g., NCH ₂ CH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I- a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 378, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

In some embodiments, for Formula (I), A is monocyclic heterocyclyl (e.g., 3- aminopyrrolidinyl); B is bicyclic heteroaryl (e.g., 8-fluoro-2-methylimidazo[1,2-a]pyridinyl); L ² is -C(O)N(R ⁴ )- (e.g., -C(O)N(H)-); X is C(R ^3a ) (e.g, CH); Y is N(R ^3c ) (e g., NCH ₃ ); Z is N; y is 0; and m is 0. In some embodiments, the compound of Formulas (I), (I-a), (I-b), (I-d), (I-e), (I-f), (I-i), and (I-j) is Compound 381, 382, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof.

The present disclosure further features compounds of Formula (II). In some embodiments, the compound of Formula (II) is a compound of Formula (Il-a): (Il-a), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; M and P are each independently C(R ² ) or N; U and W are each independently C or N; X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ) or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising U, W, X, Y, and Z may be single or double bonds as valency permits; each of L ¹ and L ² is independently absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ -heteroalkylene, -O-, - C(O)-, -N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ - C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ - C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ - alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, or -OR ^A ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , - NR ^B R ^C ,-NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)OR ^D , or -S(O) _X R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ^A , -S(O) _X R ^D , or -C(O)R ^D ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , - C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ - C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, - OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, -C(O)R ^D , or -S(O) _x R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene- heteroaryl, -OR ^A , -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ - C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or - OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (II) is a compound of Formula (Il-b): (Il-b), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; M and P are each independently C(R ² ) or N; X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ) or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each of L ¹ and L ² is independently absent, C ₁ -C ₆ - alkylene, C ₁ -C ₆ -heteroalkylene, -O-, -C(O)-, -N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, - C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3- 7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, or -OR ^A ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^c ,-NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)OR ^D , or -S(O) _X R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ - heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ^A , - S(O) _X R ^D , or -C(O)R ^D ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ - C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, -C(O)R ^D , or - S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl, -OR ^A , -C(O)NR ^B R ^c , -C(O)R ^D , -C(O)OR ^D , or - S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ⁷ is C ₁ - C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (II) is a compound of Formula (II-c): (II-c), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; M and P are each independently C(R ² ) or N; X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ) or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ - C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ - C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ - alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, or -OR ^A ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , - NR ^B R ^C ,-NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)OR ^D , or -S(O) _X R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ^A , -S(O) _X R ^D , or -C(O)R ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , - NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkyleneheteroaryl, -C(O)R ^D , or -S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl, -OR ^A , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3- 7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene- heteroaryl; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ - alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (II) is a compound of Formula (Il-d): (Il-d), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ) or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each of L ¹ and L ² is independently absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ -heteroalkylene, -O-, -C(O)-, - N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, - OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ - heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^c ,-NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^c , - C(O)OR ^D , or -S(O) _x R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ - alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ^A , -S(O) _X R ^D , or -C(O)R ^D ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , - NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkylene- heteroaryl, -C(O)R ^D , or -S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl, -OR ^A , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3- 7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene- heteroaryl; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ - alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (II) is a compound of Formula (Il-e): (Il-e), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ) or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each of L ¹ and L ² is independently absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ -heteroalkylene, -O-, -C(O)-, - N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, - OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ - heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^c ,-NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^c , - C(O)OR ^D , or -S(O) _x R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ - alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ^A , -S(O) _X R ^D , or -C(O)R ^D ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , - NO ₂ , -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkyleneheteroaryl, -C(O)R ^D , or -S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl, -OR ^A , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3- 7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene- heteroaryl; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ - alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (II) is a compound of Formula (Il-f): (Il-f), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; U and W are each independently C or N; X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ) or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising U, W, X, Y, and Z may be single or double bonds as valency permits; each of L ¹ and L ² is independently absent, C ₁ - C ₆ -alkylene, C ₁ -C ₆ -heteroalkylene, -O-, -C(O)-, -N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, - C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3- 7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , - NR ^B R ^C ,-NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)OR ^D , or -S(O) _X R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ^A , -S(O) _X R ^D , or -C(O)R ^D ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , - C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ - C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, - OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, -C(O)R ^D , or -S(O) _x R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene- heteroaryl, -OR ^A , -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ - C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or - OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (II) is a compound of Formula (Il-g): (Il-g), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; U and W are each independently C or N; X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ) or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising U, W, X, Y, and Z may be single or double bonds as valency permits; each R ¹ is independently hydrogen, C ₁ -C ₆ - alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ - alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^C ,- NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)OR ^D , or -S(O) _X R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ - C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ^A , -S(O) _X R ^D , or -C(O)R ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , - NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkylene- heteroaryl, -C(O)R ^D , or -S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl, -OR ^A , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3- 7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkyleneheteroaryl; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ - alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (II) is a compound of Formula (Il-h): (Il-h), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ) or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each of L ¹ and L ² is independently absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ -heteroalkylene, -O-, -C(O)-, - N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, - OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ - heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^c ,-NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^c , - C(O)OR ^D , or -S(O) _x R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ - alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ^A , -S(O) _X R ^D , or -C(O)R ^D ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , - NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkyleneheteroaryl, -C(O)R ^D , or -S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl, -OR ^A , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3- 7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene- heteroaryl; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ - alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (II) is a compound of Formula (Il-i): (Il-i), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, A and B are each independently cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ) or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; each of L ¹ and L ² is independently absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ -heteroalkylene, -O-, -C(O)-, - N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, - OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ - heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^c ,-NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^c , - C(O)OR ^D , or -S(O) _x R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ - alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ^A , -S(O) _X R ^D , or -C(O)R ^D ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , - NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkyleneheteroaryl, -C(O)R ^D , or -S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl, -OR ^A , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3- 7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene- heteroaryl; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ - alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (II) is a compound of Formula (Il-j): (Il-j), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, B is cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ) or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; M and P are each independently C(R ² ) or N; each of L ¹ and L ² is independently absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ - heteroalkylene, -O-, -C(O)-, -N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ - C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, or - OR ^A ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ - haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^c ,-NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)OR ^D , or - S(O) _X R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ - heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ^A , - S(O) _X R ^D , or -C(O)R ^D ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ - C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, -C(O)R ^D , or - S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl, -OR ^A , -C(O)NR ^B R ^c , -C(O)R ^D , -C(O)OR ^D , or - S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ⁷ is C ₁ - C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (II) is a compound of Formula (Il-k): (Il-k), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, B is cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ) or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising X, Y, and Z may be single or double bonds as valency permits; M and P are each independently C(R ² ) or N; each of L ¹ and L ² is independently absent, C ₁ -C ₆ -alkylene, C ₁ - C ₆ -heteroalkylene, -O-, -C(O)-, -N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene- heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^c , - C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7- membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; each R ² is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, or -OR ^A ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^c ,-NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)OR ^D , or -S(O) _X R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ - heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ^A , - S(O) _X R ^D , or -C(O)R ^D ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ - C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, -C(O)R ^D , or - S(O) _X R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl, -OR ^A , -C(O)NR ^B R ^c , -C(O)R ^D , -C(O)OR ^D , or - S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ⁷ is C ₁ - C ₆ -alkyl, halo, cyano, oxo, or -OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (II) is a compound of Formula (II-l): (II-l), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, B is cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; U and W are each independently C or N; X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ) or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising U, W, X, Y, and Z may be single or double bonds as valency permits; each of L ¹ and L ² is independently absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ - heteroalkylene, -O-, -C(O)-, -N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ - alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^C ,- NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)OR ^D , or -S(O) _X R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ - C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ^A , -S(O) _X R ^D , or -C(O)R ^D ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , - C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ - C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, - OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, -C(O)R ^D , or -S(O) _x R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene- heteroaryl, -OR ^A , -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ - C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or - OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (II) is a compound of Formula (Il-m): (Il-m), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, B is cycloalkyl, heterocyclyl, aryl, or heteroaryl, each of which is optionally substituted with one or more R ¹ ; U and W are each independently C or N;

X, Y, and Z are each independently C(R ^3a ), N, N(R ^3c ) or S, wherein at least one of X, Y, and Z is N or N(R ^3c ), and the bonds in the ring comprising U, W, X, Y, and Z may be single or double bonds as valency permits; each of L ¹ and L ² is independently absent, C ₁ -C ₆ -alkylene, C ₁ -C ₆ - heteroalkylene, -O-, -C(O)-, -N(R ⁴ )-, -N(R ⁴ )C(O)-, or -C(O)N(R ⁴ )-, wherein each alkylene and heteroalkylene is optionally substituted with one or more R ⁵ ; each R ¹ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, C ₁ -C ₆ alkylene-aryl, C ₂ -C ₆ alkenylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, heteroaryl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO ₂ , -C(O)NR ^B R ^c , -C(O)R ^D , - C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkylene, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; or two R ¹ groups, together with the atoms to which they are attached, form a 3-7-membered cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ⁶ ; R ^3a is hydrogen, C ₁ -C ₆ -alkyl, C ₂ -C ₆ - alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, -OR ^A , -NR ^B R ^C ,- NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)OR ^D , or -S(O) _X R ^D , or -C(O)R ^D ; R ^3c is hydrogen, C ₁ - C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, halo, cyano, cycloalkyl, heterocyclyl, aryl, heteroaryl, -OR ^A , -S(O) _X R ^D , or -C(O)R ^D ; each R ⁴ is independently hydrogen, C ₁ -C ₆ -alkyl, or C ₁ -C ₆ -haloalkyl; each R ⁵ is independently hydrogen, C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, halo, cyano, oxo, -OR ^A , -NR ^B R ^C , - C(O)R ^D , or -C(O)OR ^D ; each R ⁶ is independently C ₁ -C ₆ -alkyl, C ₂ -C ₆ -alkenyl, C ₂ -C ₆ -alkynyl, C ₁ - C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, - OR ^A , -NR ^B R ^C , -NR ^B C(O)R ^D , -NO2, -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D , wherein each alkyl, alkenyl, alkynyl, heteroalkyl, haloalkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl is optionally substituted with one or more R ¹¹ ; each R ^A is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, C ₁ -C ₆ alkylene-heteroaryl, -C(O)R ^D , or -S(O) _x R ^D ; each ofR ^B andR ^c is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ -C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene- heteroaryl, -OR ^A , -C(O)NR ^B R ^C , -C(O)R ^D , -C(O)OR ^D , or -S(O) _X R ^D ; or R ^B and R ^c together with the atom to which they are attached form a 3-7-membered heterocyclyl ring optionally substituted with one or more R ⁷ ; each R ^D is independently hydrogen, C ₁ -C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, C ₁ -C ₆ heteroalkyl, C ₁ -C ₆ haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, C ₁ - C ₆ alkylene-aryl, or C ₁ -C ₆ alkylene-heteroaryl; each R ⁷ is C ₁ -C ₆ -alkyl, halo, cyano, oxo, or - OR ^A1 ; each R ¹¹ is independently C ₁ -C ₆ -alkyl, C ₁ -C ₆ -heteroalkyl, C ₁ -C ₆ -haloalkyl, cycloalkyl, heterocyclyl, aryl, heteroaryl, halo, cyano, oxo, or -OR ^A ; each R ^A1 is hydrogen or C ₁ -C ₆ -alkyl; and x is 0, 1, or 2.

In some embodiments, the compound of Formula (II) is selected from a compound in

Table 2, or a pharmaceutically acceptable salt thereof.

Pharmaceutical Compositions, Kits, and Administration

The present invention provides pharmaceutical compositions comprising a compound of Formula (I) or (II), e.g., a compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer, as described herein, and optionally a pharmaceutically acceptable excipient. In certain embodiments, the pharmaceutical composition described herein comprises a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable excipient. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, is provided in an effective amount in the pharmaceutical composition. In certain embodiments, the effective amount is a therapeutically effective amount. In certain embodiments, the effective amount is a prophylactically effective amount. Pharmaceutical compositions described herein can be prepared by any method known in the art of pharmacology. In general, such preparatory methods include the steps of bringing the compound of Formula (I) or (II) (the "active ingredient") into association with a carrier and/or one or more other accessory ingredients, and then, if necessary and/or desirable, shaping and/or packaging the product into a desired single- or multi-dose unit.

Pharmaceutical compositions can be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses. As used herein, a "unit dose" is a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w/w) active ingredient.

The term "pharmaceutically acceptable excipient" refers to a non-toxic carrier, adjuvant, diluent, or vehicle that does not destroy the pharmacological activity of the compound with which it is formulated. Pharmaceutically acceptable excipients useful in the manufacture of the pharmaceutical compositions of the invention are any of those that are well known in the art of pharmaceutical formulation and include inert diluents, dispersing and/or granulating agents, surface active agents and/or emulsifiers, disintegrating agents, binding agents, preservatives, buffering agents, lubricating agents, and/or oils. Pharmaceutically acceptable excipients useful in the manufacture of the pharmaceutical compositions of the invention include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, di sodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat. Compositions of the present invention may be administered orally, parenterally (including subcutaneous, intramuscular, intravenous and intradermal), by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir. In some embodiments, provided compounds or compositions are administrable intravenously and/or orally.

The term "parenteral" as used herein includes subcutaneous, intravenous, intramuscular, intraocular, intravitreal, intra-articular, intra-synovial, intrastemal, intrathecal, intrahepatic, intraperitoneal intralesional and intracranial injection or infusion techniques. Preferably, the compositions are administered orally, subcutaneously, intraperitoneally, or intravenously. Sterile injectable forms of the compositions of this invention may be aqueous or oleaginous suspension. These suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent, for example as a solution in 1,3 -butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium.

Pharmaceutically acceptable compositions of this invention may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, aqueous suspensions or solutions. In the case of tablets for oral use, carriers commonly used include lactose and corn starch. Lubricating agents, such as magnesium stearate, are also typically added. For oral administration in a capsule form, useful diluents include lactose and dried cornstarch. When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening, flavoring or coloring agents may also be added. In some embodiments, a provided oral formulation is formulated for immediate release or sustained/delayed release. In some embodiments, the composition is suitable for buccal or sublingual administration, including tablets, lozenges and pastilles. A provided compound can also be in micro-encapsulated form.

Alternatively, pharmaceutically acceptable compositions of this invention may be administered in the form of suppositories for rectal administration. Pharmaceutically acceptable compositions of this invention may also be administered topically, especially when the target of treatment includes areas or organs readily accessible by topical application, including diseases of the eye, the skin, or the lower intestinal tract. Suitable topical formulations are readily prepared for each of these areas or organs.

For ophthalmic use, provided pharmaceutically acceptable compositions may be formulated as micronized suspensions or in an ointment such as petrolatum.

In order to prolong the effect of a drug, it is often desirable to slow the absorption of the drug from subcutaneous or intramuscular injection. This can be accomplished by the use of a liquid suspension of crystalline or amorphous material with poor water solubility. The rate of absorption of the drug then depends upon its rate of dissolution which, in turn, may depend upon crystal size and crystalline form. Alternatively, delayed absorption of a parenterally administered drug form is accomplished by dissolving or suspending the drug in an oil vehicle.

Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with ordinary experimentation.

Compounds provided herein are typically formulated in dosage unit form, e.g., single unit dosage form, for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject or organism will depend upon a variety of factors including the disease being treated and the severity of the disorder; the activity of the specific active ingredient employed; the specific composition employed; the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific active ingredient employed; the duration of the treatment; drugs used in combination or coincidental with the specific active ingredient employed; and like factors well known in the medical arts.

The exact amount of a compound required to achieve an effective amount will vary from subject to subject, depending, for example, on species, age, and general condition of a subject, severity of the side effects or disorder, identity of the particular compound(s), mode of administration, and the like. The desired dosage can be delivered three times a day, two times a day, once a day, every other day, every third day, every week, every two weeks, every three weeks, or every four weeks. In certain embodiments, the desired dosage can be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations).

In certain embodiments, an effective amount of a compound for administration one or more times a day to a 70 kg adult human may comprise about 0.0001 mg to about 3000 mg, about 0.0001 mg to about 2000 mg, about 0.0001 mg to about 1000 mg, about 0.001 mg to about 1000 mg, about 0.01 mg to about 1000 mg, about 0.1 mg to about 1000 mg, about 1 mg to about 1000 mg, about 1 mg to about 100 mg, about 10 mg to about 1000 mg, or about 100 mg to about 1000 mg, of a compound per unit dosage form.

In certain embodiments, the compounds of Formula (I) or (II) may be at dosage levels sufficient to deliver from about 0.001 mg/kg to about 100 mg/kg, from about 0.01 mg/kg to about 50 mg/kg, preferably from about 0.1 mg/kg to about 40 mg/kg, preferably from about 0.5 mg/kg to about 30 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, and more preferably from about 1 mg/kg to about 25 mg/kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic effect.

It will be appreciated that dose ranges as described herein provide guidance for the administration of provided pharmaceutical compositions to an adult. The amount to be administered to, for example, a child or an adolescent can be determined by a medical practitioner or person skilled in the art and can be lower or the same as that administered to an adult.

It will be also appreciated that a compound or composition, as described herein, can be administered in combination with one or more additional pharmaceutical agents. The compounds or compositions can be administered in combination with additional pharmaceutical agents that improve their bioavailability, reduce and/or modify their metabolism, inhibit their excretion, and/or modify their distribution within the body. It will also be appreciated that the therapy employed may achieve a desired effect for the same disorder, and/or it may achieve different effects.

The compound or composition can be administered concurrently with, prior to, or subsequent to, one or more additional pharmaceutical agents, which may be useful as, e.g., combination therapies. Pharmaceutical agents include therapeutically active agents. Pharmaceutical agents also include prophylactically active agents. Each additional pharmaceutical agent may be administered at a dose and/or on a time schedule determined for that pharmaceutical agent. The additional pharmaceutical agents may also be administered together with each other and/or with the compound or composition described herein in a single dose or administered separately in different doses. The particular combination to employ in a regimen will take into account compatibility of the inventive compound with the additional pharmaceutical agents and/or the desired therapeutic and/or prophylactic effect to be achieved. In general, it is expected that the additional pharmaceutical agents utilized in combination be utilized at levels that do not exceed the levels at which they are utilized individually. In some embodiments, the levels utilized in combination will be lower than those utilized individually.

Exemplary additional pharmaceutical agents include, but are not limited to, anti-proliferative agents, anti-cancer agents, anti-diabetic agents, anti-inflammatory agents, immunosuppressant agents, and a pain-relieving agent. Pharmaceutical agents include small organic molecules such as drug compounds (e.g., compounds approved by the U.S. Food and Drug Administration as provided in the Code of Federal Regulations (CFR)), peptides, proteins, carbohydrates, monosaccharides, oligosaccharides, polysaccharides, nucleoproteins, mucoproteins, lipoproteins, synthetic polypeptides or proteins, small molecules linked to proteins, glycoproteins, steroids, nucleic acids, DNAs, RNAs, nucleotides, nucleosides, oligonucleotides, antisense oligonucleotides, lipids, hormones, vitamins, and cells.

Also encompassed by the invention are kits (e.g., pharmaceutical packs). The inventive kits may be useful for preventing and/or treating a proliferative disease or a non-proliferative disease, e.g., as described herein. The kits provided may comprise an inventive pharmaceutical composition or compound and a container (e.g, a vial, ampule, bottle, syringe, and/or dispenser package, or other suitable container). In some embodiments, provided kits may optionally further include a second container comprising a pharmaceutical excipient for dilution or suspension of an inventive pharmaceutical composition or compound. In some embodiments, the inventive pharmaceutical composition or compound provided in the container and the second container are combined to form one-unit dosage form.

Thus, in one aspect, provided are kits including a first container comprising a compound described herein, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, or a pharmaceutical composition thereof. In certain embodiments, the kit of the disclosure includes a first container comprising a compound described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof. In certain embodiments, the kits are useful in preventing and/or treating a disease, disorder, or condition described herein in a subject (e.g., a proliferative disease or a non-proliferative disease). In certain embodiments, the kits further include instructions for administering the compound, or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, or stereoisomer thereof, or a pharmaceutical composition thereof, to a subject to prevent and/or treat a proliferative disease or a non-proliferative disease.

Methods of Use

Described herein are compounds useful for modulating splicing. In some embodiments, a compound of Formula (I) or (II) may be used to alter the amount, structure, or composition of a nucleic acid (e.g., a precursor RNA, e.g., a pre-mRNA, or the resulting mRNA) by increasing or decreasing splicing at a splice site. In some embodiments, increasing or decreasing splicing results in modulating the level or structure of a gene product (e.g., an RNA or protein) produced. In some embodiments, a compound of Formula (I) or (II) may modulate a component of the splicing machinery, e.g., by modulating the interaction with a component of the splicing machinery with another entity (e.g., nucleic acid, protein, or a combination thereof). The splicing machinery as referred to herein comprises one or more spliceosome components. Spliceosome components may comprise, for example, one or more of major spliceosome members (Ul, U2, U4, U5, U6 snRNPs), or minor spliceosome members (U11, U12, U4atac, U6atac snRNPs) and their accessory splicing factors.

In another aspect, the present disclosure features a method of modifying of a target (e.g., a precursor RNA, e.g., a pre-mRNA) through inclusion of a splice site in the target, wherein the method comprises providing a compound of Formula (I) or (II). In some embodiments, inclusion of a splice site in a target (e.g., a precursor RNA, e.g., a pre-mRNA, or the resulting mRNA) results in addition or deletion of one or more nucleic acids to the target (e.g., a new exon, e.g. a skipped exon). Addition or deletion of one or more nucleic acids to the target may result in an increase in the levels of a gene product (e.g., RNA, e.g., mRNA, or protein).

In another aspect, the present disclosure features a method of modifying a target (e.g., a precursor RNA, e.g., a pre-mRNA, or the resulting mRNA) through exclusion of a splice site in the target, wherein the method comprises providing a compound of Formula (I) or (II). In some embodiments, exclusion of a splice site in a target (e.g., a precursor RNA, e.g., a pre-mRNA) results in deletion or addition of one or more nucleic acids from the target (e.g., a skipped exon, e.g. a new exon). Deletion or addition of one or more nucleic acids from the target may result in a decrease in the levels of a gene product (e.g., RNA, e.g., mRNA, or protein). In other embodiments, the methods of modifying a target (e.g., a precursor RNA, e.g., a pre-mRNA, or the resulting mRNA) comprise suppression of splicing at a splice site or enhancement of splicing at a splice site (e.g., by more than about 0.5%, e.g., 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more), e.g., as compared to a reference (e.g., the absence of a compound of Formula (I) or (II), or in a healthy or diseased cell or tissue).

The methods described herein can be used to modulate splicing, e.g., of a nucleic acid comprising a particular sequence (e.g., a target sequence). Exemplary genes encoding a target sequence (e.g., a target sequence comprising DNA or RNA, e.g., pre-mRNA) include, inter alia, ABCA4, ABCA9, ABCB1, ABCB5, ABCC9, ABCD1, ACADL, ACADM, ACADSB, ACSS2, ACTB, ACTG2, ADA, ADAL, ADAM10, ADAM15, ADAM22, ADAM32, ADAMTS12, ADAMTS13, ADAMTS20, ADAMTS6, ADAMTS9, ADAR, ADCY3, ADCY10, ADCY8, ADNP, ADRBK2, AFP, AGL, AGP, AHCTF1, AHR, AKAP10, AKAP3, AKNA, ALAS1, ALS2CL, ALB, ALDH3A2, ALG6, AMBRA1, ANK3, ANTXR2, ANXA10, ANXA11, ANGPTL3, AP2A2, AP4E1, APC, APOA1, APOB, APOC3, APOH, AR, AR1D2, ARID3A, AR1D3B, ARFGEF1 , ARFGEF2, ARHGAP1, ARHGAP8, ARHGAP18, ARHGAP26, ARHGEF18, ARHGEF2, ARPC3, ARS2, ASH1L, ASH1L- IT1, ASNSD1, ASPM, ATAD5, ATF1, ATG4A, ATG16L2, ATM, ATN1, ATP11C, ATP6V1G3, ATP13A5, ATP7A, ATP7B, ATR, ATXN2, ATXN3, ATXN7, ATXN10, AXIN1, B2M, B4GALNT3, BBS4, BCL2, BCL2L1, BCL2-like 11 (BIM), BCL11B, BBOX1, BCS1L, BEAN1, BHLHE40, BMPR2, BMP2K, BPTF, BRAF, BRCA1, BRCA2, BRCC3, BRSK1, BRSK2, BTAF1, BTK, C2orf55, C4orf29, C6orfll8, C9orf43, C9orf72, C10orfl37, Cllorf30, Cllorf65, CllorfrO, Cllorf87, C12orf51, C13orfl, C13orfl5, C14orfl0l, C14orfll8, C15orf29, C15orf42, C15orf60, C16orf33, C16orf38, C16orf48, C18orf8, C19orf42, Clorfl07, Clorfll4, Clorfl30, Clorfl49, Clorf27, Clorf71, Clorf94, C1R, C20orf74, C21orf70, C3orf23, C4orfl8, C5orf34, C8B, C8orf33, C9orfll4, C9orf86, C9orf98, C3, CA11, CAB39, CACHD1, CACNA1A, CACNA1B, CACNA1C, CACNA2D1, CACNA1G, CACNA1H, CALCA, CALC0C02, CAMKID, CAMKK1, CAPN3, CAPN9, CAPSL, CARD11, CARKD, CASZ1, CAT, CBLB, CBX1, CBX3, CCDC102B, CCDC11, CCDC15, CCDC18, CCDC5, CCDC81, CCDC131, CCDC146, CD4, CD274, CD IB, CDC14A, CDC16, CDC2L5, CDC42BPB, CDCA8, CDH10, CDH11, CDH24, CDH8, CDH9, CDK5RAP2, CDK6, CDK8, CDK11B, CD33, CD46, CDH1, CDH23, CDK6, CDK11B, CDK13, CEBPZ, CEL, CELSR3, CENPA, CENPI, CENPT, CENTB2, CENTG2, CEP 110, CEP 170, CEP 192, CETP, CFB, CFTR, CFH, CGN, CGNL1, CHAF1A, CHD9, CHIC2, CHL1, CHN1, CHM, CLEC16A, CL1C2, CLCN1, CLINT1, CLK1, CLPB, CLPTM1, CMIP, CMYA5, CNGA3, CNOT1, CNOT7, CNTN6, COGS, C0L11A1, C0L11A2, C0L12A1, C0L14A1, C0L15A1, C0L17A1, C0L19A1, C0L1A1, C0L1A2, C0L2A1, C0L3A1, C0L4A1, COL4A2, COL4A5, COL4A6, COL5A2, C0L6A1, C0L7A1, C0L9A1, COL9A2, COL22A1, COL24A1, COL25A1, COL29A1, COLQ, COMTD1, COPA, COPB2, COPS7B, COPZ2, CPSF2, CPXM2, CR1, CRBN, CRYZ, CREBBP, CRKRS, CSE1L, CSTB, CSTF3, CT45-6, CTNNB1, CUBN, CUL4B, CUL5, CXorf41, CXXC1, CYBB, CYFIP2, CYP3A4, CYP3A43, CYP3A5, CYP4F2, CYP4F3, CYP17, CYP19, CYP24A1, CYP27A1, DAB1, DAZ2, DCBLD1, DCC, DCTN3, DCUN1D4, DDA1, DDEF1, DDX1, DDX24, DDX4, DENND2D, DEPDC2, DES, DGAT2, DHFR, DHRS7, DHRS9, DHX8, DIP2A, DMD, DMTF1, DNAH3, DNAH8, DNAI1, DNAJA4, DNAJC13, DNAJC7, DNMT1, DNTTIP2, DOCK4, DOCK5, DOCKIO, DOCK11, DOT1L, DPP3, DPP4, DPY19L2P2, DR1, DSCC1, DVL3, DUX4, DYNC1H1, DYSF, E2F1, E2F3, E2F8, E4F1, EBF1, EBF3, ECM2, EDEM3, EFCAB3, EFCAB4B, EFNA4, EFTUD2, EGFR, EIF3A, ELA1, ELA2A, ELF 2, ELF 3, ELF 4, EMCN, EMD, EML5, ENO 3, ENPP3, EP300, EPAS1, EPB41L5, EPHA3, EPHA4, EPHB1, EPHB2, EPHB3, EPS15, ERBB4, ERCC1, ERCC8, ERGIC3, ERMN, ERMP1, ERN1, ERN2, ESRI, ESRRG, ETS2, ETV3, ETV4, ETV5, ETV6, EVC2, EWSR1, EXO1, EXOC4, F3, Fll, F13A1, F5, F7, F8, FAH, FAM13A1, FAM13B1, FAM13C1, FAM134A, FAM161A, FAM176B, FAM184A, FAM19A1, FAM20A, FAM23B, FAM65C, FANCA, FANCC, FANCG, FANCM, FANK1, FAR2, FBN1, FBXO15, FBXO18, FBXO38, FCGBP, FECH, FEZ2, FGA, FGD6, FGFR2, FGFR1OP, FGFR1OP2, FGFR2, FGG, FGR, FIX, FKBP3, FLU, FLJ35848, FLJ36070, FLNA, FN1, FNBP1L, FOLH1, F0SL1, F0SL2, FOXK1, FOXM1, FOXO1, FOXP4, FRAS1, FUT9, FXN, FZD3, FZD6, GABI, GABPA, GALC, GALNT3, GAPDH, GART, GAS2L3, GATA3, GATAD2A, GBA, GBGT1, GCG, GCGR, GCK, GFI1, GFM1, GH1, GHR, GHV, GJA1, GLA, GLT8D1, GNA11, GNAQ, GNAS, GNB5, GOLGB1, G0LT1A, GOLT1B, GPATCH1, GPR158, GPR160, GPX4, GRAMD3, GRHL1, GRHL2, GRHPR, GRIA1, GRJA3, GRJA4, GRJN2B, GRM3, GRM4, GRN, GSDMB, GSTCD, GST02, GTF2I, GTPBP4, HADHA, HAND2, HBA2, HBB, HCK, HDAC3, HDAC5, HDX, HEPACAM2, HERCI, HES7, HEXA, HEXB, HHEX, HIPK3, HLA-DPB1, HLA-G, HLCS, HLTF, HMBS, HMGA1, HMGCL, HNF1A, HNF1B, HNF4A, HNF4G, HNRNPH1, HOXCIO, HP IBP 3, HPGD, HPRT1, HPRT2, HSF1, HSF4, HSF2BP, HSPA9, HSPG2, HTT, HXA, ICAl, IDH1, IDS, IFI44L, IKBKAP, IKZF1, IKZF3, IL1R2, IL5RA, IL7RA, IMMT, INPP5D, INSR, INTS3, INTU, IP04, IP08, IQGAP2, IRF2, IRF4, IRF8, IRX3, ISL1, ISL2, ITFG1, ITGA6, ITGAL, ITGB1, ITGB2, 1TGB3, ITGB4, ITIH1, ITPR2, IWS1, JAK1, JAK2, JAG1, JMJD1C, JPH3, KALRN, KAT6A, KATNAL2, KCNN2, KCNT2, KDM2A, KIAA0256, KIAA0528, KIAA0564, KIAA0586, KIAA1033, KIAA1166, KIAA1219, KIAA1409, KIAA1622, KIAA1787, KIF3B, KIF15, KIF16B, KIF5A, KIF5B, KIF9, KIN, KIR2DL5B, KIR3DL2, KIR3DL3, KIT, KLF3, KLF5, KLF7, KLF10, KLF12, KLF16, KLHL20, KLK12, KLKB1, KMT2A, KMT2B, KPNA5, KRAS, KREMEN1, KRIT1, KRT5, KRTCAP2, KYNU, L1CAM, L3MBTL, L3MBTL2, LACE1, LAMA1, LAMA2, LAMAS, LAMB1, LARP7, LDLR, LEF1, LENG1, LGALS3, LGMN, LHCGR, LHX3, LHX6, LIMCH1, LIMK2, LIN28B, LIN54, LMBRD1, EMBRD2, LMLN, EMNA, EMO2, IMO7, LOC389634, LOC390110, LPA, LPCAT2, LPL, LRP4, LRPPRC, LRRK2, LRRC19, LRRC42, LRWD1, LUM, LVRN, LYN, LYST, MADD, MAGI1, MAGT1, MALT1, MAP2K1, MAP4K4, MAPK8IP3, MAPK9, MAPT, MARC1, MARCH5, MATN2, MBD3, MCF2L2, MCM6, MDGA2, MDM4, ASXL1, FUS, SPR54, MECOM, MEF2C, MEF2D, MEGF10, MEGF11, MEMO1, MET, MGA, MGAM, MGAT4A, MGAT5, MGC16169, MGC34774, MKKS, MIB1, MIER2, MITF, MKL2, MLANA, MLH1, MLL5, MLX, MME, MPDZ, MPI, MRAP2, MRPL11, MRPL39, MRPS28, MRPS35, MS4A13, MSH2, MSH3, MSMB, MST1R, MTDH, MTERF3, MTF1, MTF2, MTIF2, MTHFR, MUC2, MUT, MVK, MYB, MYBL2, MYC, MYCBP2, MYH2, MYRF, MYT1, MY019, MY03A, MY09B, MYOM2, MYOM3, NAG, NARG1, NARG2, NCOA1, NDC80, NDFIP2, NEB, NEDD4, NEK1, NEK5, NEK11, NF1, NF2, NFATC2, NFE2L2, NFIA, NFIB, NFIX, NFKB1, NFKB2, NFKBIL2, NFRKB, NFYA, NFYB, NIPA2, NKAIN2, NKAP, NLRC3, NLRC5, NLRP3, NLRP7, NLRP8, NLRP13, NME1, NME1-NME2, NME2, NME7, NOLIO, NOP561, NOS1, NOS2A, NOTCH1, NPAS4, NPM1, NRIDI, NR1H3, NR1H4, NR4A3, NR5A1, NRXN1, NSMAF, NSMCE2, NT5C, NT5C2, NT5C3, NUBP1, NUBPL, NUDT5, NUMA1, NUP88, NUP98, NUP160, NUPL1, OAT, 0AZ1, OBFC2A, OBFC2B, OLIG2, OMA1, OPA1, OPN4, OPTN, 0SBPL11, 0SBPL8, OSGEPL1, OTC, OTX2, 0V0L2, OXT, PA2G4, PADI4, PAH, PAN2, PAOX, P APOLG, PARD3, PARP1, PARVB, PAWR, PAX3, PAX8, PBGD, PBRM1, PBX2, PCBP4, PCCA, PCGF2, PCNX, PCOTH, PDCD4, PDE4D, PDE8B, PDE10A, PD1A3, PDH1, PDLIM5, PDXK, PDZRN3, PELI2, PDK4, PDS5A, PDS5B, PGK1, PGM2, PHACTR4, PHEX, PHKB, PHLDB2, PHOX2B, PHTF1, PIAS1, PIEZO1, PIGF, PIGN, PIGT, PIK3C2G, PIK3CA, PIK3CD, PIK3CG, PIK3RI, PIP5K1A, PITRM1, PIWIL3, PKD1, PKHD1L1, PKD2, PKIB, PKLR, PKM1, PKM2, PLAGL2, PLCB1, PLCB4, PLCG1, PLD1, PLEKHA5, PLEKHA7, PLEKHM1, PLKR, PLXNC1, PMFBP1, POLN, POLR3D, POMT2, POSTN, POU2AF1, POU2F2, POU2F3, PPARA, PPFIA2, PPP1R12A, PPP3CB, PPP4C, PPP4R1L, PPP4R2, PRAME, PRC1, PRDM1, PREXI, PREX2, PRIM1, PRIM2, PRKAR1A, PRKCA, PRKG1, PRMT7, PROC, PROCR, PROSC, PRODH, PROXI, PRPF40B, PRPF4B, PRRG2, PRUNE2, PSD3, PSEN1, PSMAL, PTCHI, PTEN, PTK2, PTK2B, PTPN2, PTPN3, PTPN4, PTPN11, PTPN22, PTPRD, PTPRK, PTPRM, PTPRN2, PTPRT, PUS10, PVRL2, PYGM, QRSL1, RAB11FIP2, RAB23, RAFI, RALBP1, RALGDS, RB1CC1, RBL2, RBM39, RBM45, RBPJ, RBSN, REC8, RELB, RFC4, RFT1, RFTN1, RHOA, RHPN2, RIF1, RITJ, RLN3, RMND5B, RNF11, RNF32, RNFT1, RNGTT, ROCK1, ROCK2, RORA, RP1, RP6KA3, RP11- 265F1, RP13-36C9, RPAP3, RPN1, RPGR, RPL22, RPL22L1, RPS6KA6, RREB1, RRM1, RRP1B, RSK2, RTEL1, RTF1, RUFY1, RUNX1, RUNX2, RXRA, RYR3, SAAL1, SAE1, SALL4, SAT1, SATB2, SBCAD, SCN1A, SCN2A, SCN3A, SCN4A, SCN5A, SCN8A, SCNA, SCN11A, SC01, SCYL3, SDC1, SDK1, SDK2, SEC24A, SEC24D, SEC31A, SEL1L, SENP3, SENP6, SENP7, SERPINA1, SETD3, SETD4, SETDB1, SEZ6, SFRS12, SGCE, SG0L2, SGPL1, SH2D1A, SH3BGRL2, SH3PXD2A, SH3PXD2B, SH3RF2, SH3TC2, SHOC2, SIPA1L2, SIPA1L3, SIVA1, SKAP1, SKEV2L2, SLC6A11, SLC6A13, SLC6A6, SLC7A2, SLC12A3, SLC13A1, SLC22A17, SLC25A14, SLC28A3, SLC33A1, SLC35F6, SLC38A1, SLC38A4, SLC39A10, SLC4A2, SLC6A8, SMARCA1, SMARCA2, SMARCA5, SMARCC2, SMC5, SMN2, SMOX, SMS, SMTN, SNCAIP, SNORD86, SNRK, SNRP70, SNX5, SNX6, SOD1, SODIO, SOS, S0S2, SOX5, SOX6, SOX8, SP1, SP2, SP3, SP110, SPAG9, SPATA13, SPATA4, SPATS1, SPECC1L, SPDEF, SPI1, SPINK5, SPP2, SPTA1, SRF, SRM, SRP72, SSX3, SSX5, SSX9, STAG1, STAG2, STAMBPLI, STARD6, STAT1, STAT3, STAT5A, STAT5B, STAT6, STK17B, STX3, STXBP1, SUCLG2, SULF2, SUPT6H, SUPT16H, SV2C, SYCP2, SYT6, SYCPI, SYTL3, SYTL5, TAF2, TARDBP, TBC1D3G, TBC1D8B, TBC1D26, TBC1D29, TBCEL, TBK1, TBP, TBPL1, TBR1, TBX, TCEB3, TCF3, TCF4, TCF7L2, TCFL5, TCF12, TCP11L2, TDRD3, TEAD1, TEAD3, TEAD4, TECTB, TEK, TERFI, TERF2, TET2, TFAP2A, TFAP2B, TFAP2C, TFAP4, TFDP1, TFRC, TG, TGM7, TGS1, THAP7, THAP12, THOC2, TIAL1, TIAM2, TIMM50, TLK2, TM4SF20, TM6SF1, TMEM27, TMEM77, TMEM156, TMEM194A, TMF1, TMPRSS6, TNFRSF10A, TNFRSF10B, TNFRSF8, TNK2, TNKS, TNKS2, TOM1L1, TOM1L2, TOP2B, TP53, TP53INP1, TP53BP2, TP53I3, TP63, TRAF3IP3, TRAPPC2, TRIM44, TRIM65, TRIML1, TRIML2, TRPM3, TRPM5, TRPM7, TRPS1, TSC1, TSC2, TSHB, TSPAN7, PTC 17, TTF1, TTLL5, TTLL9, TTN, TTPAL, TTR, TUSC3, TXNDC10, UBE3A, UCK1, UGT1A1, UHRF1BP1, UNC45B, UNC5C, USH2A, USF2, USP1, USP6, USP18, USP38, USP39, UTP20, UTP15, UTP18, UTRN, UTX, UTY, UVRAG, UXT, PAPA, VEGFA, VPS29, VPS35, VPS39, VT11A, VT11B, VWA3B, WDFY2, WDR16, WDR17, WDR26, WDR44, WDR67, WDTC1, WRN, WRNIP1, WT1, WWC3, XBP1, XRN1, XRN2, XX-FW88277, YAP1, YARS, YBX1, YGM, YY1, ZBTB18, ZBTB20, ZC3HAV1, ZC3HC1, ZC3H7A, ZDHHC19, ZEB1, ZEB2, ZFPM1, ZFYVE1, ZFX, ZIC2, ZNF37A, ZNF91, ZNF114, ZNF155, ZNF169, ZNF205, ZNF236, ZNF317, ZNF320, ZNF326, ZNF335, ZNF365, ZNF367, ZNF407, ZNF468, ZNF506, ZNF511, ZNF511-PRAP1, ZNF519, ZNF521, ZNF592, ZNF618, ZNF763, and ZWINT.

Additional exemplary genes encoding a target sequence (e.g., a target sequence comprising DNA or RNA, e.g., pre-mRNA) include genes include A1CF, A4GALT, AAR2, ABAT, ABCA11P, ZNF721, ABCA5, ABHD10, ABHD13, ABHD2, ABHD6, AC000120.3, KRIT1, AC004076.1, ZNF772, AC004076.9, ZNF772, AC004223.3, RAD51D, AC004381.6, AC006486.1, ERF, AC007390.5, AC007780.1, PRKAR1A, AC007998.2, INO80C, AC009070.1, CMC2, AC009879.2, AC009879.3, ADHFE1, AC010487.3, ZNF816-ZNF321P, ZNF816, AC010328.3, AC010522.1, ZNF587B, AC010547.4, ZNF19, AC012313.3, ZNF497, AC012651.1, CAPN3, AC013489.1, DET1, AC016747.4, C2orp4, AC020907.6, FXYD3, AC021087.5, PDCD6, AHRR, AC022137.3, ZNF761, AC025283.3, NAA60, AC027644.4, RABGEF1, AC055811.2, FLCN, AC069368.3, ANKDD1A, AC073610.3, ARF3, AC074091.1,GPNl, AC079447.1, LIPT1, AC092587.1, AC079594.2, TRIM59, AC091060.1,C18orf21, AC092143.3, MC1R, AC093227.2, ZNF607, AC093512.2, ALDOA, AC098588.1, ANAPC10, AC107871.1, CAI.MI.4, AC114490.2, ZMYM6, AC138649.1, NIPA1, AC138894.1, CLN3, AC139768.1, AC242426.2, CHD1L, ACADM, ACAP3, ACKR2,RP11- 141M3.5, KRBOX1, ACMSD, ACOT9, ACP5, ACPL2, ACSBG1, ACSF2, ACSF3, ACSL1, ACSL3, ACVR1, ADAL, ADAM29, ADAMTS10, ADAMTSL5, ADARB1, ADAT2, ADCK3, ADD3, ADGRG1, ADGRG2, ADH1B, ADIPOR1, ADNP, ADPRH, AGBL5, AGP ATI, AGPAT3, AGR2, AGTR1, AHDC1, AHI1, AHNAK, AIFM1, AIFM3, AIMP2, AK4, AKAP1, AKNAD1, CLCC1, AKR1A1, AKT1, AKT1S1, AKT2, AL139011.2, PEX19, AL157935.2, ST6GALNAC6, AL358113.1JJP2, AL441992.2, KYAT1, AL449266.1,CLCC1, AL590556.3, LINC00339, CDC42, ALAS1, ALB, ALDH16A1, ALDH1B1, ALDH3A1, ALDH3B2, ALDOA, ALKBH2, ALPL, AMD1, AMICA1, AMN1, AMOTL2, AMY1B, AMY2B, ANAPC10, ANAPC11, ANAPC15, ANG, RNASE4, AL163636.2, ANGEL2, ANGPTL1, ANKMY1, ANKRD11, ANKRD28, ANKRD46, ANKRD9, ANKS3, ANKS3,RP 11-127120. 7, ANKS6, ANKZF1, ANPEP, ANXA11, ANXA2, ANXA8L2, AL603965.1, A0C3, AP000304.12, CRYZL1, AP000311.1, CRYZL1, AP000893.2,RAB30, AP001267.5, ATP5MG, AP002495.2, AP003175.1, OR2AT4, AP003419.1, CLCF1, AP005263.1, ANKRD12, AP006621.5, AP006621.1, AP1G1, AP3M1, AP3M2, APBA2, APBB1, APLP2, APOA2, AP0L1, AP0L3, APTX, ARAP1,STARD1O, ARF4, ARFIP1, ARFIP2, ARFRP1, ARHGAP11A, ARHGAP33, ARHGAP4, ARHGEF10, ARHGEF3, ARHGEF35, 0R2A1-AS1, ARHGEF35, 0R2A1-AS1, ARHGEF34P, ARID1B, ARHGEF35, OR2A20P, 0R2A1-AS1, ARHGEF9, ARL1, ARL13B, ARL16, ARL6, ARMC6, ARMC8, ARMCX2, ARMCX5, RP4-769N13.6, ARMCX5-GPRASP2, BHLHB9, ARMCX5-GPRASP2,GPRASP1, ARMCX5- GPRASP2,GPRASP2, ARMCX6, ARNT2, ARPP19, ARRB2, ARSA, ART3, ASB3,GPR75-ASB3, ASCC2, ASNS, ASNS, AC079781.5, ASPSCR1, ASS1, ASUN, ATE1, ATF1, ATF7IP2, ATG13, ATG4D, ATG7, ATG9A, ATM, ATOX1, ATP1B3, ATP2C1, ATP5F1A, ATP5G2, ATP5J, ATP5MD, ATP5PF, ATP6AP2, ATP6V0B, ATP6V1C1, ATP6V1D, ATP7B, ATXN1, ATXNILJSTI, ATXN3, ATXN7L1, AURKA, AURKB, AXDND1, B3GALNT1, B3GALT5, AF064860.1, B3GALT5,AF064860.5, B3GNT5, B4GALT3, B4GALT4, B9D1, BACH1, BAIAP2, BANF1, BANF2, BAX, BAZ2A, BBIP1, BCHE, BCL2L14, BCL6, BCL9L, BCS1L, BDH1, BDKRB2,AL355102.2, BEST1, BEST3, BEX4, BHLHB9, BID, BIN3, BIRC2, BIVM, BIVM- ERCC5, BIVM, BLCAP, BLK, BL0C1S1, RP11-644F5.10, BL0C1S6, AC090527.2, BL0C1S6, RP11-96O20.4, BLVRA, BMF, B0LA1, BORCS8-MEF2B, BORCS8, BRCA1, BRD1, BRDT, BRINP3, BROX, BTBD10, BTBD3, BTBD9, BTD, BTF3L4, BTNL9, BUB1B-PAK6, PAK6, BUB3, C10orf68, Cllorfl, Cllorf48, Cllorf54, Cl lorf54,AP001273.2, Cllorf57, Cllorf63, Cllorf82, C12orf23, C12orf4, C12orf65, C12orJ79, C14orfl59, C14orJ93, C17orf62, C18orf21, C19orfl2, C19orf40, C19orf47, C19orf48, C19orf54, CID, C1GALT1, C1QB, C1QTNF1, CIS, ClorflOl, Clorfll2, Clorfll6, Clorfl59, Clorf63, C2, C2,CFB, C20orf27, C21orf58, C2CD4D, C2orfl5, LIPT1, MRPL30, C2orf80, C2orf81, C3orfl4, C3orfl7, C3orfl8, C3orf22, C3orf33,AC104472.3, C4orf33, C5orf28, C5orf34, C6orfll8, C6orf203, C6orf211, C6orf48, C7orf50, C7orf55, C7orf55-LUC7L2, LUC7L2, C8orf44-SGK3,C8orf44, C8orf59, C9,DAB2, C9orfl53, C9orf9, CA5BP1,CA5B, CABYR, CALCA, CALC0C01, CALC0C02, CALM1, CALM3, CAEML4, RP11-315D16.2, CALN1, CALU, CANT1, CANX, CAP1, CAPN12, CAPS2, CARD8, CARHSP1, CARNS1, CASC1, CASP3, CASP7, CBFA2T2, CBS, CBY1, CCBL1, CCBL2, RBMXL1, CCDC12, CCDC126, CCDC14, CCDC149, CCDC150, CCDC169-SOHLH2, CCDC169, CCDC171, CCDC37, CCDC41, CCDC57, CCDC63, CCDC7, CCDC74B, CCDC77, CCDC82, CCDC90B, CCDC91, CCDC92, CCNE1, CCHCR1, CCL28, CCNBHP1, CCNC, CCND3, CCNG1, CCP110, CCR9, CCT7, CCT8, CD151, CD1D, CD200, CD22, CD226, CD276, CD36, CD59, CDC26, CDC42, CDC42SE1, CDC42SE2, CDHR3, CDK10, CDK16, CDK4, CDKAL1, CDKL3,CTD-2410N18.4, CDKN1A, CDKN2A, CDNF, CEBPZOS, CELF1, CEMIP, CENPK, CEP170B, CEP250, CEP 57, CEP57L1, CEP 63, CERS4, CFL1, CFL2, CFLAR, CGNL1, CHCHD7, CHD1L, CHD8, CHFR,ZNF605, CHIA, CHID1, CHL1, CHM, CHMP1A, CHMP3, RNF103-CHMP3, CHRNA2, CIDEC, CIRBP, CITED1, CKLF-CMIM1, CMTM1, CKMT1B, CLDN12,CTB-13L3.1, CLDNDl,AC021660.3, CLDND1,CPOX, CLHC1, CLIP1, CLUL1, CMC4, MTCP1, CNDP2, CNFN, CNOT1, CNOT6, CNOT7, CNOT8, CNR1, CNR2, CNTFR, CNTRL, C0A1, COASY, COCH, C0L8A1, C0LCA1, COLEC11, COMMD3- BMI1, BMI1, C0PS5, COPS7B, C0Q8A, CORO6, C0TL1, COX14,RP4-605O3.4, COX7A2, COX7A2L, COX7B2, CPA4, CPA5, CPEB1, CPNE1, AL109827.1, RBM12, CPNE1, RP1- 309K20.6, RBM12, CPNE3, CPSF3L, CPT1C, CREB3L2, CREM, CRP, CRYZ, CS,AC073896.1, CS, RP11-977G19.10, CSAD, CSDE1, CSF2RA, CSGALNACT1, CSK, CSNK2A1, CSRNP2, CT45A4, CT45A4,CT45A5, CT45A6, CTBP2, CTCFL, CTD-2116N17.1, KIAA0101, CTD- 2349B8.1, SYT17, CTD-2528L19.4, ZNF607, CTD-2619J13.8, ZNF497, CTNNA1, CTNNBIP1, CTNND1, CTPS2, CTSB, CTSL, CTTN, CUL2, CUL9, CWC15, CXorf40B, CYB561A3, CYBC1, CYLD, CYP11A1, CYP2R1, CYP4B1, CYP4F22, DAG1, DAGLB,KDELR2, DARS, DBNL, DCAF11, DCAF8,PEX19, DCLRE1C, DCTD, DCTN1, DCTN4, DCUN1D2, DDR1, DDX11, DDX19B, ACO 12184.2, DDX19B, RP 11-529K1.3, DDX25, DDX39B, ATP6V1G2-DDX39B, SNORD84, DDX42, DDX60L, DEDD, DEDD2, DEFA1, DEFA1B, DEFA1B, DEFA3, DENND1C, DENND2A, DENND4B, DET1, DGKA, DGKZ, DGLUCY, DHRS4L2, DHRS9, DHX40, DIABLO, AC048338.1, DIAPH1, DICER1, DKKL1, DLG1, DLG3, DLST, DMC1, DMKN, DMTF1, DMTN, DNAJC14, DNAJC19, DNAL1, DNASE1L1, DNMT3A, DOC2A, DOCK8, DOK1, DOPEY1, DPAGT1, DPP8, DRAM2, DRD2, DROSHA, DSN1, DTNA, DTX2, DTX3, DUOXI, DUOXA1, DUS2, DUSP10, DUSP13, DUSP18, DUSP22, DYDC1, DYDC2, DYNLL1, DYNLT1, DYRK1A, DYRK2, DYRK4, RP11-500M8. 7, DZIP1L, E2F6, ECHDC1, ECSIT, ECT2, EDC3, EDEMI, EDEM2, MMP24-AS1, RP4-614O4.il, EEF1AKNMT, EEF1D, EFEMP1, EFHC1, EGFL7, EHF, EI24, EIF1AD, EIF2B5, EIF4G1, EIF2B5, POLR2H, EIF3E, EIF3K, EIF4E3, EIF4G1, ELF1, EIMO2, ELMOD1, AP000889.3, ELMOD3, ELOC, ELOF1, ELOVL1, ELOVL7, ELP1, ELP6, EML3, EMP3, ENCI, ENDOV, ENO1, ENPP5, ENTHD2, ENTPD6, EP400NL, EPB41L1, EPDR1,NME8, EPHX1, EPM2A, EPN1, EPN2, EPN3, EPS8L2, ERBB3, ERC1, ERCC1, ERG, ERI2, ERI2, DCUN1D3, ERLIN2, ERMARD, ERRFI1, ESR2,RP 11-544120.2, ESRRA, ESRRB, ESRRG, ETFA, ETFRF1, ETV1, ETV4, ETV7, EVA1A, EVC2, EVX1, EXD2, EXO5, EXOCI, EXOC2, FAAP24, FABP6, FADS1, FADS2, FAHD2B, FAM107B, FAM111A, FAM111B, FAM114A1, FAM114A2, FAM115C, FAM115C,FAM115D, FAM120B, FAM133B, FAM135A, FAM153A, FAM153B, FAM154B, FAM156A, FAM156B, FAM168B, FAM172A, FAM182B, FAM192A, FAM19A2, FAM200B, FAM220A, FAM220A, AC009412.1, FAM222B, FAM227B, FAM234A, AC004754.1, FAM3C, FAM45A, FAM49B, FAM60A, FAM63A, FAM81A, FAM86B1, FAM86B2, FANCI, FANK1, FAR2, FAXC, FAXDC2, FBF1, FBH1, FBXL4, FBXO18, FBXO22, FBXO31, FBXO41, FBXO44, FBXO45, FBXW9, FCHO1, FCHSD2, FDFT1, FDPS, FER, FETUB, FGD4, FGF1, FGFR1, FGFRL1, FGL1, FHL2, FIBCD1, FIGNL1, FIGNL1,DDC, FKBP5, FKRP, FLRT2, FLRT3, FMC1, LUC7L2, FMC1-LUC7L2, FNDC3B, FOLH1, FOLR1, FOXP1, FOXK1, FOXM1, FOXO1, FOXP4, AC097634.4, FOXRED1, FPR1, FPR2, FRG1B, FRS2, FTO, FTSJ1, FUK, FUT10, FUT3, FUT6, FXYD3, FZD3, G2E3, GAA, GABARAPL1, GABPB1, GABRA5, GAL3ST1, GALE, GALNT11, GALNT14, GALNT6, GAPVD1, GARNL3, GAS2L3, GAS8, GATA1, GATA2, GATA4, GBA, GCNT1, GDPD2, GDPD5, GEMIN7,MARK4, GEMIN8, GGA3, GGACT, AL356966.1, GGPS1, GHRL, GID8, GIGYF2, GIMAP8, GIPC1, GJB1, GJB6, GLB1L, GLI1, GLT8D1, GMFG, GMPR2, GNAI2, GNAQ,GNB1, GNB2, GNE, GNG2, GNGT2, GNPDA1, GNPDA2, GOLGA3,CHFR, GOLGA4, GOLPH3L, GOLT1B, GPBP1L1, GPER1, GPR116, GPR141,EPDR1, GPR155, GPR161, GPR56, GPR63, GPR75-ASB3,ASB3, GPR85, GPSM2, GRAMD1B, GRB10, GRB7, GREM2, GRIA2, GSDMB, GSE1, GSN, GSTA4, GSTZ1, GTDC1, GTF2H1, GTF2H4, VARS2, GTF3C2, GUCY1A3, GUCY1B3, GUK1, GULP1, GYPC, GYSI, GZF1, HAGH, HAO2, HAPLN3, HAVCR1, HAX1, HBG2, AC 104389.4, HBG2, AC 104389.4, HBE1, HBG2, AC 104389.4, HBE1,OR51B5, HBG2,HBE1, AC 104389.28, HBS1L, HCFC1R1, HCK, HDAC2, HDAC6, HDAC7, HDLBP, HEATR4, HECTD4, HEXIM2, HHAT, HHATL, CCDC13, HINFP, HIRA, C22orf39, HIVEP3, HJV, HKR1, HLF, HMBOX1, HMGA1, HMGB3, HMGCR, HMGN4, HMOX2, HNRNPC, HNRNPD, HNRNPH1, HNRNPH3, HNRNPR, HOMER3, HOPX, HOXA3, HOXB3, HOXB3,HOXB4, HOXC4, HOXD3, HOXD3,HOXD4, HPCAL1, HPS4, HPS5, HRH1, HS3ST3A1, HSH2D, HSP90AA1, HSPD1, HTT, HUWE1, HYOU1, IAH1, ICA1L, ICAM2, ICE2, ICK, IDH2, IDH3G, IDS, IFI27, IFI44, IFT20, IFT22, IFT88, IGF2, INS-IGF2, IGF2BP3, IGFBP6, IKBKAP, IKBKB, IL11, IL18BP, IL18RAP, IL1RAP, IL1RL1, IL18R1, IL1RN, IL32, IL4I1,NUP62,ACO11452.1, IL4I1,NUP62,CTC- 326K19.6, IL6ST, ILVBL, IMMP1L, IMPDH1, INCAI, ING1, INIP, INPPI, INPP5J, INPP5K, INSIG2, INTS11, INTS12, INTS14, IP6K2, IP6K3, IPO11, LRRC70, IQCE, IQGAP3, IRAK4, IRF3, IRF5, IRF6, ISG20, IST1, ISYNA1, ITFG2, ITGB1BP1, ITGB7, ITIH4, RP5-966M1.6, ITPRIPL1, JADE1, JAK2, JARID2, JDP2, KANK1, KANK1,RP 11-3 IF 19.1, KANK2, KANSL1L, KAT6A, KBTBD2, KBTBD3, KCNAB2, KCNE3, KCNG1, KCNJ16, KCNJ9, KCNMB2,AC117457. l,LINC01014, KCTD20, KCTD7 ,RABGEF 1 , KDM1B,

KDM4A,AL451062.3, KHNYN, KIAA0040, KIAA0125, KIAA0196, KIAA0226L, PPP1R2P4, KIAA0391, KIAA0391, AL121594.1, KIAA0391, PSMA6, KIAA0753, KIAA0895, KIAA0895L, KIAA1191, KIAA1407, KIAA1841, C2orf74, KIF12, KIF14, KIF27, KIF9, KIFC3, KIN, KIRREL1, KITLG, KLC1, APOPT1, API 39300.1, KLC4, KLHDC4, KLHDC8A, KLHL13, KLHL18, KLHL2, KLHL24, KLHL7, KLK11, KLK2, KLK5, KLK6, KLK7, KNOP1, KRBA2, AC135178.2, KRBA2, RP11-849F2.7, KRIT1, KRT15, KRT8, KTN1, KXD1, KYATS, RBMXL1, KYNU, L3MBTL1, LACC1, LARGE, LARP4, LARP7, LAT2, LBHD1, LCA5, LCA5L, LCTL, LEPROTL1, LGALS8, LGALS9C, LGMN, LHFPL2, LIG4, LIMCH1, LIMK2, LIMS2, LINC00921, ZNF263, LIPF, LLGL2, LMAN2L, LMCD1, LMF1, RP11-161M6.2, LMO1, LMO3, LOXHD1, LPAR1, LPAR2, LPAR4, LPAR5, LPAR6, LPHN1, LPIN2, LPIN3, LPP, LRFN5, LRIF1, LRMP, LRRC14, LRRC20, LRRC24, C8orf82, LRRC39, LRRC42, LRRC48, LRRC4C, LRRC8A, LRRC8B, LRRD1, LRTOMT, LRTOMT, AP000812.5, LSM7, LTB4R, LTBP3, LUC7L2, FMC1-LUC7L2, LUC7L3, LUZP1, LYG1, LYL1, LYPD4, LYPD6B, LYRM1, LYRM5, LYSMD4, MACC1, MAD1L1, MAD1L1, AC069288.1, MAEA, MAFF, MAFG, MAFK, MAGEA12,CSAG4, MAGEA2, MAGEA2B, MAGEA4, MAGEB1, MAGOHB, MAN2A2, MANBAL, MAOB, MAP2K3, MAP3K7CL, MAP3K8, MAP7, MAP9, MAPK6, MAPK7, MAPK8, MAPKAP1, 10-Mar, 7-Mar, 8-Mar, MARK2, MASP1, MATK, MATR3, MATR3,SNHG4, MB, MBD5, MBNL1, MBOAT7, MCC, MCFD2, MCM9, MCOLN3, MCRS1, MDC1, MDGA2, MDH2, MDM2, MEI, MEAK7, MECR, MED4, MEF2A, MEF2B,BORCS8-MEF2B, MEF2BNB- MEF2B, MEF2B, MEF2BNB, MEF2C, MEF2D, MEGF10, MED, MEIS2, MELK, MET, METTL13, METTL23, MFF, MFN2, MFSD2A, MGST3, MIB2, MICAL1, MICAL3, MICOSIO, NBL1,MICOS10-NBL1, MIDI, MINA, MINOS 1-NBL1, MINOS 1, MIOS, MIPOL1, MIS12, MKLN1, MKNK1, MKNK1,MOB3C, MLF2, MLH1, MMP17, MOBP, MOCS1, MOGS, MOK, MORF4L1, MPC1, MPC2, MPG, MPI, MPP1, MPP2, MPPE1, MPST, MRAS, MRO, MROH1, MROH7-TTC4, MROH7, MRPL14, MRPL24, MRPL33,BABAM2, MRPL33, BRE, MRPL47, MRPL48, MRPL55, MRRF, MRTFA, MRTFB, MRVI1, MS4A1, MS4A15, MS4A3, MS4A6E,MS4A7,MS4A14, MSANTD3, MSANTD4, MSH5,MSH5-SAPCD1, MSL2, MSRB3, MSS51, MTCP1,CMC4, MTERF, MTERF1, MTERF3, MTERFD2, MTERFD3, MTF2, MTG2, MTHFD2, MTHFD2L, MTIF2, MTIF3, MTMR10, MTRF1, MTRR, MTUS2, MUTYH, MVK, MX1, MX2, MYH10, MYL12A, MYB, MYD88, MYL5, MYLIP, MYNN, MYO15A, MYO1B, MYOM2, MZF1, N4BP2L2, NAA60, NAB1, NAE1, NAGK, NAP IL 1, NAP1L4, NAPG, NARFL, NARG2, NAT1, NAT10, NBPF11, WI2-3658N16.1, NBPF12, NBPF15, NBPF24, NBPF6, NBPF9, NBR1, NCAPG2, NCBP2, NCEH1, NCOA1, NCOA4, NDC1, NDRGI, NDRG2, NDRG4, NDSTI, NDUFAF6, NDUFB2, NDUFC1, NDUFS1, NDUFS8, NDUFV1, NEDD1, NEIL1, NEIL2, NEK10, NEK11, NEK6, NEK9, NELFA, NEU4, NFAT5, NFE2, NFE2L2, AGO 19080.1, NFRKB, NFYA, NFYC, NIF3L1, NIPA2, NKIRAS1, NKX2-1, NLRC3, NME1,NME1-NME2,NME2, NME1-NME2, NME2, NME4, NME6, NME9, NODI, NOLIO, NOL8, NONO, NPAS1, NPIPA8, RP11-1212A22.1, NPIPB3, NPIPB4, NPIPB9, NPL, NPM1, NPPA, NQO2, NR1H3, NR2C2, NR2F2, NR4A1, NRDC, NREP, NRF1, NRG4, NRIP1, NSD2, NSDHL, NSG1, NSMCE2, NSRP1, NT5C2, NTF4, NTMT1, NTNG2, NUBP2, NUCB2, NUDT1, NUDT2, NUDT4, NUF2, NUMBL, NUP50, NUP54, NUP85, NVL, NXF1, NXPE1, NXPE3, OARD1, OAT, 0AZ2, OCIAD1, OCLN, ODF2, OGDHL, OGFOD2, AC026362.1, OGFOD2, RP11-197N18.2, 0LA1, OPRL1, OPTN, OR2H1, ORAI2, ORMDL1, ORMDL2, ORMDL3, 0SBPL2, 0SBPL3, 0SBPL5, 0SBPL9, OSER1, OSGIN1, 0SR2, P2RX4, P2RY2, P2RY6, P4HA2, PABPC1, PACRGL, PACSIN3, PADI1, PAIP2, PAK1, PAK3, PAK4, PAK7, PALB2, PANK2, PAQR6, PARP11, PARVG, PASK, PAX6, PBRM1, PBXIP1, PCBP3, PCBP4,AC 115284.1, PCBP4, RP11-155D18.14, RP11-155D18.12, PCGF3, PCGF5, PCNP, PCSK9, PDCD10, PDCD6, AHRR, PDDC1, PDGFRB, PDIA6, PDIK1L, PDLIM7, PDP1, PDPK1, PDPN, PDZD11, PEA15, PEX2, PEX5, PEX5L, PFKM, PFN4, PGAP2, PGAP2, AC090587.2, PGAP3, PGM3, PGPEP1, PHB, PHC2, PHF20, PHF21A, PHF23, PHKB, PHLDB1, PHOSPHO1, PHOSPHO2, KLHL23, PI4KB, PIAS2, PICALM, PIF1, PIGN, PIGO, PIGT, PIK3CD, PILRB, STAG3L5P-PVRIG2P-PILRB, PIP5K1B, PIR, PISD, PIWIL4,FUT4, PKD2, PKIA, PKIG, PKM, PKN2, PRAIA, PLA2G2A, PLA2G5, PLA2G7, PLAC8, PLAGL1, PLD1, PLD3, PLEKHA1, PLEKHA2, PLEKHA6, PLEKHG5, PLIN1, PLS1, PLS3, PLSCR1, PLSCR2, PLSCR4, PLXNB1, PLXNB2, PMP22, PMS1, PNISR, PNKP,AKT1S1, PNMT, PNPLA4, PNPLA8, PNPO, PNRC1, POC1B, POFUT1, POLB, POLDI, POLH, POLI, POLL, POLR1B, POM121, POM121QAC006014.7, POM121C, AC211429.1, POMC, POMT1, POP1, PORCN, POU5F1, PS0RS1C3, PPARD, PPARG, PPHLN1, PPIL3, PPIL4, PPM1A, PPM1B,ACO 13717.1, PPP1CB, PPP1R11, PPP1R13L, PPP1R26, PPP1R9A, PPP2R2B, PPP3CA, PPP6R1, PPP6R3, PPT2,PPT2-EGFL8, EGFL8, PPWD1, PRDM2, PRDM8, PRELID3A, PREPL, PRICKLEI, PRKAG1, PRMT2, PRMT5, PRMT7, PROMI, PRPS1, PRPSAP2, PRR14L, PRR15L, PRR5,PRR5-ARHGAP8, PRR5L, PRR7, PRRC2B, PRRT4, PRSS50, PRSS45, PRSS44, PRUNE, PRUNE1, PSEN1, PSMA2, PSMF1, PS0RS1C1, PSPH, PSRC1, PTBP3, PTHLH, PTK2, PTPDC1, PTPRM, PUF60, PUM2, PUS1, PUS10, PXN, PXYLP1, PYCR1, QRICH1, R3HCC1L, R3HDM2, RAB17, RAB23, RAB3A, RAB3D,IMEM205, RAB4B-EGLN2, EGLN2, AC008537.1, RAB5B, RAB7L1, RABL2A, RABL2B, RABL5, RACGAP1, RADU, RAD51L3-RFFL, RAD51D, RAD52, RAE1, RAI 14, RAI2, RALBP1, RAN, RANGAP1, RAP1A, RAP IB, RAP1GAP, RAPGEF4, RAPGEFL1, RASGRP2, RASSF1, RBCK1, RBM12B, RBM14, RBM4, RBM14-RBM4, RBM23, RBM4, RBM14-RBM4, RBM47, RBM7,AP002373.1, RBM7, RP 11-212D 19.4, RBMS2, RBMY1E, RBPJ, RBPMS, RBSN, RCBTB2, RCC1, RCC1, SNHG3, RCCD1, RECQL, RELL2, REPIN1, AC073111.3, REPIN1, ZNF775, RER1, RERE, RFWD3, RFX3, RGL2, RGMB, RGS11, RGS3, RGS5, AL592435.1, RHBDD1, RHNO1, TULP3, RHOC, AL603832.3, RHOC,RP11-426L16.10, RHOH, RRC8B, RRMKLB, RIN1, RIPK2, RIT1, RUM, RNASE4,ANG,AL163636.6, RNASEK, RNASEK-C17orf49, RNF111, RNF123, RNF13, RNF14, RNF185, RNF216, RNF24, RNF32, RNF34, RNF38, RNF4, RNF44, RNH1, RNMT, RNPS1, RO60, ROPN1, ROPN1B, ROR2, RP1-102H19.8, C6orfl63, RP1-283E3.8,CDK11A, RP11-12OM18.2,PRKAR1A, RP11-133K1.2, PAK6, RP11- 164J13.1,CAPN3, RP 11-21 J 18.1, ANKRD12, RPll-322E11.6,INO80C, RP11- 337C18.1O,CHD1L, RP 11-432B6.3, TRIM59, RP 11-468E2.4,IRF9, RP11-484M3.5, UPK1B, RP11-517H2.6, CCR6, RP 11-613M10.9, SLC25A51, RP11-659G9.3, RAB30, RP11- 691N7.6,CTNND1, RP11-849H4.2, RP 11-896J10.3, NKX2-1, RP11-96020.4, SQRDL, RP11- 986E7.7, SERPINA3, RP4-769N13.6, GPRASP1, RP4-769N13.6,GPRASP2, RP4-798P15.3, SEC16B, RP5-1021I20.4, ZNF410, RP6-109B7.3, FLJ27365, RPE, RPH3AL, RPL15, RPL17, RPL17-C18orf32,RPL17, RPL23A, RPL36,HSD1 IB IL, RPP38, RPS20, RPS27A, RPS3A, RPS6KA3, RPS6KC1, RPS6KL1, RPUSD1, RRAGD, RRAS2, RRBP1, RSL1D1, RSRC2, RSRP1, RUBCNL, RUNX1T1, RUVBL2, RWDD1, RWDD4, S100A13,AL162258.1, S100A13,RPl- 178F15.5, S100A16, S100A4, S100A3, S100A6, S100PBP, SAA1, SACM1L, SAMD4B, SARI A, SARAF, SARNP,RP 11-76217.5, SCAMP 5, SCAP, SCAPER, SCFD1, SCGB3A2, SCIN, SCML1, SCNN1D, SC02, SCOC, SCRN1, SDC2, SDC4, SEC13, SEC14L1, SEC14L2, SEC22C, SEC23B, SEC24C, SEC61G, SEMA4A, SEMA4C, SEMA4D, SEMA6C, SENP7, SEPPI, Il-Sep, 2-Sep, SERGEF, AC055860.1, SERP1, SERPINA1, SERPINA5, SERPINB6, SERPING1, SERPINH1, SERTAD3, SETD5, SFMBT1, AC096887.1, SFTPA1, SFTPA2, SFXN2, SGCD, SGCE, SGK3, SGK3,C8orf44, SH2B1, SH2D6, SH3BP1,Z83844.3, SH3BP2, SH3BP5, SH3D19, SH3YL1, SHC1, SHISA5, SHMT1, SHMT2, SHOC2, SHROOM1, SIGLEC5,SIGLEC14, SIL1, SIN 3 A, SIRT2, SIRT6, SKP1, STAT4, AC104109.3, SLAIN1, SLC10A3, SLC12A9, SLC14A1, SLC16A6, SLC1A2, SLC1A6, SLC20A2, SLC25A18, SLC25A19, SLC25A22, SLC25A25, SLC25A29, SLC25A30, SLC25A32, SLC25A39, SLC25A44, SLC25A45, SLC25A53, SLC26A11, SLC26A4, SLC28A1, SLC29A1, SLC2A14, SLC2A5, SLC2A8, SLC35B2, SLC35B3, SLC35C2, SLC37A1, SLC38A1, SLC38A11, SLC39A13, SLC39A14, SLC41A3, SLC44A3, SLC4A7, SLC4A8, SLC5A10, SLC5A11, SLC6A1, SLC6A12, SLC6A9, SLC7A2, SLC7A6, SLC7A7, SLC01A2, SLC01C1, SLC02B1, SLFN11, SLFN12, SLFNL1, SEMO1, SLTM, SLU7, SMAD2, SMAP2, SMARCA2, SMARCE1, AC073508.2, SMARCE1, KRT222, SMC6, SMG7, SMIM22, SMOX, SMPDL3A, SMTN, SMU1, SMUG1, SNAP25, SNCA, SNRK, SNRPC, SNRPD1, SNRPD2, SNRPN, SNRPNSNURF, SNUPN, SNX11, SNX16, SNX17, S0AT1, SOHLH2,CCDC169- SOHLH2,CCDC169, SORBS1, SORBS2, SOX5, SP2, SPART, SPATA20, SPATA21, SPATS2, SPATS2L, SPDYE2, SPECC1, SPECC1L,SPECC1L-ADORA2A, SPECC1L-ADORA2A, ADORA2A, SPEG, SPG20, SPG21, SPIDR, SPIN!, SPOCD1, SPOP, SPRR2A, SPRR2B, SPRR2E, SPRR2B, SPRR2F, SPRR2D, SPRR3, SPRY1, SPRY4, SPTBN2, SRC, SRGAP1, SRP68, SRSF11, SSX1, SSX2IP, ST3GAL4, ST3GAL6, ST5, ST6GALNAC6, ST7L, STAC3, STAG1, STAG2, STAMBP, STAMBPL1, STARD3NL, STAT6, STAU1, STAU2, AC022826.2, STAU2, RP11-463D19.2, STEAP2, STEAP3, STIL, STK25, STK33, STK38L, STK40, STMN1, STON1,STON1-GTF2A1L, STRAP, STRBP, STRC, AC011330.5, STRC, CATSPER2, STRC, CATSPER2, AC011330.5, STRCSTRCP1, STT3A, STX16-NPEPL1, NPEPL1, STX5, STX6, STX8, STXBP6, STYK1, SULT1A1, SULT1A2, SUMF2, SUN1, SUN2, SUN2, DNAL4, SUOX, SUPT6H, SUV39H2, SV2B, SYBU, SYNCRIP, SYNJ2, SYT1, SYTL4, TAB2, TACC1, TADA2B, TAF1C, TAF6,AC073842.2, TAF6, RP11-506M12.1, TAF9, TAGLN, TANK, TAP SARI, PSMB9, TAPT1, TATDN1, TAZ, TBC1D1, TBC1D12, HELLS, TBC1D15, TBC1D3H, TBC1D3G, TBC1D5, TBC1D5,SATB1, TBCA, TBCEL, TBCEL, AP000646.1, TBL1XR1, TBP, TBX5, TBXAS1, TCAF1, TCEA2, TCEAL4, TCEAL8, TCEAL9, TCEANC, TCEB1, TCF19, TCF25, TCF4, TCP1, TCP10L, AP000275.65, TCP11, TCP11L2, TCTN1, TDG, TDP1, TDRD7, TEAD2, TECR, TENC1, TENT4A, TEX264, TEX30, TEX37, TFDP1, TFDP2, TFEB, TFG, TFP1,TF, TFPI, TGIF1, THAP6, THBS3, THOC5, THRAP3, THUMPD3, TIAL1, TIMM9, TIMP1, TIRAP, TJAP1, TJP2, TK2, TLDC1, TLE3, TLE6, TLN1, TLR10, TM9SF1, TMBIM1, TMBIM4, TMBIM6, TMC6, TMCC1, TMCO4, TMEM126A, TMEM139, TMEM150B, TMEM155, TMEM161B, TMEM164, TMEM168, TMEM169, TMEM175, TMEM176B, TMEM182, TMEM199,CTB-96E2.3, TMEM216, TMEM218, TMEM230, TMEM263, TMEM45A, TMEM45B, TMEM62, TMEM63B, TMEM66, TMEM68, TMEM98, TMEM9B, TMPRSS11D, TMPRSS5, TMSB15B, TMTC4, TMUB2, TMX2-CTNND1, RP11-691N7.6,CTNND1, TNFAIP2, TNFAIP8L2, SCNM1, TNFRSF10C, TNFRSF19, TNFRSF8, TNFSF12-TNFSF13, TNFSF12, TNFSF13, TNFSF12-TNFSF13, TNFSF13, TNIP1, TNK2, TNNT1, TNRC18, TNS3, TOB2, TOM1L1, TOP1MT, TOP3B, TOX2, TP53,RP11-199F11.2, TP53I11, TP53INP2, TPCN1, TPM3P9,AC022137.3, TPT1, TRA2B, TRAF2, TRAF3, TRAPPC12, TRAPPC3, TREH, TREX1, TREX2, TRIB2, TRIM3, TRIM36, TRIM39, TRIM46, TRIM6, TRIM6-TRIM34, TRIM6-TRIM34, TRIM34, TRIM66, TRIM73, TRIT1, TRMT10B, TRMT2B, TRMT2B-AS1, TRNT1, TRO, TROVE2, TRPS1, TRPT1, TSC2, TSGA10, TSPAN14, TSPAN3, TSPAN4, TSPAN5, TSPAN6, TSPAN9, TSPO, TTC12, TTC23, TTC3, TTC39A, TTC39C, TTLL1, TTLL7, TTP AL, TUBD1, TWNK, TXNL4A, TXNL4B, TXNRD1, TYK2, U2AF1, UBA2, UBA52, UBAP2, UBE2D2, UBE2D3, UBE2E3, UBE2I, UBE2J2, UBE3A, UBL7, UBXN11, UBXN7, UGDH, UGGT1, UGP2, UMADl,AC007161.3, UNC45A, UQCC1, URGCP-MRPS24, URGCP, USMG5, USP16, USP21, USP28, USP3, USP33, USP35, USP54, USP9Y, USPL1, UTP15, VARS2, VASH2, VAV3, VDAC1, VDAC2, FDR, FEZT, VGF, FILI, FILL, VIPR1, VPS29, VPS37C, VPS8, VPS9D1, VRK2, FWA1, VWA5A, WARS, WASF1, WASHC5, WBP5, WDHD1, WDPCP, WDR37, WDR53, WDR6, WDR72, WDR74, WDR81, WDR86, WDYHV1, WFDC3, WHSCI, WIPF1, WSCD2, WWP2, XAGE1A, XAGE1B, XKR9, XPNPEP1, XRCC3, XRN2, XXYLT1, YIF1A, YIF1B, YIPF1, YIPF5, YPEL5, YWHAB, YWHAZ, YY1AP1, ZBTB1, ZBTB14, ZBTB18, ZBTB20, ZBTB21, ZBTB25, ZBTB33, ZBTB34, ZBTB38, ZBTB43, ZBTB49, ZBTB7B, ZBTB7C, ZBTB80S, ZC3H11A, ZBED6, ZC3H13, ZCCHC17, ZCCHC7, ZDHHC11, ZDHHC13, ZEB2, ZFAND5, ZFAND6, ZFP1, ZFP62, ZFX, ZFYVE16, ZFYVE19, ZFYVE20, ZFYVE27, ZHX2, ACO 16405.1, ZHX3, ZIK1, ZIM2,PEG3, ZKSCAN1, ZKSCAN3, ZKSCAN8, ZMAT3, ZMAT5, ZMIZ2, ZMYM6, ZMYND11, ZNF10,AC026786.1, ZNF133, ZNF146, ZNF16, ZNF177, ZNF18, ZNF200, ZNF202, ZNF211, ZNF219, ZNF226, ZNF227, ZNF23, ACO 10547.4, ZNF23, ACO 10547.9, ZNF239, ZNF248, ZNF25, ZNF253, ZNF254, ZNF254, AC092279.1, ZNF263, ZNF274, ZNF275, ZNF28,ZNF468, ZNF283, ZNF287, ZNF3, ZNF320, ZNF322, ZNF324B, ZNF331, ZNF334, ZNF34, ZNF350, ZNF385A, ZNF395, FBXO16, ZNF415, ZNF418, ZNF43, ZNF433-AS1, AC008770.4, ZNF438, ZNF444, ZNF445, ZNF467, ZNF480, ZNF493, ZNF493,CTD-2561J22.3, ZNF502, ZNF507, ZNF512, AC074091.1, ZNF512,RP 11-158113.2, ZNF512B, ZNF512B, SAMD10, ZNF521, ZNF532, ZNF544, AC020915.5, ZNF544, CTD- 3138B18.4, ZNF559,ZNF177, ZNF562, ZNF567, ZNF569, ZNF570, ZNF571-AS1,ZNF54O, ZNF577, ZNF580,ZNF581, ZNF580, ZNF581,CCDC106, ZNF600, ZNF611, ZNF613, ZNF615, ZNF619,ZNF620, ZNF639, ZNF652, ZNF665, ZNF667, ZNF668, ZNF671, ZNF682, ZNF687, ZNF691, ZNF696, ZNF701, ZNF706, ZNF707, ZNF714, ZNF717, ZNF718, ZNF720, ZNF721, ZNF730, ZNF763, ZNF780B, AC005614.5, ZNF782, ZNF786, ZNF79, ZNF791, ZNF81, ZNF83, ZNF837, ZNF839, ZNF84, ZNF845, ZNF846, ZNF865, ZNF91, ZNF92, ZNHIT3, ZSCAN21, ZSCAN25, ZSCAN30, and ZSCAN32.

In some embodiments, the gene encoding a target sequence comprises the HTT gene. In some embodiments, the gene encoding a target sequence comprises the MYB gene. In some embodiments, the gene encoding a target sequence comprises the SMN2 gene. In some embodiments, the gene encoding a target sequence comprises the F0XM1 gene.

Exemplary genes that may be modulated by the compounds of Formula (I) or (II) described herein may also include, inter alia, AC005258.1, AC005943.1, AC007849.1, AC008770.2, AC010487.3, AC011477.4, AC012651.1, AC012531.3, AC034102.2, AC073896.4, AC ₁ 04472.3, AL109811.3, AL133342.1, AL137782.1, AL157871.5, AF241726.2, AL355336.1, AL358113.1, AL360181.3, AL445423.2, AL691482.3, AP001267.5, RF01169, and RF02271.

The compounds described herein may further be used to modulate a sequence comprising a particular splice site sequence, e.g., an RNA sequence (e.g., a pre-mRNA sequence). In some embodiments, the splice site sequence comprises a 5' splice site sequence. In some embodiments, the splice site sequence comprises a 3' splice site sequence. Exemplary gene sequences and splice site sequences (e.g., 5' splice site sequences) include AAAgcaaguu (SEQ ID NO: 1), AAAguaaaaa (SEQ ID NO: 2), AAAguaaaau (SEQ ID NO: 3), AAAguaaagu (SEQ ID NO: 4), AAAguaaaua (SEQ ID NO: 5), AAAguaaaug (SEQ ID NO: 6), AAAguaaauu (SEQ ID NO: 7), AAAguaacac (SEQ ID NO: 8), AAAguaacca (SEQ ID NO: 9), AAAguaacuu (SEQ ID NO: 10), AAAguaagaa (SEQ ID NO: 11), AAAguaagac (SEQ ID NO: 12), AAAguaagag (SEQ ID NO: 13), AAAguaagau (SEQ ID NO: 14), AAAguaagca (SEQ ID NO: 15), AAAguaagcc (SEQ ID NO: 16), AAAguaagcu (SEQ ID NO: 17), AAAguaagga (SEQ ID NO: 18), AAAguaaggg (SEQ ID NO: 19), AAAguaaggu (SEQ ID NO: 20), AAAguaagua (SEQ ID NO: 21), AAAguaaguc (SEQ ID NO: 22), AAAguaagug (SEQ ID NO: 23), AAAguaaguu (SEQ ID NO: 24), AAAguaaucu (SEQ ID NO: 25), AAAguaauua (SEQ ID NO: 26), AAAguacaaa (SEQ ID NO: 27), AAAguaccgg (SEQ ID NO: 28), AAAguacuag (SEQ ID NO: 29), AAAguacugg (SEQ ID NO: 30), AAAguacuuc (SEQ ID NO: 31), AAAguacuug (SEQ ID NO: 32), AAAguagcuu (SEQ ID NO: 33), AAAguaggag (SEQ ID NO: 34), AAAguaggau (SEQ ID NO: 35), AAAguagggg (SEQ ID NO: 36), AAAguaggua (SEQ ID NO: 37), AAAguaguaa (SEQ ID NO: 38), AAAguauauu (SEQ ID NO: 39), AAAguauccu (SEQ ID NO: 40), AAAguaucuc (SEQ ID NO: 41), AAAguaugga (SEQ ID NO: 42), AAAguaugua (SEQ ID NO: 43), AAAguaugug (SEQ ID NO: 44), AAAguauguu (SEQ ID NO: 45), AAAguauugg (SEQ ID NO: 46), AAAguauuuu (SEQ ID NO: 47), AAAgucagau (SEQ ID NO: 48), AAAgucugag (SEQ ID NO: 49), AAAgugaaua (SEQ ID NO: 50), AAAgugagaa (SEQ ID NO: 51), AAAgugagac (SEQ ID NO: 52), AAAgugagag (SEQ ID NO: 53), AAAgugagau (SEQ ID NO: 54), AAAgugagca (SEQ ID NO: 55), AAAgugagcu (SEQ ID NO: 56), AAAgugaggg (SEQ ID NO: 57), AAAgugagua (SEQ ID NO: 58), AAAgugaguc (SEQ ID NO: 59), AAAgugagug (SEQ ID NO: 60), AAAgugaguu (SEQ ID NO: 61), AAAgugcguc (SEQ ID NO: 62), AAAgugcuga (SEQ ID NO: 63), AAAguggguc (SEQ ID NO: 64), AAAguggguu (SEQ ID NO: 65), AAAgugguaa (SEQ ID NO: 66), AAAguguaug (SEQ ID NO: 67), AAAgugugug (SEQ ID NO: 68), AAAguguguu (SEQ ID NO: 69), AAAguuaagu (SEQ ID NO: 70), AAAguuacuu (SEQ ID NO: 71), AAAguuagug (SEQ ID NO: 72), AAAguuaugu (SEQ ID NO: 73), AAAguugagu (SEQ ID NO: 74), AAAguuugua (SEQ ID NO: 75), AACguaaaac (SEQ ID NO: 76), AACguaaagc (SEQ ID NO: 77), AACguaaagg (SEQ ID NO: 78), AACguaagca (SEQ ID NO: 79), AACguaaggg (SEQ ID NO: 80), AACguaaguc (SEQ ID NO: 81), AACguaagug (SEQ ID NO: 82), AACguaaugg (SEQ ID NO: 83), AACguaguga (SEQ ID NO: 84), AACguaugua (SEQ ID NO: 85), AACguauguu (SEQ ID NO: 86), AACgugagca (SEQ ID NO: 87), AACgugagga (SEQ ID NO: 88), AACgugauuu (SEQ ID NO: 89), AACgugggau (SEQ ID NO: 90), AACgugggua (SEQ ID NO: 91), AACguguguu (SEQ ID NO: 92), AACguuggua (SEQ ID NO: 93), AAGgcaaauu (SEQ ID NO: 94), AAGgcaagag (SEQ ID NO: 95), AAGgcaagau (SEQ ID NO: 96), AAGgcaagcc (SEQ ID NO: 97), AAGgcaagga (SEQ ID NO: 98), AAGgcaaggg (SEQ ID NO: 99), AAGgcaagug (SEQ ID NO: 100), AAGgcaaguu (SEQ ID NO: 101), AAGgcacugc (SEQ ID NO: 102), AAGgcagaaa (SEQ ID NO: 103), AAGgcaggau (SEQ ID NO: 104), AAGgcaggca (SEQ ID NO: 105), AAGgcaggga (SEQ ID NO: 106), AAGgcagggg (SEQ ID NO: 107), AAGgcaggua (SEQ ID NO: 108), AAGgcaggug (SEQ ID NO: 109), AAGgcaucuc (SEQ ID NO: 110), AAGgcaugcu (SEQ ID NO: 111), AAGgcaugga (SEQ ID NO: 112), AAGgcauguu (SEQ ID NO: 113), AAGgcauuau (SEQ ID NO: 114), AAGgcgagcu (SEQ ID NO: 115), AAGgcgaguc (SEQ ID NO: 116), AAGgcgaguu (SEQ ID NO: 117), AAGgcuagcc (SEQ ID NO: 118), AAGguaaaaa (SEQ ID NO: 119), AAGguaaaac (SEQ ID NO: 120), AAGguaaaag (SEQ ID NO: 121), AAGguaaaau (SEQ ID NO: 122), AAGguaaaca (SEQ ID NO: 123), AAGguaaacc (SEQ ID NO: 124), AAGguaaacu (SEQ ID NO: 125), AAGguaaaga (SEQ ID NO: 126), AAGguaaagc (SEQ ID NO: 127), AAGguaaagg (SEQ ID NO: 128), AAGguaaagu (SEQ ID NO: 129), AAGguaaaua (SEQ ID NO: 130), AAGguaaauc (SEQ ID NO: 131), AAGguaaaug (SEQ ID NO: 132), AAGguaaauu (SEQ ID NO: 133), AAGguaacaa (SEQ ID NO: 134), AAGguaacau (SEQ ID NO: 135), AAGguaaccc (SEQ ID NO: 136), AAGguaacua (SEQ ID NO: 137), AAGguaacuc (SEQ ID NO: 138), AAGguaacug (SEQ ID NO: 139), AAGguaacuu (SEQ ID NO: 140), AAGguaagaa (SEQ ID NO: 141), AAGguaagac (SEQ ID NO: 142), AAGguaagag (SEQ ID NO: 143), AAGguaagau (SEQ ID NO: 144), AAGguaagca (SEQ ID NO: 145), AAGguaagcc (SEQ ID NO: 146), AAGguaagcg (SEQ ID NO: 147), AAGguaagcu (SEQ ID NO: 148), AAGguaagga (SEQ ID NO: 149), AAGguaaggc (SEQ ID NO: 150), AAGguaaggg (SEQ ID NO: 151), AAGguaaggu (SEQ ID NO: 152), AAGguaagua (SEQ ID NO: 153), AAGguaaguc (SEQ ID NO: 154), AAGguaagug (SEQ ID NO: 155), AAGguaaguu (SEQ ID NO: 156), AAGguaauaa (SEQ ID NO: 157), AAGguaauac (SEQ ID NO: 158), AAGguaauag (SEQ ID NO: 159), AAGguaauau (SEQ ID NO: 160), AAGguaauca (SEQ ID NO: 161), AAGguaaucc (SEQ ID NO: 162), AAGguaaucu (SEQ ID NO: 163), AAGguaauga (SEQ ID NO: 164), AAGguaaugc (SEQ ID NO: 165), AAGguaaugg (SEQ ID NO: 166), AAGguaaugu (SEQ ID NO: 167), AAGguaauua (SEQ ID NO: 168), AAGguaauuc (SEQ ID NO: 169), AAGguaauug (SEQ ID NO: 170), AAGguaauuu (SEQ ID NO: 171), AAGguacaaa (SEQ ID NO: 172), AAGguacaag (SEQ ID NO: 173), AAGguacaau (SEQ ID NO: 174), AAGguacacc (SEQ ID NO: 175), AAGguacacu (SEQ ID NO: 176), AAGguacagg (SEQ ID NO: 177), AAGguacagu (SEQ ID NO: 178), AAGguacaua (SEQ ID NO: 179), AAGguacaug (SEQ ID NO: 180), AAGguacauu (SEQ ID NO: 181), AAGguaccaa (SEQ ID NO: 182), AAGguaccag (SEQ ID NO: 183), AAGguaccca (SEQ ID NO: 184), AAGguacccu (SEQ ID NO: 185), AAGguaccuc (SEQ ID NO: 186), AAGguaccug (SEQ ID NO: 187), AAGguaccuu (SEQ ID NO: 188), AAGguacgaa (SEQ ID NO: 189), AAGguacggg (SEQ ID NO: 190), AAGguacggu (SEQ ID NO: 191), AAGguacguc (SEQ ID NO: 192), AAGguacguu (SEQ ID NO: 193), AAGguacuaa (SEQ ID NO: 194), AAGguacuau (SEQ ID NO: 195), AAGguacucu (SEQ ID NO: 196), AAGguacuga (SEQ ID NO: 197), AAGguacugc (SEQ ID NO: 198), AAGguacugu (SEQ ID NO: 199), AAGguacuuc (SEQ ID NO: 200), AAGguacuug (SEQ ID NO: 201), AAGguacuuu (SEQ ID NO: 202), AAGguagaaa (SEQ ID NO: 203), AAGguagaac (SEQ ID NO: 204), AAGguagaca (SEQ ID NO: 205), AAGguagacc (SEQ ID NO: 206), AAGguagacu (SEQ ID NO: 207), AAGguagagu (SEQ ID NO: 208), AAGguagaua (SEQ ID NO: 209), AAGguagcaa (SEQ ID NO: 210), AAGguagcag (SEQ ID NO: 211), AAGguagcca (SEQ ID NO: 212), AAGguagccu (SEQ ID NO: 213), AAGguagcua (SEQ ID NO: 214), AAGguagcug (SEQ ID NO: 215), AAGguagcuu (SEQ ID NO: 216), AAGguaggaa (SEQ ID NO: 217), AAGguaggag (SEQ ID NO: 218), AAGguaggau (SEQ ID NO: 219), AAGguaggca (SEQ ID NO: 220), AAGguaggcc (SEQ ID NO: 221), AAGguaggcu (SEQ ID NO: 222), AAGguaggga (SEQ ID NO: 223), AAGguagggc (SEQ ID NO: 224), AAGguagggg (SEQ ID NO: 225), AAGguagggu (SEQ ID NO: 226), AAGguaggua (SEQ ID NO: 227), AAGguagguc (SEQ ID NO: 228), AAGguaggug (SEQ ID NO: 229), AAGguagguu (SEQ ID NO: 230), AAGguaguaa (SEQ ID NO: 231), AAGguaguag (SEQ ID NO: 232), AAGguagucu (SEQ ID NO: 233), AAGguagugc (SEQ ID NO: 234), AAGguagugg (SEQ ID NO: 235), AAGguaguuc (SEQ ID NO: 236), AAGguaguuu (SEQ ID NO: 237), AAGguauaaa (SEQ ID NO: 238), AAGguauaau (SEQ ID NO: 239), AAGguauaca (SEQ ID NO: 240), AAGguauacu (SEQ ID NO: 241), AAGguauaua (SEQ ID NO: 242), AAGguauauc (SEQ ID NO: 243), AAGguauaug (SEQ ID NO: 244), AAGguauauu (SEQ ID NO: 245), AAGguaucac (SEQ ID NO: 246), AAGguaucag (SEQ ID NO: 247), AAGguauccc (SEQ ID NO: 248), AAGguauccu (SEQ ID NO: 249), AAGguaucuc (SEQ ID NO: 250), AAGguaucug (SEQ ID NO: 251), AAGguaucuu (SEQ ID NO: 252), AAGguaugaa (SEQ ID NO: 253), AAGguaugac (SEQ ID NO: 254), AAGguaugag (SEQ ID NO: 255), AAGguaugau (SEQ ID NO: 256), AAGguaugca (SEQ ID NO: 257), AAGguaugcc (SEQ ID NO: 258), AAGguaugcu (SEQ ID NO: 259), AAGguaugga (SEQ ID NO: 260), AAGguauggc (SEQ ID NO: 261), AAGguauggg (SEQ ID NO: 262), AAGguaugua (SEQ ID NO: 263), AAGguauguc (SEQ ID NO: 264), AAGguaugug (SEQ ID NO: 265), AAGguauguu (SEQ ID NO: 266), AAGguauuaa (SEQ ID NO: 267), AAGguauuac (SEQ ID NO: 268), AAGguauuag (SEQ ID NO: 269), AAGguauuau (SEQ ID NO: 270), AAGguauucc (SEQ ID NO: 271), AAGguauuga (SEQ ID NO: 272), AAGguauugu (SEQ ID NO: 273), AAGguauuua (SEQ ID NO: 274), AAGguauuuc (SEQ ID NO: 275), AAGguauuug (SEQ ID NO: 276), AAGguauuuu (SEQ ID NO: 277), AAGgucaaau (SEQ ID NO: 278), AAGgucaaga (SEQ ID NO: 279), AAGgucaagu (SEQ ID NO: 280), AAGgucacag (SEQ ID NO: 281), AAGgucagaa (SEQ ID NO: 282), AAGgucagac (SEQ ID NO: 283), AAGgucagag (SEQ ID NO: 284), AAGgucagca (SEQ ID NO: 285), AAGgucagcc (SEQ ID NO: 286), AAGgucagcg (SEQ ID NO: 287), AAGgucagcu (SEQ ID NO: 288), AAGgucagga (SEQ ID NO: 289), AAGgucaggc (SEQ ID NO: 290), AAGgucaggg (SEQ ID NO: 291), AAGgucaggu (SEQ ID NO: 292), AAGgucagua (SEQ ID NO: 293), AAGgucaguc (SEQ ID NO: 294), AAGgucagug (SEQ ID NO: 295), AAGgucaguu (SEQ ID NO: 296), AAGgucauag (SEQ ID NO: 297), AAGgucaucu (SEQ ID NO: 298), AAGguccaca (SEQ ID NO: 299), AAGguccaga (SEQ ID NO: 300), AAGguccaua (SEQ ID NO: 301), AAGgucccag (SEQ ID NO: 302), AAGgucccuc (SEQ ID NO: 303), AAGguccuuc (SEQ ID NO: 304), AAGgucgagg (SEQ ID NO: 305), AAGgucuaau (SEQ ID NO: 306), AAGgucuacc (SEQ ID NO: 307), AAGgucuaua (SEQ ID NO: 308), AAGgucuccu (SEQ ID NO: 309), AAGgucucug (SEQ ID NO: 310), AAGgucucuu (SEQ ID NO: 311), AAGgucugaa (SEQ ID NO: 312), AAGgucugag (SEQ ID NO: 313), AAGgucugga (SEQ ID NO: 314), AAGgucuggg (SEQ ID NO: 315), AAGgucugua (SEQ ID NO: 316), AAGgucuguu (SEQ ID NO: 317), AAGgucuucu (SEQ ID NO: 318), AAGgucuuuu (SEQ ID NO: 319), AAGgugaaac (SEQ ID NO: 320), AAGgugaaag (SEQ ID NO: 321), AAGgugaaau (SEQ ID NO: 322), AAGgugaacu (SEQ ID NO: 323), AAGgugaagc (SEQ ID NO: 324), AAGgugaagg (SEQ ID NO: 325), AAGgugaagu (SEQ ID NO: 326), AAGgugaaua (SEQ ID NO: 327), AAGgugaaug (SEQ ID NO: 328), AAGgugaauu (SEQ ID NO: 329), AAGgugacaa (SEQ ID NO: 330), AAGgugacag (SEQ ID NO: 331), AAGgugacau (SEQ ID NO: 332), AAGgugacug (SEQ ID NO: 333), AAGgugacuu (SEQ ID NO: 334), AAGgugagaa (SEQ ID NO: 335), AAGgugagac (SEQ ID NO: 336), AAGgugagag (SEQ ID NO: 337), AAGgugagau (SEQ ID NO: 338), AAGgugagca (SEQ ID NO: 339), AAGgugagcc (SEQ ID NO: 340), AAGgugagcg (SEQ ID NO: 341), AAGgugagcu (SEQ ID NO: 342), AAGgugagga (SEQ ID NO: 343), AAGgugaggc (SEQ ID NO: 344), AAGgugaggg (SEQ ID NO: 345), AAGgugaggu (SEQ ID NO: 346), AAGgugagua (SEQ ID NO: 347), AAGgugaguc (SEQ ID NO: 348), AAGgugagug (SEQ ID NO: 349), AAGgugaguu (SEQ ID NO: 350), AAGgugauaa (SEQ ID NO: 351), AAGgugauca (SEQ ID NO: 352), AAGgugaucc (SEQ ID NO: 353), AAGgugauga (SEQ ID NO: 354), AAGgugaugc (SEQ ID NO: 355), AAGgugaugu (SEQ ID NO: 356), AAGgugauua (SEQ ID NO: 357), AAGgugauug (SEQ ID NO: 358), AAGgugauuu (SEQ ID NO: 359), AAGgugcaca (SEQ ID NO: 360), AAGgugcauc (SEQ ID NO: 361), AAGgugcccu (SEQ ID NO: 362), AAGgugccug (SEQ ID NO: 363), AAGgugcgug (SEQ ID NO: 364), AAGgugcguu (SEQ ID NO: 365), AAGgugcucc (SEQ ID NO: 366), AAGgugcuga (SEQ ID NO: 367), AAGgugcugc (SEQ ID NO: 368), AAGgugcugg (SEQ ID NO: 369), AAGgugcuua (SEQ ID NO: 370), AAGgugcuuu (SEQ ID NO: 371), AAGguggaua (SEQ ID NO: 372), AAGguggcua (SEQ ID NO: 373), AAGguggcug (SEQ ID NO: 374), AAGguggcuu (SEQ ID NO: 375), AAGgugggaa (SEQ ID NO: 376), AAGgugggag (SEQ ID NO: 377), AAGgugggau (SEQ ID NO: 378), AAGgugggca (SEQ ID NO: 379), AAGgugggcc (SEQ ID NO: 380), AAGgugggcg (SEQ ID NO: 381), AAGgugggga (SEQ ID NO: 382), AAGguggggu (SEQ ID NO: 383), AAGgugggua (SEQ ID NO: 384), AAGgugggug (SEQ ID NO: 385), AAGguggguu (SEQ ID NO: 386), AAGgugguaa (SEQ ID NO: 387), AAGgugguac (SEQ ID NO: 388), AAGgugguau (SEQ ID NO: 389), AAGguggugg (SEQ ID NO: 390), AAGgugguua (SEQ ID NO: 391), AAGgugguuc (SEQ ID NO: 392), AAGgugguuu (SEQ ID NO: 393), AAGguguaag (SEQ ID NO: 394), AAGgugucaa (SEQ ID NO: 395), AAGgugucag (SEQ ID NO: 396), AAGgugucug (SEQ ID NO: 397), AAGgugugaa (SEQ ID NO: 398), AAGgugugag (SEQ ID NO: 399), AAGgugugca (SEQ ID NO: 400), AAGgugugga (SEQ ID NO: 401), AAGguguggu (SEQ ID NO: 402), AAGgugugua (SEQ ID NO: 403), AAGguguguc (SEQ ID NO: 404), AAGgugugug (SEQ ID NO: 405), AAGguguguu (SEQ ID NO: 406), AAGguguucu (SEQ ID NO: 407), AAGguguugc (SEQ ID NO: 408), AAGguguugg (SEQ ID NO: 409), AAGguguuug (SEQ ID NO: 410), AAGguuaaaa (SEQ ID NO: 411), AAGguuaaca (SEQ ID NO: 412), AAGguuaagc (SEQ ID NO: 413), AAGguuaauu (SEQ ID NO: 414), AAGguuacau (SEQ ID NO: 415), AAGguuagaa (SEQ ID NO: 416), AAGguuagau (SEQ ID NO: 417), AAGguuagca (SEQ ID NO: 418), AAGguuagcc (SEQ ID NO: 419), AAGguuagga (SEQ ID NO: 420), AAGguuaggc (SEQ ID NO: 421), AAGguuagua (SEQ ID NO: 422), AAGguuaguc (SEQ ID NO: 423), AAGguuagug (SEQ ID NO: 424), AAGguuaguu (SEQ ID NO: 425), AAGguuauag (SEQ ID NO: 426), AAGguuauga (SEQ ID NO: 427), AAGguucaaa (SEQ ID NO: 428), AAGguucaag (SEQ ID NO: 429), AAGguuccuu (SEQ ID NO: 430), AAGguucggc (SEQ ID NO: 431), AAGguucguu (SEQ ID NO: 432), AAGguucuaa (SEQ ID NO: 433), AAGguucuga (SEQ ID NO: 434), AAGguucuua (SEQ ID NO: 435), AAGguugaau (SEQ ID NO: 436), AAGguugacu (SEQ ID NO: 437), AAGguugagg (SEQ ID NO: 438), AAGguugagu (SEQ ID NO: 439), AAGguugaua (SEQ ID NO: 440), AAGguugcac (SEQ ID NO: 441), AAGguugcug (SEQ ID NO: 442), AAGguuggaa (SEQ ID NO: 443), AAGguuggca (SEQ ID NO: 444), AAGguuggga (SEQ ID NO: 445), AAGguugggg (SEQ ID NO: 446), AAGguuggua (SEQ ID NO: 447), AAGguugguc (SEQ ID NO: 448), AAGguuggug (SEQ ID NO: 449), AAGguugguu (SEQ ID NO: 450), AAGguuguaa (SEQ ID NO: 451), AAGguugucc (SEQ ID NO: 452), AAGguugugc (SEQ ID NO: 453), AAGguuguua (SEQ ID NO: 454), AAGguuuacc (SEQ ID NO: 455), AAGguuuaua (SEQ ID NO: 456), AAGguuuauu (SEQ ID NO: 457), AAGguuuccu (SEQ ID NO: 458), AAGguuucgu (SEQ ID NO: 459), AAGguuugag (SEQ ID NO: 460), AAGguuugca (SEQ ID NO: 461), AAGguuugcc (SEQ ID NO: 462), AAGguuugcu (SEQ ID NO: 463), AAGguuugga (SEQ ID NO: 464), AAGguuuggu (SEQ ID NO: 465), AAGguuugua (SEQ ID NO: 466), AAGguuuguc (SEQ ID NO: 467), AAGguuugug (SEQ ID NO: 468), AAGguuuuaa (SEQ ID NO: 469), AAGguuuuca (SEQ ID NO: 470), AAGguuuucg (SEQ ID NO: 471), AAGguuuugc (SEQ ID NO: 472), AAGguuuugu (SEQ ID NO: 473), AAGguuuuuu (SEQ ID NO: 474), AAUgcaagua (SEQ ID NO: 475), AAUgcaaguc (SEQ ID NO: 476), AAUguaaaca (SEQ ID NO: 477), AAUguaaaua (SEQ ID NO: 478), AAUguaaauc (SEQ ID NO: 479), AAUguaaaug (SEQ ID NO: 480), AAUguaaauu (SEQ ID NO: 481), AAUguaacua (SEQ ID NO: 482), AAUguaagaa (SEQ ID NO: 483), AAUguaagag (SEQ ID NO: 484), AAUguaagau (SEQ ID NO: 485), AAUguaagcc (SEQ ID NO: 486), AAUguaagcu (SEQ ID NO: 487), AAUguaagga (SEQ ID NO: 488), AAUguaagua (SEQ ID NO: 489), AAUguaaguc (SEQ ID NO: 490), AAUguaagug (SEQ ID NO: 491), AAUguaaguu (SEQ ID NO: 492), AAUguaauca (SEQ ID NO: 493), AAUguaauga (SEQ ID NO: 494), AAUguaaugu (SEQ ID NO: 495), AAUguacauc (SEQ ID NO: 496), AAUguacaug (SEQ ID NO: 497), AAUguacgau (SEQ ID NO: 498), AAUguacgua (SEQ ID NO: 499), AAUguacguc (SEQ ID NO: 500), AAUguacgug (SEQ ID NO: 501), AAUguacucu (SEQ ID NO: 502), AAUguaggca (SEQ ID NO: 503), AAUguagguu (SEQ ID NO: 504), AAUguaucua (SEQ ID NO: 505), AAUguaugaa (SEQ ID NO: 506), AAUguaugua (SEQ ID NO: 507), AAUguaugug (SEQ ID NO: 508), AAUguauguu (SEQ ID NO: 509), AAUgucagag (SEQ ID NO: 510), AAUgucagau (SEQ ID NO: 511), AAUgucagcu (SEQ ID NO: 512), AAUgucagua (SEQ ID NO: 513), AAUgucaguc (SEQ ID NO: 514), AAUgucagug (SEQ ID NO: 515), AAUgucaguu (SEQ ID NO: 516), AAUgucggua (SEQ ID NO: 517), AAUgucuguu (SEQ ID NO: 518), AAUgugagaa (SEQ ID NO: 519), AAUgugagca (SEQ ID NO: 520), AAUgugagcc (SEQ ID NO: 521), AAUgugagga (SEQ ID NO: 522), AAUgugagua (SEQ ID NO: 523), AAUgugaguc (SEQ ID NO: 524), AAUgugagug (SEQ ID NO: 525), AAUgugaguu (SEQ ID NO: 526), AAUgugauau (SEQ ID NO: 527), AAUgugcaua (SEQ ID NO: 528), AAUgugcgua (SEQ ID NO: 529), AAUgugcguc (SEQ ID NO: 530), AAUgugggac (SEQ ID NO: 531), AAUguggguc (SEQ ID NO: 532), AAUgugggug (SEQ ID NO: 533), AAUgugguuu (SEQ ID NO: 534), AAUgugugua (SEQ ID NO: 535), AAUguuaagu (SEQ ID NO: 536), AAUguuagaa (SEQ ID NO: 537), AAUguuagau (SEQ ID NO: 538), AAUguuagua (SEQ ID NO: 539), AAUguuggug (SEQ ID NO: 540), ACAgcaagua (SEQ ID NO: 541), ACAguaaaua (SEQ ID NO: 542), ACAguaaaug (SEQ ID NO: 543), ACAguaagaa (SEQ ID NO: 544), ACAguaagca (SEQ ID NO: 545), ACAguaagua (SEQ ID NO: 546), ACAguaaguc (SEQ ID NO: 547), ACAguaagug (SEQ ID NO: 548), ACAguaaguu (SEQ ID NO: 549), ACAguacgua (SEQ ID NO: 550), ACAguaggug (SEQ ID NO: 551), ACAguauaac (SEQ ID NO: 552), ACAguaugua (SEQ ID NO: 553), ACAgucaguu (SEQ ID NO: 554), ACAgugagaa (SEQ ID NO: 555), ACAgugagcc (SEQ ID NO: 556), ACAgugagcu (SEQ ID NO: 557), ACAgugagga (SEQ ID NO: 558), ACAgugaggu (SEQ ID NO: 559), ACAgugagua (SEQ ID NO: 560), ACAgugaguc (SEQ ID NO: 561), ACAgugagug (SEQ ID NO: 562), ACAgugaguu (SEQ ID NO: 563), ACAgugggua (SEQ ID NO: 564), ACAguggguu (SEQ ID NO: 565), ACAguguaaa (SEQ ID NO: 566), ACAguuaagc (SEQ ID NO: 567), ACAguuaagu (SEQ ID NO: 568), ACAguuaugu (SEQ ID NO: 569), ACAguugagu (SEQ ID NO: 570), ACAguuguga (SEQ ID NO: 571), ACCguaagua (SEQ ID NO: 572), ACCgugagaa (SEQ ID NO: 573), ACCgugagca (SEQ ID NO: 574), ACCgugaguu (SEQ ID NO: 575), ACCgugggug (SEQ ID NO: 576), ACGguaaaac (SEQ ID NO: 577), ACGguaacua (SEQ ID NO: 578), ACGguaagua (SEQ ID NO: 579), ACGguaagug (SEQ ID NO: 580), ACGguaaguu (SEQ ID NO: 581), ACGguaauua (SEQ ID NO: 582), ACGguaauuu (SEQ ID NO: 583), ACGguacaau (SEQ ID NO: 584), ACGguacagu (SEQ ID NO: 585), ACGguaccag (SEQ ID NO: 586), ACGguacggu (SEQ ID NO: 587), ACGguacgua (SEQ ID NO: 588), ACGguaggaa (SEQ ID NO: 589), ACGguaggag (SEQ ID NO: 590), ACGguaggug (SEQ ID NO: 591), ACGguaguaa (SEQ ID NO: 592), ACGguauaau (SEQ ID NO: 593), ACGguaugac (SEQ ID NO: 594), ACGguaugcg (SEQ ID NO: 595), ACGguaugua (SEQ ID NO: 596), ACGguauguc (SEQ ID NO: 597), ACGgugaaac (SEQ ID NO: 598), ACGgugaagu (SEQ ID NO: 599), ACGgugaauc (SEQ ID NO: 600), ACGgugacag (SEQ ID NO: 601), ACGgugacca (SEQ ID NO: 602), ACGgugagaa (SEQ ID NO: 603), ACGgugagau (SEQ ID NO: 604), ACGgugagcc (SEQ ID NO: 605), ACGgugagua (SEQ ID NO: 606), ACGgugagug (SEQ ID NO: 607), ACGgugaguu (SEQ ID NO: 608), ACGgugcgug (SEQ ID NO: 609), ACGguggcac (SEQ ID NO: 610), ACGguggggc (SEQ ID NO: 611), ACGgugggug (SEQ ID NO: 612), ACGguguagu (SEQ ID NO: 613), ACGgugucac (SEQ ID NO: 614), ACGgugugua (SEQ ID NO: 615), ACGguguguu (SEQ ID NO: 616), ACGguuagug (SEQ ID NO: 617), ACGguuaguu (SEQ ID NO: 618), ACGguucaau (SEQ ID NO: 619), ACUguaaaua (SEQ ID NO: 620), ACUguaagaa (SEQ ID NO: 621), ACUguaagac (SEQ ID NO: 622), ACUguaagca (SEQ ID NO: 623), ACUguaagcu (SEQ ID NO: 624), ACUguaagua (SEQ ID NO: 625), ACUguaaguc (SEQ ID NO: 626), ACUguaaguu (SEQ ID NO: 627), ACUguacguu (SEQ ID NO: 628), ACUguacugc (SEQ ID NO: 629), ACUguaggcu (SEQ ID NO: 630), ACUguaggua (SEQ ID NO: 631), ACUguauauu (SEQ ID NO: 632), ACUguaugaa (SEQ ID NO: 633), ACUguaugcu (SEQ ID NO: 634), ACUguaugug (SEQ ID NO: 635), ACUguauucc (SEQ ID NO: 636), ACUgucagcu (SEQ ID NO: 637), ACUgucagug (SEQ ID NO: 638), ACUgugaacg (SEQ ID NO: 639), ACUgugagca (SEQ ID NO: 640), ACUgugagcg (SEQ ID NO: 641), ACUgugagcu (SEQ ID NO: 642), ACUgugagua (SEQ ID NO: 643), ACUgugaguc (SEQ ID NO: 644), ACUgugagug (SEQ ID NO: 645), ACUgugaguu (SEQ ID NO: 646), ACUgugggua (SEQ ID NO: 647), ACUgugugug (SEQ ID NO: 648), ACUguuaagu (SEQ ID NO: 649), AGAgcaagua (SEQ ID NO: 650), AGAguaaaac (SEQ ID NO: 651), AGAguaaacg (SEQ ID NO: 652), AGAguaaaga (SEQ ID NO: 653), AGAguaaagu (SEQ ID NO: 654), AGAguaaauc (SEQ ID NO: 655), AGAguaaaug (SEQ ID NO: 656), AGAguaacau (SEQ ID NO: 657), AGAguaacua (SEQ ID NO: 658), AGAguaagaa (SEQ ID NO: 659), AGAguaagac (SEQ ID NO: 660), AGAguaagag (SEQ ID NO: 661), AGAguaagau (SEQ ID NO: 662), AGAguaagca (SEQ ID NO: 663), AGAguaagcu (SEQ ID NO: 664), AGAguaagga (SEQ ID NO: 665), AGAguaaggc (SEQ ID NO: 666), AGAguaaggg (SEQ ID NO: 667), AGAguaaggu (SEQ ID NO: 668), AGAguaaguc (SEQ ID NO: 669), AGAguaagug (SEQ ID NO: 670), AGAguaaguu (SEQ ID NO: 671), AGAguaauaa (SEQ ID NO: 672), AGAguaaugu (SEQ ID NO: 673), AGAguaauuc (SEQ ID NO: 674), AGAguaauuu (SEQ ID NO: 675), AGAguacacc (SEQ ID NO: 676), AGAguaccug (SEQ ID NO: 677), AGAguacgug (SEQ ID NO: 678), AGAguacucu (SEQ ID NO: 679), AGAguacuga (SEQ ID NO: 680), AGAguacuuu (SEQ ID NO: 681), AGAguagcug (SEQ ID NO: 682), AGAguaggaa (SEQ ID NO: 683), AGAguaggga (SEQ ID NO: 684), AGAguagggu (SEQ ID NO: 685), AGAguagguc (SEQ ID NO: 686), AGAguaggug (SEQ ID NO: 687), AGAguagguu (SEQ ID NO: 688), AGAguauaua (SEQ ID NO: 689), AGAguauauu (SEQ ID NO: 690), AGAguaugaa (SEQ ID NO: 691), AGAguaugac (SEQ ID NO: 692), AGAguaugau (SEQ ID NO: 693), AGAguauguc (SEQ ID NO: 694), AGAguaugug (SEQ ID NO: 695), AGAguauguu (SEQ ID NO: 696), AGAguauuaa (SEQ ID NO: 697), AGAguauuau (SEQ ID NO: 698), AGAgucagug (SEQ ID NO: 699), AGAgugagac (SEQ ID NO: 700), AGAgugagag (SEQ ID NO: 701), AGAgugagau (SEQ ID NO: 702), AGAgugagca (SEQ ID NO: 703), AGAgugagua (SEQ ID NO: 704), AGAgugaguc (SEQ ID NO: 705), AGAgugagug (SEQ ID NO: 706), AGAgugaguu (SEQ ID NO: 707), AGAgugcguc (SEQ ID NO: 708), AGAgugggga (SEQ ID NO: 709), AGAgugggug (SEQ ID NO: 710), AGAgugugug (SEQ ID NO: 711), AGAguguuuc (SEQ ID NO: 712), AGAguuagua (SEQ ID NO: 713), AGAguugaga (SEQ ID NO: 714), AGAguugagu (SEQ ID NO: 715), AGAguugguu (SEQ ID NO: 716), AGAguuugau (SEQ ID NO: 717), AGCguaagcu (SEQ ID NO: 718), AGCguaagug (SEQ ID NO: 719), AGCgugagcc (SEQ ID NO: 720), AGCgugagug (SEQ ID NO: 721), AGCguuguuc (SEQ ID NO: 722), AGGgcagagu (SEQ ID NO: 723), AGGgcagccu (SEQ ID NO: 724), AGGgcuagua (SEQ ID NO: 725), AGGguaaaga (SEQ ID NO: 726), AGGguaaaua (SEQ ID NO: 727), AGGguaaauc (SEQ ID NO: 728), AGGguaaauu (SEQ ID NO: 729), AGGguaacca (SEQ ID NO: 730), AGGguaacug (SEQ ID NO: 731), AGGguaacuu (SEQ ID NO: 732), AGGguaagaa (SEQ ID NO: 733), AGGguaagag (SEQ ID NO: 734), AGGguaagau (SEQ ID NO: 735), AGGguaagca (SEQ ID NO: 736), AGGguaagga (SEQ ID NO: 737), AGGguaaggc (SEQ ID NO: 738), AGGguaaggg (SEQ ID NO: 739), AGGguaagua (SEQ ID NO: 740), AGGguaaguc (SEQ ID NO: 741), AGGguaagug (SEQ ID NO: 742), AGGguaaguu (SEQ ID NO: 743), AGGguaauac (SEQ ID NO: 744), AGGguaauga (SEQ ID NO: 745), AGGguaauua (SEQ ID NO: 746), AGGguaauuu (SEQ ID NO: 747), AGGguacacc (SEQ ID NO: 748), AGGguacagu (SEQ ID NO: 749), AGGguacggu (SEQ ID NO: 750), AGGguaggac (SEQ ID NO: 751), AGGguaggag (SEQ ID NO: 752), AGGguaggca (SEQ ID NO: 753), AGGguaggcc (SEQ ID NO: 754), AGGguaggga (SEQ ID NO: 755), AGGguagggu (SEQ ID NO: 756), AGGguagguc (SEQ ID NO: 757), AGGguaggug (SEQ ID NO: 758), AGGguagguu (SEQ ID NO: 759), AGGguauaua (SEQ ID NO: 760), AGGguaugac (SEQ ID NO: 761), AGGguaugag (SEQ ID NO: 762), AGGguaugau (SEQ ID NO: 763), AGGguaugca (SEQ ID NO: 764), AGGguaugcu (SEQ ID NO: 765), AGGguauggg (SEQ ID NO: 766), AGGguauggu (SEQ ID NO: 767), AGGguaugua (SEQ ID NO: 768), AGGguauguc (SEQ ID NO: 769), AGGguaugug (SEQ ID NO: 770), AGGguauuac (SEQ ID NO: 771), AGGguauucu (SEQ ID NO: 772), AGGguauuuc (SEQ ID NO: 773), AGGgucagag (SEQ ID NO: 774), AGGgucagca (SEQ ID NO: 775), AGGgucagga (SEQ ID NO: 776), AGGgucaggg (SEQ ID NO: 777), AGGgucagug (SEQ ID NO: 778), AGGgucaguu (SEQ ID NO: 779), AGGguccccu (SEQ ID NO: 780), AGGgucggga (SEQ ID NO: 781), AGGgucugca (SEQ ID NO: 782), AGGgucuguu (SEQ ID NO: 783), AGGgugaaga (SEQ ID NO: 784), AGGgugacua (SEQ ID NO: 785), AGGgugagaa (SEQ ID NO: 786), AGGgugagac (SEQ ID NO: 787), AGGgugagag (SEQ ID NO: 788), AGGgugagca (SEQ ID NO: 789), AGGgugagcc (SEQ ID NO: 790), AGGgugagcu (SEQ ID NO: 791), AGGgugagga (SEQ ID NO: 792), AGGgugaggg (SEQ ID NO: 793), AGGgugaggu (SEQ ID NO: 794), AGGgugagua (SEQ ID NO: 795), AGGgugaguc (SEQ ID NO: 796), AGGgugagug (SEQ ID NO: 797), AGGgugaguu (SEQ ID NO: 798), AGGgugggga (SEQ ID NO: 799), AGGguggggu (SEQ ID NO: 800), AGGgugggua (SEQ ID NO: 801), AGGgugggug (SEQ ID NO: 802), AGGgugugua (SEQ ID NO: 803), AGGgugugug (SEQ ID NO: 804), AGGguuaaug (SEQ ID NO: 805), AGGguuagaa (SEQ ID NO: 806), AGGguuaguu (SEQ ID NO: 807), AGGguuggug (SEQ ID NO: 808), AGGguuugug (SEQ ID NO: 809), AGGguuuguu (SEQ ID NO: 810), AGUguaaaag (SEQ ID NO: 811), AGUguaaaua (SEQ ID NO: 812), AGUguaaauu (SEQ ID NO: 813), AGUguaagaa (SEQ ID NO: 814), AGUguaagag (SEQ ID NO: 815), AGUguaagau (SEQ ID NO: 816), AGUguaagca (SEQ ID NO: 817), AGUguaagcc (SEQ ID NO: 818), AGUguaagua (SEQ ID NO: 819), AGUguaagug (SEQ ID NO: 820), AGUguaaguu (SEQ ID NO: 821), AGUguaauug (SEQ ID NO: 822), AGUguaggac (SEQ ID NO: 823), AGUguagguc (SEQ ID NO: 824), AGUguaugag (SEQ ID NO: 825), AGUguaugua (SEQ ID NO: 826), AGUguauguu (SEQ ID NO: 827), AGUguauugu (SEQ ID NO: 828), AGUguauuua (SEQ ID NO: 829), AGUgucaguc (SEQ ID NO: 830), AGUgugagag (SEQ ID NO: 831), AGUgugagca (SEQ ID NO: 832), AGUgugagcc (SEQ ID NO: 833), AGUgugagcu (SEQ ID NO: 834), AGUgugagua (SEQ ID NO: 835), AGUgugaguc (SEQ ID NO: 836), AGUgugagug (SEQ ID NO: 837), AGUgugaguu (SEQ ID NO: 838), AGUgugggua (SEQ ID NO: 839), AGUgugggug (SEQ ID NO: 840), AGUgugugua (SEQ ID NO: 841), AGUguuccua (SEQ ID NO: 842), AGUguugggg (SEQ ID NO: 843), AGUguuucag (SEQ ID NO: 844), AUAguaaaua (SEQ ID NO: 845), AUAguaagac (SEQ ID NO: 846), AUAguaagau (SEQ ID NO: 847), AUAguaagca (SEQ ID NO: 848), AUAguaagua (SEQ ID NO: 849), AUAguaagug (SEQ ID NO: 850), AUAguaaguu (SEQ ID NO: 851), AUAguaggua (SEQ ID NO: 852), AUAguauguu (SEQ ID NO: 853), AUAgucucac (SEQ ID NO: 854), AUAgugagac (SEQ ID NO: 855), AUAgugagag (SEQ ID NO: 856), AUAgugagau (SEQ ID NO: 857), AUAgugagcc (SEQ ID NO: 858), AUAgugaggc (SEQ ID NO: 859), AUAgugagua (SEQ ID NO: 860), AUAgugaguc (SEQ ID NO: 861), AUAgugagug (SEQ ID NO: 862), AUAgugcguc (SEQ ID NO: 863), AUAgugugua (SEQ ID NO: 864), AUAguucagu (SEQ ID NO: 865), AUCguaagcc (SEQ ID NO: 866), AUCguaaguu (SEQ ID NO: 867), AUCguauucc (SEQ ID NO: 868), AUCgugagua (SEQ ID NO: 869), AUGgcaagcg (SEQ ID NO: 870), AUGgcaagga (SEQ ID NO: 871), AUGgcaaguu (SEQ ID NO: 872), AUGgcaggua (SEQ ID NO: 873), AUGgcaugug (SEQ ID NO: 874), AUGgcgccau (SEQ ID NO: 875), AUGgcuugug (SEQ ID NO: 876), AUGguaaaac (SEQ ID NO: 877), AUGguaaaau (SEQ ID NO: 878), AUGguaaacc (SEQ ID NO: 879), AUGguaaaga (SEQ ID NO: 880), AUGguaaaua (SEQ ID NO: 881), AUGguaaaug (SEQ ID NO: 882), AUGguaaauu (SEQ ID NO: 883), AUGguaacag (SEQ ID NO: 884), AUGguaacau (SEQ ID NO: 885), AUGguaacua (SEQ ID NO: 886), AUGguaacuc (SEQ ID NO: 887), AUGguaacuu (SEQ ID NO: 888), AUGguaagaa (SEQ ID NO: 889), AUGguaagac (SEQ ID NO: 890), AUGguaagag (SEQ ID NO: 891), AUGguaagau (SEQ ID NO: 892), AUGguaagca (SEQ ID NO: 893), AUGguaagcc (SEQ ID NO: 894), AUGguaagcu (SEQ ID NO: 895), AUGguaagga (SEQ ID NO: 896), AUGguaaggg (SEQ ID NO: 897), AUGguaagua (SEQ ID NO: 898), AUGguaaguc (SEQ ID NO: 899), AUGguaagug (SEQ ID NO: 900), AUGguaaguu (SEQ ID NO: 901), AUGguaauaa (SEQ ID NO: 902), AUGguaauau (SEQ ID NO: 903), AUGguaauga (SEQ ID NO: 904), AUGguaaugg (SEQ ID NO: 905), AUGguaauug (SEQ ID NO: 906), AUGguaauuu (SEQ ID NO: 907), AUGguacagc (SEQ ID NO: 908), AUGguacauc (SEQ ID NO: 909), AUGguaccag (SEQ ID NO: 910), AUGguaccug (SEQ ID NO: 911), AUGguacgag (SEQ ID NO: 912), AUGguacggu (SEQ ID NO: 913), AUGguagauc (SEQ ID NO: 914), AUGguagcag (SEQ ID NO: 915), AUGguagcug (SEQ ID NO: 916), AUGguaggaa (SEQ ID NO: 917), AUGguaggau (SEQ ID NO: 918), AUGguaggca (SEQ ID NO: 919), AUGguaggcu (SEQ ID NO: 920), AUGguagggg (SEQ ID NO: 921), AUGguagggu (SEQ ID NO: 922), AUGguaggua (SEQ ID NO: 923), AUGguaggug (SEQ ID NO: 924), AUGguaguuu (SEQ ID NO: 925), AUGguauagu (SEQ ID NO: 926), AUGguauaua (SEQ ID NO: 927), AUGguaucag (SEQ ID NO: 928), AUGguaucuu (SEQ ID NO: 929), AUGguaugau (SEQ ID NO: 930), AUGguaugca (SEQ ID NO: 931), AUGguaugcc (SEQ ID NO: 932), AUGguaugcg (SEQ ID NO: 933), AUGguaugcu (SEQ ID NO: 934), AUGguaugga (SEQ ID NO: 935), AUGguauggc (SEQ ID NO: 936), AUGguaugug (SEQ ID NO: 937), AUGguauguu (SEQ ID NO: 938), AUGguauuau (SEQ ID NO: 939), AUGguauuga (SEQ ID NO: 940), AUGguauuug (SEQ ID NO: 941), AUGgucaggg (SEQ ID NO: 942), AUGgucaguc (SEQ ID NO: 943), AUGgucagug (SEQ ID NO: 944), AUGgucauuu (SEQ ID NO: 945), AUGgugaaaa (SEQ ID NO: 946), AUGgugaaac (SEQ ID NO: 947), AUGgugaaau (SEQ ID NO: 948), AUGgugaacu (SEQ ID NO: 949), AUGgugaaga (SEQ ID NO: 950), AUGgugacgu (SEQ ID NO: 951), AUGgugagaa (SEQ ID NO: 952), AUGgugagac (SEQ ID NO: 953), AUGgugagag (SEQ ID NO: 954), AUGgugagca (SEQ ID NO: 955), AUGgugagcc (SEQ ID NO: 956), AUGgugagcg (SEQ ID NO: 957), AUGgugagcu (SEQ ID NO: 958), AUGgugaggc (SEQ ID NO: 959), AUGgugaggg (SEQ ID NO: 960), AUGgugagua (SEQ ID NO: 961), AUGgugaguc (SEQ ID NO: 962), AUGgugagug (SEQ ID NO: 963), AUGgugaguu (SEQ ID NO: 964), AUGgugauuu (SEQ ID NO: 965), AUGgugcgau (SEQ ID NO: 966), AUGgugcgug (SEQ ID NO: 967), AUGgugggua (SEQ ID NO: 968), AUGgugggug (SEQ ID NO: 969), AUGguggguu (SEQ ID NO: 970), AUGgugguua (SEQ ID NO: 971), AUGguguaag (SEQ ID NO: 972), AUGgugugaa (SEQ ID NO: 973), AUGgugugua (SEQ ID NO: 974), AUGgugugug (SEQ ID NO: 975), AUGguuacuc (SEQ ID NO: 976), AUGguuagca (SEQ ID NO: 977), AUGguuaguc (SEQ ID NO: 978), AUGguuagug (SEQ ID NO: 979), AUGguuaguu (SEQ ID NO: 980), AUGguucagu (SEQ ID NO: 981), AUGguucguc (SEQ ID NO: 982), AUGguuggua (SEQ ID NO: 983), AUGguugguc (SEQ ID NO: 984), AUGguugguu (SEQ ID NO: 985), AUGguuguuu (SEQ ID NO: 986), AUGguuugca (SEQ ID NO: 987), AUGguuugua (SEQ ID NO: 988), AUUgcaagua (SEQ ID NO: 989), AUUguaaaua (SEQ ID NO: 990), AUUguaagau (SEQ ID NO: 991), AUUguaagca (SEQ ID NO: 992), AUUguaagga (SEQ ID NO: 993), AUUguaaggc (SEQ ID NO: 994), AUUguaagua (SEQ ID NO: 995), AUUguaaguc (SEQ ID NO: 996), AUUguaaguu (SEQ ID NO: 997), AUUguaauua (SEQ ID NO: 998), AUUguaauuu (SEQ ID NO: 999), AUUguacaaa (SEQ ID NO: 1000), AUUguaccuc (SEQ ID NO: 1001), AUUguacgug (SEQ ID NO: 1002), AUUguacuug (SEQ ID NO: 1003), AUUguaggua (SEQ ID NO: 1004), AUUguaugag (SEQ ID NO: 1005), AUUguaugua (SEQ ID NO: 1006), AUUgucuguu (SEQ ID NO: 1007), AUUgugagcu (SEQ ID NO: 1008), AUUgugagua (SEQ ID NO: 1009), AUUgugaguc (SEQ ID NO: 1010), AUUgugaguu (SEQ ID NO: 1011), AUUgugcgug (SEQ ID NO: 1012), AUUgugggug (SEQ ID NO: 1013), AUUguuagug (SEQ ID NO: 1014), CAAguaaaaa (SEQ ID NO: 1015), CAAguaaaua (SEQ ID NO: 1016), CAAguaaauc (SEQ ID NO: 1017), CAAguaaaug (SEQ ID NO: 1018), CAAguaaccc (SEQ ID NO: 1019), CAAguaacua (SEQ ID NO: 1020), CAAguaacug (SEQ ID NO: 1021), CAAguaagaa (SEQ ID NO: 1022), CAAguaagac (SEQ ID NO: 1023), CAAguaagau (SEQ ID NO: 1024), CAAguaaggu (SEQ ID NO: 1025), CAAguaagua (SEQ ID NO: 1026), CAAguaaguc (SEQ ID NO: 1027), CAAguaagug (SEQ ID NO: 1028), CAAguaaguu (SEQ ID NO: 1029), CAAguaaucc (SEQ ID NO: 1030), CAAguaaucu (SEQ ID NO: 1031), CAAguaauua (SEQ ID NO: 1032), CAAguaauuc (SEQ ID NO: 1033), CAAguaauug (SEQ ID NO: 1034), CAAguaauuu (SEQ ID NO: 1035), CAAguacaca (SEQ ID NO: 1036), CAAguacguu (SEQ ID NO: 1037), CAAguacuuu (SEQ ID NO: 1038), CAAguagcug (SEQ ID NO: 1039), CAAguaggau (SEQ ID NO: 1040), CAAguaggua (SEQ ID NO: 1041), CAAguagguc (SEQ ID NO: 1042), CAAguaggug (SEQ ID NO: 1043), CAAguagguu (SEQ ID NO: 1044), CAAguaguuu (SEQ ID NO: 1045), CAAguauaac (SEQ ID NO: 1046), CAAguauaug (SEQ ID NO: 1047), CAAguaucuu (SEQ ID NO: 1048), CAAguaugag (SEQ ID NO: 1049), CAAguaugua (SEQ ID NO: 1050), CAAguauguc (SEQ ID NO: 1051), CAAguaugug (SEQ ID NO: 1052), CAAguauguu (SEQ ID NO: 1053), CAAguauuga (SEQ ID NO: 1054), CAAguauuuc (SEQ ID NO: 1055), CAAgucagac (SEQ ID NO: 1056), CAAgucagua (SEQ ID NO: 1057), CAAgucuaua (SEQ ID NO: 1058), CAAgucugau (SEQ ID NO: 1059), CAAgugacuu (SEQ ID NO: 1060), CAAgugagaa (SEQ ID NO: 1061), CAAgugagac (SEQ ID NO: 1062), CAAgugagca (SEQ ID NO: 1063), CAAgugaggc (SEQ ID NO: 1064), CAAgugaggg (SEQ ID NO: 1065), CAAgugagua (SEQ ID NO: 1066), CAAgugaguc (SEQ ID NO: 1067), CAAgugagug (SEQ ID NO: 1068), CAAgugaucc (SEQ ID NO: 1069), CAAgugaucu (SEQ ID NO: 1070), CAAgugauuc (SEQ ID NO: 1071), CAAgugauug (SEQ ID NO: 1072), CAAgugauuu (SEQ ID NO: 1073), CAAgugccuu (SEQ ID NO: 1074), CAAgugggua (SEQ ID NO: 1075), CAAguggguc (SEQ ID NO: 1076), CAAgugggug (SEQ ID NO: 1077), CAAgugugag (SEQ ID NO: 1078), CAAguuaaaa (SEQ ID NO: 1079), CAAguuaagu (SEQ ID NO: 1080), CAAguuaauc (SEQ ID NO: 1081), CAAguuagaa (SEQ ID NO: 1082), CAAguuaguu (SEQ ID NO: 1083), CAAguucaag (SEQ ID NO: 1084), CAAguuccgu (SEQ ID NO: 1085), CAAguuggua (SEQ ID NO: 1086), CAAguuuagu (SEQ ID NO: 1087), CAAguuucca (SEQ ID NO: 1088), CAAguuuguu (SEQ ID NO: 1089), CACguaagag (SEQ ID NO: 1090), CACguaagca (SEQ ID NO: 1091), CACguaauug (SEQ ID NO: 1092), CACguaggac (SEQ ID NO: 1093), CACguaucga (SEQ ID NO: 1094), CACgucaguu (SEQ ID NO: 1095), CACgugagcu (SEQ ID NO: 1096), CACgugaguc (SEQ ID NO: 1097), CACgugagug (SEQ ID NO: 1098), CAGgcaagaa (SEQ ID NO: 1099), CAGgcaagac (SEQ ID NO: 1100), CAGgcaagag (SEQ ID NO: 1101), CAGgcaagga (SEQ ID NO: 1102), CAGgcaagua (SEQ ID NO: 1103), CAGgcaagug (SEQ ID NO: 1104), CAGgcaaguu (SEQ ID NO: 1105), CAGgcacgca (SEQ ID NO: 1106), CAGgcagagg (SEQ ID NO: 1107), CAGgcaggug (SEQ ID NO: 1108), CAGgcaucau (SEQ ID NO: 1109), CAGgcaugaa (SEQ ID NO: 1110), CAGgcaugag (SEQ ID NO: 1111), CAGgcaugca (SEQ ID NO: 1112), CAGgcaugcg (SEQ ID NO: 1113), CAGgcaugug (SEQ ID NO: 1114), CAGgcgagag (SEQ ID NO: 1115), CAGgcgccug (SEQ ID NO: 1116), CAGgcgugug (SEQ ID NO: 1117), CAGguaaaaa (SEQ ID NO: 1118), CAGguaaaag (SEQ ID NO: 1119), CAGguaaaca (SEQ ID NO: 1120), CAGguaaacc (SEQ ID NO: 1121), CAGguaaaga (SEQ ID NO: 1122), CAGguaaagc (SEQ ID NO: 1123), CAGguaaagu (SEQ ID NO: 1124), CAGguaaaua (SEQ ID NO: 1125), CAGguaaauc (SEQ ID NO: 1126), CAGguaaaug (SEQ ID NO: 1127), CAGguaaauu (SEQ ID NO: 1128), CAGguaacag (SEQ ID NO: 1129), CAGguaacau (SEQ ID NO: 1130), CAGguaacca (SEQ ID NO: 1131), CAGguaaccg (SEQ ID NO: 1132), CAGguaacgu (SEQ ID NO: 1133), CAGguaacua (SEQ ID NO: 1134), CAGguaacuc (SEQ ID NO: 1135), CAGguaacug (SEQ ID NO: 1136), CAGguaacuu (SEQ ID NO: 1137), CAGguaagaa (SEQ ID NO: 1138), CAGguaagac (SEQ ID NO: 1139), CAGguaagag (SEQ ID NO: 1140), CAGguaagau (SEQ ID NO: 1141), CAGguaagcc (SEQ ID NO: 1142), CAGguaagga (SEQ ID NO: 1143), CAGguaaggc (SEQ ID NO: 1144), CAGguaaggg (SEQ ID NO: 1145), CAGguaaggu (SEQ ID NO: 1146), CAGguaagua (SEQ ID NO: 1147), CAGguaagug (SEQ ID NO: 1148), CAGguaaguu (SEQ ID NO: 1149), CAGguaauaa (SEQ ID NO: 1150), CAGguaauau (SEQ ID NO: 1151), CAGguaaucc (SEQ ID NO: 1152), CAGguaaugc (SEQ ID NO: 1153), CAGguaaugg (SEQ ID NO: 1154), CAGguaaugu (SEQ ID NO: 1155), CAGguaauua (SEQ ID NO: 1156), CAGguaauuc (SEQ ID NO: 1157), CAGguaauug (SEQ ID NO: 1158), CAGguaauuu (SEQ ID NO: 1159), CAGguacaaa (SEQ ID NO: 1160), CAGguacaag (SEQ ID NO: 1161), CAGguacaau (SEQ ID NO: 1162), CAGguacaca (SEQ ID NO: 1163), CAGguacacg (SEQ ID NO: 1164), CAGguacaga (SEQ ID NO: 1165), CAGguacagg (SEQ ID NO: 1166), CAGguacagu (SEQ ID NO: 1167), CAGguacaua (SEQ ID NO: 1168), CAGguacaug (SEQ ID NO: 1169), CAGguacauu (SEQ ID NO: 1170), CAGguaccac (SEQ ID NO: 1171), CAGguaccca (SEQ ID NO: 1172), CAGguacccg (SEQ ID NO: 1173), CAGguacccu (SEQ ID NO: 1174), CAGguaccgc (SEQ ID NO: 1175), CAGguaccgg (SEQ ID NO: 1176), CAGguaccuc (SEQ ID NO: 1177), CAGguaccug (SEQ ID NO: 1178), CAGguaccuu (SEQ ID NO: 1179), CAGguacgag (SEQ ID NO: 1180), CAGguacgca (SEQ ID NO: 1181), CAGguacgcc (SEQ ID NO: 1182), CAGguacggu (SEQ ID NO: 1183), CAGguacgua (SEQ ID NO: 1184), CAGguacgug (SEQ ID NO: 1185), CAGguacuaa (SEQ ID NO: 1186), CAGguacuag (SEQ ID NO: 1187), CAGguacuau (SEQ ID NO: 1188), CAGguacucc (SEQ ID NO: 1189), CAGguacucu (SEQ ID NO: 1190), CAGguacuga (SEQ ID NO: 1191), CAGguacugc (SEQ ID NO: 1192), CAGguacugu (SEQ ID NO: 1193), CAGguacuua (SEQ ID NO: 1194), CAGguacuuu (SEQ ID NO: 1195), CAGguagaaa (SEQ ID NO: 1196), CAGguagaac (SEQ ID NO: 1197), CAGguagaag (SEQ ID NO: 1198), CAGguagaca (SEQ ID NO: 1199), CAGguagacc (SEQ ID NO: 1200), CAGguagaga (SEQ ID NO: 1201), CAGguagauu (SEQ ID NO: 1202), CAGguagcaa (SEQ ID NO: 1203), CAGguagcac (SEQ ID NO: 1204), CAGguagcag (SEQ ID NO: 1205), CAGguagcca (SEQ ID NO: 1206), CAGguagcgu (SEQ ID NO: 1207), CAGguagcua (SEQ ID NO: 1208), CAGguagcuc (SEQ ID NO: 1209), CAGguagcug (SEQ ID NO: 1210), CAGguagcuu (SEQ ID NO: 1211), CAGguaggaa (SEQ ID NO: 1212), CAGguaggac (SEQ ID NO: 1213), CAGguaggag (SEQ ID NO: 1214), CAGguaggca (SEQ ID NO: 1215), CAGguaggga (SEQ ID NO: 1216), CAGguagggc (SEQ ID NO: 1217), CAGguagggg (SEQ ID NO: 1218), CAGguagggu (SEQ ID NO: 1219), CAGguaggua (SEQ ID NO: 1220), CAGguagguc (SEQ ID NO: 1221), CAGguaggug (SEQ ID NO: 1222), CAGguagguu (SEQ ID NO: 1223), CAGguaguaa (SEQ ID NO: 1224), CAGguaguau (SEQ ID NO: 1225), CAGguaguca (SEQ ID NO: 1226), CAGguagucc (SEQ ID NO: 1227), CAGguaguga (SEQ ID NO: 1228), CAGguagugu (SEQ ID NO: 1229), CAGguaguuc (SEQ ID NO: 1230), CAGguaguug (SEQ ID NO: 1231), CAGguaguuu (SEQ ID NO: 1232), CAGguauaag (SEQ ID NO: 1233), CAGguauaca (SEQ ID NO: 1234), CAGguauaga (SEQ ID NO: 1235), CAGguauauc (SEQ ID NO: 1236), CAGguauaug (SEQ ID NO: 1237), CAGguauauu (SEQ ID NO: 1238), CAGguaucag (SEQ ID NO: 1239), CAGguaucau (SEQ ID NO: 1240), CAGguauccu (SEQ ID NO: 1241), CAGguaucga (SEQ ID NO: 1242), CAGguaucgc (SEQ ID NO: 1243), CAGguaucua (SEQ ID NO: 1244), CAGguaucug (SEQ ID NO: 1245), CAGguaucuu (SEQ ID NO: 1246), CAGguaugaa (SEQ ID NO: 1247), CAGguaugac (SEQ ID NO: 1248), CAGguaugag (SEQ ID NO: 1249), CAGguaugau (SEQ ID NO: 1250), CAGguaugca (SEQ ID NO: 1251), CAGguaugcc (SEQ ID NO: 1252), CAGguaugcg (SEQ ID NO: 1253), CAGguaugcu (SEQ ID NO: 1254), CAGguaugga (SEQ ID NO: 1255), CAGguauggg (SEQ ID NO: 1256), CAGguauggu (SEQ ID NO: 1257), CAGguaugua (SEQ ID NO: 1258), CAGguauguc (SEQ ID NO: 1259), CAGguaugug (SEQ ID NO: 1260), CAGguauguu (SEQ ID NO: 1261), CAGguauuau (SEQ ID NO: 1262), CAGguauuca (SEQ ID NO: 1263), CAGguauucu (SEQ ID NO: 1264), CAGguauuga (SEQ ID NO: 1265), CAGguauugg (SEQ ID NO: 1266), CAGguauugu (SEQ ID NO: 1267), CAGguauuua (SEQ ID NO: 1268), CAGguauuuc (SEQ ID NO: 1269), CAGguauuug (SEQ ID NO: 1270), CAGguauuuu (SEQ ID NO: 1271), CAGgucaaca (SEQ ID NO: 1272), CAGgucaaug (SEQ ID NO: 1273), CAGgucacgu (SEQ ID NO: 1274), CAGgucagaa (SEQ ID NO: 1275), CAGgucagac (SEQ ID NO: 1276), CAGgucagca (SEQ ID NO: 1277), CAGgucagcc (SEQ ID NO: 1278), CAGgucagcg (SEQ ID NO: 1279), CAGgucagga (SEQ ID NO: 1280), CAGgucagua (SEQ ID NO: 1281), CAGgucaguc (SEQ ID NO: 1282), CAGgucagug (SEQ ID NO: 1283), CAGgucaguu (SEQ ID NO: 1284), CAGgucaucc (SEQ ID NO: 1285), CAGgucaugc (SEQ ID NO: 1286), CAGgucauua (SEQ ID NO: 1287), CAGgucauuu (SEQ ID NO: 1288), CAGguccacc (SEQ ID NO: 1289), CAGguccacu (SEQ ID NO: 1290), CAGguccagu (SEQ ID NO: 1291), CAGguccauc (SEQ ID NO: 1292), CAGguccauu (SEQ ID NO: 1293), CAGgucccag (SEQ ID NO: 1294), CAGgucccug (SEQ ID NO: 1295), CAGguccuga (SEQ ID NO: 1296), CAGguccugc (SEQ ID NO: 1297), CAGguccugg (SEQ ID NO: 1298), CAGgucggcc (SEQ ID NO: 1299), CAGgucggug (SEQ ID NO: 1300), CAGgucguug (SEQ ID NO: 1301), CAGgucucuc (SEQ ID NO: 1302), CAGgucucuu (SEQ ID NO: 1303), CAGgucugag (SEQ ID NO: 1304), CAGgucugcc (SEQ ID NO: 1305), CAGgucugcg (SEQ ID NO: 1306), CAGgucugga (SEQ ID NO: 1307), CAGgucuggu (SEQ ID NO: 1308), CAGgucugua (SEQ ID NO: 1309), CAGgucuguc (SEQ ID NO: 1310), CAGgucugug (SEQ ID NO: 1311), CAGgucuguu (SEQ ID NO: 1312), CAGgucuucc (SEQ ID NO: 1313), CAGgucuuuc (SEQ ID NO: 1314), CAGgugaaag (SEQ ID NO: 1315), CAGgugaaau (SEQ ID NO: 1316), CAGgugaaca (SEQ ID NO: 1317), CAGgugaaga (SEQ ID NO: 1318), CAGgugaagg (SEQ ID NO: 1319), CAGgugaaua (SEQ ID NO: 1320), CAGgugaauc (SEQ ID NO: 1321), CAGgugaauu (SEQ ID NO: 1322), CAGgugacaa (SEQ ID NO: 1323), CAGgugacau (SEQ ID NO: 1324), CAGgugacca (SEQ ID NO: 1325), CAGgugaccc (SEQ ID NO: 1326), CAGgugaccg (SEQ ID NO: 1327), CAGgugaccu (SEQ ID NO: 1328), CAGgugacgg (SEQ ID NO: 1329), CAGgugacua (SEQ ID NO: 1330), CAGgugacuc (SEQ ID NO: 1331), CAGgugacug (SEQ ID NO: 1332), CAGgugagaa (SEQ ID NO: 1333), CAGgugagac (SEQ ID NO: 1334), CAGgugagag (SEQ ID NO: 1335), CAGgugagau (SEQ ID NO: 1336), CAGgugagca (SEQ ID NO: 1337), CAGgugagcc (SEQ ID NO: 1338), CAGgugagcg (SEQ ID NO: 1339), CAGgugagcu (SEQ ID NO: 1340), CAGgugagga (SEQ ID NO: 1341), CAGgugaggc (SEQ ID NO: 1342), CAGgugaggg (SEQ ID NO: 1343), CAGgugaggu (SEQ ID NO: 1344), CAGgugagua (SEQ ID NO: 1345), CAGgugaguc (SEQ ID NO: 1346), CAGgugagug (SEQ ID NO: 1347), CAGgugaguu (SEQ ID NO: 1348), CAGgugauaa (SEQ ID NO: 1349), CAGgugaucc (SEQ ID NO: 1350), CAGgugaucu (SEQ ID NO: 1351), CAGgugaugc (SEQ ID NO: 1352), CAGgugaugg (SEQ ID NO: 1353), CAGgugaugu (SEQ ID NO: 1354), CAGgugauua (SEQ ID NO: 1355), CAGgugauuc (SEQ ID NO: 1356), CAGgugauug (SEQ ID NO: 1357), CAGgugauuu (SEQ ID NO: 1358), CAGgugcaaa (SEQ ID NO: 1359), CAGgugcaag (SEQ ID NO: 1360), CAGgugcaca (SEQ ID NO: 1361), CAGgugcacg (SEQ ID NO: 1362), CAGgugcaga (SEQ ID NO: 1363), CAGgugcagg (SEQ ID NO: 1364), CAGgugcaua (SEQ ID NO: 1365), CAGgugcauc (SEQ ID NO: 1366), CAGgugcaug (SEQ ID NO: 1367), CAGgugccaa (SEQ ID NO: 1368), CAGgugccca (SEQ ID NO: 1369), CAGgugcccc (SEQ ID NO: 1370), CAGgugcccg (SEQ ID NO: 1371), CAGgugccua (SEQ ID NO: 1372), CAGgugccug (SEQ ID NO: 1373), CAGgugcgaa (SEQ ID NO: 1374), CAGgugcgca (SEQ ID NO: 1375), CAGgugcgcc (SEQ ID NO: 1376), CAGgugcgcg (SEQ ID NO: 1377), CAGgugcgga (SEQ ID NO: 1378), CAGgugcggu (SEQ ID NO: 1379), CAGgugcgua (SEQ ID NO: 1380), CAGgugcguc (SEQ ID NO: 1381), CAGgugcgug (SEQ ID NO: 1382), CAGgugcuag (SEQ ID NO: 1383), CAGgugcuau (SEQ ID NO: 1384), CAGgugcuca (SEQ ID NO: 1385), CAGgugcucc (SEQ ID NO: 1386), CAGgugcucg (SEQ ID NO: 1387), CAGgugcugc (SEQ ID NO: 1388), CAGgugcugg (SEQ ID NO: 1389), CAGgugcuua (SEQ ID NO: 1390), CAGgugcuuc (SEQ ID NO: 1391), CAGgugcuug (SEQ ID NO: 1392), CAGguggaac (SEQ ID NO: 1393), CAGguggaag (SEQ ID NO: 1394), CAGguggaau (SEQ ID NO: 1395), CAGguggaga (SEQ ID NO: 1396), CAGguggagu (SEQ ID NO: 1397), CAGguggauu (SEQ ID NO: 1398), CAGguggcca (SEQ ID NO: 1399), CAGguggcuc (SEQ ID NO: 1400), CAGguggcug (SEQ ID NO: 1401), CAGgugggaa (SEQ ID NO: 1402), CAGgugggac (SEQ ID NO: 1403), CAGgugggag (SEQ ID NO: 1404), CAGgugggau (SEQ ID NO: 1405), CAGgugggca (SEQ ID NO: 1406), CAGgugggcc (SEQ ID NO: 1407), CAGgugggcu (SEQ ID NO: 1408), CAGgugggga (SEQ ID NO: 1409), CAGguggggc (SEQ ID NO: 1410), CAGguggggg (SEQ ID NO: 1411), CAGguggggu (SEQ ID NO: 1412), CAGgugggua (SEQ ID NO: 1413), CAGguggguc (SEQ ID NO: 1414), CAGgugggug (SEQ ID NO: 1415), CAGguggguu (SEQ ID NO: 1416), CAGguggucu (SEQ ID NO: 1417), CAGguggugg (SEQ ID NO: 1418), CAGgugguug (SEQ ID NO: 1419), CAGguguaca (SEQ ID NO: 1420), CAGguguagg (SEQ ID NO: 1421), CAGguguauc (SEQ ID NO: 1422), CAGgugucac (SEQ ID NO: 1423), CAGgugucag (SEQ ID NO: 1424), CAGgugucca (SEQ ID NO: 1425), CAGguguccu (SEQ ID NO: 1426), CAGgugucua (SEQ ID NO: 1427), CAGgugucuc (SEQ ID NO: 1428), CAGgugucug (SEQ ID NO: 1429), CAGgugugaa (SEQ ID NO: 1430), CAGgugugac (SEQ ID NO: 1431), CAGgugugag (SEQ ID NO: 1432), CAGgugugau (SEQ ID NO: 1433), CAGgugugca (SEQ ID NO: 1434), CAGgugugcc (SEQ ID NO: 1435), CAGgugugcg (SEQ ID NO: 1436), CAGgugugcu (SEQ ID NO: 1437), CAGgugugga (SEQ ID NO: 1438), CAGguguggc (SEQ ID NO: 1439), CAGgugugua (SEQ ID NO: 1440), CAGguguguc (SEQ ID NO: 1441), CAGgugugug (SEQ ID NO: 1442), CAGguguguu (SEQ ID NO: 1443), CAGguguuua (SEQ ID NO: 1444), CAGguuaaaa (SEQ ID NO: 1445), CAGguuaaua (SEQ ID NO: 1446), CAGguuaauc (SEQ ID NO: 1447), CAGguuaccu (SEQ ID NO: 1448), CAGguuagaa (SEQ ID NO: 1449), CAGguuagag (SEQ ID NO: 1450), CAGguuagau (SEQ ID NO: 1451), CAGguuagcc (SEQ ID NO: 1452), CAGguuaggg (SEQ ID NO: 1453), CAGguuaggu (SEQ ID NO: 1454), CAGguuagua (SEQ ID NO: 1455), CAGguuaguc (SEQ ID NO: 1456), CAGguuagug (SEQ ID NO: 1457), CAGguuaguu (SEQ ID NO: 1458), CAGguuauca (SEQ ID NO: 1459), CAGguuaugu (SEQ ID NO: 1460), CAGguuauua (SEQ ID NO: 1461), CAGguuauug (SEQ ID NO: 1462), CAGguucaaa (SEQ ID NO: 1463), CAGguucaac (SEQ ID NO: 1464), CAGguucaag (SEQ ID NO: 1465), CAGguucaca (SEQ ID NO: 1466), CAGguucacg (SEQ ID NO: 1467), CAGguucagg (SEQ ID NO: 1468), CAGguucaug (SEQ ID NO: 1469), CAGguuccag (SEQ ID NO: 1470), CAGguuccca (SEQ ID NO: 1471), CAGguucccg (SEQ ID NO: 1472), CAGguucgaa (SEQ ID NO: 1473), CAGguucgag (SEQ ID NO: 1474), CAGguucuau (SEQ ID NO: 1475), CAGguucugc (SEQ ID NO: 1476), CAGguucuua (SEQ ID NO: 1477), CAGguucuuc (SEQ ID NO: 1478), CAGguucuuu (SEQ ID NO: 1479), CAGguugaac (SEQ ID NO: 1480), CAGguugaag (SEQ ID NO: 1481), CAGguugagu (SEQ ID NO: 1482), CAGguugaua (SEQ ID NO: 1483), CAGguuggag (SEQ ID NO: 1484), CAGguuggca (SEQ ID NO: 1485), CAGguuggcc (SEQ ID NO: 1486), CAGguugguc (SEQ ID NO: 1487), CAGguuggug (SEQ ID NO: 1488), CAGguugguu (SEQ ID NO: 1489), CAGguuguaa (SEQ ID NO: 1490), CAGguuguac (SEQ ID NO: 1491), CAGguuguau (SEQ ID NO: 1492), CAGguuguca (SEQ ID NO: 1493), CAGguuguga (SEQ ID NO: 1494), CAGguuguug (SEQ ID NO: 1495), CAGguuuaag (SEQ ID NO: 1496), CAGguuuacc (SEQ ID NO: 1497), CAGguuuagc (SEQ ID NO: 1498), CAGguuuagu (SEQ ID NO: 1499), CAGguuucuu (SEQ ID NO: 1500), CAGguuugaa (SEQ ID NO: 1501), CAGguuugag (SEQ ID NO: 1502), CAGguuugau (SEQ ID NO: 1503), CAGguuugcc (SEQ ID NO: 1504), CAGguuugcu (SEQ ID NO: 1505), CAGguuuggg (SEQ ID NO: 1506), CAGguuuggu (SEQ ID NO: 1507), CAGguuugua (SEQ ID NO: 1508), CAGguuugug (SEQ ID NO: 1509), CAGguuuguu (SEQ ID NO: 1510), CAGguuuucu (SEQ ID NO: 1511), CAGguuuugg (SEQ ID NO: 1512), CAGguuuuuc (SEQ ID NO: 1513), CAGguuuuuu (SEQ ID NO: 1514), CAUgcagguu (SEQ ID NO: 1515), CAUguaaaac (SEQ ID NO: 1516), CAUguaacua (SEQ ID NO: 1517), CAUguaagaa (SEQ ID NO: 1518), CAUguaagag (SEQ ID NO: 1519), CAUguaagau (SEQ ID NO: 1520), CAUguaagcc (SEQ ID NO: 1521), CAUguaagua (SEQ ID NO: 1522), CAUguaagug (SEQ ID NO: 1523), CAUguaaguu (SEQ ID NO: 1524), CAUguaauua (SEQ ID NO: 1525), CAUguacaua (SEQ ID NO: 1526), CAUguaccac (SEQ ID NO: 1527), CAUguacguu (SEQ ID NO: 1528), CAUguaggua (SEQ ID NO: 1529), CAUguaggug (SEQ ID NO: 1530), CAUguagguu (SEQ ID NO: 1531), CAUguaugaa (SEQ ID NO: 1532), CAUguaugua (SEQ ID NO: 1533), CAUguaugug (SEQ ID NO: 1534), CAUguauguu (SEQ ID NO: 1535), CAUgugagaa (SEQ ID NO: 1536), CAUgugagca (SEQ ID NO: 1537), CAUgugagcu (SEQ ID NO: 1538), CAUgugagua (SEQ ID NO: 1539), CAUgugaguc (SEQ ID NO: 1540), CAUgugagug (SEQ ID NO: 1541), CAUgugaguu (SEQ ID NO: 1542), CAUgugcgua (SEQ ID NO: 1543), CAUgugggaa (SEQ ID NO: 1544), CAUguggguu (SEQ ID NO: 1545), CAUgugugug (SEQ ID NO: 1546), CAUguguguu (SEQ ID NO: 1547), CAUguuaaua (SEQ ID NO: 1548), CAUguuagcc (SEQ ID NO: 1549), CCAguaagau (SEQ ID NO: 1550), CCAguaagca (SEQ ID NO: 1551), CCAguaagcc (SEQ ID NO: 1552), CCAguaagcu (SEQ ID NO: 1553), CCAguaagga (SEQ ID NO: 1554), CCAguaagua (SEQ ID NO: 1555), CCAguaaguc (SEQ ID NO: 1556), CCAguaagug (SEQ ID NO: 1557), CCAguaaguu (SEQ ID NO: 1558), CCAguaauug (SEQ ID NO: 1559), CCAguacggg (SEQ ID NO: 1560), CCAguagguc (SEQ ID NO: 1561), CCAguauugu (SEQ ID NO: 1562), CCAgugaggc (SEQ ID NO: 1563), CCAgugagua (SEQ ID NO: 1564), CCAgugagug (SEQ ID NO: 1565), CCAguggguc (SEQ ID NO: 1566), CCAguuaguu (SEQ ID NO: 1567), CCAguugagu (SEQ ID NO: 1568), CCCguaagau (SEQ ID NO: 1569), CCCguauguc (SEQ ID NO: 1570), CCCguauguu (SEQ ID NO: 1571), CCCguccugc (SEQ ID NO: 1572), CCCgugagug (SEQ ID NO: 1573), CCGguaaaga (SEQ ID NO: 1574), CCGguaagau (SEQ ID NO: 1575), CCGguaagcc (SEQ ID NO: 1576), CCGguaagga (SEQ ID NO: 1577), CCGguaaggc (SEQ ID NO: 1578), CCGguaaugg (SEQ ID NO: 1579), CCGguacagu (SEQ ID NO: 1580), CCGguacuga (SEQ ID NO: 1581), CCGguauucc (SEQ ID NO: 1582), CCGgucagug (SEQ ID NO: 1583), CCGgugaaaa (SEQ ID NO: 1584), CCGgugagaa (SEQ ID NO: 1585), CCGgugaggg (SEQ ID NO: 1586), CCGgugagug (SEQ ID NO: 1587), CCGgugaguu (SEQ ID NO: 1588), CCGgugcgcg (SEQ ID NO: 1589), CCGgugggcg (SEQ ID NO: 1590), CCGguugguc (SEQ ID NO: 1591), CCUguaaaug (SEQ ID NO: 1592), CCUguaaauu (SEQ ID NO: 1593), CCUguaagaa (SEQ ID NO: 1594), CCUguaagac (SEQ ID NO: 1595), CCUguaagag (SEQ ID NO: 1596), CCUguaagca (SEQ ID NO: 1597), CCUguaagcg (SEQ ID NO: 1598), CCUguaagga (SEQ ID NO: 1599), CCUguaaguu (SEQ ID NO: 1600), CCUguaggua (SEQ ID NO: 1601), CCUguaggug (SEQ ID NO: 1602), CCUguaucuu (SEQ ID NO: 1603), CCUguauggu (SEQ ID NO: 1604), CCUguaugug (SEQ ID NO: 1605), CCUgugagaa (SEQ ID NO: 1606), CCUgugagca (SEQ ID NO: 1607), CCUgugaggg (SEQ ID NO: 1608), CCUgugaguc (SEQ ID NO: 1609), CCUgugagug (SEQ ID NO: 1610), CCUgugaguu (SEQ ID NO: 1611), CCUguggcuc (SEQ ID NO: 1612), CCUgugggua (SEQ ID NO: 1613), CCUgugugua (SEQ ID NO: 1614), CCUguuagaa (SEQ ID NO: 1615), CGAguaaggg (SEQ ID NO: 1616), CGAguaaggu (SEQ ID NO: 1617), CGAguagcug (SEQ ID NO: 1618), CGAguaggug (SEQ ID NO: 1619), CGAguagguu (SEQ ID NO: 1620), CGAgugagca (SEQ ID NO: 1621), CGCguaagag (SEQ ID NO: 1622), CGGgcaggca (SEQ ID NO: 1623), CGGguaagcc (SEQ ID NO: 1624), CGGguaagcu (SEQ ID NO: 1625), CGGguaaguu (SEQ ID NO: 1626), CGGguaauuc (SEQ ID NO: 1627), CGGguaauuu (SEQ ID NO: 1628), CGGguacagu (SEQ ID NO: 1629), CGGguacggg (SEQ ID NO: 1630), CGGguaggag (SEQ ID NO: 1631), CGGguaggcc (SEQ ID NO: 1632), CGGguaggug (SEQ ID NO: 1633), CGGguauuua (SEQ ID NO: 1634), CGGgucugag (SEQ ID NO: 1635), CGGgugaccg (SEQ ID NO: 1636), CGGgugacuc (SEQ ID NO: 1637), CGGgugagaa (SEQ ID NO: 1638), CGGgugaggg (SEQ ID NO: 1639), CGGgugaggu (SEQ ID NO: 1640), CGGgugagua (SEQ ID NO: 1641), CGGgugagug (SEQ ID NO: 1642), CGGgugaguu (SEQ ID NO: 1643), CGGgugauuu (SEQ ID NO: 1644), CGGgugccuu (SEQ ID NO: 1645), CGGgugggag (SEQ ID NO: 1646), CGGgugggug (SEQ ID NO: 1647), CGGguggguu (SEQ ID NO: 1648), CGGguguguc (SEQ ID NO: 1649), CGGgugugug (SEQ ID NO: 1650), CGGguguguu (SEQ ID NO: 1651), CGGguucaag (SEQ ID NO: 1652), CGGguucaug (SEQ ID NO: 1653), CGGguuugcu (SEQ ID NO: 1654), CGUguagggu (SEQ ID NO: 1655), CGUguaugca (SEQ ID NO: 1656), CGUguaugua (SEQ ID NO: 1657), CGUgucugua (SEQ ID NO: 1658), CGUgugagug (SEQ ID NO: 1659), CGUguuuucu (SEQ ID NO: 1660), CUAguaaaug (SEQ ID NO: 1661), CUAguaagcg (SEQ ID NO: 1662), CUAguaagcu (SEQ ID NO: 1663), CUAguaagua (SEQ ID NO: 1664), CUAguaaguc (SEQ ID NO: 1665), CUAguaagug (SEQ ID NO: 1666), CUAguaaguu (SEQ ID NO: 1667), CUAguaauuu (SEQ ID NO: 1668), CUAguaggua (SEQ ID NO: 1669), CUAguagguu (SEQ ID NO: 1670), CUAguaugua (SEQ ID NO: 1671), CUAguauguu (SEQ ID NO: 1672), CUAgugagua (SEQ ID NO: 1673), CUCguaagca (SEQ ID NO: 1674), CUCguaagug (SEQ ID NO: 1675), CUCguaaguu (SEQ ID NO: 1676), CUCguaucug (SEQ ID NO: 1677), CUCgucugug (SEQ ID NO: 1678), CUCgugaaua (SEQ ID NO: 1679), CUCgugagua (SEQ ID NO: 1680), CUCgugauua (SEQ ID NO: 1681), CUGguaaaaa (SEQ ID NO: 1682), CUGguaaaau (SEQ ID NO: 1683), CUGguaaacc (SEQ ID NO: 1684), CUGguaaacg (SEQ ID NO: 1685), CUGguaaagc (SEQ ID NO: 1686), CUGguaaaua (SEQ ID NO: 1687), CUGguaaauc (SEQ ID NO: 1688), CUGguaaaug (SEQ ID NO: 1689), CUGguaaauu (SEQ ID NO: 1690), CUGguaacac (SEQ ID NO: 1691), CUGguaacag (SEQ ID NO: 1692), CUGguaaccc (SEQ ID NO: 1693), CUGguaaccg (SEQ ID NO: 1694), CUGguaacug (SEQ ID NO: 1695), CUGguaacuu (SEQ ID NO: 1696), CUGguaagaa (SEQ ID NO: 1697), CUGguaagag (SEQ ID NO: 1698), CUGguaagau (SEQ ID NO: 1699), CUGguaagca (SEQ ID NO: 1700), CUGguaagcc (SEQ ID NO: 1701), CUGguaagcu (SEQ ID NO: 1702), CUGguaagga (SEQ ID NO: 1703), CUGguaaggc (SEQ ID NO: 1704), CUGguaaggg (SEQ ID NO: 1705), CUGguaaggu (SEQ ID NO: 1706), CUGguaagua (SEQ ID NO: 1707), CUGguaagug (SEQ ID NO: 1708), CUGguaaguu (SEQ ID NO: 1709), CUGguaauga (SEQ ID NO: 1710), CUGguaaugc (SEQ ID NO: 1711), CUGguaauuc (SEQ ID NO: 1712), CUGguaauuu (SEQ ID NO: 1713), CUGguacaac (SEQ ID NO: 1714), CUGguacaau (SEQ ID NO: 1715), CUGguacaga (SEQ ID NO: 1716), CUGguacaua (SEQ ID NO: 1717), CUGguacauu (SEQ ID NO: 1718), CUGguaccau (SEQ ID NO: 1719), CUGguacguu (SEQ ID NO: 1720), CUGguacuaa (SEQ ID NO: 1721), CUGguacuug (SEQ ID NO: 1722), CUGguacuuu (SEQ ID NO: 1723), CUGguagaga (SEQ ID NO: 1724), CUGguagaua (SEQ ID NO: 1725), CUGguagcgu (SEQ ID NO: 1726), CUGguaggau (SEQ ID NO: 1727), CUGguaggca (SEQ ID NO: 1728), CUGguaggua (SEQ ID NO: 1729), CUGguagguc (SEQ ID NO: 1730), CUGguaggug (SEQ ID NO: 1731), CUGguaucaa (SEQ ID NO: 1732), CUGguaugau (SEQ ID NO: 1733), CUGguauggc (SEQ ID NO: 1734), CUGguauggu (SEQ ID NO: 1735), CUGguaugua (SEQ ID NO: 1736), CUGguaugug (SEQ ID NO: 1737), CUGguauguu (SEQ ID NO: 1738), CUGguauuga (SEQ ID NO: 1739), CUGguauuuc (SEQ ID NO: 1740), CUGguauuuu (SEQ ID NO: 1741), CUGgucaaca (SEQ ID NO: 1742), CUGgucagag (SEQ ID NO: 1743), CUGgucccgc (SEQ ID NO: 1744), CUGgucggua (SEQ ID NO: 1745), CUGgucuggg (SEQ ID NO: 1746), CUGgugaagu (SEQ ID NO: 1747), CUGgugaaua (SEQ ID NO: 1748), CUGgugaauu (SEQ ID NO: 1749), CUGgugacua (SEQ ID NO: 1750), CUGgugagaa (SEQ ID NO: 1751), CUGgugagac (SEQ ID NO: 1752), CUGgugagca (SEQ ID NO: 1753), CUGgugagcu (SEQ ID NO: 1754), CUGgugagga (SEQ ID NO: 1755), CUGgugaggc (SEQ ID NO: 1756), CUGgugaggg (SEQ ID NO: 1757), CUGgugaggu (SEQ ID NO: 1758), CUGgugagua (SEQ ID NO: 1759), CUGgugaguc (SEQ ID NO: 1760), CUGgugagug (SEQ ID NO: 1761), CUGgugaguu (SEQ ID NO: 1762), CUGgugauua (SEQ ID NO: 1763), CUGgugauuu (SEQ ID NO: 1764), CUGgugcaga (SEQ ID NO: 1765), CUGgugcgcu (SEQ ID NO: 1766), CUGgugcgug (SEQ ID NO: 1767), CUGgugcuga (SEQ ID NO: 1768), CUGgugggag (SEQ ID NO: 1769), CUGgugggga (SEQ ID NO: 1770), CUGgugggua (SEQ ID NO: 1771), CUGguggguc (SEQ ID NO: 1772), CUGgugggug (SEQ ID NO: 1773), CUGguggguu (SEQ ID NO: 1774), CUGgugugaa (SEQ ID NO: 1775), CUGgugugca (SEQ ID NO: 1776), CUGgugugcu (SEQ ID NO: 1777), CUGguguggu (SEQ ID NO: 1778), CUGgugugug (SEQ ID NO: 1779), CUGguguguu (SEQ ID NO: 1780), CUGguuagcu (SEQ ID NO: 1781), CUGguuagug (SEQ ID NO: 1782), CUGguucgug (SEQ ID NO: 1783), CUGguuggcu (SEQ ID NO: 1784), CUGguuguuu (SEQ ID NO: 1785), CUGguuugua (SEQ ID NO: 1786), CUGguuuguc (SEQ ID NO: 1787), CUGguuugug (SEQ ID NO: 1788), CUUguaaaug (SEQ ID NO: 1789), CUUguaagcu (SEQ ID NO: 1790), CUUguaagga (SEQ ID NO: 1791), CUUguaaggc (SEQ ID NO: 1792), CUUguaagua (SEQ ID NO: 1793), CUUguaagug (SEQ ID NO: 1794), CUUguaaguu (SEQ ID NO: 1795), CUUguacguc (SEQ ID NO: 1796), CUUguacgug (SEQ ID NO: 1797), CUUguaggua (SEQ ID NO: 1798), CUUguagugc (SEQ ID NO: 1799), CUUguauagg (SEQ ID NO: 1800), CUUgucagua (SEQ ID NO: 1801), CUUgugagua (SEQ ID NO: 1802), CUUgugaguc (SEQ ID NO: 1803), CUUgugaguu (SEQ ID NO: 1804), CUUguggguu (SEQ ID NO: 1805), CUUgugugua (SEQ ID NO: 1806), CUUguuagug (SEQ ID NO: 1807), CUUguuugag (SEQ ID NO: 1808), GAAguaaaac (SEQ ID NO: 1809), GAAguaaagc (SEQ ID NO: 1810), GAAguaaagu (SEQ ID NO: 1811), GAAguaaaua (SEQ ID NO: 1812), GAAguaaauu (SEQ ID NO: 1813), GAAguaagaa (SEQ ID NO: 1814), GAAguaagcc (SEQ ID NO: 1815), GAAguaagcu (SEQ ID NO: 1816), GAAguaagga (SEQ ID NO: 1817), GAAguaagua (SEQ ID NO: 1818), GAAguaagug (SEQ ID NO: 1819), GAAguaaguu (SEQ ID NO: 1820), GAAguaauau (SEQ ID NO: 1821), GAAguaaugc (SEQ ID NO: 1822), GAAguaauua (SEQ ID NO: 1823), GAAguaauuu (SEQ ID NO: 1824), GAAguaccau (SEQ ID NO: 1825), GAAguacgua (SEQ ID NO: 1826), GAAguacguc (SEQ ID NO: 1827), GAAguaggca (SEQ ID NO: 1828), GAAguagguc (SEQ ID NO: 1829), GAAguauaaa (SEQ ID NO: 1830), GAAguaugcu (SEQ ID NO: 1831), GAAguaugug (SEQ ID NO: 1832), GAAguauguu (SEQ ID NO: 1833), GAAguauuaa (SEQ ID NO: 1834), GAAgucagug (SEQ ID NO: 1835), GAAgugagag (SEQ ID NO: 1836), GAAgugagcg (SEQ ID NO: 1837), GAAgugaggu (SEQ ID NO: 1838), GAAgugaguc (SEQ ID NO: 1839), GAAgugagug (SEQ ID NO: 1840), GAAgugaguu (SEQ ID NO: 1841), GAAgugauaa (SEQ ID NO: 1842), GAAgugauuc (SEQ ID NO: 1843), GAAgugcgug (SEQ ID NO: 1844), GAAguguggg (SEQ ID NO: 1845), GAAguguguc (SEQ ID NO: 1846), GAAguuggug (SEQ ID NO: 1847), GACguaaagu (SEQ ID NO: 1848), GACguaagcu (SEQ ID NO: 1849), GACguaagua (SEQ ID NO: 1850), GACguaaugg (SEQ ID NO: 1851), GACguaugcc (SEQ ID NO: 1852), GACguauguu (SEQ ID NO: 1853), GACgugagcc (SEQ ID NO: 1854), GACgugagug (SEQ ID NO: 1855), GAGgcaaaug (SEQ ID NO: 1856), GAGgcaagag (SEQ ID NO: 1857), GAGgcaagua (SEQ ID NO: 1858), GAGgcaagug (SEQ ID NO: 1859), GAGgcaaguu (SEQ ID NO: 1860), GAGgcacgag (SEQ ID NO: 1861), GAGgcaggga (SEQ ID NO: 1862), GAGgcaugug (SEQ ID NO: 1863), GAGgcgaagg (SEQ ID NO: 1864), GAGguaaaaa (SEQ ID NO: 1865), GAGguaaaac (SEQ ID NO: 1866), GAGguaaaag (SEQ ID NO: 1867), GAGguaaaau (SEQ ID NO: 1868), GAGguaaacc (SEQ ID NO: 1869), GAGguaaaga (SEQ ID NO: 1870), GAGguaaagc (SEQ ID NO: 1871), GAGguaaagu (SEQ ID NO: 1872), GAGguaaaua (SEQ ID NO: 1873), GAGguaaauc (SEQ ID NO: 1874), GAGguaaaug (SEQ ID NO: 1875), GAGguaaauu (SEQ ID NO: 1876), GAGguaacaa (SEQ ID NO: 1877), GAGguaacag (SEQ ID NO: 1878), GAGguaacca (SEQ ID NO: 1879), GAGguaaccu (SEQ ID NO: 1880), GAGguaacuu (SEQ ID NO: 1881), GAGguaagaa (SEQ ID NO: 1882), GAGguaagag (SEQ ID NO: 1883), GAGguaagau (SEQ ID NO: 1884), GAGguaagca (SEQ ID NO: 1885), GAGguaagcc (SEQ ID NO: 1886), GAGguaagcg (SEQ ID NO: 1887), GAGguaagcu (SEQ ID NO: 1888), GAGguaagga (SEQ ID NO: 1889), GAGguaaggc (SEQ ID NO: 1890), GAGguaaggg (SEQ ID NO: 1891), GAGguaaggu (SEQ ID NO: 1892), GAGguaagua (SEQ ID NO: 1893), GAGguaaguc (SEQ ID NO: 1894), GAGguaauaa (SEQ ID NO: 1895), GAGguaauac (SEQ ID NO: 1896), GAGguaauau (SEQ ID NO: 1897), GAGguaauca (SEQ ID NO: 1898), GAGguaaucu (SEQ ID NO: 1899), GAGguaaugg (SEQ ID NO: 1900), GAGguaaugu (SEQ ID NO: 1901), GAGguaauug (SEQ ID NO: 1902), GAGguaauuu (SEQ ID NO: 1903), GAGguacaaa (SEQ ID NO: 1904), GAGguacaac (SEQ ID NO: 1905), GAGguacaga (SEQ ID NO: 1906), GAGguacagc (SEQ ID NO: 1907), GAGguacagu (SEQ ID NO: 1908), GAGguacaua (SEQ ID NO: 1909), GAGguacauu (SEQ ID NO: 1910), GAGguaccag (SEQ ID NO: 1911), GAGguaccga (SEQ ID NO: 1912), GAGguaccug (SEQ ID NO: 1913), GAGguaccuu (SEQ ID NO: 1914), GAGguacuag (SEQ ID NO: 1915), GAGguacuau (SEQ ID NO: 1916), GAGguacucc (SEQ ID NO: 1917), GAGguacugc (SEQ ID NO: 1918), GAGguacugg (SEQ ID NO: 1919), GAGguacugu (SEQ ID NO: 1920), GAGguacuug (SEQ ID NO: 1921), GAGguacuuu (SEQ ID NO: 1922), GAGguagaag (SEQ ID NO: 1923), GAGguagaga (SEQ ID NO: 1924), GAGguagagg (SEQ ID NO: 1925), GAGguagagu (SEQ ID NO: 1926), GAGguagauc (SEQ ID NO: 1927), GAGguagcua (SEQ ID NO: 1928), GAGguagcug (SEQ ID NO: 1929), GAGguaggaa (SEQ ID NO: 1930), GAGguaggag (SEQ ID NO: 1931), GAGguaggca (SEQ ID NO: 1932), GAGguaggcu (SEQ ID NO: 1933), GAGguaggga (SEQ ID NO: 1934), GAGguagggc (SEQ ID NO: 1935), GAGguagggg (SEQ ID NO: 1936), GAGguaggua (SEQ ID NO: 1937), GAGguaggug (SEQ ID NO: 1938), GAGguagguu (SEQ ID NO: 1939), GAGguaguaa (SEQ ID NO: 1940), GAGguaguag (SEQ ID NO: 1941), GAGguaguau (SEQ ID NO: 1942), GAGguagucu (SEQ ID NO: 1943), GAGguagugc (SEQ ID NO: 1944), GAGguagugg (SEQ ID NO: 1945), GAGguaguua (SEQ ID NO: 1946), GAGguaguug (SEQ ID NO: 1947), GAGguauaag (SEQ ID NO: 1948), GAGguauacu (SEQ ID NO: 1949), GAGguauagc (SEQ ID NO: 1950), GAGguauaug (SEQ ID NO: 1951), GAGguauauu (SEQ ID NO: 1952), GAGguaucau (SEQ ID NO: 1953), GAGguaucug (SEQ ID NO: 1954), GAGguaucuu (SEQ ID NO: 1955), GAGguaugaa (SEQ ID NO: 1956), GAGguaugac (SEQ ID NO: 1957), GAGguaugag (SEQ ID NO: 1958), GAGguaugcc (SEQ ID NO: 1959), GAGguaugcg (SEQ ID NO: 1960), GAGguaugcu (SEQ ID NO: 1961), GAGguaugga (SEQ ID NO: 1962), GAGguauggg (SEQ ID NO: 1963), GAGguauggu (SEQ ID NO: 1964), GAGguaugua (SEQ ID NO: 1965), GAGguauguc (SEQ ID NO: 1966), GAGguaugug (SEQ ID NO: 1967), GAGguauguu (SEQ ID NO: 1968), GAGguauucc (SEQ ID NO: 1969), GAGguauuga (SEQ ID NO: 1970), GAGguauugu (SEQ ID NO: 1971), GAGguauuua (SEQ ID NO: 1972), GAGguauuuc (SEQ ID NO: 1973), GAGguauuug (SEQ ID NO: 1974), GAGguauuuu (SEQ ID NO: 1975), GAGgucaaca (SEQ ID NO: 1976), GAGgucaagg (SEQ ID NO: 1977), GAGgucaaug (SEQ ID NO: 1978), GAGgucacug (SEQ ID NO: 1979), GAGgucagaa (SEQ ID NO: 1980), GAGgucagag (SEQ ID NO: 1981), GAGgucagcu (SEQ ID NO: 1982), GAGgucagga (SEQ ID NO: 1983), GAGgucaggc (SEQ ID NO: 1984), GAGgucaggg (SEQ ID NO: 1985), GAGgucaggu (SEQ ID NO: 1986), GAGgucagua (SEQ ID NO: 1987), GAGgucauau (SEQ ID NO: 1988), GAGgucaugu (SEQ ID NO: 1989), GAGgucauuu (SEQ ID NO: 1990), GAGguccaua (SEQ ID NO: 1991), GAGguccauc (SEQ ID NO: 1992), GAGguccggg (SEQ ID NO: 1993), GAGguccggu (SEQ ID NO: 1994), GAGguccuug (SEQ ID NO: 1995), GAGgucgggg (SEQ ID NO: 1996), GAGgucucgu (SEQ ID NO: 1997), GAGgucugag (SEQ ID NO: 1998), GAGgucuggu (SEQ ID NO: 1999), GAGgucuguc (SEQ ID NO: 2000), GAGgucuguu (SEQ ID NO: 2001), GAGgucuuuu (SEQ ID NO: 2002), GAGgugaaaa (SEQ ID NO: 2003), GAGgugaaau (SEQ ID NO: 2004), GAGgugaaca (SEQ ID NO: 2005), GAGgugaagg (SEQ ID NO: 2006), GAGgugaaua (SEQ ID NO: 2007), GAGgugaauu (SEQ ID NO: 2008), GAGgugacau (SEQ ID NO: 2009), GAGgugacca (SEQ ID NO: 2010), GAGgugaccu (SEQ ID NO: 2011), GAGgugacua (SEQ ID NO: 2012), GAGgugacuu (SEQ ID NO: 2013), GAGgugagaa (SEQ ID NO: 2014), GAGgugagac (SEQ ID NO: 2015), GAGgugagag (SEQ ID NO: 2016), GAGgugagau (SEQ ID NO: 2017), GAGgugagca (SEQ ID NO: 2018), GAGgugagcc (SEQ ID NO: 2019), GAGgugagcg (SEQ ID NO: 2020), GAGgugagcu (SEQ ID NO: 2021), GAGgugagga (SEQ ID NO: 2022), GAGgugaggc (SEQ ID NO: 2023), GAGgugaggg (SEQ ID NO: 2024), GAGgugagua (SEQ ID NO: 2025), GAGgugagug (SEQ ID NO: 2026), GAGgugaguu (SEQ ID NO: 2027), GAGgugauau (SEQ ID NO: 2028), GAGgugaucc (SEQ ID NO: 2029), GAGgugaucu (SEQ ID NO: 2030), GAGgugauga (SEQ ID NO: 2031), GAGgugaugg (SEQ ID NO: 2032), GAGgugaugu (SEQ ID NO: 2033), GAGgugauuc (SEQ ID NO: 2034), GAGgugcaca (SEQ ID NO: 2035), GAGgugcaga (SEQ ID NO: 2036), GAGgugcagc (SEQ ID NO: 2037), GAGgugcagg (SEQ ID NO: 2038), GAGgugccag (SEQ ID NO: 2039), GAGgugccca (SEQ ID NO: 2040), GAGgugccuu (SEQ ID NO: 2041), GAGgugcggg (SEQ ID NO: 2042), GAGgugcgug (SEQ ID NO: 2043), GAGgugcucc (SEQ ID NO: 2044), GAGgugcugg (SEQ ID NO: 2045), GAGgugcuua (SEQ ID NO: 2046), GAGgugcuug (SEQ ID NO: 2047), GAGguggaaa (SEQ ID NO: 2048), GAGguggaau (SEQ ID NO: 2049), GAGguggacc (SEQ ID NO: 2050), GAGguggacg (SEQ ID NO: 2051), GAGguggagg (SEQ ID NO: 2052), GAGguggcug (SEQ ID NO: 2053), GAGgugggaa (SEQ ID NO: 2054), GAGgugggag (SEQ ID NO: 2055), GAGgugggau (SEQ ID NO: 2056), GAGgugggca (SEQ ID NO: 2057), GAGgugggcg (SEQ ID NO: 2058), GAGgugggcu (SEQ ID NO: 2059), GAGgugggga (SEQ ID NO: 2060), GAGguggggc (SEQ ID NO: 2061), GAGguggggg (SEQ ID NO: 2062), GAGgugggua (SEQ ID NO: 2063), GAGguggguc (SEQ ID NO: 2064), GAGgugggug (SEQ ID NO: 2065), GAGguggguu (SEQ ID NO: 2066), GAGgugguau (SEQ ID NO: 2067), GAGgugguuc (SEQ ID NO: 2068), GAGgugucau (SEQ ID NO: 2069), GAGgugugag (SEQ ID NO: 2070), GAGgugugau (SEQ ID NO: 2071), GAGgugugca (SEQ ID NO: 2072), GAGgugugcu (SEQ ID NO: 2073), GAGgugugga (SEQ ID NO: 2074), GAGguguggg (SEQ ID NO: 2075), GAGguguggu (SEQ ID NO: 2076), GAGgugugua (SEQ ID NO: 2077), GAGgugugug (SEQ ID NO: 2078), GAGguuaaau (SEQ ID NO: 2079), GAGguuaaga (SEQ ID NO: 2080), GAGguuaaua (SEQ ID NO: 2081), GAGguuaccg (SEQ ID NO: 2082), GAGguuagaa (SEQ ID NO: 2083), GAGguuagac (SEQ ID NO: 2084), GAGguuagag (SEQ ID NO: 2085), GAGguuaggu (SEQ ID NO: 2086), GAGguuagua (SEQ ID NO: 2087), GAGguuaguc (SEQ ID NO: 2088), GAGguuagug (SEQ ID NO: 2089), GAGguuaguu (SEQ ID NO: 2090), GAGguuaugu (SEQ ID NO: 2091), GAGguuauuc (SEQ ID NO: 2092), GAGguucaaa (SEQ ID NO: 2093), GAGguucaua (SEQ ID NO: 2094), GAGguucuga (SEQ ID NO: 2095), GAGguugaag (SEQ ID NO: 2096), GAGguugcag (SEQ ID NO: 2097), GAGguugcug (SEQ ID NO: 2098), GAGguuggaa (SEQ ID NO: 2099), GAGguuggag (SEQ ID NO: 2100), GAGguuggau (SEQ ID NO: 2101), GAGguuggua (SEQ ID NO: 2102), GAGguugguc (SEQ ID NO: 2103), GAGguugguu (SEQ ID NO: 2104), GAGguuguag (SEQ ID NO: 2105), GAGguuucug (SEQ ID NO: 2106), GAGguuugag (SEQ ID NO: 2107), GAGguuugga (SEQ ID NO: 2108), GAGguuuggg (SEQ ID NO: 2109), GAGguuugua (SEQ ID NO: 2110), GAGguuuguu (SEQ ID NO: 2111), GAGguuuuca (SEQ ID NO: 2112), GAGguuuuga (SEQ ID NO: 2113), GAGguuuugg (SEQ ID NO: 2114), GAGguuuuua (SEQ ID NO: 2115), GAGguuuuuc (SEQ ID NO: 2116), GAUguaaaau (SEQ ID NO: 2117), GAUguaagca (SEQ ID NO: 2118), GAUguaagcc (SEQ ID NO: 2119), GAUguaaggu (SEQ ID NO: 2120), GAUguaagua (SEQ ID NO: 2121), GAUguaagug (SEQ ID NO: 2122), GAUguaaguu (SEQ ID NO: 2123), GAUguacauc (SEQ ID NO: 2124), GAUguaggua (SEQ ID NO: 2125), GAUguauggc (SEQ ID NO: 2126), GAUguaugua (SEQ ID NO: 2127), GAUguauguu (SEQ ID NO: 2128), GAUgucagug (SEQ ID NO: 2129), GAUgugagag (SEQ ID NO: 2130), GAUgugagcc (SEQ ID NO: 2131), GAUgugagcu (SEQ ID NO: 2132), GAUgugagga (SEQ ID NO: 2133), GAUgugaguc (SEQ ID NO: 2134), GAUgugagug (SEQ ID NO: 2135), GAUgugaguu (SEQ ID NO: 2136), GAUgugggua (SEQ ID NO: 2137), GAUgugggug (SEQ ID NO: 2138), GAUguguguu (SEQ ID NO: 2139), GAUguuagcu (SEQ ID NO: 2140), GAUguucagu (SEQ ID NO: 2141), GAUguucgug (SEQ ID NO: 2142), GAUguuuguu (SEQ ID NO: 2143), GCAguaaagg (SEQ ID NO: 2144), GCAguaagaa (SEQ ID NO: 2145), GCAguaagga (SEQ ID NO: 2146), GCAguaagua (SEQ ID NO: 2147), GCAguaaguc (SEQ ID NO: 2148), GCAguaaguu (SEQ ID NO: 2149), GCAguagaug (SEQ ID NO: 2150), GCAguaggua (SEQ ID NO: 2151), GCAguaugug (SEQ ID NO: 2152), GCAguauguu (SEQ ID NO: 2153), GCAgucagua (SEQ ID NO: 2154), GCAgucagug (SEQ ID NO: 2155), GCAguccggu (SEQ ID NO: 2156), GCAgugacuu (SEQ ID NO: 2157), GCAgugagcc (SEQ ID NO: 2158), GCAgugagcg (SEQ ID NO: 2159), GCAgugagcu (SEQ ID NO: 2160), GCAgugagua (SEQ ID NO: 2161), GCAgugagug (SEQ ID NO: 2162), GCAgugaguu (SEQ ID NO: 2163), GCAgugggua (SEQ ID NO: 2164), GCAguuaagu (SEQ ID NO: 2165), GCAguugagu (SEQ ID NO: 2166), GCCguaaguc (SEQ ID NO: 2167), GCCgugagua (SEQ ID NO: 2168), GCGguaaagc (SEQ ID NO: 2169), GCGguaaaua (SEQ ID NO: 2170), GCGguaagcu (SEQ ID NO: 2171), GCGguaaggg (SEQ ID NO: 2172), GCGguaagug (SEQ ID NO: 2173), GCGguaauca (SEQ ID NO: 2174), GCGguacgua (SEQ ID NO: 2175), GCGguacuug (SEQ ID NO: 2176), GCGguagggu (SEQ ID NO: 2177), GCGguagugu (SEQ ID NO: 2178), GCGgugagca (SEQ ID NO: 2179), GCGgugagcu (SEQ ID NO: 2180), GCGgugaguu (SEQ ID NO: 2181), GCGguggcuc (SEQ ID NO: 2182), GCGgugugca (SEQ ID NO: 2183), GCGguguguu (SEQ ID NO: 2184), GCGguuaagu (SEQ ID NO: 2185), GCGguuugca (SEQ ID NO: 2186), GCUgcuguaa (SEQ ID NO: 2187), GCUguaaaua (SEQ ID NO: 2188), GCUguaagac (SEQ ID NO: 2189), GCUguaagag (SEQ ID NO: 2190), GCUguaagca (SEQ ID NO: 2191), GCUguaagga (SEQ ID NO: 2192), GCUguaagua (SEQ ID NO: 2193), GCUguaaguc (SEQ ID NO: 2194), GCUguaagug (SEQ ID NO: 2195), GCUguaaguu (SEQ ID NO: 2196), GCUguaggug (SEQ ID NO: 2197), GCUguauggu (SEQ ID NO: 2198), GCUgucagug (SEQ ID NO: 2199), GCUguccuug (SEQ ID NO: 2200), GCUgugagaa (SEQ ID NO: 2201), GCUgugagcc (SEQ ID NO: 2202), GCUgugagga (SEQ ID NO: 2203), GCUgugagua (SEQ ID NO: 2204), GCUgugaguc (SEQ ID NO: 2205), GCUgugagug (SEQ ID NO: 2206), GCUgugaguu (SEQ ID NO: 2207), GCUguggguu (SEQ ID NO: 2208), GGAguaagag (SEQ ID NO: 2209), GGAguaagca (SEQ ID NO: 2210), GGAguaagcc (SEQ ID NO: 2211), GGAguaagcu (SEQ ID NO: 2212), GGAguaagga (SEQ ID NO: 2213), GGAguaagug (SEQ ID NO: 2214), GGAguaaguu (SEQ ID NO: 2215), GGAguaauuu (SEQ ID NO: 2216), GGAguacugu (SEQ ID NO: 2217), GGAguaggaa (SEQ ID NO: 2218), GGAguaggua (SEQ ID NO: 2219), GGAguagguu (SEQ ID NO: 2220), GGAguaguau (SEQ ID NO: 2221), GGAguaugac (SEQ ID NO: 2222), GGAguauggu (SEQ ID NO: 2223), GGAgucaagu (SEQ ID NO: 2224), GGAgugaggg (SEQ ID NO: 2225), GGAgugagua (SEQ ID NO: 2226), GGAgugaguc (SEQ ID NO: 2227), GGAgugagug (SEQ ID NO: 2228), GGAgugaguu (SEQ ID NO: 2229), GGAgugcuuu (SEQ ID NO: 2230), GGAgugggca (SEQ ID NO: 2231), GGAgugggug (SEQ ID NO: 2232), GGAguuaagg (SEQ ID NO: 2233), GGAguugaga (SEQ ID NO: 2234), GGCguaagcc (SEQ ID NO: 2235), GGCguaggua (SEQ ID NO: 2236), GGCguaggug (SEQ ID NO: 2237), GGCgugagcc (SEQ ID NO: 2238), GGCgugaguc (SEQ ID NO: 2239), GGGguaaaca (SEQ ID NO: 2240), GGGguaaacc (SEQ ID NO: 2241), GGGguaaacu (SEQ ID NO: 2242), GGGguaagaa (SEQ ID NO: 2243), GGGguaagag (SEQ ID NO: 2244), GGGguaagau (SEQ ID NO: 2245), GGGguaagca (SEQ ID NO: 2246), GGGguaagcc (SEQ ID NO: 2247), GGGguaagcu (SEQ ID NO: 2248), GGGguaagga (SEQ ID NO: 2249), GGGguaaggg (SEQ ID NO: 2250), GGGguaagua (SEQ ID NO: 2251), GGGguaagug (SEQ ID NO: 2252), GGGguaaguu (SEQ ID NO: 2253), GGGguagaca (SEQ ID NO: 2254), GGGguaggag (SEQ ID NO: 2255), GGGguaggcc (SEQ ID NO: 2256), GGGguaggga (SEQ ID NO: 2257), GGGguaggua (SEQ ID NO: 2258), GGGguaggug (SEQ ID NO: 2259), GGGguagguu (SEQ ID NO: 2260), GGGguagugc (SEQ ID NO: 2261), GGGguaucug (SEQ ID NO: 2262), GGGguaugac (SEQ ID NO: 2263), GGGguaugga (SEQ ID NO: 2264), GGGguaugua (SEQ ID NO: 2265), GGGguauguc (SEQ ID NO: 2266), GGGguaugug (SEQ ID NO: 2267), GGGguauguu (SEQ ID NO: 2268), GGGgucagua (SEQ ID NO: 2269), GGGguccgug (SEQ ID NO: 2270), GGGgucggag (SEQ ID NO: 2271), GGGgucugug (SEQ ID NO: 2272), GGGgugaaca (SEQ ID NO: 2273), GGGgugaaga (SEQ ID NO: 2274), GGGgugagaa (SEQ ID NO: 2275), GGGgugagau (SEQ ID NO: 2276), GGGgugagcc (SEQ ID NO: 2277), GGGgugagcg (SEQ ID NO: 2278), GGGgugagcu (SEQ ID NO: 2279), GGGgugagga (SEQ ID NO: 2280), GGGgugaggc (SEQ ID NO: 2281), GGGgugaggg (SEQ ID NO: 2282), GGGgugaguc (SEQ ID NO: 2283), GGGgugagug (SEQ ID NO: 2284), GGGgugaguu (SEQ ID NO: 2285), GGGgugcgua (SEQ ID NO: 2286), GGGguggggu (SEQ ID NO: 2287), GGGgugggua (SEQ ID NO: 2288), GGGgugggug (SEQ ID NO: 2289), GGGguggguu (SEQ ID NO: 2290), GGGgugugcg (SEQ ID NO: 2291), GGGgugugua (SEQ ID NO: 2292), GGGguguguc (SEQ ID NO: 2293), GGGgugugug (SEQ ID NO: 2294), GGGguuacag (SEQ ID NO: 2295), GGGguuggac (SEQ ID NO: 2296), GGGguuggga (SEQ ID NO: 2297), GGGguuugcc (SEQ ID NO: 2298), GGGguuugua (SEQ ID NO: 2299), GGUguaagaa (SEQ ID NO: 2300), GGUguaagau (SEQ ID NO: 2301), GGUguaagca (SEQ ID NO: 2302), GGUguaagcc (SEQ ID NO: 2303), GGUguaagcg (SEQ ID NO: 2304), GGUguaaguc (SEQ ID NO: 2305), GGUguaagug (SEQ ID NO: 2306), GGUguagguc (SEQ ID NO: 2307), GGUguaggug (SEQ ID NO: 2308), GGUguagguu (SEQ ID NO: 2309), GGUguccgua (SEQ ID NO: 2310), GGUgugagag (SEQ ID NO: 2311), GGUgugagcc (SEQ ID NO: 2312), GGUgugagcu (SEQ ID NO: 2313), GGUgugagua (SEQ ID NO: 2314), GGUgugaguc (SEQ ID NO: 2315), GGUgugcuuc (SEQ ID NO: 2316), GGUguggcug (SEQ ID NO: 2317), GGUgugguga (SEQ ID NO: 2318), GGUgugucug (SEQ ID NO: 2319), GGUguugaaa (SEQ ID NO: 2320), GGUguugcug (SEQ ID NO: 2321), GUAguaagau (SEQ ID NO: 2322), GUAguaagua (SEQ ID NO: 2323), GUAguaagug (SEQ ID NO: 2324), GUAguagcuu (SEQ ID NO: 2325), GUAguaggua (SEQ ID NO: 2326), GUAgucagua (SEQ ID NO: 2327), GUAgugagua (SEQ ID NO: 2328), GUAguggugg (SEQ ID NO: 2329), GUAguuaagu (SEQ ID NO: 2330), GUAguuucug (SEQ ID NO: 2331), GUCguaagug (SEQ ID NO: 2332), GUCgugagug (SEQ ID NO: 2333), GUCgugaguu (SEQ ID NO: 2334), GUGgcaagua (SEQ ID NO: 2335), GUGgcuugua (SEQ ID NO: 2336), GUGguaaaau (SEQ ID NO: 2337), GUGguaaaga (SEQ ID NO: 2338), GUGguaaauu (SEQ ID NO: 2339), GUGguaacau (SEQ ID NO: 2340), GUGguaacua (SEQ ID NO: 2341), GUGguaagaa (SEQ ID NO: 2342), GUGguaagac (SEQ ID NO: 2343), GUGguaagag (SEQ ID NO: 2344), GUGguaagau (SEQ ID NO: 2345), GUGguaagca (SEQ ID NO: 2346), GUGguaagcg (SEQ ID NO: 2347), GUGguaagcu (SEQ ID NO: 2348), GUGguaagga (SEQ ID NO: 2349), GUGguaaggc (SEQ ID NO: 2350), GUGguaagua (SEQ ID NO: 2351), GUGguaaguc (SEQ ID NO: 2352), GUGguaagug (SEQ ID NO: 2353), GUGguaaguu (SEQ ID NO: 2354), GUGguaauga (SEQ ID NO: 2355), GUGguaauuc (SEQ ID NO: 2356), GUGguaauuu (SEQ ID NO: 2357), GUGguacaug (SEQ ID NO: 2358), GUGguacgau (SEQ ID NO: 2359), GUGguacuau (SEQ ID NO: 2360), GUGguacuug (SEQ ID NO: 2361), GUGguagaua (SEQ ID NO: 2362), GUGguagcgc (SEQ ID NO: 2363), GUGguaggga (SEQ ID NO: 2364), GUGguagguc (SEQ ID NO: 2365), GUGguaggug (SEQ ID NO: 2366), GUGguagguu (SEQ ID NO: 2367), GUGguauaaa (SEQ ID NO: 2368), GUGguaucuc (SEQ ID NO: 2369), GUGguaugaa (SEQ ID NO: 2370), GUGguaugau (SEQ ID NO: 2371), GUGguaugca (SEQ ID NO: 2372), GUGguaugua (SEQ ID NO: 2373), GUGguauguu (SEQ ID NO: 2374), GUGguccgug (SEQ ID NO: 2375), GUGgucuggc (SEQ ID NO: 2376), GUGgugaaac (SEQ ID NO: 2377), GUGgugagaa (SEQ ID NO: 2378), GUGgugagau (SEQ ID NO: 2379), GUGgugagca (SEQ ID NO: 2380), GUGgugagcu (SEQ ID NO: 2381), GUGgugagga (SEQ ID NO: 2382), GUGgugaggc (SEQ ID NO: 2383), GUGgugagug (SEQ ID NO: 2384), GUGgugaguu (SEQ ID NO: 2385), GUGgugauua (SEQ ID NO: 2386), GUGgugauuc (SEQ ID NO: 2387), GUGgugcgau (SEQ ID NO: 2388), GUGgugcuua (SEQ ID NO: 2389), GUGgugggaa (SEQ ID NO: 2390), GUGgugggua (SEQ ID NO: 2391), GUGguggguc (SEQ ID NO: 2392), GUGguguccg (SEQ ID NO: 2393), GUGguuagca (SEQ ID NO: 2394), GUGguuaggu (SEQ ID NO: 2395), GUGguuagug (SEQ ID NO: 2396), GUGguuugca (SEQ ID NO: 2397), GUGguuugua (SEQ ID NO: 2398), GUUguaaggu (SEQ ID NO: 2399), GUUguaagua (SEQ ID NO: 2400), GUUguaaguc (SEQ ID NO: 2401), GUUguaaguu (SEQ ID NO: 2402), GUUguaccac (SEQ ID NO: 2403), GUUguagcgu (SEQ ID NO: 2404), GUUguaugug (SEQ ID NO: 2405), GUUguauguu (SEQ ID NO: 2406), GUUgucugug (SEQ ID NO: 2407), GUUgugagcu (SEQ ID NO: 2408), GUUgugagug (SEQ ID NO: 2409), GUUgugaguu (SEQ ID NO: 2410), GUUgugggua (SEQ ID NO: 2411), GUUguggguu (SEQ ID NO: 2412), UAAguaaaug (SEQ ID NO: 2413), UAAguaacua (SEQ ID NO: 2414), UAAguaagaa (SEQ ID NO: 2415), UAAguaagag (SEQ ID NO: 2416), UAAguaagau (SEQ ID NO: 2417), UAAguaagca (SEQ ID NO: 2418), UAAguaagcu (SEQ ID NO: 2419), UAAguaagga (SEQ ID NO: 2420), UAAguaaggu (SEQ ID NO: 2421), UAAguaagua (SEQ ID NO: 2422), UAAguaaguc (SEQ ID NO: 2423), UAAguaagug (SEQ ID NO: 2424), UAAguaaguu (SEQ ID NO: 2425), UAAguaauaa (SEQ ID NO: 2426), UAAguacuag (SEQ ID NO: 2427), UAAguaguuu (SEQ ID NO: 2428), UAAguauaaa (SEQ ID NO: 2429), UAAguauaca (SEQ ID NO: 2430), UAAguaugua (SEQ ID NO: 2431), UAAguauuau (SEQ ID NO: 2432), UAAguauuuu (SEQ ID NO: 2433), UAAgucuuuu (SEQ ID NO: 2434), UAAgugagac (SEQ ID NO: 2435), UAAgugagga (SEQ ID NO: 2436), UAAgugaggg (SEQ ID NO: 2437), UAAgugagua (SEQ ID NO: 2438), UAAgugaguc (SEQ ID NO: 2439), UAAgugagug (SEQ ID NO: 2440), UAAgugaguu (SEQ ID NO: 2441), UAAgugaucc (SEQ ID NO: 2442), UAAgugauuc (SEQ ID NO: 2443), UAAgugcgug (SEQ ID NO: 2444), UAAguuaagu (SEQ ID NO: 2445), UAAguuccag (SEQ ID NO: 2446), UAAguucuuu (SEQ ID NO: 2447), UAAguuguaa (SEQ ID NO: 2448), UAAguuguau (SEQ ID NO: 2449), UAAguuuguu (SEQ ID NO: 2450), UACguaacug (SEQ ID NO: 2451), UACguaagaa (SEQ ID NO: 2452), UACguaagau (SEQ ID NO: 2453), UACguaagua (SEQ ID NO: 2454), UACguaagug (SEQ ID NO: 2455), UACguauccu (SEQ ID NO: 2456), UACgucuggc (SEQ ID NO: 2457), UACgugacca (SEQ ID NO: 2458), UAGgcaagac (SEQ ID NO: 2459), UAGgcaaguc (SEQ ID NO: 2460), UAGgcagguc (SEQ ID NO: 2461), UAGgcgugug (SEQ ID NO: 2462), UAGguaaaaa (SEQ ID NO: 2463), UAGguaaaac (SEQ ID NO: 2464), UAGguaaaag (SEQ ID NO: 2465), UAGguaaaau (SEQ ID NO: 2466), UAGguaaaca (SEQ ID NO: 2467), UAGguaaaga (SEQ ID NO: 2468), UAGguaaaua (SEQ ID NO: 2469), UAGguaaauc (SEQ ID NO: 2470), UAGguaaaug (SEQ ID NO: 2471), UAGguaaauu (SEQ ID NO: 2472), UAGguaacac (SEQ ID NO: 2473), UAGguaacag (SEQ ID NO: 2474), UAGguaacau (SEQ ID NO: 2475), UAGguaacca (SEQ ID NO: 2476), UAGguaacgg (SEQ ID NO: 2477), UAGguaacua (SEQ ID NO: 2478), UAGguaacuc (SEQ ID NO: 2479), UAGguaacug (SEQ ID NO: 2480), UAGguaacuu (SEQ ID NO: 2481), UAGguaagac (SEQ ID NO: 2482), UAGguaagag (SEQ ID NO: 2483), UAGguaagau (SEQ ID NO: 2484), UAGguaagca (SEQ ID NO: 2485), UAGguaagcc (SEQ ID NO: 2486), UAGguaagcu (SEQ ID NO: 2487), UAGguaagga (SEQ ID NO: 2488), UAGguaaggc (SEQ ID NO: 2489), UAGguaaggg (SEQ ID NO: 2490), UAGguaagua (SEQ ID NO: 2491), UAGguaaguc (SEQ ID NO: 2492), UAGguaagug (SEQ ID NO: 2493), UAGguaaguu (SEQ ID NO: 2494), UAGguaauag (SEQ ID NO: 2495), UAGguaauau (SEQ ID NO: 2496), UAGguaaucu (SEQ ID NO: 2497), UAGguaauga (SEQ ID NO: 2498), UAGguaaugg (SEQ ID NO: 2499), UAGguaaugu (SEQ ID NO: 2500), UAGguaauua (SEQ ID NO: 2501), UAGguaauuc (SEQ ID NO: 2502), UAGguaauuu (SEQ ID NO: 2503), UAGguacagc (SEQ ID NO: 2504), UAGguacagu (SEQ ID NO: 2505), UAGguacauu (SEQ ID NO: 2506), UAGguaccag (SEQ ID NO: 2507), UAGguaccua (SEQ ID NO: 2508), UAGguaccuu (SEQ ID NO: 2509), UAGguacgag (SEQ ID NO: 2510), UAGguacgua (SEQ ID NO: 2511), UAGguacguu (SEQ ID NO: 2512), UAGguacuau (SEQ ID NO: 2513), UAGguacuga (SEQ ID NO: 2514), UAGguacugg (SEQ ID NO: 2515), UAGguacuuc (SEQ ID NO: 2516), UAGguacuuu (SEQ ID NO: 2517), UAGguagcgg (SEQ ID NO: 2518), UAGguaggaa (SEQ ID NO: 2519), UAGguaggac (SEQ ID NO: 2520), UAGguaggau (SEQ ID NO: 2521), UAGguaggga (SEQ ID NO: 2522), UAGguagggg (SEQ ID NO: 2523), UAGguaggua (SEQ ID NO: 2524), UAGguagguc (SEQ ID NO: 2525), UAGguaggug (SEQ ID NO: 2526), UAGguagguu (SEQ ID NO: 2527), UAGguaguaa (SEQ ID NO: 2528), UAGguagucu (SEQ ID NO: 2529), UAGguagugg (SEQ ID NO: 2530), UAGguagugu (SEQ ID NO: 2531), UAGguaguuu (SEQ ID NO: 2532), UAGguauaaa (SEQ ID NO: 2533), UAGguauaac (SEQ ID NO: 2534), UAGguauaag (SEQ ID NO: 2535), UAGguauaau (SEQ ID NO: 2536), UAGguauaca (SEQ ID NO: 2537), UAGguauacu (SEQ ID NO: 2538), UAGguauaua (SEQ ID NO: 2539), UAGguauauc (SEQ ID NO: 2540), UAGguauauu (SEQ ID NO: 2541), UAGguaucag (SEQ ID NO: 2542), UAGguaucua (SEQ ID NO: 2543), UAGguaucuc (SEQ ID NO: 2544), UAGguaugaa (SEQ ID NO: 2545), UAGguaugag (SEQ ID NO: 2546), UAGguaugca (SEQ ID NO: 2547), UAGguaugga (SEQ ID NO: 2548), UAGguauggc (SEQ ID NO: 2549), UAGguauggu (SEQ ID NO: 2550), UAGguaugua (SEQ ID NO: 2551), UAGguauguc (SEQ ID NO: 2552), UAGguaugug (SEQ ID NO: 2553), UAGguauguu (SEQ ID NO: 2554), UAGguauuaa (SEQ ID NO: 2555), UAGguauuac (SEQ ID NO: 2556), UAGguauuau (SEQ ID NO: 2557), UAGguauuca (SEQ ID NO: 2558), UAGguauucc (SEQ ID NO: 2559), UAGguauucu (SEQ ID NO: 2560), UAGguauuga (SEQ ID NO: 2561), UAGguauuua (SEQ ID NO: 2562), UAGguauuuc (SEQ ID NO: 2563), UAGguauuuu (SEQ ID NO: 2564), UAGgucacuc (SEQ ID NO: 2565), UAGgucagcu (SEQ ID NO: 2566), UAGgucaggu (SEQ ID NO: 2567), UAGgucagua (SEQ ID NO: 2568), UAGgucagug (SEQ ID NO: 2569), UAGgucaguu (SEQ ID NO: 2570), UAGgucaucu (SEQ ID NO: 2571), UAGgucauug (SEQ ID NO: 2572), UAGguccaau (SEQ ID NO: 2573), UAGguccugu (SEQ ID NO: 2574), UAGgucucaa (SEQ ID NO: 2575), UAGgucucgc (SEQ ID NO: 2576), UAGgucuggc (SEQ ID NO: 2577), UAGgucuguc (SEQ ID NO: 2578), UAGgucugug (SEQ ID NO: 2579), UAGgugaagu (SEQ ID NO: 2580), UAGgugaaua (SEQ ID NO: 2581), UAGgugaaug (SEQ ID NO: 2582), UAGgugaauu (SEQ ID NO: 2583), UAGgugacau (SEQ ID NO: 2584), UAGgugacca (SEQ ID NO: 2585), UAGgugacua (SEQ ID NO: 2586), UAGgugagaa (SEQ ID NO: 2587), UAGgugagac (SEQ ID NO: 2588), UAGgugagag (SEQ ID NO: 2589), UAGgugagau (SEQ ID NO: 2590), UAGgugagcc (SEQ ID NO: 2591), UAGgugagcu (SEQ ID NO: 2592), UAGgugagga (SEQ ID NO: 2593), UAGgugaggc (SEQ ID NO: 2594), UAGgugaggu (SEQ ID NO: 2595), UAGgugagua (SEQ ID NO: 2596), UAGgugaguc (SEQ ID NO: 2597), UAGgugagug (SEQ ID NO: 2598), UAGgugauca (SEQ ID NO: 2599), UAGgugauuc (SEQ ID NO: 2600), UAGgugauuu (SEQ ID NO: 2601), UAGgugcaua (SEQ ID NO: 2602), UAGgugcauc (SEQ ID NO: 2603), UAGgugccgu (SEQ ID NO: 2604), UAGgugccug (SEQ ID NO: 2605), UAGgugcgca (SEQ ID NO: 2606), UAGgugcgua (SEQ ID NO: 2607), UAGgugcgug (SEQ ID NO: 2608), UAGgugcuga (SEQ ID NO: 2609), UAGguggaua (SEQ ID NO: 2610), UAGgugggaa (SEQ ID NO: 2611), UAGgugggac (SEQ ID NO: 2612), UAGgugggag (SEQ ID NO: 2613), UAGgugggau (SEQ ID NO: 2614), UAGgugggcc (SEQ ID NO: 2615), UAGgugggcu (SEQ ID NO: 2616), UAGguggguu (SEQ ID NO: 2617), UAGguggugu (SEQ ID NO: 2618), UAGguguaaa (SEQ ID NO: 2619), UAGgugugaa (SEQ ID NO: 2620), UAGgugugag (SEQ ID NO: 2621), UAGgugugca (SEQ ID NO: 2622), UAGgugugcc (SEQ ID NO: 2623), UAGgugugcg (SEQ ID NO: 2624), UAGguguggu (SEQ ID NO: 2625), UAGgugugua (SEQ ID NO: 2626), UAGgugugug (SEQ ID NO: 2627), UAGguguugg (SEQ ID NO: 2628), UAGguuaagc (SEQ ID NO: 2629), UAGguuagac (SEQ ID NO: 2630), UAGguuagcc (SEQ ID NO: 2631), UAGguuaggc (SEQ ID NO: 2632), UAGguuagua (SEQ ID NO: 2633), UAGguuaguc (SEQ ID NO: 2634), UAGguuagug (SEQ ID NO: 2635), UAGguucccc (SEQ ID NO: 2636), UAGguucuac (SEQ ID NO: 2637), UAGguuggua (SEQ ID NO: 2638), UAGguugguu (SEQ ID NO: 2639), UAGguugucc (SEQ ID NO: 2640), UAGguuuauu (SEQ ID NO: 2641), UAGguuugcc (SEQ ID NO: 2642), UAGguuugua (SEQ ID NO: 2643), UAGguuuguc (SEQ ID NO: 2644), UAGguuugug (SEQ ID NO: 2645), UAGguuuguu (SEQ ID NO: 2646), UAGguuuuuc (SEQ ID NO: 2647), UAGguuuuug (SEQ ID NO: 2648), UAUguaagaa (SEQ ID NO: 2649), UAUguaagau (SEQ ID NO: 2650), UAUguaagca (SEQ ID NO: 2651), UAUguaagcc (SEQ ID NO: 2652), UAUguaagua (SEQ ID NO: 2653), UAUguaaguc (SEQ ID NO: 2654), UAUguaagug (SEQ ID NO: 2655), UAUguaaguu (SEQ ID NO: 2656), UAUguacgug (SEQ ID NO: 2657), UAUguacguu (SEQ ID NO: 2658), UAUguagguc (SEQ ID NO: 2659), UAUguagguu (SEQ ID NO: 2660), UAUguauccu (SEQ ID NO: 2661), UAUguaucuc (SEQ ID NO: 2662), UAUguaugua (SEQ ID NO: 2663), UAUguauguc (SEQ ID NO: 2664), UAUguaugug (SEQ ID NO: 2665), UAUguauuau (SEQ ID NO: 2666), UAUgucagaa (SEQ ID NO: 2667), UAUgucugua (SEQ ID NO: 2668), UAUgugaaua (SEQ ID NO: 2669), UAUgugacag (SEQ ID NO: 2670), UAUgugagua (SEQ ID NO: 2671), UAUgugagug (SEQ ID NO: 2672), UAUgugaguu (SEQ ID NO: 2673), UAUgugggca (SEQ ID NO: 2674), UAUgugugua (SEQ ID NO: 2675), UAUguguuua (SEQ ID NO: 2676), UAUguuuugu (SEQ ID NO: 2677), UCAgcgacau (SEQ ID NO: 2678), UCAguaaaau (SEQ ID NO: 2679), UCAguaaaua (SEQ ID NO: 2680), UCAguaacug (SEQ ID NO: 2681), UCAguaagaa (SEQ ID NO: 2682), UCAguaagag (SEQ ID NO: 2683), UCAguaagau (SEQ ID NO: 2684), UCAguaagca (SEQ ID NO: 2685), UCAguaagcc (SEQ ID NO: 2686), UCAguaagcu (SEQ ID NO: 2687), UCAguaaggg (SEQ ID NO: 2688), UCAguaagua (SEQ ID NO: 2689), UCAguaaguc (SEQ ID NO: 2690), UCAguaagug (SEQ ID NO: 2691), UCAguaaguu (SEQ ID NO: 2692), UCAguaucuu (SEQ ID NO: 2693), UCAguaugga (SEQ ID NO: 2694), UCAguauggu (SEQ ID NO: 2695), UCAgucccca (SEQ ID NO: 2696), UCAgugagca (SEQ ID NO: 2697), UCAgugagcu (SEQ ID NO: 2698), UCAgugagua (SEQ ID NO: 2699), UCAgugagug (SEQ ID NO: 2700), UCAgugaguu (SEQ ID NO: 2701), UCAgugauug (SEQ ID NO: 2702), UCAgugggug (SEQ ID NO: 2703), UCAguugagc (SEQ ID NO: 2704), UCAguugauu (SEQ ID NO: 2705), UCAguuuagu (SEQ ID NO: 2706), UCCguaagca (SEQ ID NO: 2707), UCCguaagcu (SEQ ID NO: 2708), UCCguaaguc (SEQ ID NO: 2709), UCCguaagug (SEQ ID NO: 2710), UCCguaauag (SEQ ID NO: 2711), UCCguacuua (SEQ ID NO: 2712), UCCguaugua (SEQ ID NO: 2713), UCCguauguu (SEQ ID NO: 2714), UCCgugagau (SEQ ID NO: 2715), UCCgugaguc (SEQ ID NO: 2716), UCGguaaauu (SEQ ID NO: 2717), UCGguaagag (SEQ ID NO: 2718), UCGguaagcu (SEQ ID NO: 2719), UCGguacauc (SEQ ID NO: 2720), UCGguacucc (SEQ ID NO: 2721), UCGguagacc (SEQ ID NO: 2722), UCGguagguu (SEQ ID NO: 2723), UCGguaguaa (SEQ ID NO: 2724), UCGguaugug (SEQ ID NO: 2725), UCGguauguu (SEQ ID NO: 2726), UCGguauuga (SEQ ID NO: 2727), UCGgucagua (SEQ ID NO: 2728), UCGgucuuag (SEQ ID NO: 2729), UCGgugaagu (SEQ ID NO: 2730), UCGgugagaa (SEQ ID NO: 2731), UCGgugagca (SEQ ID NO: 2732), UCGgugaggc (SEQ ID NO: 2733), UCGgugagua (SEQ ID NO: 2734), UCGgugcgcu (SEQ ID NO: 2735), UCGgugcuuu (SEQ ID NO: 2736), UCGgugguuu (SEQ ID NO: 2737), UCGguuagcu (SEQ ID NO: 2738), UCUguaaaag (SEQ ID NO: 2739), UCUguaagaa (SEQ ID NO: 2740), UCUguaagau (SEQ ID NO: 2741), UCUguaagca (SEQ ID NO: 2742), UCUguaagcu (SEQ ID NO: 2743), UCUguaagua (SEQ ID NO: 2744), UCUguaaguc (SEQ ID NO: 2745), UCUguaagug (SEQ ID NO: 2746), UCUguaaguu (SEQ ID NO: 2747), UCUguaauaa (SEQ ID NO: 2748), UCUguaauga (SEQ ID NO: 2749), UCUguaaugu (SEQ ID NO: 2750), UCUguaggua (SEQ ID NO: 2751), UCUguagguu (SEQ ID NO: 2752), UCUguauaua (SEQ ID NO: 2753), UCUguaugac (SEQ ID NO: 2754), UCUguaugua (SEQ ID NO: 2755), UCUguccucg (SEQ ID NO: 2756), UCUgugagag (SEQ ID NO: 2757), UCUgugagcu (SEQ ID NO: 2758), UCUgugagga (SEQ ID NO: 2759), UCUgugagua (SEQ ID NO: 2760), UCUgugaguc (SEQ ID NO: 2761), UCUgugagug (SEQ ID NO: 2762), UCUgugaguu (SEQ ID NO: 2763), UCUgugcgua (SEQ ID NO: 2764), UCUgugugag (SEQ ID NO: 2765), UGAguaacuu (SEQ ID NO: 2766), UGAguaagau (SEQ ID NO: 2767), UGAguaagca (SEQ ID NO: 2768), UGAguaagcu (SEQ ID NO: 2769), UGAguaaggc (SEQ ID NO: 2770), UGAguaaggu (SEQ ID NO: 2771), UGAguaagua (SEQ ID NO: 2772), UGAguaaguc (SEQ ID NO: 2773), UGAguaagug (SEQ ID NO: 2774), UGAguaaguu (SEQ ID NO: 2775), UGAguaaucc (SEQ ID NO: 2776), UGAguaauua (SEQ ID NO: 2777), UGAguacagu (SEQ ID NO: 2778), UGAguacgua (SEQ ID NO: 2779), UGAguacguu (SEQ ID NO: 2780), UGAguacugu (SEQ ID NO: 2781), UGAguagcug (SEQ ID NO: 2782), UGAguaggua (SEQ ID NO: 2783), UGAguauaaa (SEQ ID NO: 2784), UGAguaugcu (SEQ ID NO: 2785), UGAguaugga (SEQ ID NO: 2786), UGAguaugua (SEQ ID NO: 2787), UGAguauguc (SEQ ID NO: 2788), UGAguauguu (SEQ ID NO: 2789), UGAgucagag (SEQ ID NO: 2790), UGAgucuacg (SEQ ID NO: 2791), UGAgugaaua (SEQ ID NO: 2792), UGAgugaauu (SEQ ID NO: 2793), UGAgugagaa (SEQ ID NO: 2794), UGAgugagau (SEQ ID NO: 2795), UGAgugagca (SEQ ID NO: 2796), UGAgugagcc (SEQ ID NO: 2797), UGAgugagga (SEQ ID NO: 2798), UGAgugagua (SEQ ID NO: 2799), UGAgugagug (SEQ ID NO: 2800), UGAgugaguu (SEQ ID NO: 2801), UGAgugggaa (SEQ ID NO: 2802), UGAguuaaga (SEQ ID NO: 2803), UGAguuaaug (SEQ ID NO: 2804), UGAguuacgg (SEQ ID NO: 2805), UGAguuaggu (SEQ ID NO: 2806), UGAguucuau (SEQ ID NO: 2807), UGAguugguu (SEQ ID NO: 2808), UGAguuguag (SEQ ID NO: 2809), UGAguuuauc (SEQ ID NO: 2810), UGCguaaguc (SEQ ID NO: 2811), UGCguaagug (SEQ ID NO: 2812), UGCguacggc (SEQ ID NO: 2813), UGCguacggg (SEQ ID NO: 2814), UGCguaugua (SEQ ID NO: 2815), UGGgcaaguc (SEQ ID NO: 2816), UGGgcaagug (SEQ ID NO: 2817), UGGgcacauc (SEQ ID NO: 2818), UGGgccacgu (SEQ ID NO: 2819), UGGgccccgg (SEQ ID NO: 2820), UGGguaaaau (SEQ ID NO: 2821), UGGguaaagc (SEQ ID NO: 2822), UGGguaaagg (SEQ ID NO: 2823), UGGguaaagu (SEQ ID NO: 2824), UGGguaaaua (SEQ ID NO: 2825), UGGguaaaug (SEQ ID NO: 2826), UGGguaaauu (SEQ ID NO: 2827), UGGguaacag (SEQ ID NO: 2828), UGGguaacau (SEQ ID NO: 2829), UGGguaacua (SEQ ID NO: 2830), UGGguaacuu (SEQ ID NO: 2831), UGGguaagaa (SEQ ID NO: 2832), UGGguaagac (SEQ ID NO: 2833), UGGguaagag (SEQ ID NO: 2834), UGGguaagau (SEQ ID NO: 2835), UGGguaagca (SEQ ID NO: 2836), UGGguaagcc (SEQ ID NO: 2837), UGGguaagcu (SEQ ID NO: 2838), UGGguaaggg (SEQ ID NO: 2839), UGGguaaggu (SEQ ID NO: 2840), UGGguaagua (SEQ ID NO: 2841), UGGguaaguc (SEQ ID NO: 2842), UGGguaagug (SEQ ID NO: 2843), UGGguaaguu (SEQ ID NO: 2844), UGGguaaugu (SEQ ID NO: 2845), UGGguaauua (SEQ ID NO: 2846), UGGguaauuu (SEQ ID NO: 2847), UGGguacaaa (SEQ ID NO: 2848), UGGguacagu (SEQ ID NO: 2849), UGGguacuac (SEQ ID NO: 2850), UGGguaggga (SEQ ID NO: 2851), UGGguagguc (SEQ ID NO: 2852), UGGguaggug (SEQ ID NO: 2853), UGGguagguu (SEQ ID NO: 2854), UGGguaguua (SEQ ID NO: 2855), UGGguauagu (SEQ ID NO: 2856), UGGguaugaa (SEQ ID NO: 2857), UGGguaugac (SEQ ID NO: 2858), UGGguaugag (SEQ ID NO: 2859), UGGguaugua (SEQ ID NO: 2860), UGGguauguc (SEQ ID NO: 2861), UGGguaugug (SEQ ID NO: 2862), UGGguauguu (SEQ ID NO: 2863), UGGguauuug (SEQ ID NO: 2864), UGGgucuuug (SEQ ID NO: 2865), UGGgugaccu (SEQ ID NO: 2866), UGGgugacua (SEQ ID NO: 2867), UGGgugagac (SEQ ID NO: 2868), UGGgugagag (SEQ ID NO: 2869), UGGgugagca (SEQ ID NO: 2870), UGGgugagcc (SEQ ID NO: 2871), UGGgugagga (SEQ ID NO: 2872), UGGgugaggc (SEQ ID NO: 2873), UGGgugaggg (SEQ ID NO: 2874), UGGgugagua (SEQ ID NO: 2875), UGGgugaguc (SEQ ID NO: 2876), UGGgugagug (SEQ ID NO: 2877), UGGgugaguu (SEQ ID NO: 2878), UGGgugcgug (SEQ ID NO: 2879), UGGguggagg (SEQ ID NO: 2880), UGGguggcuu (SEQ ID NO: 2881), UGGguggggg (SEQ ID NO: 2882), UGGgugggua (SEQ ID NO: 2883), UGGguggguc (SEQ ID NO: 2884), UGGgugggug (SEQ ID NO: 2885), UGGguggguu (SEQ ID NO: 2886), UGGgugugga (SEQ ID NO: 2887), UGGguguguc (SEQ ID NO: 2888), UGGgugugug (SEQ ID NO: 2889), UGGguguguu (SEQ ID NO: 2890), UGGguguuua (SEQ ID NO: 2891), UGGguuaaug (SEQ ID NO: 2892), UGGguuaguc (SEQ ID NO: 2893), UGGguuagug (SEQ ID NO: 2894), UGGguuaguu (SEQ ID NO: 2895), UGGguucaag (SEQ ID NO: 2896), UGGguucgua (SEQ ID NO: 2897), UGGguuggug (SEQ ID NO: 2898), UGGguuuaag (SEQ ID NO: 2899), UGGguuugua (SEQ ID NO: 2900), UGUgcaagua (SEQ ID NO: 2901), UGUguaaaua (SEQ ID NO: 2902), UGUguaagaa (SEQ ID NO: 2903), UGUguaagac (SEQ ID NO: 2904), UGUguaagag (SEQ ID NO: 2905), UGUguaaggu (SEQ ID NO: 2906), UGUguaagua (SEQ ID NO: 2907), UGUguaaguc (SEQ ID NO: 2908), UGUguaaguu (SEQ ID NO: 2909), UGUguacuuc (SEQ ID NO: 2910), UGUguaggcg (SEQ ID NO: 2911), UGUguaggua (SEQ ID NO: 2912), UGUguaguua (SEQ ID NO: 2913), UGUguaugug (SEQ ID NO: 2914), UGUgucagua (SEQ ID NO: 2915), UGUgucugua (SEQ ID NO: 2916), UGUgucuguc (SEQ ID NO: 2917), UGUgugaccc (SEQ ID NO: 2918), UGUgugagau (SEQ ID NO: 2919), UGUgugagca (SEQ ID NO: 2920), UGUgugagcc (SEQ ID NO: 2921), UGUgugagua (SEQ ID NO: 2922), UGUgugaguc (SEQ ID NO: 2923), UGUgugagug (SEQ ID NO: 2924), UGUgugcgug (SEQ ID NO: 2925), UGUgugggug (SEQ ID NO: 2926), UGUguggguu (SEQ ID NO: 2927), UGUgugugag (SEQ ID NO: 2928), UGUguguucu (SEQ ID NO: 2929), UGUguuuaga (SEQ ID NO: 2930), UUAguaaaua (SEQ ID NO: 2931), UUAguaagaa (SEQ ID NO: 2932), UUAguaagua (SEQ ID NO: 2933), UUAguaagug (SEQ ID NO: 2934), UUAguaaguu (SEQ ID NO: 2935), UUAguaggug (SEQ ID NO: 2936), UUAgugagca (SEQ ID NO: 2937), UUAgugaguu (SEQ ID NO: 2938), UUAguuaagu (SEQ ID NO: 2939), UUCguaaguc (SEQ ID NO: 2940), UUCguaaguu (SEQ ID NO: 2941), UUCguaauua (SEQ ID NO: 2942), UUCgugagua (SEQ ID NO: 2943), UUCgugaguu (SEQ ID NO: 2944), UUGgcaagug (SEQ ID NO: 2945), UUGgccgagu (SEQ ID NO: 2946), UUGguaaaaa (SEQ ID NO: 2947), UUGguaaaau (SEQ ID NO: 2948), UUGguaaaga (SEQ ID NO: 2949), UUGguaaagg (SEQ ID NO: 2950), UUGguaaagu (SEQ ID NO: 2951), UUGguaaauc (SEQ ID NO: 2952), UUGguaaaug (SEQ ID NO: 2953), UUGguaaauu (SEQ ID NO: 2954), UUGguaacug (SEQ ID NO: 2955), UUGguaacuu (SEQ ID NO: 2956), UUGguaagaa (SEQ ID NO: 2957), UUGguaagag (SEQ ID NO: 2958), UUGguaagcu (SEQ ID NO: 2959), UUGguaagga (SEQ ID NO: 2960), UUGguaaggg (SEQ ID NO: 2961), UUGguaagua (SEQ ID NO: 2962), UUGguaagug (SEQ ID NO: 2963), UUGguaaguu (SEQ ID NO: 2964), UUGguaauac (SEQ ID NO: 2965), UUGguaauca (SEQ ID NO: 2966), UUGguaaugc (SEQ ID NO: 2967), UUGguaaugu (SEQ ID NO: 2968), UUGguaauug (SEQ ID NO: 2969), UUGguaauuu (SEQ ID NO: 2970), UUGguacaua (SEQ ID NO: 2971), UUGguacgug (SEQ ID NO: 2972), UUGguagagg (SEQ ID NO: 2973), UUGguaggac (SEQ ID NO: 2974), UUGguaggcg (SEQ ID NO: 2975), UUGguaggcu (SEQ ID NO: 2976), UUGguaggga (SEQ ID NO: 2977), UUGguaggua (SEQ ID NO: 2978), UUGguagguc (SEQ ID NO: 2979), UUGguaggug (SEQ ID NO: 2980), UUGguauaaa (SEQ ID NO: 2981), UUGguauaca (SEQ ID NO: 2982), UUGguauauu (SEQ ID NO: 2983), UUGguaucua (SEQ ID NO: 2984), UUGguaucuc (SEQ ID NO: 2985), UUGguaugca (SEQ ID NO: 2986), UUGguaugua (SEQ ID NO: 2987), UUGguaugug (SEQ ID NO: 2988), UUGguauguu (SEQ ID NO: 2989), UUGguauugu (SEQ ID NO: 2990), UUGguauuua (SEQ ID NO: 2991), UUGguauuuu (SEQ ID NO: 2992), UUGgucagaa (SEQ ID NO: 2993), UUGgucagua (SEQ ID NO: 2994), UUGgucucug (SEQ ID NO: 2995), UUGgucugca (SEQ ID NO: 2996), UUGgugaaaa (SEQ ID NO: 2997), UUGgugacug (SEQ ID NO: 2998), UUGgugagac (SEQ ID NO: 2999), UUGgugagau (SEQ ID NO: 3000), UUGgugagca (SEQ ID NO: 3001), UUGgugagga (SEQ ID NO: 3002), UUGgugaggg (SEQ ID NO: 3003), UUGgugagua (SEQ ID NO: 3004), UUGgugaguc (SEQ ID NO: 3005), UUGgugagug (SEQ ID NO: 3006), UUGgugaguu (SEQ ID NO: 3007), UUGgugaugg (SEQ ID NO: 3008), UUGgugauua (SEQ ID NO: 3009), UUGgugauug (SEQ ID NO: 3010), UUGgugcaca (SEQ ID NO: 3011), UUGgugggaa (SEQ ID NO: 3012), UUGguggggc (SEQ ID NO: 3013), UUGgugggua (SEQ ID NO: 3014), UUGguggguc (SEQ ID NO: 3015), UUGgugggug (SEQ ID NO: 3016), UUGguggguu (SEQ ID NO: 3017), UUGguguggu (SEQ ID NO: 3018), UUGguguguc (SEQ ID NO: 3019), UUGgugugug (SEQ ID NO: 3020), UUGguguguu (SEQ ID NO: 3021), UUGguuaagu (SEQ ID NO: 3022), UUGguuagca (SEQ ID NO: 3023), UUGguuagug (SEQ ID NO: 3024), UUGguuaguu (SEQ ID NO: 3025), UUGguuggga (SEQ ID NO: 3026), UUGguugguu (SEQ ID NO: 3027), UUGguuugua (SEQ ID NO: 3028), UUGguuuguc (SEQ ID NO: 3029), UUUgcaagug (SEQ ID NO: 3030), UUUguaaaua (SEQ ID NO: 3031), UUUguaaaug (SEQ ID NO: 3032), UUUguaagaa (SEQ ID NO: 3033), UUUguaagac (SEQ ID NO: 3034), UUUguaagag (SEQ ID NO: 3035), UUUguaagca (SEQ ID NO: 3036), UUUguaaggu (SEQ ID NO: 3037), UUUguaagua (SEQ ID NO: 3038), UUUguaaguc (SEQ ID NO: 3039), UUUguaagug (SEQ ID NO: 3040), UUUguaaguu (SEQ ID NO: 3041), UUUguaauuu (SEQ ID NO: 3042), UUUguacagg (SEQ ID NO: 3043), UUUguacgug (SEQ ID NO: 3044), UUUguacuag (SEQ ID NO: 3045), UUUguacugu (SEQ ID NO: 3046), UUUguagguu (SEQ ID NO: 3047), UUUguauccu (SEQ ID NO: 3048), UUUguauguu (SEQ ID NO: 3049), UUUgugagca (SEQ ID NO: 3050), UUUgugagug (SEQ ID NO: 3051), UUUgugcguc (SEQ ID NO: 3052), UUUguguguc (SEQ ID NO: 3053), and uGGguaccug (SEQ ID NO: 3054).

Additional exemplary gene sequences and splice site sequences (e.g., 5' splice site sequences) include AAGgcaagau (SEQ ID NO: 96), AUGguaugug (SEQ ID NO: 937), GGGgugaggc (SEQ ID NO: 2281), CAGguaggug (SEQ ID NO: 1222), AAGgucagua (SEQ ID NO: 293), AAGguuagag (SEQ ID NO: 3055), AUGgcacuua (SEQ ID NO: 3056), UAAguaaguc (SEQ ID NO: 2423), UGGgugagcu (SEQ ID NO: 3057), CGAgcugggc (SEQ ID NO: 3058), AAAgcacccc (SEQ ID NO: 3059), UAGguggggg (SEQ ID NO: 3060), AGAguaacgu (SEQ ID NO: 3061), UCGgugaugu (SEQ ID NO: 3062), AAUgucaguu (SEQ ID NO: 516), AGGgucugag (SEQ ID NO: 3063), GAGgugacug (SEQ ID NO: 3064), AUGguagguu (SEQ ID NO: 3065), GAGgucuguc (SEQ ID NO: 2000), CAGguaugug (SEQ ID NO: 1260), CAAguacugc (SEQ ID NO: 3066), CACgugcgua (SEQ ID NO: 3067), CCGgugagcu (SEQ ID NO: 3068), CAGguacuuc (SEQ ID NO: 3069), CAGgcgagag (SEQ ID NO: 1115), GAAgcaagua (SEQ ID NO: 3070), AGGgugagca (SEQ ID NO: 789), CAGgcaaguc (SEQ ID NO: 3071), AAGgugaggc (SEQ ID NO: 344), CAGguaagua (SEQ ID NO: 1147), CCAguugggu (SEQ ID NO: 3072), AAGguguggg (SEQ ID NO: 3073), CAGguuggag (SEQ ID NO: 1484), CCGguaugaa (SEQ ID NO: 3074), UGGguaaugu (SEQ ID NO: 2845), CAGgugaggu (SEQ ID NO: 1344), AGAguaauag (SEQ ID NO: 3075), CAGguaugag (SEQ ID NO: 1249), AUGguaaguu (SEQ ID NO: 901), UUGguggguc (SEQ ID NO: 3015), UUUguaagca (SEQ ID NO: 3036), CUCguaugcc (SEQ ID NO: 3076), UAGguaagag (SEQ ID NO: 2483), UAGgcaaguu (SEQ ID NO: 3077), GGAguuaagu (SEQ ID NO: 3078), GAGguaugcc (SEQ ID NO: 1959), AAGguguggu (SEQ ID NO: 402), CAGgugggug (SEQ ID NO: 1415), UUAguaagua (SEQ ID NO: 2933), AAGguuggcu (SEQ ID NO: 3079), UGAguaugug (SEQ ID NO: 3080), CCAgccuucc (SEQ ID NO: 3081), CCUguacgug (SEQ ID NO: 3082), CCUguaggua (SEQ ID NO: 1601), CAGguacgcu (SEQ ID NO: 3083), GAGguucuuc (SEQ ID NO: 3084), AAGguugccu (SEQ ID NO: 3085), CGUguucacu (SEQ ID NO: 3086), CGGgugggga (SEQ ID NO: 3087), UAGgugggau (SEQ ID NO: 2614), CGGguaagga (SEQ ID NO: 3088), AAGguacuau (SEQ ID NO: 195), GGGguaagcu (SEQ ID NO: 2248), ACGguagagc (SEQ ID NO: 3089), CAGgugaaga (SEQ ID NO: 1318), GCGguaagag (SEQ ID NO: 3090), CAGguguugu (SEQ ID NO: 3091), GAAguuugug (SEQ ID NO: 3092), AUGgugagca (SEQ ID NO: 955), CGGguucgug (SEQ ID NO: 3093), AUUguccggc (SEQ ID NO: 3094), GAUgugugug (SEQ ID NO: 3095), AUGgucuguu (SEQ ID NO: 3096), AAGguaggau (SEQ ID NO: 219), CCGguaagau (SEQ ID NO: 1575), AAGguaaaga (SEQ ID NO: 126), GGGgugaguu (SEQ ID NO: 2285), AGGguuggug (SEQ ID NO: 808), GGAgugagug (SEQ ID NO: 2228), AGUguaagga (SEQ ID NO: 3097), UAGguaacug (SEQ ID NO: 2480), AAGgugaaga (SEQ ID NO: 3098), UGGguaagug (SEQ ID NO: 2843), CAGguaagag (SEQ ID NO: 1140), UAGgugagcg (SEQ ID NO: 3099), GAGguaaaaa (SEQ ID NO: 1865), GCCguaaguu (SEQ ID NO: 3100), AAGguuuugu (SEQ ID NO: 473), CAGgugagga (SEQ ID NO: 1341), ACAgcccaug (SEQ ID NO: 3101), GCGgugagcc (SEQ ID NO: 3102), CAGguaugca (SEQ ID NO: 1251), AUGguaccua (SEQ ID NO: 3103), CAAguaugua (SEQ ID NO: 1050), AUGguggugc (SEQ ID NO: 3104), UAAguggcag (SEQ ID NO: 3105), UAGguauagu (SEQ ID NO: 3106), CUGguauuua (SEQ ID NO: 3107), AGGguaaacg (SEQ ID NO: 3108), AUAguaagug (SEQ ID NO: 850), UUGguacuga (SEQ ID NO: 3109), GGUguaagcc (SEQ ID NO: 2303), GAGguggaua (SEQ ID NO: 3110), GAUguaagaa (SEQ ID NO: 3111), ACGgucaguu (SEQ ID NO: 3112), UAAguaaaca (SEQ ID NO: 3113), AAGguaucug (SEQ ID NO: 251), AGGguauuug (SEQ ID NO: 3114), AAGgugaaug (SEQ ID NO: 328), CUGgugaauu (SEQ ID NO: 1749), CAGguuuuuu (SEQ ID NO: 1514), CAUguaugug (SEQ ID NO: 1534), UUGguagagg (SEQ ID NO: 2973), AAGguaugcc (SEQ ID NO: 258), CAGgugccac (SEQ ID NO: 3115), UCGguauuga (SEQ ID NO: 2727), AAGguuugug (SEQ ID NO: 468), AAUguacagg (SEQ ID NO: 3116), CAUguggguu (SEQ ID NO: 1545), CAUgugaguu (SEQ ID NO: 1542), UUGguaaugu (SEQ ID NO: 2968), AGUguaggug (SEQ ID NO: 3117), GAGguaacuc (SEQ ID NO: 3118), GAGguggcgc (SEQ ID NO: 3119), CUGguaauug (SEQ ID NO: 3120), GAGguuugcu (SEQ ID NO: 3121), UGUguacgug (SEQ ID NO: 3122), UAGguaaaga (SEQ ID NO: 2468), CUAguaggca (SEQ ID NO: 3123), UCUgugaguc (SEQ ID NO: 2761), UCUguaaggc (SEQ ID NO: 3124), CAGguuugug (SEQ ID NO: 1509), GAGguagggc (SEQ ID NO: 1935), AAGguaacca (SEQ ID NO: 3125), ACUgugaguu (SEQ ID NO: 646), UAGguaauag (SEQ ID NO: 2495), AAAguaagcu (SEQ ID NO: 17), AUGgugagug (SEQ ID NO: 963), UAGguuugug (SEQ ID NO: 2645), AACguaggac (SEQ ID NO: 3126), GUAgcaggua (SEQ ID NO: 3127), GAGgucagac (SEQ ID NO: 3128), AGGguaugaa (SEQ ID NO: 3129), GAGguuagug (SEQ ID NO: 2089), CAGgcacgug (SEQ ID NO: 3130), GGGgcaagac (SEQ ID NO: 3131), CAGguguguc (SEQ ID NO: 1441), CAGguauuga (SEQ ID NO: 1265), CAGguauguc (SEQ ID NO: 1259), AAGgcaaggu (SEQ ID NO: 3132), UUGgugagaa (SEQ ID NO: 3133), AAGguaaaau (SEQ ID NO: 122), GGGguaagua (SEQ ID NO: 2251), AAGguaucuu (SEQ ID NO: 252), GACgugaguc (SEQ ID NO: 3134), UAUguaugcu (SEQ ID NO: 3135), AAGguacugu (SEQ ID NO: 199), CAGgugaacu (SEQ ID NO: 3136), CACguaaaug (SEQ ID NO: 3137), AAGgugugau (SEQ ID NO: 3138), GAAguauuug (SEQ ID NO: 3139), AAGgucugug (SEQ ID NO: 3140), AAGguggagg (SEQ ID NO: 3141), AAGguauaug (SEQ ID NO: 244), CAGguucuua (SEQ ID NO: 1477), AGGguaacca (SEQ ID NO: 730), CAGgugucac (SEQ ID NO: 1423), AAAguucugu (SEQ ID NO: 3142), UUGgugaguu (SEQ ID NO: 3007), CAAgugaguc (SEQ ID NO: 1067), UAGguagguc (SEQ ID NO: 2525), GCGgugagcu (SEQ ID NO: 2180), AUUgugagga (SEQ ID NO: 3143), CAGgugcaca (SEQ ID NO: 1361), CAGguuggaa (SEQ ID NO: 3144), CUGgucacuu (SEQ ID NO: 3145), GGAguaagug (SEQ ID NO: 2214), GAGgugggcu (SEQ ID NO: 2059), AAGguacuug (SEQ ID NO: 201), AGGguaggau (SEQ ID NO: 3146), AAUguguguu (SEQ ID NO: 3147), ACAguuaagu (SEQ ID NO: 568), GAGgugugug (SEQ ID NO: 2078), AAGgcgggcu (SEQ ID NO: 3148), AUAgcaagua (SEQ ID NO: 3149), AAGguuguua (SEQ ID NO: 454), CAAgcaaggc (SEQ ID NO: 3150), GUGguaauua (SEQ ID NO: 3151), UCUguucagu (SEQ ID NO: 3152), AGGguaggcc (SEQ ID NO: 754), AAGguaucau (SEQ ID NO: 3153), UAGguaccuu (SEQ ID NO: 2509), AAGguaugac (SEQ ID NO: 254), GGAguaggua (SEQ ID NO: 2219), UAAguuggca (SEQ ID NO: 3154), AGUgugaggc (SEQ ID NO: 3155), GAGguuugug (SEQ ID NO: 3156), UGGgucugcu (SEQ ID NO: 3157), CAGgugaucc (SEQ ID NO: 1350), CAGgucagug (SEQ ID NO: 1283), AAGguaaggg (SEQ ID NO: 151), CAGgugcagu (SEQ ID NO: 3158), GAGguggguc (SEQ ID NO: 2064), GCUgugagug (SEQ ID NO: 2206), AAGguggagu (SEQ ID NO: 3159), GGGgucaguu (SEQ ID NO: 3160), AGCguaagug (SEQ ID NO: 719), AGAguaugaa (SEQ ID NO: 691), GGGguagggu (SEQ ID NO: 3161), AAGgccagca (SEQ ID NO: 3162), CGAguaugcc (SEQ ID NO: 3163), GUGgugagcg (SEQ ID NO: 3164), AAUguaaauu (SEQ ID NO: 481), CAGgugcgca (SEQ ID NO: 1375), GGUguaugaa (SEQ ID NO: 3165), CUUgugaguu (SEQ ID NO: 1804), AAGguaucuc (SEQ ID NO: 250), AGAguaagga (SEQ ID NO: 665), UAGguaagac (SEQ ID NO: 2482), GAGgugagug (SEQ ID NO: 2026), CAGguguguu (SEQ ID NO: 1443), UUGgugagua (SEQ ID NO: 3004), AGGgcgaguu (SEQ ID NO: 3166), CAGguuuugc (SEQ ID NO: 3167), UUUgugaguu (SEQ ID NO: 3168), AGGguaagca (SEQ ID NO: 736), GAGguccucu (SEQ ID NO: 3169), CCAgcaggua (SEQ ID NO: 3170), GAGguucgcg (SEQ ID NO: 3171), CAGgugaucu (SEQ ID NO: 1351), ACUguaagua (SEQ ID NO: 625), AAGguaaauc (SEQ ID NO: 131), CAGgcaaaua (SEQ ID NO: 3172), GUGguaagca (SEQ ID NO: 2346), CAGguuaaau (SEQ ID NO: 3173), UUGguaauaa (SEQ ID NO: 3174), UAUguaggua (SEQ ID NO: 3175), CAGguaguau (SEQ ID NO: 1225), AAGgugugcc (SEQ ID NO: 3176), UGGguaagag (SEQ ID NO: 2834), CAGgcaagca (SEQ ID NO: 3177), UUGguaaggg (SEQ ID NO: 2961), AAGgcaggug (SEQ ID NO: 109), ACGguaaaug (SEQ ID NO: 3178), GCUgugagca (SEQ ID NO: 3179), AUGguacaca (SEQ ID NO: 3180), GUAguguguu (SEQ ID NO: 3181), ACUguaagag (SEQ ID NO: 3182), CCCgcagguc (SEQ ID NO: 3183), GAGgugagcc (SEQ ID NO: 2019), GAGgugcugu (SEQ ID NO: 3184), UAAguaugcu (SEQ ID NO: 3185), GAGgccaucu (SEQ ID NO: 3186), UCAgugagug (SEQ ID NO: 2700), CAGgugcuac (SEQ ID NO: 3187), AAUgugggug (SEQ ID NO: 533), GAGgugugaa (SEQ ID NO: 3188), CUGguagguc (SEQ ID NO: 1730), GUGgcgcgcg (SEQ ID NO: 3189), CAGgugcaaa (SEQ ID NO: 1359), UAAguggagg (SEQ ID NO: 3190), CAUgugggua (SEQ ID NO: 3191), GAGguagggu (SEQ ID NO: 3192), AAAgugaguu (SEQ ID NO: 61), AGGguucuag (SEQ ID NO: 3193), UGUgugagcu (SEQ ID NO: 3194), AGGgugaauc (SEQ ID NO: 3195), CAGgucaggg (SEQ ID NO: 3196), AAGgucccug (SEQ ID NO: 3197), CUGguagagu (SEQ ID NO: 3198), UAGgucaguu (SEQ ID NO: 2570), AAAguaaggg (SEQ ID NO: 19), CAAguaugug (SEQ ID NO: 1052), CAGgugcuuu (SEQ ID NO: 3199), AAGguaauuc (SEQ ID NO: 169), GGGgugcacg (SEQ ID NO: 3200), ACUgugcuac (SEQ ID NO: 3201), CAGguaccua (SEQ ID NO: 3202), CAGguagcuu (SEQ ID NO: 1211), UGGgugaggc (SEQ ID NO: 2873), CUGguacauu (SEQ ID NO: 1718), AGGguaaucu (SEQ ID NO: 3203), CAGguacaag (SEQ ID NO: 1161), CAGguaauuc (SEQ ID NO: 1157), AGGgcacuug (SEQ ID NO: 3204), UAGgugagaa (SEQ ID NO: 2587), GAGguaaugc (SEQ ID NO: 3205), CCAgugaguu (SEQ ID NO: 3206), AAAguaugug (SEQ ID NO: 44), CUGgugaauc (SEQ ID NO: 3207), UAUguaugua (SEQ ID NO: 2663), CCUgcaggug (SEQ ID NO: 3208), CAGguaucug (SEQ ID NO: 1245), GAGgugaggu (SEQ ID NO: 3209), CUGguaaaac (SEQ ID NO: 3210), UGUgugugcu (SEQ ID NO: 3211), CAGguuaagu (SEQ ID NO: 3212), CAGguaaucc (SEQ ID NO: 1152), UAGguauuug (SEQ ID NO: 3213), UGGguagguc (SEQ ID NO: 2852), CAGguaacag (SEQ ID NO: 1129), AGCgugcgug (SEQ ID NO: 3214), AAGgucagga (SEQ ID NO: 289), GGUgugagcc (SEQ ID NO: 2312), CUGguaagua (SEQ ID NO: 1707), GGGgugggca (SEQ ID NO: 3215), AAGgugggaa (SEQ ID NO: 376), CAGgugagug (SEQ ID NO: 1347), CUGguuguua (SEQ ID NO: 3216), CAGguaauag (SEQ ID NO: 3217), UAGgugaguu (SEQ ID NO: 3218), AGAguaaguu (SEQ ID NO: 671), UAGguaaucc (SEQ ID NO: 3219), CCGgugacug (SEQ ID NO: 3220), GUCgugauua (SEQ ID NO: 3221), CUUguaagug (SEQ ID NO: 1794), UAGguaguca (SEQ ID NO: 3222), CUGguaaguc (SEQ ID NO: 3223), AGGgugagcg (SEQ ID NO: 3224), CAGguaugga (SEQ ID NO: 1255), AUUgugacca (SEQ ID NO: 3225), GUUgugggua (SEQ ID NO: 2411), AAGguacaag (SEQ ID NO: 173), CUAgcaagug (SEQ ID NO: 3226), CUGgugagau (SEQ ID NO: 3227), CAGgugggca (SEQ ID NO: 1406), AUGgcucgag (SEQ ID NO: 3228), CUGguacguu (SEQ ID NO: 1720), UUGgugugua (SEQ ID NO: 3229), GAGgugucug (SEQ ID NO: 3230), GAGgugggac (SEQ ID NO: 3231), GGGgugggag (SEQ ID NO: 3232), GCAgcgugag (SEQ ID NO: 3233), GAGguaaaga (SEQ ID NO: 1870), GAGguaugua (SEQ ID NO: 1965), AAGgugagac (SEQ ID NO: 336), AAGguacaau (SEQ ID NO: 174), CUGguaugag (SEQ ID NO: 3234), AACguaaaau (SEQ ID NO: 3235), GUGguaggga (SEQ ID NO: 2364), CUGguaugug (SEQ ID NO: 1737), CUUguaagca (SEQ ID NO: 3236), AAGguaggga (SEQ ID NO: 223), AUUguaagcc (SEQ ID NO: 3237), AUGguaagcu (SEQ ID NO: 895), CAGgugaauu (SEQ ID NO: 1322), UAGgugaaua (SEQ ID NO: 2581), CAAguaugga (SEQ ID NO: 3238), AUGguauggc (SEQ ID NO: 936), GAGgucaugc (SEQ ID NO: 3239), CAGguacccu (SEQ ID NO: 1174), ACAgugagac (SEQ ID NO: 3240), CAGgucugau (SEQ ID NO: 3241), GAAguugggu (SEQ ID NO: 3242), CUGgugcgug (SEQ ID NO: 1767), CAGguacgag (SEQ ID NO: 1180), ACAgugagcc (SEQ ID NO: 556), AAGguaagua (SEQ ID NO: 153), GGAguaaggc (SEQ ID NO: 3243), GAGgugugua (SEQ ID NO: 2077), AAGgucauuu (SEQ ID NO: 3244), CAGguagucu (SEQ ID NO: 3245), AUGguaucug (SEQ ID NO: 3246), AAGguaaacu (SEQ ID NO: 125), GAGguaggug (SEQ ID NO: 1938), CUGguaagca (SEQ ID NO: 1700), AGGguaagag (SEQ ID NO: 734), AAAguaaagc (SEQ ID NO: 3247), CAGguuugag (SEQ ID NO: 1502), GAGgcgggua (SEQ ID NO: 3248), CGAguacgau (SEQ ID NO: 3249), CAGguuguug (SEQ ID NO: 1495), AAAguauggg (SEQ ID NO: 3250), UAGgcugguc (SEQ ID NO: 3251), AAGguaagga (SEQ ID NO: 149), AAGguuuccu (SEQ ID NO: 458), UUGguaaaac (SEQ ID NO: 3252), GAGguaagua (SEQ ID NO: 1893), CAGguucaag (SEQ ID NO: 1465), UGGguuaugu (SEQ ID NO: 3253), GAGgugaguu (SEQ ID NO: 2027), ACGgugaaac (SEQ ID NO: 598), GAUguaacca (SEQ ID NO: 3254), AAGgugcggg (SEQ ID NO: 3255), CCGguacgug (SEQ ID NO: 3256), GAUgugagaa (SEQ ID NO: 3257), GUGgcgguga (SEQ ID NO: 3258), CAGguauuag (SEQ ID NO: 3259), GAGguuggga (SEQ ID NO: 3260), AAGgcuagua (SEQ ID NO: 3261), AAGgugggcg (SEQ ID NO: 381), CAGgcaggga (SEQ ID NO: 3262), AAUguuaguu (SEQ ID NO: 3263), GAGguaaagg (SEQ ID NO: 3264), CAGgugugcu (SEQ ID NO: 1437), CUGguaugau (SEQ ID NO: 1733), AUGguuaguc (SEQ ID NO: 978), CUGgugagaa (SEQ ID NO: 1751), CAGgccggcg (SEQ ID NO: 3265), CAGgugacug (SEQ ID NO: 1332), AAAguaaggu (SEQ ID NO: 20), UAAguacuug (SEQ ID NO: 3266), AAGguaaagc (SEQ ID NO: 127), UCGguagggg (SEQ ID NO: 3267), CAGguaggaa (SEQ ID NO: 1212), AGUguaagca (SEQ ID NO: 817), CCCgugagau (SEQ ID NO: 3268), GUGguuguuu (SEQ ID NO: 3269), CAGguuugcc (SEQ ID NO: 1504), AGGguauggg (SEQ ID NO: 766), UAAguaagug (SEQ ID NO: 2424), GAGguaagac (SEQ ID NO: 3270), GAUguagguc (SEQ ID NO: 3271), CAAguaggug (SEQ ID NO: 1043), AUAguaaaua (SEQ ID NO: 845), GAGguugggg (SEQ ID NO: 3272), GAGgcgagua (SEQ ID NO: 3273), CAGguagugu (SEQ ID NO: 1229), GUGguaggug (SEQ ID NO: 2366), CAAgugagug (SEQ ID NO: 1068), AAGgugacaa (SEQ ID NO: 330), CCAgcguaau (SEQ ID NO: 3274), ACGgugaggu (SEQ ID NO: 3275), GGGguauauu (SEQ ID NO: 3276), CAGgugagua (SEQ ID NO: 1345), AAGgugcgug (SEQ ID NO: 364), UAUguaaauu (SEQ ID NO: 3277), CAGgucagua (SEQ ID NO: 1281), ACGguacuua (SEQ ID NO: 3278), GAGgucagca (SEQ ID NO: 3279), UAAguaugua (SEQ ID NO: 2431), GGGgucagac (SEQ ID NO: 3280), AAUgugugag (SEQ ID NO: 3281), UCCgucagua (SEQ ID NO: 3282), CAGgugcuuc (SEQ ID NO: 1391), CCAguuagug (SEQ ID NO: 3283), CCGgugggcg (SEQ ID NO: 1590), AGGgugcaug (SEQ ID NO: 3284), GGGguaggau (SEQ ID NO: 3285), UAGgugggcc (SEQ ID NO: 2615), GAGguguucg (SEQ ID NO: 3286), UUGgcaagaa (SEQ ID NO: 3287), UCCguaagua (SEQ ID NO: 3288), CAGguguaag (SEQ ID NO: 3289), CUCgugagua (SEQ ID NO: 1680), GAGguguuuu (SEQ ID NO: 3290), GAGgugagca (SEQ ID NO: 2018), GAGguaaagu (SEQ ID NO: 1872), AAGguacguu (SEQ ID NO: 193), CAGguccagu (SEQ ID NO: 1291), AUGgugaaac (SEQ ID NO: 947), GUAgugagcu (SEQ ID NO: 3291), CAGgugaaaa (SEQ ID NO: 3292), AGGguacagg (SEQ ID NO: 3293), AAGguaacgc (SEQ ID NO: 3294), AAGguauacc (SEQ ID NO: 3295), CCUgugagau (SEQ ID NO: 3296), GGGguacgug (SEQ ID NO: 3297), GAGguauggu (SEQ ID NO: 1964), UAGguauuau (SEQ ID NO: 2557), GAAguaggag (SEQ ID NO: 3298), UCGguaaggg (SEQ ID NO: 3299), CCGguaagcg (SEQ ID NO: 3300), GAAguaauua (SEQ ID NO: 1823), CAGgugaguc (SEQ ID NO: 1346), AAGgucaaga (SEQ ID NO: 279), AUGguaaguc (SEQ ID NO: 899), CAGgugagcu (SEQ ID NO: 1340), CCAguuuuug (SEQ ID NO: 3301), CAGgugggag (SEQ ID NO: 1404), AAGguauuau (SEQ ID NO: 270), AAGguaaaua (SEQ ID NO: 130), AAGgugcugu (SEQ ID NO: 3302), AAAguacacc (SEQ ID NO: 3303), CUGguucgug (SEQ ID NO: 1783), UCAguaaguc (SEQ ID NO: 2690), GAAguacgug (SEQ ID NO: 3304), CAGgugacaa (SEQ ID NO: 1323), UGGguaagaa (SEQ ID NO: 2832), UGUguagggg (SEQ ID NO: 3305), GAGguaggca (SEQ ID NO: 1932), UUGgugaggc (SEQ ID NO: 3306), AUGgugugua (SEQ ID NO: 974), CAGguccucc (SEQ ID NO: 3307), UUGguaaaug (SEQ ID NO: 2953), GCUgugaguu (SEQ ID NO: 2207), AUGgucugua (SEQ ID NO: 3308), CAUgcaggug (SEQ ID NO: 3309), CUGguacacc (SEQ ID NO: 3310), CAGguccuua (SEQ ID NO: 3311), CAAguaaucu (SEQ ID NO: 1031), AUGgcagccu (SEQ ID NO: 3312), AAGgucagaa (SEQ ID NO: 282), AACgugaggc (SEQ ID NO: 3313), CAGgcacgca (SEQ ID NO: 1106), ACGguccagg (SEQ ID NO: 3314), UCUguacaua (SEQ ID NO: 3315), GAGgugauua (SEQ ID NO: 3316), ACGguaaaua (SEQ ID NO: 3317), AUGguaacug (SEQ ID NO: 3318), CAGgcgcguu (SEQ ID NO: 3319), CAGguauaga (SEQ ID NO: 1235), AAGguuuguu (SEQ ID NO: 3320), CAGguaugaa (SEQ ID NO: 1247), UAGguuggua (SEQ ID NO: 2638), CUGgugagac (SEQ ID NO: 1752), CAGguuagga (SEQ ID NO: 3321), AUGgugacug (SEQ ID NO: 3322), UUGguauccc (SEQ ID NO: 3323), CUUguaggac (SEQ ID NO: 3324), AAAguguguu (SEQ ID NO: 69), CAGguuucuu (SEQ ID NO: 1500), GGGguauggc (SEQ ID NO: 3325), GGGguaggac (SEQ ID NO: 3326), ACUguaaguc (SEQ ID NO: 626), AUCguaagcu (SEQ ID NO: 3327), UAGguucccc (SEQ ID NO: 2636), GGUgugagca (SEQ ID NO: 3328), CUGguuggua (SEQ ID NO: 3329), GGGguuaggg (SEQ ID NO: 3330), UGAguaagaa (SEQ ID NO: 3331), GAGguauucc (SEQ ID NO: 1969), UGGguuaguc (SEQ ID NO: 2893), CAGgcucgug (SEQ ID NO: 3332), UAGguagagu (SEQ ID NO: 3333), UAGgugcccu (SEQ ID NO: 3334), AAAgugagua (SEQ ID NO: 58), GAGguucaua (SEQ ID NO: 2094), UUGguaagag (SEQ ID NO: 2958), ACCgugugua (SEQ ID NO: 3335), UAUguaguau (SEQ ID NO: 3336), UGGguaauag (SEQ ID NO: 3337), CAGgucugaa (SEQ ID NO: 3338), AAAguauaaa (SEQ ID NO: 3339), GUGgugaguc (SEQ ID NO: 3340), AGUgugauua (SEQ ID NO: 3341), UUGgugugug (SEQ ID NO: 3020), CAGgugaugg (SEQ ID NO: 1353), GCUgugagua (SEQ ID NO: 2204), CAGguacaug (SEQ ID NO: 1169), AAGguacagu (SEQ ID NO: 178), GAAguuguag (SEQ ID NO: 3342), CAGgugauua (SEQ ID NO: 1355), UAGgugaauu (SEQ ID NO: 2583), GGUguuaaua (SEQ ID NO: 3343), CAGguauuua (SEQ ID NO: 1268), CAAguacucg (SEQ ID NO: 3344), CAAguaagaa (SEQ ID NO: 1022), AAGguaccuu (SEQ ID NO: 188), ACGgugaggg (SEQ ID NO: 3345), UGAgcaggca (SEQ ID NO: 3346), GGGgugaccg (SEQ ID NO: 3347), GAGguaaaug (SEQ ID NO: 1875), CGGguuugug (SEQ ID NO: 3348), AAGgugagcg (SEQ ID NO: 341), GUGguaugga (SEQ ID NO: 3349), CUGguaagga (SEQ ID NO: 1703), GAGguaccag (SEQ ID NO: 1911), CCGgugagug (SEQ ID NO: 1587), AAGguuagaa (SEQ ID NO: 416), GAGguacuug (SEQ ID NO: 1921), AGAguaaaac (SEQ ID NO: 651), UCUgugagua (SEQ ID NO: 2760), AAGgcgggaa (SEQ ID NO: 3350), CAGguaugcg (SEQ ID NO: 1253), AGGguaaaac (SEQ ID NO: 3351), AAGgugacug (SEQ ID NO: 333), AGGguauguu (SEQ ID NO: 3352), AAGguaugua (SEQ ID NO: 263), CAGgucucuc (SEQ ID NO: 1302), CAGgcaugua (SEQ ID NO: 3353), CUGguaggua (SEQ ID NO: 1729), AAGgucaugc (SEQ ID NO: 3354), CAGguacaca (SEQ ID NO: 1163), GAUguacguu (SEQ ID NO: 3355), ACAguacgug (SEQ ID NO: 3356), ACGguaccca (SEQ ID NO: 3357), CAGguagugc (SEQ ID NO: 3358), ACAguaagag (SEQ ID NO: 3359), GGUgcacacc (SEQ ID NO: 3360), GAGguguaac (SEQ ID NO: 3361), AAGgugugua (SEQ ID NO: 403), UAGguacuua (SEQ ID NO: 3362), GCGguacugc (SEQ ID NO: 3363), UGGguaaguc (SEQ ID NO: 2842), CAUguaggua (SEQ ID NO: 1529), CAGguaggau (SEQ ID NO: 3364), CAGgucuggc (SEQ ID NO: 3365), GUGguuuuaa (SEQ ID NO: 3366), CAGgugggaa (SEQ ID NO: 1402), UGGgugagua (SEQ ID NO: 2875), CGAgugagcc (SEQ ID NO: 3367), AAGguauggc (SEQ ID NO: 261), AGUguuguca (SEQ ID NO: 3368), CAGgugauuu (SEQ ID NO: 1358), UAGguaucuc (SEQ ID NO: 2544), UAAguauguu (SEQ ID NO: 3369), AAGguugagc (SEQ ID NO: 3370), AGAguaaaga (SEQ ID NO: 653), GGUguaagua (SEQ ID NO: 3371), GGGgugagcu (SEQ ID NO: 2279), CAGguauaau (SEQ ID NO: 3372), GAGguacaaa (SEQ ID NO: 1904), AUGguaccaa (SEQ ID NO: 3373), UAGguagggg (SEQ ID NO: 2523), UGAgucagaa (SEQ ID NO: 3374), AAGgcaauua (SEQ ID NO: 3375), UUGguaagau (SEQ ID NO: 3376), CAGguacaga (SEQ ID NO: 1165), AGAguuagag (SEQ ID NO: 3377), CAGgugcguc (SEQ ID NO: 1381), GAGguauuac (SEQ ID NO: 3378), ACGguacaga (SEQ ID NO: 3379), CAGgucuucc (SEQ ID NO: 1313), AAGguaaggu (SEQ ID NO: 152), GAGguaauuu (SEQ ID NO: 1903), AGUguaggcu (SEQ ID NO: 3380), AAAguaagcg (SEQ ID NO: 3381), CCUguaagcc (SEQ ID NO: 3382), AGGgugauuu (SEQ ID NO: 3383), UGUguaugaa (SEQ ID NO: 3384), CUGguacaca (SEQ ID NO: 3385), AGGguagaga (SEQ ID NO: 3386), AUAguaagca (SEQ ID NO: 848), AGAguaugua (SEQ ID NO: 3387), UUGgucagca (SEQ ID NO: 3388), CAGgcaaguu (SEQ ID NO: 1105), AAGguauaua (SEQ ID NO: 242), AAGgucugga (SEQ ID NO: 314), CAGguacgca (SEQ ID NO: 1181), AGGgugcggg (SEQ ID NO: 3389), AUGguaagug (SEQ ID NO: 900), AAAgugauga (SEQ ID NO: 3390), UGCgugagua (SEQ ID NO: 3391), AGAguaggga (SEQ ID NO: 684), UGUguaggua (SEQ ID NO: 2912), UAGguaggau (SEQ ID NO: 2521), UAAgugagug (SEQ ID NO: 2440), GCUguaagua (SEQ ID NO: 2193), GAAguaagaa (SEQ ID NO: 1814), UCGgugaggc (SEQ ID NO: 2733), UAGguauuuu (SEQ ID NO: 2564), AAGguacaca (SEQ ID NO: 3392), AAGguaggua (SEQ ID NO: 227), UGGguagguu (SEQ ID NO: 2854), ACAgcaagua (SEQ ID NO: 541), GAGguaggag (SEQ ID NO: 1931), UGGgugaguu (SEQ ID NO: 2878), GCGgugagau (SEQ ID NO: 3393), CCUguagguu (SEQ ID NO: 3394), CAGgugugua (SEQ ID NO: 1440), CUGguaagcc (SEQ ID NO: 1701), AAGgugauuc (SEQ ID NO: 3395), CAGguagcua (SEQ ID NO: 1208), GUUguaagug (SEQ ID NO: 3396), AUGguaagca (SEQ ID NO: 893), AUAguaggga (SEQ ID NO: 3397), GGGguucgcu (SEQ ID NO: 3398), CCGgucagag (SEQ ID NO: 3399), GUAguaugag (SEQ ID NO: 3400), CGUguaagau (SEQ ID NO: 3401), UGAguaggca (SEQ ID NO: 3402), UCAguaugua (SEQ ID NO: 3403), GAGguaucug (SEQ ID NO: 1954), AGAguauuuu (SEQ ID NO: 3404), AAGguuguag (SEQ ID NO: 3405), AGUguaaguu (SEQ ID NO: 821), CGGguaaguu (SEQ ID NO: 1626), UCGgugcgga (SEQ ID NO: 3406), UAGguaagua (SEQ ID NO: 2491), GAAguuagau (SEQ ID NO: 3407), GCUgugagac (SEQ ID NO: 3408), CAGgcaggua (SEQ ID NO: 3409), CAGguagggg (SEQ ID NO: 1218), UAAguuaaga (SEQ ID NO: 3410), AUGguggguu (SEQ ID NO: 970), UAGguaaguu (SEQ ID NO: 2494), CUGguaaauu (SEQ ID NO: 1690), CCGguaagga (SEQ ID NO: 1577), GAGgcaggca (SEQ ID NO: 3411), CAUguaagug (SEQ ID NO: 1523), AAGgugccua (SEQ ID NO: 3412), UUGguaggga (SEQ ID NO: 2977), AAGguaaaca (SEQ ID NO: 123), CGGgugugag (SEQ ID NO: 3413), GGGgugugag (SEQ ID NO: 3414), UCCguggguc (SEQ ID NO: 3415), ACGguaaauc (SEQ ID NO: 3416), UCAguaggua (SEQ ID NO: 3417), CAGgucagcc (SEQ ID NO: 1278), CAGgcggugg (SEQ ID NO: 3418), CGAguaagcu (SEQ ID NO: 3419), CCCgugagca (SEQ ID NO: 3420), AAAguaauga (SEQ ID NO: 3421), CUGguaagcu (SEQ ID NO: 1702), CGGguaacca (SEQ ID NO: 3422), CAGgucgcac (SEQ ID NO: 3423), GAGguaggcc (SEQ ID NO: 3424), UAGgugagcc (SEQ ID NO: 2591), UAGguaggca (SEQ ID NO: 3425), GCGgugcgug (SEQ ID NO: 3426), AUGgugagua (SEQ ID NO: 961), GGGgugaggg (SEQ ID NO: 2282), GAGgucacac (SEQ ID NO: 3427), CAGguaggcc (SEQ ID NO: 3428), CAAgugcuga (SEQ ID NO: 3429), GUCgucuuca (SEQ ID NO: 3430), CAUguaagaa (SEQ ID NO: 1518), GUAguaagga (SEQ ID NO: 3431), UAGguuugua (SEQ ID NO: 2643), CAAguuagag (SEQ ID NO: 3432), AAGguagagu (SEQ ID NO: 208), AAGgugagau (SEQ ID NO: 338), AAAguaggua (SEQ ID NO: 37), ACAgugaauc (SEQ ID NO: 3433), CAGgugugcg (SEQ ID NO: 1436), CAGgucggcc (SEQ ID NO: 1299), AAGguaguau (SEQ ID NO: 3434), ACUgucaguc (SEQ ID NO: 3435), UCUgcagccu (SEQ ID NO: 3436), CGAguaagug (SEQ ID NO: 3437), AGAguaauua (SEQ ID NO: 3438), AGUgugagug (SEQ ID NO: 837), CCGgugagcg (SEQ ID NO: 3439), AAGguaaccu (SEQ ID NO: 3440), AAGguugugg (SEQ ID NO: 3441), AAGgcauggg (SEQ ID NO: 3442), AAGgucagag (SEQ ID NO: 284), ACGguaaggu (SEQ ID NO: 3443), GGGgugagca (SEQ ID NO: 3444), GAGguugcuu (SEQ ID NO: 3445), AAGguaucgc (SEQ ID NO: 3446), CCGguaaagg (SEQ ID NO: 3447), AAAguuaaug (SEQ ID NO: 3448), UAGguacgag (SEQ ID NO: 2510), ACCguaauua (SEQ ID NO: 3449), GGGguaagga (SEQ ID NO: 2249), CCGguaacgc (SEQ ID NO: 3450), CAGgucagaa (SEQ ID NO: 1275), AAGguacuga (SEQ ID NO: 197), GAGgugacca (SEQ ID NO: 2010), GGGgugagcc (SEQ ID NO: 2277), AAGguacagg (SEQ ID NO: 177), AUGguaauua (SEQ ID NO: 3451), CAGgugagag (SEQ ID NO: 1335), AAGgugacuc (SEQ ID NO: 3452), AUAguaagua (SEQ ID NO: 849), GAGguaaacc (SEQ ID NO: 1869), CAGgugggau (SEQ ID NO: 1405), CAGgugagaa (SEQ ID NO: 1333), AGGguaaaaa (SEQ ID NO: 3453), GAGgugugac (SEQ ID NO: 3454), CACguaagcu (SEQ ID NO: 3455), CAGguccccc (SEQ ID NO: 3456), CAGgucaggu (SEQ ID NO: 3457), CGGguaaguc (SEQ ID NO: 3458), ACGguauggg (SEQ ID NO: 3459), GAUguaaguu (SEQ ID NO: 2123), CAAguaauau (SEQ ID NO: 3460), CAGguugggg (SEQ ID NO: 3461), CCUgugcugg (SEQ ID NO: 3462), AAGguaugau (SEQ ID NO: 256), AGGguagagg (SEQ ID NO: 3463), AAGguggguu (SEQ ID NO: 386), CAGgugugaa (SEQ ID NO: 1430), UUGguaugug (SEQ ID NO: 2988), UUGguaucuc (SEQ ID NO: 2985), GGGgugagug (SEQ ID NO: 2284), CUGgugugug (SEQ ID NO: 1779), AGGguagggc (SEQ ID NO: 3464), GUGgugagua (SEQ ID NO: 3465), CAGguaugua (SEQ ID NO: 1258), AAGguacauu (SEQ ID NO: 181), UUAguaagug (SEQ ID NO: 2934), AAUguauauc (SEQ ID NO: 3466), CUUguaagua (SEQ ID NO: 1793), GAGguuagua (SEQ ID NO: 2087), CAGguaaggu (SEQ ID NO: 1146), CAGguaaugu (SEQ ID NO: 1155), AGGgugaggc (SEQ ID NO: 3467), CAGguauuuc (SEQ ID NO: 1269), CAGgucugga (SEQ ID NO: 1307), GGGgugugcu (SEQ ID NO: 3468), UAGgugagug (SEQ ID NO: 2598), AAUguaaccu (SEQ ID NO: 3469), UAAgugaguc (SEQ ID NO: 2439), CAGgugcacu (SEQ ID NO: 3470), ACGguaagua (SEQ ID NO: 579), GAGguauccu (SEQ ID NO: 3471), UCUguaaguc (SEQ ID NO: 2745), CAGguauuca (SEQ ID NO: 1263), UGUguaagug (SEQ ID NO: 3472), CCAgcaaggc (SEQ ID NO: 3473), GAGgugaagg (SEQ ID NO: 2006), AAUguggggu (SEQ ID NO: 3474), UCGgugcgug (SEQ ID NO: 3475), UUGguaaggc (SEQ ID NO: 3476), GAGguaagug (SEQ ID NO: 3477), AAAguaagau (SEQ ID NO: 14), UAGgucuuuu (SEQ ID NO: 3478), GAGgucugau (SEQ ID NO: 3479), CCAguuagag (SEQ ID NO: 3480), UGGgugaaaa (SEQ ID NO: 3481), AGAguaagau (SEQ ID NO: 662), CAGguaauug (SEQ ID NO: 1158), CAGgccgguc (SEQ ID NO: 3482), CCGguaagag (SEQ ID NO: 3483), GAGgugagcu (SEQ ID NO: 2021), CUGguaagac (SEQ ID NO: 3484), CAGgugagau (SEQ ID NO: 1336), CUGguuuguu (SEQ ID NO: 3485), UGGguaggua (SEQ ID NO: 3486), CAGguuagug (SEQ ID NO: 1457), CAGguguucg (SEQ ID NO: 3487), CGGguagguc (SEQ ID NO: 3488), GUGguacaua (SEQ ID NO: 3489), AAGguacuaa (SEQ ID NO: 194), GAUgugagua (SEQ ID NO: 3490), UGUguaagac (SEQ ID NO: 2904), GAGguagccg (SEQ ID NO: 3491), UAGgugaucu (SEQ ID NO: 3492), CAGguacgug (SEQ ID NO: 1185), CUUgucaguc (SEQ ID NO: 3493), GAGguaucac (SEQ ID NO: 3494), GAGguaauga (SEQ ID NO: 3495), AAGguaacac (SEQ ID NO: 3496), CAGguaaagc (SEQ ID NO: 1123), AAGgcaagua (SEQ ID NO: 3497), CGCgugagcc (SEQ ID NO: 3498), AGUgugcguu (SEQ ID NO: 3499), GAUguaagca (SEQ ID NO: 2118), AAGguaauag (SEQ ID NO: 159), GGAgcaguug (SEQ ID NO: 3500), AGCguaagau (SEQ ID NO: 3501), AAGgucaggc (SEQ ID NO: 290), GAGguauuca (SEQ ID NO: 3502), AAUguaaagu (SEQ ID NO: 3503), CAGguaacaa (SEQ ID NO: 3504), UCGguaggug (SEQ ID NO: 3505), AAAguaaguc (SEQ ID NO: 22), CGGgugcagu (SEQ ID NO: 3506), GGUgugugca (SEQ ID NO: 3507), UGAgugagaa (SEQ ID NO: 2794), CACguguaag (SEQ ID NO: 3508), GUGguuggua (SEQ ID NO: 3509), GCAgccuuga (SEQ ID NO: 3510), CGAgugugau (SEQ ID NO: 3511), CAGguauaua (SEQ ID NO: 3512), UAUguaugug (SEQ ID NO: 2665), CCCgugguca (SEQ ID NO: 3513), AUGguaagac (SEQ ID NO: 890), GAGgugugga (SEQ ID NO: 2074), AGUguauccu (SEQ ID NO: 3514), UGAguguguc (SEQ ID NO: 3515), UGGguaaucu (SEQ ID NO: 3516), AUGgcagguu (SEQ ID NO: 3517), GAGguaagau (SEQ ID NO: 1884), UCAgcagcgu (SEQ ID NO: 3518), AAGgugggau (SEQ ID NO: 378), CGGgugcgcu (SEQ ID NO: 3519), CAGgugucug (SEQ ID NO: 1429), AGCgugguaa (SEQ ID NO: 3520), AAUgugaaug (SEQ ID NO: 3521), UCGgugagac (SEQ ID NO: 3522), UAGguaaagc (SEQ ID NO: 3523), CUGguaaaag (SEQ ID NO: 3524), CCGgugcgga (SEQ ID NO: 3525), CAGguacuca (SEQ ID NO: 3526), CAGguagcaa (SEQ ID NO: 1203), GAAguugagu (SEQ ID NO: 3527), GAGguggagg (SEQ ID NO: 2052), AGGguaugag (SEQ ID NO: 762), UAGguaugcu (SEQ ID NO: 3528), UAGgugagac (SEQ ID NO: 2588), CAGguaauua (SEQ ID NO: 1156), CGUguaagcc (SEQ ID NO: 3529), CUUguaaguu (SEQ ID NO: 1795), AAGguaacuu (SEQ ID NO: 140), UCGgcaaggc (SEQ ID NO: 3530), GAGguucucg (SEQ ID NO: 3531), GAGgugggcg (SEQ ID NO: 2058), AAGgcaugug (SEQ ID NO: 3532), CUGguauguu (SEQ ID NO: 1738), UAAgucauuu (SEQ ID NO: 3533), CAUguaauua (SEQ ID NO: 1525), AAUguaaaga (SEQ ID NO: 3534), UAGgugcuca (SEQ ID NO: 3535), AAGguaaugg (SEQ ID NO: 166), GAGguacuga (SEQ ID NO: 3536), UGGguaagua (SEQ ID NO: 2841), UGGguaaaaa (SEQ ID NO: 3537), AAGgugagcu (SEQ ID NO: 342), UACgugaguu (SEQ ID NO: 3538), AGGgugagcc (SEQ ID NO: 790), CGGgugagga (SEQ ID NO: 3539), UGGgugagag (SEQ ID NO: 2869), GGUguaagcu (SEQ ID NO: 3540), CGGguggguu (SEQ ID NO: 1648), CCAgcuaagu (SEQ ID NO: 3541), AAGguuuguc (SEQ ID NO: 467), GAGguuagac (SEQ ID NO: 2084), GAGguaccuc (SEQ ID NO: 3542), UUUguaaguu (SEQ ID NO: 3041), GAGguuagga (SEQ ID NO: 3543), CAGguaggga (SEQ ID NO: 1216), AGGguaauac (SEQ ID NO: 744), UGCgugugua (SEQ ID NO: 3544), CCAguaacca (SEQ ID NO: 3545), AGGgucuguc (SEQ ID NO: 3546), UGGguaugua (SEQ ID NO: 2860), GUGguaagcu (SEQ ID NO: 2348), CAGguaaccu (SEQ ID NO: 3547), AAGgugaguu (SEQ ID NO: 350), UAGguucgug (SEQ ID NO: 3548), AAAguuagua (SEQ ID NO: 3549), UGGgcaaguc (SEQ ID NO: 2816), AAGgcacagu (SEQ ID NO: 3550), GUUguaaguc (SEQ ID NO: 2401), AAGguuugcc (SEQ ID NO: 462), CUUgcauggg (SEQ ID NO: 3551), GCGgugagua (SEQ ID NO: 3552), GGGguaagcg (SEQ ID NO: 3553), GCCguaagaa (SEQ ID NO: 3554), GAGgucggga (SEQ ID NO: 3555), UUGguauugu (SEQ ID NO: 2990), AGUgugagac (SEQ ID NO: 3556), CUGgugggga (SEQ ID NO: 1770), AGAguaaggu (SEQ ID NO: 668), CCGguggguc (SEQ ID NO: 3557), CAGguauucu (SEQ ID NO: 1264), UGGguaacgu (SEQ ID NO: 3558), UUGgugagag (SEQ ID NO: 3559), UAGguacccu (SEQ ID NO: 3560), GGGgugcguc (SEQ ID NO: 3561), AAGgcaggag (SEQ ID NO: 3562), ACGguacauu (SEQ ID NO: 3563), GAGguaguua (SEQ ID NO: 1946), CAGguauggg (SEQ ID NO: 1256), UUUguguguc (SEQ ID NO: 3053), CAGguacuua (SEQ ID NO: 1194), AUGguauacu (SEQ ID NO: 3564), AGUgugagcc (SEQ ID NO: 833), ACAguaacga (SEQ ID NO: 3565), CUGguaccca (SEQ ID NO: 3566), CAGguaaccc (SEQ ID NO: 3567), GGAguaagua (SEQ ID NO: 3568), GAGgugggug (SEQ ID NO: 2065), ACUguauguc (SEQ ID NO: 3569), ACGgugagua (SEQ ID NO: 606), CUGguaaugu (SEQ ID NO: 3570), AAGguaucag (SEQ ID NO: 247), CAGgugcccc (SEQ ID NO: 1370), AGUgucagug (SEQ ID NO: 3571), AAGguaggag (SEQ ID NO: 218), GGAguaugug (SEQ ID NO: 3572), UUGguauuuu (SEQ ID NO: 2992), CCUguuguga (SEQ ID NO: 3573), UUUguaagaa (SEQ ID NO: 3033), UAGguaacau (SEQ ID NO: 2475), CAGguaagca (SEQ ID NO: 3574), CAGgucacag (SEQ ID NO: 3575), CAGgugugag (SEQ ID NO: 1432), UAGguuugcg (SEQ ID NO: 3576), CUGguaagaa (SEQ ID NO: 1697), ACGguuguau (SEQ ID NO: 3577), AAGguugggg (SEQ ID NO: 446), AAGgugaauu (SEQ ID NO: 329), GGGguuaguu (SEQ ID NO: 3578), ACGguaaggc (SEQ ID NO: 3579), CAGguuuaag (SEQ ID NO: 1496), CUGguaaguu (SEQ ID NO: 1709), GGGgugagag (SEQ ID NO: 3580), UGGguggguu (SEQ ID NO: 2886), GAGguuuguu (SEQ ID NO: 2111), UGGguaaaug (SEQ ID NO: 2826), CAGgcaggcc (SEQ ID NO: 3581), CACgugcagg (SEQ ID NO: 3582), AAGgugagcc (SEQ ID NO: 340), CAAguaagug (SEQ ID NO: 1028), CAGgucaguc (SEQ ID NO: 1282), GCGguauaau (SEQ ID NO: 3583), UAGguaaagu (SEQ ID NO: 3584), UAGguggauu (SEQ ID NO: 3585), GAGgucugga (SEQ ID NO: 3586), UCGgucaguu (SEQ ID NO: 3587), UGGguaacug (SEQ ID NO: 3588), AAGguuugau (SEQ ID NO: 3589), UGUgcuggug (SEQ ID NO: 3590), UGUguaccuc (SEQ ID NO: 3591), UGGguacagu (SEQ ID NO: 2849), AUCgucagcg (SEQ ID NO: 3592), CAGgucuugg (SEQ ID NO: 3593), GAAguuggua (SEQ ID NO: 3594), GAAguaaaga (SEQ ID NO: 3595), UUGguaagcu (SEQ ID NO: 2959), UAGguaccag (SEQ ID NO: 2507), AGGguaucau (SEQ ID NO: 3596), CAGguaaaaa (SEQ ID NO: 1118), ACGguaauuu (SEQ ID NO: 583), AUUguaaguu (SEQ ID NO: 997), GAGguacagu (SEQ ID NO: 1908), CAGgugaaag (SEQ ID NO: 1315), UGGguuguuu (SEQ ID NO: 3597), GGGguaggug (SEQ ID NO: 2259), CAGgugccca (SEQ ID NO: 1369), AGCgugagau (SEQ ID NO: 3598), CCAgugagug (SEQ ID NO: 1565), AGGguagaug (SEQ ID NO: 3599), UGGguguguc (SEQ ID NO: 2888), AUCgcgugag (SEQ ID NO: 3600), AGGguaagcc (SEQ ID NO: 3601), AGGguagcag (SEQ ID NO: 3602), UUCguuuccg (SEQ ID NO: 3603), AAGguaagcg (SEQ ID NO: 147), UGGguaagcc (SEQ ID NO: 2837), CAGguauggc (SEQ ID NO: 3604), UGUguaagua (SEQ ID NO: 2907), AAGguagaga (SEQ ID NO: 3605), ACGguaauaa (SEQ ID NO: 3606), CUGguacggu (SEQ ID NO: 3607), GAGgucacag (SEQ ID NO: 3608), UAUguaaguu (SEQ ID NO: 2656), CUGguacgcc (SEQ ID NO: 3609), CAAguaagau (SEQ ID NO: 1024), CUAgugagua (SEQ ID NO: 1673), CCGguaaccg (SEQ ID NO: 3610), CUUguaaguc (SEQ ID NO: 3611), GUGgugagaa (SEQ ID NO: 2378), ACCguaugua (SEQ ID NO: 3612), GUAguaagug (SEQ ID NO: 2324), UUGgugggua (SEQ ID NO: 3014), CGGguacuuu (SEQ ID NO: 3613), UGGguaaaua (SEQ ID NO: 2825), AGAgugagua (SEQ ID NO: 704), AAGguagguu (SEQ ID NO: 230), AAGguaugcg (SEQ ID NO: 3614), CCUguaggcu (SEQ ID NO: 3615), ACAguagaaa (SEQ ID NO: 3616), CCGguuagua (SEQ ID NO: 3617), CGGguaggcg (SEQ ID NO: 3618), GCAgugagug (SEQ ID NO: 2162), GAGgugaguc (SEQ ID NO: 3619), CUGguagccu (SEQ ID NO: 3620), CAUguaugua (SEQ ID NO: 1533), GAAguaacuu (SEQ ID NO: 3621), GAAguaagau (SEQ ID NO: 3622), AAGguuagau (SEQ ID NO: 417), AAGguaauca (SEQ ID NO: 161), AAUguaugua (SEQ ID NO: 507), UGAguaagau (SEQ ID NO: 2767), AGAgugagca (SEQ ID NO: 703), GUAguucuau (SEQ ID NO: 3623), GAGguaauca (SEQ ID NO: 1898), UAGguaugga (SEQ ID NO: 2548), UAGgugggac (SEQ ID NO: 2612), GAGguacaug (SEQ ID NO: 3624), UGGguaaggc (SEQ ID NO: 3625), CAGguacgcc (SEQ ID NO: 1182), CCAguuacgc (SEQ ID NO: 3626), ACUgugguga (SEQ ID NO: 3627), GAGguaaguc (SEQ ID NO: 1894), AUUguaggug (SEQ ID NO: 3628), ACCgucagug (SEQ ID NO: 3629), AAUgugaggg (SEQ ID NO: 3630), ACUgugagug (SEQ ID NO: 645), UGGguguggu (SEQ ID NO: 3631), AAGguuggga (SEQ ID NO: 445), AAGguuugga (SEQ ID NO: 464), UCCgugagug (SEQ ID NO: 3632), CGGgugagug (SEQ ID NO: 1642), AGAguaagcu (SEQ ID NO: 664), CAGgcaagcu (SEQ ID NO: 3633), UAGguauauu (SEQ ID NO: 2541), AAAguagcag (SEQ ID NO: 3634), GAGguaaccu (SEQ ID NO: 1880), AAGgugggca (SEQ ID NO: 379), AGGgugagua (SEQ ID NO: 795), UGGguaaggu (SEQ ID NO: 2840), CUUgucagug (SEQ ID NO: 3635), UAGgugcgcu (SEQ ID NO: 3636), GAGgcaaauu (SEQ ID NO: 3637), AGGguaccuc (SEQ ID NO: 3638), CAAgugcgua (SEQ ID NO: 3639), AGAguaagac (SEQ ID NO: 660), GUGguaaaua (SEQ ID NO: 3640), GAUguaagcg (SEQ ID NO: 3641), GAGguaaagc (SEQ ID NO: 1871), UAGgugagua (SEQ ID NO: 2596), CAGguaacau (SEQ ID NO: 1130), CCUguacggc (SEQ ID NO: 3642), UAGguauguc (SEQ ID NO: 2552), UAGguccaua (SEQ ID NO: 3643), GAGgugaaaa (SEQ ID NO: 2003), AAAguacuga (SEQ ID NO: 3644), UUGguaagcg (SEQ ID NO: 3645), CAGgcaagcg (SEQ ID NO: 3646), UUUgcagguu (SEQ ID NO: 3647), CAGguuuaua (SEQ ID NO: 3648), CUGguaaagc (SEQ ID NO: 1686), AUGgugagcu (SEQ ID NO: 958), CAGgugguug (SEQ ID NO: 1419), GUAguaaguu (SEQ ID NO: 3649), CAGguaauac (SEQ ID NO: 3650), CAGgcaaggc (SEQ ID NO: 3651), AAGguaauuu (SEQ ID NO: 171), UUUguccgug (SEQ ID NO: 3652), GAGguagguu (SEQ ID NO: 1939), ACCgugagug (SEQ ID NO: 3653), CAAguaagcu (SEQ ID NO: 3654), ACAgugagua (SEQ ID NO: 560), UUGgugagau (SEQ ID NO: 3000), AAGguagucu (SEQ ID NO: 233), CAGguaaagg (SEQ ID NO: 3655), GGGguaugga (SEQ ID NO: 2264), UUUguaagug (SEQ ID NO: 3040), GUGguaagag (SEQ ID NO: 2344), AGUgugaguu (SEQ ID NO: 838), AAGgcaagcg (SEQ ID NO: 3656), UAAgugagua (SEQ ID NO: 2438), AGGgugagug (SEQ ID NO: 797), AGUguacgug (SEQ ID NO: 3657), AGGgugcgua (SEQ ID NO: 3658), GGCgugagcc (SEQ ID NO: 2238), CGAguuauga (SEQ ID NO: 3659), CAGguaaaga (SEQ ID NO: 1122), UUGgugaaga (SEQ ID NO: 3660), AGGguaaugg (SEQ ID NO: 3661), AAGguccaga (SEQ ID NO: 300), AGUgugaguc (SEQ ID NO: 836), CAGguaauuu (SEQ ID NO: 1159), CAGguaacgc (SEQ ID NO: 3662), CUGguacacu (SEQ ID NO: 3663), CUGguuagug (SEQ ID NO: 1782), CAGguacuug (SEQ ID NO: 3664), CACguaagua (SEQ ID NO: 3665), GUGgugcggc (SEQ ID NO: 3666), GAGgucaguu (SEQ ID NO: 3667), AUGguaugcc (SEQ ID NO: 932), AAGgugugug (SEQ ID NO: 405), CUGguggguc (SEQ ID NO: 1772), CAGgugaggc (SEQ ID NO: 1342), AAGguuaguc (SEQ ID NO: 423), AAGguagcug (SEQ ID NO: 215), GAGgucagga (SEQ ID NO: 1983), GUUguaggua (SEQ ID NO: 3668), UGGguacaag (SEQ ID NO: 3669), AUGguaggug (SEQ ID NO: 924), GAGguaagcc (SEQ ID NO: 1886), AUGgcaagua (SEQ ID NO: 3670), AAGguauauu (SEQ ID NO: 245), GCGgugagag (SEQ ID NO: 3671), AAGgugcuuc (SEQ ID NO: 3672), UAGguacauc (SEQ ID NO: 3673), ACUgugguaa (SEQ ID NO: 3674), GAGguaggcu (SEQ ID NO: 1933), GAGguaugca (SEQ ID NO: 3675), AGGguaguuc (SEQ ID NO: 3676), CAGguauccu (SEQ ID NO: 1241), AGGguaaguc (SEQ ID NO: 741), AGGgucaguu (SEQ ID NO: 779), CAGguuggga (SEQ ID NO: 3677), CAGguggaua (SEQ ID NO: 3678), GGAguagguu (SEQ ID NO: 2220), GAGguaggau (SEQ ID NO: 3679), GGGguuugug (SEQ ID NO: 3680), UAGguaauug (SEQ ID NO: 3681), AAGguaaccc (SEQ ID NO: 136), ACGguaagaa (SEQ ID NO: 3682), GAGguagggg (SEQ ID NO: 1936), CGAguaggug (SEQ ID NO: 1619), UCCguaagug (SEQ ID NO: 2710), UCGguacagg (SEQ ID NO: 3683), CAAguaagcg (SEQ ID NO: 3684), AAGguccgcg (SEQ ID NO: 3685), AAUgugagua (SEQ ID NO: 523), CAGgugaaug (SEQ ID NO: 3686), GUGguaaggc (SEQ ID NO: 2350), AGAgugagug (SEQ ID NO: 706), UCUguauguc (SEQ ID NO: 3687), UGGgugaguc (SEQ ID NO: 2876), UCGguuagua (SEQ ID NO: 3688), GAUguaugca (SEQ ID NO: 3689), GAGguuggug (SEQ ID NO: 3690), GAGguggggc (SEQ ID NO: 2061), UGGgucaguc (SEQ ID NO: 3691), GCAgugagua (SEQ ID NO: 2161), CAGguugcuu (SEQ ID NO: 3692), AGGguagagu (SEQ ID NO: 3693), UAGgucaggu (SEQ ID NO: 2567), CGCguaugua (SEQ ID NO: 3694), GAGguauuaa (SEQ ID NO: 3695), CAGguaaacu (SEQ ID NO: 3696), AAAguaaguu (SEQ ID NO: 24), GGGgucuggc (SEQ ID NO: 3697), GCUguggggu (SEQ ID NO: 3698), UUGguaaguc (SEQ ID NO: 3699), AAGguagaag (SEQ ID NO: 3700), AAUgugaguc (SEQ ID NO: 524), AAGgucagcu (SEQ ID NO: 288), AAGguaagag (SEQ ID NO: 143), AUGgugagga (SEQ ID NO: 3701), AAGguacuuc (SEQ ID NO: 200), AAGguaagaa (SEQ ID NO: 141), CCGguacagc (SEQ ID NO: 3702), GCGgugcgga (SEQ ID NO: 3703), CAGguacaua (SEQ ID NO: 1168), CUGgugagga (SEQ ID NO: 1755), CUGguaggug (SEQ ID NO: 1731), AACguagguu (SEQ ID NO: 3704), AUGgugugug (SEQ ID NO: 975), UUGguacuau (SEQ ID NO: 3705), CAGgucggug (SEQ ID NO: 1300), CAGgcauggg (SEQ ID NO: 3706), AUGguaucuu (SEQ ID NO: 929), AAGguaacua (SEQ ID NO: 137), CAGgugggcg (SEQ ID NO: 3707), CACgugagga (SEQ ID NO: 3708), AAGgugguuc (SEQ ID NO: 392), UGGgcauucu (SEQ ID NO: 3709), AUGguaagcc (SEQ ID NO: 894), AGGgucagug (SEQ ID NO: 778), AGAguacgua (SEQ ID NO: 3710), AAGguaggca (SEQ ID NO: 220), AAGguauuca (SEQ ID NO: 3711), CAGguagauu (SEQ ID NO: 1202), GAGguauuua (SEQ ID NO: 1972), GAGgucuaca (SEQ ID NO: 3712), GUUguagguc (SEQ ID NO: 3713), CAGguacucg (SEQ ID NO: 3714), GUCguauguu (SEQ ID NO: 3715), AAGguacuuu (SEQ ID NO: 202), AGAgugagau (SEQ ID NO: 702), AGUguuggua (SEQ ID NO: 3716), AAUgugagug (SEQ ID NO: 525), AAGguagauu (SEQ ID NO: 3717), AUGguuugua (SEQ ID NO: 988), GAGgccccag (SEQ ID NO: 3718), AUGgucaguu (SEQ ID NO: 3719), UCUguaagga (SEQ ID NO: 3720), CAGgucgggc (SEQ ID NO: 3721), CAGguaagcc (SEQ ID NO: 1142), UAGgucagug (SEQ ID NO: 2569), AGAguaggaa (SEQ ID NO: 683), CUGguacuuc (SEQ ID NO: 3722), CUCguaagca (SEQ ID NO: 1674), CAGguaacua (SEQ ID NO: 1134), CAGguggcug (SEQ ID NO: 1401), UGGguccgua (SEQ ID NO: 3723), GAGguugugc (SEQ ID NO: 3724), CAGgugcgcg (SEQ ID NO: 1377), AAAguauggc (SEQ ID NO: 3725), UGAguacgua (SEQ ID NO: 2779), CUGguacgga (SEQ ID NO: 3726), CAAgugaccu (SEQ ID NO: 3727), AAGgugaugu (SEQ ID NO: 356), AAGgucugca (SEQ ID NO: 3728), AAAguuugua (SEQ ID NO: 75), AAGgugagca (SEQ ID NO: 339), GAUguaagcc (SEQ ID NO: 2119), CAAguaauuu (SEQ ID NO: 1035), CAGgugugug (SEQ ID NO: 1442), UGGgugaggg (SEQ ID NO: 2874), AAGgugaccu (SEQ ID NO: 3729), UAGgugugag (SEQ ID NO: 2621), CAGgcagguc (SEQ ID NO: 3730), UCAguaaguu (SEQ ID NO: 2692), UCAgcaguga (SEQ ID NO: 3731), AAGguaccac (SEQ ID NO: 3732), UAAguaggug (SEQ ID NO: 3733), AAGgucagcc (SEQ ID NO: 286), CAGguaacuc (SEQ ID NO: 1135), AAAguaagag (SEQ ID NO: 13), AAGguagaua (SEQ ID NO: 209), AAGgcaaggg (SEQ ID NO: 99), CAGgugucgg (SEQ ID NO: 3734), CAGguggcua (SEQ ID NO: 3735), GAGguugcca (SEQ ID NO: 3736), CAGgccgugg (SEQ ID NO: 3737), UUGguauaug (SEQ ID NO: 3738), GAGguugagu (SEQ ID NO: 3739), GAGguagguc (SEQ ID NO: 3740), GUGguaagac (SEQ ID NO: 2343), UAGguccuuc (SEQ ID NO: 3741), GAGgcaaguc (SEQ ID NO: 3742), GAGguaacau (SEQ ID NO: 3743), CAGguauauc (SEQ ID NO: 1236), UCGguugguu (SEQ ID NO: 3744), CAGgugaacc (SEQ ID NO: 3745), CAGgucuuuu (SEQ ID NO: 3746), CAGgcauggc (SEQ ID NO: 3747), AAAguacuug (SEQ ID NO: 32), CAGgugauuc (SEQ ID NO: 1356), UUGguagguu (SEQ ID NO: 3748), UAUgugagca (SEQ ID NO: 3749), CAGgugagcg (SEQ ID NO: 1339), AAUguaauaa (SEQ ID NO: 3750), AAAguaaggc (SEQ ID NO: 3751), UAGguuuguc (SEQ ID NO: 2644), UAGgugggag (SEQ ID NO: 2613), GAGguaaguu (SEQ ID NO: 3752), AAGguagccg (SEQ ID NO: 3753), CAGguggugc (SEQ ID NO: 3754), UGAgucaguu (SEQ ID NO: 3755), CUGguaggcc (SEQ ID NO: 3756), CAAguaagga (SEQ ID NO: 3757), CGGguaaggc (SEQ ID NO: 3758), AAGgcgagga (SEQ ID NO: 3759), CAGguaguuc (SEQ ID NO: 1230), CAGguaagga (SEQ ID NO: 1143), CCUgugagug (SEQ ID NO: 1610), AAGguaaaug (SEQ ID NO: 132), CCGguaauua (SEQ ID NO: 3760), CAGguaaguu (SEQ ID NO: 1149), AAGgugguca (SEQ ID NO: 3761), CAGguaccuc (SEQ ID NO: 1177), AUCguaagua (SEQ ID NO: 3762), CCGguacaua (SEQ ID NO: 3763), GCGgugagug (SEQ ID NO: 3764), GAGgugguau (SEQ ID NO: 2067), CUGgugugga (SEQ ID NO: 3765), GAGguaauuc (SEQ ID NO: 3766), CAAguacgua (SEQ ID NO: 3767), UCUguaagug (SEQ ID NO: 2746), AAUguaagug (SEQ ID NO: 491), AGGgucuguu (SEQ ID NO: 783), GAGguacugc (SEQ ID NO: 1918), AGGguaaggc (SEQ ID NO: 738), AAGgcaagag (SEQ ID NO: 95), CAGguggguu (SEQ ID NO: 1416), UAGguuagga (SEQ ID NO: 3768), UGAguaagcu (SEQ ID NO: 2769), AGAguaagag (SEQ ID NO: 661), AUGgcaggug (SEQ ID NO: 3769), UAGgcaagua (SEQ ID NO: 3770), AUGguaggua (SEQ ID NO: 923), GCAgcccgca (SEQ ID NO: 3771), ACGguaaacu (SEQ ID NO: 3772), AGGgugaguu (SEQ ID NO: 798), GUAguagucu (SEQ ID NO: 3773), GUGgcugaaa (SEQ ID NO: 3774), CAGguuaguc (SEQ ID NO: 1456), CUGgugagca (SEQ ID NO: 1753), UCAguaagug (SEQ ID NO: 2691), AAAgugauug (SEQ ID NO: 3775), UAGgucugga (SEQ ID NO: 3776), GAGguguuuc (SEQ ID NO: 3777), AAGguaaauu (SEQ ID NO: 133), CAUguacauc (SEQ ID NO: 3778), AAGguuugaa (SEQ ID NO: 3779), CCAgcaagug (SEQ ID NO: 3780), UAGguaauaa (SEQ ID NO: 3781), GAGgcaagug (SEQ ID NO: 1859), CAAgugauuc (SEQ ID NO: 1071), CAGgucgugg (SEQ ID NO: 3782), GAAguaugcc (SEQ ID NO: 3783), UCGgugcccu (SEQ ID NO: 3784), GAGgucaguc (SEQ ID NO: 3785), CAGgugagac (SEQ ID NO: 1334), UUUgucugua (SEQ ID NO: 3786), CAGguagaua (SEQ ID NO: 3787), UGGguaucag (SEQ ID NO: 3788), UAGgugggcu (SEQ ID NO: 2616), AUGgugagau (SEQ ID NO: 3789), CAGguaacac (SEQ ID NO: 3790), CCGguauccu (SEQ ID NO: 3791), UAGguaagcu (SEQ ID NO: 2487), UCAguacauc (SEQ ID NO: 3792), UAGguuugcc (SEQ ID NO: 2642), AUGguaagaa (SEQ ID NO: 889), UUGguaagac (SEQ ID NO: 3793), CCGguuaguc (SEQ ID NO: 3794), GAGguaagaa (SEQ ID NO: 1882), UGGguaaguu (SEQ ID NO: 2844), CCGgugagaa (SEQ ID NO: 1585), CCUgugaggg (SEQ ID NO: 1608), ACGguaggag (SEQ ID NO: 590), ACAguauguc (SEQ ID NO: 3795), CAGguauuaa (SEQ ID NO: 3796), CAGguggauc (SEQ ID NO: 3797), AGAgugcgua (SEQ ID NO: 3798), AAGgugaccg (SEQ ID NO: 3799), AGAguaggug (SEQ ID NO: 687), ACUguaugua (SEQ ID NO: 3800), UAGgucaauu (SEQ ID NO: 3801), AGUguguaag (SEQ ID NO: 3802), CGGguaccuu (SEQ ID NO: 3803), CUAgugaguu (SEQ ID NO: 3804), CUAguaagug (SEQ ID NO: 1666), CAGguacaac (SEQ ID NO: 3805), UAGgugugug (SEQ ID NO: 2627), CAUguacggc (SEQ ID NO: 3806), AUGgugugag (SEQ ID NO: 3807), AGGguggaag (SEQ ID NO: 3808), CAGgugcgag (SEQ ID NO: 3809), UAGgugcucc (SEQ ID NO: 3810), AAGguggugg (SEQ ID NO: 390), AAGgucuguu (SEQ ID NO: 317), CAGgugggcc (SEQ ID NO: 1407), AAGgucaguc (SEQ ID NO: 294), CAGguuuuua (SEQ ID NO: 3811), AACgugaggu (SEQ ID NO: 3812), CGGguaagag (SEQ ID NO: 3813), UUUgucggua (SEQ ID NO: 3814), UAGguuaagu (SEQ ID NO: 3815), GUGguaagaa (SEQ ID NO: 2342), CAGguauugg (SEQ ID NO: 1266), GCUguaaguu (SEQ ID NO: 2196), CUAguaagua (SEQ ID NO: 1664), UCGguaaaua (SEQ ID NO: 3816), CAGguaacuu (SEQ ID NO: 1137), CCUgugagua (SEQ ID NO: 3817), CAGguuauau (SEQ ID NO: 3818), CUGgugaaca (SEQ ID NO: 3819), AAGguauaaa (SEQ ID NO: 238), GAGguaagca (SEQ ID NO: 1885), AAGgugaagc (SEQ ID NO: 324), CAGgugaguu (SEQ ID NO: 1348), UUUgugagua (SEQ ID NO: 3820), CUUguacgcc (SEQ ID NO: 3821), AGAguaagug (SEQ ID NO: 670), UGGguaggug (SEQ ID NO: 2853), UGAgcccugc (SEQ ID NO: 3822), UGUguaugua (SEQ ID NO: 3823), AAGguagagg (SEQ ID NO: 3824), GAGguggggg (SEQ ID NO: 2062), UAGguaauuc (SEQ ID NO: 2502), AAGgcauggu (SEQ ID NO: 3825), AGAguaagca (SEQ ID NO: 663), AAGguaggaa (SEQ ID NO: 217), CAAguaagua (SEQ ID NO: 1026), ACUguaauug (SEQ ID NO: 3826), CAGgucugug (SEQ ID NO: 1311), UCGguaccga (SEQ ID NO: 3827), CUGgugagag (SEQ ID NO: 3828), AAGguuugcu (SEQ ID NO: 463), AUGguaccac (SEQ ID NO: 3829), UAAguuaguu (SEQ ID NO: 3830), CAGguaggac (SEQ ID NO: 1213), AGAgugaggc (SEQ ID NO: 3831), CGAgucagua (SEQ ID NO: 3832), CAGgucugag (SEQ ID NO: 1304), GAGguggugg (SEQ ID NO: 3833), ACGguauugg (SEQ ID NO: 3834), GCUgcgagua (SEQ ID NO: 3835), CUGguaagug (SEQ ID NO: 1708), GUGgugagau (SEQ ID NO: 2379), GGGguuugau (SEQ ID NO: 3836), UCUgugagug (SEQ ID NO: 2762), CUUgucagua (SEQ ID NO: 1801), GAGguaaaac (SEQ ID NO: 1866), UCUguaagau (SEQ ID NO: 2741), CCAguaaguu (SEQ ID NO: 1558), CAGguaaagu (SEQ ID NO: 1124), GCGgugagca (SEQ ID NO: 2179), UAAguaagag (SEQ ID NO: 2416), CUGgcaggug (SEQ ID NO: 3837), GAGguaaggg (SEQ ID NO: 1891), UGAguaaguu (SEQ ID NO: 2775), GAGgugagac (SEQ ID NO: 2015), GCUgucuguu (SEQ ID NO: 3838), AAGguaacaa (SEQ ID NO: 134), GAGguaacgg (SEQ ID NO: 3839), CUGguauucu (SEQ ID NO: 3840), CAAguaacug (SEQ ID NO: 1021), AAGguggggu (SEQ ID NO: 383), UAGguauggc (SEQ ID NO: 2549), CAGguauuuu (SEQ ID NO: 1271), GUGguaaacu (SEQ ID NO: 3841), GAGgucugag (SEQ ID NO: 1998), CUGguaaggu (SEQ ID NO: 1706), CAAguaaguu (SEQ ID NO: 1029), AAGguagacc (SEQ ID NO: 206), GAGgcgagcg (SEQ ID NO: 3842), CUGguaaaua (SEQ ID NO: 1687), UGUguaagcg (SEQ ID NO: 3843), CAGguuaggg (SEQ ID NO: 1453), GGGgugagga (SEQ ID NO: 2280), ACAguaugug (SEQ ID NO: 3844), CCGgugggga (SEQ ID NO: 3845), GAGgucagug (SEQ ID NO: 3846), AGGguaaggu (SEQ ID NO: 3847), ACAguaagua (SEQ ID NO: 546), GGUguaaggu (SEQ ID NO: 3848), GAGguaauaa (SEQ ID NO: 1895), CAGguauucc (SEQ ID NO: 3849), CUGguauaaa (SEQ ID NO: 3850), CCGgucugug (SEQ ID NO: 3851), CAGguaacug (SEQ ID NO: 1136), GCAguaagua (SEQ ID NO: 2147), AAGguagggg (SEQ ID NO: 225), CAAguccacc (SEQ ID NO: 3852), CAAguuggug (SEQ ID NO: 3853), CAGgugcggu (SEQ ID NO: 1379), CAGguaaaau (SEQ ID NO: 3854), ACGguaagga (SEQ ID NO: 3855), UGGguaauaa (SEQ ID NO: 3856), UAGguaagug (SEQ ID NO: 2493), CCGguagguu (SEQ ID NO: 3857), AGAguaugga (SEQ ID NO: 3858), CUCgugaguc (SEQ ID NO: 3859), AAAgccggug (SEQ ID NO: 3860), UUGguaauuu (SEQ ID NO: 2970), GAGguaaaag (SEQ ID NO: 1867), CCUgugugag (SEQ ID NO: 3861), AAAguaagga (SEQ ID NO: 18), UGAgugagug (SEQ ID NO: 2800), AAGguacaug (SEQ ID NO: 180), CCGguaaaug (SEQ ID NO: 3862), CAGgugaagc (SEQ ID NO: 3863), CAGguacccg (SEQ ID NO: 1173), GAGguaaggc (SEQ ID NO: 1890), UUUguauguu (SEQ ID NO: 3049), CAGgugcucc (SEQ ID NO: 1386), UCGguagguc (SEQ ID NO: 3864), CGGgugaggc (SEQ ID NO: 3865), AAGguaauua (SEQ ID NO: 168), ACUgugaguc (SEQ ID NO: 644), AAGgucagca (SEQ ID NO: 285), GUGgugagug (SEQ ID NO: 2384), CAUguccacc (SEQ ID NO: 3866), AAGgugaccc (SEQ ID NO: 3867), CGGguuagua (SEQ ID NO: 3868), GCGguaguaa (SEQ ID NO: 3869), GCUguaggua (SEQ ID NO: 3870), CCUguugagu (SEQ ID NO: 3871), UAGgucuggc (SEQ ID NO: 2577), GAUgugagcc (SEQ ID NO: 2131), CUUgugagua (SEQ ID NO: 1802), CUGguguguu (SEQ ID NO: 1780), GAGgcaugug (SEQ ID NO: 1863), CAGgcaagag (SEQ ID NO: 1101), UUGguaagaa (SEQ ID NO: 2957), GAGguguggg (SEQ ID NO: 2075), GAGguauuuu (SEQ ID NO: 1975), CAGguaguaa (SEQ ID NO: 1224), AGGguaagac (SEQ ID NO: 3872), UUUguaggca (SEQ ID NO: 3873), AGGgugagau (SEQ ID NO: 3874), GAGguuugua (SEQ ID NO: 2110), AAGgugagug (SEQ ID NO: 349), GAGgugggag (SEQ ID NO: 2055), AAGgugagaa (SEQ ID NO: 335), CUGguaagag (SEQ ID NO: 1698), AUAguaaaga (SEQ ID NO: 3875), GAUgugaguc (SEQ ID NO: 2134), AAGgugcagg (SEQ ID NO: 3876), CAGgucuguc (SEQ ID NO: 1310), GAGgugauuu (SEQ ID NO: 3877), CAGguuggcu (SEQ ID NO: 3878), CGGguauggg (SEQ ID NO: 3879), AUGguccauc (SEQ ID NO: 3880), CCGguuggug (SEQ ID NO: 3881), GGAguaaguc (SEQ ID NO: 3882), AAUguaagga (SEQ ID NO: 488), CAGguuuguu (SEQ ID NO: 1510), UAGgugugua (SEQ ID NO: 2626), UAUgucuuug (SEQ ID NO: 3883), ACGguacuuc (SEQ ID NO: 3884), AAGgcacgcg (SEQ ID NO: 3885), CUGguaaacc (SEQ ID NO: 1684), CUUgugggua (SEQ ID NO: 3886), UGAguaaguc (SEQ ID NO: 2773), CUGgugggug (SEQ ID NO: 1773), GAGguggaga (SEQ ID NO: 3887), GUGguggcug (SEQ ID NO: 3888), GUGguaagug (SEQ ID NO: 2353), AACgugagua (SEQ ID NO: 3889), GAAgcuguaa (SEQ ID NO: 3890), CGGguaucuu (SEQ ID NO: 3891), CAGgugucag (SEQ ID NO: 1424), AAUguacgca (SEQ ID NO: 3892), CCGgugggua (SEQ ID NO: 3893), UGGgugaggu (SEQ ID NO: 3894), AAGguauguu (SEQ ID NO: 266), CAGguauguu (SEQ ID NO: 1261), CAGguuugcu (SEQ ID NO: 1505), UUGguaaguu (SEQ ID NO: 2964), CAGguaguug (SEQ ID NO: 1231), CCUgugaaua (SEQ ID NO: 3895), GCUgugugug (SEQ ID NO: 3896), CAAguaauuc (SEQ ID NO: 1033), AGGguaaugu (SEQ ID NO: 3897), GCUgugaguc (SEQ ID NO: 2205), ACCguaaguu (SEQ ID NO: 3898), CGUguaagua (SEQ ID NO: 3899), GGGguaaguc (SEQ ID NO: 3900), AAUguaugau (SEQ ID NO: 3901), AAUgugauua (SEQ ID NO: 3902), UCAguaagaa (SEQ ID NO: 2682), CAGguccguc (SEQ ID NO: 3903), GAAguauuga (SEQ ID NO: 3904), UUGguaagga (SEQ ID NO: 2960), CAGgucgguu (SEQ ID NO: 3905), UAGguuagug (SEQ ID NO: 2635), ACGguaaaac (SEQ ID NO: 577), AAGguagguc (SEQ ID NO: 228), UACgugagua (SEQ ID NO: 3906), UUGguaagca (SEQ ID NO: 3907), GCGgugaguc (SEQ ID NO: 3908), GAAguaaggg (SEQ ID NO: 3909), CGCgugaguu (SEQ ID NO: 3910), CAGguacccc (SEQ ID NO: 3911), UCUguaagac (SEQ ID NO: 3912), GAGgugggca (SEQ ID NO: 2057), AAUguaagac (SEQ ID NO: 3913), CAGgcaaggg (SEQ ID NO: 3914), CAAguaacua (SEQ ID NO: 1020), AAAguuuguc (SEQ ID NO: 3915), CAGguacugu (SEQ ID NO: 1193), AAGgucccuc (SEQ ID NO: 303), UCGguaaguc (SEQ ID NO: 3916), UGGgugagug (SEQ ID NO: 2877), CUUgugagau (SEQ ID NO: 3917), AGAgugagcu (SEQ ID NO: 3918), UAAgugggga (SEQ ID NO: 3919), UAGguaggga (SEQ ID NO: 2522), CAGguuagcc (SEQ ID NO: 1452), AGGguaauca (SEQ ID NO: 3920), AAGguucagc (SEQ ID NO: 3921), UGGgugggug (SEQ ID NO: 2885), CAGguuguga (SEQ ID NO: 1494), AAGguaagug (SEQ ID NO: 155), CAUgugcgua (SEQ ID NO: 1543), CCGguauauu (SEQ ID NO: 3922), ACCguaugug (SEQ ID NO: 3923), CAGguauagu (SEQ ID NO: 3924), CAGguauuac (SEQ ID NO: 3925), CAGgugcagg (SEQ ID NO: 1364), GUGgugagcu (SEQ ID NO: 2381), AAGguaacau (SEQ ID NO: 135), CUGgugaugg (SEQ ID NO: 3926), AUGguaaaug (SEQ ID NO: 882), CCGgugagca (SEQ ID NO: 3927), AAGguaaacc (SEQ ID NO: 124), AAGguacugg (SEQ ID NO: 3928), GCGgucagga (SEQ ID NO: 3929), CUGgucaggg (SEQ ID NO: 3930), AAAguacguu (SEQ ID NO: 3931), AGAguagguu (SEQ ID NO: 688), AGGguaagcu (SEQ ID NO: 3932), AUUgugagua (SEQ ID NO: 1009), CCGgccacca (SEQ ID NO: 3933), GAGguaacuu (SEQ ID NO: 1881), GAGguaugaa (SEQ ID NO: 1956), CAGgucagac (SEQ ID NO: 1276), UAGgcgugug (SEQ ID NO: 2462), AGGguaaguu (SEQ ID NO: 743), CAGgcaugag (SEQ ID NO: 1111), CAGguaacgu (SEQ ID NO: 1133), CAGgcgagca (SEQ ID NO: 3934), UAGguauggu (SEQ ID NO: 2550), AGAguaggau (SEQ ID NO: 3935), CUGguuucaa (SEQ ID NO: 3936), GAGguaaacu (SEQ ID NO: 3937), CAGgcaugca (SEQ ID NO: 1112), UUGguaaucu (SEQ ID NO: 3938), AGGgcagaau (SEQ ID NO: 3939), AUGguaaaac (SEQ ID NO: 877), GCUgcaggug (SEQ ID NO: 3940), GAAgcacgug (SEQ ID NO: 3941), CAUguaaaca (SEQ ID NO: 3942), UGGguaagau (SEQ ID NO: 2835), AGGguagcua (SEQ ID NO: 3943), AGGguggggu (SEQ ID NO: 800), CCUguaaguu (SEQ ID NO: 1600), UGAgugaguu (SEQ ID NO: 2801), GGAguaugua (SEQ ID NO: 3944), CAGgugaccu (SEQ ID NO: 1328), AAAguacgga (SEQ ID NO: 3945), GAGguacaga (SEQ ID NO: 1906), GAUguaggua (SEQ ID NO: 2125), GGGguaauug (SEQ ID NO: 3946), UAGguggguu (SEQ ID NO: 2617), GUGguacgua (SEQ ID NO: 3947), AAGguacagc (SEQ ID NO: 3948), GAGgugaaga (SEQ ID NO: 3949), GGGguaagca (SEQ ID NO: 2246), UGAguagguc (SEQ ID NO: 3950), GGGguaaguu (SEQ ID NO: 2253), AUUgugaguu (SEQ ID NO: 1011), UCAguaagac (SEQ ID NO: 3951), AGUgugagcu (SEQ ID NO: 834), AAGgcaaaac (SEQ ID NO: 3952), CUGgugaguc (SEQ ID NO: 1760), AAGgucucug (SEQ ID NO: 310), GAGgcugugc (SEQ ID NO: 3953), AGAgugagac (SEQ ID NO: 700), GAGgugaugu (SEQ ID NO: 2033), AGAguauggu (SEQ ID NO: 3954), UGGguggguc (SEQ ID NO: 2884), GCUgcugagc (SEQ ID NO: 3955), CAGguagcug (SEQ ID NO: 1210), UAGgucagaa (SEQ ID NO: 3956), CCGguaggug (SEQ ID NO: 3957), GCAguaugau (SEQ ID NO: 3958), CAGguuucag (SEQ ID NO: 3959), GAGguuugcc (SEQ ID NO: 3960), GGGguggggg (SEQ ID NO: 3961), AAGguacaua (SEQ ID NO: 179), UGGguguguu (SEQ ID NO: 2890), AGAguaaggc (SEQ ID NO: 666), GCGguuagug (SEQ ID NO: 3962), AAGgugacuu (SEQ ID NO: 334), AUGguaagau (SEQ ID NO: 892), AUGguaguug (SEQ ID NO: 3963), CAUguaagac (SEQ ID NO: 3964), CUGguaugua (SEQ ID NO: 1736), UUCguaagga (SEQ ID NO: 3965), GAAguaugac (SEQ ID NO: 3966), CGGguaauuc (SEQ ID NO: 1627), UGGguaacuu (SEQ ID NO: 2831), CAGgugccua (SEQ ID NO: 1372), CAUguagggc (SEQ ID NO: 3967), ACCgucagga (SEQ ID NO: 3968), CGUguucgau (SEQ ID NO: 3969), GAGgcaggac (SEQ ID NO: 3970), UAGguaauau (SEQ ID NO: 2496), UCGguauacu (SEQ ID NO: 3971), UAGguugugc (SEQ ID NO: 3972), CCGgugaguc (SEQ ID NO: 3973), CAGgugccaa (SEQ ID NO: 1368), CAGgugaugc (SEQ ID NO: 1352), AAGgugagga (SEQ ID NO: 343), GUGgugaggg (SEQ ID NO: 3974), UGGgucagua (SEQ ID NO: 3975), GAGgucaggg (SEQ ID NO: 1985), UAGguacgua (SEQ ID NO: 2511), GAGgcaagag (SEQ ID NO: 1857), CCUguuggua (SEQ ID NO: 3976), GAGguaucca (SEQ ID NO: 3977), UAAguaagcu (SEQ ID NO: 2419), AAGgucaguu (SEQ ID NO: 296), AAAguuaaag (SEQ ID NO: 3978), GAGgugcuau (SEQ ID NO: 3979), ACGguaaguu (SEQ ID NO: 581), CUGgugaggg (SEQ ID NO: 1757), GAGguuaugu (SEQ ID NO: 2091), CUUgugugca (SEQ ID NO: 3980), UGAgcugggg (SEQ ID NO: 3981), AAGguauagu (SEQ ID NO: 3982), UAGguaaaac (SEQ ID NO: 2464), GGGgugaggu (SEQ ID NO: 3983), GAGgcaagca (SEQ ID NO: 3984), GGAguaacgu (SEQ ID NO: 3985), AGAguaagua (SEQ ID NO: 3986), AAAguaagua (SEQ ID NO: 21), GAGgcaacca (SEQ ID NO: 3987), UGUguaaguu (SEQ ID NO: 2909), UAGgugaggc (SEQ ID NO: 2594), ACAguaagaa (SEQ ID NO: 544), UGAguaagug (SEQ ID NO: 2774), CAAgucagua (SEQ ID NO: 1057), AGGguaaaug (SEQ ID NO: 3988), AAGguaugca (SEQ ID NO: 257), GCUgugcgug (SEQ ID NO: 3989), GAGguucgcc (SEQ ID NO: 3990), AAGgcuugca (SEQ ID NO: 3991), CAGgcaagug (SEQ ID NO: 1104), AUAguaaguc (SEQ ID NO: 3992), UUGguaggua (SEQ ID NO: 2978), GCAgcaggua (SEQ ID NO: 3993), AAGguauauc (SEQ ID NO: 243), AGCguaagcc (SEQ ID NO: 3994), CUGguucgaa (SEQ ID NO: 3995), ACGgugggug (SEQ ID NO: 612), CUGgucauug (SEQ ID NO: 3996), CAGgucagga (SEQ ID NO: 1280), CAAgugagac (SEQ ID NO: 1062), GAGguacugg (SEQ ID NO: 1919), GAGguguagu (SEQ ID NO: 3997), GAGguguccu (SEQ ID NO: 3998), CAGgugcgua (SEQ ID NO: 1380), AGUgcccuga (SEQ ID NO: 3999), AUGgugaguc (SEQ ID NO: 962), UGUgugugua (SEQ ID NO: 4000), CAGguaugcu (SEQ ID NO: 1254), CUGguacagu (SEQ ID NO: 4001), UUGguacgua (SEQ ID NO: 4002), UCUguacgua (SEQ ID NO: 4003), UAAguaauuc (SEQ ID NO: 4004), CACguaugug (SEQ ID NO: 4005), CAGgcaagua (SEQ ID NO: 1103), UCGgugagug (SEQ ID NO: 4006), GGUgugaguc (SEQ ID NO: 2315), UCUguaagcu (SEQ ID NO: 2743), AAGguucaga (SEQ ID NO: 4007), AGGguacuuc (SEQ ID NO: 4008), GCGgcagguu (SEQ ID NO: 4009), GAGgcccgug (SEQ ID NO: 4010), CAGguauaaa (SEQ ID NO: 4011), AUGgucaagu (SEQ ID NO: 4012), AAGgugagua (SEQ ID NO: 347), GUGguuuguu (SEQ ID NO: 4013), AGAgugagga (SEQ ID NO: 4014), GAGguaugac (SEQ ID NO: 1957), UAGgcgugag (SEQ ID NO: 4015), AAGguacucc (SEQ ID NO: 4016), UGAgugagga (SEQ ID NO: 2798), GAGguaugau (SEQ ID NO: 4017), GGGgucggua (SEQ ID NO: 4018), ACGguaugca (SEQ ID NO: 4019), CAGguaccac (SEQ ID NO: 1171), UAAguaccug (SEQ ID NO: 4020), AGGgugggcu (SEQ ID NO: 4021), CUGgucuguu (SEQ ID NO: 4022), UAGgucagag (SEQ ID NO: 4023), AAGguguguu (SEQ ID NO: 406), CUGgucagug (SEQ ID NO: 4024), AAGgugggac (SEQ ID NO: 4025), GUGguaguag (SEQ ID NO: 4026), CUAguuuagg (SEQ ID NO: 4027), CCCgccccau (SEQ ID NO: 4028), GCUguacugc (SEQ ID NO: 4029), GAGguaauau (SEQ ID NO: 1897), UAGguuggug (SEQ ID NO: 4030), AAGguccaac (SEQ ID NO: 4031), UAGgugagga (SEQ ID NO: 2593), GUGguaaguu (SEQ ID NO: 2354), AGUgugagag (SEQ ID NO: 831), AAUguacaug (SEQ ID NO: 497), UUGgcaggug (SEQ ID NO: 4032), UAGguuauug (SEQ ID NO: 4033), CAGguacuga (SEQ ID NO: 1191), GCGguggguc (SEQ ID NO: 4034), UGUguaagau (SEQ ID NO: 4035), GAGgugagua (SEQ ID NO: 2025), GCAgccccgg (SEQ ID NO: 4036), CAGgugcuaa (SEQ ID NO: 4037), AGUguaagag (SEQ ID NO: 815), CAGguacauc (SEQ ID NO: 4038), CAGgugggac (SEQ ID NO: 1403), AGGguaaaua (SEQ ID NO: 727), UAAguaauua (SEQ ID NO: 4039), CAGguaaccg (SEQ ID NO: 1132), AAGguuugca (SEQ ID NO: 461), UAGgugguuu (SEQ ID NO: 4040), CAGgugaccg (SEQ ID NO: 1327), UGUguaagcu (SEQ ID NO: 4041), GGAgugaguc (SEQ ID NO: 2227), AGGguaggag (SEQ ID NO: 752), AGGgugggug (SEQ ID NO: 802), AAGgucugag (SEQ ID NO: 313), GAUguaauau (SEQ ID NO: 4042), GGGguaauua (SEQ ID NO: 4043), UAGguaggua (SEQ ID NO: 2524), GAGgcaagua (SEQ ID NO: 1858), GAGguaagga (SEQ ID NO: 1889), UAGguacuac (SEQ ID NO: 4044), UCGgugggug (SEQ ID NO: 4045), AAGgugugga (SEQ ID NO: 401), CAGgucugcc (SEQ ID NO: 1305), UAAgugagcc (SEQ ID NO: 4046), GAAguaaguu (SEQ ID NO: 1820), GAAguaagcc (SEQ ID NO: 1815), UAGgugcgac (SEQ ID NO: 4047), GAGguauggc (SEQ ID NO: 4048), GCAguaagaa (SEQ ID NO: 2145), CAGgugugga (SEQ ID NO: 1438), UUGguaacgu (SEQ ID NO: 4049), GCUguaaaaa (SEQ ID NO: 4050), UUGguuagua (SEQ ID NO: 4051), AUAguaaggg (SEQ ID NO: 4052), UUGguacuag (SEQ ID NO: 4053), CGGgcagccg (SEQ ID NO: 4054), CAGgugcugg (SEQ ID NO: 1389), UAUgugaguu (SEQ ID NO: 2673), CAGgucuggg (SEQ ID NO: 4055), UAAguaagaa (SEQ ID NO: 2415), AAGguuauua (SEQ ID NO: 4056), AGAguaaagc (SEQ ID NO: 4057), AGAgugugag (SEQ ID NO: 4058), UAGgugcgag (SEQ ID NO: 4059), CAAguaaacg (SEQ ID NO: 4060), AAGguacgua (SEQ ID NO: 4061), CUGgugagua (SEQ ID NO: 1759), CCAguaugua (SEQ ID NO: 4062), UUGgugagug (SEQ ID NO: 3006), UGAguaagua (SEQ ID NO: 2772), GAGguuagca (SEQ ID NO: 4063), GUGguaagcc (SEQ ID NO: 4064), CUGguauggc (SEQ ID NO: 1734), AAAguaacac (SEQ ID NO: 8), CAGguacuaa (SEQ ID NO: 1186), UCUguaaguu (SEQ ID NO: 2747), GAGgugaggg (SEQ ID NO: 2024), ACUgugggua (SEQ ID NO: 647), GAUguuugug (SEQ ID NO: 4065), CAGgugucaa (SEQ ID NO: 4066), CAGgucacca (SEQ ID NO: 4067), CCGgugagua (SEQ ID NO: 4068), UUGguaaaua (SEQ ID NO: 4069), CAGguggggg (SEQ ID NO: 1411), ACUgcaggug (SEQ ID NO: 4070), UAGguauguu (SEQ ID NO: 2554), GGAgcaagug (SEQ ID NO: 4071), UCGgugccuc (SEQ ID NO: 4072), CAAguaacuu (SEQ ID NO: 4073), GAGguaacca (SEQ ID NO: 1879), CAGguaauau (SEQ ID NO: 1151), GGAguaagaa (SEQ ID NO: 4074), GAGguaccuu (SEQ ID NO: 1914), AGGguaagga (SEQ ID NO: 737), CCUgugaguc (SEQ ID NO: 1609), GAGguaaugg (SEQ ID NO: 1900), AUGguguguc (SEQ ID NO: 4075), GGGgugagua (SEQ ID NO: 4076), AGGgucaggu (SEQ ID NO: 4077), UGGguaaggg (SEQ ID NO: 2839), AGGguagguu (SEQ ID NO: 759), AUAgugaguu (SEQ ID NO: 4078), CCCguaggcu (SEQ ID NO: 4079), ACAguaugua (SEQ ID NO: 553), GACgugugua (SEQ ID NO: 4080), GCGgugagga (SEQ ID NO: 4081), CAGgugaccc (SEQ ID NO: 1326), UAAguuuagu (SEQ ID NO: 4082), ACAguugagu (SEQ ID NO: 570), CGGgugaggg (SEQ ID NO: 1639), CAGguggauu (SEQ ID NO: 1398), CGGguagagg (SEQ ID NO: 4083), UAGgugcgug (SEQ ID NO: 2608), GGGguaagaa (SEQ ID NO: 2243), GAGguggggu (SEQ ID NO: 4084), CACguggguu (SEQ ID NO: 4085), ACGguaauug (SEQ ID NO: 4086), AGAgugaguc (SEQ ID NO: 705), UUGgcuccaa (SEQ ID NO: 4087), AAGgugaugc (SEQ ID NO: 355), AAGguugguc (SEQ ID NO: 448), AGCguaaguu (SEQ ID NO: 4088), AUUguaugua (SEQ ID NO: 1006), UCAguuaagu (SEQ ID NO: 4089), CAAguacgug (SEQ ID NO: 4090), CAGgugcgug (SEQ ID NO: 1382), CAGguaggua (SEQ ID NO: 1220), AUGguggggu (SEQ ID NO: 4091), AUGgugaguu (SEQ ID NO: 964), CAGguaauca (SEQ ID NO: 4092), AAGguagggu (SEQ ID NO: 226), CAGgccaagg (SEQ ID NO: 4093), GUGgugagag (SEQ ID NO: 4094), AAGguuggug (SEQ ID NO: 449), CAGguacucu (SEQ ID NO: 1190), UAGgcaugug (SEQ ID NO: 4095), UUGguaccuu (SEQ ID NO: 4096), CUGgugugcc (SEQ ID NO: 4097), ACAguugcca (SEQ ID NO: 4098), UUGguaauau (SEQ ID NO: 4099), GAGgugcaug (SEQ ID NO: 4100), UUGguuugua (SEQ ID NO: 3028), UUGguaagug (SEQ ID NO: 2963), UGUgugugug (SEQ ID NO: 4101), GUGguuugua (SEQ ID NO: 2398), GCGguacaca (SEQ ID NO: 4102), AGAguaugcu (SEQ ID NO: 4103), UUUguaagua (SEQ ID NO: 3038), UCUgugcggg (SEQ ID NO: 4104), AAGgucagug (SEQ ID NO: 295), GAGguaggaa (SEQ ID NO: 1930), GCGguuagca (SEQ ID NO: 4105), AGGgugaggg (SEQ ID NO: 793), GAAgugagua (SEQ ID NO: 4106), CAGgugacag (SEQ ID NO: 4107), AAGgugauua (SEQ ID NO: 357), GAGgccagcc (SEQ ID NO: 4108), GAGgucuccu (SEQ ID NO: 4109), UAGguauuac (SEQ ID NO: 2556), CAUguaagag (SEQ ID NO: 1519), CUGguagggc (SEQ ID NO: 4110), GAAguaagua (SEQ ID NO: 1818), CGGguaagug (SEQ ID NO: 4111), CAGguaaucu (SEQ ID NO: 4112), GUGguaggua (SEQ ID NO: 4113), CAGgugggua (SEQ ID NO: 1413), AAGgccagug (SEQ ID NO: 4114), AAAgugaauc (SEQ ID NO: 4115), ACGguuacgu (SEQ ID NO: 4116), AUGguaggaa (SEQ ID NO: 917), CGGgugagac (SEQ ID NO: 4117), GAGguuggaa (SEQ ID NO: 2099), UGGgugagcc (SEQ ID NO: 2871), CCAgugagua (SEQ ID NO: 1564), CUAguacgag (SEQ ID NO: 4118), CAGguaugac (SEQ ID NO: 1248), GCUgugaggu (SEQ ID NO: 4119), CUGguaugaa (SEQ ID NO: 4120), GGUguacgac (SEQ ID NO: 4121), CUUgugagug (SEQ ID NO: 4122), GUGgugagca (SEQ ID NO: 2380), CUGguaacuu (SEQ ID NO: 1696), CAGguacuau (SEQ ID NO: 1188), AGGguaaggg (SEQ ID NO: 739), UUGguuaguu (SEQ ID NO: 3025), GGUguaagca (SEQ ID NO: 2302), UCGgugagga (SEQ ID NO: 4123), UGGguaaaca (SEQ ID NO: 4124), UCGguacgug (SEQ ID NO: 4125), UAGguagcag (SEQ ID NO: 4126), CUGguaaggc (SEQ ID NO: 1704), GUGguaagga (SEQ ID NO: 2349), UAAguaagca (SEQ ID NO: 2418), GAGguuccaa (SEQ ID NO: 4127), CUGguaugga (SEQ ID NO: 4128), GGGgugggua (SEQ ID NO: 2288), CAGguuuccc (SEQ ID NO: 4129), CAGgucucug (SEQ ID NO: 4130), GAGgugagga (SEQ ID NO: 2022), CUUguggguu (SEQ ID NO: 1805), AUGgugagac (SEQ ID NO: 953), CAGgugaagg (SEQ ID NO: 1319), GCGguagggg (SEQ ID NO: 4131), GUUguuuccc (SEQ ID NO: 4132), AAAgcaucca (SEQ ID NO: 4133), GUGguagguu (SEQ ID NO: 2367), AAGgugugaa (SEQ ID NO: 398), CAGguacagu (SEQ ID NO: 1167), AAGguaccaa (SEQ ID NO: 182), UUGguaauug (SEQ ID NO: 2969), AAGgugcuca (SEQ ID NO: 4134), AAGguucaac (SEQ ID NO: 4135), CAGguuuaca (SEQ ID NO: 4136), GCUguaagug (SEQ ID NO: 2195), AGGguauguc (SEQ ID NO: 769), GAGgucgggg (SEQ ID NO: 1996), AAGgugccug (SEQ ID NO: 363), AAGguaaaaa (SEQ ID NO: 119), GUGgugaguu (SEQ ID NO: 2385), UAGguaagaa (SEQ ID NO: 4137), AGGguauccu (SEQ ID NO: 4138), GUGguaauau (SEQ ID NO: 4139), UCUguaagua (SEQ ID NO: 2744), UGGguaugga (SEQ ID NO: 4140), AUGguaugga (SEQ ID NO: 935), GACgugagcc (SEQ ID NO: 1854), CUGguuuggc (SEQ ID NO: 4141), AUGguauauc (SEQ ID NO: 4142), AAAguaaacu (SEQ ID NO: 4143), AGCgugagug (SEQ ID NO: 721), CUGguauaga (SEQ ID NO: 4144), CAGgugggga (SEQ ID NO: 1409), AGAguauguu (SEQ ID NO: 696), UAGguacuug (SEQ ID NO: 4145), GCAguaggug (SEQ ID NO: 4146), AGUguauguc (SEQ ID NO: 4147), AAGguuaagc (SEQ ID NO: 413), CUGguggccu (SEQ ID NO: 4148), GAAgugaguc (SEQ ID NO: 1839), UUGguguaag (SEQ ID NO: 4149), CAGguaagaa (SEQ ID NO: 1138), CGGgucucgg (SEQ ID NO: 4150), GAGgugcaca (SEQ ID NO: 2035), CUCguuaguu (SEQ ID NO: 4151), AAGgugauca (SEQ ID NO: 352), UAUguaagaa (SEQ ID NO: 2649), GAGgugcuug (SEQ ID NO: 2047), CAGgugguca (SEQ ID NO: 4152), ACGguaaguc (SEQ ID NO: 4153), ACAguaaugu (SEQ ID NO: 4154), CCUguaaggu (SEQ ID NO: 4155), GAGguuaagu (SEQ ID NO: 4156), UCGguaugug (SEQ ID NO: 2725), UGGguauguu (SEQ ID NO: 2863), AAGguauuac (SEQ ID NO: 268), CAGgugaggg (SEQ ID NO: 1343), UUGguaaaca (SEQ ID NO: 4157), AAGguagugu (SEQ ID NO: 4158), GAGguguggc (SEQ ID NO: 4159), CAGguacgga (SEQ ID NO: 4160), AAGgucauca (SEQ ID NO: 4161), CAAguaggca (SEQ ID NO: 4162), CAGgugaaac (SEQ ID NO: 4163), CAGguacugc (SEQ ID NO: 1192), AAUgcaagug (SEQ ID NO: 4164), CAUguaauuc (SEQ ID NO: 4165), AAGguaugcu (SEQ ID NO: 259), CUGgugaguu (SEQ ID NO: 1762), CAGgugguuu (SEQ ID NO: 4166), UGUgugagua (SEQ ID NO: 2922), AAGgucggug (SEQ ID NO: 4167), AUGguaaauu (SEQ ID NO: 883), AGGguauuac (SEQ ID NO: 771), AGUguaugga (SEQ ID NO: 4168), AACguaagau (SEQ ID NO: 4169), GUGguaaggu (SEQ ID NO: 4170), ACUguuagua (SEQ ID NO: 4171), CAGguaucag (SEQ ID NO: 1239), AAGguuaguu (SEQ ID NO: 425), CUGgugagcu (SEQ ID NO: 1754), UUGgugagcu (SEQ ID NO: 4172), UGUguacgua (SEQ ID NO: 4173), GAGgucagcc (SEQ ID NO: 4174), GAGguagaau (SEQ ID NO: 4175), AAGguaugag (SEQ ID NO: 255), UAGguauuuc (SEQ ID NO: 2563), UGUguaacac (SEQ ID NO: 4176), AGUguaaggc (SEQ ID NO: 4177), GAGgucugcu (SEQ ID NO: 4178), AAGguuagca (SEQ ID NO: 418), CAGguaaaug (SEQ ID NO: 1127), AACguaagcu (SEQ ID NO: 4179), CAGgucugca (SEQ ID NO: 4180), CAGguauugu (SEQ ID NO: 1267), GUGguaauuc (SEQ ID NO: 2356), GAGguauaug (SEQ ID NO: 1951), GCCgugagcc (SEQ ID NO: 4181), GAGguaagag (SEQ ID NO: 1883), UGAguaugua (SEQ ID NO: 2787), CAGguaaggg (SEQ ID NO: 1145), GAGguaaauu (SEQ ID NO: 1876), CAGgcaacuu (SEQ ID NO: 4182), UGUguaaguc (SEQ ID NO: 2908), CAGgugcgcu (SEQ ID NO: 4183), CGGguaaacc (SEQ ID NO: 4184), CCGgucaguc (SEQ ID NO: 4185), UAGgugggcg (SEQ ID NO: 4186), GCGgucaguu (SEQ ID NO: 4187), GGGguggguc (SEQ ID NO: 4188), AGCguaauag (SEQ ID NO: 4189), ACGgugaguc (SEQ ID NO: 4190), CUGguacuug (SEQ ID NO: 1722), CAGguuggua (SEQ ID NO: 4191), AGAguaugug (SEQ ID NO: 695), CUGgugggua (SEQ ID NO: 1771), GAGguggcuu (SEQ ID NO: 4192), AUAguauuga (SEQ ID NO: 4193), UGAgucgucc (SEQ ID NO: 4194), CAGgugcucu (SEQ ID NO: 4195), UACguaauau (SEQ ID NO: 4196), GCUguccuga (SEQ ID NO: 4197), CAGgcugcac (SEQ ID NO: 4198), CUGgugcgcu (SEQ ID NO: 1766), GCGguaagaa (SEQ ID NO: 4199), UAAguuacuu (SEQ ID NO: 4200), GAAgugagug (SEQ ID NO: 1840), UAGgcaaguc (SEQ ID NO: 2460), UAAguaaaua (SEQ ID NO: 4201), ACGgugagug (SEQ ID NO: 607), CAGguagguu (SEQ ID NO: 1223), GGGguauaac (SEQ ID NO: 4202), GUUgugaguu (SEQ ID NO: 2410), CAUgugagua (SEQ ID NO: 1539), GAGgugcauu (SEQ ID NO: 4203), AAGguuugua (SEQ ID NO: 466), UCGguaaugu (SEQ ID NO: 4204), CGAguaaggg (SEQ ID NO: 1616), GAGgcacgga (SEQ ID NO: 4205), AGGgugugga (SEQ ID NO: 4206), CAGguauggu (SEQ ID NO: 1257), AAGguagaaa (SEQ ID NO: 203), CAGgugccug (SEQ ID NO: 1373), UGGguauaug (SEQ ID NO: 4207), UGAgugagac (SEQ ID NO: 4208), UGGguaauuu (SEQ ID NO: 2847), AUGguaaaua (SEQ ID NO: 881), AAGgcaaagg (SEQ ID NO: 4209), AGUguuuguu (SEQ ID NO: 4210), AUGguauugg (SEQ ID NO: 4211), CUGgugaggc (SEQ ID NO: 1756), UUGguaaaau (SEQ ID NO: 2948), ACAgugaguu (SEQ ID NO: 563), CAGgugcugu (SEQ ID NO: 4212), GAGguuaaga (SEQ ID NO: 2080), AGAguaagaa (SEQ ID NO: 659), GAGguccgcg (SEQ ID NO: 4213), GUGgugagga (SEQ ID NO: 2382), CAGgugagcc (SEQ ID NO: 1338), CAGgugacau (SEQ ID NO: 1324), AUGgcaagcu (SEQ ID NO: 4214), UCGguaauau (SEQ ID NO: 4215), CAGgcaacaa (SEQ ID NO: 4216), GGGguaggga (SEQ ID NO: 2257), CUGgucucgc (SEQ ID NO: 4217), UAGguaacga (SEQ ID NO: 4218), CGGguaaggu (SEQ ID NO: 4219), UAGguaaugc (SEQ ID NO: 4220), CAGgcaagaa (SEQ ID NO: 1099), ACAguaggua (SEQ ID NO: 4221), CAAguaugag (SEQ ID NO: 1049), GCUguucgaa (SEQ ID NO: 4222), AAGguuaugc (SEQ ID NO: 4223), GAUgugaguu (SEQ ID NO: 2136), CAGguggaga (SEQ ID NO: 1396), AGAguuaguu (SEQ ID NO: 4224), UGAgugugcg (SEQ ID NO: 4225), GAGguacagc (SEQ ID NO: 1907), CAGguaagac (SEQ ID NO: 1139), CAUgugcuuu (SEQ ID NO: 4226), AGGguguguu (SEQ ID NO: 4227), ACAguuaagg (SEQ ID NO: 4228), ACAgugaggg (SEQ ID NO: 4229), GAUguauacc (SEQ ID NO: 4230), UUAguaagcu (SEQ ID NO: 4231), CAGguaagau (SEQ ID NO: 1141), AGAgcugcgu (SEQ ID NO: 4232), GAGgcaaguu (SEQ ID NO: 1860), GAAguaagug (SEQ ID NO: 1819), AAGgugaaaa (SEQ ID NO: 4233), AAGguaccua (SEQ ID NO: 4234), GAGguaucag (SEQ ID NO: 4235), AUGguaugua (SEQ ID NO: 4236), AAGguaugaa (SEQ ID NO: 253), UUGgugagcc (SEQ ID NO: 4237), AAGguuagga (SEQ ID NO: 420), AGGguaugua (SEQ ID NO: 768), CAGguaccga (SEQ ID NO: 4238), AGAguaaacu (SEQ ID NO: 4239), AAGgugcaua (SEQ ID NO: 4240), AAGguaaugu (SEQ ID NO: 167), CCGgugugug (SEQ ID NO: 4241), AGGguaaauu (SEQ ID NO: 729), GGGguuuggc (SEQ ID NO: 4242), CAGguacacg (SEQ ID NO: 1164), UUGguaacca (SEQ ID NO: 4243), GAGgucaggu (SEQ ID NO: 1986), UCUguuggua (SEQ ID NO: 4244), CAGguuaguu (SEQ ID NO: 1458), UUGguauguc (SEQ ID NO: 4245), AAGgugcguc (SEQ ID NO: 4246), AGGguaagaa (SEQ ID NO: 733), UUUguaagcc (SEQ ID NO: 4247), AAGgucaggu (SEQ ID NO: 292), CUGguaaacu (SEQ ID NO: 4248), UCGguaauuu (SEQ ID NO: 4249), CUGguaggcu (SEQ ID NO: 4250), GAGgucugua (SEQ ID NO: 4251), GAGguacuuu (SEQ ID NO: 1922), CUGguaaagg (SEQ ID NO: 4252), CGGgugugug (SEQ ID NO: 1650), CAGguguggu (SEQ ID NO: 4253), UCGguacguc (SEQ ID NO: 4254), CAGgugccag (SEQ ID NO: 4255), GGGgugagaa (SEQ ID NO: 2275), ACAgcuagua (SEQ ID NO: 4256), AAGguauagc (SEQ ID NO: 4257), CUGguaggag (SEQ ID NO: 4258), GCUguacgua (SEQ ID NO: 4259), AAGguaaagg (SEQ ID NO: 128), CAAgcacgag (SEQ ID NO: 4260), CUAguaagac (SEQ ID NO: 4261), CCCguaagcg (SEQ ID NO: 4262), CAAgugugag (SEQ ID NO: 1078), AUGguaaggg (SEQ ID NO: 897), AAGgugaggg (SEQ ID NO: 345), CAAguaggua (SEQ ID NO: 1041), GGUguugcug (SEQ ID NO: 2321), GAGguacugu (SEQ ID NO: 1920), UAGguaagau (SEQ ID NO: 2484), CAGgugcgaa (SEQ ID NO: 1374), GAGguccagg (SEQ ID NO: 4263), UUGguauaca (SEQ ID NO: 2982), GGAgugagua (SEQ ID NO: 2226), GAGgugagau (SEQ ID NO: 2017), AAGguggggc (SEQ ID NO: 4264), CAGguaaacg (SEQ ID NO: 4265), UCGguaacuu (SEQ ID NO: 4266), CAGguaaauu (SEQ ID NO: 1128), GAGgugcgca (SEQ ID NO: 4267), ACUgugagua (SEQ ID NO: 643), ACGgugugac (SEQ ID NO: 4268), GUGguaaguc (SEQ ID NO: 2352), CAGguaggca (SEQ ID NO: 1215), CAGgucagca (SEQ ID NO: 1277), GUGguaugug (SEQ ID NO: 4269), AAAguaucug (SEQ ID NO: 4270), CGGguaugua (SEQ ID NO: 4271), AAGguaauaa (SEQ ID NO: 157), GAGgugggga (SEQ ID NO: 2060), GCUguaggug (SEQ ID NO: 2197), GAAgugaguu (SEQ ID NO: 1841), AAAguauuua (SEQ ID NO: 4272), UAUguaagua (SEQ ID NO: 2653), ACGguaugag (SEQ ID NO: 4273), CUGgugagug (SEQ ID NO: 1761), AGAguaaaau (SEQ ID NO: 4274), GCUguauggc (SEQ ID NO: 4275), AUGguaaacc (SEQ ID NO: 879), GCAguaauaa (SEQ ID NO: 4276), UAAguauuua (SEQ ID NO: 4277), AAUgucagug (SEQ ID NO: 515), AUUgcaggag (SEQ ID NO: 4278), CCGguaagaa (SEQ ID NO: 4279), AAGgcaaguu (SEQ ID NO: 101), GAGguuuguc (SEQ ID NO: 4280), AAGguaacug (SEQ ID NO: 139), AAAguaugag (SEQ ID NO: 4281), GAUguuagua (SEQ ID NO: 4282), CAGguggguc (SEQ ID NO: 1414), AAGguaccga (SEQ ID NO: 4283), CCAguaauua (SEQ ID NO: 4284), GUGguaugcg (SEQ ID NO: 4285), AUGgugcgcu (SEQ ID NO: 4286), CAGgucuaug (SEQ ID NO: 4287), AAGguauuua (SEQ ID NO: 274), CUAguaagau (SEQ ID NO: 4288), AGAguaauuu (SEQ ID NO: 675), GAGguaacgu (SEQ ID NO: 4289), AAGguagcca (SEQ ID NO: 212), CUGgucccgg (SEQ ID NO: 4290), GAGguccuuc (SEQ ID NO: 4291), ACGgucaccc (SEQ ID NO: 4292), AAGguaauac (SEQ ID NO: 158), CAGgugcaug (SEQ ID NO: 1367), AUGguaauag (SEQ ID NO: 4293), UUUguaacac (SEQ ID NO: 4294), UGGguaugau (SEQ ID NO: 4295), CAGgcccccc (SEQ ID NO: 4296), AGAguaguaa (SEQ ID NO: 4297), AGUguaagaa (SEQ ID NO: 814), GAAguauguu (SEQ ID NO: 1833), CAGgugugca (SEQ ID NO: 1434), UUGgugaggg (SEQ ID NO: 3003), UGGguugguu (SEQ ID NO: 4298), CAGguacgua (SEQ ID NO: 1184), GAGgugcggc (SEQ ID NO: 4299), UCUguacggg (SEQ ID NO: 4300), CGGgugcgug (SEQ ID NO: 4301), UACguaagug (SEQ ID NO: 2455), CAUguaagga (SEQ ID NO: 4302), CAGgugacgg (SEQ ID NO: 1329), GAUguaugcu (SEQ ID NO: 4303), UCUgcaauuc (SEQ ID NO: 4304), UGAguaaggc (SEQ ID NO: 2770), GAGguauauu (SEQ ID NO: 1952), AGAgugaguu (SEQ ID NO: 707), AAGguaagcu (SEQ ID NO: 148), UAGgugaagu (SEQ ID NO: 2580), CAGguuagua (SEQ ID NO: 1455), UAUguaagug (SEQ ID NO: 2655), UUGguggggg (SEQ ID NO: 4305), UGAgcucaaa (SEQ ID NO: 4306), UCGguaugua (SEQ ID NO: 4307), UAAguaugcc (SEQ ID NO: 4308), AAUguaagua (SEQ ID NO: 489), CAGguuugca (SEQ ID NO: 4309), ACGgugagag (SEQ ID NO: 4310), CAGguguuuu (SEQ ID NO: 4311), GUGgugagcc (SEQ ID NO: 4312), AGGguacaua (SEQ ID NO: 4313), UAGguaaccc (SEQ ID NO: 4314), GUGgucagua (SEQ ID NO: 4315), CUGgugagcc (SEQ ID NO: 4316), CAGgugcuua (SEQ ID NO: 1390), AUAgucguga (SEQ ID NO: 4317), AUAgugagug (SEQ ID NO: 862), GAGgucaaaa (SEQ ID NO: 4318), CGUguagcuu (SEQ ID NO: 4319), CAGguguuug (SEQ ID NO: 4320), CAGguuggac (SEQ ID NO: 4321), CAGguaagcu (SEQ ID NO: 4322), AGGgucagaa (SEQ ID NO: 4323), CACguauguc (SEQ ID NO: 4324), CACgugagug (SEQ ID NO: 1098), GGGguacgga (SEQ ID NO: 4325), AAGgcaggac (SEQ ID NO: 4326), GAGgugaagc (SEQ ID NO: 4327), GAGguuugaa (SEQ ID NO: 4328), CAGguaagug (SEQ ID NO: 1148), CAGguaacca (SEQ ID NO: 1131), CAGguacucc (SEQ ID NO: 1189), AAGgugcuuu (SEQ ID NO: 371), GAGguaaaua (SEQ ID NO: 1873), GAGgcaggug (SEQ ID NO: 4329), GAGguucgga (SEQ ID NO: 4330), CAGguauuug (SEQ ID NO: 1270), CAGguaaaua (SEQ ID NO: 1125), CAGgugaugu (SEQ ID NO: 1354), CAGgugauac (SEQ ID NO: 4331), GAGgugaggc (SEQ ID NO: 2023), AGGguggggg (SEQ ID NO: 4332), UAAguaaguu (SEQ ID NO: 2425), UGGgugaaca (SEQ ID NO: 4333), UAGguacugc (SEQ ID NO: 4334), CAGgcuccug (SEQ ID NO: 4335), AGGguaggca (SEQ ID NO: 753), CAGgugcccg (SEQ ID NO: 1371), GAGguacauc (SEQ ID NO: 4336), AGGgugugug (SEQ ID NO: 804), AAGguaguaa (SEQ ID NO: 231), UGGguaugag (SEQ ID NO: 2859), GGGgugugug (SEQ ID NO: 2294), CUAguaggug (SEQ ID NO: 4337), GAGgcaagga (SEQ ID NO: 4338), AAGgcaagac (SEQ ID NO: 4339), AAAgugcggu (SEQ ID NO: 4340), AAGguugguu (SEQ ID NO: 450), GAGguuaaug (SEQ ID NO: 4341), UUGgugaguc (SEQ ID NO: 3005), UCGguuagcu (SEQ ID NO: 2738), GCAguaagca (SEQ ID NO: 4342), AAGgcaagca (SEQ ID NO: 4343), ACAguaagcu (SEQ ID NO: 4344), GAGguaacag (SEQ ID NO: 1878), AAAguacgua (SEQ ID NO: 4345), GAGguaauac (SEQ ID NO: 1896), UUGguaggug (SEQ ID NO: 2980), CUGguuaguc (SEQ ID NO: 4346), GAGgugacgc (SEQ ID NO: 4347), ACAguaagga (SEQ ID NO: 4348), AAUguacuua (SEQ ID NO: 4349), GGGguacagu (SEQ ID NO: 4350), CGUguaugug (SEQ ID NO: 4351), UCCguagguu (SEQ ID NO: 4352), GAGguggucg (SEQ ID NO: 4353), UCAgugaguc (SEQ ID NO: 4354), AAAguaagca (SEQ ID NO: 15), GAGgucuggu (SEQ ID NO: 1999), GAGguaauua (SEQ ID NO: 4355), GUAguaagua (SEQ ID NO: 2323), AAGgugggga (SEQ ID NO: 382), UCUgugagca (SEQ ID NO: 4356), GAAguucgug (SEQ ID NO: 4357), ACGgugaggc (SEQ ID NO: 4358), UCAgugagua (SEQ ID NO: 2699), UAGguaguug (SEQ ID NO: 4359), GGUgucuggg (SEQ ID NO: 4360), GGGguaagug (SEQ ID NO: 2252), GAGguggguu (SEQ ID NO: 2066), UGUgugaguu (SEQ ID NO: 4361), CAUguaagua (SEQ ID NO: 1522), AAGguaggug (SEQ ID NO: 229), AAUguaggag (SEQ ID NO: 4362), GAGgcacguc (SEQ ID NO: 4363), CAAguacauu (SEQ ID NO: 4364), UUGguacaga (SEQ ID NO: 4365), GAGguaguag (SEQ ID NO: 1941), AAAgugaggg (SEQ ID NO: 57), UUGgucagug (SEQ ID NO: 4366), AGGgugaguc (SEQ ID NO: 796), CAGgugaaca (SEQ ID NO: 1317), GGUgugggcc (SEQ ID NO: 4367), CGGgugagcu (SEQ ID NO: 4368), GGGgugaguc (SEQ ID NO: 2283), ACAgugagag (SEQ ID NO: 4369), AGGgugaggu (SEQ ID NO: 794), GCUguaaguc (SEQ ID NO: 2194), AUAguagguu (SEQ ID NO: 4370), CAGgcaugug (SEQ ID NO: 1114), AAGguaaguu (SEQ ID NO: 156), CAGguccgug (SEQ ID NO: 4371), GAGgcaggua (SEQ ID NO: 4372), AUGguggaag (SEQ ID NO: 4373), AUGgugggcg (SEQ ID NO: 4374), GAGgugagaa (SEQ ID NO: 2014), AGUgugagca (SEQ ID NO: 832), UUGguaagua (SEQ ID NO: 2962), CAAguaagca (SEQ ID NO: 4375), GGUgugagcu (SEQ ID NO: 2313), CCCgugggua (SEQ ID NO: 4376), CAGguagaau (SEQ ID NO: 4377), CAGgcugagc (SEQ ID NO: 4378), CUGguggccc (SEQ ID NO: 4379), UGAguaagag (SEQ ID NO: 4380), CACguuagcu (SEQ ID NO: 4381), AAGgugaguc (SEQ ID NO: 348), AAGguagcuc (SEQ ID NO: 4382), UCGgugaguu (SEQ ID NO: 4383), GAGgcccuuc (SEQ ID NO: 4384), CAGguuaugc (SEQ ID NO: 4385), CCUguaagcu (SEQ ID NO: 4386), CAGgucuccu (SEQ ID NO: 4387), UAGguaggcu (SEQ ID NO: 4388), GGGguagggg (SEQ ID NO: 4389), AAGguaguga (SEQ ID NO: 4390), GAGguuguug (SEQ ID NO: 4391), CAGguugguu (SEQ ID NO: 1489), AAAguaagcc (SEQ ID NO: 16), ACAgugagug (SEQ ID NO: 562), UGGgugugau (SEQ ID NO: 4392), CCCguaacua (SEQ ID NO: 4393), AAGguguugc (SEQ ID NO: 408), AAAgcuggug (SEQ ID NO: 4394), GAGguauagu (SEQ ID NO: 4395), ACGguaagag (SEQ ID NO: 4396), AUGguacggu (SEQ ID NO: 913), GAGgccaguu (SEQ ID NO: 4397), GAGguaugcg (SEQ ID NO: 1960), UCGgugggag (SEQ ID NO: 4398), AAGguggaua (SEQ ID NO: 372), CCAguguggc (SEQ ID NO: 4399), AGGguaagug (SEQ ID NO: 742), UCUguagguc (SEQ ID NO: 4400), CAGgcaagga (SEQ ID NO: 1102), CGGguaauuu (SEQ ID NO: 1628), AUUgugaguc (SEQ ID NO: 1010), CAGguaaacc (SEQ ID NO: 1121), AAGgucaauu (SEQ ID NO: 4401), AAGgugaaua (SEQ ID NO: 327), GUCguaagaa (SEQ ID NO: 4402), GCGguaaguc (SEQ ID NO: 4403), CUGguagagc (SEQ ID NO: 4404), GAGgucgguc (SEQ ID NO: 4405), CAGguaaaca (SEQ ID NO: 1120), AAGgcaagga (SEQ ID NO: 98), CAGgucgucu (SEQ ID NO: 4406), GGGguagggc (SEQ ID NO: 4407), CUGguacuaa (SEQ ID NO: 1721), GAGguagcug (SEQ ID NO: 1929), CUUgucagcu (SEQ ID NO: 4408), UAGguaaggc (SEQ ID NO: 2489), CUGguauuac (SEQ ID NO: 4409), UAAguacguc (SEQ ID NO: 4410), AAGguaagcc (SEQ ID NO: 146), ACGgugaaag (SEQ ID NO: 4411), CCAgccaaua (SEQ ID NO: 4412), CAGguuuguc (SEQ ID NO: 4413), AAGguauaau (SEQ ID NO: 239), AAGgucuuag (SEQ ID NO: 4414), AGGgugagcu (SEQ ID NO: 791), AAGguuaggg (SEQ ID NO: 4415), CGGguaaauu (SEQ ID NO: 4416), CAGguaacgg (SEQ ID NO: 4417), AGAgugugua (SEQ ID NO: 4418), ACAguaaguu (SEQ ID NO: 549), GAUguaauuu (SEQ ID NO: 4419), GAGguaggga (SEQ ID NO: 1934), UUGgcaagug (SEQ ID NO: 2945), AAAgugagga (SEQ ID NO: 4420), AAGguagugc (SEQ ID NO: 234), AGAguaauuc (SEQ ID NO: 674), GGAguaaaua (SEQ ID NO: 4421), GUGguaccca (SEQ ID NO: 4422), CAGguauugc (SEQ ID NO: 4423), GAUgugaggg (SEQ ID NO: 4424), CAAguaaauc (SEQ ID NO: 1017), CAGgugucuc (SEQ ID NO: 1428), AAGguaacag (SEQ ID NO: 4425), UUGguaaaag (SEQ ID NO: 4426), CAGguaucau (SEQ ID NO: 1240), ACGgugagac (SEQ ID NO: 4427), CUGguaugac (SEQ ID NO: 4428), CAGguucacu (SEQ ID NO: 4429), GAGgugauca (SEQ ID NO: 4430), AGUguaaguc (SEQ ID NO: 4431), AACguaagua (SEQ ID NO: 4432), AAAgugagug (SEQ ID NO: 60), GAGguacagg (SEQ ID NO: 4433), CAAguaauga (SEQ ID NO: 4434), GAUguaagga (SEQ ID NO: 4435), UCAguucccc (SEQ ID NO: 4436), GCGguaagga (SEQ ID NO: 4437), UAGguacuaa (SEQ ID NO: 4438), AAGgugaaag (SEQ ID NO: 321), ACUguaagug (SEQ ID NO: 4439), UGGguaugug (SEQ ID NO: 2862), AUGguaacag (SEQ ID NO: 884), CAGguagggu (SEQ ID NO: 1219), ACAguaagug (SEQ ID NO: 548), AAGgugcucc (SEQ ID NO: 366), AAGgugugcu (SEQ ID NO: 4440), AAGgugguga (SEQ ID NO: 4441), ACGgugcgcc (SEQ ID NO: 4442), AAGguauugc (SEQ ID NO: 4443), GGGguaugug (SEQ ID NO: 2267), CAGgugggcu (SEQ ID NO: 1408), GAGguauguu (SEQ ID NO: 1968), AACgugaaua (SEQ ID NO: 4444), CAGguaaugg (SEQ ID NO: 1154), UAGguaugau (SEQ ID NO: 4445), CAGgcaggug (SEQ ID NO: 1108), GGGguugguc (SEQ ID NO: 4446), AAGguauggg (SEQ ID NO: 262), UAAgugaggc (SEQ ID NO: 4447), CAAgugaucg (SEQ ID NO: 4448), AAAguacggg (SEQ ID NO: 4449), AGAgcuacag (SEQ ID NO: 4450), GAGgugggaa (SEQ ID NO: 2054), CAGguacuuu (SEQ ID NO: 1195), GAGgugagag (SEQ ID NO: 2016), CAGguagguc (SEQ ID NO: 1221), UGGguacagc (SEQ ID NO: 4451), AAGgugucag (SEQ ID NO: 396), AAGgcaagaa (SEQ ID NO: 4452), GAGguaaaca (SEQ ID NO: 4453), AAGguaaagu (SEQ ID NO: 129), AAGguaguca (SEQ ID NO: 4454), CUGguauguc (SEQ ID NO: 4455), GAGguauggg (SEQ ID NO: 1963), AAGguauugu (SEQ ID NO: 273), CUGguacuga (SEQ ID NO: 4456), GAGguaagcu (SEQ ID NO: 1888), UGGgugggua (SEQ ID NO: 2883), CAGguucgug (SEQ ID NO: 4457), AAGguauggu (SEQ ID NO: 4458), CAGgugagca (SEQ ID NO: 1337), UGGguaaauu (SEQ ID NO: 2827), UGUguaggug (SEQ ID NO: 4459), UGUgugagcc (SEQ ID NO: 2921), CUGguaauau (SEQ ID NO: 4460), AAAguauguu (SEQ ID NO: 45), UGUguaagaa (SEQ ID NO: 2903), CUAgugagaa (SEQ ID NO: 4461), AGGguagguc (SEQ ID NO: 757), AAGgugggug (SEQ ID NO: 385), UCGguaagug (SEQ ID NO: 4462), AGUguaaaua (SEQ ID NO: 812), GAUguaagug (SEQ ID NO: 2122), AAGguuagug (SEQ ID NO: 424), UAGguaagca (SEQ ID NO: 2485), CAAgugagaa (SEQ ID NO: 1061), AGUguaagua (SEQ ID NO: 819), CAGgugaauc (SEQ ID NO: 1321), UGGgugagac (SEQ ID NO: 2868), AAGguagggc (SEQ ID NO: 224), CUGguuugug (SEQ ID NO: 1788), GCGguagggc (SEQ ID NO: 4463), GAGguaaucc (SEQ ID NO: 4464), AUUguaauaa (SEQ ID NO: 4465), CUGgugaaua (SEQ ID NO: 1748), AAGguuuaaa (SEQ ID NO: 4466), CCUguacugu (SEQ ID NO: 4467), GCGgugagcg (SEQ ID NO: 4468), AAGguaaucc (SEQ ID NO: 162), UAUgugagua (SEQ ID NO: 2671), CCCgugagug (SEQ ID NO: 1573), CAGgugcaga (SEQ ID NO: 1363), CAGgucaguu (SEQ ID NO: 1284), CAGguaggcu (SEQ ID NO: 4469), AAAguaagug (SEQ ID NO: 23), UAGguugguc (SEQ ID NO: 4470), CAGguugccu (SEQ ID NO: 4471), AAGguaugga (SEQ ID NO: 260), GGUguggacg (SEQ ID NO: 4472), AAAgugagaa (SEQ ID NO: 51), AGGgugagag (SEQ ID NO: 788), GAUguggcau (SEQ ID NO: 4473), UCGguaaggu (SEQ ID NO: 4474), GAGgugcguc (SEQ ID NO: 4475), CGGgugaguc (SEQ ID NO: 4476), AAGguacggg (SEQ ID NO: 190), GAGguucuug (SEQ ID NO: 4477), AAGgugcuug (SEQ ID NO: 4478), UAGguaugua (SEQ ID NO: 2551), AUGgucagca (SEQ ID NO: 4479), CGGguacuca (SEQ ID NO: 4480), AGGgugagga (SEQ ID NO: 792), AUCgugagua (SEQ ID NO: 869), UCAguaagua (SEQ ID NO: 2689), UAGguaaaua (SEQ ID NO: 2469), AAGguaauug (SEQ ID NO: 170), GAAgucagug (SEQ ID NO: 1835), CAGguacaaa (SEQ ID NO: 1160), AAAguuaauc (SEQ ID NO: 4481), AGCgugagcg (SEQ ID NO: 4482), CCGgcuggug (SEQ ID NO: 4483), AGUguaauuu (SEQ ID NO: 4484), UGAgccacuc (SEQ ID NO: 4485), GGGgucugua (SEQ ID NO: 4486), AUGgcauguc (SEQ ID NO: 4487), CGGguaaaga (SEQ ID NO: 4488), AGGguagcau (SEQ ID NO: 4489), CGGguaggag (SEQ ID NO: 1631), GAGguucgug (SEQ ID NO: 4490), UAAguuauuc (SEQ ID NO: 4491), UAUguaagau (SEQ ID NO: 2650), AAGguaguuu (SEQ ID NO: 237), CAGgugguau (SEQ ID NO: 4492), GUGguaauga (SEQ ID NO: 2355), AAGgugauuu (SEQ ID NO: 359), CAGgugaagu (SEQ ID NO: 4493), GUAguaauua (SEQ ID NO: 4494), AUGguuggug (SEQ ID NO: 4495), CCAguaagug (SEQ ID NO: 1557), UAGgugagag (SEQ ID NO: 2589), AUGgugaggc (SEQ ID NO: 959), AAAguuagug (SEQ ID NO: 72), AAGgugccuu (SEQ ID NO: 4496), UAGguaugag (SEQ ID NO: 2546), CAGgugugac (SEQ ID NO: 1431), CUGguggguu (SEQ ID NO: 1774), AUGguaagga (SEQ ID NO: 896), UCUguaagaa (SEQ ID NO: 2740), UCCgugaguu (SEQ ID NO: 4497), AAAgcaggua (SEQ ID NO: 4498), UAUgugagug (SEQ ID NO: 2672), CAGguggagg (SEQ ID NO: 4499), CAGguuagac (SEQ ID NO: 4500), AUAguaagac (SEQ ID NO: 846), AAGguguugu (SEQ ID NO: 4501), GAGgucugug (SEQ ID NO: 4502), AAGguaagau (SEQ ID NO: 144), CAUguaaguu (SEQ ID NO: 1524), CUGguaauua (SEQ ID NO: 4503), CAGguaggcg (SEQ ID NO: 4504), AGAguaaguc (SEQ ID NO: 669), UGGgugagga (SEQ ID NO: 2872), AAUguaggua (SEQ ID NO: 4505), UAGguuagca (SEQ ID NO: 4506), GGGguaggua (SEQ ID NO: 2258), GAGguauugc (SEQ ID NO: 4507), AUUguacaca (SEQ ID NO: 4508), GAAguaggua (SEQ ID NO: 4509), GGAguaagcu (SEQ ID NO: 2212), UAGguaugug (SEQ ID NO: 2553), GAGgugaaua (SEQ ID NO: 2007), GAGgugggau (SEQ ID NO: 2056), AAGguaaucu (SEQ ID NO: 163), GGUgugaguu (SEQ ID NO: 4510), AACgugaguu (SEQ ID NO: 4511), GAGguaaccg (SEQ ID NO: 4512), UAGguaagga (SEQ ID NO: 2488), AUUguaagaa (SEQ ID NO: 4513), UGGgugagca (SEQ ID NO: 2870), AAGguaaggc (SEQ ID NO: 150), CCAguaucgu (SEQ ID NO: 4514), CCGgugggug (SEQ ID NO: 4515), GAGguagugu (SEQ ID NO: 4516), ACGgugggaa (SEQ ID NO: 4517), GAGgugaccu (SEQ ID NO: 2011), CACguaugua (SEQ ID NO: 4518), AGGgugggga (SEQ ID NO: 799), AAUguaaguc (SEQ ID NO: 490), AAAguuaagu (SEQ ID NO: 70), CAUgugagug (SEQ ID NO: 1541), AGAguauguc (SEQ ID NO: 694), GCGguaugac (SEQ ID NO: 4519), CGGgugaguu (SEQ ID NO: 1643), CCGguauuuu (SEQ ID NO: 4520), GAGguagaac (SEQ ID NO: 4521), UAGguaugaa (SEQ ID NO: 2545), CAGgcgcgug (SEQ ID NO: 4522), CAAguaaguc (SEQ ID NO: 1027), AGUguaagau (SEQ ID NO: 816), AAGguucuac (SEQ ID NO: 4523), CCAguaagua (SEQ ID NO: 1555), GAGguagcag (SEQ ID NO: 4524), CAGgucuguu (SEQ ID NO: 1312), CAGguacaau (SEQ ID NO: 1162), CCGguaaaga (SEQ ID NO: 1574), UAAgugcugu (SEQ ID NO: 4525), AGGgugagaa (SEQ ID NO: 786), CUCguaaggu (SEQ ID NO: 4526), CAGgucagcu (SEQ ID NO: 4527), CAGguaaggc (SEQ ID NO: 1144), AGGgugcagg (SEQ ID NO: 4528), GAGgugaaac (SEQ ID NO: 4529), AGGguaagua (SEQ ID NO: 740), AAUguaugcc (SEQ ID NO: 4530), AAGguaagca (SEQ ID NO: 145), ACGguacggu (SEQ ID NO: 587), AAGguaauga (SEQ ID NO: 164), UCUgcucaau (SEQ ID NO: 4531), ACGguaaugu (SEQ ID NO: 4532), AAGguaguug (SEQ ID NO: 4533), ACGguaagug (SEQ ID NO: 580), CAGgugauga (SEQ ID NO: 4534), GAGguaacac (SEQ ID NO: 4535), GAGguaggua (SEQ ID NO: 1937), CAGguaccuu (SEQ ID NO: 1179), CAGguaauaa (SEQ ID NO: 1150), UUGgugggug (SEQ ID NO: 3016), CUGguaauga (SEQ ID NO: 1710), UAGguaaguc (SEQ ID NO: 2492), AGGgugugac (SEQ ID NO: 4536), GAGgcaauaa (SEQ ID NO: 4537), GUGguaaagc (SEQ ID NO: 4538), CUGgugggcg (SEQ ID NO: 4539), GAUguauguu (SEQ ID NO: 2128), AGGgugagac (SEQ ID NO: 787), UCGgucagca (SEQ ID NO: 4540), AUGgugauua (SEQ ID NO: 4541), CGAgugugua (SEQ ID NO: 4542), CAGguuggug (SEQ ID NO: 1488), AGCgcaagua (SEQ ID NO: 4543), UGGguacguu (SEQ ID NO: 4544), GAGguauuug (SEQ ID NO: 1974), AGUguacaua (SEQ ID NO: 4545), AUGguaagua (SEQ ID NO: 898), ACAguagguu (SEQ ID NO: 4546), AAGgugagag (SEQ ID NO: 337), UUGgugaagu (SEQ ID NO: 4547), AAAguaugua (SEQ ID NO: 43), UGGguaagga (SEQ ID NO: 4548), UAGgugccuu (SEQ ID NO: 4549), and CCUgugggug (SEQ ID NO: 4550).

Additional exemplary gene sequences and splice site sequences (e.g., 5' splice site sequences) include UCCguaaguu (SEQ ID NO: 4551), GUGguaaacg (SEQ ID NO: 4552), CGGgugcggu (SEQ ID NO: 4553), CAUguacuuc (SEQ ID NO: 4554), AGAguaaagg (SEQ ID NO: 4555), CGCgugagua (SEQ ID NO: 4556), AGAgugggca (SEQ ID NO: 4557), AGAguaagcc (SEQ ID NO: 4558), AGAguaaaca (SEQ ID NO: 4559), GUGguuauga (SEQ ID NO: 4560), AGGguaauaa (SEQ ID NO: 4561), UGAguaagac (SEQ ID NO: 4562), AGAguuuguu (SEQ ID NO: 4563), CGGgucugca (SEQ ID NO: 4564), CAGguaaguc (SEQ ID NO: 4565), AAGguagaau (SEQ ID NO: 4566), CAGgucccuc (SEQ ID NO: 4567), AGAguaaugg (SEQ ID NO: 4568), GAGgucuaag (SEQ ID NO: 4569), AGAguagagu (SEQ ID NO: 4570), AUGgucagua (SEQ ID NO: 4571), GAGgccuggg (SEQ ID NO: 4572), AAGguguggc (SEQ ID NO: 4573), AGAgugaucu (SEQ ID NO: 4574), AAGguaucca (SEQ ID NO: 4575), UUCguaagua (SEQ ID NO: 4576), UAAgugggug (SEQ ID NO: 4577), GCCgugaacg (SEQ ID NO: 4578), GAGguugugg (SEQ ID NO: 4579), UAUguaugca (SEQ ID NO: 4580), UGUguaacaa (SEQ ID NO: 4581), AGGguauuag (SEQ ID NO: 4582), UGAguauauc (SEQ ID NO: 4583), AGAguuugug (SEQ ID NO: 4584), GAGgucgcug (SEQ ID NO: 4585), GAGgucaucg (SEQ ID NO: 4586), ACGguaaagc (SEQ ID NO: 4587), UGAguacuug (SEQ ID NO: 4588), CGAgucgccg (SEQ ID NO: 4589), CUGguacguc (SEQ ID NO: 4590), AGGguauugc (SEQ ID NO: 4591), GAAgugaaug (SEQ ID NO: 4592), CAGaugaguc (SEQ ID NO: 4593), UGGguauugg (SEQ ID NO: 4594), UGAguaaaga (SEQ ID NO: 4595), GUGguuccug (SEQ ID NO: 4596), UGAgcaagua (SEQ ID NO: 4597), UAUguaagag (SEQ ID NO: 4598), AAGgucuugc (SEQ ID NO: 4599), AAAgcaugug (SEQ ID NO: 4600), AGAguacagu (SEQ ID NO: 4601), GUGguaaucc (SEQ ID NO: 4602), CAGguagagg (SEQ ID NO: 4603), AAGguacaac (SEQ ID NO: 4604), UGGgcagcau (SEQ ID NO: 4605), CCGgucauca (SEQ ID NO: 4606), CCGguuugua (SEQ ID NO: 4607), UGAguaaggg (SEQ ID NO: 4608), GAAguaugua (SEQ ID NO: 4609), GGGguagcuc (SEQ ID NO: 4610), GCUguacaua (SEQ ID NO: 4611), CUGgucucuu (SEQ ID NO: 4612), GUGguaaaug (SEQ ID NO: 4613), AUCguaagug (SEQ ID NO: 4614), GAGgcaugua (SEQ ID NO: 4615), AAGgucuccc (SEQ ID NO: 4616), UGGgugcguu (SEQ ID NO: 4617), UGUguagguu (SEQ ID NO: 4618), GAAgugagca (SEQ ID NO: 4619), GGUguaauuu (SEQ ID NO: 4620), CUGgugaaau (SEQ ID NO: 4621), AUCguaaguc (SEQ ID NO: 4622), AGAguaaucc (SEQ ID NO: 4623), GGAguagguc (SEQ ID NO: 4624), GAGguaccaa (SEQ ID NO: 4625), CUUguaggug (SEQ ID NO: 4626), AAGguauaag (SEQ ID NO: 4627), AGAguuggua (SEQ ID NO: 4628), AUGguuugug (SEQ ID NO: 4629), UGGgucagau (SEQ ID NO: 4630), AGAguaggac (SEQ ID NO: 4631), AGAguagugu (SEQ ID NO: 4632), AGAguaggag (SEQ ID NO: 4633), CAGgucucua (SEQ ID NO: 4634), AAGguggaug (SEQ ID NO: 4635), UGGguaucaa (SEQ ID NO: 4636), GAUguaugga (SEQ ID NO: 4637), AAGguguuuc (SEQ ID NO: 4638), GCAguguaaa (SEQ ID NO: 4639), UUAguaugua (SEQ ID NO: 4640), UCUguaugca (SEQ ID NO: 4641), AAUguaaaau (SEQ ID NO: 4642), AGAguaaauu (SEQ ID NO: 4643), GGGguacuuu (SEQ ID NO: 4644), GAAguuugau (SEQ ID NO: 4645), AAAguagauu (SEQ ID NO: 4646), UGUguagagu (SEQ ID NO: 4647), UGGguaagcg (SEQ ID NO: 4648), CGGguucagg (SEQ ID NO: 4649), AGGguacgac (SEQ ID NO: 4650), UCGguaagaa (SEQ ID NO: 4651), AGGguuggca (SEQ ID NO: 4652), AAAguacagu (SEQ ID NO: 4653), UAAguuaagg (SEQ ID NO: 4654), AUGguaaugu (SEQ ID NO: 4655), GUGguuuuac (SEQ ID NO: 4656), AGAguaacaa (SEQ ID NO: 4657), AAGguagccc (SEQ ID NO: 4658), GCGgugaggc (SEQ ID NO: 4659), AUGguucagc (SEQ ID NO: 4660), AAGguacuua (SEQ ID NO: 4661), AAGguccgug (SEQ ID NO: 4662), UAGguaagcg (SEQ ID NO: 4663), AUGguaccuu (SEQ ID NO: 4664), GCCguggugg (SEQ ID NO: 4665), CUGgugcguc (SEQ ID NO: 4666), CAGguggaaa (SEQ ID NO: 4667), AAAgucugua (SEQ ID NO: 4668), GAGguaaccc (SEQ ID NO: 4669), AGAguauggg (SEQ ID NO: 4670), UAUgccccug (SEQ ID NO: 4671), AAGgugccag (SEQ ID NO: 4672), ACGgugcggc (SEQ ID NO: 4673), AGGguacuga (SEQ ID NO: 4674), AGAguaagcg (SEQ ID NO: 4675), CUGgcaaggg (SEQ ID NO: 4676), CCAgugugug (SEQ ID NO: 4677), GAGguagacg (SEQ ID NO: 4678), CGGgugcggg (SEQ ID NO: 4679), GAUguaagcu (SEQ ID NO: 4680), AUUguauuua (SEQ ID NO: 4681), UGCgugagug (SEQ ID NO: 4682), CUGgucuaua (SEQ ID NO: 4683), GAGgugcuag (SEQ ID NO: 4684), GAGgugccau (SEQ ID NO: 4685), CAGguacguc (SEQ ID NO: 4686), GAGguucagc (SEQ ID NO: 4687), AACguaagaa (SEQ ID NO: 4688), AGAguaguac (SEQ ID NO: 4689), AAGguaacgg (SEQ ID NO: 4690), UAGgugugac (SEQ ID NO: 4691), CCGguaauag (SEQ ID NO: 4692), CAGguaccag (SEQ ID NO: 4693), UUUguaauug (SEQ ID NO: 4694), AAUguacgaa (SEQ ID NO: 4695), CAGguaauga (SEQ ID NO: 4696), AUCgucaagg (SEQ ID NO: 4697), CUGguagaug (SEQ ID NO: 4698), GGGgugcagu (SEQ ID NO: 4699), AGUgugagaa (SEQ ID NO: 4700), GGGguuuuau (SEQ ID NO: 4701), CCUguccccu (SEQ ID NO: 4702), AUUgugaagu (SEQ ID NO: 4703), AAGguaaacg (SEQ ID NO: 4704), UACgucgugg (SEQ ID NO: 4705), AAGgugccau (SEQ ID NO: 4706), GGGgucccag (SEQ ID NO: 4707), UAUguauggu (SEQ ID NO: 4708), CGGguaauua (SEQ ID NO: 4709), CGGguacucc (SEQ ID NO: 4710), CAGgugacuu (SEQ ID NO: 4711), AGUguggguu (SEQ ID NO: 4712), AGAguauggc (SEQ ID NO: 4713), AAGgccaaca (SEQ ID NO: 4714), AAAgcaagua (SEQ ID NO: 4715), UCAguagguc (SEQ ID NO: 4716), GUGguggcgg (SEQ ID NO: 4717), CAUguauccu (SEQ ID NO: 4718), UCGgugagcc (SEQ ID NO: 4719), AUAguugggu (SEQ ID NO: 4720), AAUguuagcu (SEQ ID NO: 4721), AUGgugaaug (SEQ ID NO: 4722), CGGguaaugu (SEQ ID NO: 4723), UCUguaggug (SEQ ID NO: 4724), CCGgugaggc (SEQ ID NO: 4725), UGAguccacu (SEQ ID NO: 4726), CUAguaagag (SEQ ID NO: 4727), CGGguggggc (SEQ ID NO: 4728), CGAguaagca (SEQ ID NO: 4729), UGUgccaauu (SEQ ID NO: 4730), UCGguaagcc (SEQ ID NO: 4731), UAUguaggug (SEQ ID NO: 4732), UUGgugggcc (SEQ ID NO: 4733), GAGgcugggc (SEQ ID NO: 4734), AGAguaacuu (SEQ ID NO: 4735), ACGguagguc (SEQ ID NO: 4736), CAGgcccaga (SEQ ID NO: 4737), CCGguggguu (SEQ ID NO: 4738), AAGgugacgg (SEQ ID NO: 4739), GGGguacagc (SEQ ID NO: 4740), CAUguaaguc (SEQ ID NO: 4741), AUUgugagaa (SEQ ID NO: 4742), UGUguaagga (SEQ ID NO: 4743), UUUguaagau (SEQ ID NO: 4744), AGGgucauuu (SEQ ID NO: 4745), UGGguuuguu (SEQ ID NO: 4746), CGAguaagcc (SEQ ID NO: 4747), GUGgugugua (SEQ ID NO: 4748), AUGguauaac (SEQ ID NO: 4749), UGGguacgua (SEQ ID NO: 4750), AAAguagagu (SEQ ID NO: 4751), UCGguaacug (SEQ ID NO: 4752), AGAguaauga (SEQ ID NO: 4753), AUGguggguc (SEQ ID NO: 4754), AGAguaauau (SEQ ID NO: 4755), CAGguacugg (SEQ ID NO: 4756), UAAgucaguu (SEQ ID NO: 4757), GCGguagaga (SEQ ID NO: 4758), AAGgugaugg (SEQ ID NO: 4759), ACAguauguu (SEQ ID NO: 4760), GAUguacguc (SEQ ID NO: 4761), UAGguuucuc (SEQ ID NO: 4762), GAGgcauggg (SEQ ID NO: 4763), AUAgcuaagu (SEQ ID NO: 4764), GUAgucugua (SEQ ID NO: 4765), AAGgugaacg (SEQ ID NO: 4766), GUGguggucg (SEQ ID NO: 4767), GAGguugauc (SEQ ID NO: 4768), UGAguggguu (SEQ ID NO: 4769), ACUguacgug (SEQ ID NO: 4770), CUGgugacug (SEQ ID NO: 4771), CAAguuaagc (SEQ ID NO: 4772), GAGguaccca (SEQ ID NO: 4773), AACguaacuu (SEQ ID NO: 4774), CAGguuacua (SEQ ID NO: 4775), AGAguuaguc (SEQ ID NO: 4776), UGGgcacguc (SEQ ID NO: 4777), AGUguauggu (SEQ ID NO: 4778), AAGguugcaa (SEQ ID NO: 4779), CAGguuguua (SEQ ID NO: 4780), AAGgcauccc (SEQ ID NO: 4781), GAUguaaggc (SEQ ID NO: 4782), AGGguacggg (SEQ ID NO: 4783), GAGgucaaag (SEQ ID NO: 4784), CAAgugagcg (SEQ ID NO: 4785), AGAguaaucu (SEQ ID NO: 4786), UCGguagcug (SEQ ID NO: 4787), AAAguaguag (SEQ ID NO: 4788), CAGguucguc (SEQ ID NO: 4789), CGUguaugaa (SEQ ID NO: 4790), AGUguaaaaa (SEQ ID NO: 4791), AAGgucucac (SEQ ID NO: 4792), UAGguggagc (SEQ ID NO: 4793), UGAguaggug (SEQ ID NO: 4794), AGAguaugcc (SEQ ID NO: 4795), GAGguugcau (SEQ ID NO: 4796), CAAguaagag (SEQ ID NO: 4797), UCUgugugcc (SEQ ID NO: 4798), GAGgugaugc (SEQ ID NO: 4799), GGGgugauaa (SEQ ID NO: 4800), CCCgugagcc (SEQ ID NO: 4801), AGAguaacug (SEQ ID NO: 4802), GCGguaagua (SEQ ID NO: 4803), AGAguacauc (SEQ ID NO: 4804), UCGgucuggg (SEQ ID NO: 4805), UAAguaucuc (SEQ ID NO: 4806), GGCguagguu (SEQ ID NO: 4807), AGAguacgcc (SEQ ID NO: 4808), GAUgucuucu (SEQ ID NO: 4809), AGGgcaaggu (SEQ ID NO: 4810), CGAguaugau (SEQ ID NO: 4811), AUGguagagu (SEQ ID NO: 4812), CAAguacgag (SEQ ID NO: 4813), UCGguaugau (SEQ ID NO: 4814), CCGguguguu (SEQ ID NO: 4815), AGGgucugug (SEQ ID NO: 4816), GGAguaggcu (SEQ ID NO: 4817), AAGgucuaug (SEQ ID NO: 4818), GCAgugcgug (SEQ ID NO: 4819), UGGgugagaa (SEQ ID NO: 4820), AGGguaaagu (SEQ ID NO: 4821), GAGguaggac (SEQ ID NO: 4822), CUAguaagca (SEQ ID NO: 4823), UUAguaggcu (SEQ ID NO: 4824), CUGgugggau (SEQ ID NO: 4825), CUGguuagua (SEQ ID NO: 4826), AAGguacgug (SEQ ID NO: 4827), CGGgugagau (SEQ ID NO: 4828), AAGgugcaug (SEQ ID NO: 4829), AAUgugggcu (SEQ ID NO: 4830), CAGguugacu (SEQ ID NO: 4831), CAGguuacag (SEQ ID NO: 4832), GCGguaacau (SEQ ID NO: 4833), AUUgucaguc (SEQ ID NO: 4834), CAAguauaca (SEQ ID NO: 4835), GAUguccgcc (SEQ ID NO: 4836), AAGgugcgga (SEQ ID NO: 4837), AACguaagag (SEQ ID NO: 4838), UGGguuggua (SEQ ID NO: 4839), CAAguguaag (SEQ ID NO: 4840), GUGguaacgu (SEQ ID NO: 4841), CUGgugauca (SEQ ID NO: 4842), AGGguggggc (SEQ ID NO: 4843), UCGguaaaga (SEQ ID NO: 4844), CAGguacacc (SEQ ID NO: 4845), CGGguaaggg (SEQ ID NO: 4846), CAAguuugcu (SEQ ID NO: 4847), ACAgugcgug (SEQ ID NO: 4848), UUGguauggg (SEQ ID NO: 4849), GAGgcucauc (SEQ ID NO: 4850), CUGguaauag (SEQ ID NO: 4851), AUGguggaua (SEQ ID NO: 4852), UCAgugaauu (SEQ ID NO: 4853), AAUguaauua (SEQ ID NO: 4854), GCAgucuaaa (SEQ ID NO: 4855), AAGguauucu (SEQ ID NO: 4856), GAGgucauca (SEQ ID NO: 4857), UGGguccaug (SEQ ID NO: 4858), AGAguuugua (SEQ ID NO: 4859), AGGguagacu (SEQ ID NO: 4860), AAGguaggac (SEQ ID NO: 4861), UGUguguuga (SEQ ID NO: 4862), UCAguacgug (SEQ ID NO: 4863), AUGgucucuc (SEQ ID NO: 4864), UGAguuagua (SEQ ID NO: 4865), UGAguaaagu (SEQ ID NO: 4866), GAGgugaccg (SEQ ID NO: 4867), GAGguauauc (SEQ ID NO: 4868), CAGgugccau (SEQ ID NO: 4869), AGAgugguga (SEQ ID NO: 4870), GUUguaagaa (SEQ ID NO: 4871), AGAguaaaua (SEQ ID NO: 4872), AGGgugaagg (SEQ ID NO: 4873), CUGguagauu (SEQ ID NO: 4874), GAGguucagg (SEQ ID NO: 4875), AGGgucuuca (SEQ ID NO: 4876), CUGguaaccu (SEQ ID NO: 4877), ACAguacuga (SEQ ID NO: 4878), AGAguggguc (SEQ ID NO: 4879), AUGguaugag (SEQ ID NO: 4880), AAGguuauau (SEQ ID NO: 4881), AGAguauagu (SEQ ID NO: 4882), AAAguaugaa (SEQ ID NO: 4883), UAGguggcua (SEQ ID NO: 4884), ACCguauggg (SEQ ID NO: 4885), AAAguauaau (SEQ ID NO: 4886), UUUguauggc (SEQ ID NO: 4887), GGGgucgcgu (SEQ ID NO: 4888), GUGgugguuu (SEQ ID NO: 4889), CAGguuugac (SEQ ID NO: 4890), GGAguaggcg (SEQ ID NO: 4891), GAGguacccu (SEQ ID NO: 4892), AUGgugugca (SEQ ID NO: 4893), GUGguuggug (SEQ ID NO: 4894), AAAguaugcu (SEQ ID NO: 4895), UAAguuacau (SEQ ID NO: 4896), ACAguaugag (SEQ ID NO: 4897), GGAguauguu (SEQ ID NO: 4898), UUUgugagaa (SEQ ID NO: 4899), AAUgugcguu (SEQ ID NO: 4900), CAGguagagu (SEQ ID NO: 4901), AUGguguuaa (SEQ ID NO: 4902), CAUgugcguc (SEQ ID NO: 4903), AUAguuggau (SEQ ID NO: 4904), GAGguacgua (SEQ ID NO: 4905), GUUgugagaa (SEQ ID NO: 4906), CAAguacauc (SEQ ID NO: 4907), GAGguaguuu (SEQ ID NO: 4908), ACUguacaga (SEQ ID NO: 4909), CCGguuguga (SEQ ID NO: 4910), UGGgucagug (SEQ ID NO: 4911), GUAguaagaa (SEQ ID NO: 4912), GACguacuuu (SEQ ID NO: 4913), AGAgucaguc (SEQ ID NO: 4914), UAGguuaguu (SEQ ID NO: 4915), AGGgcagcag (SEQ ID NO: 4916), AAGguccuac (SEQ ID NO: 4917), AAUguaauug (SEQ ID NO: 4918), CAGgugcggg (SEQ ID NO: 4919), CUGguaaugg (SEQ ID NO: 4920), CAAguagccc (SEQ ID NO: 4921), GAAgucaguu (SEQ ID NO: 4922), ACAguaauug (SEQ ID NO: 4923), UUAguuagua (SEQ ID NO: 4924), CCUguauuuu (SEQ ID NO: 4925), AUCguaagaa (SEQ ID NO: 4926), CCAgugagca (SEQ ID NO: 4927), GAAguaaggc (SEQ ID NO: 4928), UGAgugggua (SEQ ID NO: 4929), UCAgugguag (SEQ ID NO: 4930), UCUguacagg (SEQ ID NO: 4931), CGAgugagug (SEQ ID NO: 4932), UCCguaugug (SEQ ID NO: 4933), CAUgccguuu (SEQ ID NO: 4934), AAAgugacuu (SEQ ID NO: 4935), AGAguaggca (SEQ ID NO: 4936), GAAguaagag (SEQ ID NO: 4937), CAGgcagguu (SEQ ID NO: 4938), UUGguagagc (SEQ ID NO: 4939), AAGguggaaa (SEQ ID NO: 4940), GAGgcagguc (SEQ ID NO: 4941), AUGguacgac (SEQ ID NO: 4942), AGGguaggaa (SEQ ID NO: 4943), AGGguaggua (SEQ ID NO: 4944), UUGguaaggu (SEQ ID NO: 4945), AUGguacaga (SEQ ID NO: 4946), CAGguagagc (SEQ ID NO: 4947), UAGguaaggu (SEQ ID NO: 4948), GGGguuagag (SEQ ID NO: 4949), AAGguaucaa (SEQ ID NO: 4950), GAGguagccc (SEQ ID NO: 4951), CAGgugccuc (SEQ ID NO: 4952), GCAguaagag (SEQ ID NO: 4953), ACGguagagu (SEQ ID NO: 4954), UGGguaaugg (SEQ ID NO: 4955), CUGgucaguu (SEQ ID NO: 4956), GUGguacauu (SEQ ID NO: 4957), AAAguagguu (SEQ ID NO: 4958), AAGgccaaga (SEQ ID NO: 4959), CGGgugggca (SEQ ID NO: 4960), ACGguccggg (SEQ ID NO: 4961), CGAguaugag (SEQ ID NO: 4962), CUGguaugcc (SEQ ID NO: 4963), GAGguggaug (SEQ ID NO: 4964), CAGgccuuuc (SEQ ID NO: 4965), AAAguacauc (SEQ ID NO: 4966), AAAguaauca (SEQ ID NO: 4967), GAGguaacug (SEQ ID NO: 4968), CUGguaaaga (SEQ ID NO: 4969), CGUguaagca (SEQ ID NO: 4970), UGGgcaagua (SEQ ID NO: 4971), GCGguggcga (SEQ ID NO: 4972), GAGguggccg (SEQ ID NO: 4973), AUUgcaugca (SEQ ID NO: 4974), ACGgugacug (SEQ ID NO: 4975), CAGgucagau (SEQ ID NO: 4976), AGAguaacuc (SEQ ID NO: 4977), UGAguaacag (SEQ ID NO: 4978), AAGguacccg (SEQ ID NO: 4979), AGGguaggcu (SEQ ID NO: 4980), GGGgcaggac (SEQ ID NO: 4981), CCUguaagug (SEQ ID NO: 4982), AUUguaagug (SEQ ID NO: 4983), ACUguacgag (SEQ ID NO: 4984), GUAguagugu (SEQ ID NO: 4985), AGAguaugag (SEQ ID NO: 4986), UCAguguggg (SEQ ID NO: 4987), UGGguauaua (SEQ ID NO: 4988), UAGguagcua (SEQ ID NO: 4989), GGGguaaaga (SEQ ID NO: 4990), AGGguuacuu (SEQ ID NO: 4991), CAUguaaaug (SEQ ID NO: 4992), GGAguaguaa (SEQ ID NO: 4993), CAGgucaauc (SEQ ID NO: 4994), CGGguuagug (SEQ ID NO: 4995), UAGguacaug (SEQ ID NO: 4996), UAGguuaaga (SEQ ID NO: 4997), UGGguaccuu (SEQ ID NO: 4998), CGGguggaca (SEQ ID NO: 4999), CAGgucuuac (SEQ ID NO: 5000), AAGguggagc (SEQ ID NO: 5001), AUGguaacca (SEQ ID NO: 5002), UCGguaaguu (SEQ ID NO: 5003), UAUguacaaa (SEQ ID NO: 5004), AAUguagauu (SEQ ID NO: 5005), GUAgcuagua (SEQ ID NO: 5006), AAGguauugg (SEQ ID NO: 5007), GAGgucuuug (SEQ ID NO: 5008), GAAguucagg (SEQ ID NO: 5009), UGGguaucac (SEQ ID NO: 5010), AGAguacugg (SEQ ID NO: 5011), CAGguuaaug (SEQ ID NO: 5012), AGGguacgug (SEQ ID NO: 5013), AGGgcacagg (SEQ ID NO: 5014), CUGguuaguu (SEQ ID NO: 5015), UUGguacgag (SEQ ID NO: 5016), ACGgugauca (SEQ ID NO: 5017), CCUgugagag (SEQ ID NO: 5018), GAGgugaagu (SEQ ID NO: 5019), AAGguacauc (SEQ ID NO: 5020), UCUguaugug (SEQ ID NO: 5021), UUGguggaag (SEQ ID NO: 5022), UGGgcagguu (SEQ ID NO: 5023), GAAguggagc (SEQ ID NO: 5024), ACAguaagac (SEQ ID NO: 5025), CGGguaccaa (SEQ ID NO: 5026), CAAguacguc (SEQ ID NO: 5027), AGAgugaggg (SEQ ID NO: 5028), CGGguaagaa (SEQ ID NO: 5029), AAUguaggug (SEQ ID NO: 5030), AUCgugugcu (SEQ ID NO: 5031), UAGgucaugg (SEQ ID NO: 5032), CAGguuuuga (SEQ ID NO: 5033), AAGgcaugca (SEQ ID NO: 5034), GAGgugcugc (SEQ ID NO: 5035), AAGguuaaua (SEQ ID NO: 5036), CAGguucauc (SEQ ID NO: 5037), GCGguaggug (SEQ ID NO: 5038), GACgugagua (SEQ ID NO: 5039), CAGgucuacu (SEQ ID NO: 5040), UUGguaugag (SEQ ID NO: 5041), AGCgugggca (SEQ ID NO: 5042), AUGguaaggu (SEQ ID NO: 5043), AUGguaccuc (SEQ ID NO: 5044), UUGguauggu (SEQ ID NO: 5045), UAUguaugaa (SEQ ID NO: 5046), UGGguauggg (SEQ ID NO: 5047), GAUguaaaua (SEQ ID NO: 5048), CCGguaaguu (SEQ ID NO: 5049), GAGgucugaa (SEQ ID NO: 5050), GAGgugcgag (SEQ ID NO: 5051), CUGgucagcc (SEQ ID NO: 5052), CAGguuuugu (SEQ ID NO: 5053), CGGguggugu (SEQ ID NO: 5054), UAAguuagua (SEQ ID NO: 5055), UUUgugugug (SEQ ID NO: 5056), CAGguuaacc (SEQ ID NO: 5057), UUGguacuuu (SEQ ID NO: 5058), GCUguaaggc (SEQ ID NO: 5059), AGGguggcug (SEQ ID NO: 5060), GAUguaaaaa (SEQ ID NO: 5061), AAGgucaaaa (SEQ ID NO: 5062), CAGguagcgc (SEQ ID NO: 5063), CAGguuuggc (SEQ ID NO: 5064), GAGgugguuu (SEQ ID NO: 5065), CGGguaaaua (SEQ ID NO: 5066), CUGguucggu (SEQ ID NO: 5067), GGAgugagcc (SEQ ID NO: 5068), AAGgugcgcg (SEQ ID NO: 5069), GAAguacauc (SEQ ID NO: 5070), AGUgucugua (SEQ ID NO: 5071), CCCgugagcu (SEQ ID NO: 5072), GAGguucaca (SEQ ID NO: 5073), CUAgugggua (SEQ ID NO: 5074), GAGguaacua (SEQ ID NO: 5075), UCGguauguc (SEQ ID NO: 5076), UAAguauuug (SEQ ID NO: 5077), CAGguaagcg (SEQ ID NO: 5078), GAGgugguaa (SEQ ID NO: 5079), CGAguaagag (SEQ ID NO: 5080), CCGguaagcu (SEQ ID NO: 5081), GAGgucuugu (SEQ ID NO: 5082), AAGguggguc (SEQ ID NO: 5083), CACguaagug (SEQ ID NO: 5084), AGUguaauga (SEQ ID NO: 5085), AAAgugugua (SEQ ID NO: 5086), GGAgugccaa (SEQ ID NO: 5087), CACgugaguu (SEQ ID NO: 5088), AAGguuggau (SEQ ID NO: 5089), UAUguaaaua (SEQ ID NO: 5090), CUGguaggaa (SEQ ID NO: 5091), UAUguaaacu (SEQ ID NO: 5092), AAUguauuuu (SEQ ID NO: 5093), CUGgcaagug (SEQ ID NO: 5094), UGUgugguau (SEQ ID NO: 5095), UAUguauguu (SEQ ID NO: 5096), UUGgugacuc (SEQ ID NO: 5097), GGAguaaggu (SEQ ID NO: 5098), AAGguagaug (SEQ ID NO: 5099), UGGguagggu (SEQ ID NO: 5100), AAUguaauuc (SEQ ID NO: 5101), GUGguauggc (SEQ ID NO: 5102), GGAguggguu (SEQ ID NO: 5103), AGGguaccac (SEQ ID NO: 5104), UAGgugacag (SEQ ID NO: 5105), ACAguaggca (SEQ ID NO: 5106), AUGguuugaa (SEQ ID NO: 5107), GCAguaacua (SEQ ID NO: 5108), CCGguaggua (SEQ ID NO: 5109), AGAguaggcc (SEQ ID NO: 5110), AAGguugaca (SEQ ID NO: 5111), CUGgugugua (SEQ ID NO: 5112), GAAgucuguc (SEQ ID NO: 5113), UGGgcucgga (SEQ ID NO: 5114), CAGguagccu (SEQ ID NO: 5115), AGAguaggua (SEQ ID NO: 5116), UAAguauguc (SEQ ID NO: 5117), CUGguauauc (SEQ ID NO: 5118), GAGguguguu (SEQ ID NO: 5119), AUGgugcaug (SEQ ID NO: 5120), AAGguacgcc (SEQ ID NO: 5121), UGAguaacua (SEQ ID NO: 5122), GAGgugacag (SEQ ID NO: 5123), GUUguccugu (SEQ ID NO: 5124), UUGgugucuu (SEQ ID NO: 5125), AAUgugaagg (SEQ ID NO: 5126), UUGguggaua (SEQ ID NO: 5127), UAGguguguu (SEQ ID NO: 5128), CUGgcaaguu (SEQ ID NO: 5129), GCAguaagau (SEQ ID NO: 5130), GCGguggaaa (SEQ ID NO: 5131), UGCguccagc (SEQ ID NO: 5132), AAAguggagu (SEQ ID NO: 5133), CGUgugagcc (SEQ ID NO: 5134), AGAguacugu (SEQ ID NO: 5135), CAGguauagc (SEQ ID NO: 5136), UACguaagga (SEQ ID NO: 5137), AAGgucuuua (SEQ ID NO: 5138), AAGguggucu (SEQ ID NO: 5139), GGGguaaauu (SEQ ID NO: 5140), UCAgugagga (SEQ ID NO: 5141), AGAguacguu (SEQ ID NO: 5142), GAGgucguca (SEQ ID NO: 5143), UAGguuugau (SEQ ID NO: 5144), CAUguaaacc (SEQ ID NO: 5145), AAGguggcac (SEQ ID NO: 5146), CAGguagaug (SEQ ID NO: 5147), AACguaaaag (SEQ ID NO: 5148), UAGgucucug (SEQ ID NO: 5149), AUAguaggug (SEQ ID NO: 5150), UAGgcaagag (SEQ ID NO: 5151), UAGgcacggc (SEQ ID NO: 5152), AAGgucuuca (SEQ ID NO: 5153), CCAguaugcu (SEQ ID NO: 5154), CAAgugaguu (SEQ ID NO: 5155), CAGgucucaa (SEQ ID NO: 5156), CAGguuacau (SEQ ID NO: 5157), GGAgugagca (SEQ ID NO: 5158), AGAguacgca (SEQ ID NO: 5159), CUGguguugg (SEQ ID NO: 5160), AAGguacuca (SEQ ID NO: 5161), CUAguaaggg (SEQ ID NO: 5162), AGAguaaaag (SEQ ID NO: 5163), AAGguaacga (SEQ ID NO: 5164), CUGguccccg (SEQ ID NO: 5165), UAAguauggg (SEQ ID NO: 5166), GAGgucgagc (SEQ ID NO: 5167), UUGguauaua (SEQ ID NO: 5168), AAAgucaagg (SEQ ID NO: 5169), AAGgucuagg (SEQ ID NO: 5170), CGAguagguc (SEQ ID NO: 5171), AGGguucguu (SEQ ID NO: 5172), GAGgcaggcc (SEQ ID NO: 5173), CUAguauuac (SEQ ID NO: 5174), ACGguaugug (SEQ ID NO: 5175), UAGgugguuc (SEQ ID NO: 5176), AGAguauaac (SEQ ID NO: 5177), UUGgugcguc (SEQ ID NO: 5178), ACCguuaucu (SEQ ID NO: 5179), CCAgugauga (SEQ ID NO: 5180), GAAguaugca (SEQ ID NO: 5181), GAAguauggc (SEQ ID NO: 5182), CCGguaggac (SEQ ID NO: 5183), AAUguaagca (SEQ ID NO: 5184), AGAguaauug (SEQ ID NO: 5185), AGGguugguu (SEQ ID NO: 5186), GUGguaggag (SEQ ID NO: 5187), AAGgcaguuu (SEQ ID NO: 5188), CAAguaagcc (SEQ ID NO: 5189), CUGgcaagua (SEQ ID NO: 5190), CAGgcaugau (SEQ ID NO: 5191), AGGguaauug (SEQ ID NO: 5192), GGGguaaccu (SEQ ID NO: 5193), AAAguaacua (SEQ ID NO: 5194), UAGgucugcc (SEQ ID NO: 5195), ACGguaugaa (SEQ ID NO: 5196), AGUguauggg (SEQ ID NO: 5197), UGGguuggca (SEQ ID NO: 5198), UAGguaaacu (SEQ ID NO: 5199), AGAgugggua (SEQ ID NO: 5200), AGAguauuug (SEQ ID NO: 5201), AGUguaggaa (SEQ ID NO: 5202), CUUguacgua (SEQ ID NO: 5203), GAUgugagau (SEQ ID NO: 5204), CAGgcagcca (SEQ ID NO: 5205), AAGgucacug (SEQ ID NO: 5206), AAGgucugac (SEQ ID NO: 5207), UAGguuccuu (SEQ ID NO: 5208), CUGgugcuuu (SEQ ID NO: 5209), UGAguuggug (SEQ ID NO: 5210), UUGgugggau (SEQ ID NO: 5211), UGAguagggu (SEQ ID NO: 5212), UCGgugaggu (SEQ ID NO: 5213), AAAguaaaga (SEQ ID NO: 5214), AAGgcaaguc (SEQ ID NO: 5215), CGGguaaagc (SEQ ID NO: 5216), AAAguuaguu (SEQ ID NO: 5217), UUAguaagca (SEQ ID NO: 5218), GAGgucacau (SEQ ID NO: 5219), UAAgugguau (SEQ ID NO: 5220), UAGgugcuuu (SEQ ID NO: 5221), GGAguaggca (SEQ ID NO: 5222), UGAguaagga (SEQ ID NO: 5223), CAGguggagc (SEQ ID NO: 5224), GAUguagaag (SEQ ID NO: 5225), AAUgccugcc (SEQ ID NO: 5226), AUGguaaggc (SEQ ID NO: 5227), UGGguaauau (SEQ ID NO: 5228), CUGguaccuc (SEQ ID NO: 5229), CACgugagcc (SEQ ID NO: 5230), UGAguuugug (SEQ ID NO: 5231), CCGguagugu (SEQ ID NO: 5232), AAAgugacaa (SEQ ID NO: 5233), GAAguggguu (SEQ ID NO: 5234), CAGgugcagc (SEQ ID NO: 5235), GAGgugggcc (SEQ ID NO: 5236), UAUgugcguc (SEQ ID NO: 5237), GGGguacugg (SEQ ID NO: 5238), CUGguagguu (SEQ ID NO: 5239), UUGgcauguu (SEQ ID NO: 5240), AAUguaauac (SEQ ID NO: 5241), UAGgccggug (SEQ ID NO: 5242), AGAgucagua (SEQ ID NO: 5243), UAAguaaauc (SEQ ID NO: 5244), CAGguuccuc (SEQ ID NO: 5245), UAGguacgau (SEQ ID NO: 5246), AGAguuagug (SEQ ID NO: 5247), GCAguaagug (SEQ ID NO: 5248), AGGgugguag (SEQ ID NO: 5249), GGAguaaugu (SEQ ID NO: 5250), GAUguaaguc (SEQ ID NO: 5251), CCAguuucgu (SEQ ID NO: 5252), AAGguucggg (SEQ ID NO: 5253), AUGguggagu (SEQ ID NO: 5254), AAGguaccgg (SEQ ID NO: 5255), GAAgugcgaa (SEQ ID NO: 5256), UGGgucaguu (SEQ ID NO: 5257), AAGguguaga (SEQ ID NO: 5258), UGGguaggcc (SEQ ID NO: 5259), CCAgugaguc (SEQ ID NO: 5260), AAGgucacuu (SEQ ID NO: 5261), AGCgugaggc (SEQ ID NO: 5262), UCCgugguaa (SEQ ID NO: 5263), AGAguacuua (SEQ ID NO: 5264), GGGgucagau (SEQ ID NO: 5265), AAGguggacc (SEQ ID NO: 5266), AGAgugagcg (SEQ ID NO: 5267), AGAgucagau (SEQ ID NO: 5268), UAAguauuac (SEQ ID NO: 5269), AGAguauuuc (SEQ ID NO: 5270), AGAguucagc (SEQ ID NO: 5271), AUGgugaagu (SEQ ID NO: 5272), UAGgugaucc (SEQ ID NO: 5273), GGAguaagau (SEQ ID NO: 5274), UAGguaccaa (SEQ ID NO: 5275), AGAguugguc (SEQ ID NO: 5276), GAAgugagac (SEQ ID NO: 5277), AUCguagguu (SEQ ID NO: 5278), GAGguacgcu (SEQ ID NO: 5279), ACGguaaggg (SEQ ID NO: 5280), CAGgcauguc (SEQ ID NO: 5281), UUAguaagau (SEQ ID NO: 5282), UGAguagguu (SEQ ID NO: 5283), AGGguacgaa (SEQ ID NO: 5284), ACGguauguu (SEQ ID NO: 5285), AGGguacugu (SEQ ID NO: 5286), UUGguaugga (SEQ ID NO: 5287), UAAguaacug (SEQ ID NO: 5288), GCGgucagcc (SEQ ID NO: 5289), UUUgugaguc (SEQ ID NO: 5290), GUGgucagug (SEQ ID NO: 5291), CUGgucugua (SEQ ID NO: 5292), GAGguucuua (SEQ ID NO: 5293), AUGguacuga (SEQ ID NO: 5294), AAUgugcuuu (SEQ ID NO: 5295), AGGguggcgu (SEQ ID NO: 5296), CCGgcaggaa (SEQ ID NO: 5297), CAUguggguc (SEQ ID NO: 5298), UUGguuuguu (SEQ ID NO: 5299), CAGguucugu (SEQ ID NO: 5300), ACGguaagcg (SEQ ID NO: 5301), CUGgucagua (SEQ ID NO: 5302), UCAguaggcu (SEQ ID NO: 5303), UGAguaggac (SEQ ID NO: 5304), CAGguuuuaa (SEQ ID NO: 5305), GAGguguccc (SEQ ID NO: 5306), AGGguggguu (SEQ ID NO: 5307), GUGgugagac (SEQ ID NO: 5308), CACguaggga (SEQ ID NO: 5309), GUGguauuuu (SEQ ID NO: 5310), GAGauauccu (SEQ ID NO: 5311), AAGgugaaca (SEQ ID NO: 5312), UAAguagggc (SEQ ID NO: 5313), CUGgugcggg (SEQ ID NO: 5314), CUGgucaaua (SEQ ID NO: 5315), AGAguaaaaa (SEQ ID NO: 5316), AAGgugcagu (SEQ ID NO: 5317), CGGguaagca (SEQ ID NO: 5318), AAAgugagcc (SEQ ID NO: 5319), AUGguaauca (SEQ ID NO: 5320), GCAguacgug (SEQ ID NO: 5321), AUGguacaug (SEQ ID NO: 5322), AAGguuaaga (SEQ ID NO: 5323), CGGguaaaug (SEQ ID NO: 5324), GAGguucgca (SEQ ID NO: 5325), GAGgcucugg (SEQ ID NO: 5326), AUGgugggac (SEQ ID NO: 5327), AACgugguag (SEQ ID NO: 5328), AAGgugauag (SEQ ID NO: 5329), GGGguuugca (SEQ ID NO: 5330), CAUguaaggg (SEQ ID NO: 5331), UCAguugagu (SEQ ID NO: 5332), AAAgugcggc (SEQ ID NO: 5333), AGAgugagcc (SEQ ID NO: 5334), AUGgcaagaa (SEQ ID NO: 5335), ACAguaaggu (SEQ ID NO: 5336), AAGgucucua (SEQ ID NO: 5337), GUGguaaaaa (SEQ ID NO: 5338), AAAguaggug (SEQ ID NO: 5339), UAGgugcacu (SEQ ID NO: 5340), GUCgugguau (SEQ ID NO: 5341), CAGguauagg (SEQ ID NO: 5342), UGAgugagag (SEQ ID NO: 5343), ACUgugagcc (SEQ ID NO: 5344), AUCguuaguu (SEQ ID NO: 5345), UUUguaccaa (SEQ ID NO: 5346), UGGgugagau (SEQ ID NO: 5347), AGAgugagaa (SEQ ID NO: 5348), AGAguagggg (SEQ ID NO: 5349), AGGgcaagua (SEQ ID NO: 5350), CGGgucagua (SEQ ID NO: 5351), UUGguaugcc (SEQ ID NO: 5352), CGGguuagau (SEQ ID NO: 5353), GGGgugaagu (SEQ ID NO: 5354), CCCgugugaa (SEQ ID NO: 5355), GCAguuugga (SEQ ID NO: 5356), UGCguaagac (SEQ ID NO: 5357), AGAgucugua (SEQ ID NO: 5358), CACgugagca (SEQ ID NO: 5359), AGGguaaaag (SEQ ID NO: 5360), CAGgcugggu (SEQ ID NO: 5361), GAAgucuuca (SEQ ID NO: 5362), AAGgcaaaaa (SEQ ID NO: 5363), GUAguaaaua (SEQ ID NO: 5364), CUAgugagag (SEQ ID NO: 5365), GAAguuucug (SEQ ID NO: 5366), CCUguacgua (SEQ ID NO: 5367), GAGgugcgcg (SEQ ID NO: 5368), AAGguguaaa (SEQ ID NO: 5369), CCAguauguu (SEQ ID NO: 5370), CCGgucagcu (SEQ ID NO: 5371), AUGguuccug (SEQ ID NO: 5372), CAAguuaaau (SEQ ID NO: 5373), AGAguaggcu (SEQ ID NO: 5374), AUGgugggca (SEQ ID NO: 5375), GGAguaagac (SEQ ID NO: 5376), AGGgucacga (SEQ ID NO: 5377), UAGgugauau (SEQ ID NO: 5378), GAAguaaguc (SEQ ID NO: 5379), CGGguaagau (SEQ ID NO: 5380), CAAguagcua (SEQ ID NO: 5381), UGAguaaaau (SEQ ID NO: 5382), GUCguacgug (SEQ ID NO: 5383), AUGguacgua (SEQ ID NO: 5384), CAGgucucgg (SEQ ID NO: 5385), GAGgcauguc (SEQ ID NO: 5386), AGAgugggau (SEQ ID NO: 5387), GUGguuagag (SEQ ID NO: 5388), UGGgugguga (SEQ ID NO: 5389), AAGguuaaac (SEQ ID NO: 5390), CUUguuagcu (SEQ ID NO: 5391), AAAguaggaa (SEQ ID NO: 5392), UAGguuguau (SEQ ID NO: 5393), AGGgugcgcc (SEQ ID NO: 5394), AAGgugggcu (SEQ ID NO: 5395), UAAguaucug (SEQ ID NO: 5396), AAGguaacgu (SEQ ID NO: 5397), AUGguggggc (SEQ ID NO: 5398), CAAguacacg (SEQ ID NO: 5399), GGCguaagug (SEQ ID NO: 5400), AUAguaggac (SEQ ID NO: 5401), AGAgugaggu (SEQ ID NO: 5402), UUUguaaaaa (SEQ ID NO: 5403), GAAguuugua (SEQ ID NO: 5404), CUAguaaucu (SEQ ID NO: 5405), AAGguuuuua (SEQ ID NO: 5406), GAGgugcguu (SEQ ID NO: 5407), UAGgcgagua (SEQ ID NO: 5408), ACCgugagua (SEQ ID NO: 5409), CAGgucccga (SEQ ID NO: 5410), AUGguacugg (SEQ ID NO: 5411), UGAguucagu (SEQ ID NO: 5412), AAUguguggu (SEQ ID NO: 5413), UCCguugguu (SEQ ID NO: 5414), CAGgucagag (SEQ ID NO: 5415), CAGgucccua (SEQ ID NO: 5416), UAGguagacu (SEQ ID NO: 5417), CAAguuaagg (SEQ ID NO: 5418), GAGgugugcg (SEQ ID NO: 5419), GAAgcugccc (SEQ ID NO: 5420), CGAguacgug (SEQ ID NO: 5421), CGGguaggua (SEQ ID NO: 5422), UUGguauuga (SEQ ID NO: 5423), AUUguaugau (SEQ ID NO: 5424), UUGguaugaa (SEQ ID NO: 5425), GAGgugguca (SEQ ID NO: 5426), GCUguaugaa (SEQ ID NO: 5427), CAGguguugc (SEQ ID NO: 5428), CAGguaaaac (SEQ ID NO: 5429), AUAguaaggu (SEQ ID NO: 5430), CUGguuagag (SEQ ID NO: 5431), AGCgugugag (SEQ ID NO: 5432), AAGguuaucu (SEQ ID NO: 5433), CACgugagua (SEQ ID NO: 5434), AGGgucagua (SEQ ID NO: 5435), GAGguauaau (SEQ ID NO: 5436), CAGguuauuu (SEQ ID NO: 5437), AGGguggacu (SEQ ID NO: 5438), AUUguaauuc (SEQ ID NO: 5439), UUUguggguu (SEQ ID NO: 5440), AUGguacgug (SEQ ID NO: 5441), AAGguguucc (SEQ ID NO: 5442), CAGgugacgc (SEQ ID NO: 5443), GAGguacuaa (SEQ ID NO: 5444), ACAguucagu (SEQ ID NO: 5445), GAGgucacgg (SEQ ID NO: 5446), CAAguaaggc (SEQ ID NO: 5447), AAGguuuggg (SEQ ID NO: 5448), AAAgugggcu (SEQ ID NO: 5449), GCGguucuug (SEQ ID NO: 5450), GAGguggagc (SEQ ID NO: 5451), UGAgucagug (SEQ ID NO: 5452), CAGgucaagg (SEQ ID NO: 5453), AGUguaagcu (SEQ ID NO: 5454), GAGgcagaaa (SEQ ID NO: 5455), AAGgucacac (SEQ ID NO: 5456), GAAguagguu (SEQ ID NO: 5457), GUCguaaguu (SEQ ID NO: 5458), AGAguaugca (SEQ ID NO: 5459), CCUgugcaaa (SEQ ID NO: 5460), ACGgugaaaa (SEQ ID NO: 5461), CAGguacgaa (SEQ ID NO: 5462), CAUgugagga (SEQ ID NO: 5463), AGCgugagua (SEQ ID NO: 5464), GGUguguagg (SEQ ID NO: 5465), AACgugagcu (SEQ ID NO: 5466), GAGgugaacu (SEQ ID NO: 5467), AGAguucagu (SEQ ID NO: 5468), AACgugugua (SEQ ID NO: 5469), CAGguugugg (SEQ ID NO: 5470), AAGguacuag (SEQ ID NO: 5471), UCAgugaaaa (SEQ ID NO: 5472), AAUgucuggu (SEQ ID NO: 5473), ACGguaaaau (SEQ ID NO: 5474), CUGguguaag (SEQ ID NO: 5475), GAGgugcgaa (SEQ ID NO: 5476), AGGguuucuc (SEQ ID NO: 5477), CAGguagccc (SEQ ID NO: 5478), AUUguauugg (SEQ ID NO: 5479), AUGguacuua (SEQ ID NO: 5480), GAGgcccgac (SEQ ID NO: 5481), UCGguaagac (SEQ ID NO: 5482), CGGgcuguag (SEQ ID NO: 5483), UAUgugugug (SEQ ID NO: 5484), UAGguagaaa (SEQ ID NO: 5485), GUGgucauua (SEQ ID NO: 5486), UAGgugaaag (SEQ ID NO: 5487), ACUguaauuc (SEQ ID NO: 5488), GCAguacagg (SEQ ID NO: 5489), UCGgugaguc (SEQ ID NO: 5490), UAUguaggga (SEQ ID NO: 5491), AUGguauguc (SEQ ID NO: 5492), GUGgugugug (SEQ ID NO: 5493), CUGgugaccu (SEQ ID NO: 5494), AAUgugaaua (SEQ ID NO: 5495), UAGgucucac (SEQ ID NO: 5496), GAGguuauug (SEQ ID NO: 5497), UGAguaggcu (SEQ ID NO: 5498), CGGgcacgua (SEQ ID NO: 5499), GCAguaaaua (SEQ ID NO: 5500), CCGgugagag (SEQ ID NO: 5501), UAAguugguc (SEQ ID NO: 5502), CCGgugagcc (SEQ ID NO: 5503), AAGguuguca (SEQ ID NO: 5504), CUGguauuau (SEQ ID NO: 5505), GGGguauggg (SEQ ID NO: 5506), AAAgucagua (SEQ ID NO: 5507), UUUguaugua (SEQ ID NO: 5508), UAAguacugc (SEQ ID NO: 5509), CAGguaccaa (SEQ ID NO: 5510), GAAguucaga (SEQ ID NO: 5511), AUGgugcggu (SEQ ID NO: 5512), GUGgugaggu (SEQ ID NO: 5513), UGAguaagcc (SEQ ID NO: 5514), UAUguaaggg (SEQ ID NO: 5515), GUGguggaaa (SEQ ID NO: 5516), GAGgugauug (SEQ ID NO: 5517), GGAguuugua (SEQ ID NO: 5518), AAGgucacga (SEQ ID NO: 5519), GUGguagagg (SEQ ID NO: 5520), UAAguauauc (SEQ ID NO: 5521), AAGgugucca (SEQ ID NO: 5522), UAUgugguau (SEQ ID NO: 5523), GAGguacaau (SEQ ID NO: 5524), AAGguggggg (SEQ ID NO: 5525), GGAguaggug (SEQ ID NO: 5526), and UAGgugacuu (SEQ ID NO: 5527).

In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises AGA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises AAA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

AAC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

AAU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

AAG. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

AC A. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

AUA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

AUU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

AUG. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

AUC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

CAA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

CAU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CAC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CAG. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises GAA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

GAC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

GAU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

GAG. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

GGA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

GCA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

GGG. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

GGC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

GUU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises

GGU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises GUC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises GUA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises GUG. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises UCU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises UCC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises UCA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises UCG. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises UUU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises UUC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises UUA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises UUG. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises UGU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises UAU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises GGA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CUU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CUC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CUA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CUG. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CCU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CCC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CCA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CCG. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises ACU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises ACC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises ACG. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises AGC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises AGU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises AGG. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CGU. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises UAC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises UAA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises UAG. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CGC. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CGA. In some embodiments, the splice site sequence (e.g., 5' splice site sequence) comprises CGG. In some embodiments, the splice site sequence comprises AGAguaaggg (SEQ ID NO: 667). In some embodiments, the splice site sequence comprises UGAguaagca (SEQ ID NO: 2768).

In an embodiment, a gene sequence or splice site sequence provided herein is related to a proliferative disease, disorder, or condition (e.g., cancer, benign neoplasm, or inflammatory disease). In an embodiment, a gene sequence or splice site sequence provided herein is related to a non-proliferative disease, disorder, or condition. In an embodiment, a gene sequence or splice site sequence provided herein is related to a neurological disease or disorder; autoimmune disease or disorder; immunodeficiency disease or disorder; lysosomal storage disease or disorder; cardiovascular condition, disease or disorder; metabolic disease or disorder; respiratory condition, disease, or disorder; renal disease or disorder; or infectious disease in a subject. In an embodiment, a gene sequence or splice site sequence provided herein is related to a neurological disease or disorder (e.g., Huntington's disease). In an embodiment, a gene sequence or splice site sequence provided herein is related to an immunodeficiency disease or disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to a lysosomal storage disease or disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to a cardiovascular condition, disease or disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to a metabolic disease or disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to a respiratory condition, disease, or disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to a renal disease or disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to an infectious disease.

In an embodiment, a gene sequence or splice site sequence provided herein is related to a mental retardation disorder. In an embodiment, a gene sequence or splice site sequence provided herein is related to a mutation in the SETD5 gene. In an embodiment, a gene sequence or splice site sequence provided herein is related to an immunodeficiency disorder. In an embodiment, a gene sequence and splice site sequence provided herein is related to a mutation in the GATA2 gene. In an embodiment, a gene sequence or splice site sequence provided herein is related to a lysosomal storage disease.

In some embodiments, a compound of Formula (I) or (II) described herein interacts with (e.g., binds to) a splicing complex component (e.g., a nucleic acid (e.g., an RNA) or a protein). In some embodiments, the splicing complex component is selected from 9G8, Al hnRNP, A2 hnRNP, ASD-1, ASD-2b, ASF, BRR2, Bl hnRNP, Cl hnRNP, C ₂ hnRNP, CBP20, CBP80, CELF, F hnRNP, FBP11, Fox-1, Fox-2, G hnRNP, H hnRNP, hnRNP 1, hnRNP 3, hnRNP C, hnRNP G, hnRNP K, hnRNP M, hnRNP U, Hu, HUR, I hnRNP, K hnRNP, KH-type splicing regulatory protein (KSRP), L hnRNP, LUC ₇ L, M hnRNP, mBBP, muscle-blind like (MBNL), NF45, NF AR, Nova-1, Nova-2, nPTB, P54/SFRS11, polypyrimidine tract binding protein (PTB), a PRP protein (e.g., PRP8, PRP6, PRP31, PRP4, PRP3, PRP28, PRP5, PRP2, PRP19), PRP19 complex proteins, RBM42, R hnRNP, RNPC ₁ , SADI, SAM68, SC ₃ 5, SF, SF1/BBP, SF2, SF3A complex, SF3B complex, SFRS10, an Sm protein (such as B, DI, D2, D3, F, E, G), SNU17, SNU66, SNU114, an SR protein, SRm300, SRp20, SRp30c, SRP35C, SRP36, SRP38, SRp40, SRp55, SRp75, SRSF, STAR, GSG, SUP-12, TASR-1, TASR-2, TIA, TIAR, TRA2, TRA2a/b, U hnRNP, U1 snRNP, U11 snRNP, U12 snRNP, U1-70K, Ul-A, Ul-C, U2 snRNP, U2AF1-RS2, U2AF35, U2AF65, U4 snRNP, U5 snRNP, U6 snRNP, Urp, and YB1.

In some embodiments, the splicing complex component comprises RNA (e.g., snRNA). In some embodiments, a compound described herein binds to a splicing complex component comprising snRNA. The snRNA may be selected from, e.g., U1 snRNA, U2 snRNA, U4 snRNA, U5 snRNA, U6 snRNA, U11 snRNA, U12 snRNA, U4atac snRNA, and any combination thereof.

In some embodiments, the splicing complex component comprises a protein, e.g., a protein associated with an snRNA. In some embodiments, the protein comprises SC ₃ 5, SRp55, SRp40, SRm300, SFRS10, TASR-1, TASR-2, SF2/ASF, 9G8, SRp75, SRp30c, SRp20 and P54/SFRS11. In some embodiments, the splicing complex component comprises a U2 snRNA auxiliary factor (e.g., U2AF65, U2AF35), Urp/U2AFl-RS2, SF1/BBP, CBP80, CBP 20, SF1 or PTB/hnRNPl. In some embodiments, the hnRNP protein comprises Al, A2/B1, L, M, K, U, F, H, G, R, I or C ₁ /C ₂ . Human genes encoding hnRNPs include HNRNPAO, HNRNPA1, HNRNPA1L1, HNRNPA1L2, HNRNPA3, HNRNPA2B1, HNRNPAB, HNRNPB1, HNRNPC, HNRNPCL1, HNRNPD, HNRPDL, HNRNPF, HNRNPH1, HNRNPH2, HNRNPH3, HNRNPK, HNRNPL, HNRPLL, HNRNPM, HNRNPR, HNRNPU, HNRNPUL1, HNRNPUL2, HNRNPUL3, and FMRI.

In one aspect, the compounds of Formula (I) or (II) and pharmaceutically acceptable salts, solvates, hydrates, tautomers, stereoisomers, and compositions thereof, may modulate (e.g., increase or decrease) a splicing event of a target nucleic acid sequence (e.g., DNA, RNA, or a pre-mRNA), for example, a nucleic acid encoding a gene described herein, or a nucleic acid encoding a protein described herein, or a nucleic acid comprising a splice site described herein. In an embodiment, the splicing event is an alternative splicing event.

In an embodiment, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, and compositions thereof increases splicing at splice site on a target nucleic acid (e.g., an RNA, e.g., a pre-mRNA), by about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, e.g., as determined by a known method in the art, e.g., qPCR. In an embodiment, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, and compositions thereof decreases splicing at splice site on a target nucleic acid (e.g., an RNA, e.g., a pre-mRNA), by about 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, e.g., as determined by a known method in the art, e.g., qPCR.

In another aspect, the present disclosure features a method of forming a complex comprising a component of a spliceosome (e.g., a major spliceosome component or a minor spliceosome component), a nucleic acid (e.g., a DNA, RNA, e.g., a pre-mRNA), and a compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, or composition thereof, comprising contacting the nucleic acid (e.g., a DNA, RNA, e.g., a pre-mRNA) with said compound of Formula (I) or (II). In an embodiment, the component of a spliceosome is selected from the Ul, U2, U4, U5, U6, U11, U12, U4atac, U6atac small nuclear ribonucleoproteins (snRNPs), or a related accessory factor. In an embodiment, the component of a spliceosome is recruited to the nucleic acid in the presence of the compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, or composition thereof.

In another aspect, the present disclosure features a method of altering the conformation of a nucleic acid (e.g., a DNA, RNA, e.g., a pre-mRNA) comprising contacting the nucleic acid with a compound of Formula (I) or (II) or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer, or composition thereof. In an embodiment, the altering comprises forming a bulge or kink in the nucleic acid. In an embodiment, the altering comprises stabilizing a bulge or a kink in the nucleic acid. In an embodiment, the altering comprises reducing a bulge or a kink in the nucleic acid. In an embodiment, the nucleic acid comprises a splice site. In an embodiment, the compound of Formula (I) or (II) interacts with a nucleobase, ribose, or phosphate moiety of a nucleic acid (e.g., a DNA, RNA, e.g., pre-mRNA).

The present disclosure also provides methods for the treatment or prevention of a disease, disorder, or condition. In an embodiment, the disease, disorder or condition is related to (e.g., caused by) a splicing event, such as an unwanted, aberrant, or alternative splicing event. In an embodiment, the disease, disorder or condition comprises a proliferative disease (e.g., cancer, benign neoplasm, or inflammatory disease) or non-proliferative disease. In an embodiment, the disease, disorder, or condition comprises a neurological disease, autoimmune disorder, immunodeficiency disorder, cardiovascular condition, metabolic disorder, lysosomal storage disease, respiratory condition, renal disease, or infectious disease in a subject. In another embodiment, the disease, disorder, or condition comprises a haploinsufficiency disease, an autosomal recessive disease (e.g., with residual function), or a paralogue activation disorder. In another embodiment, the disease, disorder, or condition comprises an autosomal dominant disorder (e.g., with residual function). Such methods comprise the step of administering to the subject in need thereof an effective amount of a compound of Formula (I) or (II), or a pharmaceutically acceptable salt, solvate, hydrate, tautomer, stereoisomer thereof, or a pharmaceutical composition thereof. In certain embodiments, the methods described herein include administering to a subject an effective amount of a compound of Formula (I) or (II), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof.

In certain embodiments, the subject being treated is a mammal. In certain embodiments, the subject is a human. In certain embodiments, the subject is a domesticated animal, such as a dog, cat, cow, pig, horse, sheep, or goat. In certain embodiments, the subject is a companion animal such as a dog or cat. In certain embodiments, the subject is a livestock animal such as a cow, pig, horse, sheep, or goat. In certain embodiments, the subject is a zoo animal. In another embodiment, the subject is a research animal such as a rodent, dog, or non-human primate. In certain embodiments, the subject is a non-human transgenic animal such as a transgenic mouse or transgenic pig.

A proliferative disease may also be associated with inhibition of apoptosis of a cell in a biological sample or subject. All types of biological samples described herein or known in the art are contemplated as being within the scope of the disclosure. The compounds of Formula (I) or (II) and pharmaceutically acceptable salts, solvates, hydrates, tautomers, stereoisomers, and compositions thereof, may induce apoptosis, and therefore, be useful in treating and/or preventing proliferative diseases.

In certain embodiments, the proliferative disease to be treated or prevented using the compounds of Formula (I) or (II) is cancer. As used herein, the term "cancer" refers to a malignant neoplasm (Stedman's Medical Dictionary, 25th ed.; Hensyl ed.; Williams & Wilkins: Philadelphia, 1990). All types of cancers disclosed herein or known in the art are contemplated as being within the scope of the disclosure. Exemplary cancers include, but are not limited to, acoustic neuroma; adenocarcinoma; adrenal gland cancer; anal cancer; angiosarcoma (e.g., lymphangiosarcoma, lymphangioendotheliosarcoma, hemangiosarcoma); appendix cancer; benign monoclonal gammopathy; biliary cancer (e.g., cholangiocarcinoma); bladder cancer; breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast); brain cancer (e.g., meningioma, glioblastomas, glioma (e.g., astrocytoma, oligodendroglioma), medulloblastoma); bronchus cancer; carcinoid tumor; cervical cancer (e.g., cervical adenocarcinoma); choriocarcinoma; chordoma; craniopharyngioma; colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma); connective tissue cancer; epithelial carcinoma; ependymoma; endotheliosarcoma (e.g., Kaposi's sarcoma, multiple idiopathic hemorrhagic sarcoma); endometrial cancer (e.g., uterine cancer, uterine sarcoma); esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett's adenocarcinoma); Ewing's sarcoma; eye cancer (e.g., intraocular melanoma, retinoblastoma); familiar hypereosinophilia; gall bladder cancer; gastric cancer (e.g., stomach adenocarcinoma); gastrointestinal stromal tumor (GIST); germ cell cancer; head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma), throat cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer), e.g., adenoid cystic carcinoma (ACC)); hematopoietic cancers (e.g., leukemia such as acute lymphocytic leukemia (ALL) (e.g., B-cell ALL, T-cell ALL), acute myelocytic leukemia (AML) (e.g., B-cell AML, T-cell AML), chronic myelocytic leukemia (CML) (e.g., B-cell CML, T-cell CML), and chronic lymphocytic leukemia (CLL) (e.g., B-cell CLL, T-cell CLL)); lymphoma such as Hodgkin lymphoma (HL) (e.g., B-cell HL, T-cell HL) and non-Hodgkin lymphoma (NHL) (e.g., B-cell NHL such as diffuse large cell lymphoma (DLCL) (e.g., diffuse large B-cell lymphoma), follicular lymphoma, chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL), mantle cell lymphoma (MCL), marginal zone B-cell lymphomas (e.g., mucosa-associated lymphoid tissue (MALT) lymphomas, nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma), primary mediastinal B-cell lymphoma, Burkitt lymphoma, lymphoplasmacytic lymphoma (i.e., Waldenstrom's macroglobulinemia), hairy cell leukemia (HCL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma and primary central nervous system (CNS) lymphoma; and T-cell NHL such as precursor T-lymphoblastic lymphoma/leukemia, peripheral T-cell lymphoma (PTCL) (e.g., cutaneous T-cell lymphoma (CTCL) (e.g., mycosis fungoides, Sezary syndrome), angioimmunoblastic T-cell lymphoma, extranodal natural killer T-cell lymphoma, enteropathy type T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, and anaplastic large cell lymphoma); a mixture of one or more leukemia/lymphoma as described above; and multiple myeloma (MM)), heavy chain disease (e.g., alpha chain disease, gamma chain disease, mu chain disease); hemangioblastoma; hypopharynx cancer; inflammatory myofibroblastic tumors; immunocytic amyloidosis; kidney cancer (e.g., nephroblastoma a.k.a. Wilms' tumor, renal cell carcinoma); liver cancer (e.g., hepatocellular cancer (HCC), malignant hepatoma); lung cancer (e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung); leiomyosarcoma (I-MS); mastocytosis (e.g., systemic mastocytosis); muscle cancer; myelodysplastic syndrome (MDS); mesothelioma; myeloproliferative disorder (MPD) (e.g., polycythemia vera (PV), essential thrombocytosis (ET), agnogenic myeloid metaplasia (AMM) a.k.a. myelofibrosis (MF), chronic idiopathic myelofibrosis, chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), hypereosinophilic syndrome (HES)); neuroblastoma; neurofibroma (e.g., neurofibromatosis (NF) type 1 or type 2, schwannomatosis); neuroendocrine cancer (e.g., gastroenteropancreatic neuroendocrine tumor (GEP-NET), carcinoid tumor); osteosarcoma (e.g., bone cancer); ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma); papillary adenocarcinoma; pancreatic cancer (e.g., pancreatic adenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), Islet cell tumors); penile cancer (e.g., Paget's disease of the penis and scrotum); pinealoma; primitive neuroectodermal tumor (PNT); plasma cell neoplasia; paraneoplastic syndromes; intraepithelial neoplasms; prostate cancer (e.g., prostate adenocarcinoma); rectal cancer; rhabdomyosarcoma; salivary gland cancer; skin cancer (e.g., squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)); small bowel cancer (e.g., appendix cancer); soft tissue sarcoma (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myxosarcoma); sebaceous gland carcinoma; small intestine cancer; sweat gland carcinoma; synovioma; testicular cancer (e.g., seminoma, testicular embryonal carcinoma); thyroid cancer (e.g., papillary carcinoma of the thyroid, papillary thyroid carcinoma (PTC), medullary thyroid cancer); urethral cancer; vaginal cancer; and vulvar cancer (e.g., Paget's disease of the vulva).

In some embodiments, the cancer is selected from adenoid cystic carcinoma (ACC), acute myelocytic leukemia (AML) (e.g., B-cell AML, T-cell AML), chronic myelocytic leukemia (CML) (e.g., B-cell CML, T-cell CML), non-Hodgkin lymphoma (NHL), Burkitt lymphoma, colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma), prostate cancer (e.g., prostate adenocarcinoma), ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma), and myelodysplastic syndrome (MDS).

In some embodiments, the proliferative disease is associated with a benign neoplasm. For example, a benign neoplasm may include adenoma, fibroma, hemangioma, tuberous sclerosis, and lipoma. All types of benign neoplasms disclosed herein or known in the art are contemplated as being within the scope of the disclosure.

In some embodiments, the proliferative disease is associated with angiogenesis. All types of angiogenesis disclosed herein or known in the art are contemplated as being within the scope of the disclosure.

In some embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a non-proliferative disease. Exemplary nonproliferative diseases include a neurological disease, autoimmune disorder, immunodeficiency disorder, lysosomal storage disease, cardiovascular condition, metabolic disorder, respiratory condition, inflammatory disease, renal disease, or infectious disease.

In certain embodiments, the non-proliferative disease is a neurological disease. In certain embodiments, the compound of Formula (I) or (II), or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a neurological disease, disorder, or condition. A neurological disease, disorder, or condition may include a neurodegenerative disease, a psychiatric condition, or a musculoskeletal disease. A neurological disease may further include a repeat expansion disease, e.g., which may be characterized by the expansion of a nucleic acid sequence in the genome. For example, a repeat expansion disease includes myotonic dystrophy, amyotrophic lateral sclerosis, Huntington's disease, a trinucleotide repeat disease, or a polyglutamine disorder (e.g., ataxia, fragile X syndrome). In some embodiments, the neurological disease comprises a repeat expansion disease, e.g., Huntington's disease. Additional neurological diseases, disorders, and conditions include Alzheimer's disease, Huntington's chorea, a prion disease (e.g., Creutzfeld- Jacob disease, bovine spongiform encephalopathy, Kuru, or scrapie), a mental retardation disorder (e.g., a disorder caused by a SETD5 gene mutation, e.g., intellectual disability-facial dysmorphism syndrome, autism spectrum disorder), Lewy Body disease, diffuse Lewy body disease (DLBD), dementia, progressive supranuclear palsy (PSP), progressive bulbar palsy (PBP), psuedobulbar palsy, spinal and bulbar muscular atrophy (SBMA), primary lateral sclerosis, Pick's disease, primary progressive aphasia, corticobasal dementia, Parkinson's disease, Down's syndrome, multiple system atrophy, spinal muscular atrophy (SMA), progressive spinobulbar muscular atrophy (e.g., Kennedy disease), post-polio syndrome (PPS), spinocerebellar ataxia, pantothenate kinase-associated neurodegeneration (PANK), spinal degenerative disease/motor neuron degenerative diseases, upper motor neuron disorder, lower motor neuron disorder, Hallervorden-Spatz syndrome, cerebral infarction, cerebral trauma, chronic traumatic encephalopathy, transient ischemic attack, Lytigo-bodig (amyotrophic lateral sclerosis-parkinsonism dementia), Guam -Parkinsonism dementia, hippocampal sclerosis, corticobasal degeneration, Alexander disease, Apler's disease, Krabbe's disease, neuroborreliosis, neurosyphilis, Sandhoff disease, Tay-Sachs disease, Schilder's disease, Batten disease, Cockayne syndrome, Kearns-Sayre syndrome, Gerstmann-Straussler-Scheinker syndrome and other transmissible spongiform encephalopathies, hereditary spastic paraparesis, Leigh's syndrome, a demyelinating diseases, neuronal ceroid lipofuscinoses, epilepsy, tremors, depression, mania, anxiety and anxiety disorders, sleep disorders (e.g., narcolepsy, fatal familial insomnia), acute brain injuries (e.g., stroke, head injury), autism, Machado-Joseph disease, or a combination thereof. In some embodiments, the neurological disease comprises Friedrich's ataxia or Sturge Weber syndrome. In some embodiments, the neurological disease comprises Huntington's disease. In some embodiments, the neurological disease comprises spinal muscular atrophy. All types of neurological diseases disclosed herein or known in the art are contemplated as being within the scope of the disclosure.

In certain embodiments, the non-proliferative disease is an autoimmune disorder or an immunodeficiency disorder. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat an autoimmune disease, disorder, or condition, or an immunodeficiency disease, disorder, or condition. Exemplary autoimmune and immunodeficiency diseases, disorders, and conditions include arthritis (e.g., rheumatoid arthritis, osteoarthritis, gout), Chagas disease, chronic obstructive pulmonary disease (COPD), dermatomyositis, diabetes mellitus type 1, endometriosis, Goodpasture's syndrome, Graves' disease, Guillain-Barre syndrome (GBS), Hashiomoto's disease, Hi dradenitis suppurativa, Kawasaki disease, ankylosing spondylitis, IgA nephropathy, idiopathic thrombocytopenic purpura, inflammatory bowel disease, Crohn's disease, ulcerative colitis, collagenous colitis, lymphocytic colitis, ischemic colitis, diversion colitis, Behcet's syndrome, infective colitis, indeterminate colitisinterstitial cystitis, lupus (e.g., systemic lupus erythematosus, discoid lupus, drug-induced lupus, neonatal lupus), mixed connective tissue disease, morphea, multiple sclerosis, myasthenia gravis, narcolepsy, neuromyotonia, pemphigus vulgaris, pernicious anemia, psoriasis, psoriatic arthritis, polymyositis, primary biliary cirrhosis, relapsing polychondritis, scleroderma, Sjogren's syndrome, Stiff person syndrome, vasculitis, vitiligo, a disorder caused by a GATA2 mutation (e.g., GATA2 deficiency; GATA2 haploinsufficiency; Emberger syndrome; monocytopenia and mycobacterium avium complex/dendritic cell, monocyte, B and NK lymphocyte deficiency; familial myelodysplastic syndrome; acute myeloid leukemia; chronic myelomonocytic leukemia), neutropenia, aplastic anemia, and Wegener's granulomatosis. In some embodiments, the autoimmune or immunodeficiency disorder comprises chronic mucocutaneous candidiasis. All types of autoimmune disorders and immunodeficiency disorders disclosed herein or known in the art are contemplated as being within the scope of the disclosure.

In certain embodiments, the non-proliferative disease is a cardiovascular condition. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a cardiovascular disease, disorder, or condition. A cardiovascular disease, disorder, or condition may include a condition relating to the heart or vascular system, such as the arteries, veins, or blood. Exemplary cardiovascular diseases, disorders, or conditions include angina, arrhythmias (atrial or ventricular or both), heart failure, arteriosclerosis, atheroma, atherosclerosis, cardiac hypertrophy, cardiac or vascular aneurysm, cardiac myocyte dysfunction, carotid obstructive disease, endothelial damage after PTCA (percutaneous transluminal coronary angioplasty), hypertension including essential hypertension, pulmonary hypertension and secondary hypertension (renovascular hypertension, chronic glomerulonephritis), myocardial infarction, myocardial ischemia, peripheral obstructive arteriopathy of a limb, an organ, or a tissue; peripheral artery occlusive disease (PAOD), reperfusion injury following ischemia of the brain, heart or other organ or tissue, restenosis, stroke, thrombosis, transient ischemic attack (TIA), vascular occlusion, vasculitis, and vasoconstriction. All types of cardiovascular diseases, disorders, or conditions disclosed herein or known in the art are contemplated as being within the scope of the disclosure.

In certain embodiments, the non-proliferative disease is a metabolic disorder. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a metabolic disease, disorder, or condition. A metabolic disease, disorder, or condition may include a disorder or condition that is characterized by abnormal metabolism, such as those disorders relating to the consumption of food and water, digestion, nutrient processing, and waste removal. A metabolic disease, disorder, or condition may include an acidbase imbalance, a mitochondrial disease, a wasting syndrome, a malabsorption disorder, an iron metabolism disorder, a calcium metabolism disorder, a DNA repair deficiency disorder, a glucose metabolism disorder, hyperlactatemia, a disorder of the gut microbiota. Exemplary metabolic conditions include obesity, diabetes (Type I or Type II), insulin resistance, glucose intolerance, lactose intolerance, eczema, hypertension, Hunter syndrome, Krabbe disease, sickle cell anemia, maple syrup urine disease, Pompe disease, and metachromatic leukodystrophy. All types of metabolic diseases, disorders, or conditions disclosed herein or known in the art are contemplated as being within the scope of the disclosure.

In certain embodiments, the non-proliferative disease is a respiratory condition. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a respiratory disease, disorder, or condition. A respiratory disease, disorder, or condition can include a disorder or condition relating to any part of the respiratory system, such as the lungs, alveoli, trachea, bronchi, nasal passages, or nose. Exemplary respiratory diseases, disorders, or conditions include asthma, allergies, bronchitis, allergic rhinitis, chronic obstructive pulmonary disease (COPD), lung cancer, oxygen toxicity, emphysema, chronic bronchitis, and acute respiratory distress syndrome. All types of respiratory diseases, disorders, or conditions disclosed herein or known in the art are contemplated as being within the scope of the disclosure.

In certain embodiments, the non-proliferative disease is a renal disease. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a renal disease, disorder, or condition. A renal disease, disorder, or condition can include a disease, disorder, or condition relating to any part of the waste production, storage, and removal system, including the kidneys, ureter, bladder, urethra, adrenal gland, and pelvis. Exemplary renal diseases include acute kidney failure, amyloidosis, Alport syndrome, adenovirus nephritis, acute lobar nephronia, tubular necrosis, glomerulonephritis, kidney stones, urinary tract infections, chronic kidney disease, polycystic kidney disease, and focal segmental glomerulosclerosis (FSGS). In some embodiments, the renal disease, disorder, or condition comprises HIV-associated nephropathy or hypertensive nephropathy. All types of renal diseases, disorders, or conditions disclosed herein or known in the art are contemplated as being within the scope of the disclosure.

In certain embodiments, the non-proliferative disease is an infectious disease. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat an infectious disease, disorder, or condition. An infectious disease may be caused by a pathogen such as a virus or bacteria. Exemplary infectious diseases include human immunodeficiency syndrome (HIV), acquired immunodeficiency syndrome (AIDS), meningitis, African sleeping sickness, actinomycosis, pneumonia, botulism, chlamydia, Chagas disease, Colorado tick fever, cholera, typhus, giardiasis, food poisoning, ebola hemorrhagic fever, diphtheria, Dengue fever, gonorrhea, streptococcal infection (e.g., Group A or Group B), hepatitis A, hepatitis B, hepatitis C, herpes simplex, hookworm infection, influenza, Epstein-Barr infection, Kawasaki disease, kuru, leprosy, leishmaniasis, measles, mumps, norovirus, meningococcal disease, malaria, Lyme disease, listeriosis, rabies, rhinovirus, rubella, tetanus, shingles, scarlet fever, scabies, Zika fever, yellow fever, tuberculosis, toxoplasmosis, or tularemia. In some embodiments, the infectious disease comprises cytomegalovirus. All types of infectious diseases, disorders, or conditions disclosed herein or known in the art are contemplated as being within the scope of the disclosure. In certain embodiments, the disease, disorder, or condition is a haploinsufficiency disease. In certain embodiments, the compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a haploinsufficiency disease, disorder, or condition. A haploinsufficiency disease, disorder, or condition may refer to a monogenic disease in which an allele of a gene has a loss-of-function lesion, e.g., a total loss of function lesion. In an embodiment, the loss-of-function lesion is present in an autosomal dominant inheritance pattern or is derived from a sporadic event. In an embodiment, the reduction of gene product function due to the altered allele drives the disease phenotype despite the remaining functional allele (i.e. said disease is haploinsufficient with regard to the gene in question). In an embodiment, a compound of Formula (I) or (II) increases expression of the haploinsufficient gene locus. In an embodiment, a compound of Formula (I) or (II) increases one or both alleles at the haploinsufficient gene locus. Exemplary haploinsufficiency diseases, disorders, and conditions include Robinow syndrome, cardiomyopathy, cerebellar ataxia, pheochromocytoma, Charcot-Marie-Tooth disease, neuropathy, Takenouchi-Kosaki syndrome, Coffin-Siris syndrome 2, chromosome lp35 deletion syndrome, spinocerebellar ataxia 47, deafness, seizures, dystonia 9, GLUT1 deficiency syndrome 1, GLUT1 deficiency syndrome 2, stomatin-deficient cryohydrocytosis, basal cell carcinoma, basal cell nevus syndrome, medulloblastoma, somatic, brain malformations, macular degeneration, cone-rod dystrophy, Dejerine-Sottas disease, hypomyelinating neuropathy, Roussy -Levy syndrome, glaucoma, autoimmune lymphoproliferative syndrome, pituitary hormone deficiency, epileptic encephalopathy, early infantile, popliteal pterygium syndrome, van der Woude syndrome, Loeys-Dietz syndrome, Skraban-Deardorff syndrome, erythrocytosis, megalencephaly-polymicrogyria-polydactyly- hydrocephalus syndrome, mental retardation, CINCA syndrome, familial cold inflammatory syndrome 1, keratoendothelitis fugax hereditaria, Muckle-Wells syndrome, Feingold syndrome 1, Acute myeloid leukemia, Heyn-Sproul -Jackson syndrome, Tatton-Brown-Rahman syndrome, Shashi-Pena syndrome, Spastic paraplegia, autosomal dominant, macrophthalmia, colobomatous, with microcornea, holoprosencephaly, schizencephaly, endometrial cancer, familial, colorectal cancer, hereditary nonpolyposis, intellectual developmental disorder with dysmorphic facies and behavioral abnormalities, ovarian hyperstimulation syndrome, schizophrenia, Dias-Logan syndrome, premature ovarian failure, dystonia, dopa-responsive, due to sepiapterin reductase deficiency, Beck-Fahmer syndrome, chromosome 2pl2-pl l.2 deletion syndrome, neuronopathy, spastic paraplegia, familial adult myoclonic, colorectal cancer, hypothyroidism, Culler-Jones syndrome, holoprosencephaly, myelokathexis, WHIM syndrome, Mowat-Wilson syndrome, mental retardation, an intellectual developmental disorder, autism spectrum disorder, epilepsy, epileptic encephalopathy, Dravet syndrome, migraines, a mental retardation disorder (e.g., a disorder caused by a SETD5 gene mutation, e.g., intellectual disability-facial dysmorphism syndrome, autism spectrum disorder), a disorder caused by a GATA2 mutation (e.g., GATA2 deficiency; GATA2 haploinsufficiency; Emberger syndrome; monocytopenia and mycobacterium avium complex/dendritic cell, monocyte, B and NK lymphocyte deficiency; familial myelodysplastic syndrome; acute myeloid leukemia; chronic myelomonocytic leukemia), and febrile seizures.

In certain embodiments, the disease, disorder, or condition is an autosomal recessive disease, e.g., with residual function. In certain embodiments, the compound of Formula (I) or (II), or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat an autosomal recessive disease, disorder, or condition. An autosomal recessive disease with residual function may refer to a monogenic disease with either homozygous recessive or compound heterozygous heritability. These diseases may also be characterized by insufficient gene product activity (e.g., a level of gene product greater than 0%). In an embodiment, a compound of Formula (I) or (II) may increase the expression of a target (e.g., a gene) related to an autosomal recessive disease with residual function. Exemplary autosomal recessive diseases with residual function include Friedreich's ataxia, Stargardt disease, Usher syndrome, chlorioderma, fragile X syndrome, achromatopsia 3, Hurler syndrome, hemophilia B, alpha- 1 -antitrypsin deficiency, Gaucher disease, X-linked retinoschisis, Wiskott-Aldrich syndrome, mucopolysaccharidosis (Sanfilippo B), DDC deficiency, epidermolysis bullosa dystrophica, Fabry disease, metachromatic leukodystrophy, and odontochondrodysplasia.

In certain embodiments, the disease, disorder, or condition is an autosomal dominant disease. In certain embodiments, the compound of Formula (I) or (II), or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat an autosomal dominant disease, disorder, or condition. An autosomal dominant disease may refer to a monogenic disease in which the mutated gene is a dominant gene. These diseases may also be characterized by insufficient gene product activity (e.g., a level of gene product greater than 0%). In an embodiment, a compound of Formula (I) or (II) may increase the expression of a target (e.g., a gene) related to an autosomal dominant disease. Exemplary autosomal dominant diseases include Huntington's disease, achondroplasia, antithrombin III deficiency, Gilbert's disease, Ehlers-Danlos syndrome, hereditary hemorrhagic telangiectasia, intestinal polyposis, hereditary elliptosis, hereditary spherocytosis, marble bone disease, Marfan's syndrome, protein C deficiency, Treacher Collins syndrome, Von Willebrand's disease, tuberous sclerosis, osteogenesis imperfecta, polycystic kidney disease, neurofibromatosis, and idiopathic hypoparathyroidism.

In certain embodiments, the disease, disorder, or condition is a paralogue activation disorder. In certain embodiments, the compound of Formula (I) or (II), or a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof, is used to prevent or treat a paralogue activation disease, disorder, or condition. A paralogue activation disorder may comprise a homozygous mutation of genetic locus leading to loss-of-function for the gene product. In these disorders, there may exist a separate genetic locus encoding a protein with overlapping function (e.g. developmental paralogue), which is otherwise not expressed sufficiently to compensate for the mutated gene. In an embodiment, a compound of Formula (I) or (II) activates a gene connected with a paralogue activation disorder (e.g., a paralogue gene).

The cell described herein may be an abnormal cell. The cell may be in vitro or in vivo. In certain embodiments, the cell is a proliferative cell. In certain embodiments, the cell is a cancer cell. In certain embodiments, the cell is a non-proliferative cell. In certain embodiments, the cell is a blood cell. In certain embodiments, the cell is a lymphocyte. In certain embodiments, the cell is a benign neoplastic cell. In certain embodiments, the cell is an endothelial cell. In certain embodiments, the cell is an immune cell. In certain embodiments, the cell is a neuronal cell. In certain embodiments, the cell is a glial cell. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell is a fibroblast. In certain embodiment, the cell is a primary cell, e.g., a cell isolated from a subject (e.g., a human subject).

In some embodiments, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has improved cell permeability over a reference compound, e.g., in a standard assay for measuring cell permeability. Cell permeability may be investigated, for example, using a standard assay run in either Madin-Darby Canine Kidney (MDCK) cells expressing Breast Cancer Resistance Protein (BCRP) or subclone MDCKII cells expressing Multidrug Resistance Protein 1 (MDR1); see, e.g., Drug Metabolism and Disposition 36, 268-275 (2008) and Journal of Pharmaceutical Sciences 107 2225-2235 (2018). In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell permeability measurement (Papp) of < 2x 10 ^-6 cm s ^-1 . In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell permeability measurement (Papp) of between 2-6X10 ^-6 cm s ^-1 . In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell permeability measurement (Papp) of Papp greater than 6X10 ^-6 cm s ^-1 . In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell permeability greater than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%. 85%, 90%, 95%, 99% or more, e.g., compared with a reference compound.

In some embodiments, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, exhibits decreased cell efflux, e.g., over a reference compound, e.g., in a standard assay for measuring cell efflux. cell efflux may be investigated, for example, using a standard assay run in either Madin-Darby Canine Kidney (MDCK) cells expressing Breast Cancer Resistance Protein (BCRP) or subclone MDCKII cells expressing Multidrug Resistance Protein 1 (MDR1); see, e.g., Drug Metabolism and Disposition 36, 268-275 (2008) and Journal of Pharmaceutical Sciences 107 2225-2235 (2018). In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell efflux ratio of less than 1.5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell efflux ratio of between 1.5 and 5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell efflux ratio greater than 5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a cell efflux ratio less than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%. 85%, 90%, 95%, 99% or more, e.g., compared with a reference compound. In some embodiments, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, modulates the expression of a target protein (e.g., HTT or MYB) in a reference cell or sample. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, increases the expression of a target protein (e.g., HTT or MYB) in a reference cell or sample. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, decreases the expression of a target protein (e.g., HTT or MYB) in a reference cell or sample. The effect of an exemplary compound of Formula (I) or (II) on protein abundance may be measured using a standard assay for measuring protein abundance, such as the HiBit-assay system (Promega). In this assay, percent response for each respective cell line may be as calculated at each compound concentration as follows: % response = 100 * (S - PC) / (NC - PC). For the normalized response at each concentration, a four-parameter logistical regression may be fit to the data and the response may be interpolated at the 50% value to determine a concentration for protein abundance at 50% (IC ₅₀ ) an untreated control. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a protein abundance response less than 100 nM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a protein abundance response between 100-1000 nM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a protein abundance response greater than 1000 nM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a protein abundance response greater than 10 uM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, modulates the protein abundance of a target protein by about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%. 85%, 90%, 95%, 99% or more, e.g., compared with a reference compound.

In some embodiments, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, modulates the viability of a target cell in a subject or sample. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, increases the viability of a target cell in a subject or sample. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, decreases the viability of a target cell in a subject or sample. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, does not impact the viability of a cell (e.g., is non-toxic) in a subject or sample. The effect an exemplary compound of Formula (I) or (II) on cell viability may be measured using a standard assay for measuring cell toxicity, such as the cell Titer Gio 2.0 assay in either K562 (human chronic myelogenous leukemia) or SH-SY5Y (human neuroblastoma) cells. The concentration at which cell viability is measured may be based on the particular assay used. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, is tolerated by a target cell at a concentration of less than 100 nM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, is tolerated by a target cell at a concentration of between 100-1000 nM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, is tolerated by a target cell at a concentration of greater than 1000 nM. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, is tolerated by a target cell at a concentration of greater than 10 uM.

In some embodiments, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has improved brain permeability over a reference compound, e.g., in a standard assay for measuring brain permeability. Brain permeability may be measured, for example, by determining the unbound partition coefficient (Kpuu), brain. In such an assay, the unbound brain partition coefficient (K _{p,uu, brain} ) may be defined as the ratio of unbound brain-free compound concentration to unbound plasma concentration. It is calculated using the following equation:

C _brain and C _plasma represent the total concentrations in brain and plasma, respectively. In this assay, the f _{u, brain} and f _{u, plasma} may be the unbound fraction of the compound in brain and plasma, respectively. Both f _{u, brain} and f _{u, plasma} may be determined in vitro via equilibrium dialysis. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kp value of greater than 5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kp value between 1 and 5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kp value between 0.2-1. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kp value of less than 0.2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kpuu value of greater than 2.5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kpuu value between 0.5-2.5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kpuu value between 0.1-0.5. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a Kpuu value of less than 0.1. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a brain permeability greater than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%. 85%, 90%, 95%, 99% or more, e.g., compared with a reference compound.

In some embodiments, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, exhibits selectivity for one target nucleic acid sequence, e.g., pre-mRNA transcript sequence or bulge, compared to another target nucleic acid sequence, e.g., pre-mRNA transcript sequence or bulge. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, exhibits selectivity for HTT, e.g., an HTT-related nucleic acid sequence. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, exhibits selectivity for SMN2, e.g., an SMN2-related nucleic acid sequence. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, exhibits selectivity for Target C, e.g., a Target C-related nucleic acid sequence. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, exhibits selectivity for MYB, e.g., a MYB-related nucleic acid sequence. Selectivity for one target nucleic acid sequence over another may be measured using any number of methods known in the art. In an embodiment, selectivity may be measured by determining the ratio of derived qPCR values (e.g., as described herein) for one target nucleic acid sequence over another. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for one target nucleic acid sequence over another. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1,

1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for HTT over another target nucleic acid sequence. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1,

1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for SMN2 over another. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for MYB over another target nucleic acid sequence. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for Target C sequence over another. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for HTT over MYB. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for MYB over HTT. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1,

1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for HTT over SMN2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for SMN2 over HTT. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for SMN2 over MYB. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a ratio of greater than 1.1, 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 selectivity for MYB over SMN2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 3 -fold greater selectivity for HTT over MYB. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 3-fold greater selectivity for MYB over HTT. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 10-fold greater selectivity for HTT over MYB. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 10-fold greater selectivity for MYB over HTT. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 3-fold greater selectivity for HTT over SMN2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 3 -fold greater selectivity for SMN2 over HTT. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 10-fold greater selectivity for HTT over SMN2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 10-fold greater selectivity for SMN2 over HTT. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 3-fold greater selectivity for MYB over SMN2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 3-fold greater selectivity for SMN2 over MYB. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 10-fold greater selectivity for MYB over SMN2. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a 10-fold greater selectivity for SMN2 over MYB. In an embodiment, a compound of Formula (I) or (II) or a pharmaceutically acceptable salt thereof, e.g., as described herein, has a selectivity for one target nucleic acid sequence that is greater than 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%. 85%, 90%, 95%, 99% or more, e.g., compared with a second nucleic acid sequence.

In certain embodiments, the methods described herein comprise the additional step of administering one or more additional pharmaceutical agents in combination with the compound of Formula (I) or (II), a pharmaceutically acceptable salt thereof, or compositions comprising such compound or pharmaceutically acceptable salt thereof. Such additional pharmaceutical agents include, but are not limited to, anti -proliferative agents, anti-cancer agents, anti-diabetic agents, anti-inflammatory agents, immunosuppressant agents, and a pain-relieving agent. The additional pharmaceutical agent(s) may synergistically augment the modulation of splicing induced by the inventive compounds or compositions of this disclosure in the biological sample or subject. Thus, the combination of the inventive compounds or compositions and the additional pharmaceutical agent(s) may be useful in treating, for example, a cancer or other disease, disorder, or condition resistant to a treatment using the additional pharmaceutical agent(s) without the inventive compounds or compositions.

EXAMPLES

In order that the invention described herein may be more fully understood, the following examples are set forth. The examples described in this application are offered to illustrate the compounds, pharmaceutical compositions, and methods provided herein and are not to be construed in any way as limiting their scope.

The compounds provided herein can be prepared from readily available starting materials using modifications to the specific synthesis protocols set forth below that would be well known to those of skill in the art. It will be appreciated that where typical or preferred process conditions (i.e., reaction temperatures, times, mole ratios of reactants, solvents, pressures, etc.) are given, other process conditions can also be used unless otherwise stated. Optimum reaction conditions may vary with the particular reactants or solvents used, but such conditions can be determined by those skilled in the art by routine optimization procedures.

Additionally, as will be apparent to those skilled in the art, conventional protecting groups may be necessary to prevent certain functional groups from undergoing undesired reactions. The choice of a suitable protecting group for a particular functional group as well as suitable conditions for protection and deprotection are well known in the art. For example, numerous protecting groups, and their introduction and removal, are described in Greene et al.. Protecting Groups in Organic Synthesis, Second Edition, Wiley, New York, 1991, and references cited therein.

Reactions can be purified or analyzed according to any suitable method known in the art. For example, product formation can be monitored by spectroscopic means, such as nuclear magnetic resonance (NMR) spectroscopy (e.g., ³ H or ¹³ C), infrared (IR) spectroscopy, spectrophotometry (e.g., UV-visible), mass spectrometry (MS), or by chromatographic methods such as high performance liquid chromatography (HPLC) or thin layer chromatography (TLC).

Proton NMR: ³ H NMR spectra were recorded in CDCl ₃ solution in 5-mm o.d. tubes (Wildmad) at 24 °C and were collected on a BRUKER AVANCE NEO 400 at 400 MHz for ¹ H. The chemical shifts (4) are reported relative to tetramethylsilane (TMS = 0.00 ppm) and expressed in ppm.

LC/MS: Liquid chromatography-mass spectrometry (I-C/MS) was performed on Shimadzu-2020EV using column: Shim-pack XR-ODS (C18, 04.6 x 50 mm, 3 μm, 120 A, 40 °C) operating in ESI(+) ionization mode; flow rate = 1.2 Ml/min. Mobile phase = 0.05% TFA in water or CH ₃ CN; or on Shimadzu-2020EV using column : Poroshell HPH-C18 (C18, 04.6 x 50 mm, 3 μm, 120 A, 40 °C) operating in ESI(+) ionization mode; flow rate = 1.2 Ml/min. Mobile phase A: Water/5Mm NH4HCO ₃ , Mobile phase B: CH ₃ CN.)

Analytical chiral HPLC: Analytical chiral HPLC was performed on a Agilent 1260 using column: CHIRALPAK IG-3, CHIRALPAK IC-3 or CHIRALPAK OJ-3, with flow rate = 1.2 Ml/min. Mobile phase = MTBE(DEA):EtOH=50:50).

Analytical chiral HPLC: Analytical chiral HPLC was performed on a Agilent 1260 using column: CHIRALPAK IG-3, CHIRALPAK IC-3 or CHIRALPAK OJ-3, with flow rate = 1.2 Ml/min. Mobile phase = MTBE(DEA):EtOH=50:50).

Preparative HPLC purification: prep-HPLC purification was performed using one of the following HPLC conditions:

Condition 1 : Shimadzu, Column: Xbridge Prep OBD C18 Column, 30A — 150mm 5μm; Mobile Phase A: water (10 mmol/L NH4HCO ₃ ) Mobile Phase B: acetonitrile; Flow rate:60 Ml/min; Gradient 1 : 3 B to 3 B in 2 min; Gradient 2: 5% B to 35% B in 6 min; Gradient 3 : 3 B to 33 B in 6 min; Gradient 4: 5% B up to 45% in 6 min; Gradient 5: 3% B to 23% B in 6 min; Gradient 6: 10% B to 60% B in 8 min; Gradient 7: 5 B to 45 B in 10 min; Gradient 8: 10% B up to 47% B in 10 min; Gradient 9: 10% B up to 50% B in 8 min; Gradient 9: 5% B to 35% B in 8 min; Gradient 10: 10% B to 48% B in 10 min; Gradient 11 : 20% B to 52% B in 8 min; Gradient 12: 20% B to 50% B in 6 min; Gradient 13: 20% B to 43% B in 8 min; Gradient 14: 15% B to 45% B in 8 min; Gradient 14: 10% B to 55% B in 8 min; Gradient 15: 5% B to 38% B in 10 min; Gradient 16: 10% B to 35% B in 8 min; Gradient 17: 5% B to 42% B in 8 min; Gradient 18: 5% B to 30 %B in 8 min; Gradient 18: 5% B to 40% B in 8 min; Gradient 19: 5% B to 45% B in 8 min; Gradient 21 : 5% B to 37% B in 8 min; Gradient 22: 5% B to 65% B in 8 min; Gradient 23 : 10% B to 65%B in 8 min; Gradient 24: 5% B to 50% B in 8 min.

Condition 2: Column: Xselect CSH OBD Column 30* 150mm 5 μm, n; Mobile Phase A: water (10mmol/L NH4HCO ₃ ); Mobile Phase B: acetonitrile; Flow rate: 60 Ml/min; Gradient 1 : 10 B to 55 B in 8 min; Gradient 2: 5 B to 50 B in 8 min; Gradient 3: 10 B to 60 B in 10 min; Gradient 4: 10 B to 40 B in 8 min; Gradient 5: 5 B to 65 B in 8 min; Gradient 6: 3% B to 63% B in 6 min; Gradient 7: 10% B to 52% B in 8 min; Gradient 8: 5% B to 37% B in 8 min; Gradient 9: 10% B to 38% B in 8 min; Gradient 10: 3% B to 75% B in 8 min; Gradient 11 : 10% B to 42% B in 8 min; Gradient 12: 15% B to 40% B in 10 min; Gradient 13: 10% B to 60% B in 8 min; Gradient 14: 5% B to 35% B in 8 min; Gradient 15: 15% B to 36% B in 8 min.

Condition 3: Column: EP-C18M 10 μm 120A; Mobile Phase A: water (Immol/L HCl); Mobile Phase B: acetonitrile; Flow rate: 100 Ml/min; Gradient: 40% B to 70% B in 35 min.

Condition 4: Column: Poroshell HPH-C18, 3.0*50 mm,2.7um; Mobile Phase A: water (5 Mm NH4HCO ₃ ); Mobile Phase B: acetonitrile; Flow rate: 1.2 Ml/min; Gradient 1 : 10% B to 95% B in 1.2 min, hold 0.5 min.

Condition 5: Column: X Select CSH OBD 30 x 150 mm 5 μm; Mobile phase A: water (0.1% formic acid); Mobile phase B: acetonitrile; Gradient 1 : 3% phase B up to 18% in 6 min.

Condition 6: Column: X Select CSH OBD 30 x 150 mm 5 μm; Mobile phase A: water (0.05% HCl); Mobile phase B: acetonitrile; Flow rate: 60 Ml/min; Gradient 1 : 3% phase B up to 3% in 2 min; Gradient 2: 3% B to 18% B in 8 min.

Condition 7: Column: X Select CSH OBD 30 x 150 mm 5 μm; Mobile phase A: water (0.05% formic acid); Mobile phase B: acetonitrile; Flow rate: 60 Ml/min; Gradient 1 : 3% phase B up to 20% in 8 min.

Condition 8: Column: YMC-Actus Triart C18, 30 mm x 150 mm, 5 μm; Mobile phase A: water (0.05% HCl); Mobile phase B: acetonitrile; Gradient 1 : 5% B to 35% B in 8 min.

Condition 9: Column: YMC-Actus Triart Cl 8, 30 mm x 150 mm, 5 μm; Mobile phase A: water (10 mmol/L NH4HCO ₃ ); Mobile phase B: acetonitrile; Flow rate: 60 Ml/min Gradient 1 : 10% B to 70% B in 8 min; Gradient 2: 15% B to 55% B in 8 min; Gradient 3: 5% B to 65% B in 8 min; Gradient 4: 5% B to 45% B in 8 min; Gradient 5: 15% B to 45% B in 10 min; Gradient 6: 15% B to 70% B in 8 min; Gradient 7: 5% B to 50% B in 8 min; Gradient 8: 15% B to 50% B in 8 min; Gradient 9: 20% B to 44% B in 10 min.

Condition 10: XBridge Prep OBD Column 19 x 150mm 8 μm; Mobile Phase A: Water (0.05% NH3 H ₂ O), Mobile Phase B: ACN; Flow rate: 20 mL/min; Gradient 1 : 20% B to 50% B in 8 min; Gradient 2: 25% B to 55% B in 8 min; Gradient 3: 35% B to 65% B in 14 min; Gradient 4: 10% B to 45% B in 12 min; Gradient 5: 24% B to 54% B in 8 min; Gradient 6: 45% B to 65% B in 14 min; Gradient 7: 55% B to 82% B in 9 min; Gradient 8: 20% B to 50% B in 7 min; Gradient 9: 56% B to 76% B in 8 min; Gradient 10: 24% B to 47% B in 8 min; Gradient 11 : 30% B to 60% B in 8 min; Gradient 12: 15% B to 45% B in 8 min; Gradient 13: 20% B to 45% B in 8 min; Gradient 14: 50% B to 70 % B in 12 min; Gradient 15: 50% B to 80 % B in 8 min; Gradient 16: 40% B to 75% B in 7 min.

Condition 11 : Column: YMC-Actus Triart C18 ExRS, 30 x 250 mm, 5μm; Mobile Phase A: Water (10 mmol/L NH4HCO ₃ + 0.1%NH3.H ₂ O); Mobile Phase B: Acetonitrile; Flow rate: 35 mL/min; Gradient 1 : 33% B to 74% B in 7 min

Condition 12: Column: Welch Ultimate XB-C18, 50 x 250mm, 10 μm; Mobile Phase A: Water (0.1% NH3.H ₂ O), Mobile Phase B: Acetonitrile; Gradient 1 : 5% B to 45% B in 10 min; Gradient 2: 5% B to 35% B in 10 min; Gradient 3: 10% B to 55% B in 10 min;

Condition 13: SunFire Prep Column 19 x 150 mm, 10 μm, Mobile Phase A: Water (0.05% NH4OH), Mobile Phase B: Acetonitrile, Gradient 1 : 30% B to 50% B in 7 min;

Condition 14: SunFire Prep Column 19 x 150 mm, 10 μm, Mobile Phase A: Water (0.05% TFA), Mobile Phase B: Acetonitrile, Gradient 1 : 21% B to 35% B in 14 min; Gradient 2: 10% B to 20% B in 7 min

Condition 15: Welch Ultimate XB-C18, 50 x 250mm, 10 μm; Mobile Phase A: Water (0.1% TFA), Mobile Phase B: Acetonitrile; Gradient 1 : 10% B to 50% B in 12 min; Gradient 2: 30% B to 60% B in 10 min; Gradient 3: 10% B to 45% B in 12 min; Gradient 4: 35% B to 70% B in 10 min;

Condition 16: Welch Ultimate XB-C18, 50 x 250mm, 10 μm; Mobile Phase A: Water (0.1% NaHCCh), Mobile Phase B: Acetonitrile; Gradient 1 : 35% B to 75% B in 10 min.

Condition 17: Column: Xselect C18, 19 x 150 mm, 5 μm; Mobile Phase A: 0.1%TFA, Mobile Phase B: Acetonitrile; Flow rate: 20 mL/min; Gradient 1 : 5% B to 40% B in 7min.

Condition 18: Column, C18 silica gel, XBridge, 19x150mm; Mobile Phase A: Water (0.05% HCl), Mobile Phase B: Acetonitrile, Gradient 1 : 20% B to 30% B in 14 min

Preparative chiral HPLC: purification by chiral HPLC was performed on a Gilson-GX 281 using column: CHIRALPAK IG-3, CHIRALPAK IC-3 or CHIRALPAK OJ-3.

Condition 1 : Column: CHIRALPAK IG, 3 x 25 cm, 5 μm; Mobile Phase A: MTBE (0.1%DEA), Mobile Phase B: ethanol; Flow rate:20 Ml/min; Gradient 1 : 50 B to 50 B in 18 min. Condition 2: Column: CHIRAL ART cell ulose-SC, 3 x 25 cm, 5 μm; Mobile Phase A: MTBE(0.1% DEA)-HPLC, Mobile Phase B: MeOH-HPLC; Flow rate: 35 mL/min; Gradient 1: to 30% B isocratic in 22 min, Gradient 2: 50% B isocratic in 36 min.

Condition 3: Column: CHIRAL ART cell ulose-SC, 3 x 25 cm, 5 μm; Mobile Phase A: HEX: DCM=3: 1(0.2% DEA), Mobile Phase B: Ethanol; Flow rate: 35 mL/min; Gradient 1: 50% B to 50% B in 22 min;

Condition 4: Column: CHIRALPAK IH, 3 x 25 cm, 5 μm; Mobile Phase A: MTBE(2mM NH3-MEOH), Mobile Phase B: IPA: DCM=1:1 ; Flow rate: 35 mL/min; Gradient 1: 25% B to 25% B in 12 min

Condition 5: Column, CHIRAL ART cell ulose-SC, 3 x 25 cm, 5 μm; Mobile Phase A: MTBE (0.5% 2MNH ₃ -MeOH), Mobile Phase B: IPA: ACN=2: 1; Flow rate: 35 mL/min; Gradient 1: 30% B isocratic

Condition 6: Column: CHIRAL ART cell ulose-SB, 3 x 25 cm, 5 μm; Mobile Phase A: Hex(0.2% IP Amine), Mobile Phase B: EtOH: DCM=1: 1; Flow rate: 35 mL/min; Gradient 1: 20% B isocratic

Condition 7: Column: CHIRALPAK IA, 2*25 cm, 5 μm; Mobile Phase A: Hex: DCM=5: 1, Mobile Phase B: EtOH(0.1% 2M NH ₃ -MeOH); Flow rate: 25 mL/min; Gradient 1 : 45% B isocratic in 18 min;

Condition 8: Column: CHIRALPAK IF, 3 x 25 cm, 5 μm; Mobile Phase A: HEX: DCM=3: 1-HPLC, Mobile Phase B: EtOH(0.1% DEA)— HPLC; Flow rate: 35 mL/min; Gradient 1 : 50% B isocratic in 40 min

Condition 9: Column: CHIRALPAK IC, 2 x 25 cm, 5 μm; Mobile Phase A: Hex: DCM=1: 1-HPLC, Mobile Phase B: EtOH(0.1% DEA)— HPLC; Flow rate: 23 mL/min; Gradient 1 : 50% B isocratic in 90 min.

Condition 10: Column: CHIRAL ART cell ulose-SZ, 3 x 25 cm, 5 μm; Mobile Phase A: Hex: DCM=1: 1-HPLC, Mobile Phase B: EtOH (0.1% DEA)-HPLC; Flow rate: 30 mL/min; Gradient 1: 50% B isocratic in 12 min.

Condition 11 : Column: CHIRAL ART Amylose-C NEO, 3 x 25 cm, 5 μm; Mobile Phase A: EtOH(0.5% 2M NH3-MeOH)-HPLC, Mobile Phase B: EtOH(0.5% 2M NH3-MeOH)— HPLC; Flow rate: 28 mL/min; Gradient 1: 50% B isocratic in 15 min. Condition 12: Column: CHIRALPAK IG, 3 x 25 cm, 5 μm; Mobile Phase A: HEX: DCM=3: 1-HPLC, Mobile Phase B: EtOH(0.5% 2M NH3-MeOH)--HPLC; Flow rate: 30 mL/min; Gradient 1 : 50% B isocratic in 16 min.

Reverse flash chromatography: purification by reverse flash chromatography was performed using one of the following conditions:

Condition 1 : Column, C18; Mobile phase: MeOH in water; Gradient 1, 10% to 50% in 1 0 min; Detector, UV 254 nm.

Condition 2: Column, silica gel; Mobile phase: MeOH in water; Gradient 1 : 10% to 50% in 10 min; Detector, UV 254 nm.

Condition 3: Column, C18 silica gel; mobile phase A: Water (0.1% NH3H ₂ O), Mobile Phase B: ACN; Gradient 1 : 30% B to 80% B gradient in 12 min; Gradient 2: 20% B to 60% B in 12 min; Gradient 3: 10% B to 80% B in 15 min; Gradient 4: 5% B to 40% B in 12 min; Gradient 5: 20% B to 50% B in 12 min; Gradient 6: 30% B to 60% B in 10 min; Gradient 7: 20% B to 50% B in 7 min; Gradient 8: 20% B to 70% B in 12 min; Gradient 9: 10% B to 100% B in 15 min; Gradient 10: 5% B to 35% B in 10 min.

Condition 4: Column: ACE 5AQ, 21.2 x 150 mm, 5 μm; Mobile Phase A: Water (0.1% TFA), Mobile Phase B: Acetonitrile/Methanol (1 : 1); Flow rate: 20 mL/min; Gradient: 5% B to 40% B in 8 min

Condition 5: Column: C18 silica gel; Mobile Phase A: Water (0.1% FA), Mobile Phase B: Acetonitrile. Gradient 1 : 30% B to 70% B in 12 min; Gradient 2: 30% B to 80% B in 12 min; Gradient 3: 20% B to 60% B in 10 min; Gradient 4: 24% B to 40% B in 7 min; Gradient 5: 40% B to 80% B in 10 min; Gradient 6: 10% B to 50% B in 10 min; Gradient 7: 5% B to 35% B in 10 min.

Condition 6: Column: C18 silica gel; Mobile Phase A: Water (0.1% TFA), Mobile Phase B: Acetonitrile; Gradient 1 : 20% B to 50% B in 10 min; Gradient 2: 10% B to 35% B in 10 min; Gradient 3: 20% B to 70% B in 12 min.

Condition 7: Column: Cl 8 silica gel; Mobile Phase A: Water (0.5% NH3) Mobile Phase B: Acetonitrile; Gradient 1 : 40% B to 70% B in 10 min; Gradient 2: 30% B to 50% B in 12 min; Gradient 3: 30% B to 60% B in 12 min;

Condition 8: Column: C18 silica gel, XBridge, 19x150mm; Mobile Phase A: Water (0.05% NH3.H ₂ O), Mobile Phase B: Acetonitrile, Gradient 1 : 20% B to 50% B in 7 min; Condition 9: Column: C18 silica gel, XBridge, 19x150mm; Mobile Phase A: Water (0.05% TFA), Mobile Phase B: Acetonitrile, Gradient 1 : 20% B to 50% B in 7 min.

Condition 10: Column: C18 silica gel; Mobile Phase A: Water (10 mmol/L NH4HCO ₃ ), Mobile Phase B: Acetonitrile; Graident 1 : 10% B to 50% B in 10 min.

Thin Layer chromatography: purification by thin layer chromatography was performed using one of the following conditions:

Condition 1 : Column: YMC-Actus Triart C18 ExRS, 30 x 250 mm, 5μm; Mobile Phase A: Water (10 mmol/L NH4HCO ₃ +0.1%NH3.H ₂ O), Mobile Phase B: Acetonitrile; Flow rate: 35 mL/min; Gradient 1 : 15% B to 70% B in 8 min; Gradient 2: 16% B to 64% B in 8 min General Synthetic Schemes

Compounds of the present disclosure may be prepared using a synthetic protocol illustrated in one of Schemes A, B, or C.

General Synthetic Schemes

Compounds of the present disclosure may be prepared using a synthetic protocol illustrated in one of Schemes A, B, or C.

Scheme A:

Scheme A. An exemplary method of preparing a compound of Formula (I); wherein A, B, W, X, Y, Z, R ² , and m are as defined herein; and LG ¹ , LG ² , and LG ³ are each independently a leaving group (e.g., halo, -B(OR ¹² )2). In some embodiments of the application, y is 0.

An exemplary method of preparing a compound described herein, e.g., a compound of Formula (II-I) is provided in Scheme A. In Step 1, B-2 is prepared by treating B-l with a mixture of 2,2,6,6-tetramethylpiperidine, isopropylmagnesium chloride (iPrMgCl), lithium chloride (LiC1), iodine (I ₂ ), and zinc chloride (ZnCI ₂ ) in tetrahydrofuran (THF), or with a similar combination of reagents or solvent. In Step 2, B-3 is prepared by incubating B2 with 1,1'- bis(diphenylphosphino)ferrocene)palladium(II) dichloride (Pd(dppf)Cl ₂ ), carbon monoxide (CO), and triethylamine (TEA), in a mixture of methanol (MeOH) and dichloromethane (CH ₂ CI ₂ ) or a similar mixture of solvents. Alternative catalysts to Pd(dppf)Cl ₂ may also be used, such as a suitable palladium catalyst, and/or using alternative reagents sufficient to provide B-3. In Step 3, B-5 is prepared by incubating B-3 with B-4 in the presence of RuPhos-Pd(II) (e.g., RuPhos-Pd(II)-G2 or RuPhos-Pd(II)-G3), and cesium carbonate (Cs ₂ CO ₃ ) or a similar reagent. Step 3 may also be carried out using an alternative catalyst to RuPhos-Pd(II), such as another ruthenium catalyst. The reaction may be conducted in dioxane or a similar solvent, at 100 °C or a temperature sufficient to provide B-5. B-5 is then converted to B-6 by treatment with a mixture of ammonia and methanol, at 100 °C or a temperature sufficient to provide B-6.

B-6 and B-7 are coupled to provide a compound of Formula (II-I) in Step 5. This coupling reaction may be conducted in the presence of tris(dibenzylideneacetone)dipalladium(0) (Pd ₂ (dba) ₃ , XantPhos, and cesium carbonate or a suitable alternative. Step 5 may also be carried out using an alternative catalyst to Pd2(dba)3, such as another palladium catalyst, and/or an alternative ligand to XantPhos (e.g., a different phosphine ligand). The reaction may be conducted in dioxane or a similar solvent, at 100 °C or a temperature sufficient to provide the compound of Formula (II-I). Each starting material and/or intermediate in Scheme B may be protected and deprotected using standard protecting group methods. In addition, purification and characterization of each intermediate as well as the final compound of Formula (II) may be afforded by any accepted procedure.

Scheme B. An exemplary method of preparing a compound of Formula (I); wherein A is as defined herein.

Scheme C. An exemplary method of preparing a compound of Formula (I); wherein B is as defined herein.

Exemplary protocols for the synthesis of compounds in Tables 1 and 2, e.g., Compounds 1-287, can be found in Examples 1-41 in WO 2021/174165, which is incorporated herein by reference in its entirety.

Example 42: Synthesis of Compound 303

Synthesis of Intermediate Cl

Methyl 2-amino-4-bromo-5-fluorobenzoate (100.0 mg, 0.403 mmol, 1.0 equiv), methanol (1 mL), water (1 mL), 1,1-dioxo-l-sulfonylidenedisilver (201.1 mg, 0.645 mmol, 1.6 equiv), iodine (163.7 mg, 0.645 mmol, 1.6 equiv) and tetrahydrofuran (1 mL) were combined at 25 °C. The resulting mixture was stirred for 5 h at 25 °C, then diluted with water (20 mL) and extracted with ethyl acetate (2x20 mL). The organic layers were combined, dried by NA ₂ SO ₄ , filtered and the filtrate concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (5: 1) to afford methyl 2-amino-4-bromo-5- fluoro-3 -iodobenzoate (70 mg, 45.5%) as a solid. LCMS (ES, m/z): 373 [M+H] ⁺ . Synthesis of Intermediate C2

To a mixture of methyl 2-amino-4-bromo-5-fluoro-3 -iodobenzoate (2.8 g, 7.488 mmol, 1.0 equiv) and methylboronic acid (2.6 g, 44.928 mmol, 6.0 equiv) in DME (40 mL) and H ₂ O (10 mL) was added K ₂ CO ₃ (2.07 g, 14.976 mmol, 2.0 equiv) and Pd(PPh ₃ ) ₂ Cl ₂ (0.5 g, 0.749 mmol, 0.1 equiv). The reaction mixture was stirred for 6 h at 80 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (5: 1) to afford methyl 2-amino-4-bromo-5-fluoro- 3 -methylbenzoate (1.2 g, 46%) as a solid. LCMS (ES, m z) : 262 [M+H] ⁺ .

Synthesis of Intermediate C3

Methyl 2-amino-4-bromo-5-fluoro-3-methylbenzoate (1.2 g, 4.579 mmol, 1.0 equiv) and AC2O (0.6 g, 5.953 mmol, 1.3 equiv) were combined at 25 °C. The resulting mixture was stirred for 1 h at 25 °C. To the reaction mixture was added potassium acetate (0.13 g, 1.374 mmol, 0.3 equiv) and isoamyl nitrite (1.1 g, 10.074 mmol, 2.2 equiv). The resulting mixture was stirred for an additional 2 h at 80 °C, then quenched with water (100 mL) at 25 °C and extracted with CH ₂ Cl ₂ (2x100 mL). The organic layers were combined, dried by Na ₂ SO ₄ , filtered, and the filtrate concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-bromo-5-fluoro-lH- indazole-7-carboxylate (0.18 g, 12%) as a solid. LCMS (ES, m 273 [M+H] ⁺ . Synthesis of Intermediate C4

Methyl 4-bromo-5-fluoro-lH-indazole-7-carboxylate (50.0 mg, 0.183 mmol, 1.0 equiv), ethyl acetate (2 mL), and boron trifluoride trimethyloxidanium fluoride (108.3 mg, 0.732 mmol, 4.0 equiv) were combined at room temperature. The resulting mixture was stirred for 16 h at room temperature, then quenched with water and extracted with ethyl acetate (2x5 mL). The organic layers were combined, dried by Na ₂ SO ₄ , filtered, and the filtrate concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-bromo-5-fluoro-2-methylindazole-7-carboxylate (51 mg, 87%) as a solid. LCMS (ES, m/z): 287 [M+H] ⁺ .

Synthesis of Intermediate C5

Methyl 4-bromo-5-fluoro-2-methylindazole-7-carboxylate (180.0 mg, 0.627 mmol, 1.0 equiv), CS ₂ CO ₃ (409.8 mg, 1.254 mmol, 2.0 equiv), tert-butyl piperazine- 1 -carboxylate (233.5 mg, 1.254 mmol, 2.0 equiv), XPhos (59.7 mg, 0.125 mmol, 0.2 equiv), Pd ₂ (dba) ₃ (57.4 mg, 0.063 mmol, 0.1 equiv) and dioxane (5 mL) were combined at room temperature. The resulting mixture was stirred for 3 h at 70°C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (12: 1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-5-fluoro-2- methylindazole-7-carboxylate (230 mg, 93%) as a solid. LCMS (ES, m z): 393 [M+H] ⁺ . Synthesis of Intermediate C6

Methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-5-fluoro- 2-methylindazole-7-carboxylate (230.0 mg, 0.586 mmol, 1.0 equiv), tetrahydrofuran (2 mL), water (2 mL) and LiOH (140.3 mg, 5.860 mmol, 10.0 equiv) were combined at room temperature. The resulting mixture was stirred for 3 h at 50°C, then diluted with water (30 mL), acidified to pH 5 with HCl (aq.), and extracted with ethyl acetate (2x50 mL). The organic layers were combined, dried by Na ₂ SO ₄ , filtered, and the filtrate concentrated under reduced pressure to afford 4-[4-(tert-butoxycarbonyl)piperazin-l- yl]-5-fluoro-2-methylindazole-7-carboxylic acid (150 mg, 62%) as a solid. LCMS (ES, m/z): 385 [M+H] ⁺ .

Synthesis of Intermediate C7

A mixture of 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-5-fluoro-2-methyli ndazole-7-carboxylic acid (70.0 mg, 0.185 mmol, 1.0 equiv), 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (39.7 mg, 0.240 mmol, 1.3 equiv), HATU (140.6 mg, 0.370 mmol, 2.0 equiv), DMF (3 mL), and DIEA (95.6 mg, 0.740 mmol, 4.0 equiv) was stirred for 2 h at room temperature, then diluted with water (10 mL) at room temperature and extracted with ethyl acetate (2x10 mL). The organic layers were combined, dried over Na ₂ SO ₄ , filtered, and the filtrate concentrated under reduced pressure to afford tert-butyl 4-[5-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (75 mg, 71%) as a solid. LCMS (ES, m/z): 526 [M+H] ⁺ .

Synthesis of Compound 303

A mixture of tert-butyl 4-[5-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (70.0 mg, 0.133 mmol, 1.0 equiv), DCM (1 mL), and TFA (1 mL) was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 1, Gradient 1) to afford 5-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-m ethyl-4- (piperazin-l-yl)indazole- 7-carboxamide (32.1 mg, 56.37%) as a solid. LCMS (ES, m/z): 426 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-t/ ₆ ) 5 11.11 (m, 1H), 9.37 (d, J= 1.6 Hz, 1H), 8.91 (s, 3H), 8.07 (d, J= 2.6 Hz, 1H), 7.86 (d, J= 14.1 Hz, 1H), 7.67 (d, J= 12.1 Hz, 1H), 4.34 (s, 3H), 3.68 (d, J= 5.1 Hz, 4H), 3.32 (s, 4H), 2.42 (s, 3H)

Example 43: Synthesis of Compound 290

Synthesis of Intermediate C8

To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (2.0 g, 7.841 mmol, 1.0 equiv) and K ₂ CO ₃ (1625.4 mg, 11.761 mmol, 1.5 equiv) in DMF (20 mL) was added 2- iodopropane (2.0 g, 11.761 mmol, 1.5 equiv) dropwise at room temperature. The resulting mixture was stirred for 16 h at 80 °C, then cooled to room temperature, diluted with water (60 mL), and extracted with ethyl acetate (2 x 50 mL). The organic layers were combined, washed with water (1x100 mL) and brine (1x100 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (3 : 1) to afford methyl 4- bromo-2-isopropylindazole-7-carboxylate (450 mg, 19.31%) as an oil. LCMS (ES, m/z): 297 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 8.66 (s, 1H), 7.83 (d, J= 7.6 Hz, 1H), 7.41 (d, J= 7.6 Hz, 1H), 4.93 (p, J= 6.7 Hz, 1H), 3.89 (s, 3H), 1.59 (d, J= 6.7 Hz, 6H).

Synthesis of Intermediate C9

To a mixture of methyl 4-bromo-2-isopropylindazole-7-carboxylate (200.0 mg, 0.673 mmol, 1.0 equiv), tert-butyl piperazine- 1 -carboxylate (250.7 mg, 1.346 mmol, 2.0 equiv), and CS ₂ CO ₃ (659.9 mg, 2.019 mmol, 3.0 equiv) in dioxane (2 mL) was added RuPhos (62.8 mg, 0.135 mmol, 0.2 equiv) and RuPhos G3 Pd (56.3 mg, 0.067 mmol, 0.1 equiv). After stirring for 3 h at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-isopropylindazol e-7- carboxylate (250 mg, 92%) as a solid. LCMS (ES, m/z): 403 [M+H] ⁺ .

Synthesis of Intermediate CIO

A mixture of methyl 4-[4-(tert-butoxy carbonyl) piperazin- 1-yl] -2-isopropylindazole -7- carboxylate (250 mg, 0.621 mmol, 1.00 equiv), tetrahydrofuran (1.2 mL), water (1.2 mL), and LiOELELO (39.1 mg, 0.931 mmol, 1.5 equiv) was stirred for 1 h at room temperature. The reaction mixture was acidified to pH 6 with HCl (1 N, aq.) in ice-water bath, then extracted with ethyl acetate (3x3 mL). The organic layers were combined, dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[4-(tert- butoxycarbonyl)piperazin-l-yl]-2-isopropylindazole-7-carboxy lic acid (100 mg, 41%) as a solid.

LCMS (ES, m/z): 389 [M+H] ⁺ .

Synthesis of Intermediate Cl 1

A mixture of 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-isopropylindazol e-7-carboxylic acid (70 mg, 0.180 mmol, 1.0 equiv), 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (29.8 mg, 0.180 mmol, 1.0 equiv), DMF (1 mL), DIEA (46.6 mg, 0.360 mmol, 2.0 equiv) and HATU (82.2 mg, 0.217 mmol, 1.2 equiv) was stirred for 3 h at room temperature, then diluted with water (3 mL) and extracted with ethyl acetate (3 x 4 mL). The organic layers were combined, washed with water (2 x 10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (10: 1) to afford tert-butyl 4-[7-({8-fluoro- 2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-isopropylind azol-4-yl]piperazine-l- carboxylate (60 mg, 62%) as an oil. LCMS (ES, m/z): 536 [M+H] ⁺ .

Synthesis of Compound 290 A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- isopropylindazol-4-yl]piperazine-l -carboxylate (60.0 mg, 0.112 mmol, 1.0 equiv), DCM (1 mL) and TFA (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- isopropyl-4-(piperazin-l-yl)indazole- 7-carboxamide (15 mg, 28%) as a solid. LCMS (ES, m/z): 436 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.15 (s, 1H), 9.22 (d, J= 1.7 Hz, 1H), 8.82 (s, 1H), 7.99 (d, J= 8.1 Hz, 1H), 7.92 (d, J= 3.0 Hz, 1H), 7.44-6.97 (m, 1H), 6.49 (d, J= 8.2 Hz, 1H), 5.13-4.87 (m, 1H), 3.38-3.34 (m, 4 H), 2.94-2.90 (m, 4H), 2.36 (s, 3H), 1.67 (d, J= 6.7 Hz, 6H).

Example 44: Synthesis of Compound 295

Synthesis of Intermediate C12

To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (650 mg, 2.54 mmol, 1.0 equiv) and 3-iodooxetane (937.6 mg, 5.09 mmol, 2 equiv) in DMF (6.5 mL,) was added K ₂ CO ₃ (704.3 mg, 5.09 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 100°C under nitrogen atmosphere, then cooled to room temperature. The resulting mixture was diluted with water (6 mL) and extracted with ethyl acetate (3 x 6 mL). The organic layers were combined, washed with brine (lx 10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4- bromo-2-(oxetan-3-yl)indazole-7-carboxylate (200 mg, 25%) as a solid. LCMS (ES, m/z): 311 [M+H] ⁺ .

Synthesis of Intermediate Cl 3

To a stirred mixture of methyl 4-bromo-2-(oxetan-3-yl)indazole-7-carboxylate (200 mg, 0.64 mmol, 1 equiv) and tert-butyl piperazine- 1 -carboxylate (239.4 mg, 1.28 mmol, 2 equiv) in 1,4- dioxane (2 mL) was added CS ₂ CO ₃ (628.3 mg, 1.93 mmol, 3 equiv), RuPhos (59.9 mg, 0.13 mmol, 0.2 equiv), and RuPhos G3 Pd (53.7 mg, 0.06 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100°C under nitrogen atmosphere, then cooled to room temperature. The resulting mixture was diluted with water (5 mL) and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with brine (lx 5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-[4-(tert- butoxycarbonyl)piperazin-l-yl]-2-(oxetan-3-yl)indazole-7-car boxylate (220 mg, 82%) as a solid. LCMS (ES, m/z): 417 [M+H] ⁺ .

Synthesis of Intermediate C14

A solution of methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-(oxetan-3-yl)ind azole-7- carboxylate (200 mg, 0.4 mmol, 1.0 equiv) in tetrahydrofuran (2 mL) was treated with lithiumol hydrate (80.6 mg, 1.9 mmol, 4.0 equiv) in water (2 mL) at room temperature. The resulting mixture was stirred for 2 h at 50 °C under nitrogen atmosphere, then cooled to 0 °C. The resulting mixture was acidified to pH 4 with HCl (I M) and extracted with ethyl acetate (2 x 10 mL). The organic layers were combined, washed with brine (1x10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-(oxetan-3-yl)ind azole-7-carboxylic acid (160 mg, 83%) as a solid. LCMS (ES, m/z): 403 [M+H] ⁺ .

Synthesis of Intermediate Cl 5

To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-(oxetan-3-yl)ind azole-7- carboxylic acid (160 mg, 0.39 mmol, 1.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6- amine (72.2 mg, 0.43 mmol, 1.1 equiv) in DMF (1 mL) was added DIEA (154.1 mg, 1.19 mmol, 3.0 equiv) and HATU (226.7 mg, 0.59 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature under nitrogen atmosphere, then quenched with water and extracted with ethyl acetate (2 x 10 mL). The organic layers were combined, washed with brine (1x10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :2) to afford tert-butyl 4-[7-({8-fluoro-2- methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)-2-(oxetan-3 -yl)indazol-4-yl]piperazine- 1 - carboxylate (100 mg, 46%) as a solid. LCMS (ES, m/z): 550 [M+H] ⁺ .

Synthesis of Compound 295

A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- (oxetan-3-yl)indazol-4-yl]piperazine-l -carboxylate (100 mg, 0.18 mmol, 1.0 equiv) in DCM (1 mL) was treated with TFA (1 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 1) to afford N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-(oxetan-3-yl)-4-(piperaz in-l-yl)indazole-7-carboxamide trifluoroacetic acid salt (23.3 mg, 28%) as a solid. LCMS (ES, m/z): 450 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.17 (s, 1H), 9.38 (s, 1H), 9.16 (s, 1H), 8.85 (s, 2H), 8.27-8.02 (m, 2H), 7.50 (d, J= 11.8 Hz, 1H), 6.66 (d, J= 8.1 Hz, 1H), 6.12-5.95 (m, 1H), 5.25-5.08 (m, 4H), 3.66-3.58 (m, 4H), 3.37 (s, 4H), 2.41 (s, 3H).

Example 45: Synthesis of Compound 299

Synthesis of Intermediate C16

A mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (150.0 mg, 0.037 mmol, 1.0 equiv), tert-butyl l,6-diazaspiro[3.4]octane-l -carboxylate (153.8 mg, 0.724 mmol, 1.3 equiv), Ruphos (26.0 mg, 0.056 mmol, 0.1 equiv), Dioxane (4 mL), Cs ₂ CO ₃ (363.2 mg, 1.114 mmol, 2.0 equiv) and RuPhos G3 Pd (6.2 mg, 0.007 mmol, 0.2 equiv) was stirred for 2 h at 85 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 1) to afford methyl 4-[l-(tert-butoxycarbonyl)-l,6-diazaspiro[3.4]octan-6-yl]-2- methylindazole-7-carboxylate (170 mg, 70%) as a solid. LCMS (ES, m z): 401 [M+H] ⁺ .

Synthesis of Intermediate Cl 7 C ₁ 6 C ₁ 7

A mixture of methyl 4-[l-(tert-butoxycarbonyl)-l,6-diazaspiro[3.4]octan-6-yl]-2- methylindazole -7-carboxylate (170.0 mg, 0.424 mmol, 1.0 equiv), NaOH (169.7 mg, 4.240 mmol, 10.0 equiv), methanol (3 mL), and water (3 mL) was stirred for 5 h at 50 °C. The resulting mixture was dilute d with water (50 mL), acidified to pH 5 with 1 N of HCl, and extracted with ethyl acetate (2x5 0 mL). The resulting mixture was concentrated under reduced pressure to afford 4-[l-(tert-butox ycarbonyl)-l,6-diazaspiro[3.4]octan-6-yl]-2-methylindazole-7 -carboxylic acid (160 mg, 88%) as a solid. LCMS (ES, m/z): 387 [M+H] ⁺ .

Synthesis of Intermediate C18

A mixture of 4-[l-(tert-butoxycarbonyl)-l,6-diazaspiro[3.4]octan-6-yl]-2- methylindazole- 7- carboxylic acid (50.0 mg, 0.052 mmol, 1.0 equiv), 8-fluoro-2-methylimidazo[1,2-a]pyridin-6- amine (27.7 mg, 0.168 mmol, 1.3 equiv), HATU (98.3 mg, 0.258 mmol, 2.0 equiv), DMF (2.0 mL), and DIEA (50.1 mg, 0.387 mmol, 3.0 equiv) was stirred for 5 h at 50 °C. The resulting mixture was diluted with water (20 mL) and extracted with ethyl acetate (2x20 mL). The organic layer were combined, washed with water (1 x 40 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 6-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- methylindazol-4-yl]-l,6-diazaspiro[3.4]octane-l-carboxylate (65 mL, 94%) as a solid. LCMS (ES, m/z): 534 [M+H] ⁺ .

Synthesis of Compound 299

A mixture of tert-butyl 6-[7-({8-fluoroimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methy lindazol-4 -yl]-l,6-diazaspiro[3.4]octane-l -carboxylate (80.0 mg, 0.154 mmol, 1.0 equiv), DCM (1 mL), an d TFA (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated u nder reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, G radient 2) to afford 4-{ l,6-diazaspiro[3.4]octan-6-yl}-N-{8-fluoro-2-methylimidazo[1 ,2-a]pyridi n-6-yl}-2-methylindazole-7-carboxamide (45.3 mg, 66%) as a solid. LCMS (ES, m/zy. 434 [M+ H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.18 (s, 1H), 9.41 (d, J= 1.6 Hz, 1H), 9.10-9.09 (m, 1H ), 9.00-8.97 (m, 1H), 8.90 (s, 1H), 8.09 (s, 1H), 7.99 (d, J= 8.2 Hz, 1H), 7.73 (d, J= 12.0 Hz, 1H ), 6.10 (d, J= 8.4 Hz, 1H), 4.44 (d, J= 12.4 Hz, 1H), 4.31 (s, 3H), 4.00 -3.53 (m, 5H), 2.81 (dd, J= 13.6, 5.8 Hz, 1H), 2.66 (t, J= 8.1 Hz, 2H), 2.43 (s, 4H).

Example 46: Synthesis of Compound 316

Synthesis of Intermediate C19

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and 2,2,2-trifluoroethyl trifluoromethanesulfonate (70.5 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added CS ₂ CO ₃ (198.0 mg, 0.60 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 5 h at room temperature, then quenched with water (2 mL) and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with brine (1x5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-(2, 2, 2-trifluoroethyl)indazol-4-yl]piperazine-l -carboxylate (52 mg, 44.59%) as a solid. LCMS (ES, m/z): 576 [M+H] ⁺ .

Synthesis of Compound 316

A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- (2,2,2-trifluoroethyl)indazol-4-yl]piperazine-l -carboxylate (47.0 mg, 0.08 mmol, 1 equiv) in DCM (0.5 mL) was treated with TFA (0.5 mL) at room temperature. The resulting mixture was stirred for 30 min at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 3) to afford N-{8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-l-yl )-2-(2,2,2-trifluoroethyl)indazole- 7-carboxamide trifluoroacetic acid salt (6 mg, 15%) as a solid. LCMS (ES, m/z): 476 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.15 (s, 1H), 9.43 (s, 1H), 9.31 (s, 2H), 9.14 (s, 1H), 8.18- 8.00 (m, 2H), 7.64 (d, J= 11.8 Hz, 1H), 6.65 (d, J= 8.1 Hz, 1H), 5.69 (q, J= 9.0 Hz, 2H), 3.67 (s, 4H), 3.36 (s, 4H), 2.42 (s, 3H).

Example 47: Synthesis of Compound 304

Synthesis of Intermediate C20

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (100 mg, 0.20 mmol, 1.0 equiv) and 4- iodooxane (64.4 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added CS ₂ CO ₃ (198.0 mg, 0.61 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then quenched with water at room temperature and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with brine (1x5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(oxan-4- yl)indazol-4-yl]piperazine-l -carboxylate (41 mg, 35%) as a solid. LCMS (ES, m/z): 578 [M+H] ⁺ .

Synthesis of Compound 394 To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-(oxan-4-yl)indazol-4-yl]piperazine-l -carboxylate (40 mg, 0.07 mmol, 1.0 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 4) to afford N-{8- fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-(oxan-4-yl)-4-(piperazin- 1 -yl)indazole-7- carboxamide trifluoroacetic acid salt (22.8 mg, 50%) as a solid. LCMS (ES, m/z): 478 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.17 (s, 1H), 9.44 (d, J= 1.6 Hz, 1H), 9.15 (s, 2H), 9.00 (s, 1H), 8.13 (d, J= 2.6 Hz, 1H), 8.04 (d, J= 8.0 Hz, 1H), 7.71 (dd, J= 11.8, 1.6 Hz, 1H), 6.62 (d, J = 8.1 Hz, 1H), 4.95 (tt, J= 10.4, 5.5 Hz, 1H), 4.10 (dt, J= 11.2, 3.2 Hz, 2H), 3.69-3.51 (m, 6H), 3.37-3.35 (m, 4H), 2.44 (s, 3H), 2.25 (td, J= 10.3, 9.5, 4.1 Hz, 4H).

Example 48: Synthesis of Compound 357

Synthesis of Intermediate C22

A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(2- oxopropyl)indazol-4-yl]piperazine-l -carboxylate (90.0 mg, 0.16 mmol, 1.0 equiv) in methanol (1 mL) was treated with NaBH4 (7.4 mg, 0.19 mmol, 1.2 equiv) at 0 °C under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature, then quenched with sat. NH4CI (aq.) at 0 °C and extracted with ethyl acetate (2 x 5 mL). The organic layers were combined, washed with brine (1x5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :4) to afford tert-butyl 4-[7-({8-fluoro- 2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-oxopropyl )indazol-4-yl]piperazine-l- carboxylate (57 mg, 63%) as a solid. LCMS (ES, m/z): 552 [M+H] ⁺ . Synthesis of Compound 357

A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(2- oxopropyl)indazol-4-yl]piperazine-l -carboxylate (57.0 mg, 0.10 mmol, 1.0 equiv) in DCM (0.6 mL) was treated with TFA (0.6 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 5) to afford N-{8-fluoro-2- methylimidazof 1 ,2-a]pyridin-6-yl } -2-(2-oxopropyl)-4-(piperazin- 1 -yl)indazole-7-carboxamide trifluoroacetic acid salt (1.7 mg, 3%) as a solid. LCMS (ES, m/z): 452 [M+H] ⁺ . ¹ H NMR (400 MHz, Methanol-d ₄ ) δ 9.54 (s, 1H), 8.66 (s, 1H), 8.19 (d, J= 7.9 Hz, 1H), 8.09 (s, 1H), 8.02 (d, J = 11.3 Hz, 1H), 6.69 (d, J = 8.0 Hz, 1H), 4.73-4.60 (m, 1H), 4.48 (dd, J= 23.1, 10.0 Hz, 2H), 3.71 (t, J= 5.0 Hz, 4H), 3.52 (t, J= 5.1 Hz, 4H), 2.59 (s, 3H), 1.35 (d, J= 6.1 Hz, 3H).

Example 49: Synthesis of Compound 354

Synthesis of Intermediate C23 m azo e, , r , C ₂ 3

A mixture of l-chloro-2-methyl-2-propanol (1.5 g, 13.816 mmol, 1.0 equiv), DCM (15 mL), imidazole (1.8 g, 27.615 mmol, 2.0 equiv), and t-butyldimethylchlorosilane (3.1 g, 20.701 mmol, 1.5 equiv) was stirred for 3 h at room temperature. The reaction mixture was quenched with water (100 mL) at room temperature and extracted with CH ₂ CI ₂ (2x100 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (5:1) to afford tert-butyl[(l-chloro-2-methylpropan-2-yl)oxy]dimethylsilane (1.2 g, 35%) as an oil.

Synthesis of Intermediate C24 C ₁ 9 C ₂ 4

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2H- indazol-4-yl]piperazine-l -carboxylate (100.0 mg, 0.203 mmol, 1.0 equiv), CS ₂ CO ₃ (198.66 mg, 0.609 mmol, 3 equiv), dimethylformamide (2 mL), and tert-butyl[(l-chloro-2-methylpropan-2- yl)oxy]dimethylsilane (135.4 mg, 0.609 mmol, 3.0 equiv) was stirred for 48 h at 50 °C. The reaction was quenched with water (5 mL) at room temperature and extracted with ethyl acetate (2x5 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (30: 1) to afford tert-butyl 4-[7-({8-fluoro- 2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-hydroxy-2 -methylpropyl) indazol-4- yl]piperazine-l -carboxylate (100 mg, 79%) as a solid. LCMS (ES, m z ): 566 [M+H] ⁺ .

Synthesis of Compound 354

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(2- hydroxy-2-methylpropyl)indazol-4-yl]piperazine-l -carboxylate (60.0 mg, 0.106 mmol, 1.0 equiv), DCM (1 mL), and trifluoroacetaldehyde (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford N-{8-fluoro-2- methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-(2-hydroxy-2-methylpropyl)-4-(piperazin- 1 -yl)indazole-7 - carboxamide trifluoroacetic acid salt (37.1 mg, 75%) as a solid. LCMS (ES, m/z): 466 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.41 (s, 1H), 9.46 (d, J= 1.6 Hz, 1H), 9.03 (s, 2H), 8.82 (s, 1H), 8.16 - 8.09 (m, 1H), 8.04 (d, J= 8.0 Hz, 1H), 7.60 (d, J= 11.9 Hz, 1H), 6.63 (d, J= 8.1 Hz, 1H), 4.51 (s, 2H), 3.66-3.57 (m, 4H), 3.37-3.36 (m, 4H), 2.43 (s, 3H), 1.23 (s, 6H).

Example 50: Synthesis of Compound 358

Synthesis of Intermediate C25

Methyl 1-hydroxycyclopropane-l -carboxylate (2.0 g, 17.224 mmol, 1.0 equiv), DCM (30 mL), PPTS (1.3 g, 5.167 mmol, 0.3 equiv), and dihydropyran (2.1 g, 25.836 mmol, 1.5 equiv) were combined at 0 °C. The resulting mixture was stirred for 5 h at room temperature, then quenched with water (100 mL) at room temperature and extracted with CH ₂ Cl ₂ (2x100 mL). The organic layers were combined, dried by Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (5: 1) to afford methyl l-(oxan-2-yloxy)cyclopropane-l- carboxylate (2.5 g, 65%) as a solid. ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 4.83-4.81 (m, 1H), 3.79- 3.71 (m, 1H), 3.64 (s, 3H), 3.52-3.36 (m, 1H), 1.84-1.62 (m, 2H), 1.61-1.32 (m, 5H), 1.27-1.08 (m, 3H).

Synthesis of Intermediate C26 Methyl l-(oxan-2-yloxy)cyclopropane-l -carboxylate (400.0 mg, 1.998 mmol, 1.0 equiv), tetrahydrofuran (10 mL), and LiA1H ₄ (113.7 mg, 2.997 mmol, 1.5 equiv) were combined at 0°C The resulting mixture was stirred for 1 h at room temperature under nitrogen atmosphere, quenched with water (100mL) at 0°C and extracted with ethyl acetate (2x100 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The resulting mixture was concentrated under reduced pressure to give a solid.

Synthesis of Intermediate C27

[l-(oxan-2-yloxy)cyclopropyl]methanol (300 mg, 1.742 mmol, 1.0 equiv), DCM (6 mL), triethylamine (352.5 mg, 3.484 mmol, 2.0 equiv), and methanesulfonyl chloride (399.0 mg, 3.484 mmol, 2.0 equiv) were combined at 0°C. The resulting mixture was stirred for 2 h at 0°C, then quenched with water (50 mL) at 0°C and extracted with CH ₂ CI ₂ (2x50 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a solid.

Synthesis of Intermediate C28

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2H- indazol-4-yl]piperazine-l -carboxylate (100.0 mg, 0.203 mmol, 1.0 equiv), CS ₂ CO ₃ (198.6 mg, 0.609 mmol, 3.0 equiv), dimethylformamide (2 mL), and [l-(oxan-2-yloxy)cyclopropyl]methyl methanesulfonate (152.1 mg, 0.609 mmol, 3.0 equiv) was stirred overnight at 50 °C. The reaction mixture was quenched with water (10 mL) at room temperature and extracted with ethyl acetate (2x10 mL). The organic layer were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (30: 1) to afford tert-butyl 4-[7- ({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-{ [l-(oxan-2-yloxy)cyclopropyl] methyl }indazol-4-yl]piperazine-l -carboxylate (100 mg, 70%) as a solid. LCMS (ES, m/z)'. 648 [M+H] ⁺ .

Synthesis of Compound 358 C ₂ 8 358

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-[(l- hydroxycyclopropyl)methyl]indazol-4-yl]piperazine-l-carboxyl ate (100.0 mg, 0.177 mmol, 1.0 equiv), DCM (1 mL), and trifluoroacetaldehyde (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford N-{8-fluoro-2- methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-[( 1 -hydroxy cy cl opropyl)methyl]-4-(piperazin- 1 - yl)indazole-7-carboxamide trifluoroacetic acid salt (29.4 mg, 35%) as a solid. LCMS (ES, m/z): 464 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.42 (s, 1H), 9.46 (d, J= 1.6 Hz, 1H), 9.01 (s, 2H), 8.88 (s, 1H), 8.12 (d, J = 2.7 Hz, 1H), 8.05 (d, J= 8.0 Hz, 1H), 7.61 (d, J= 11.7 Hz, 1H), 6.64 (d, J= 8.1 Hz, 1H), 4.63 (s, 2H), 3.62 (t, J= 5.1 Hz, 4H), 3.373.36 (m, 4H), 2.42 (s, 3H), 1.00-0.83 (m, 2H), 0.83-0.74 (m, 2H).

Example 51: Synthesis of Compound 305

Synthesis of Intermediate C29

C19 C29

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (100.0 mg, 0.20 mmol, 1 equiv) and 1- fluoro-2-iodo-ethane,(52.8 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added CS ₂ CO ₃ (198.0 mg, 0.60 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with brine (1x5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(2- fluoroethyl)indazol-4-yl]piperazine-l -carboxylate (41 mg, 38%) as a solid. LCMS (ES, m/z): 540 [M+H] ⁺ .

Synthesis of Compound 305

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-(2-fluoroethyl)indazol-4-yl]piperazine-l -carboxylate (41.0 mg, 0.07 mmol, 1 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 6) to afford N-{8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2-fluoroethyl) -4-(piperazin-l-yl)indazole-7- carboxamide trifluoroacetic acid (24.3 mg, 49%) as a solid. LCMS (ES, m/z): 440 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.19 (s, 1H), 9.43 (d, J= 1.5 Hz, 1H), 9.01 (s, 1H), 8.95 (s, 2H), 8.10 (s, 1H), 8.06 (d, J= 8.0 Hz, 1H), 7.70 (d, J= 12.0 Hz, 1H), 6.64 (d, J= 8.1 Hz, 1H), 5.16 (t, J= 4.6 Hz, 1H), 5.01 (t, J= 4.6 Hz, 1H), 4.96 (t, J= 4.7 Hz, 1H), 4.84 (t, J= 4.7 Hz, 1H), 3.61 (t, J= 5.2 Hz, 4H), 3.37 (s, 4H), 2.42 (d, J= 0.9 Hz, 3H).

Example 52: Synthesis of Compound 302

Synthesis of Intermediate C30

To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (10 g, 39.2 mmol, 1.0 equiv) and tert-butyl piperazine- 1 -carboxylate (10.9 g, 58.8 mmol, 1.5 equiv) in toluene (100 mL) was added K ₂ CO ₃ (16.2 g, 117.6 mmol, 3 equiv), BINAP (4.8 g, 7.8 mmol, 0.2 equiv), and Pd(AcO)2 (0.8 g, 3.9 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred overnight at 100°C under nitrogen atmosphere, then cooled to room temperature. The resulting mixture was diluted with water (100 mL) and extracted with ethyl acetate (2 x 100 mL). The organic layers were combined, washed with brine (1x100 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2H-indazole-7-carb oxylate (10.4 g, 74%) as a solid. LCMS (ES, m/z): 361 [M+H] ⁺ .

Synthesis of Intermediate C3I A solution of methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2H-indazole-7-carb oxylate (10.4 g, 28.8 mmol, 1 equiv) in THF (100 mL) was treated with LiOH.H ₂ O (2.7 g, 115.4 mmol, 4 equiv) in water (100 mL) at room temperature. The resulting mixture was stirred for 2 h at 50 °C under nitrogen atmosphere, then cooled to 0 °C. The resulting mixture was acidified to pH 4 with HCl (1 M) and extracted with ethyl acetate (3 x 150 mL). The organic layers were combined, washed with brine (1x100 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (15: 1) to afford 4-[4-(tert- butoxycarbonyl)piperazin-l-yl]-2H-indazole-7-carboxylic acid (9.6 g, 96%) as a solid. LCMS (ES, m/z): 347 [M+H] ⁺ .

Synthesis of Intermediate C32

To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2H-indazole-7-carb oxylic acid (9.6 g, 27.7 mmol, 1.0 equiv), 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (5.0 g, 30.4 mmol, 1.1 equiv), and NMI (9.1 g, 110.8 mmol, 4 equiv) in acetonitrile (100 mL) was added TCFH (9.3 g, 33.2 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature under nitrogen atmosphere, then diluted with water and extracted with ethyl acetate (3 x 100 mL). The organic layers were combined, washed with brine (1x100 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :4) to afford tert-butyl 4-[7-({8-fluoro-2- methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)-2H-indazol-4-yl]piperazine- 1 -carboxylate (10.6 g, 77%) as a solid. LCMS (ES, m/z): 494 [M+H] ⁺ .

Synthesis of Intermediate C33

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (60 mg, 0.12 mmol, 1 equiv) and 1- bromo-3-methoxypropane (27.9 mg, 0.18 mmol, 1.5 equiv) in DMF (0.6 mL) was added CS ₂ CO ₃ (118.8 mg, 0.37 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with brine (1 x 5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(3- methoxypropyl)indazol-4-yl]piperazine-l -carboxylate (34 mg, 49%) as a solid. LCMS (ES, m/z): 566 [M+H] ⁺ .

Synthesis of Compound 302

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-(3-methoxypropyl)indazol-4-yl]piperazine-l -carboxylate (34 mg, 0.06 mmol, 1 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 7) to afford N-{8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(3-methoxypropy l)-4-(piperazin-l-yl)indazole-7- carboxamide trifluoroacetic acid salt (14.1 mg, 50%) as a solid. LCMS (ES, m/z): 466 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.19 (s, 1H), 9.39 (d, J = 1.6 Hz, 1H), 8.96-8.93 (m, 3H), 8.09 (d, J= 2.1 Hz, 1H), 8.04 (d, J= 8.0 Hz, 1H), 7.62 (d, J= 12.0 Hz, 1H), 6.62 (d, J= 8.1 Hz, 1H), 4.63 (t, J= 7.1 Hz, 2H), 3.59-3.57 (m, 4H), 3.42 (t, J= 6.1 Hz, 2H), 3.36-3.34 (m, 4H), 3.28 (s, 3H), 2.42 (s, 3H), 2.30 (q, J= 6.5 Hz, 2H).

Example 53: Synthesis of Compound 338

Synthesis of Intermediate C34

To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (110 mg, 0.223 mmol, 1.0 equiv) and 3-(iodomethyl)oxetane (66.20 mg, 0.335 mmol, 1.5 equiv) in DMF (2.2 mL) was added CS ₂ CO ₃ (217.8 mg, 0.669 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then diluted with water (10 mL) and extracted with ethyl acetate (3x10 mL). The organic layer were combined, washed with water (3x10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA (100%) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(oxetan-3- ylmethyl)indazol-4-yl]piperazine-l -carboxylate (65 mg, 52%) as a solid. LCMS (ES, m, z):423.2 [M+H] ⁺ .

Synthesis of Compound 338

C34 To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-(oxetan-3-ylmethyl)indazol-4-yl]piperazine-l -carboxylate (20 mg, 0.035 mmol, 1.0 equiv) in DCM (0.5 mL) was added ZnBr ₂ (79.91 mg, 0.350 mmol, 10 equiv) at room temperature. The resulting mixture was stirred for 16 h at room temperature, then diluted with water (2 mL) and extracted with CH ₂ Cl ₂ (2x2 mL). The organic layers were combined, dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 2) to afford N-{ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-(oxetan-3 -ylmethyl)-4-(piperazin- 1 - yl)indazole-7-carboxamide (5.6 mg, 34%) as a solid. LCMS (ES, m, z):403.2 [M+H] ⁺ . ¹ H NMR (400 MHz, Methanol-d ₄ ) δ 9.02 (s, 1H), 8.55 (s, 1H), 8.06 (d, J= 8.0 Hz, 1H), 7.69-7.63 (m, 1H), 7.14 (d, J= 11.8 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 4.95-4.82 (m, 4H), 4.71 (t, J= 6.1 Hz, 2H), 3.82-3.72 (m, 1H), 3.42 (t, J= 4.9 Hz, 4H), 3.07 (m, 4H), 2.42 (s, 3H)).

Example 54: Synthesis of Compound 317

Synthesis of Intermediate C35

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and epibromohydrin (41.6 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added CS ₂ CO ₃ (198.0 mg, 0.60 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (2 mL) and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with brine (1x5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(oxiran-2- ylmethyl)indazol-4-yl]piperazine-l -carboxylate (55 mg, 49%) as a solid. LCMS (ES, m/z): 550 [M+H] ⁺ .

Synthesis of Compound 317

A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- (oxiran-2-ylmethyl)indazol-4-yl]piperazine-l -carboxylate (55 mg, 0.10 mmol, 1.0 equiv) in DCM (0.5 mL) was treated with TFA (0.1 mL) at 0 °C. The resulting mixture was stirred for 30 min at 0 °C, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 3) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin- 6-yl}-2-(oxiran-2-ylmethyl)-4-(piperazin-l-yl)indazole-7-car boxamide (2 mg, 4%) as a solid. LCMS (ES, m/z): 450 [M+H] ⁺ .

Example 55: Synthesis of Compound 339

Synthesis of Intermediate C21

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (300.0 mg, 0.61 mmol, 1.0 equiv) and l-chloropropan-2-one (67.4 mg, 0.73 mmol, 1.2 equiv) in DMF (3 mL) was added CS ₂ CO ₃ (594.1 mg, 1.82 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then diluted with water and extracted with ethyl acetate (3 x 6 mL). The organic layers were combined, washed with brine (1x5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :3) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(2- oxopropyl)indazol-4-yl]piperazine-l -carboxylate (135 mg, 40%) as a solid. LCMS (ES, m/z): 550 [M+H] ⁺ .

Synthesis of Compound 339 C ₂ 1 339

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(2- oxopropyl)indazol-4-yl]piperazine-l -carboxylate (50 mg, 0.09 mmol, 1 equiv) in DCM (0.5 mL) and TFA (0.5 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 3) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2- oxopropyl)-4-(piperazin-l-yl)indazole-7-carboxamide trifluoroacetic acid salt (21.8 mg, 44%) as a solid. LCMS (ES, m/z): 450 [M+H] ⁺ . ¹ H NMR (400 MHz, Methanol-d ₄ ) δ 11.42 (s, 1H), 9.48 (d, J= 1.7 Hz, 1H), 8.62 (s, 1H), 8.20 (d, J= 8.0 Hz, 1H), 8.03 (d, J= 1.9 Hz, 1H), 7.91 (dd, J = 11.5, 1.5 Hz, 1H), 6.71 (d, J= 8.0 Hz, 1H), 5.65 (s, 2H), 3.71 (dd, J= 6.7, 3.8 Hz, 4H), 3.52 (dd, J= 6.7, 3.7 Hz, 4H), 2.63-2.49 (m, 3H), 2.36 (s, 3H).

Example 56: Synthesis of Compound 308

Synthesis of Intermediate C36 To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (100 mg, 0.20 mmol, 1 equiv) and 3- (bromomethyl)-3-methyloxetane (50.1 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added CS ₂ CO ₃ (198.0 mg, 0.60 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (2 mL) and extracted with ethyl acetate (3 x 2 mL). The organic layers were combined, washed with brine (1x2 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-[(3- methyloxetan-3-yl)methyl] indazol-4-yl]piperazine-l -carboxylate (42 mg, 36%) as a solid.

LCMS (ES, m/z): 578 [M+H] ⁺ .

Synthesis of Compound 308

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-[(3-methyloxetan-3-yl)methyl]indazol-4-yl]pi perazine-l-carboxylate (42 mg, 0.07 mmol, 1.0 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 8) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-[(3-methyl oxetan-3-yl)methyl]-4- (piperazin-l-yl)indazole-7-carboxamide trifluoroacetic acid salt (20.1 mg, 48%) as a solid. LCMS (ES, m/z): 478 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 10.87 (s, 1H), 9.63 (s, 1H), 9.20 (d, J= 1.6 Hz, 1H), 9.16 (s, 2H), 8.20 (d, J= 8.2 Hz, 1H), 8.08 (d, J= 2.9 Hz, 1H), 7.53 (d, J= 12.3 Hz, 1H), 6.98 (d, J= 8.3 Hz, 1H), 4.76 (dd, J= 12.3, 5.4 Hz, 2H), 4.56 (dd, J= 12.3, 7.5 Hz, 2H), 3.67 (t, J= 5.5 Hz, 4H), 3.52 (s, 2H), 3.39 (s, 4H), 2.40 (s, 3H), 1.32 (s, 3H).

Example 57: Synthesis of Compound 331 Synthesis of Intermediate C37

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (120.0 mg, 0.24 mmol, 1.0 equiv) and methyl chloroacetate (39.5 mg, 0.36 mmol, 1.5 equiv) in DMF (1.2 mL) was added CS ₂ CO ₃ (237.6 mg, 0.73 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (3 mL) and extracted with ethyl acetate (3 x 2 mL). The organic layers were combined, washed with brine (1x2 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(2- methoxy-2-oxoethyl)indazol-4-yl]piperazine-l -carboxylate (48 mg, 35%) as a solid. LCMS (ES, m/z): 566 [M+H] ⁺ .

Synthesis of Intermediate C38 C ₃ 7 C ₃ 8

A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(2- methoxy-2-oxoethyl)indazol-4-yl]piperazine-l -carboxylate (48.0 mg, 0.08 mmol, 1.0 equiv) in tetrahydrofuran (0.5 mL) was treated with LiOH.H ₂ O (10.1 mg, 0.42 mmol, 5.0 equiv) in water (0.5 mL) at room temperature. The resulting mixture was stirred for 2 h at 50 °C under nitrogen atmosphere, then cooled to 0 °C, acidified to pH 4 with HCl (1 M), and extracted with ethyl acetate (2 x 5 mL). The organic layers were combined, washed with brine (1x5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford {4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)indazol-2-yl} acetic acid (34 mg, 73%) as a solid. LCMS (ES, m/z): 552 [M+H] ⁺ .

Synthesis of Compound 331

A solution of {4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-7-({8-fluoro-2-me thylimidazo[1,2- a]pyridin-6-yl} carbarnoyl)indazol-2-yl} acetic acid (34 mg, 0.06 mmol, 1.0 equiv) in DCM (0.4 mL) was treated with TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 9) to afford [7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-4-(piperazin-l-y l)indazol-2-yl]acetic acid trifluoroacetic acid salt (2.5 mg, 7%) as a solid. LCMS (ES, m/z): 452 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.17 (s, 1H), 9.39 (s, 1H), 8.96 (s, 1H), 8.89 (s, 2H), 8.15-8.01 (m, 2H), 7.66 (d, J= 12.2 Hz, 1H), 6.64 (d, J= 8.1 Hz, 1H), 5.54 (s, 2H), 3.60 (d, J= 5.7 Hz, 4H), 3.37 (s, 4H), 2.40 (s, 3H).

Example 58: Synthesis of Compound 309

Synthesis of Intermediate C39

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and 2-chloro-N,N-dimethylacetamide (36.9 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added Cs ₂ CO ₃ (198.0 mg, 0.60 mmol, 3.0 equiv) at room temperature .The resulting mixture was stirred for 3 h at room temperature, then diluted with water (3 mL) and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with brine (1 x 5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-{2-[(dimethylcarbamoyl)methyl]-7-({8-fluoro-2-methylimidaz o[1,2- a]pyridin-6-yl}carbamoyl)indazol-4-yl}piperazine-l-carboxyla te (45 mg, 38%) as a solid.

LCMS (ES, m/z): 579 [M+H] ⁺ .

Synthesis of Compound 309

To a stirred solution of tert-butyl 4-{2-[(dimethylcarbamoyl)methyl]-7-({8-fluoro-2- methylimidazof 1 ,2-a]pyridin-6-yl } carbarnoyl)indazol-4-yl (piperazine- 1 -carboxylate (47 mg, 0.081 mmol, 1 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 10) to afford 2-[(dimethylcarbamoyl)methyl]-N-{8-fluoro-2-methylimidazo[1, 2-a]pyridin-6-yl}-4- (piperazin-l-yl)indazole-7-carboxamide trifluoroacetic acid salt (24.1 mg, 62%) as a solid.

LCMS (ES, m/z): 479 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.26 (s, 1H), 9.51 (d, J = 1.6 Hz, 1H), 9.14 (s, 2H), 8.86 (s, 1H), 8.15 (d, J= 2.6 Hz, 1H), 8.05 (d, J= 8.0 Hz, 1H), 7.82 (d, J= 11.8 Hz, 1H), 6.63 (d, J= 8.1 Hz, 1H), 5.68 (s, 2H), 3.62 (t, J= 5.1 Hz, 4H), 3.36 (s, 4H), 3.18 (s, 3H), 2.93 (s, 3H), 2.47 (s, 3H).

Example 59: Synthesis of Compound 355

Synthesis of Intermediate C40

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2H- indazol-4-yl]piperazine-l -carboxylate (150.0 mg, 0.304 mmol, 1.0 equiv), dimethylformamide (3 mL), caesio methaneperoxoate caesium (297.9 mg, 0.912 mmol, 3.0 equiv) and 3- bromocyclobutan-l-one (58.8 mg, 0.395 mmol, 1.3 equiv) was stirred for 1 h at room temperature. The reaction was quenched with water (10 mL) and extracted with ethyl acetate (2x10 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (40: 1) to afford tert-butyl 4-[7-({8-fluoro- 2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(3-oxocyclob utyl)indazol-4-yl] piperazine-1- carboxylate (70 mg, 37%) as a solid. LCMS (ES, m/ z):562 [M+H] ⁺ .

Synthesis of Intermediate C41

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl ) -2-(3- oxocyclobutyl)indazol-4-yl]piperazine-l -carboxylate (50.0 mg, 0.089 mmol, 1.0 equiv), methanol (1 mL), and NaBH ₄ (6.7 mg, 0.178 mmol, 2.0 equiv) was stirred for 1 h at 0°C under nitrogen atmosphere. The reaction was quenched with water (5 mL) and extracted with ethyl acetate (2x5 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (30: 1) to afford tert-butyl 4-[7- ({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-( 3-hydroxycyclobutyl)indazol-4- yl]piperazine-l -carboxylate (45 mg, 81%) as a solid. LCMS (ES, m/z): 564 [M+H] ⁺ .

Synthesis of Compound 355

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl ) -2-(3- hydroxycyclobutyl)indazol-4-yl]piperazine-l -carboxylate (40.0 mg, 0.071 mmol, 1.0 equiv), DCM (1 mL) and trifluoroacetaldehyde (4 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 4, Gradient 1) to afford N- { 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-(3 -hydroxycyclobutyl)-4-(piperazin- 1 - yl)indazole-7-carboxamide (5 mg, 15.00%) as a solid. LCMS (ES, m/z): 463 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.27 (s, 1H), 9.28 (d, J= 1.6 Hz, 1H), 8.85 (s, 1H), 7.99 (d, J= 8.1 Hz, 1H), 7.95-7.88 (m, 1H), 7.27 (dd, J= 12.3, 1.7 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 5.53 (d, J= 6.1 Hz, 1H), 4.87 (t, J= 8.0 Hz, 1H), 4.14 (q, J= 7.0 Hz, 1H), 3.37- 3.36 (m, 4H), 2.92-2.90 (m, 6H), 2.72-2.59 (m, 2H), 2.35 (s, 3H).

Example 60: Synthesis of Compound 311

Synthesis of Intermediate C42

A mixture of methyl 2-amino-4-bromo-5-fluoro-3- methylbenzoate (1.2 g, 4.579 mmol, 1.0 equiv) and AC2O (0.6 g, 5.953 mmol, 1.3 equiv) was stirred for 1 h at 25 °C. To the reaction mixture was added potassium acetate (0.13 g, 1.374 mmol, 0.3 equiv) and isoamyl nitrite (1.1 g, 10.074 mmol, 2.2 equiv). The resulting mixture was stirred for an additional 2 h at 80 °C, then quenched with water (100 mL) and extracted with CH ₂ CI ₂ (2x100 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl methyl 5-(acetyloxy)-4-bromo-lH-indazole-7-carboxylate (800 g, 50%) as a solid. LCMS (ES, m/z): 313 [M+H] ⁺ .

Synthesis of Intermediate C43

A mixture of methyl 5-(acetyloxy)-4-bromo- 2H-indazole-7-carboxylate (0.8 g, 2.555 mmol, 1.0 equiv), ethyl acetate (15 mL), and (CH ₃ ) ₃ O ⁺ BF ₄ - (1.5 g, 10.220 mmol, 4.0 equiv) was stirred for 16 h at room temperature. The reaction mixture was quenched with water (50 mL) and extracted with ethyl acetate (2x50 mL). The organic layer were combined, dried over Na ₂ SO ₄ , and concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 5-(acetyloxy)-4-bromo-2- methylindazole-7-carboxylate (780 mg, 84%) as a solid. LCMS (ES, m z): 327 [M+H] ⁺ .

Synthesis of Intermediate C44

A mixture of methyl 5-(acetyloxy)-4-bromo-2-methylindazole-7-carboxylate (0.8 g, 2.445 mmol, 1.0 equiv), methanol (10 mL), water (5 mL), and K ₂ CO ₃ (1.0 g, 7.335 mmol, 3.0 equiv) was stirred for 1 h at room temperature. The reaction mixture was quenched with water (100 mL) and extracted with ethyl acetate (2x100 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4- bromo-5-hydroxy-2-methylindazole-7-carboxylate (410 mg, 53%) as a solid. LCMS (ES, m/z): 285 [M+H] ⁺ .

Synthesis of Intermediate C45

A mixture of methyl 4-bromo-5-hydroxy-2-methylindazole-7-carboxylate (0.8 g, 2.806 mmol, 1.0 equiv), K ₂ CO ₃ (0.8 g, 5.612 mmol, 2.0 equiv), DMF (15 mL), and methyl iodide (0.8 g, 5.612 mmol, 2.0 equiv) was stirred for 1 h at room temperature. The reaction mixture was quenched with water (100 mL) and extracted with ethyl acetate (2x100 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-bromo-5-methoxy-2-methylindazole-7-carboxylate (750 mg, 79%) as a solid. LCMS (ES, m/z): 299 [M+H] ⁺ .

Synthesis of Intermediate C46

A mixture of methyl 4-bromo-5-methoxy-2-methylindazole-7-carboxylate (0.7 g, 2.340 mmol, 1.0 equiv), CS ₂ CO ₃ (1.5 g, 4.680 mmol, 2.0 equiv), tert-butyl piperazine- 1 -carboxylate (0.8 g, 4.680 mmol, 2.0 equiv), XPhos (0.2 g, 0.468 mmol, 0.2 equiv), Pd2(dba)3 (0.2 g, 0.234 mmol, 0.1 equiv), and dioxane (10 mL) was stirred for 3 h at 70 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-[4- (tert-butoxycarbonyl)piperazin-l-yl]- 5-methoxy-2-methylindazole-7-carboxylate (0.9 g, 86%) as a solid. LCMS (ES, m/z): 405 [M+H] ⁺ .

Synthesis of Intermediate C47

A mixture of methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-5-methoxy-2-methyl indazole-7-c arboxylate (0.9 g, 2.225 mmol, 1.0 equiv), THF (10 mL), water (5 mL), and LiOH (0.5 g, 22.250 mmol, 10.0 equiv) was stirred for 3 h at 50 °C. The resulting mixture was diluted with water (10 0 mL), acidified to pH 5 with HCl (aq.), and extracted with ethyl acetate (2x100 mL). The organi c layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under red uced pressure to afford 4-[4-(tert-butoxycarbonyl)piperazin- l-yl]-5-m ethoxy -2 -methylindazole-7 -carboxylic acid (0.63 g, 73%) as a solid. LCMS (ES, m/z): 391 [M+H] ⁺ .

Synthesis of Intermediate C48

A mixture of 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-5-methoxy-2-methyl indazole-7- carboxylic acid (250.0 mg, 0.640 mmol, 1.0 equiv), 8-fluoro-2-methylimidazo[1,2-a]pyridin-6- amine (137.4 mg, 0.832 mmol, 1.3 equiv), HATU (486.9 mg, 1.280 mmol, 2.0 equiv), DIEA (248.2 mg, 1.920 mmol, 3.0 equiv) and DMF (6 mL) was stirred for 3 h at 50 °C. The reaction mixture was diluted with water (50 mL) and extracted with ethyl acetate (2x50 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-[7-({8-fluoro-2- methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)-5-methoxy-2-methylindazol-4- yl]piperazine- 1 - carboxylate (350 mg, 92%) as a solid. LCMS (ES, m/z): 538 [M+H] ⁺ .

Synthesis of Compound 311

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-5-metho xy-2-methylindazol-4-yl]piperazine-l -carboxylate (90.0 mg, 0.167 mmol, 1.0 equiv), DCM (1 m L), and TFA (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concentr ated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Conditio n 3, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-5-methoxy-2- methyl -4-(piperazin-l-yl)indazole-7-carboxamide trifluoroacetic acid salt (32 mg, 42%) as a solid. LC MS (ES, m/z): 526 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.24 (m, 1H), 9.44 (d, J= 1.5 H z, 1H), 9.18 (s, 2H), 8.79 (s, 1H), 8.15 (d, J= 2.6 Hz, 1H), 7.91 (s, 1H), 7.85 (d, J= 12.3 Hz, 1H) , 4.33 (d, J= 4.4 Hz, 3H), 3.88 (s, 3H), 3.63 (t, J= 5.0 Hz, 4H), 3.28-3.27 (m, 4H), 2.49 (s, 3H).

Example 61: Synthesis of Compound 312

Synthesis of Intermediate C49

C19 C49

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (100 mg, 0.20 mmol, 1 equiv) and butyl iodide (55.9 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added CS ₂ CO ₃ (198.0 mg, 0.60 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (3 mL) and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with brine (1x5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-[2-butyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}c arbamoyl)indazol- 4-yl]piperazine-l-caroxylate (42 mg, 38%) as a solid. LCMS (ES, m/z): 550 [M+H] ⁺ .

Synthesis of Compound 312 To a stirred solution of tert-butyl 4-[2-butyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (42 mg, 0.07 mmol, 1 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 11) to afford 2-butyl-N-{8-fluoro-2- methylimidazo[ 1 ,2-a]pyridin-6-yl } -4-(piperazin- 1 -yl)indazole-7-carboxamide trifluoroacetic acid salt (23.6 mg, 56%) as a solid. LCMS (ES, m/z): 450 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.25 (s, 1H), 9.45 (d, J= 1.6 Hz, 1H), 9.05 (s, 2H), 8.96 (s, 1H), 8.14 (s, 1H), 8.04 (d, J= 8.0 Hz, 1H), 7.73 (d, J= 11.9 Hz, 1H), 6.62 (d, J= 8.1 Hz, 1H), 4.59 (t, J= 7.0 Hz, 2H), 3.61 (s, 4H), 3.36 (s, 4H), 2.46-2.41 (m, 3H), 2.03 (p, J= 7.1 Hz, 2H), 1.35 (q, J= 7.5 Hz, 2H), 0.97 (t, J= 7.4 Hz, 3H).

Example 62: Synthesis of Compound 313

Synthesis of Intermediate C50

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl} carbamoyl)-2H- indazol-4-yl]piperazine-l -carboxylate (90.0 mg, 0.182 mmol, 1.0 equiv), CS ₂ CO ₃ (178.8 mg, 0.546 mmol, 3.0 equiv), 4-(chloromethyl)pyridine (25.5 mg, 0.200 mmol, 1.1 equiv), and DMF (2 mL) was stirred for 3 h at room temperature. The reaction was quenched with water (10 mL) and extracted with ethyl acetate (2x10 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated in vacuo to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (20: 1) to afford tertbutyl 4-[7-({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)-2-(pyri din-4- ylmethyl)indazol-4-yl]piperazine-l -carboxylate (60 mg, 51%) as a solid. LCMS (ES, m/z): 585 [M+H] ⁺ .

Synthesis of Compound 313

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(pyrid in-4-ylmethyl)indazol-4-yl]piperazine-l -carboxylate (70.0 mg, 0.120 mmol, 1.0 equiv), DCM (1 mL), and TFA (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concen trated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Conditi on 3, Gradient 2) to afford N-{ 8-fluoro-2-methylimidazo[ 1,2-a]pyri din-6-yl} -4-(piperazin-l -yl)- 2-(pyridin-4-ylmethyl)indazole-7-carboxamide tri fluoroacetic acid salt (22 mg, 36%) as a solid. LCMS (ES, m/z): 485 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.19 (s, 1H), 9.48 (d, J= 1.5 Hz, 1H), 9.17 (s, 1H), 9.11 (s, 2H), 8.73- 8.65 (m, 2H), 8.20-8.13 (m, 1H), 8.07 (d, J= 8.0 Hz, 1 H), 7.74 (dd, J= 11.9, 1.6 Hz, 1H), 7.56-7.48 (m, 2H), 6.66 (d, J= 8.1 Hz, 1H), 5.98 (s, 2H), 3.6 8 -3.59 (m, 4H), 3.36-3.35 (m, 4H), 2.45 (s, 3H).

Example 63: Synthesis of Compound 318

Synthesis of Intermediate C51

C19 C ₅ 1

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl ) -2H- indazol-4-yl]piperazine-l -carboxylate (90.0 mg, 0.182 mmol, 1.0 equiv), CS ₂ CO ₃ (178.8 mg, 0.546 mmol, 3.0 equiv), DMF (2 mL), and 5-(chloromethyl)pyrimidine (28.1 mg, 0.218 mmol, 1.2 equiv) was stirred for 1 h at room temperature. The reaction was quenched with water (20 mL) and extracted with ethyl acetate (2x20 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (30: 1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(pyrimidin- 5-ylmethyl)indazol- 4-yl]piperazine-l -carboxylate (50 mg, 44%) as an oil. LCMS (ES, m/z): 586 [M+H] ⁺ .

Synthesis of Compound 318 C ₅ 1 318

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- (pyrimidin-5-ylmethyl)indazol-4-yl]piperazine-l-carboxylate (80.0 mg, 0.137 mmol, 1.0 equiv), DCM (1 mL), and TFA (1 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep- HPLC (Condition 3, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4- (piperazin-l-yl)-2-(pyrimidin-5-ylmethyl)indazole-7-carboxam ide trifluoroacetic acid salt (17.2 mg, 25%) as a solid. LCMS (ES, m/z): 486 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.08 (s, 1H), 9.42 (d, J= 1.6 Hz, 1H), 9.21 (s, 1H), 9.10 (d, J= 20.0 Hz, 3H), 8.91 (d, J= 6.1 Hz, 2H), 8.12-8.00 (m, 2H), 7.58 (d, J= 12.0 Hz, 1H), 6.64 (d, J= 8.1 Hz, 1H), 5.89 (s, 2H), 3.62-3.61 (m, 4H), 3.36-3.35 (m, 4H), 2.42 (s, 3H).

Example 64: Synthesis of Compound 341

Synthesis of Intermediate C52

Tert-butyl 4-(hydroxymethyl)pyrazole-l-carboxylate (400 mg, 2.018 mmol, 1.0 equiv), DCM (8 mL), triethylamine (408.40 mg, 4.036 mmol, 2 equiv), and methanesulfonyl chloride (300.48 mg, 2.623 mmol, 1.3 equiv) were combined at 0 °C. The resulting mixture was stirred for 1 h at room temperature under nitrogen atmosphere, then quenched with water (50 mL) at 0°C and extracted with DCM (2x50 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a solid.

Synthesis of Intermediate C53

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2H- indazol-4-yl]piperazine-l -carboxylate (65.0 mg, 0.132 mmol, 1.0 equiv), caesio methaneperoxoate caesium (129.1 mg, 0.396 mmol, 3.0 equiv), dimethylformamide (2 mL) and tert-butyl 4-[(methanesulfonyloxy)methyl]pyrazole-l -carboxylate (54.5 mg, 0.198 mmol, 1.5 equiv) was stirred for 5 h at 50 °C. The reaction mixture was cooled to room temperature, diluted with water (10 mL), and extracted with ethyl acetate (2x10 mL). The organic layers were combined, dried over Na ₂ SO ₄ , and filtered. The filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (30: 1) to afford tert-butyl 4-(2-{[l-(tert-butoxycarbonyl)pyrazol-4-yl]methyl}- 7-({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)indazol-4-yl)piperazine- 1 - carboxylate (45 mg, 47%) as a solid. LCMS (ES, m z): 673 [M+H] ⁺ .

Synthesis of Compound 341 A mixture of tert-butyl 4-(2-{[l-(tert-butoxycarbonyl)pyrazol-4-yl]methyl}-7- ({8-fluoro-2- methylimidazof 1 ,2-a]pyridin-6-yl } carbarnoyl)indazol-4-yl)piperazine- 1 -carboxylate (40. Omg, 0.059 mmol, 1.0 equiv), DCM (1 mL), and trifluoroacetaldehyde (1 mL, 10.202 mmol, 171.8 equiv) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin -l-yl)-2- (lH-pyrazol-4-ylmethyl)indazole-7-carboxamide trifluoroacetic acid salt (18 mg, 64%) as a solid. LCMS (ES, m/z): 473 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.25 (s, 1H), 9.40 (d, J = 1.6 Hz, 1H), 8.96 (s, 1H), 8.92 (s, 2H), 8.09 (d, J= 2.7 Hz, 1H), 8.03 (d, J= 8.0 Hz, 1H), 7.85 (s, 2H), 7.61 (d, J= 11.8 Hz, 1H), 6.62 (d, J= 8.1 Hz, 1H), 5.69 (s, 2H), 3.60 (t, J= 5.1 Hz, 4H), 3.36 (s, 4H), 2.43 (s, 3H).

Example 65: Synthesis of Compound 326

Synthesis of Intermediate C54 C ₅ 4

To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (1.6 g, 5.946 mmol, 1 equiv) in THF (1.5 mL) and water (0.5 mL) was added lithiumol hydrate (0.50 g, 11.892 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting solution was concentrated under reduced pressure and acidified to pH 6 with citric acid to afford a precipitate. The precipitated solid was collected by filtration and dried under infrared light to afford 4-bromo-2-methylindazole-7-carboxylic acid (1.3 g, 86%) as a solid. LCMS (ES, m/z): 255 [M+H] ⁺ .

Synthesis of Intermediate C55

To a stirred mixture of 4-bromo-2-methylindazole-7-carboxylic acid (500 mg, 1.960 mmol, 1 equiv) and DIEA (760.06 mg, 5.880 mmol, 3 equiv) in DMF (10 mL) was added HATU (968.96 mg, 2.548 mmol, 1.3 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (420.91 mg, 2.548 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature and filtrated. The filter cake was dried under infrared light to afford 4-bromo-N-{8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole- 7-carboxamide (600 mg, 76%) as a solid. LCMS (ES, m/zp. 402 [M+H] ⁺ .

Synthesis of Intermediate C56

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (70 mg, 0.174 mmol, 1 equiv) and tert-butyl (2R,6S)-2,6- dimethylpiperazine-1 -carboxylate (44.76 mg, 0.209 mmol, 1.2 equiv) in 1,4-dioxane (1.4 mL) was added CS ₂ CO ₃ (170.11 mg, 0.522 mmol, 3.0 equiv), RuPhos (8.12 mg, 0.017 mmol, 0.1 equiv), and RuPhos Palladacycle Gen.3 (14.56 mg, 0.017 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (20: 1) to afford tert-butyl (2R,6S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}c arbamoyl)-2-methylindazol-4-yl]- 2,6-dimethylpiperazine-l -carboxylate (70 mg, 56%) as a solid. LCMS (ES, m/zp. 536 [M+H] ⁺ .

Synthesis of Compound 326

C ₅ 6 326

To a stirred solution of tert-butyl(2R,6S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyri din-6- yl}carbamoyl)-2-methylindazol-4-yl]-2,6-dimethylpiperazine-l -carboxylate (70 mg, 0.131 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 103.02 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 1) to afford 4-[(3R,5S)-3,5-dimethylpiperazin-l-yl]-N-{8-fluoro-2-methyli midazo[1,2- a]pyridin-6-yl}-2-methylindazole-7-carboxamide (11.1 mg, 20%) as a solid. LCMS (ES, m/z): 436 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.08 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.80 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.35 (d, J= 12.6 Hz, 1H), 6.48 (d, J= 8.2 Hz, 1H), 4.30 (s, 3H), 3.79 (d, J= 11.7 Hz, 2H), 2.95 (s, 3H), 2.49-2.44 (m, 2H), 2.35 (s, 3H), 1.07 (d, J = 6.2 Hz, 6H).

Example 66: Synthesis of Compound 345

Synthesis of Intermediate C57

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N- (piperidin-4-yl)carbamate (43.02 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (6.96 mg, 0.015 mmol, 0.1 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (20: 1) to afford tert-butyl N- cyclopropyl-N-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- methylindazol-4-yl]piperidin-4-yl} carbamate (50 mg, 42%) as an oil. LCMS (ES, m/z)'. 562 [M+H] ⁺

Synthesis of Compound 345

To a stirred solution of tert-butyl N-cyclopropyl-N-{ l-[7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-y l}carbamate (50 mg, 0.089 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 151.23 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 2) to afford 4-[4-(cyclopropylamino)piperidin-l-yl]-N-{8-fluoro-2-methyli midazo[1,2- a]pyridin-6-yl}-2-methylindazole-7-carboxamide (3.6 mg, 9%) as solid. LCMS (ES, m/z): 462 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.78 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.0 Hz, 1H), 7.34 (dd, J= 12.4, 1.6 Hz, 1H), 6.49 (d, J = 8.2 Hz, 1H), 4.30 (s, 3H), 3.89 (d, J= 12.6 Hz, 2H), 3.11-3.02 (m, 2H), 2.79 (s, 1H), 2.35 (s, 3H), 2.13 (dt, J= 6.6, 3.1 Hz, 1H), 2.01 (d, J= 12.6 Hz, 2H), 1.48 (q, J= 10.7, 9.9 Hz, 2H), 0.40 (dt, J= 6.3, 3.0 Hz, 2H), 0.24 (p, J= 3.9 Hz, 2H).

Example 67: Synthesis of Compound 335

Synthesis of Intermediate C58

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(piperidin-4- ylmethyl)carbamate (38.36 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added CS ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (20: 1) to afford tert-butyl N- ({ 1 -[7-({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)-2-methylindazol-4- yl]piperidin-4-yl}methyl)carbamate (60 mg, 75%) as a solid. LCMS (ES, m/z): 536 [M+H] ⁺ .

Synthesis of Compound 335

To a stirred solution of tert-butyl N-({ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-yl}methyl)car bamate (60 mg, 0.112 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 120.19 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 1) to afford 4-[4-(aminomethyl)piperidin- 1 -yl]-N-{ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2- methylindazole-7-carboxamide (30.5 mg, 63%) as a solid. LCMS (ES, m/z): 436 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.76 (d, J= 3.0 Hz, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.34 (dd, J= 12.4, 1.7 Hz, 1H), 6.49 (d, J = 8.2 Hz, 1H), 4.30 (s, 3H), 3.97 (d, J= 11.7 Hz, 2H), 2.96 (s, 3H), 2.38 - 2.32 (m, 3H), 1.83 (t, J = 15.5 Hz, 2H), 1.60 (d, J= 44.4 Hz, 1H), 1.41 - 1.27 (m, 2H).

Example 68: Synthesis of Compound 327

Synthesis of Intermediate C59 , C ₅ 5 C ₅ 9

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(pyrrolidin-3- ylmethyl)carbamate (35.85 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added CS ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (20: 1) to afford tert-butyl N- ({ 1 -[7-({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)-2-methylindazol-4- yl]pyrrolidin-3-yl}methyl)carbamate (70 mg, 90%) as a solid. LCMS (ES, m z): 522 [M+H] ⁺ .

Synthesis of Compound 327 C ₅ 9 327 To a stirred solution of tert-butyl N-({ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}methyl)ca rbamate (70 mg, 0.134 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 100.32 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 3) to afford 4-[3-(aminomethyl)pyrrolidin-l-yl]-N-{8-fluoro-2-methylimida zo[1,2- a]pyridin-6-yl}-2-methylindazole-7-carboxamide (16.2 mg, 29%) as a solid. LCMS (ES, m/z): 422 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.82 (d, J= 11.3 Hz, 1H), 7.96 - 7.86 (m, 2H), 7.30 (dd, J= 12.5, 1.7 Hz, 1H), 6.02 (dd, J= 8.4, 2.2 Hz, 1H), 4.27 (s, 3H), 3.82 - 3.57 (m, 3H), 3.19 - 3.04 (m, 1H), 2.69 (d, J= 6.6 Hz, 1H), 2.39 (t, J= 7.4 Hz, 1H), 2.35 (s, 3H), 2.14 (s, 1H), 1.81 (q, J= 11.3, 9.3 Hz, 1H).

Example 69: Synthesis of Compound 328

Synthesis of Compound 328 328

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and N-(piperidin-4-yl)acetamide (25.45 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added CS ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (10: 1), followed by Prep-HPLC (Condition 5, Gradient 4) to afford 4-(4-acetamidopiperidin-l-yl)-N-{8-fluoro-2-methylimidazo[1, 2-a]pyridin- 6-yl}-2-methylindazole-7-carboxamide (15 mg, 21.69%) as a solid. LCMS (ES, m/z): 464 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.79 (s, 1H), 7.98 (d, J= 8.1 Hz, 1H), 7.90 (t, J= 4.9 Hz, 2H), 7.34 (dd, J= 12.4, 1.7 Hz, 1H), 6.51 (d, J= 8.2 Hz, 1H), 4.30 (s, 3H), 3.94 - 3.78 (m, 3H), 3.12 (t, J= 12.0 Hz, 2H), 2.35 (s, 3H), 1.90 (d, J = 12.5 Hz, 2H), 1.83 (s, 3H), 1.57 (q, J= 10.6 Hz, 2H).

Example 70: Synthesis of Compound 336

Synthesis of Intermediate C60 C ₅ 5 C ₆ 0

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(4- methylpiperidin-4-yl)carbamate (38.36 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added CS ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (20: 1) to afford tert-butyl N- {l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoy l)-2-methylindazol-4-yl]-4- methylpiperidin-4-yl} carbamate (65 mg, 81%) as a solid. LCMS (ES, m/z): 536 [M+H] ⁺ .

Synthesis of Compound 336

To a stirred solution of tert-butyl N-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]-4-methylpiperidin-4-yl}c arbamate (65 mg, 0.121 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 110.94 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 1) to afford 4-(4-amino-4-methylpiperidin-l-yl)-N-{8-fluoro-2-methylimida zo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (15.5 mg, 29%) as a solid. LCMS (ES, m/zy 436 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.78 (s, 1H), 7.97 (d, J= 8.2 Hz, 1H), 7.90 (d, J= 3.0 Hz, 1H), 7.34 (dd, J= 12.3, 1.7 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 4.29 (s, 3H), 3.53 (s, 4H), 2.35 (d, J= 0.9 Hz, 3H), 1.68 - 1.55 (m, 4H), 1.17 (s, 3H).

Example 71: Synthesis of Compound 346

Synthesis of Intermediate C61

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(4- fluoropyrrolidin-3-yl)-N-methylcarbamate (39.07 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added CS ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 100 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (20: 1) to afford tert-butyl N-{4-fluoro-l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2- methylindazol-4-yl]pyrrolidin-3-yl}-N-m ethylcarbamate (70 mg, 87%) as a solid. LCMS (ES, m/z): 540 [M+H] ⁺ .

Synthesis of Compound 346 C ₆ 1 346

To a stirred solution of tert-butyl N-{4-fluoro-l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}-N-m ethylcarbamate (70 mg, 0.130 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 103.78 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 4) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[3-fluoro- 4- (methylamino)pyrrolidin-l-yl]-2-methylindazole-7-carboxamide (3.4 mg, 6%) as a solid. LCMS (ES, m/z): 440 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.02 (s, 1H), 9.20 (d, J= 1.7 Hz, 1H), 8.86 (s, 1H), 7.95 (d, J= 8.2 Hz, 1H), 7.92 - 7.86 (m, 1H), 7.32 (dd, J= 12.4, 1.7 Hz, 1H), 6.06 (d, J= 8.4 Hz, 1H), 5.40 (d, J= 54.5 Hz, 1H), 4.28 (s, 3H), 3.94 (td, J= 25.2, 21.2, 9.8 Hz, 3H), 2.44 (s, 3H), 2.37 - 2.33 (m, 3H).

Example 72: Synthesis of Compound 329

Synthesis of Compound 329

A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- (oxiran-2-ylmethyl)indazol-4-yl]piperazine-l -carboxylate (38.0 mg, 0.07 mmol, 1.0 equiv) in DCM (0.4 mL) was treated with TFA (0.4 mL) at room temperature. The resulting mixture was stirred for 30 min at 0 °C, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 12) to afford 2-(2,3- dihydroxypropyl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6 -yl}-4-(piperazin-l-yl)indazole- 7-carboxamide trifluoroacetic acid salt (10.8 mg, 28%) as a solid. LCMS (ES, m/z): 468 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.32 (s, 1H), 9.44 (s, 1H), 9.07 (s, 2H), 8.88 (s, 1H), 8.11 (d, J = 2.7 Hz, 1H), 8.03 (d, J = 7.9 Hz, 1H), 7.66 (d, J= 11.7 Hz, 1H), 6.62 (d, J= 8.1 Hz, 1H), 4.69 (dd, J= 13.5, 3.7 Hz, 1H), 4.48 (dd, J = 13.5, 7.7 Hz, 1H), 4.14 (d, J = 6.4 Hz, 1H), 3.62 (d, J= 5.5 Hz, 4H), 3.48 (td, J= 11.0, 10.3, 5.5 Hz, 2H), 3.37 (s, 4H), 2.43 (s, 3H).

Example 73: Synthesis of Compound 356

Synthesis of Intermediate C62

C19 C ₆ 2

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2H- indazol-4-yl]piperazine-l -carboxylate (100.0 mg, 0.2 mmol, 1.0 equiv), 3 -bromooxolane (45.8 mg, 0.3 mmol, 1.5 equiv), and CS ₂ CO ₃ (198.0 mg, 0.6 mmol, 3.0 equiv) in DMF (1 mL) was stirred for 1 h at room temperature under nitrogen atmosphere. The reaction mixture was diluted with water (3 mL) and extracted with ethyl acetate (2 x 5 mL). The organic layers were combined, washed with brine (1x5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :4) to afford tert-butyl-4- [7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)- 2-(oxolan-3-yl)indazol-4-yl] piperazine- 1 -carboxylate (52.0 mg, 46%) as a solid. LCMS (ES, m/z): 564 [M+H] ⁺ .

Synthesis of Compound 356 A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- (oxolan-3-yl)indazol-4-yl]piperazine-l -carboxylate (52.0 mg, 0.09 mmol, 1.0 equiv) in DCM (0.5 mL) was treated with DCM (0.5 mL) at room temperature. The resulting mixture was stirred for 30 min at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 13) to afford N-{8-fluoro-2- methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-(oxolan-3 -yl)-4-(piperazin- 1 -yl)indazole-7-carboxamide trifluoroacetic acid salt (17.1 mg, 33%) as a solid. LCMS (ES, m/z): 464 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.32 (s, 1H), 9.47 (s, 1H), 9.07 (s, 2H), 8.94 (s, 1H), 8.17 (s, 1H), 8.04 (d, J = 7.9 Hz, 1H), 7.63 (d, J= 11.7 Hz, 1H), 6.63 (d, J= 8.1 Hz, 1H), 5.52 (ddt, J= 9.3, 6.8, 3.4 Hz, 2H), 4.33-4.09 (m, 3H), 3.98 (td, J= 8.2, 5.3 Hz, 1H), 3.77-3.57 (m, 4H), 3.37 (s, 4H), 2.63 (dq, J= 15.4, 7.7 Hz, 1H), 2.45 (s, 3H).

Example 74: Synthesis of Compounds 350 and 351

Synthesis of Compounds 350 and 351

4- [3 -(dimethylamino)pyrrolidin- 1 -yl]-N- { 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2- methylindazole-7-carboxamide (20 mg) was purified by PREP-CHIRAL-HPLC (Condition 1, Gradient 1) to afford Compound 350 (First peak: RT (min): 5.9) (5 mg) and Compound 351 (Second peak: RT (min): 6.4) (5 mg) as solids. Compound 350: LCMS: (ES, m, z):436 [M+H] ⁺ . ¹ H NMR: (400 MHz, DMSO-d ₆ ) δ 11.02 (d, J = 2.4 Hz, 1H), 9.20 (t, J = 2.1 Hz, 1H), 8.87 (d, J = 2.4 Hz, 1H), 7.97 - 7.86 (m, 2H), 7.36 - 7.28 (m, 1H), 6.05 (dd, J = 8.3, 2.4 Hz, 1H), 4.28 (d, J = 2.4 Hz, 3H), 3.85 (s, 1H), 3.77 (s, 1H), 3.65 (d, J = 9.3 Hz, 1H), 3.46 (s, 2H), 2.89 (s, 1H), 2.35 (d, J = 2.4 Hz, 6H), 2.29 (s, 3H), 1.92 (s, 1H). Compound 351: LCMS: (ES, m, z):436 [M+H] ⁺ . ¹ H NMR: (400 MHz, DMSO-d ₆ ) δ 11.02 (s, 1H), 9.20 (d, J = 1.7 Hz, 1H), 8.87 (s, 1H), 7.96 - 7.86 (m, 2H), 7.31 (dd, J = 12.4, 1.7 Hz, 1H), 6.05 (d, J = 8.4 Hz, 1H), 4.28 (s, 3H), 3.85 (t, J = 8.6 Hz, 1H), 3.77 (t, J = 9.4 Hz, 1H), 3.64 (q, J = 8.9 Hz, 1H), 3.48 (d, J = 9.0 Hz, 2H), 2.91 (s, 1H), 2.37 - 2.33 (m, 3H), 2.29 (s, 6H), 1.92 (t, J = 10.3 Hz, 1H). Example 75: Synthesis of Compound 288

Synthesis of Intermediate C63

To a stirred mixture of 2-amino-4-bromo-3 -methylbenzoic acid (10 g, 43.467 mmol, 1.0 equiv) and CS ₂ CO ₃ (21.2g, 65.201 mmol, 1.5 equiv) in DMF (100 mL) was added CH ₃ I (7.4 g, 52.160 mmol, 1.2 equiv) in portions at 0 °C under N2 atmosphere. The resulting mixture was stirred for 2 h at room temperature under N2 atmosphere. The resulting mixture was diluted with water (300 mL) and extracted with ethyl acetate (2x300 mL). The organic layers were combined, washed with water (3x400 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford methyl 2-amino-4-bromo-3 -methylbenzoate (10.4 g, 98%) as a solid. LCMS (ES, m, z):244 [M+H] ⁺ .

Synthesis of Intermediate C64

A mixture of methyl 2-amino-4-bromo-3-methylbenzoate (10 g, 40.969 mmol, 1.00 equiv) and AC ₂ O (5.02 g, 49.163 mmol, 1.2 equiv) in CHCL (200 mL) was stirred for 1 h at room temperature under N ₂ atmosphere. To the reaction mixture was added AcOK (1.21 g, 12.291 mmol, 0.3 equiv) and aspiral (1.056 mg, 90.132 mmol, 2.2 equiv). The resulting mixture was stirred for 16 h at 80 °C under N2 atmosphere. The precipitate formed that was collected by filtration and washed with isopropanol (2x50 mL). The resulting solid was dried to afford methyl 4-bromo-2H-indazole-7-carboxylate (10.1 g, 97%) as a solid. LCMS (ES, m/z)'.255 [M+H] ⁺ .

Synthesis of Intermediate C65

To a stirred solution of methyl 4-bromo-2H-indazole-7-carboxylate (1 g, 3.920 mmol, 1.00 equiv) in ethyl acetate (7.5 mL) was added Et3O ⁺ BF4- (3724.20 mg, 19.600 mmol, 5.0 equiv) in portions at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with water (10 mL) and extracted with ethyl acetate (3 x 20 mL). The organic layers were combined, washed with water (2x20 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :1) to afford methyl 4-bromo-2-ethylindazole-7-carboxylate (610 mg, 55%) as a solid. LCMS (ES, m, z):283 [M+H] ⁺ .

Synthesis of Intermediate C66

To a stirred mixture of methyl 4-bromo-2-ethylindazole-7-carboxylate (250 mg, 0.883 mmol, 1.0 equiv) and tert-butyl piperazine- 1 -carboxylate (328.9 mg, 1.766 mmol, 2.0 equiv) in dioxane (5 mL) was added CS ₂ CO ₃ (575.4 mg, 1.766 mmol, 2.0 equiv), RuPhos Palladacycle Gen.3 (73.9 mg, 0.088 mmol, 0.1 equiv), and RuPhos (82.4 mg, 0.177 mmol, 0.2 equiv) at room temperature under N ₂ atmosphere. The resulting mixture was stirred for 3 h at 100 °C under nitrogen atmosphere, then concentrated under reduced pressure and purified by silica gel column chromatography, eluted with ethyl acetate to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin- l-yl]-2-ethylindazole-7-carboxylate (240 mg, 70%) as a solid. LCMS (ES, m, z):389 [M+H] ⁺ . Synthesis of Intermediate C67

To a stirred mixture of methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-ethylindazole-7- carboxylate (210 mg, 0.541 mmol, 1.00 equiv) in THF (1.1 mL) and water (0.55 mL) was added LiOH (51.78 mg, 2.164 mmol, 4.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at 50°C. The resulting mixture was concentrated under reduced pressure, diluted with water (2 mL), acidified to pH 7 with HCl (1 N), and extracted with ethyl acetate (3x3 mL). The organic layers were combined, dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[4-(tert-butoxycarbonyl)piperazin-l- yl]-2-ethylindazole-7-carboxylic acid (200 mg, 99%) as a solid. LCMS (ES, m/z ):375 [M+H] ⁺ .

Synthesis of Intermediate C68

To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-ethylindazole-7- carboxylic acid (50 mg, 0.134 mmol, 1.00 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (22.06 mg, 0.134 mmol, 1.0 equiv) in DMF (1 mL) was added DIEA (34.5 mg, 0.268 mmol, 2.0 equiv) and HATU (60.9 mg, 0.161 mmol, 1.2 equiv) dropwise at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with water (3 mL) and extracted with ethyl acetate (3 x 3 mL). The organic layers were combined, washed with water (3x3 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[2-ethyl-7-({8-fluoro-2- methylimidazof 1 ,2-a]pyridin-6-yl } carbarnoyl)indazol-4-yl]piperazine- 1 -carboxylate (58 mg, 83%) as a solid. LCMS (ES, m, z):522 [M+H] ⁺ .

Synthesis of Compound 288

To a stirred solution of tert-butyl 4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (58 mg, 1.0 equiv) in DCM (1.8 mL) was added TFA (0.6 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 2) to afford 2-ethyl-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-l-yl)indazole -7-carboxamide (9.8 mg, 21%) as a solid. LCMS (ES, m, z):422 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.22 (d, J= 1.7 Hz, 1H), 8.86 (s, 1H), 8.00 (d, J= 8.0 Hz, 1H), 7.91 (d, J= 3.1 Hz, 1H), 7.32 (dd, J = 12.3, 1.7 Hz, 1H), 6.54 (d, J= 8.1 Hz, 1H), 4.60 (q, J= 7.3 Hz, 2H), 3.44 (t, J= 5.1 Hz, 4H), 3.07 (t, J= 5.1 Hz, 4H), 2.36 (s, 3H), 1.63 (t, J= 7.3 Hz, 3H).

Example 76: Synthesis of Compound 289

Synthesis of Intermediate C69 To a stirred solution of methyl 4-bromo-2-ethylindazole-7-carboxylate (250 mg, 0.883 mmol, 1.0 equiv) and tert-butyl (lR,5S)-3,8-diazabicyclo[3.2.1]octane-8-carboxylate (374.9 mg, 1.766 mmol, 2.0 equiv) in dioxane (5 mL) was added Cs ₂ CO ₃ (575.40 mg, 1.766 mmol, 2.0 equiv), RuPhos Palladacycle Gen.3 (73.9 mg, 0.088 mmol, 0.1 equiv), and RuPhos (82.4 mg, 0.177 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford methyl 4-[(lR,5S)-8-(tert-butoxycarbonyl)-3,8-diazabicyclo[3.2.1]oc tan-3-yl]-2- ethylindazole-7-carboxylate (300 mg, 82%) as a solid. LCMS (ES, m/z):415 [M+H] ⁺ .

Synthesis of Intermediate C70

To a stirred solution of methyl 4-[(lR,5S)-8-(tert-butoxycarbonyl)-3,8-diazabicyclo[3.2.1]oc tan- 3-yl]-2-ethylindazole-7-carboxylate (280 mg, 0.676 mmol, 1.0 equiv) in THF (1.4 mL) and water (1.4 mL) was added LiOEl H ₂ O (113.4 mg, 2.702 mmol, 4.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at 50 °C, then concentrated under reduced pressure to give a residue. The resulting mixture was diluted with water (2 mL) and extracted with ethyl acetate (3 x 3 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(lR,5S)-8-(tert-butoxycarbonyl)-3,8- diazabicyclo[3.2.1]octan-3-yl]-2-ethylindazole-7-carboxylic acid (250 mg, 92%) as a solid. LCMS (ES, m/z):401 [M+H] ⁺ .

Synthesis of Intermediate C71 To a stirred solution of 4-[(lR,5S)-8-(tert-butoxycarbonyl)-3,8-diazabicyclo[3.2.1]oc tan-3-yl]-2- ethylindazole-7-carboxylic acid (50.0 mg, 0.125 mmol, 1.0 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine (20.6 mg, 0.125 mmol, 1.0 equiv) in DMF (1 mL) was added DIEA (48.4 mg, 0.375 mmol, 3.0 equiv) and HATU (85.5 mg, 0.225 mmol, 1.8 equiv) at room temperature. The resulting mixture was stirred for 4 h at room temperature, then diluted with water (3 mL) and extracted with ethyl acetate (3x3 mL). The organic layers were combined, washed with water (3x3 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl (lR,5S)-3-[2-ethyl-7-({8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol- 4-yl]-3,8- diazabicyclo[3.2.1]octane-8-carboxylate (60 mg, 88%) as a solid. LCMS (ES, m, z):548 [M+H] ⁺ . Synthesis of Compound 289

To a stirred solution of tert-butyl (lR,5S)-3-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridi n- 6-yl}carbamoyl)indazol-4-yl]-3,8-diazabicyclo[3.2.1]octane-8 -carboxylate (60 mg, 1.0 equiv) in DCM (1.8 mL) was added TFA (0.6 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 2) to afford 4- [(lR,5S)-3,8-diazabicyclo[3.2.1]octan-3-yl]-2-ethyl-N-{8-flu oro-2-methylimidazo[1,2-a]pyridin- 6-yl}indazole-7-carboxamide (17.7 mg, 36%) as a solid. LCMS (ES, m, z):448 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.15 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.87 (s, 1H), 7.99-7.87 (m, 2H), 7.29 (dd, J= 12.4, 1.7 Hz, 1H), 6.37 (d, J= 8.4 Hz, 1H), 4.58 (q, J= 7.2 Hz, 2H), 3.72 (d, J= 11.0 Hz, 2H), 3.57 (s, 2H), 3.15 (d, J= 10.8 Hz, 2H), 2.52-2.51 (m, 1H), 2.35 (s, 3H), 1.78-1.74 (m, 4H), 1.62 (t, J= 7.3 Hz, 3H).

Example 77: Synthesis of Compound 293

Synthesis of Intermediate C72 C ₇ 2

A mixture of 3-methylpyrazin-2-amine (2.00 g, 18.326 mmol, 1.0 equiv) and NBS (3.59 g, 20.159 mmol, 1.1 equiv) in DMF (40 mL) was stirred for 1.5 h at room temperature. The resulting mixture was diluted with water (100 mL) and extracted with ethyl acetate (3 x 80 mL). The organic layers were combined, washed with brine (3x80 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford 5-bromo-3-methylpyrazin-2-amine (2.13 g, 62%) as a solid. LCMS (ES, m/z): 188.1 [M+H] ⁺ .

Synthesis of Intermediate C73

To a stirred mixture of 5-bromo-3-methylpyrazin-2-amine (2.1 g, 11.169 mmol, 1.0 equiv) and l-bromo-2,2-dimethoxypropane (2.45 g, 13.403 mmol, 1.2 equiv) in isopropanol (41 mL) was added PPTS (196.5 mg, 0.782 mmol, 0.07 equiv) in portions at room temperature. The resulting mixture was stirred for 16 h at 80 °C, then diluted with water (40 mL) and extracted with ethyl acetate (4 x 40 mL). The organic layers were combined, dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford 6- bromo-2,8-dimethylimidazo[1,2-a]pyrazine (890 mg, 35%) as a solid. LCMS (ES, m z).226 [M+H] ⁺ .Synthesis of Intermediate C74

To a stirred mixture of 6-bromo-2,8-dimethylimidazo[1,2-a]pyrazine (500.0 mg, 2.212 mmol, 1.0 equiv) and diphenylmethanimine (400.8 mg, 2.212 mmol, 1.0 equiv) in toluene (7.5 mL) was added t-BuONa (637.6 mg, 6.636 mmol, 3.0 equiv), Pd ₂ (dba) ₃ (202.5 mg, 0.221 mmol, 0.1 equiv), and t-BuXPhos (187.8 mg, 0.442 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 60 °C under nitrogen atmosphere, then concentrated under vacuum to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford N-{2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}-l,l- diphenylmethanimine (630 mg, 87%) as a oil. LCMS (ES, m/z):327 [M+H] ⁺ .

Synthesis of Intermediate C75

HCI, THF rt, 2 h

To a stirred solution of N-{2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}-l,l-diphenylmetha nimine (620 mg, 1.899 mmol, 1.0 equiv) in THF (12 mL) was added HCI (6 mL, con) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was diluted with water (15 mL), basified to pH 8 with saturated Na ₂ CO ₃ (aq.), and extracted with ethyl acetate (3 x 20 mL). The organic layers were combined, dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (10: 1) to afford 2,8-dimethylimidazo[1,2-a]pyrazin-6-amine (160 mg, 52%) as a solid. LCMS (ES, m/z): 163 [M+H] ⁺ .

Synthesis of Intermediate C76

To a stirred solution of methyl 4-bromo-2H-indazole-7-carboxylate (500 mg, 1.960 mmol, 1.00 equiv) and in ethyl acetate (7.5 mL) was added Me3OBF4 (1449.67 mg, 9.800 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (10 mL) and extracted with ethyl acetate (3 x 10 mL). The organic layers were combined, washed with water (2x10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford methyl 4-bromo-2- methylindazole-7-carboxylate (410 mg, 78%) as a solid. LCMS (ES, m/z)269 [M+H] ⁺ .

Synthesis of Intermediate C77

To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (410.0 mg, 1.524 mmol, 1.0 equiv) and tert-butyl piperazine- 1 -carboxylate (567.6 mg, 3.048 mmol, 2.0 equiv) in dioxane (8.2 mL) was added Cs ₂ CO ₃ (1.49 g, 4.572 mmol, 3.0 equiv), RuPhos Palladacycle Gen.3 (127.4 mg, 0.152 mmol, 0.1 equiv), and RuPhos (142.2 mg, 0.305 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 100 °C under nitrogen atmosphere, then concentrated under vacuum to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-[4-(tert- butoxycarbonyl)piperazin-l-yl]-2-methylindazole-7-carboxylat e (700 mg, 98%) as a solid. LCMS (ES, m/z):375 [M+H] ⁺ .

Synthesis of Intermediate C78 LiOH H ₂ O, THF

50 °C, 3 h

Boc Boc

To a stirred mixture of methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-methylindazole-7 - carboxylate (300 mg, 0.801 mmol, 1.00 equiv) in THF (1.5 mL) and water (1.5 mL) was added LiOH.H ₂ O (95.9 mg, 4.005 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 3 h at 50 °C, then concentrated under vacuum. The resulting mixture was diluted with water (6 mL), acidified to pH 7 with concentrated HCl, and extracted with ethyl acetate (4 x 10 mL). The organic layers were combined, dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[4-(tert- butoxycarbonyl)piperazin-l-yl]-2-methylindazole-7-carboxylic acid (200 mg, 69%) as a solid. LCMS (ES, m/z):361 [M+H] ⁺ .

Synthesis of Intermediate C79 C ₇ 8 C ₇ 9

To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-methylindazole-7 -carboxylic acid (80.0 mg, 0.222 mmol, 1.0 equiv) and 2,8-dimethylimidazo[1,2-a]pyrazin-6-amine (36.0 mg, 0.222 mmol, 1.0 equiv) in DMF (1.6 mL) was added DIEA (86.1 mg, 0.666 mmol, 3.0 equiv) and HATU (151.9 mg, 0.400 mmol, 1.8 equiv) at room temperature. The resulting mixture was stirred for 7 h at room temperature, then diluted with water (3 mL) and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with water (3x5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({2,8-dimethylimidazo[1,2-a]pyrazin- 6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-l-carboxylat e (60 mg, 54%) as a solid. LCMS (ES, m/z):505 [M+H]+Synthesis of Compound 293

To a stirred solution of tert-butyl 4-[7-({2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2- methylindazol-4-yl]piperazine-l -carboxylate (60 mg, 0.119 mmol, 1 equiv) in DCM (0.6 mL) was added TFA (1.8 mL) dropwise at 0 °C. The resulting mixture was stirred for 1 h at 0 °C, then concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 2) to afford N-{2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}-2-methyl-4- (piperazin-l-yl)indazole-7-carboxamide (5.9 mg, 12%) as a solid. LCMS (ES, m, z):405 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.27 (s, 1H), 9.30 (s, 1H), 8.81 (s, 1H), 8.07-7.95 (m, 2H), 6.50 (d, J= 8.2 Hz, 1H), 4.28 (s, 3H), 3.37 (s, 4H), 2.93 (d, J= 4.7 Hz, 4H), 2.73 (s, 3H), 2.39 (s, 3H).

Example 78: Synthesis of Compound 291

Synthesis of Compound 291

To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-(2-methoxyethyl)indazol-4-yl]piperazine-l -carboxylate (90.0 mg, 0.163 mmol, 1.0 equiv) in DCM (1.8 mL) was added BBr ₃ (163.5 mg, 0.652 mmol, 4.0 equiv) dropwise at 0 °C. The resulting mixture was concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 1, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[l, 2- a]pyridin-6-yl}-2-(2-hydroxyethyl)-4-(piperazin-l-yl)indazol e-7-carboxamide hydrochloride (4.3 mg, 6%) as a solid. LCMS (ES, m, z):438 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.43 (s, 1H), 9.63 (d, J= 1.6 Hz, 1H), 9.38-9.37 (m, 2H), 8.93 (s, 1H), 8.33-8.28 (m, 1H), 8.10 (d, J= 11.6 Hz, 1H), 8.05 (d, J= 8.0 Hz, 1H), 6.63 (d, J= 8.1 Hz, 1H), 4.63 (t, J= 5.4 Hz, 2H), 4.02 (t, J= 5.4 Hz, 2H), 3.66 (t, J= 5.1 Hz, 4H), 3.33-3.32 (m, 4H), 2.51 (s, 3H).

Example 79: Synthesis of Compound 292

Synthesis of Intermediate C80

To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (600.0 mg, 2.352 mmol, 1.0 equiv) and K ₂ CO ₃ (650.0 mg, 4.704 mmol, 2.0 equiv) in DMF (6 mL) was added 2-bromoethyl methyl ether (490.4 mg, 3.528 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 16 h at 80 °C, then diluted with water (15 mL) and extracted with ethyl acetate (3x20 mL). The organic layers were combined, washed with water (3x15 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-bromo-2-(2-methoxyethyl)indazole-7-carboxylate (200 mg, 27%) as a solid. LCMS (ES, m/z):312 [M+H] ⁺ .

Synthesis of Intermediate C81 To a stirred mixture of methyl 4-bromo-2-(2 -methoxy ethyl)indazole-7-carboxylate (200.0 mg, 0.639 mmol, 1.0 equiv) and tert-butyl piperazine- 1 -carboxylate (237.9 mg, 1.278 mmol, 2.0 equiv) in dioxane (4 mL) was added Cs ₂ CO ₃ (624.3 mg, 1.917 mmol, 3.0 equiv), RuPhos Palladacycle Gen.3 (53.4 mg, 0.064 mmol, 0.1 equiv), and RuPhos (59.61 mg, 0.128 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 100 °C under nitrogen atmosphere, then concentrated under vacuum to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford methyl 4-[4- (tert-butoxycarbonyl)piperazin-l-yl]-2-(2-methoxyethyl)indaz ole-7-carboxylate (320 mg, 99%) as an oil. LCMS (ES, m/z):419 [M+H] ⁺ .

Synthesis of Intermediate C82

To a stirred mixture of methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-(2- methoxyethyl)indazole-7-carboxylate (320.0 mg, 0.765 mmol, 1.0 equiv) in THF (1.6 mL) and water (1.6 mL) was added LiOH.H ₂ O (91.6 mg, 3.825 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then concentrated under vacuum. The resulting mixture was diluted with water (5 mL), acidified to pH 6 with HCl (1 N), and extracted with ethyl acetate (4 x 30 mL). The organic layers were combined, dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure. to afford 4-[4-(tert-butoxycarbonyl)piperazin- l-yl]-2-(2 -methoxy ethyl)indazole-7- carboxylic acid (220 mg, 71%) as a solid. LCMS (ES, m, z):405 [M+H] ⁺ .

Synthesis of Intermediate C83

To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-(2-methoxyethyl) indazole-7- carboxylic acid (220.0 mg, 0.544 mmol, 1.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin- 6-amine (89.8 mg, 0.544 mmol, 1.0 equiv) in DMF (4.4 mL) was added DIEA (210.9 mg, 1.632 mmol, 3.0 equiv) and HATU (372.3 mg, 0.979 mmol, 1.8 equiv) at room temperature. The resulting mixture was stirred for 4 h at room temperature, then diluted with water (12 mL) and extracted with ethyl acetate (3 x 10 mL). The organic layers were combined, washed with brine (3x10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2-(2-methoxyethyl)indazol-4-yl]piperazine-l- carboxylate (170 mg, 34%) as a solid. LCMS (ES, m/z):552 [M+H] ⁺ .

Synthesis of Compound 292

To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-(2-methoxyethyl)indazol-4-yl]piperazine-l -carboxylate (70.0 mg, 0.076 mmol, 1.0 equiv) in DCM (1.5 mL) was added TFA (0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 1, Gradient 1) to afford N-{8- fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-(2-methoxyethyl)-4-(piperazin- 1 -yl)indazole-7- carboxamide hydrochloride (17.9 mg, 52%) as a solid. LCMS (ES, m, z):452 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.40 (s, 1H), 9.65 (d, J= 1.5 Hz, 1H), 9.50-9.49 (m, 2H), 8.97 (s, 1H), 8.31 (s, 1H), 8.12 (d, J= 11.6 Hz, 1H), 8.05 (d, J= 8.0 Hz, 1H), 6.63 (d, J= 8.1 Hz, 1H), 4.75 (t, J= 5.2 Hz, 2H), 3.98 (t, J= 5.2 Hz, 2H), 3.66 (t, J= 5.0 Hz, 4H), 3.32-3.31 (m, 4H), 3.29 (s, 3H), 2.50 (s, 3H).

Example 80: Synthesis of Compound 296

Synthesis of Intermediate C84

To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (220.0 mg, 0.818 mmol, 1.0 equiv) and tert-butyl N-cyclopropyl-N-(pyrrolidin-3-yl)carbamate (370.1 mg, 1.636 mmol, 2.0 equiv) in dioxane (4 mL) was added Cs ₂ CO ₃ (532.7 mg, 1.636 mmol, 2.0 equiv), Pd2(dba)3 (74.8 mg, 0.082 mmol, 0.1 equiv), and X-Phos (77.9 mg, 0.164 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 85 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (10: 1) to afford methyl 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-l-y l}-2-methylindazole-7- carboxylate (290 mg, 86%) as a solid. LCMS (ES, m/z):415 [M+H] ⁺ .

Synthesis of Intermediate C85

To a stirred solution of methyl 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-l-y l}- 2-methylindazole-7-carboxylate (100.0 mg, 0.241 mmol, 1.0 equiv) in THF (1.25 mL) and water (1.25 mL) was added LiOH.H ₂ O (81.0 mg, 1.928 mmol, 8.0 equiv) at room temperature. The resulting mixture was stirred for 2 h at 50 °C, then concentrated under vacuum. The resulting mixture was diluted with water (2 mL), acidified to pH 7 with HCl (1 N), and extracted with ethyl acetate (3 x 2 mL). The organic layers were combined, dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-{3- [(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-l-yl}-2- methylindazole-7-carboxylic acid (80 mg, 83%) as a solid. LCMS (ES, m/z):401 [M+H] ⁺ .

Synthesis of Intermediate C86

To a stirred solution of 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-l-y l}-2- methylindazole-7-carboxylic acid (80.0 mg, 0.200 mmol, 1.0 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine (33.0 mg, 0.200 mmol, 1.0 equiv) in DMF (1.4 mL) was added DIEA (77.5 mg, 0.600 mmol, 3.0 equiv) and HATU (113.9 mg, 0.300 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 3 h at 50 °C, then diluted with water (1 mL) and extracted with ethyl acetate (3 x 2 mL). The organic layers were combined, washed with water (3x2 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA (100%) to afford tert-butyl N-cyclopropyl-N-{ l-[7-({8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methy lindazol-4-yl]pyrrolidin-3- yl}carbamate (80 mg, 73%) as an oil. LCMS (ES, m, z):548 [M+H] ⁺ .

Synthesis of Compound 296 To a stirred solution of tert-butyl N-cyclopropyl-N-{ l-[7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3- yl}carbamate (80.0 mg, 0.088 mmol, 1.0 equiv) in DCM (2.4 mL) was added TFA (0.8 mL) dropwise at 0 °C. The resulting mixture was concentrated under vacuum to give a residue. The residue was purified by Prep- HPLC (Condition 2, Gradient 2) to afford 4-[3-(cyclopropylamino)pyrrolidin-l-yl]-N-{8-fluoro- 2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carbo xamide (9.8 mg, 25%) as a solid. LCMS (ES, m/z):448 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.82 (s, 1H), 7.96-7.86 (m, 2H), 7.31 (dd, J= 12.4, 1.7 Hz, 1H), 6.01 (d, J= 8.4 Hz, 1H), 4.27 (s, 3H), 3.84-3.71 (m, 2H), 3.64 (d, J= 8.1 Hz, 1H), 3.56 (q, J= 5.4 Hz, 1H), 3.51- 3.44 (m, 1H), 2.35 (s, 3H), 2.17 (dt, J= 7.2, 4.5 Hz, 2H), 1.98 (dq, J= 12.6, 6.4 Hz, 1H), 0.49- 0.36 (m, 2H), 0.32-0.20 (m, 2H).

Example 81: Synthesis of Compound 298

Synthesis of Intermediate C87 C ₈ 7

To a stirred solution of methyl 4-bromo-2H-indazole-7-carboxylate (0.5 g, 1.960 mmol, 1.0 equiv) in ethyl acetate (7.5 mL) was added tetrafluoroboranuide; trimethyloxidanium (1.45g, 9.800 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (10 mL) and extracted with ethyl acetate (3 x 10 mL). The organic layers were combined, washed with water (2x10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford methyl 4-bromo-2-methylindazole-7-carboxylate (560 mg, 99%) as a solid. LCMS (ES, m/z):269 [M+H] ⁺ .

Synthesis of Intermediate C88

To a stirred solution of methyl 4-bromo-2-methylindazole-7-carboxylate (200.0 mg, 0.743 mmol, 1.0 equiv) and tert-butyl N-methyl-N-(pyrrolidin-3-yl)carbamate (297.7 mg, 1.486 mmol, 2.0 equiv) in dioxane (4 mL) was added CS ₂ CO ₃ (726.5 mg, 2.229 mmol, 3.0 equiv), RuPhos (69.4 mg, 0.149 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (62.2 mg, 0.074 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 100 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (10: 1) to afford methyl 4-{3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l-yl}-2- methylindazole-7- carboxylate (280 mg, 97%) as a solid. LCMS (ES, m, z):389 [M+H] ⁺ .

Synthesis of Intermediate C89

To a stirred solution of methyl 4-{3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l-yl}-2- methylindazole-7-carboxylate (290.0 mg, 0.747 mmol, 1.0 equiv) in THF (3.7 mL) was added water (3.7 mL) and lithiumol hydrate (156.6 mg, 3.735 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 16 h at 50 °C. The resulting mixture was concentrated under vacuum, diluted with water (10 mL), acidified to pH 7 with concentrated HCl, and extracted with ethyl acetate (3 x 10 mL). The organic layers were combined, washed with brine (3x10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-{3-[(tert- butoxycarbonyl)(methyl)amino]pyrrolidin-l-yl}-2-methylindazo le-7-carboxylic acid (270 mg, 97%) as a solid. LCMS (ES, m/z):375 [M+H] ⁺ .

Synthesis of Intermediate C90

To a stirred solution of 4-{3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l-yl}-2- methylindazole-7-carboxylic acid (70.0 mg, 0.187 mmol, 1.0 equiv) in DMF (1.4 mL) was added HATU (106.6 mg, 0.280 mmol, 1.5 equiv), DIEA (72.5 mg, 0.561 mmol, 3.0 equiv), and 8- fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (30.9 mg, 0.187 mmol, 1 equiv) in portions at room temperature. The resulting mixture was stirred for 7 h at room temperature, then diluted with water (5 mL) and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with water (3x5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA (100%) to afford tert-butyl N-{ 1- [7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)- 2-methylindazol-4-yl]pyrrolidin- 3 -yl}-N-methyl carbamate (77 mg, 79%) as a solid. LCMS (ES, m/z):522 [M+H] ⁺ .

Synthesis of Compound 298

To a stirred solution of tert-butyl N-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}-N-m ethylcarbamate (77.0 mg, 0.148 mmol, 1.0 equiv) in DCM (2.1 mL) was added TFA (0.7 mL) dropwise at 0 °C. The resulting mixture was stirred for 1 h at room temperature, then concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford N-{8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[3-(me thylamino)pyrrolidin-l- yl]indazole-7-carboxamide trifluoroacetic acid salt (30.3 mg, 49%) as a solid. LCMS (ES, m, z):422 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.18 (s, 1H), 9.39 (s, 1H), 8.90-8.89 (m, 3H), 8.08 (s, 1H), 7.99 (d, J= 8.2 Hz, 1H), 7.70 (d, J= 11.9 Hz, 1H), 6.13 (d, J= 8.4 Hz, 1H), 4.31 (s, 3H), 3.99-3.97 (m, 2H), 3.89-3.73 (m, 3H), 2.73-2.67 (m, 3H), 2.49-2.48 (m, 1H), 2.42 (s, 3H), 2.28-2.25 (m, 1H).

Example 82: Synthesis of Compound 301

Synthesis of Intermediate C91

To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (120.0 mg, 0.446 mmol, 1.0 equiv) and tert-butyl l,7-diazaspiro[3.5]nonane-l-carboxylate (201.8 mg, 0.892 mmol, 2.0 equiv) in dioxane (2.5 mL) was added CS ₂ CO ₃ (435.9 mg, 1.338 mmol, 3.0 equiv), RuPhos (41.6 mg, 0.089 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (37.3 mg, 0.045 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 85 °C under nitrogen atmosphere, then concentrated under vacuum to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (10: 1) to afford tert-butyl 7-[7-(methoxycarbonyl)-2-methylindazol-4-yl]-l,7- diazaspiro[3.5 ]nonane-l -carboxylate (180 mg, 97%) as a solid. LCMS (ES, m/z):415 [M+H] ⁺ .

Synthesis of Intermediate C92

To a stirred mixture of tert-butyl 7-[7-(methoxycarbonyl)-2-methylindazol-4-yl]-l,7- diazaspiro[3.5 ]nonane-l -carboxylate (180.0 mg, 0.434 mmol, 1.0 equiv) in THF (2.5 mL) and water (2.5 mL) was added LiOH.H ₂ O (52.0 mg, 2.170 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 4 h at 50 °C, then concentrated under vacuum, diluted with water (5 mL), acidified to pH 6 with HCl (1 N), and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[l-(tert-butoxycarbonyl)-l,7- diazaspiro[3.5]nonan-7-yl]-2-methylindazole-7-carboxylic acid (160 mg, 92%) as a solid. LCMS (ES, m/z):401 [M+H] ⁺ .

Synthesis of Intermediate C93

To a stirred solution of 4-[l-(tert-butoxycarbonyl)-l,7-diazaspiro[3.5]nonan-7-yl]-2- methylindazole-7-carboxylic acid (160.0 mg, 0.400 mmol, 1.0 equiv) in DMF (3.2 mL) was added DIEA (206.5 mg, 1.600 mmol, 4.0 equiv), HATU (227.8 mg, 0.600 mmol, 1.5 equiv), and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (66.0 mg, 0.400 mmol, 1.0 equiv) in portions at room temperature. The resulting mixture was stirred for 3 h at 50 °C, then diluted with water (10 mL) and extracted with EtOAc (3 x 10 mL). The organic layers were combined, washed with water (3x5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with ethyl acetate to afford tert-butyl 7-[7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol- 4-yl]-l,7-diazaspiro[3.5]nonane- 1-carboxylate (140 mg, 64%) as a solid. LCMS (ES, m, z):548 [M+H] ⁺ .

Synthesis of Compound 301

To a stirred solution of tert-butyl 7-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]-l,7-diazaspiro[3.5]nonan e-l-carboxylate (140.0 mg, 0.205 mmol, 1.0 equiv) in DCM (3 mL) was added TFA (1 mL) dropwise at 0 °C. The resulting mixture was stirred for 1 h at 0 °C, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford 4-{ l,7- diazaspiro[3.5]nonan-7-yl}-N-{8-fluoro-2-methylimidazo[1,2-a ]pyridin-6-yl}-2-methylindazole- 7-carboxamide trifluoroacetic acid salt (11.9 mg, 13%) as a solid. LCMS (ES, m, z):448 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.22 (s, 1H), 9.42 (d, J= 1.5 Hz, 1H), 8.86-8.85 (m, 3H), 8.10 (d, J= 2.7 Hz, 1H), 8.00 (d, J= 8.1 Hz, 1H), 7.75 (d, J= 12.0 Hz, 1H), 6.57 (d, J= 8.2 Hz, 1H), 4.32 (s, 3H), 3.93 (t, J= 7.3 Hz, 2H), 3.65-3.54 (m, 2H), 3.38 (dd, J= 13.5, 6.9 Hz, 2H), 2.42-2.35 (m, 5H), 2.19-2.18 (m, 4H).

Example 83: Synthesis of Compound 337

Synthesis of Intermediate C94

A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2H- indazol-4-yl]piperazine-l -carboxylate (150 mg, 0.304 mmol, 1 equiv), l-chloro-2-iodoethane (69.44 mg, 0.365 mmol, 1.2 equiv), and K ₂ CO ₃ (63.01 mg, 0.456 mmol, 1.5 equiv) in DMF (2 mL) was stirred for 12 h at room temperature. The solids were removed by filtration. The filtrate was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl 4-[2- (2-chloroethyl)-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6 -yl}carbamoyl)indazol-4- yl]piperazine-l -carboxylate (60 mg, 36%) as a solid. LCMS (ES, m z): 556 [M+H] ⁺ .

Synthesis of Compound 337

A mixture of tert-butyl 4-[2-(2-chloroethyl)-7-({8-fluoro-2-methylimidazo[1,2-a]pyri din-6- yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (80 mg, 0.144 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The resulting mixture was basified to pH 8 with 7 N NH ₃ (gas) in methanol, then concentrated under reduced pressure to give a residue. The residue was purified by reverse flash (Condition 1, Gradient 2) to afford 2-(2- chloroethyl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl} -4-(piperazin-l-yl)indazole-7- carboxamide (18 mg, 27%) as a solid. LCMS (ES, m/z): 456 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.25 (d, J= 1.7 Hz, 1H), 8.92 (s, 1H), 8.01 (d, J= 8.1 Hz, 1H), 7.91 (dd, J= 3.2, 1.0 Hz, 1H), 7.39 (dd, J= 12.5, 1.7 Hz, 1H), 6.51 (d, J= 8.2 Hz, 1H), 4.91 (t, J= 5.7 Hz, 2H), 4.33 (t, J= 5.7 Hz, 2H), 3.45 - 3.31 (m, 4H), 2.94 (t, J= 5.0 Hz, 4H), 2.35 (d, J= 0.8 Hz, 3H).

Example 84: Synthesis of Compound 338

Synthesis of Intermediate C95 C ₁ 9 C ₅ 9

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2H- indazol-4-yl]piperazine-l -carboxylate (100 mg, 0.203 mmol, 1 equiv), 2-(iodomethyl)oxetane (48.14 mg, 0.244 mmol, 1.2 equiv), and CS ₂ CO ₃ (198.05 mg, 0.609 mmol, 3.0 equiv) in DMF (2 mL) was stirred for 3 h at room temperature. The reaction mixture was filtered to remove solids. The filtrate was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(oxetan-2- ylmethyl)indazol-4-yl]piperazine-l -carboxylate (70 mg, 61%) as a solid. LCMS (ES, m/z): 564 [M+H] ⁺ .

Synthesis of Compound 338

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- (oxetan-2-ylmethyl)indazol-4-yl]piperazine-l-carboxylate (60 mg, 0.106 mmol, 1 equiv) and TFA (97.10 mg, 0.848 mmol, 8 equiv) in DCM (2 mL) was stirred for 1 h at room temperature. The resulting mixture was basified to pH 8 with 7 N NH ₃ (gas) in methanol, then concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 1, Gradient 3) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin- 6-yl}-2-(oxetan-2-ylmethyl)-4-(piperazin-l-yl)indazole-7-car boxamide (18 mg, 36%) as a solid. LCMS (ES, m/z): 464 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.14 (s, 1H), 9.25 (d, J= 1.6 Hz, 1H), 8.81 (s, 1H), 8.00 (d, J= 8.1 Hz, 1H), 7.95 - 7.88 (m, 1H), 7.31 (dd, J= 12.4, 1.7 Hz, 1H), 6.51 (d, J= 8.2 Hz, 1H), 5.29 (t, J= 6.0 Hz, 1H), 4.88 (dd, J= 13.9, 6.6 Hz, 1H), 4.79 (dd, J= 13.8, 4.3 Hz, 1H), 4.64 - 4.51 (m, 1H), 4.43 (dt, J= 9.0, 6.0 Hz, 1H), 3.37 (d, J= 5.0 Hz, 4H), 2.94 (s, 4H), 2.78 (dd, J= 11.4, 7.4 Hz, 1H), 2.56 (dd, J = 9.2, 2.3 Hz, 1H), 2.35 (d, J= 0.8 Hz, 3H).

Example 85: Synthesis of Compound 306

Synthesis of Intermediate C96 C ₉ 6

To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (100 mg, 0.392 mmol, 1 equiv) and 2-bromoethyl methyl ether (81.74 mg, 0.588 mmol, 1.5 equiv) in DMF (2.5 mL) was added K ₂ CO ₃ (108.37 mg, 0.784 mmol, 2 equiv) at room temperature. The resulting mixture was stirred for 5 h at 80 °C, then cooled to room temperature. The resulting mixture was quenched with water (5 mL) and extracted with ethyl acetate (2 x 3 mL). The organic layers were combined, washed with brine (2 x 2 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4- bromo-2-(2-methoxyethyl)indazole-7-carboxylate (93.5 mg, 76%) as a solid. LCMS (ES, m/z):313 [M+H] ⁺ .

Synthesis of Intermediate C97

C ₉ 6 C ₉ 7

A mixture of methyl 4-bromo-2-(2-methoxyethyl)indazole-7-carboxylate (20 mg, 0.064 mmol, 1 equiv) and LiOH (5 mg, 0.192 mmol, 3 equiv) in water (0.25 mL), THF (0.5 mL) and methanol (0.5 mL) was stirred for 3 h at room temperature. The resulting mixture was concentrated under vacuum to give a residue. The residue was acidified to pH 3 with 1 N HCl. A solid precipitated that was collected by filtration, then washed with water (0.25 mL) to afford 4-bromo-2-(2- methoxyethyl)indazole-7-carboxylic acid (10 mg, 52%) as a solid. LCMS (ES, m/z):299 [M+H] ⁺ .

Synthesis of Intermediate C98

To a stirred of mixture of 4-bromo-2-(2-methoxyethyl)indazole-7-carboxylic acid (550 mg, 1.839 mmol, 1 equiv), DIEA (712 mg, 5.517 mmol, 3 equiv), and HATU (839 mg, 2.207 mmol, 1.2 equiv) in DMF (15 mL) was added 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (364 mg, 2.207 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with water (10 mL) and extracted with ethyl acetate (2 x 20 mL). The organic layers were combined, washed with brine (1 x 20 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2 - methoxyethyl)indazole-7-carboxamide (350 mg, 43%) as a solid. LCMS (ES, m, z):446 [M+H] ⁺ .

Synthesis of Intermediate C99 C ₉ 9

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2 - methoxyethyl) indazole-7-carboxamide (100 mg, 0.224 mmol, 1 equiv), rac-tert-butyl (2R,6S)- 2,6-dimethylpiperazine-l- carboxylate (96 mg, 0.448 mmol, 2 equiv), and Cs ₂ CO ₃ (219 mg, 0.672 mmol, 3 equiv) in dioxane (5 mL) as added RuPhos (20 mg, 0.045 mmol, 0.2 equiv) and RuPhos Pd G3 (18 mg, 0.022 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 80 °C under nitrogen atmosphere, then quenched with water (10 mL) and extracted with ethyl acetate (2 xlO mL). The organic layers were combined, washed with water (2x5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :2) to afford rac-tert-butyl (2R,6S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}c arbamoyl)-2-(2-methoxy ethyl) indazol-4-yl]-2,6-dimethylpiperazine-l-carboxylate(60 mg, 46%) as a solid. LCMS (ES, m, z):580 [M+H] ⁺ .

Synthesis of Compound 306 C ₉ 9

306

A mixture of tert-butyl (2R,6S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2- (2-methoxyethyl)indazol-4-yl]-2,6-dimethylpiperazine-l-carbo xylate (50 mg, 0.086 mmol, 1 equiv) and TFA (1 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum to give a residue. The residue was adjusted to pH 8 with ammonia and purified by Prep-HPLC (Condition 5, Gradient 5) to afford 4-[(3R,5S)-3,5-dimethylpiperazin-l-yl]-N-{8-fluoro-2-methyli midazo[1,2-a]pyridin-6-yl}-2-(2- methoxyethyl)indazole-7-carboxamide (12 mg, 24% ) as a solid. LCMS (ES, m, ^/ z):479.56 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.12 (s, 1H), 9.23 (d, J= 1.6 Hz, 1H), 8.81 (s, 1H), 7.98 (d, J= 8.1 Hz, 1H), 7.91 (d, J = 3.4 Hz, 1H), 7.31 (dd, J= 12.4, 1.7 Hz, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.74 (t, J= 5.2 Hz, 2H), 3.95 (t, J= 5.2 Hz, 2H), 3.83 - 3.73 (m, 2H), 3.30 (s, 3H), 2.94 (d, J= 8.0 Hz, 2H), 2.45 (d, J= 11.0 Hz, 1H), 2.35 (s, 3H), 2.29 (s, 1H), 1.07 (d, J= 6.2 Hz, 6H). ¹⁹ F NMR (282.3 MHz, DMSO-d ₆ ) δ -132.011.

Example 86: Synthesis of Compound 294

Synthesis of Intermediate Cl 00 cioo o a stirred mixture of 2-amino-4-bromo-3 -methylbenzoic acid (5.00 g, 21.73 mmol, 1.00 equiv) and Cs ₂ CO ₃ (10.62 g, 32.6 mmol, 1.50 equiv) in DMF (50 mL) was added methyl iodide (3.70 g, 26.08 mmol, 1.20 equiv) dropwise at 0 °C under nitrogen atmosphere. The resulting mixture was stirred for 8 h at room temperature under nitrogen atmosphere, then diluted with water and extracted with ethyl acetate (3x200 mL). The organic layers were combined, washed with half saturated aqueous NaCl (3x100 mL), followed by saturated aqueous NaCl (1x100 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford methyl 2-amino-4-bromo-3 -methylbenzoate (5 g, 94%) as a solid. LCMS (ES, m, z):244 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.57 - 7.50 (m, 1H), 6.86 - 6.78 (m, 3H), 3.80 (s, 3H), 2.24 (s, 3H).

Synthesis of Intermediate C101

Methyl 2-amino-4-bromo-3-methylbenzoate (3.60 g, 14.75 mmol, 1.00 equiv), m-CPBA (10.18 g, 59.00 mmol, 4.00 equiv) and DCE (80 mL) were combined at room temperature. The resulting mixture was stirred for 2 h at 90 °C under nitrogen atmosphere, then quenched with water at 0 °C, and purified by silica gel column chromatography, eluted with PE / EA (5: 1) to afford methyl 4-bromo-3-methyl-2-nitrobenzoate (3.5 g, 87%) as a solid.

Synthesis of Intermediate Cl 02

Methyl 4-bromo-3-methyl-2-nitrobenzoate (3.50 g, 12.77 mmol, 1.00 equiv), NBS (2.27 g, 12.77 mmol, 1.00 equiv), BPO (0.33 g, 1.28 mmol, 0.10 equiv), and CCE (70 mL) were combined at room temperature. The resulting mixture was stirred for 16 h at 80 °C under nitrogen atmosphere, then purified by silica gel column chromatography, eluted with PE / EA (5: 1) to afford 3 g methyl 4-bromo-3 -(brom omethyl)-2 -nitrobenzoate.

Synthesis of Intermediate C103

Methyl 4-bromo-3-(bromomethyl)-2-nitrobenzoate (3.00 g, 8.5 mmol, 1.00 equiv), aminocyclopropane (0.73 g, 12.75 mmol, 1.50 equiv), K ₂ CO ₃ (2.35 g, 16.99 mmol, 2.00 equiv), and acetonitrile (60 mL) were combined at room temperature. The resulting mixture was stirred for 16 h at room temperature under nitrogen atmosphere, then purified by Chiral -Prep-HPLC (Condition 2, Gradient 1) to afford methyl 4-bromo-3-[(cyclopropylamino)methyl]-2- nitrobenzoate (400 mg, 14%) as a solid. LCMS (ES, m, z):329 [M+H] ⁺ .

Synthesis of Intermediate C104

Methyl 4-bromo-3-[(cyclopropylamino)methyl]-2-nitrobenzoate (300 mg, 0.91 mmol, 1.00 equiv), SnCl ₂ 2H ₂ O (411.3 mg, 1.82 mmol, 2.00 equiv), and ethanol (10 mL) were combined at room temperature. The resulting mixture was stirred for 4 h at 40 °C under nitrogen atmosphere, then purified by reverse flash chromatography (Condition 4, Gradient 1) to afford 4-bromo-2- cyclopropylindazole -7-carboxylic acid (160 mg, 62%) as a solid. LCMS (ES, m, z):28 l [M+H] ⁺ .

Synthesis of Intermediate C105

To a stirred solution of 4-bromo-2-cyclopropylindazole-7-carboxylic acid (150 mg, 0.53 mmol, 1.00 equiv) and CS ₂ CO ₃ (260.8 mg, 0.8 mmol, 1.50 equiv) in DMF (2 mL) was added CH ₃ I (90.89 mg, 0.64 mmol, 1.20 equiv) dropwise at 0 °C under nitrogen atmosphere. The resulting mixture was stirred for 8 h at room temperature under nitrogen atmosphere. The resulting mixture was extracted with EtOAc (3x40 mL). The combined organic layers were washed with half saturated aqueous NaCl (3x20 mL) and 1x50 ml of saturated aqueous NaCl , dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. This resulted in methyl 4-bromo-2-cyclopropylindazole -7-carboxylate (150 mg, 95%) as a solid. LCMS (ES, m, z):295 [M+H] ⁺ .

Synthesis of Intermediate C106

Methyl 4-bromo-2-cyclopropylindazole-7-carboxylate (140 mg, 0.47 mmol, 1.00 equiv), tertbutyl piperazine- 1 -carboxylate (106.02 mg, 0.57 mmol, 1.20 equiv), Cs ₂ CO ₃ (463.67 mg, 1.42 mmol, 3.00 equiv), RuPhos Palladacycle Gen.3 (39.67 mg, 0.05 mmol, 0.10 equiv), and dioxane (2 mL) were combined at room temperature. The resulting mixture was stirred for 1 overnight at 60 °C under nitrogen atmosphere, then purified by silica gel column chromatography, eluted with PE / EA (5:1) to afford methyl 4-[4-(tert-butoxy carbonyl) piperazin- 1 -yl]-2- cyclopropylindazole-7 -carboxylate (87 mg, 46%) as a solid. LCMS (ES, m/z):40 l [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 8.64 (s, 1H), 7.84 (d, J= 8.1 Hz, 1H), 6.36 (d, J= 8.2 Hz, 1H), 4.09 (tt, J= 7.6, 3.9 Hz, 1H), 3.80 (s, 3H), 3.57 - 3.50 (m, 4H), 3.36 (dd, J= 6.4, 3.8 Hz, 4H), 1.44 (s, 9H), 1.31 (td, J = 4.7, 4.3, 3.1 Hz, 2H), 1.19 - 1.07 (m, 2H).

Synthesis of Intermediate Cl 07

Methyl 4-[4-(tert-butoxy carbonyl) piperazin-l-yl]-2-cyclopropylindazole -7-carboxylate (60 mg, 0.15 mmol, 1.00 equiv), LiOH (14.35 mg, 0.6 mmol, 4.00 equiv) and THF (2 mL) were combined at room temperature. The resulting mixture was stirred for 4 h at 60 °C under nitrogen atmosphere, then acidified to pH 6 with HCl (aq.) and extracted with ethyl acetate (3x20 mL).

The organic layers were combined, washed with water (3x20 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-[4- (tert-butoxy carbonyl) piperazin- 1 -yl]-2- cyclopropylindazole-7-carboxylic acid (54 mg, 93%) as a solid. LCMS (ES, m/z):387 [M+H] ⁺ .

Synthesis of Intermediate Cl 08

A mixture of 4-[4-(tert-butoxycarbonyl) piperazin-l-yl]-2-cyclopropylindazole-7-carboxylic acid (30 mg, 0.08 mmol, 1.00 equiv), 8-fluoro-2-methylimidazo[1,2-a] pyridin-6-amine (19.23 mg, 0.12 mmol, 1.50 equiv), EDCI (17.86 mg, 0.09 mmol, 1.20 equiv), HOBT (12.59 mg, 0.09 mmol, 1.20 equiv), DIEA (30.1 mg, 0.23 mmol, 3.00 equiv), and DMF (1 mL) was stirred for 16 h at 50 °C under nitrogen atmosphere. The resulting mixture was extracted with ethyl acetate (3x20 mL). The organic layers were combined, washed with water (3x20 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford tert-butyl 4-[2-cyclopropyl-7-({8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl} carbamoyl) indazol-4-yl] piperazine- 1- carboxylate (35 mg, 84%) as a solid. LCMS (ES, m, z):534 [M+H] ⁺ .

Synthesis of Compound 294

A mixture of tert-butyl 4-[2-cyclopropyl-7-({8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl} carbamoyl)indazol-4-yl]piperazine-l -carboxylate (33 mg, 0.06 mmol, 1.00 equiv) and ZnBn (139.28 mg, 0.62 mmol, 10.00 equiv) in DCM (0.5 mL) was stirred for 30 min at 40 °C under nitrogen atmosphere. To the reaction mixture was added ethanol (0.5 mL), and the resulting mixture was stirred for an additional 10 min. The resulting product was purified by Prep-HPLC (Condition 6, Gradient 1) to afford 2-cyclopropyl-N-{8-fluoro-2-methylimidazo[1,2-a] pyridin- 6-yl}-4-(piperazin-l-yl) indazole-7-carboxamide (16.5 mg, 60.93%) as a solid. LCMS (ES, m, z):434 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.93 (s, 1H), 9.18 (d, J= 1.6 Hz, 1H), 8.85 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.91 (d, J= 3.1 Hz, 1H), 7.18 (dd, J= 12.2, 1.7 Hz, 1H), 6.48 (d, J= 8.2 Hz, 1H), 4.28 (tt, J= 7.6, 3.9 Hz, 1H), 3.34 (d, J= 9.9 Hz, 4H), 2.91 (t, J= 5.0 Hz, 4H), 2.35 (d, J= 0.9 Hz, 3H), 1.47 (td, J= 5.2, 4.4, 3.1 Hz, 2H), 1.25 - 1.12 (m, 2H).

Example 87: Synthesis of Compound 275

Synthesis of Intermediate Cl 09 Cs ₂ CO ₃ (2.5 eq), dioxane, 100 °C, overnight

A mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l-carboxylate (100.0 mg, 0.27 mmol, 1.00 equiv), 6-bromo-2-methyl-8-(trifluoromethyl)imidazo[1,2-a]pyridine (93.1 mg, 0.33 mmol, 1.2 equiv), Cs ₂ CO ₃ (226.6 mg, 0.69 mmol, 2.50 equiv), BrettPhos (29.8 mg, 0.05 mmol, 0.2 equiv), BrettPhos-Pd-G ₃ (25.2 mg, 0.02 mmol, 0.1 equiv) and dioxane (5 mL) was evacuated and flushed three times with nitrogen. The resulting solution was stirred for 16 h at 100°C, then quenched with water and extracted with ethyl acetate (3x20 mL). The organic layers were combined, washed with saturated aqueous NaCl (1x50 mL), dried over anhydrous sodium sulfate, and filtered. The filtrate was concentrated under vacuum to give a residue. The residue was applied onto a silica gel column with ethyl acetate/petroleum ether to afford tertbutyl 4-(2-methyl-7-{[2-methyl-8-(trifluoromethyl)imidazo[1,2-a]py ridin-6- yl]carbamoyl}indazol-4-yl)piperazine-l-carboxylate (100 mg, 64%) as a solid. LCMS (ES, m/z): 558 [M+H] ⁺ .

Synthesis of Compound 275

A mixture of tert-butyl 4-(2-methyl-7-{[2-methyl-8-(trifluoromethyl)imidazo[1,2-a] pyridin-6- yl]carbamoyl} indazol-4-yl)piperazine-l -carboxylate (100.0 mg, 0.18 mmol, 1.00 equiv), DCM (2.0 mL), and TFA (0.5 mL) was stirred for 30 min at room temperature. The resulting mixture was concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 6, Gradient 2) to afford 2-methyl-N-[2-methyl-8-(trifluoromethyl)imidazo[1,2-a] pyridin-6-yl]-4-(piperazin-l-yl)indazole-7-carboxamide (36.7 mg, 44.2%) as a solid. LCMS (ES, m/z): 458 [M+H] ⁺ . ¹ H-NMR (400 MHz, DMSO-d ₆ ) δ 11.09 (s, 1H), 9.51 (d, J= 1.9 Hz, 1H), 8.81 (s, 1H), 8.02 - 7.94 (m, 2H), 7.83 - 7.78 (m, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.29 (s, 3H), 3.39 - 3.32 (m, 4H), 2.95 - 2.88 (m, 4H), 2.39 (s, 3H).

Example 88: Synthesis of Compound 307

Synthesis of Intermediate Cl 10 eno

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2 - methoxyethyl)indazole-7-carboxamide (100 mg, 0.224 mmol, 1 equiv), tert-butyl N-ethyl-N- (piperidin-4-yl)carbamate (102 mg, 0.448 mmol, 2 equiv), and Cs ₂ CO ₃ (219 mg, 0.672 mmol, 3 equiv) in dioxane (6 mL) was added RuPhos (21 mg, 0.045 mmol, 0.2 equiv) and RuPhos Pd G3 (18 mg, 0.022 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 80°C under nitrogen atmosphere, then quenched with water (10 mL) and extracted with ethyl acetate (2 x10 mL). The organic layers were combined, washed with brine (2 x 5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (3: 1) to afford tert-butyl N-ethyl-N-{ l-[7-({8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-(2-me thoxyethyl)indazol-4- yl]piperidin-4-yl} carbamate (45 mg, 34%) as a solid. LCMS (ES, m, z):594.0 [M+H] ⁺ .

Synthesis of Compound 307

C110 307

A mixture of tert-butyl N-ethyl-N-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-(2-methoxyethyl)indazol-4-yl]piperidin-4-yl} carbamate (50 mg, 0.084 mmol, 1 equiv) and TFA (2 mL) in DCM (4 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was neutralized to pH 8 with 7 N NH ₃ (g) in methanol, then purified by Prep-HPLC (Condition 2, Gradient 6) to afford 4-[4-(ethylamino)piperidin-l-yl]-N-{8-fluoro-2-methylimidazo [1,2-a]pyridin-6-yl}-2-(2- methoxyethyl)indazole-7-carboxamide (15 mg, 36%) as a solid. LCMS (ES, m, z):494 [M+H] ⁺ .

¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.23 (d, J = 1.6 Hz, 1H), 8.77 (s, 1H), 7.98 (d, J = 8.1 Hz, 1H), 7.91 (d, J = 3.5 Hz, 1H), 7.31 (dd, J = 12.4, 1.7 Hz, 1H), 6.49 (d, J = 8.2 Hz, 1H), 4.73 (t, J = 5.1 Hz, 2H), 3.95 (t, J = 5.2 Hz, 2H), 3.91 (s, 2H), 3.86 (s, 1H), 3.30 (s, 3H), 3.07 (t, J = 11.5 Hz, 2H), 2.72 - 2.54 (m, 3H), 2.35 (s, 3H), 1.97 (d, J = 12.5 Hz, 2H), 1.61 (s, 1H), 1.44 (q, J = 10.1 Hz, 2H), 1.04 (t, J = 7.1 Hz, 3H). ¹⁹ F NMR (282 MHz, DMSO-d ₆ ) δ -132.01, - 132.02.

Example 89: Synthesis of Compounds 310 and 330

Synthesis of Intermediate Cl 11 cm

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2 - methoxyethyl)indazole-7-carboxamide (100 mg, 0.224 mmol, 1 equiv), tert-butyl pyrrolidin-3- ylcarbamate (83 mg, 0.448 mmol, 2 equiv), and Cs ₂ CO ₃ (219 mg, 0.672 mmol, 3 equiv) in 1,4- di oxane (6 mL) was added RuPhos (21 mg, 0.045 mmol, 0.2 equiv) and RuPhos Pd G3 (19 mg, 0.022 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 80°C under nitrogen atmosphere, then quenched with water (10 mL) at room temperature and extracted with ethyl acetate (3 xlO mL). The organic layers were combined, washed with water (2 x 5 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 1) to afford tert-butyl (l-(7- ((8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2-( 2-methoxyethyl)-2H-indazol-4- yl)pyrrolidin-3-yl)carbamate (50 mg, 40%) as a solid. LCMS (ES, m, z):552.0 [M+H] ⁺ .

Synthesis of Intermediate Cl 12

A mixture of tert-butyl N-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- (2-methoxyethyl)indazol-4-yl]pyrrolidin-3-yl} carbamate (100 mg, 0.181 mmol, 1 equiv) and TFA (0.8 mL) in DCM (2 mL) was stirred for 1 h at room temperate. The resulting mixture was concentrated under vacuum to give a residue. The residue was basified to pH 8 with 7 M NHs(g) in methanol, then purified by reverse flash chromatography (Condition 1, Gradient 4) to afford 4- (3 -aminopyrrolidin- 1 -yl)-N-{ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-(2- methoxyethyl)indazole-7-carboxamide (36 mg, 44%) as a solid. LCMS (ES, m, z):452 [M+H] ⁺ .

Synthesis of Compounds 310 and 330

C112 330

To a stirred solution of 4-(3-aminopyrrolidin-l-yl)-N-{8-fluoro-2-methylimidazo[1,2-a ]pyridin- 6-yl}-2-(2-methoxyethyl)indazole-7-carboxamide (100 mg, 0.221 mmol, 1 equiv) and DIEA (129 mg, 0.996 mmol, 4.5 equiv) in DMF (5 mL) was added iodoethane (62 mg, 0.398 mmol, 1.8 equiv) dropwise at 0 °C. The resulting mixture was stirred for 2 h at room temperature, then diluted with water (10 mL) and extracted with ethyl acetate (3 x 10 mL). The organic layers were combined, washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 6) to afford 4-(3-(ethylamino)pyrrolidin-l-yl)-N- (8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(2 -methoxy ethyl)-2H-indazole-7-carboxamide (6 mg, 5%) and 4-(3-(diethylamino)pyrrolidin-l-yl)-N-(8-fluoro-2-methylimid azo[1,2-a]pyridin- 6-yl)-2-(2-methoxyethyl)-2H-indazole-7-carboxamide as solids. 4-(3-(diethylamino)pyrrolidin-l- yl)-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(2-met hoxyethyl)-2H-indazole-7- carboxamide was further purified by prep-HPLC (Condition 7, Gradient 1) to afford 4-(3- (diethylamino)pyrrolidin- 1 -yl)-N-(8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl)-2-(2- methoxyethyl)-2H-indazole-7-carboxamide compound with 2,2,2-trifluoro-113-ethan-l-one (5 mg, 4%) as a solid. Compound 310: LCMS (ES, m, z):480 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.22 (d, J = 1.7 Hz, 1H), 8.84 (s, 1H), 7.96 (d, J = 8.2 Hz, 1H), 7.90 (d, J = 3.0 Hz, 1H), 7.29 (dd, J = 12.4, 1.7 Hz, 1H), 6.06 (d, J = 8.4 Hz, 1H), 4.72 (t, J = 5.1 Hz, 2H), 3.95 (t, J = 5.1 Hz, 2H), 3.82 (d, J = 16.1 Hz, 2H), 3.70 (s, 2H), 3.31 (s, 3H), 2.83 (s, 2H),

2.35 (s, 3H), 2.07 (s, 1H), 1.13 (t, J = 7.0 Hz, 3H). ¹⁹ F NMR (282 MHz, DMSO-d ₆ ) δ -132.117. Compound 330: LCMS: (ES, m, z):508 [M+H] ⁺ . ¹ H NMR (300 MHz, Methanol-d ₄ ) δ 9.46 -

9.36 (m, 1H), 8.71 (d, J= 1.6 Hz, 1H), 8.12 - 7.93 (m, 3H), 7.85 (d, J= 10.5 Hz, 1H), 6.23 - 6.12 (m, 1H), 4.75 (t, J= 5.0 Hz, 2H), 4.29 (t, J= 8.2 Hz, 1H), 4.18 (t, J= 8.9 Hz, 1H), 4.02 (d, J = 12.1 Hz, 1H), 4.02 (s, 3H), 3.95 - 3.79 (m, 2H), 3.42 (dd, J= 11.0, 5.1 Hz, 7H), 2.73 - 2.63 (m, 1H), 2.53 (d, J= 3.2 Hz, 3H), 2.40 (q, J = 10.8, 10.2 Hz, 1H), 1.41 (t, J = 7.2 Hz, 6H). ¹⁹ F NMR (282 MHz, Methanol-d ₄ ) δ -76.86, -133.40 - -134.87 (m).

Example 90: Synthesis of Compound 340

Synthesis of Intermediate Cl 13 r , C ₁ 13

To a stirred solution of 5-methyl-lH-indazole (500 mg, 3.783 mmol, 1 equiv) in DCM (10 mL) was added Et3N (1.15 g, 11.349 mmol, 3 equiv), BOC2O (908.2 mg, 4.161 mmol, 1.1 equiv), and DMAP (46.2 mg, 0.378 mmol, 0.1 equiv) in portions at room temperature. The resulting mixture was stirred for 16 h at room temperature, then washed with water (2x10 mL). The organic layer was dried over anhydrous Na ₂ SO ₄ and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (2: 1) to afford tert-butyl 5-m ethylindazole- 1- carboxylate (500 mg, 57%) as a solid. LCMS (ES, m, z):233 [M+H] ⁺ .

Synthesis of Intermediate Cl 14 C ₁ 13 C ₁ 14

To a stirred solution of tert-butyl 5-methylindazole-l -carboxylate (200.0 mg, 0.861 mmol, 1 equiv) in CC ₁ 4 (6 mL) was added NBS (183.9 mg, 1.033 mmol, 1.2 equiv) and AIBN (14.1 mg, 0.086 mmol, 0.1 equiv) in portions at room temperature. The resulting mixture was stirred for 24 h at 50 °C, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 5- (bromomethyl)indazole-l -carboxylate (65 mg, 24%) as a solid. LCMS (ES, m/z):3 l l [M+H] ⁺ .

Synthesis of Intermediate Cl 15

To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (70.0 mg, 0.142 mmol, 1.0 equiv) and tert-butyl 5-(bromomethyl)indazole-l -carboxylate (66.2 mg, 0.213 mmol, 1.5 equiv) in DMF (1.7 mL) was added Cs ₂ CO ₃ (138.6 mg, 0.426 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then diluted with water (6 mL) and extracted with ethyl acetate (3 x 6 mL). The organic layers were combined, washed with water (3x10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with ethyl acetate to afford tert-butyl 5 -({4-[4-(tert- butoxy carbonyl)piperazin-l-yl]-7-({8-fluoro-2-methylimidazo[1,2-a] pyri din-6- yl}carbamoyl)indazol-2-yl}methyl)indazole-l-carboxylate (40 mg, 39%) as a solid. LCMS (ES, m, z):724 [M+H] ⁺ .

Synthesis of Compound 340

To a stirred solution of tert-butyl 5-({4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-7-({8-fluoro-2 - methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)indazol-2-yl }methyl)indazole- 1 -carboxylate (35.0 mg, 0.048 mmol, 1.0 equiv) in DCM (1 mL) was added TFA (0.3 mL) dropwise at 0 °C. The resulting mixture was stirred for 1 h at 0 °C, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 2) to afford N-{8- fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-(l H-indazol-5-ylmethyl)-4-(piperazin- 1 - yl)indazole-7-carboxamide trifluoroacetate (7.8 mg, 31%) as a solid. LCMS (ES, m, z):524 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 13.15 -13.14(m, 1H), 11.25 (s, 1H), 9.36 (s, 1H), 9.10 (s, 1H), 8.99-8.98 (m, 2H), 8.10 (s, 1H), 8.08 (d, J= 7.6 Hz, 1H), 8.02 (d, J = 8.0 Hz, 1H), 7.98 (s, 1H), 7.61-7.51 (m, 2H), 7.48 (d, J= 11.9 Hz, 1H), 6.62 (d, J= 8.1 Hz, 1H), 5.89 (s, 2H), 3.64-3.57 (m, 4H), 3.36-3.35 (m, 4H), 2.42 (s, 3H).

Example 91: Synthesis of Compound 314

Synthesis of Intermediate Cl 16

To a mixture of 4-[4-(2,2-dimethylpropanoyl)piperazin-l-yl]-2-methylindazole -7-carboxamide (60 mg, 0.167 mmol, 1 equiv), 6-bromo-2,8-dimethylimidazo[1,2-a]pyrazine (45.34 mg, 0.200 mmol, 1.2 equiv), and Cs ₂ CO ₃ (108.91 mg, 0.334 mmol, 2.0 equiv) in dioxane (2 mL) was added Xantphos (9.67 mg, 0.017 mmol, 0.1 equiv) and Pd ₂ (dba) ₃ (7.65 mg, 0.008 mmol, 0.05 equiv). The reaction mixture was stirred overnight at 100 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :2) to afford N-{2,8-dimethylimidazo[1,2- a]pyrazin-6-yl}-4-[4-(2,2-dimethylpropanoyl)piperazin-l-yl]- 2-methylindazole-7-carboxamide (40 mg, 49%) as a solid. LCMS (ES, m/z): 515 [M+H] ⁺ .

Synthesis of Compound 314

A solution of tert-butyl 4-[7-({8-cyano-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) -2- methylindazol-4-yl]piperazine-l -carboxylate (40 mg, 0.078 mmol, 1 equiv) in DCM was treated with TFA (0.5 mL, 6.732 mmol, 86.60 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 8, Gradient 1) to afford N-{8-cyano-2-methylimidazo[l, 2- a]pyridin-6-yl}-2-methyl-4-(piperazin-l-yl)indazole-7-carbox amide hydrochloride (20.7 mg, 58%) as a solid. LCMS (ES, m/z): 415 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.37 (s, 1H), 9.92 (d, J= 1.8 Hz, 1H), 9.60 (s, 2H), 8.95 (s, 1H), 8.57 (s, 1H), 8.24 (s, 1H), 8.02 (d, J= 8.0 Hz, 1H), 6.60 (d, J= 8.1 Hz, 1H), 4.33 (s, 3H), 3.66 (t, 4H), 3.31 (t, 4H), 2.45 (s, 3H).

Example 92: Synthesis of Compound 359

Synthesis of Intermediate Cl 17

To a stirred solution of methyl 4-bromo-2H-indazole-7-carboxylate (5.0 g, 19.602 mmol, 1 equiv) in ethyl acetate (150 mL) was added tetrafluorob oranui de; trimethyloxidanium (14.50 g, 98.010 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with ethyl acetate (150 mL) and washed with water (3x200 mL). The organic phase was dried over anhydrous Na2SO4, and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford methyl 4-bromo-2-methylindazole-7-carboxylate (4.8 g, 91%) as a solid. LCMS (ES, m/z): 269[M+H]+. ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 8.62 (s, 1H), 7.84 (d, J= 7.6 Hz, 1H), 7.42 (d, J= 7.7 Hz, 1H), 4.25 (s, 3H), 3.89 (s, 3H). Synthesis of Intermediate Cl 18

To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (4.5 g, 16.723 mmol, 1 equiv) and tert-butyl piperazine- 1 -carboxylate (6.23 g, 33.446 mmol, 2 equiv) in dioxane (90 mL) was added C ₈ 2CO ₃ (16.35 g, 50.169 mmol, 3 equiv), RuPhos (1.56 g, 3.345 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (1.40 g, 1.672 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 100 °C under nitrogen atmosphere, then concentrated under vacuum to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-[4-(tert- butoxycarbonyl)piperazin-l-yl]-2-methylindazole-7-carboxylat e (5.2 g, 83%) as a solid.

LCMS (ES, m/z): 375[M+H] ⁺ .

Synthesis of Intermediate Cl 19

A mixture of methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-methylindazole-7 -carboxylate (2.5 g, 6.677 mmol, 1 equiv) and NH3(g) in methanol (70 mL) was stirred for 2 days at 100 °C. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (1.35 g, 56%) as a solid. LCMS (ES, m/z): 360 [M+H] ⁺ .

Synthesis of Intermediate Cl 20

To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (60 mg, 0.167 mmol, 1 equiv), 6-bromo-8-methoxy-2-methylimidazo[1,2-a]pyrazine (48.49 mg, 0.200 mmol, 1.2 equiv), and Cs ₂ CO ₃ (108.78 mg, 0.334 mmol, 2 equiv) in dioxane (2 mL) was added Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv) and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :2) to afford tert-butyl 4-[7-({8-methoxy-2- methylimidazo[ 1 ,2-a]pyrazin-6-yl } carbarnoyl)-2-methylindazol-4-yl]piperazine- 1 -carboxylate (35 mg, 40%) as a solid. LCMS (ES, m/z): 521 [M+H] ⁺ .

Synthesis of Compound 359

A solution of tert-butyl 4-[7-({8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoy l)-2- methylindazol-4-yl]piperazine-l -carboxylate (20 mg, 0.038 mmol, 1 equiv) in 1,4-dioxane was treated with HBr in AcOH (0.5 mL, 17.117 mmol, 445.56 equiv). The reaction mixture was stirred for 2 h at 80 °C, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 9, Gradient 1) to afford N-{8-hydroxy-2- methylimidazo[1,2-a]pyrazin-6-yl}-2-methyl-4-(piperazin-l-yl )indazole-7-carboxamide; trifluoroacetic acid (6.5 mg, 31%) as a solid. LCMS (ES, m/z): 407 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.94 (s, 1H), 8.90 (s, 3H), 8.33 (s, 1H), 8.01 (d, J= 8.0 Hz, 1H), 7.78 (s, 1H), 6.61 (d, J= 8.1 Hz, 1H), 4.30 (s, 3H), 3.62 (t, 4H), 3.35 (t, 4H), 2.34 (s, 3H). ¹⁹ F NMR (400 MHz, DMSO-d ₆ ) δ -73.89.

Example 93: Synthesis of Compound 332

Synthesis of Intermediate C121

To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (60 mg, 0.167 mmol, 1 equiv), 6-bromo-4-fluoro-1,2-dimethyl- 1,3 -benzodiazole (48.69 mg, 0.200 mmol, 1.2 equiv), and Cs ₂ CO ₃ (108.78 mg, 0.334 mmol, 2 equiv) in dioxane (2 mL) was added Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv) and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :2) to afford tert-butyl 4-{7-[(7-fluoro-2,3- dimethyl-l,3-benzodiazol-5-yl)carbamoyl]-2-methylindazol-4-y l}piperazine-l -carboxylate (43 mg, 49%) as a solid. LCMS (ES, m/z): 522[M+H] ⁺ .

Synthesis of Compound 332

A solution of tert-butyl 4-{7-[(7-fluoro-2,3-dimethyl-l,3-benzodiazol-5-yl)carbamoyl] -2- methylindazol-4-yl (piperazine- 1 -carboxylate (41 mg, 0.079 mmol, 1 equiv) in DCM was added TFA (0.5 mL, 6.732 mmol, 85.64 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 1, Gradient 2) to afford N-(7-fluoro-2,3-dimethyl-l,3- benzodiazol-5-yl)-2-methyl-4-(piperazin-l-yl)indazole-7-carb oxamide; trifluoroacetic acid (26.9 mg, 64%) as a solid. LCMS (ES, m/z): 422 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.34 (s, 1H), 8.96 (s, 2H), 8.91 (s, 1H), 8.05 (d, J= 8.1 Hz, 1H), 8.00 (s, 1H), 7.55 (d, J= 12.4 Hz, 1H), 6.63 (d, J= 8.1 Hz, 1H), 4.34 (s, 3H), 3.81 (s, 3H), 3.59 (t, 4H), 3.36 (t, 4H), 2.63 (s, 3H). ¹⁹ F NMR (300 MHz, DMSO-d ₆ ) δ -74.09, -128.50.

Example 94: Synthesis of Compound 343

Synthesis of Intermediate Cl 22

C122

To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (100 mg, 0.278 mmol, 1 equiv) and 6-bromo-8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridine (86.50 mg, 0.334 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (271.95 mg, 0.834 mmol, 3 equiv), XantPhos (16.10 mg, 0.028 mmol, 0.1 equiv), and Pd ₂ (dba) ₃ CHCl ₃ (14.40 mg, 0.014 mmol, 0.05 equiv). The reaction mixture was stirred for 16 h at 100 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-TLC/silica gel column chromatography, eluted with PE/THF (60%) to afford tert-butyl 4-[7-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl }carbamoyl)-2-methylindazol-4- yl]piperazine-l -carboxylate (50 mg, 33%) as a solid. LCMS (ES, m/z): 538 [M+H] ⁺ .

Synthesis of Compound 343 A mixture of tert-butyl 4-[7-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (50 mg, 0.093 mmol, 1 equiv), TFA (1 mL, 13.463 mmol), and DCM (3 mL) was stirred for 1 h at 25 °C. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep- HPLC (Condition 10, Gradient 1, Gradient 2) to afford N-{8-fluoro-7-methoxy-2- methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-methyl-4-(piperazin- 1 -yl)indazole-7-carboxamide (35 mg, 86%) as a solid. LCMS (ES, m/z): 438 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.73 (s, 1H), 9.79 (s, 1H), 8.94 (s, 1H), 8.15 - 8.04 (m, 2H), 6.64-6.62 (m, 1H), 4.71 (s, 3H), 4.32 (s, 3H), 3.76-6.60 (m, 4H),3.42-3.19(m,4H) 2.44 (s, 3H).

Example 95: Synthesis of Compound 319

Synthesis of Intermediate C123

C123

To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (60 mg, 0.167 mmol, 1 equiv) and 5-bromo-7-fluoro-2-methylindazole (45.88 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (108.78 mg, 0.334 mmol, 2 equiv) and Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv). The reaction mixture was stirred for 1 h at 100 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :2) to afford tert-butyl 4-{7-[(7-fluoro-2-methylindazol-5-yl)carbamoyl]-2-methylinda zol-4-yl}piperazine-l- carboxylate (35 mg, 41%) as a solid. LCMS (ES, m/z): 508 [M+H] ⁺ .

Synthesis of Compound 319

To a solution of tert-butyl 4-{7-[(7-fluoro-2-methylindazol-5-yl)carbamoyl]-2-methyl- octahydroindazol-4-yl (piperazine- 1 -carboxylate (30 mg, 0.058 mmol, 1 equiv) in DCM was added HCl (gas) in 1,4-dioxane (0.5 mL, 16.456 mmol, 282.85 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 11, Gradient 1) to afford N-(7-fluoro-2- methylindazol-5-yl)-2-methyl-4-(piperazin-l-yl)indazole-7-ca rboxamide hydrochloride (12.7 mg, 49%) as a solid. LCMS (ES, m/z): 408 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.17 (s, 1H), 9.27 (s, 2H), 8.90 (s, 1H), 8.44 (d, J= 2.9 Hz, 1H), 8.08 (d, J= 1.6 Hz, 1H), 8.03 (d, J= 7.9 Hz, 1H), 7.44 (dd, J= 13.2, 1.6 Hz, 1H), 6.61 (d, J= 8.1 Hz, 1H), 4.32 (s, 3H), 4.20 (s, 3H), 3.60 (t, 4H), 3.33 (t, 4H). ¹⁹ F NMR (300 MHz, DMSO-d ₆ ) δ -128.029.

Example 96: Synthesis of Compound 320

Synthesis of Intermediate Cl 24

To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (60 mg, 0.167 mmol, 1 equiv) and 5-bromo-2,7-dimethylindazole (45.09 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (108.78 mg, 0.334 mmol, 2 equiv), Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv), and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-TLC/silica gel column chromatography, eluted with PE / EA (1 :2) to afford tert-butyl 4-{7-[(2,7-dimethylindazol-5- yl)carbamoyl]-2-methylindazol-4-yl (piperazine- 1 -carboxylate (36 mg, 43%) as a solid. LCMS (ES, m/z): 504[M+H] ⁺ .

Synthesis of Compound 320

A solution of tert-butyl 4-{7-[(2,7-dimethylindazol-5-yl)carbamoyl]-2-methylindazol-4 - yl (piperazine- 1 -carboxylate (35 mg, 0.069 mmol, 1 equiv) in DCM was treated with TFA (0.5 mL, 6.732 mmol, 96.86 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 3) to afford N-(2,7-dimethylindazol-5-yl)-2-methyl-4-(piperazin-l- yl)indazole-7-carboxamide; trifluoroacetic acid (19.3 mg, 53%) as a solid. LCMS (ES, m/z): 404 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 8.88 (m, 3H), 8.27 (s, 1H), 8.21 (s, 1H), 8.03 (d, J= 7.9 Hz, 1H), 7.15 (s, 1H), 6.61 (d, J= 8.0 Hz, 1H), 4.33 (s, 3H), 4.16 (s, 3H), 3.57 (t, 4H), 3.36 (t, 4H), 2.54 (s, 3H). ¹⁹ F NMR (300 MHz, DMSO-d ₆ ) δ -74.21.

Example 97: Synthesis of Compound 321

Synthesis of Intermediate Cl 25 C ₁ 25

To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (60 mg, 0.167 mmol, 1 equiv) and 6-bromo-1,2,4-trimethyl-l,3-benzodiazole (47.90 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (108.78 mg, 0.334 mmol, 2 equiv), Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv), and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :2) to afford tert-butyl 4-{2-methyl-7-[(2,3,7- trimethyl-l,3-benzodiazol-5-yl)carbamoyl]indazol-4-yl}pipera zine-l-carboxylate (51 mg, 59%) as a solid. LCMS (ES, m/z): 518[M+H] ⁺ .

Synthesis of Compound 321

A solution of tert-butyl 4-{2-methyl-7-[(2,3,7-trimethyl-l,3-benzodiazol-5- yl)carbamoyl]indazol-4-yl}piperazine-l-carboxylate (50 mg, 0.097 mmol, 1 equiv) in DCM (1.0 mL) was treated with TFA (0.5 mL, 6.732 mmol, 69.69 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 3) to afford 2-methyl-4-(piperazin- l-yl)-N-(2,3,7-trimethyl-l,3-benzodiazol-5-yl)indazole-7-car boxamide trifluoroacetate (26.6 mg, 51%) as a solid. LCMS (ES, m/z): 418 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.38 (s, 1H), 9.00 (s, 2H), 8.93 (s, 1H), 8.41 (s, 1H), 8.06 (d, J= 8.0 Hz, 1H), 7.51 (s, 1H), 6.63 (d, J= 8.1 Hz, 1H), 4.34 (s, 3H), 3.91 (s, 3H), 3.59 (t, 4H), 3.34 (t, 4H), 2.81 (s, 3H), 2.61 (s, 3H).

Example 98: Synthesis of Compound 322

Synthesis of Intermediate Cl 26 To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (60 mg, 0.167 mmol, 1 equiv) and 6-bromo-2,8-dimethylimidazo[1,2-b]pyridazine (45.29 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL, 23.608 mmol, 141.42 equiv) was added Cs ₂ CO ₃ (108.78 mg, 0.334 mmol, 2 equiv), Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv), and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :2) to afford tert-butyl 4-[7-({2,8- dimethylimidazo[1,2-b]pyridazin-6-yl}carbamoyl)-2-methylinda zol-4-yl]piperazine-l- carboxylate (28 mg, 33%) as a solid. LCMS (ES, m/z): 505 [M+H] ⁺ .

Synthesis of Compound 322

A solution of tert-butyl 4-[7-({2,8-dimethylimidazo[1,2-b]pyridazin-6-yl}carbamoyl)-2 - methylindazol-4-yl]piperazine-l -carboxylate (28 mg, 0.055 mmol, 1 equiv) in DCM was treated with HCI (gas) in 1,4-dioxane (0.5 mL, 54.855 mmol, 988.55 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 11, Gradient 1) to afford N-{2,8- dimethylimidazo[1,2-b]pyridazin-6-yl}-2-methyl-4-(piperazin- l-yl)indazole-7-carboxamide hydrochloride (14.2 mg, 58%) as a solid. LCMS (ES, m/z): 405 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.79 (s, 1H), 9.56 (s, 2H), 9.00 (s, 1H), 8.65 (s, 1H), 8.37 (s, 1H), 8.10 (d, J= 8.1, 1.5 Hz, 1H), 6.64 (d, J= 8.2 Hz, 1H), 4.29 (s, 3H), 3.70 (t, 4H), 3.32 (t, 4H), 2.72 (s, 3H), 2.55 (s, 3H).

Example 99: Synthesis of Compound 323

Synthesis of Intermediate Cl 27

To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (60 mg, 0.167 mmol, 1 equiv) and 6-bromo-8-methoxy-2-methylimidazo[1,2-a]pyrazine (48.49 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (108.78 mg, 0.334 mmol, 2 equiv), Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv), and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :2) to afford tert-butyl 4-[7-({8-methoxy-2- methylimidazof 1 ,2-a]pyrazin-6-yl } carbarnoyl)-2-methylindazol-4-yl]piperazine- 1 -carboxylate (35 mg, 40 %) as a solid. LCMS (ES, m/z): 521 [M+H] ⁺ .

Synthesis of Compound 323

A solution of tert-butyl 4-[7-({8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoy l)-2- methylindazol-4-yl]piperazine-l -carboxylate (20 mg, 0.038 mmol, 1 equiv) in 1,4-dioxane was treated with HBr in AcOH (0.5 mL, 17.117 mmol, 445.56 equiv). The reaction mixture was stirred for 2 h at 80 °C. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 11, Gradient 1) to afford N-{8- hydroxy-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-methyl-4-(pipe razin-l-yl)indazole-7- carboxamide; trifluoroacetic acid (6.5 mg, 31%) as a solid. LCMS (ES, m/z): 421 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.48 (s, 1H), 9.40 (brs, 2H), 9.23 (s, 1H), 8.95 (s, 1H), 8.21 (s, 1H), 8.07 (d, J= 8.0 Hz, 1H), 6.63 (d, J= 8.1 Hz, 1H), 4.29 (s, 3H), 4.21 (s, 3H), 3.66 (t, 4H), 3.32 (t, 4H), 2.46 (s, 3H). Example 100: Synthesis of Compound 324

Synthesis of Intermediate Cl 28

C128

To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl) piperazine- 1 -carboxylate (60 mg, 0.167 mmol, 1 equiv), 5-bromo-2-methylindazole (52.85 mg, 0.251 mmol, 1.5 equiv) and Cs ₂ CO ₃ (108.78 mg, 0.334 mmol, 2 equiv) in dioxane (2 mL) was added XantPhos (19.32 mg, 0.033 mmol, 0.2 equiv) and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred for 30 seconds at room temperature under nitrogen atmosphere, then overnight at 100°C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (2:1) to afford tert-butyl 4-{2-methyl-7-[(2-methylindazol-5-yl) carbamoyl] indazol-4-yl} piperazine- 1 -carboxylate (30 mg, 33%) as a solid. LCMS (ES, m/z): 490 [M+H] ⁺ .

Synthesis of Compound 324

To a mixture of tert-butyl 4-{2-methyl-7-[(2-methylindazol-5-yl) carbamoyl] indazol-4- yl (piperazine- 1 -carboxylate (30 mg, 0.061 mmol, 1 equiv) in DCM (1.0 mL) was added TFA (0.5 mL, 6.732 mmol, 109.85 equiv). The reaction mixture was stirred for 1 hour at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 11, Gradient 1) to afford 2-methyl-N-(2-methylindazol-5-yl)- 4-(piperazin-l-yl) indazole-7-carboxamide hydrochloride (7.6 mg, 28%) as a solid. LCMS (ES, m/z): 390 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.15 (s, 1H), 9.40 (s, 2H), 8.90 (s, 1H), 8.38 (d, J= 1.9 Hz, 1H), 8.31 (s, 1H), 8.03 (d, J= 7.9 Hz, 1H), 7.63 (d, J = 9.1 Hz, 1H), 7.40 (dd, J= 9.1, 2.0 Hz, 1H), 6.61 (d, J= 8.0 Hz, 1H), 4.32 (s, 3H), 4.16 (s, 3H), 3.60 (t, 4H), 3.32 (t, 4H).

Example 101: Synthesis of Compound 325

Synthesis of Intermediate Cl 29

To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (60 mg, 0.167 mmol, 1.00 equiv), 5-bromo-6-(methoxymethoxy)-2,7-dimethylindazole (57.12 mg, 0.200 mmol, 1.2 equiv), and Cs ₂ CO ₃ (108.78 mg, 0.334 mmol, 2.0 equiv) in dioxane (2 mL) was added XantPhos (19.32 mg, 0.033 mmol, 0.2 equiv) and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.10 equiv). The reaction mixture was stirred for 16 h at 100 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :2) to afford tert-butyl 4-(7-{[6- (methoxymethoxy)-2,7-dimethylindazol-5-yl]carbamoyl}-2-methy lindazol-4-yl)piperazine-l- carboxylate (40 mg, 43%) as a solid. LCMS (ES, m z): 564 [M+H] ⁺ .

Synthesis of Compound 325

A solution of tert-butyl 4-(7-{[6-(methoxymethoxy)-2,7-dimethylindazol-5-yl]carbamoyl }-2- methylindazol-4-yl)piperazine-l -carboxylate (40 mg, 0.071 mmol, 1 equiv) in DCM was treated with HCI (gas) in 1,4-dioxane (0.3 mL, 32.913 mmol, 463.79 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 11, Gradient 1) to afford N-(6-hydroxy-2,7- dimethylindazol-5-yl)-2-methyl-4-(piperazin-l-yl)indazole-7- carboxamide hydrochloride (12.1 mg, 36%). LCMS (ES, m/zy. 420 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.60 (s, 1H), 9.22 (br, 3H), 8.86 (s, 1H), 8.61 (s, 1H), 8.17 (s, 1H), 8.05 (d, J= 7.9 Hz, 1H), 6.60 (d, J= 8.0 Hz, 1H), 4.29 (s, 3H), 4.10 (s, 3H), 3.44 (t, 4H), 3.34 (t, 4H), 2.43 (s, 3H).

Example 102: Synthesis of Compound 315

Synthesis of Intermediate Cl 30

C130

To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (60 mg, 0.167 mmol, 1 equiv) and 5-bromo-7-fluoro-6-methoxy-2-methylindazole (51.90 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs2CO3 (108.78 mg, 0.334 mmol, 2 equiv), Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv), and Pd2(dba) ₃ (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred for 1 h at 100 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :2) to afford tert-butyl 4-{7-[(7-fluoro-6- methoxy-2-methylindazol-5-yl)carbamoyl]-2-methylindazol-4-yl }piperazine-l -carboxylate (32 mg, 36%) as a solid. LCMS (ES, m /z) 538 [M+H] ⁺ Synthesis of Compound 315

A solution of tert-butyl 4-{7-[(7-fluoro-6-methoxy-2-methylindazol-5-yl)carbamoyl]-2- methylindazol-4-yl (piperazine- 1 -carboxylate (32 mg, 0.060 mmol, 1 equiv) in DCM was treated with HC1 (gas) in 1,4-di oxane (0.5 mL, 16.456 mmol, 276.47 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a reisdue. The residue was purified by Prep-HPLC (Condition 11, Gradient 1) to afford N-(7-fluoro-6- methoxy-2-methylindazol-5-yl)-2-methyl-4-(piperazin-l-yl)ind azole-7-carboxamide hydrochloride (13.5 mg, 47%) as a solid. LCMS (ES, m/z): 438 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.58 (s, 1H), 9.29 (s, 2H), 8.90 (s, 1H), 8.69 (s, 1H), 8.40 (s, 1H), 8.06 (d, J= 8.0 Hz, 1H), 6.61 (d, J= 8.1 Hz, 1H), 4.31 (s, 3H), 4.18 - 4.11 (m, 6H), 3.60 (t, 4H), 3.32 (t, 4H). ¹⁹ F NMR (300 MHz, DMSO-d ₆ ) δ 149.08.

Example 103: Synthesis of Compound 344

Synthesis of Intermediate Cl 31 C ₁ 31

To a mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (100 mg, 0.278 mmol, 1 equiv) and 6-bromo-8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridine (86.50 mg, 0.334 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (271.95 mg, 0.834 mmol, 3 equiv), XantPhos (16.10 mg, 0.028 mmol, 0.1 equiv), and Pd ₂ (dba) ₃ CHCl ₃ (14.40 mg, 0.014 mmol, 0.05 equiv). The reaction mixture was stirred for 16 h at 100 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-TLC/silica gel column chromatography, eluted with PE/THF (60%) to afford tert-butyl 4-{7-[(6-methoxy-2,7-dimethylindazol-5-yl)carbamoyl]-2-methy lindazol-4-yl}piperazine-l- carboxylate (53 mg, 36%) as a solid. LCMS (ES, m z): 534 [M+H] ⁺ .

Synthesis of Compound 344 A mixture of tert-butyl 4-{7-[(6-methoxy-2,7-dimethylindazol-5-yl)carbamoyl]-2-methy lindazol-

4-yl}piperazine-l-carboxylate (50 mg, 0.094 mmol, 1 equiv) and TFA (1 mL, 13.463 mmol, 143.69 equiv) in DCM (3 mL) was stirred for 1 h at 25 °C. The resulting mixture was concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 1, Gradient 2, Gradient 4) to afford N-(6-methoxy-2,7-dimethylindazol-

5-yl)-2-methyl-4-(piperazin-l-yl)indazole-7-carboxamide trifluoroacetate (37 mg, 91%) as a solid. LCMS (ES, m/z): 434 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.51 (s, 1H), 8.87 (s, 1H), 8.75 (s, 1H), 8.25 (s, 1H), 8.07 (d, J= 8.0 Hz, 1H), 6.62 (d, J= 8.0 Hz, 1H), 4.32 (s, 3H), 4.14 (s, 3H), 3.94 (s, 3H), 3.62 - 3.53 (m, 4H), 3.43 - 3.19 (m, 4H), 2.50(s, 3H).

Example 104: Synthesis of Compound 333

Synthesis of Intermediate Cl 32

To a mixture of Cs ₂ CO ₃ (108.78 mg, 0.334 mmol, 2 equiv) and 6-bromo-7-fluoro-2- methylimidazo[1,2-a]pyridine (45.88 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) was added Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv) and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). The reaction mixture was stirred overnight at 100 °C under a nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :2) to afford tert-butyl 4-[7-({7-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (45 mg, 53%) as a solid. LCMS (ES, m/z): 508 [M+H] ⁺ .

Synthesis of Compound 333 C ₁ 32 333

A solution of tert-butyl 4-[7-({7-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- methylindazol-4-yl]piperazine-l -carboxylate (41 mg, 0.081 mmol, 1 equiv) in DCM was treated with TFA (0.5 mL, 6.732 mmol, 83.33 equiv). The reaction mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 1, Gradient 2) to afford N-{7-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-l-yl )indazole-7-carboxamide trifluoroacetate (25.6 mg, 61%) as a solid. LCMS (ES, m/z): 408 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.59 (d, J= 3.1 Hz, 1H), 9.98 (d, J= 6.6 Hz, 1H), 9.04 (s, 2H), 8.96 (s, 1H), 8.16 (s, 1H), 8.08 (dd, J= 9.1, 5.1 Hz, 2H), 6.64 (d, J= 8.1 Hz, 1H), 4.27 (s, 3H), 3.64 (t, 4H), 3.27 (t, 4H), 2.45 (s, 3H). ¹⁹ F NMR (300 MHz, DMSO-d ₆ ) δ -73.71, -117.21.

Example 105: Synthesis of Compound 334

Synthesis of Intermediate Cl 33 C ₁ 33

To a stirred mixture of 4-bromo-2-methylindazole-7-carboxylic acid (80 mg, 0.314 mmol, 1 equiv) and HATU (155.03 mg, 0.408 mmol, 1.3 equiv) in DMF (2 mL) was added DIEA (121.61 mg, 0.942 mmol, 3 equiv) and 2,8-dimethylimidazo[1,2-a]pyrazin-6-amine (66.13 mg, 0.408 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. A precipitate formed that was collected by filtration. The resulting solid was dried under infrared light to afford 4-bromo-N-{2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 48%) as a solid. LCMS (ES, m/z): 399[M+H] ⁺ .

Synthesis of Intermediate Cl 34

To a stirred mixture of 4-bromo-N-{2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}-2-methyli ndazole- 7-carboxamide (60 mg, 0.150 mmol, 1 equiv) and tert-butyl (2R,6S)-2,6-dimethylpiperazine-l- carboxylate (38.65 mg, 0.180 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs ₂ CO ₃ (146.89 mg, 0.450 mmol, 3 equiv), RuPhos (14.03 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.57 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (20: 1) to afford tert-butyl (2R,6S)-4-[7- ({2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)-2-methyl indazol-4-yl]-2,6- dimethylpiperazine-1 -carboxylate (70 mg, 66%) as a solid. LCMS (ES, m/z): 533[M+H] ⁺ .

Synthesis of Compound 334

B134 334

To a stirred solution of tert-butyl (2R,6S)-4-[7-({2,8-dimethylimidazo[1,2-a]pyrazin-6- yl}carbamoyl)-2-methylindazol-4-yl]-2,6-dimethylpiperazine-l -carboxylate (70 mg, 0.131 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 102.44 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 4) to afford N-{2,8-dimethylimidazo[1,2-a]pyrazin-6-yl}-4-[(3R,5S)-3,5- dimethylpiperazin-l-yl]-2-methylindazole-7-carboxamide (11.3 mg, 20%) as a solid. LCMS (ES, m/z): 433 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.34 (s, 1H), 9.36 (s, 1H), 9.17 (d, J = 10.6 Hz, 1H), 8.94 (s, 1H), 8.59 (d, J= 10.8 Hz, 1H), 8.11 - 8.05 (m, 2H), 6.66 (d, J= 8.1 Hz, 1H), 4.31 (s, 3H), 4.03 (d, J= 13.2 Hz, 2H), 3.00 - 2.89 (m, 2H), 2.76 (s, 3H), 2.43 (s, 3H), 1.33 (d, J = 6.4 Hz, 6H).

Example 106: Synthesis of Compound 347

Synthesis of Intermediate Cl 35

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(piperidin-4-yl)- N-(pyridin-2-ylmethyl)carbamate (52.16 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (20: 1) to afford tert-butyl N- { 1 -[7-({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)-2-methylindazol-4- yl]piperidin-4-yl}-N-(pyridin-2-ylmethyl)carbamate (70 mg, 77%) as solid. LCMS (ES, m/z): 613[M+H] ⁺ .

Synthesis of Compound 347

To a stirred solution of tert-butyl N-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperidin-4-yl}-N-(pyri din-2 -ylmethyl)carbamate (70 mg, 0.114 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 117.84 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 7) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl- 4-{4-[(pyridin-2-ylmethyl)amino]piperidin-l-yl}indazole-7-ca rboxamide (13.1 mg, 22%) as a solid. LCMS (ES, m/z). 513 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.21 (d, J = 1.7 Hz, 1H), 8.78 (s, 1H), 8.51 (d, J= 4.8 Hz, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.0 Hz, 1H), 7.77 (td, J= 7.6, 1.8 Hz, 1H), 7.49 (d, J= 7.8 Hz, 1H), 7.34 (dd, J= 12.4, 1.7 Hz, 1H), 7.29 - 7.22 (m, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.30 (s, 3H), 3.89 (d, J= 92 Hz, 4H), 3.06 (t, J= 11.8 Hz, 2H), 2.79 - 2.63 (m, 1H), 2.38 - 2.33 (m, 3H), 2.01 (d, J= 12.3 Hz, 2H), 1.52 (d, J= 11.4 Hz, 2H). Example 107: Synthesis of Compound 360

Synthesis of Intermediate Cl 36 C ₁ 36

A mixture of sodium sulfate (111.38 g, 784.152 mmol, 8 equiv), hydroxylamine hydrochloride (23.84 g, 343.067 mmol, 3.5 equiv), and chloral (21.67 g, 147.029 mmol, 1.5 equiv) was dissolved in water (500 mL). To the reaction mixture was added a solution of 3-bromo-5-fluoro- 2-methylaniline (20 g, 98.019 mmol, 1 equiv) in a mixture of water (540 mL), ethanol (70 mL), and concentrated HCl (17 mL). The reaction mixture was stirred overnight at 60 °C, then cooled to room temperature. A precipitate formed that was collected by filtration and washed with water (2x50 mL). The resulting solid was dried in an oven under reduced pressure to afford (2E)-N-(3- bromo-5-fluoro-2-methylphenyl)-2-(N-hydroxyimino)acetamide (22 g, 82%) as a solid. LCMS (ES, m/z): 275[M+H] ⁺ .

Synthesis of Intermediate Cl 37

(2E)-N-(3-bromo-5-fluoro-2-methylphenyl)-2-(N-hydroxyimin o)acetamide (22 g, 79.978 mmol, 1 equiv) was added to sulfuric acid (170 mL) in portions at 60 °C. The resulting mixture was stirred for 1 h at 60 °C, then cooled to room temperature and slowly added to ice water. A precipitate formed that was collected by filtration and washed with water (2x20 mL). The resulting solid was dried under vacuum to afford 6-bromo-4-fluoro-7-methyl-lH-indole-2,3- dione (18.5 g, 90%) as a solid. LCMS (ES, m/z): 258[M+H] ⁺ .

Synthesis of Intermediate Cl 38

To a mixture of 6-bromo-4-fluoro-7-methyl-lH-indole-2, 3-dione (18.5 g, 71.693 mmol, 1 equiv) and NaOH (2 M) (91 mL, 645.237 mmol, 9 equiv) was added H ₂ O ₂ (15.4 mL, 358.465 mmol, 5 equiv) dropwise over 15 min at room temperature. The resulting mixture was stirred for an additional 3 h at room temperature, then quenched with saturated sodium sulfite (aq.) at room temperature and neutralized to pH 7 with HCl (2 M). The resulting mixture was filtered, and the filter cake washed with water (2x20 mL). The filtrate was concentrated under reduced pressure to give a residue. The residue was acidified to pH 4 with HCl (2 M). The precipitated solids were collected by filtration and washed with water (2x20 mL). The resulting solid was dried under infrared light to afford 2-amino-4-bromo-6-fluoro-3-methylbenzoic acid (16 g, 90%) as a solid.

LCMS (ES, m/z): 249[M+H] ⁺ .

Synthesis of Intermediate Cl 39

To a stirred solution of 2-amino-4-bromo-6-fluoro-3 -methylbenzoic acid (6 g, 24.189 mmol, 1 equiv) in methanol (60 mL) was added sulfuric acid (23.72 g, 241.890 mmol, 10 equiv) dropwise at room temperature. The resulting mixture was stirred for 16 h at 80 °C, then concentrated under reduced pressure to give a residue. The residue was quenched with a mixture of water and ice (50 mL) at room temperature. The resulting mixture was extracted with DCM (3 x 50mL). The organic layers were combined, washed with brine (lx 50mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 2-amino-4-bromo-6-fluoro-3-methylbenzoate (2.48 g, 39%) as an oil. LCMS (ES, m/z): 262[M+H] ⁺ .

Synthesis of Intermediate Cl 40

To a stirred solution of methyl 2-amino-4-bromo-6-fluoro-3-methylbenzoate (2.35 g, 8.967 mmol, 1 equiv) and KO Ac (0.97 g, 9.864 mmol, 1.1 equiv) in CHCl ₃ (50 mL) was added AC2O (1.83 g, 17.934 mmol, 2 equiv) dropwise at 0 °C. The resulting mixture was stirred for 20 min at room temperature. To the reaction mixture was added 18-Crown-6 (0.43 g, 1.614 mmol, 0.18 equiv) and tBuONO (2.03 g, 19.727 mmol, 2.2 equiv). The resulting mixture was stirred for an additional 2 h at 65 °C. The resulting mixture was diluted with saturated NaHCOs (aq.) (20 mL) and extracted with DCM (2x50 mL). The organic layers were combined, washed with brine (30 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was triturated with diethyl ether (10 mL) to afford methyl 4-bromo-6-fluoro-2H-indazole-7-carboxylate (1.8 g, 74%) as a solid. LCMS (ES, m/z): 273M+H] ⁺ .

Synthesis of Intermediate C141

To a stirred solution of methyl 4-bromo-6-fluoro-2H-indazole-7-carboxylate (1.7 g, 6.226 mmol, 1 equiv) in ethyl acetate (50 mL) was added trimethyloxonium tetrafluoroborate (1.38 g, 9.339 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature, then diluted with ethyl acetate (50 mL) and washed with brine (3x50 mL). The organic phase was concentrated under reduced pressure to afford methyl 4-bromo-6-fluoro-2- methylindazole-7-carboxylate (1.7 g, 95%) as a solid. LCMS (ES, m z): 287[M+H] ⁺ .

Synthesis of Intermediate Cl 42

To a stirred mixture of methyl 4-bromo-6-fluoro-2-methylindazole-7-carboxylate (1.6 g, 5.573 mmol, 1 equiv) in THF (12 mL) and water (4 mL) was added lithiumol hydrate (0.47 g, 11.146 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature, then concentrated under reduced pressure, diluted with water (20 mL), and acidified to pH 3 with citric acid. A precipitate formed that was collected by filtration and washed with water (2x10 mL) to afford 4-bromo-6-fluoro-2-methylindazole-7-carboxylic acid (1.5 g, 99%) as a solid. LCMS (ES, m/z): 273[M+H] ⁺ .

Synthesis of Intermediate Cl 43 C ₁ 43

To a stirred mixture of 4-bromo-6-fluoro-2-methylindazole-7-carboxylic acid (500 mg, 1.831 mmol, 1 equiv) and HATU (835.49 mg, 2.197 mmol, 1.2 equiv) in DMF (15 mL) was added DIEA (946.65 mg, 7.324 mmol, 4 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine hydrochloride (369.20 mg, 1.831 mmol, 1 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature, then diluted with tert-butyl methyl ether (40 mL). A precipitate formed that was collected by filtration and washed with tert-butyl methyl ether (2x10 mL) to afford 4-bromo-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6 -yl}-2- methylindazole-7-carboxamide (530 mg, 69%) as a solid. LCMS (ES, m z): 420[M+H] ⁺ .

Synthesis of Intermediate Cl 44

To a mixture of 4-bromo-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6 -yl}-2- methylindazole-7-carboxamide (200 mg, 0.476 mmol, 1 equiv) and tert-butyl piperazine- 1- carboxylate (177.29 mg, 0.952 mmol, 2 equiv) in 1,4-di oxane (6 mL) was added Cs ₂ CO ₃ (465.21 mg, 1.428 mmol, 3 equiv), Ruphos (44.42 mg, 0.095 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (39.81 mg, 0.048 mmol, 0.1 equiv). The reaction mixture was stirred for 4 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-[6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl} carbamoyl)-2- methylindazol-4-yl]piperazine-l -carboxylate (230 mg, 92%) as a solid. LCMS (ES, m/z): 526[M+H] ⁺ .

Synthesis of Compound 360

To a stirred solution of tert-butyl 4-{6-fluoro-7-[({8-fluoro-2-methyl-octahydroimidazo[1,2- a]pyridin-6-yl}amino)(hydroxy)methyl]-2-methyl-octahydroinda zol-4-yl}piperazine-l- carboxylate (70 mg, 0.129 mmol, 1 equiv) in DMSO (28 mL) and water (0.7 mL) was added potassium hydroxide (72.23 mg, 1.290 mmol, 10 equiv). The resulting mixture was stirred for 2 days at 110 °C. The product was purified by Prep-HPLC (Condition 10, Gradient 4) to afford 7- [({8-fluoro-2-methyl-octahydroimidazo[1,2-a]pyridin-6-yl}ami no)(hydroxy)methyl]-2-methyl-4- (piperazin-l-yl)-octahydroindazol-6-ol (3.1 mg, 5%) as a solid. LCMS (ES, m/z): 424 [M+H] ⁺ . ¹ H NMR (300 MHz, Methanol-d ₄ ) δ 9.37 (s, 1H), 8.43 (s, 1H), 7.99 (s, 1H), 7.82 (d, J= 11.4 Hz, 1H), 6.17 (s, 1H), 4.24 (s, 3H), 3.64 (d, J= 5.5 Hz, 4H), 3.47 (d, J= 5.4 Hz, 4H), 2.54 (s, 3H).

Example 108: Synthesis of Compound 348

Synthesis of Intermediate Cl 45

C144 C145

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl 2,7- diazaspiro[3.5]nonane-2-carboxylate (40.51 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (20: 1) to afford 4-{2,7- diazaspiro[3.5]nonan-7-yl}-N-{8-fluoro-2-methylimidazo[1,2-a ]pyridin-6-yl}-2-methylindazole- 7-carboxamide (60 mg, 81%) as a solid. LCMS (ES, m z): 548[M+H] ⁺ .

Synthesis of Compound 348

To a stirred solution of tert-butyl 7-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]-2,7-diazaspiro[3.5]nonan e-2-carboxylate (60 mg, 0.110 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 122.88 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 1) to afford 4-{2,7-diazaspiro[3.5]nonan-7-yl}-N-{8-fluoro-2-methylimidaz o[1,2- a]pyridin-6-yl}-2-methylindazole-7-carboxamide (22.1 mg, 45%) as a solid. LCMS (ES, m z ): 448 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.06 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.78 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.34 (dd, J= 12.4, 1.7 Hz, 1H), 6.50 (d, J = 8.3 Hz, 1H), 4.30 (s, 3H), 3.63 (s, 2H), 3.40 - 3.35 (m, 6H), 2.35 (s, 3H), 1.89 (t, J= 5.5 Hz, 4H).

Example 109: Synthesis of Compound 349

Synthesis of Intermediate Cl 46

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl 1,8- diazaspiro[4.5]decane-l-carboxylate (43.02 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (20: 1) to afford tert-butyl 8- [7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)- 2-methylindazol-4-yl]-l,8- diazaspiro[4.5]decane-l -carboxylate (70 mg, 84%) as a solid. LCMS (ES, m z): 562[M+H] ⁺ .

Synthesis of Compound 349 C ₁ 46 349 To a stirred solution of tert-butyl 8-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]-l,8-diazaspiro[4.5]decan e-l-carboxylate (70 mg, 0.125 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 108.02 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 5, Gradient 1) to afford 4-{ l,8-diazaspiro[4.5]decan-8-yl}-N-{8-fluoro-2-methylimidazo[1 ,2- a]pyridin-6-yl}-2-methylindazole-7-carboxamide (23.8 mg, 41%) as a solid. LCMS (ES, m z) : 462 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.06 (s, 1H), 9.21 (s, 1H), 8.77 (s, 1H), 7.96 (d, J= 7.9 Hz, 1H), 7.90 (d, J = 3.1 Hz, 1H), 7.33 (d, J= 12.2 Hz, 1H), 6.49 (d, J = 7.9 Hz, 1H), 4.29 (s, 3H), 3.59 - 3.42 (m, 4H), 2.91 - 2.83 (m, 3H), 1.76 - 1.65 (m, 6H), 1.56 (t, J= 7.4 Hz, 2H).

Example 110: Synthesis of Compound 361

Synthesis of Compound 361 C ₁ 44 361

To a stirred solution of tert-butyl 4-[6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (50 mg, 0.095 mmol, 1 equiv) in methanol (1 mL) was added HCI (g) in methanol (1 mL, 32.913 mmol, 345.95 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC with the following conditions (Condition 5, Gradient 1) to afford 6-fluoro-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-l-yl )indazole-7-carboxamide (18.7 mg, 46%) as a solid. LCMS (ES, m/z): 426 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.90 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.77 (s, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.28 - 7.21 (m, 1H), 6.24 (d, J= 15.0 Hz, 1H), 4.20 (s, 3H), 3.31 (s, 4H), 2.90 (s, 4H), 2.35 (s, 3H).

Example 111: Synthesis of Compound 362 Synthesis of Intermediate Cl 47 C ₁ 44 C ₁ 47

A solution of tert-butyl 4-[6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (60 mg, 0.114 mmol, 1 equiv) and DIEA (29.51 mg, 0.228 mmol, 2 equiv) in Methylamine (2M in THF, 5 mL) was stirred overnight at 80 °C. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- methyl-6-(methylamino)indazol-4-yl]piperazine-l -carboxylate (60 mg, 98%) as a solid. LCMS (ES, m/z): 537[M+H] ⁺ .

Synthesis of Compound 362 C ₁ 47 362

To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methyl-6-(methylamino)indazol-4-yl]piperazine- l -carboxylate (60 mg, 0.112 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 10.202 mmol, 91.24 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 4) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-6- (methylamino)-4-(piperazin-l-yl)indazole-7-carboxamide (27.2 mg, 56%) as a solid. LCMS (ES, m/z): 437 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.58 (s, 1H), 9.56 (q, J = 4.9 Hz, 1H), 9.10 (d, J = 1.6 Hz, 1H), 8.52 (s, 1H), 7.85 (d, J = 3.4 Hz, 1H), 7.24 (dd, J = 12.5, 1.7 Hz, 1H), 5.90 (s, 1H), 4.15 (s, 3H), 3.45 (t, J = 5.0 Hz, 4H), 3.14 (d, J = 6.0 Hz, 4H), 2.98 (d, J = 5.0 Hz, 3H), 2.34 (s, 3H).

Example 112: Synthesis of Compound 363

Synthesis of Intermediate Cl 48

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2H- indazol-4-yl]piperazine-l -carboxylate (100 mg, 0.203 mmol, 1 equiv), l-chloro-2-iodoethane (57.87 mg, 0.304 mmol, 1.5 equiv), and KOH (68.21 mg, 1.218 mmol, 6.0 equiv) in DMF (2 mL) was stirred for 12 h at 90 °C. The mixture was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl 4-[2-ethenyl-7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (100 mg) as a solid. LCMS (ES, m/z): 520 [M+H] ⁺ .

Synthesis of Compound 363

A mixture of tert-butyl 4-[2-ethenyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (100 mg, 0.192 mmol, 1 equiv) and TFA (0.3 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The resulting mixture was basified to pH 8 with 7 M NH3(gas) in methanol, then concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 1, Gradient 5) to afford 2-ethenyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4- (piperazin-l- yl)indazole-7-carboxamide (24 mg, 30%) as a solid. LCMS (ES, m/z): 420 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 10.91 (s, 1H), 9.22 (d, J= 1.7 Hz, 1H), 9.10 (s, 1H), 8.04 (d, J= 8.1 Hz, 1H), 7.95 - 7.87 (m, 1H), 7.67 (dd, J= 15.5, 8.8 Hz, 1H), 7.35 (dd, J= 12.3, 1.6 Hz, 1H), 6.52 (d, J= 8.2 Hz, 1H), 6.26 (d, J= 15.3 Hz, 1H), 5.36 (d, J= 8.6 Hz, 1H), 3.39 (d, J= 5.3 Hz, 4H), 2.94 (s, 4H), 2.39 - 2.32 (m, 3H).

Example 113: Synthesis of Compounds 352 and 353

Synthesis of Compounds 352 and 353

353

Compounds 352 and 353 were isolated by Chiral Prep-HPLC (Condition 3, Gradient 1) Compound 352 : RT=4.680 min. LCMS (ES, m, z):422 [M+H] ⁺ . ¹ H NMR (400 MHz, Methanol-d ₄ ) δ 9.06 (d, J= 1.8 Hz, 1H), 8.49 (d, J= 2.0 Hz, 1H), 8.08 (dd, J= 8.2, 1.1 Hz, 1H), 7.70 (t, J= 2.2 Hz, 1H), 7.22 (dq, J= 11.8, 1.7 Hz, 1H), 6.53 (dd, J= 8.2, 1.5 Hz, 1H), 4.32 (s, 3H), 3.82 (d, J= 11.7 Hz, 2H), 3.20-2.93 (m, 4H), 2.66 (dd, J= 12.3, 10.3 Hz, 1H), 2.43 (s, 3H), 1.21 (d, J= 6.4 Hz, 3H). Compound 353 : RT=5.317 min. LCMS (ES, m, z):422 [M+H] ⁺ . ¹ H NMR (400 MHz, Methanol-d ₄ ) δ 9.04 (s, 1H), 8.47 (d, J= 3.8 Hz, 1H), 8.06 (dd, J= 8.9, 1.8 Hz, 1H), 7.68 (d, J= 3.3 Hz, 1H), 7.22-7.18 (m, 1H), 6.51 (dd, J= 8.2, 3.0 Hz, 1H), 4.31 (d, J= 1.6 Hz, 3H), 3.81 (dd, J= 11.0, 5.2 Hz, 2H), 3.15-2.96 (m, 4H), 2.65 (dd, J= 12.5, 10.3 Hz, 1H), 2.43 (d, J= 1.0 Hz, 3H), 1.21 (d, J = 6.4 Hz, 3H).

Example 114: Synthesis of Compound 364

Synthesis of Intermediate Cl 49 C ₂ 1 C149

A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(2- oxopropyl)indazol-4-yl]piperazine-l -carboxylate (60.0 mg, 0.10 mmol, 1.0 equiv) in DCM (2 mL) was treated with DAST (35.1 mg, 0.21 mmol, 2.0 equiv) at 0 °C. The resulting mixture was stirred for 3 h at room temperature, then quenched with ice-water at 0 °C. The resulting mixture was extracted with ethyl acetate (3x10 mL). The organic layers were combined, washed with brine (1x10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[2-(2,2-difluoropropyl)-7-({8- fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbamoyl)indazol-4-yl]piperazine- 1 -carboxylate (29 mg, 46%) as a solid. LCMS (ES, m/z): 572 [M+H] ⁺ .

Synthesis of Compound 364

A solution of tert-butyl 4-[2-(2,2-difluoropropyl)-7-({8-fluoro-2-methylimidazo[1,2-a ]pyridin-6- yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (29.0 mg, 0.05 mmol, 1.0 equiv) in DCM (0.5 mL) was treated with TFA (0.5 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 1) to afford 2-(2,2-difluoropropyl)- N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin -l-yl)indazole-7-carboxamide; trifluoroacetic acid (8 mg, 27%) as a solid. LCMS (ES, m/z): 472 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.19 (s, 1H), 9.40 (s, 1H), 9.00 (s, 1H), 8.86-8.85 (m, 2H), 8.08-8.06 (m, 2H), 7.53 (d, J= 11.9 Hz, 1H), 6.66 (d, J= 8.0 Hz, 1H), 5.17 (t, J= 13.1 Hz, 2H), 3.60-3.59 (m, 4H), 3.37- 3.35 (m, 4H), 2.41 (s, 3H), 1.78 (t, J= 19.2 Hz, 3H).

Example 115: Synthesis of Compound 365

Synthesis of Intermediate Cl 50

A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2H- indazol-4-yl]piperazine-l -carboxylate (50 mg, 0.1 mmol, 1 equiv), 2-oxaspiro[3.3]heptan-6-yl methanesulfonate (50 mg, 0.26 mmol, 2.57 equiv), and Cs ₂ CO ₃ (99 mg, 0.3 mmol, 3.0 equiv) in DMF (2 mL) was stirred for 12 h at 90 °C. The reaction mixture was purified by reverse flash chromatography (Condition 2, Gradient 3) to afford tert-butyl 4-[7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-{2-oxaspiro[3. 3]heptan-6-yl}indazol-4- yl]piperazine-l -carboxylate (50 mg, 84%) as a solid. LCMS (ES, m z): 590 [M+H] ⁺ .

Synthesis of Compound 365

365 C ₁ 50 A mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-{2- oxaspiro[3.3]heptan-6-yl}indazol-4-yl]piperazine-l-carboxyla te (30 mg, 0.05 mmol, 1 equiv) and ZnBr2 (30 mg, 0.133 mmol, 2.62 equiv) in DCM (1 mL) was stirred for 12 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 1, Gradient 5) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-{2-oxaspir o[3.3]heptan-6-yl}-4- (piperazin-l-yl)indazole-7-carboxamide (2 mg, 8%) as a solid. LCMS (ES, m/z): 490 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.20 (d, J= 1.7 Hz, 1H), 8.84 (s, 1H), 7.98 (d, J = 8.1 Hz, 1H), 7.92 (d, J= 3.1 Hz, 1H), 7.22 (dd, J= 12.3, 1.7 Hz, 1H), 6.49 (d, J= 8.2 Hz, 1H), 5.19 (p, J= 8.1 Hz, 1H), 4.77 (s, 2H), 4.70 (s, 2H), 3.32-3.26 (m, 4H), 2.96-2.91 (m, 8H), 2.39- 2.33 (m, 3H).

Example 116: Synthesis of Compound 366

Synthesis of Intermediate C151 -r , m n C ₁ 51

To a stirred solutioin of l,3-oxazol-5-ylmethanol (600.0 mg, 6.055 mmol, 1.0 equiv) in DCM (12 mL) was added Et3N (919.1 mg, 9.082 mmol, 1.5 equiv) and MsCI (762.9 mg, 6.660 mmol, 1.1 equiv) dropwise at 0 °C under nitrogen atmosphere. The resulting mixture was stirred for 30 min at room temperature under nitrogen atmosphere, then concentrated under vacuum to give a residue.

Synthesis of Intermediate Cl 52 To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (600.0 mg, 1.216 mmol, 1.0 equiv) in DMF (12 mL) was added Cs ₂ CO ₃ (1.18 g, 3.648 mmol, 3.0 equiv) and l,3-oxazol-5-ylmethyl methanesulfonate (215.4 mg, 1.216 mmol, 1.0 equiv) at room temperature. The resulting mixture was stirred for 16 h at 50 °C, then cooled to room temperature. The resulting mixture was diluted with water (20 mL) and extracted with ethyl acetate (3x20 mL). The organic layers were combined, washed with water (3x20 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with ethyl acetate to afford tert-butyl 4-[7- ({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-( l,3-oxazol-5-ylmethyl)indazol-4- yl]piperazine-l -carboxylate (80 mg, 11%) as a solid. LCMS (ES, m/z):575 [M+H] ⁺ .

Synthesis of Compound 366

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-(l,3-oxazol-5-ylmethyl)indazol-4-yl]piperazi ne-l-carboxylate (75.0 mg, 0.131 mmol, 1.0 equiv) in DCM (2 mL) was added TFA (0.2 mL) dropwise at 0 °C. The resulting mixture was stirred for 30 min at room temperature, then concentrated under vacuum to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 8) to afford N-{8- fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-(l ,3 -oxazol-5-ylmethyl)-4-(piperazin- 1 -yl) indazole-7-carboxamide (20.2 mg, 33%) as a solid. LCMS (ES, m, z):475 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.02 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.95 (s, 1H), 8.42 (s, 1H), 7.99 (d, J= 8.1 Hz, 1H), 7.92 (d, J = 3.1 Hz, 1H), 7.50 (s, 1H), 7.14 (dd, J= 12.2, 1.7 Hz, 1H), 6.51 (d, J= 8.2 Hz, 1H), 5.95 (s, 2H), 3.38 (t,4H), 2.93 (t, 4H), 2.36 (s, 3H).

Example 117: Synthesis of Compound 367 Synthesis of Intermediate Cl 53

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (120.0 mg, 0.24 mmol, 1.0 equiv) and l-bromo-2-m ethoxypropane (55.8 mg, 0.36 mmol, 1.5 equiv) in DMF (1.5 mL) was added Cs ₂ CO ₃ (237.6 mg, 0.73 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 4 h at 40 °C, then diluted with water and extracted with ethyl acetate (3 x 10 mL). The organic layers were combined, washed with brine (1x10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with EA to afford tertbutyl 4-[7-({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)-2-(2- methoxypropyl)indazol-4-yl]piperazine-l -carboxylate (70 mg, 51%) as a solid. LCMS (ES, m/z): 566 [M+H] ⁺ .

Synthesis of Compound 367

A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-(2- methoxypropyl)indazol-4-yl]piperazine-l -carboxylate (70.0 mg, 0.12 mmol, 1.0 equiv) in DCM (0.7 mL) was treated with TFA (0.7 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 15) to afford N-{8-fluoro-2- methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-(2-methoxypropyl)-4-(piperazin- 1 -yl)indazole-7 - carboxamide; trifluoroacetic acid (28 mg, 39%) as a solid. LCMS (ES, m/z): 466 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.24 (s, 1H), 9.41 (d, J= 1.6 Hz, 1H), 8.90-8.88 (m, 3H), 8.08 (d, J = 2.7 Hz, 1H), 8.05 (d, J= 8.0 Hz, 1H), 7.62 (d, J= 11.9 Hz, 1H), 6.63 (d, J= 8.1 Hz, 1H), 4.76-4.50 (m, 2H), 4.03 (td, J= 6.8, 4.5 Hz, 1H), 3.60 (t, J= 5.0 Hz, 4H), 3.37-3.35 (m, 4H), 3.24 (s, 3H), 2.42 (s, 3H), 1.21 (d, J = 6.2 Hz, 3H).

Example 118: Synthesis of Compound 368

Synthesis of Intermediate Cl 54

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and 4-(chloromethyl)-l-methyl-1,2,3-triazole (31.9 mg, 0.24 mmol, 1.2 equiv) in DMF (1 mL) was added Cs ₂ CO ₃ (198.0 mg, 0.60 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then diluted with water and extracted with ethyl acetate (2 x 15 mL). The organic layers were combined, washed with brine (1x10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with ethyl acetate to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- [(l-methyl-1,2,3-triazol-4-yl)methyl]indazol-4-yl]piperazine -l-carboxylate (65 mg, 55%) as a solid. LCMS (ES, m/z): 589 [M+H] ⁺ .

Synthesis of Compound 368 A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-[(l- methyl-1,2,3-triazol-4-yl)methyl]indazol-4-yl]piperazine-l-c arboxylate (65.0 mg, 0.11 mmol, 1.0 equiv) in DCM (0.3 mL) was treated with TFA (0.3 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 3, Gradient 7) to afford N-{8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-[(l -methyl- 1,2, 3-tri azol -4-yl)methyl]-4- (piperazin-l-yl)indazole-7-carboxamide; trifluoroacetic acid (25.8 mg, 39%) as a solid. LCMS (ES, m/z): 489 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.22 (s, 1H), 9.40 (d, J= 1.6 Hz, 1H), 9.04 (s, 1H), 8.90-8.89 (m, 2H), 8.26 (s, 1H), 8.08 (d, J= 2.7 Hz, 1H), 8.03 (d, J= 8.0 Hz, 1H), 7.55 (d, J= 12.0 Hz, 1H), 6.63 (d, J= 8.1 Hz, 1H), 5.89 (s, 2H), 4.06 (s, 3H), 3.60-3.59 (m, 4H), 3.36-3.34 (m, 4H), 2.42 (s, 3H).

Example 119: Synthesis of Compound 369

Synthesis of Intermediate Cl 55

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(2-hydroxyethyl)- N-(piperidin-4-yl)carbamate (43.74 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (20: 1) to afford tert-butyl N- {l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoy l)-2-methylindazol-4- yl]piperidin-4-yl}-N-(2-hydroxyethyl)carbamate (70 mg, 83%) as an oil. LCMS (ES, m/z): 566[M+H] ⁺ . Synthesis of Compound 369

To a stirred solution of tert-butyl N-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperidin-4-yl}-N-(2-hydrox yethyl)carbamate (70 mg, 0.124 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 108.79 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 8) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-{4-[(2- hydroxyethyl)amino]piperidin-l-yl}-2-methylindazole-7-carbox amide (14.1 mg, 24%) as a solid. LCMS (ES, m/z): 466[M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.78 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.91 (d, J= 3.2 Hz, 1H), 7.34 (dd, J= 12.4, 1.7 Hz, 1H), 6.56 - 6.45 (m, 2H), 4.57 (s, 1H), 4.30 (s, 3H), 3.91 (d, J= 12.7 Hz, 2H), 3.50 (s, 2H), 3.06 (t, J= 11.8 Hz, 2H), 2.70 (s, 3H), 2.35 (s, 3H), 1.99 (d, J= 12.6 Hz, 2H), 1.47 (d, J= 11.6 Hz, 2H).

Example 120: Synthesis of Compound 370

Synthesis of Intermediate C156 C156

A mixture of tert-butyl 4-oxopiperidine-l -carboxylate (2.0 g, 10.038 mmol, 1 equiv) and benzylamine (1.08 g, 10.038 mmol, 1 equiv) in toluene (30 mL) was stirred overnight at 120 °C with an attached Dean-Stark trap. The resulting mixture was cooled to room temperature, then concentrated under vacuum to afford tert-butyl 4-(benzylimino)piperidine-l -carboxylate (3.05 g, crude) as an oil. LCMS (ES, m/z): 289[M+H] ⁺ .

Synthesis of Intermediate Cl 57 C ₁ 56 C ₁ 57

To a stirred solution of tert-butyl 4-(benzylimino)piperidine-l -carboxylate (3.05 g, 10.576 mmol, 1 equiv), DMF (2.32 g, 31.728 mmol, 3 equiv), and KHF2 (0.66 g, 8.461 mmol, 0.8 equiv) in acetonitrile (30 mL) was added TFA (1.51 g, 13.220 mmol, 1.25 equiv) dropwise at 0°C under nitrogen atmosphere. The resulting mixture was stirred for 20 min at 0 °C under nitrogen atmosphere. To the reaction mixture was added trifluoromethyltrimethylsilane (2.26 g, 15.864 mmol, 1.5 equiv) dropwise at 0 °C under nitrogen atmosphere. The resulting mixture was stirred overnight at room temperature under nitrogen atmosphere, then quenched with saturated NaHCO3 (50 mL) at room temperature. The resulting mixture was extracted with ethyl acetate (3 x50 mL). The organic layers were combined, washed with brine (1x50 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford tert-butyl 4-(benzylamino)-4-(trifluoromethyl)piperidine-l -carboxylate (820 mg, 22%) as an oil. LCMS (ES, m/z): 359[M+H] ⁺ .

Synthesis of Intermediate Cl 58 C ₁ 57 C ₁ 58

A mixture of tert-butyl 4-(benzylamino)-4-(trifluoromethyl)piperidine-l -carboxylate (200 mg, 0.558 mmol, 1 equiv) and HCl (gas) in 1,4-dioxane (2 mL) was stirred for 2 h at room temperature under nitrogen atmosphere. The resulting mixture was concentrated under vacuum to afford N-benzyl-4-(trifluoromethyl)piperidin-4-amine dihydrochloride (180 mg, 97%) as a solid. LCMS (ES, m/z): 259[M+H] ⁺ . Synthesis of Intermediate Cl 59 C ₅ 5 C159

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and N-benzyl-4- (trifluoromethyl)piperidin-4-amine (46.23 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (20: 1) to afford 4-[4- (benzylamino)-4-(trifluoromethyl)piperidin- 1 -yl]-N-{ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6- yl}-2-methylindazole-7-carboxamide (70 mg, 81%) as an oil. LCMS (ES, m/z): 580[M+H] ⁺ .

Synthesis of Compound 370

C159 370

To a solution of 4-[4-(benzylamino)-4-(trifluoromethyl)piperidin-l-yl]-N-{8-f luoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxa mide (70 mg, 0.121 mmol, 1 equiv) in methanol (5 mL) was added Pd/C (10%, 10 mg) under nitrogen atmosphere. The reaction mixture was hydrogenated at room temperature for 1 h using a hydrogen balloon. The resulting mixture was filtered, and the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 2) to afford 4-[4-amino- 4-(trifluoromethyl)piperidin- 1 -yl]-N- { 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2- methylindazole-7-carboxamide (7.9 mg, 13%) as a solid. LCMS (ES, m/z): 490[M+H] ⁺ . ¹ H NMR (400 MHz, Methanol-d ₄ ) δ 9.09 (d, J= 1.6 Hz, 1H), 8.52 (s, 1H), 8.09 (d, J= 8.1 Hz, 1H), 7.75 - 7.70 (m, 1H), 7.26 (dd, J= 11.8, 1.7 Hz, 1H), 6.57 (d, J= 8.2 Hz, 1H), 4.85 (s, 3H), 4.33 (s, 2H), 3.85 (d, J= 12.8 Hz, 2H), 3.49 - 3.39 (m, 2H), 2.44 (d, J= 0.9 Hz, 3H), 2.17 - 2.03 (m, 2H), 1.76 (d, J= 13.2 Hz, 2H), 1.31 (s, 1H).

Example 121: Synthesis of Compound 371

Synthesis of Intermediate Cl 60

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N- [(3R)-pyrrolidin-3-yl]carbamate (40.51 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (2 mL) was added Cs ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (20: 1) to afford tert-butyl N- cyclopropyl-N-[(3R)-l-[7-({8-fluoro-2-methylimidazo[1,2-a]py ridin-6-yl}carbamoyl)-2- methylindazol-4-yl]pyrrolidin-3-yl]carbamate (60 mg, 73%) as a solid. LCMS (ES, m/z): 548[M+H] ⁺ .

Synthesis of Compound 371

To a stirred solution of tert-butyl N-cyclopropyl-N-[(3R)-l-[7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3- yl]carbamate (60 mg, 0.110 mmol, 1 equiv) in DCM (1 mL) was added TMSI (109.61 mg, 0.550 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature, then neutralized with tri ethyl amine. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 2, Gradient 2), followed by chiral SFC (Condition 4, Gradient 1) to afford 4-[(3R)-3-(cyclopropylamino)pyrrolidin-l-yl]-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxa mide (17.8 mg, 36%) as a solid. LCMS (ES, m/z): 448[M+H] ⁺ . ¹ H NMR (400 MHz, Methanol-d ₄ ) δ 9.02 (d, J= 1.8 Hz, 1H), 8.54 (s, 1H), 8.04 (d, J= 8.4 Hz, 1H), 7.70 (d, J = 3.0 Hz, 1H), 7.18 (dd, J= 11.9, 1.6 Hz, 1H), 6.07 (d, J= 8.5 Hz, 1H), 4.29 (s, 3H), 3.93 - 3.81 (m, 2H), 3.70 (dq, J= 12.0, 6.8, 6.1 Hz, 2H), 3.53 (dd, J= 10.3, 5.5 Hz, 1H), 2.44 (s, 3H), 2.40 - 2.26 (m, 2H), 2.15 - 2.02 (m, 1H), 0.58 (d, J = 6.9 Hz, 2H), 0.45 3.7 Hz, 2H).

Example 122: Synthesis of Compound 372

Synthesis of Intermediate C161

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N- [(3S)-pyrrolidin-3-yl]carbamate (40.51 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) was added Cs ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (20: 1) to afford tert-butyl N- cyclopropyl-N-[(3S)-l-[7-({8-fluoro-2-methylimidazo[1,2-a]py ridin-6-yl}carbamoyl)-2- methylindazol-4-yl]pyrrolidin-3-yl]carbamate (60 mg, 73%) as a solid. LCMS (ES, m/z): 548[M+H] ⁺ .

Synthesis of Compound 372

To a stirred solution of tert-butyl N-cyclopropyl-N-[(3R)-l-[7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3- yl]carbamate (60 mg, 0.110 mmol, 1 equiv) in DCM (1 mL) was added TMSI (109.61 mg, 0.550 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature, then neutralized with tri ethyl amine. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 12, Gradient 1). The product was further purified by chiral SFC (Condition 4, Gradient 1) to afford 4-[(3 S)-3 - (cyclopropylamino)pyrrolidin-l-yl]-N-{8-fluoro-2-methylimida zo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (9.3 mg, 19%) as a solid. LCMS (ES, m z): 448[M+H] ⁺ . ¹ H NMR (400 MHz, Methanol-d ₄ ) δ 9.02 (d, J= 1.6 Hz, 1H), 8.54 (s, 1H), 8.04 (d, J= 8.4 Hz, 1H), 7.70 (d, J = 3.0 Hz, 1H), 7.18 (dd, J= 11.9, 1.7 Hz, 1H), 6.07 (d, J= 8.4 Hz, 1H), 4.29 (s, 3H), 3.92 - 3.80 (m, 2H), 3.69 (dq, J= 12.1, 6.7, 6.0 Hz, 2H), 3.57 - 3.50 (m, 1H), 2.44 (s, 3H), 2.40 - 2.26 (m, 2H), 2.12 - 2.04 (m, 2H), 0.61 - 0.52 (m, 2H), 0.44 (h, J= 4.5, 3.9 Hz, 2H). Example 123: Synthesis of Compound 373

Synthesis of Compound 373

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (100 mg, 0.249 mmol, 1 equiv) and N-[l- (fluoromethyl)cyclopropyl]pyrrolidin-3-amine (47.20 mg, 0.299 mmol, 1.2 equiv) in 1,4-dioxane (2 mL) was added Cs ₂ CO ₃ (243.01 mg, 0.747 mmol, 3 equiv), RuPhos (23.20 mg, 0.050 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (20.79 mg, 0.025 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (20: 1), followed by Prep-HPLC (Condition 12, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin- 6-yl}-4-(3-{[l-(fluoromethyl)cyclopropyl]amino}pyrrolidin-l- yl)-2-methylindazole-7- carboxamide (5.1 mg, 4%) as a solid. LCMS (ES, m/z): 480[M+H] ⁺ . ¹ H NMR (400 MHz, Methanol-d ₄ ) δ 9.04 (d, J= 1.7 Hz, 1H), 8.53 (s, 1H), 8.04 (d, J= 8.4 Hz, 1H), 7.74 - 7.68 (m, 1H), 7.21 (dd, J= 11.9, 1.6 Hz, 1H), 6.06 (d, J= 8.4 Hz, 1H), 4.52 (s, 1H), 4.40 (s, 1H), 4.30 (s, 3H), 3.89 (q, J= 7.8, 6.7 Hz, 3H), 3.85 - 3.78 (m, 1H), 3.71 (q, J= 7.7 Hz, 1H), 2.44 (d, J= 0.9 Hz, 3H), 2.34 (dd, J= 12.1, 6.3 Hz, 1H), 2.04 (dt, J= 13.9, 6.9 Hz, 1H), 1.31 (s, 2H), 0.84 - 0.67 (m, 4H).

Example 124: Synthesis of Compound 374

Synthesis of Intermediate Cl 62

A mixture of methyl 4-bromo-2H-indazole-7-carboxylate (8 g, 31.36 mmol, 1 equiv) and tetrafluoroboranuide; tri ethyl oxi danium (17.9 g, 94.09 mmol, 3 equiv) in ethyl acetate (100 mL) was stirred overnight at room temperature. The reaction mixture was quenched with water (200 mL) at room temperature, then extracted with ethyl acetate (3 x 50 mL). The organic layers were combined, washed with brine (1 x 100 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford methyl 4-bromo-2- ethylindazole-7-carboxylate (6.36 g, 72%) as a solid. LCMS (ES, m/z): 283 [M+H] ⁺ .

Synthesis of Intermediate C163

A mixture of methyl 4-bromo-2-ethylindazole-7-carboxylate (5.4 g, 18.93 mmol, 1 equiv) and LiOH.H ₂ O (7.9 g, 189.3 mmol, 10 equiv) in THF (50 mL), methanol (50 mL) and water (25 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was dissolved in ethyl acetate (100 mL) and diluted with water (200 mL). The resulting mixture was acidified to pH 2 with IM HCl (aq.) and extracted with ethyl acetate (3 x 50 mL). The organic layers were combined, washed with brine (1 x 100 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to afford 4-bromo-2-ethylindazole-7-carboxylic acid (5 g, 98%) as a solid. LCMS (ES, m/z): 269 [M+H] ⁺ .

Synthesis of Intermediate Cl 64

To a stirred mixture of 4-bromo-2-ethylindazole-7-carboxylic acid (5.8 g, 21.55 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (5.3 g, 32.33 mmol, 1.5 equiv) in DMF (20 mL) was added HATU (9.8 g, 25.86 mmol, 1.2 equiv) and DIEA (13.9 g, 107.76 mmol, 5 equiv) in portions at room temperature. The resulting mixture was stirred for 4 h at room temperature, then quenched with water (50 mL). A precipitate formed that was collected by filtration and washed with water (2 x 50 mL) to afford 4-bromo-2-ethyl-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (8.1 g, 90%) as a solid. LCMS (ES, m/z): 416 [M+H] ⁺ .

Synthesis of Intermediate Cl 65 C ₁ 65

To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (180 mg, 0.43 mmol, 1 equiv) and tert-butyl N-methyl-N- (pyrrolidin-3-yl)carbamate (87 mg, 0.43 mmol, 1 equiv) in dioxane (10 mL) was added Cs ₂ CO ₃ (423 mg, 1.29 mmol, 3 equiv), RuPhos (41 mg, 0.086 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90°C under nitrogen atmosphere, then concentrated under reduced pressure to give a residue. The residue was taken up in water (20 mL) and extracted with ethyl acetate (3 x 10 mL). The organic layers were combined, washed with brine (1 x 30 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl N-{ l-[2- ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbam oyl)indazol-4-yl]pyrrolidin-3-yl}- N-methyl carbamate (160 mg, 69%) as a solid. LCMS (ES, m/z): 536 [M+H] ⁺ .

Synthesis of Compound 374

A mixture of tert-butyl N-{l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)indazol-4-yl]pyrrolidin-3-yl}-N-methylcarbamate (135 mg, 0.25 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was basified to pH 8 with 7 M NH3(g) in methanol. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (Condition 13, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[3 - (methylamino)pyrrolidin-l-yl]indazole-7-carboxamide (30 mg, 27%) as a solid. LCMS (ES, m/z): 436 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.05 (s, 1H), 9.19 (d, J = 1.6 Hz, 1H), 8.84 (s, 1H), 7.97 - 7.85 (m, 2H), 7.26 (dd, J = 12.4, 1.6 Hz, 1H), 6.01 (d, J = 8.4 Hz, 1H), 4.57 (q, J = 7.3 Hz, 2H), 3.76 (dq, J = 13.7, 7.1, 6.3 Hz, 1H), 3.65 (d, J = 7.4 Hz, 3H), 3.42 (dd, J = 10.2, 4.0 Hz, 2H), 2.35 (s, 6H), 2.14 (dd, J = 11.2, 4.5 Hz, 1H), 1.92 (dd, J = 11.8, 6.1 Hz, 1H), 1.61 (t, J = 7.2 Hz, 3H).

Example 125: Synthesis of Compound 375

Synthesis of Compound 375

To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and N,N-dimethylpyrrolidin-3 -amine (25 mg, 0.22 mmol, 1 equiv) in dioxane (5 mL) was added Cs ₂ CO ₃ (211 mg, 0.66 mmol, 3 equiv), RuPhos (20 mg, 0.044 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90 °C under nitrogen atmosphere, then cooled to room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was dissolved in water (20 mL) and extracted with ethyl acetate (3x5 mL). The organic layers were combined, washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (Condition 13, Gradient 2) to afford 4-[3- (dimethylamino)pyrrolidin-l-yl]-2-ethyl-N-{8-fluoro-2-methyl imidazo[1,2-a]pyri din-6- yl}indazole-7-carboxamide (17.4 mg, 18%) as a solid. LCMS (ES, m/z) 450 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.06 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.88 (s, 1H), 7.98 - 7.86 (m, 2H), 7.27 (dd, J= 12.4, 1.7 Hz, 1H), 6.05 (d, J= 8.4 Hz, 1H), 4.57 (q, J= 13 Hz, 2H), 3.81 (dt, J= 19.0, 9.0 Hz, 2H), 3.65 (q, J= 9.5, 9.0 Hz, 1H), 3.46 (t, J= 9.0 Hz, 1H), 2.91 (s, 1H), 2.35 (s, 3H), 2.28 (s, 6H), 2.23 (s, 1H), 1.93 (q, J= 11.6, 10.7 Hz, 1H), 1.61 (t, J= 7.2 Hz, 3H).

Example 126: Synthesis of Compound 376

Synthesis of Intermediate Cl 66 C ₁ 64 C ₁ 66

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (190 mg, 0.46 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N- (piperidin-4-yl)carbamate (110 mg, 0.46 mmol, 1 equiv) in dioxane (10 mL) was added Cs ₂ CO ₃ (446 mg, 1.38 mmol, 3 equiv), RuPhos (43 mg, 0.092 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (38 mg, 0.046 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90 °C under nitrogen atmosphere, then cooled to room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was dissolved in water (20 mL) and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl N-cyclopropyl-N-{ l-[2-ethyl-7- ({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)inda zol-4-yl]piperidin-4- yljcarbamate (150 mg, 57%) as a solid. LCMS (ES, m/z): 576 [M+H] ⁺ .

Synthesis of Compound 376 A mixture of tert-butyl N-cyclopropyl-N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl} carbarnoyl)indazol-4-yl]piperidin-4-yl} carbamate (60 mg, 0.104 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was basified to pH 8 with 7 M NH3(g) in methanol, then concentrated under vacuum to give a residue. The residue was purified by prep-HPLC (Condition 13, Gradient 3) to afford 4-[4- (cy cl opropylamino)piperi din- l-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyri din-6- yl}indazole-7-carboxamide (20 mg, 40%) as a solid. LCMS (ES, m/z): 476 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.80 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.30 (dd, J= 12.3, 1.7 Hz, 1H), 6.48 (d, J= 8.2 Hz, 1H), 4.60 (q, J = 7.2 Hz, 2H), 3.88 (d, J= 13.0 Hz, 2H), 3.13 - 2.99 (m, 2H), 2.77 (dd, J= 9.2, 5.0 Hz, 1H), 2.35 (s, 3H), 2.13 (tt, J = 6.8, 3.6 Hz, 1H), 2.06 - 1.96 (m, 2H), 1.62 (t, J = 7.3 Hz, 3H), 1.48 (q, J = 10.2 Hz, 2H), 0.40 (dt, J= 6.2, 3.0 Hz, 2H), 0.24 (p, J= 3.9 Hz, 2H).

Example 127: Synthesis of Compound 377

Synthesis of Intermediate Cl 67

C164 C167

To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and tert-butyl (2R,6S)-2,6- dimethylpiperazine-1 -carboxylate (50 mg, 0.24 mmol, 1.0 equiv) in dioxane (5 mL) was added Cs ₂ CO ₃ (211 mg, 0.648 mmol, 3 equiv), RuPhos (20 mg, 0.044 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90 °C under nitrogen atmosphere, then cooled to room temperature. The resulting mixture was concentrated under reduced pressure to give a residue. The residue was dissolved in water (20 mL) and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl (2R,6S)-4-[2-ethyl-7-({8-fluoro-2- methylimidazof 1 ,2-a]pyridin-6-yl } carbarnoyl)indazol-4-yl]-2,6-dimethylpiperazine- 1 - carboxylate (65 mg, 55%) as a solid. LCMS (ES, m/z)'. 550 [M+H] ⁺ .

Synthesis of Compound 377 C ₁ 67 377

A mixture of tert-butyl (2R,6S)-4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridi n-6- yl}carbamoyl)indazol-4-yl]-2,6-dimethylpiperazine-l-carboxyl ate (10 mg, 0.018 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure, then basified to pH 8 with 7 M NH3 (g) in methanol, and concentrated under vacuum to give a residue. The residue was purified by prep-HPLC (Condition 13, Gradient 4) to afford 4-[(3R,5S)-3,5-dimethylpiperazin-l-yl]-2-ethyl- N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-ca rboxamide (12 mg, 27%) as a solid. LCMS (ES, m/z): 450 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.20 (d, J = 1.6 Hz, 1H), 8.82 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.29 (dd, J= 12.3, 1.7 Hz, 1H), 6.47 (d, J= 8.2 Hz, 1H), 4.60 (q, J= 7.3 Hz, 2H), 3.78 (dd, J= 12.2, 2.7 Hz, 2H), 2.96 (tt, J= 8.0, 5.5 Hz, 2H), 2.44 (d, J= 11.0 Hz, 2H), 2.35 (s, 3H), 1.62 (t, J= 7.2 Hz, 3H), 1.07 (d, J = 6.2 Hz, 6H).

Example 128: Synthesis of Compound 378

Synthesis of Compound 378

B164 378

To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and 1 -methylpiperazine (22 mg, 0.22 mmol, 1 equiv) in dioxane (5 mL) was added Cs ₂ CO ₃ (211 mg, 0.66 mmol, 3 equiv), RuPhos (20 mg, 0.044 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90°C under nitrogen atmosphere, then cooled to room temperature, and concentrated under reduced pressure to give a residue. The residue was dissolved in water (20 mL) and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by prep-HPLC (Condition 13, Gradient 2) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4- (4-methylpiperazin-l-yl)indazole-7-carboxamide (15 mg, 16%) as a solid. LCMS (ES, m/z): 436 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.84 (s, 1H), 7.98 (d, J= 8.1 Hz, 1H), 7.90 (dd, J= 3.1, 1.0 Hz, 1H), 7.30 (dd, J= 12.4, 1.7 Hz, 1H), 6.51 (d, J = 8.2 Hz, 1H), 4.60 (q, J= 13 Hz, 2H), 3.43 (t, J= 5.0 Hz, 4H), 2.55 (d, J= 4.9 Hz, 4H), 2.35 (s, 3H), 2.28 (s, 3H), 1.62 (t, J= 13 Hz, 3H).

Example 129: Synthesis of Compound 379

Synthesis of Intermediate Cl 68 C ₁ 64 C ₁ 68

To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and tert-butyl 4,7- diazaspiro[2.5]octane-4-carboxylate (46 mg, 0.22 mmol, 1 equiv) in dioxane (5 mL) was added Cs ₂ CO ₃ (211 mg, 0.66 mmol, 3 equiv), RuPhos (10 mg, 0.044 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90°C under nitrogen atmosphere, then cooled to room temperature, and concentrated under vacuum to give a residue. The residue was dissolved in water (20 mL) and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl 7-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}c arbamoyl)indazol- 4-yl]-4,7-diazaspiro[2.5]octane-4-carboxylate (50 mg, 42%) as a solid. LCMS (ES, m/z): 548 [M+H] ⁺ .

Synthesis of Compound 379 A mixture of tert-butyl 7-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-4,7-diazaspiro[2.5]octane-4-carbo xylate (40 mg, 0.073 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum, basified to pH 8 with 7 M NHs(g) in methanol, and concentrated under vacuum to give a residue. The residue was purified by prep- HPLC (Condition 13, Gradient 3) to afford 4-{4,7-diazaspiro[2.5]octan-7-yl}-2-ethyl-N-{8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxa mide (20 mg, 61%) as a solid. LCMS (ES, m/z): 448 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.20 (s, 1H), 8.73 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.93 - 7.87 (m, 1H), 7.30 (d, J= 12.3 Hz, 1H), 6.46 (d, J= 8.2 Hz, 1H), 4.59 (q, J= 7.2 Hz, 2H), 3.40 (s, 2H), 3.25 (s, 2H), 2.99 (d, J= 6.0 Hz, 2H), 2.35 (s, 3H), 1.62 (t, J= 7.3 Hz, 3H), 0.61 (s, 2H), 0.54 (s, 2H).

Example 130: Synthesis of Compound 380

Synthesis of Intermediate Cl 69

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (90 mg, 0.216 mmol, 1 equiv) and tert-butyl N-ethyl-N-(piperidin-4- yl)carbamate (49 mg, 0.216 mmol, 1 equiv) in dioxane (5 mL) was added Cs ₂ CO ₃ (211 mg, 0.648 mmol, 3 equiv), RuPhos (11 mg, 0.044 mmol, 0.2 equiv), and RuPhos Palladacycle Gen.3 (10 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90 °C under nitrogen atmosphere, then cooled to room temperature, and concentrated under reduced pressure to give a residue. The residue was dissolved in water (20 mL) and extracted with ethyl acetate (3 x 5 mL). The organic layers were combined, washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ , and filtered. After filtration, the filtrate was concentrated under reduced pressure to give a residue. The residue was purified by reverse flash chromatography (Condition 2, Gradient 2) to afford tert-butyl N-ethyl- N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}c arbamoyl)indazol-4- yl]piperidin-4-yl} carbamate (45 mg, 37%) as a solid. LCMS (ES, m/z): 564 [M+H] ⁺ .

Synthesis of Compound 380

A mixture of tert-butyl N-ethyl-N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)indazol-4-yl]piperidin-4-yl} carbamate (35 mg, 0.062 mmol, 1 equiv) in trifluoroacetic acid (1 mL) and DCM (1 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure, basified to pH 8 with 7 M NH3(g) in methanol, and concentrated under vacuum to give a residue. The residue was purified by prep- HPLC (Condition 13, Gradient 3) to afford 2-ethyl-4-[4-(ethylamino)piperidin-l-yl]-N-{8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxa mide (15 mg, 52%) as a solid. LCMS (ES, m/z): 464 [M+H] ⁺ . ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.79 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.30 (dd, J= 12.3, 1.7 Hz, 1H), 6.48 (d, J= 8.2 Hz, 1H), 4.60 (q, J= 7.2 Hz, 2H), 3.89 (d, J= 12.7 Hz, 2H), 3.06 (t, J= 11.4 Hz, 2H), 2.75 - 2.55 (m, 3H), 2.35 (s, 3H), 1.96 (d, J= 12.1 Hz, 2H), 1.62 (t, J= 7.2 Hz, 3H), 1.45 (q, J= 10.0, 9.6 Hz, 2H), 1.04 (t, J= 7.1 Hz, 3H).

Example 131: Synthesis of Compound 381

Synthesis of Compound 381

To a stirred solution of tert-butyl N-cyclopropyl-N-[(3R)-l-[7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3- yl]carbamate (60 mg, 0.110 mmol, 1 equiv) in DCM (1 mL, 143.58 equiv) was added TFA (1 mL, 122.88 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 4) to afford 4-[(3R)-3-aminopyrrolidin-l-yl]-N-{8-fluoro-2-methylimidazo[ 1,2- a]pyridin-6-yl}-2-methylindazole-7-carboxamide (10.4 mg, 23%) as a solid. LCMS (ES, m z): 408[M+H] ⁺ . ¹ H NMR (400 MHz, Methanol-d ₄ ) δ 9.39 (d, J= 1.4 Hz, 1H), 8.62 (s, 1H), 8.10 (d, J= 8.3 Hz, 1H), 8.00 (s, 1H), 7.82 (d, J= 11.3 Hz, 1H), 6.17 (d, J= 8.4 Hz, 1H), 4.32 (s, 3H), 4.15 (s, 1H), 4.02 (dt, J= 17.0, 9.3 Hz, 2H), 3.95 - 3.85 (m, 1H), 3.77 (d, J= 10.9 Hz, 1H), 2.63 - 2.56 (m, 1H), 2.54 (s, 3H), 2.31 (s, 1H).

Example 132: Synthesis of Compound 382

Synthesis of Compound 382

To a stirred solution of tert-butyl N-cyclopropyl-N-[(3S)-l-[7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3- yl]carbamate (60 mg, 0.110 mmol, 1 equiv) in DCM (1 mL, 143.58 equiv) was added TFA (1 mL, 122.88 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature, then concentrated under reduced pressure to give a residue. The residue was purified by Prep-HPLC (Condition 10, Gradient 4) to afford 4-[(3S)-3-aminopyrrolidin-l-yl]-N-{8-fluoro-2-methylimidazo[ 1,2- a]pyridin-6-yl}-2-methylindazole-7-carboxamide (22.1 mg, 50%) as a solid. LCMS (ES, m/z): 408[M+H] ⁺ . ¹ H NMR (400 MHz, Methanol-d ₄ ) δ 9.39 (d, J= 1.4 Hz, 1H), 8.62 (s, 1H), 8.10 (d, J= 8.3 Hz, 1H), 8.00 (s, 1H), 7.82 (d, J= 11.3 Hz, 1H), 6.17 (d, J= 8.4 Hz, 1H), 4.32 (s, 3H), 4.15 (s, 1H), 4.02 (dt, J= 17.0, 9.3 Hz, 2H), 3.95 - 3.85 (m, 1H), 3.77 (d, J= 10.9 Hz, 1H), 2.63 - 2.56 (m, 1H), 2.54 (s, 3H), 2.31 (s, 1H).

Example 133: Synthesis of Compound 383

Synthesis of Intermediate Cl 62

C162

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-{2- azabicyclo[2.1.1]hexan-4-yl}carbamate (35.49 mg, 0.179 mmol, 1.2 equiv) in 1,4-dioxane (1.2 mL) were added Cs ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 hr at 100 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (20: 1) to afford tertbutyl N-{2-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbam oyl)-2-methylindazol-4- yl]-2-azabicyclo[2.1.1]hexan-4-yl}carbamate (C162, 70 mg, 90%) as a solid. LCMS (ES, m/z): 520 [M+H] ⁺

Synthesis of Compound 383 C ₁ 62 383

To a stirred solution of tert-butyl N-{2-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]-2-azabicyclo[2.1.1]hexan -4-yl}carbamate (70 mg, 0.135 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL, 13.463 mmol, 99.93 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient l) to afford 4-{4-amino-2-azabicyclo[2. l.l]hexan-2 -yl}-N-{8-fluoro-2 - methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxa mide (Compound 383, 14 mg, 24%) as a solid. LCMS (ES, m/z): 420 [M+H] ⁺¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.97 (s, 1H), 9.19 (s, 1H), 8.78 (s, 1H), 7.95 - 7.87 (m, 2H), 7.32 (d, J= 12.4 Hz, 1H), 6.29 (d, J= 8.4 Hz, 1H), 4.52 (s, 1H), 4.28 (s, 3H), 3.49 (s, 2H), 2.35 (s, 3H), 1.85 (s, 2H), 1.61 (s, 2H).

Example 134: Synthesis of Compound 384

Synthesis of Intermediate C163

A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl ) -2H- indazol-4-yl]piperazine-l -carboxylate (100 mg, 0.203 mmol, 1 equiv), (3-hydroxyoxetan-3-yl)methyl methane sulfonate (55 mg, 0.304 mmol, 1.5 equiv) and Cs ₂ CO ₃ (198 mg, 0.609 mmol, 3.0 equiv) in DMF (2 mL) was stirred for 12 hr at 90 °C. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford tert-butyl 4- [7-( { 8-fluoro-2-methylimidazo [ 1 ,2-a]pyridin-6-yl } carbamoyl) -2 - [ (3 -hydroxy oxetan-3 - yl)methyl]indazol-4-yl]piperazine-l -carboxylate (C ₁ 63, 35 mg, 29%) as a solid. LCMS (ES, m/z): 580

[M+H] ⁺

Synthesis of Compound 384

C163 384

A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl ) -2- [(3 -hydroxyoxetan-3-yl)methyl]indazol-4-yl]piperazine-l -carboxylate (30 mg, 0.052 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin- 6-yl} -2-[(3-hydroxyoxetan-3-yl)methyl]-4-(piperazin-l-yl)indazole -7-carboxamide (Compound 384, 10 mg, 40%) as a solid. LCMS (ES, m/z): 480 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.03 (s, 1H), 9.24 (d, J= 1.6 Hz, 1H), 8.77 (s, 1H), 8.00 (d, J= 8.1 Hz, 1H), 7.92 (d, J= 3.2 Hz, 1H), 7.25 (dd, J= 12.4, 1.7 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 6.25 (s, 1H), 4.88 (s, 2H), 4.84- 4.70 (m, 2H), 4.51 (d, J= 6.5 Hz, 2H), 3.45-3.37 (m, 4H), 2.91-2.73 (m, 4H), 2.35 (s, 3H).

Example 135: Synthesis of Compound 385

Synthesis of Intermediate Cl 64 C ₁ 64

Into a 40 mL round-bottom flask were added methyl 3 -hydroxy -2-nitrobenzoate (700 mg, 3.551 mmol, 1 equiv), acetic acid (10 mL) and Br2 (851.14 mg, 5.327 mmol, 1.5 equiv) at 25 degrees C. The resulting mixture was stirred for 12 hr at 25 °C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (3 : 1) to afford methyl 4-bromo-3-hydroxy-2-nitrobenzoate (Cl 64, 730 mg, 74%) as a solid. LCMS (ES, m/z): 274 [M-H] ’ Synthesis of Intermediate Cl 65 C ₁ 64 C ₁ 65

Into a 40 mL round-bottom flask were added methyl 4-bromo-3-hydroxy-2-nitrobenzoate (300 mg, 1.087 mmol, 1 equiv), acetic acid (6 mL) and zinc (213.16 mg, 3.260 mmol, 3.00 equiv) at 25 degrees C. The resulting mixture was stirred for 12 h at 25 degrees C. The reaction was quenched by the addition of sodium bicarbonate aqueous solution (50mL) at 25 degrees C. The aqueous layer was extracted with ethyl acetate (3x20 mL). The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 2-amino-4-bromo-3- hydroxybenzoate (C165, 200 mg, 74%) as a solid. LCMS (ES, m z) : 246 [M+H] ⁺ Synthesis of Intermediate C166 C165 C166

Into a 40 mL round-bottom flask were added methyl 2-amino-4-bromo-3 -hydroxybenzoate (200 mg, 0.813 mmol, 1 equiv) THF (10 mL) carbonyldiimidazole (197.70 mg, 1.220 mmol, 1.5 equiv) and triethylamine (246.75 mg, 2.439 mmol, 3 equiv) at 25 °C. The resulting mixture was stirred for 12 h at 60 °C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 7-bromo-2-oxo-3H-l,3-benz oxazole-4-carboxylate (C166, 200 mg, 90%) as a solid. LCMS (ES, m z): 272 [M-H] -

Synthesis of Intermediate C167

Into a 40 mL vial were added methyl 7-bromo-2-oxo-3H-l,3-benzoxazole-4-carboxylate (200 mg, 0.735 mmol, 1 equiv), triphenylphosphine (289.24 mg, 1.103 mmol, 1.5 equiv), DCM (4mL) and 2-methoxyethanol (67.13 mg, 0.882 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred for 1 hr at 0 °C under nitrogen atmosphere. To the above mixture was added DEAD (192.05 mg, 1.103 mmol, 1.5 equiv). The resulting mixture was stirred for additional 2 h at 25 degrees C. The reaction was quenched by the addition of water (10 mL) at room temperature. The aqueous layer was extracted with ethyl acetate (2 x 10 mL). The resulting liquid was dried Na ₂ SO ₄ . The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (3 : 1) to afford methyl 7-bromo-2-(2- methoxy ethoxy)- 1, 3 -benzoxazole-4 -carb oxy late (C167, 160 mg, 65%) as a solid.

LCMS (ES, m/z): 330 [M+H] ⁺ Synthesis of Intermediate Cl 68 C167 C168

Into a 40 mL vial were added methyl 7-bromo-2-(2-methoxyethoxy)-l,3-benzoxazole-4- carboxylate (150 mg, 0.454 mmol, 1 equiv), tert-butyl piperazine- 1 -carboxylate (101.55 mg, 0.545 mmol, 1.2 equiv) BINAP (56.59 mg, 0.091 mmol, 0.2 equiv), K3PO4 (289.33 mg, 1.362 mmol, 3 equiv), Pd2(dba)3 (41.61 mg, 0.045 mmol, 0.1 equiv) and dioxane (5 mL) at room temperature. The resulting mixture was stirred for 3 hr at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with THF/ EA (1 : 1) to afford methyl 7- ^-(tertbutoxy carbonyl)piperazin-l-yl]-2-(2-methoxyethoxy)-l,3-benzoxazole -4-carboxylate (Cl 68, 120 mg, 60%) as a solid. LCMS (ES, m/z): 436 [M+H] ⁺

Synthesis of Intermediate Cl 69 C ₁ 68 C ₁ 69

Into a 40 mL vial were added methyl 7-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-(2-me thoxyethoxy) -l,3-benzoxazole-4-carboxylate (120 mg, 0.276 mmol, 1 equiv), tetrahydrofuran (2 mL), water (2 mL) and LiOH (9.90 mg, 0.414 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 3 h at 40°C. The resulting mixture was diluted with water (30 mL). The mixture was acidified to pH 5 with HCl (aq.). The aqueous layer was extracted with ethyl acetate (2 x 50 mL). The resulting mixture was concentrated under reduced pressure. This resulted in 7-[4-(tert-butoxycarbonyl)piperazin - 1 -yl]-2-(2 -methoxy ethoxy) -l,3-benzoxazole-4- carboxylic acid (Cl 69, 100 mg, 86%) as a solid. LCMS (ES, m/z): 422 [M+H] ⁺

Synthesis of Intermediate C170

Into a 40 mL vial were added 7-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-(2 - methoxyethoxy) -1,3-ben zoxazole-4-carboxylic acid (100 mg, 0.237 mmol, 1 equiv), 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine (47.03 mg, 0.284 mmol, 1.2 equiv), HATU (85.79 mg, 0.355 mmol, 1.5 equiv), dimethylformamide (3 mL) and DIEA (92.00 mg, 0.711 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The reaction was quenched by the addition of water (10 mL) at room temperature. The aqueous layer was extracted with ethyl acetate (2 x 10 mL). The resulting liquid was dried over Na ₂ SO ₄ . The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (3: 1) to afford tert-butyl 4-[4-({8-fluoro-2- methylimidazo [1 ,2-a]pyri din-6-yl} carbarnoyl)-2-(2 -methoxy ethoxy)- l,3-benzoxazol-7- yl]piperazine-l-carboxylate(C ₁ 70, 63mg, 46%) as a solid. LCMS (ES, m z): 569 [M+H] ⁺ Synthesis of Compound 367

Into a 8 mL vial were added tert-butyl 4-[4-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yljcarb amoyl)-2-(2-methoxyethoxy)-l,3-benzoxazol-7-yl]piperazine-l- carboxylate (40 mg, 0.070 mmol, 1 equiv), DCM (1 mL), trimethyl silyl tritiate (156.35 mg, 0.700 mmol, 10 equiv) and DIEA (90.92 mg, 0.700 mmol, 10 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The crude product was purified by Prep-HPLC (Condition 11, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-(2- methoxyethoxy)-7-(piperazin-l-yl)-l,3-benzoxazole-4-carboxam ide (Compound 367, 7.7 mg, 23%) as a solid. LCMS (ES, m/z): 469 [M+H] ⁺ 1H NMR (300 MHz, DMSO-d ₆ ) δ 10.62 (s, 1H), 9.06 (d, J= 1.6 Hz, 1H), 7.94 (d, J= 3.1 Hz, 1H), 7.40 (d, J= 8.7 Hz, 1H), 7.22 (dd, J= 12.6, 1.6 Hz, 1H), 6.79 (d, J= 8.8 Hz, 1H), 4.20 (t, J = 5.2 Hz, 2H), 3.45 (t, J= 5.2 Hz, 2H), 3.21 (dd, J= 6.4, 3.5 Hz, 4H), 3.09 (s, 3H), 2.88 (dd, J= 6.2, 3.5 Hz, 4H), 2.34 (s, 2H).

Example 136: Synthesis of Compound 386

Synthesis of Intermediate C171 C ₁ 71

To a solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )- 2-methylindazol-4-yl]piperazine-l -carboxylate (50 mg, 0.099 mmol, 1 equiv) in DMF (1 mL) was added sodium hydride (60% in oil, 7.88 mg, 2 equiv) at 0 °C. The mixture was stirred for 15 min. CH ₃ I (13.28 mg, 0.094 mmol, 0.95 equiv) was added and the mixture was allowed to warm to room temperature and stirred for 2 hr. The reaction mixture was quenched by water and extracted with DCM (3 x 25 mL). The organic phase was concentrated under reduced pressure to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}(methyl)c arbamoyl)-2- methylindazol-4-yl]piperazine-l -carboxylate (C171, 40 mg, 77%) as a solid. LCMS (ES, m/z): 522 [M+H] ⁺

Synthesis of Compound 386 C ₁ 71 386

To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}(methyl)carbamoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (40 mg, 0.077 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N- { 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -N,2-dimethyl-4-(piperazin- 1 -yl)indazole-7 - carboxamide (Compound 386, 8.8 mg, 27%) as a solid. LCMS (ES, m/z): 422 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 8.38 (s, 1H), 8.28 (s, 1H), 7.65 (d, J= 2.9 Hz, 1H), 7.19 - 7.11 (m, 2H), 6.22 (d, J= 7.6 Hz, 1H), 4.08 (s, 3H), 3.35 (s, 3H), 3.14 (t, J= 4.9 Hz, 4H), 2.93 (t, J= 4.9 Hz, 4H), 2.26 (s, 3H).

Example 137: Synthesis of Compound 387

Synthesis of Intermediate C172

To a stirred solution of methyl 4-bromo-2-methylindazole-7-carboxylate (350 mg, 1.30 mmol, 1.0 equiv) and tert-butyl N-methyl-N-[(3R)-pyrrolidin-3-yl]carbamate (286.5 mg, 1.43 mmol, 1.1 equiv) in dioxane (4 mL) were added Cs ₂ CO ₃ (1.27 g, 3.90 mmol, 3.0 equiv), RuPhos (121.3 mg, 0.26 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (108.7 mg, 0.13 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at 100 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (10: 1) to afford methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l-y l]- 2-methylindazole-7-carboxylate (C172, 398 mg, 78%) as a solid. LCMS (ES, m/z): 389 [M+H] ⁺ Synthesis of Intermediate C173

To a stirred solution of methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l- yl]-2-methylindazole-7-carboxylate (398.0 mg, 1.02 mmol, 1.0 equiv) in THF (4 mL) were added H ₂ O (4 mL) and LiOH (214.9 mg, 5.12 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 16 hr at 50 °C. The resulting mixture was concentrated under vacuum and diluted with water (10 mL). The mixture was acidified to pH 7 with HCl (2 M) and was extracted with ethyl acetate (3 x 10 mL). The combined organic layers were washed with brine (3 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l- yl]-2-methylindazole-7-carboxylic acid (C173, 312 mg, 81%) as a solid. LCMS (ES, m/z): 375 [M+H] ⁺

Synthesis of Intermediate C174

To a stirred solution of 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l-y l]-2- methylindazole-7-carboxylic acid (312.0 mg, 0.83 mmol, 1.0 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyrazin-6-amine (152.3 mg, 0.91 mmol, 1.1 equiv) in DMF (4 mL) were added HATU (475.2 mg, 1.24 mmol, 1.5 equiv) and DIEA (323.0 mg, 2.49 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 7 hr at room temperature. The resulting mixture was diluted with water (5 mL) and extracted with ethyl acetate (3 x 20 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with ethyl acetate (100%) to afford tert-butyl N-[(3R)- l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-methylindazol-4- yl]pyrrolidin-3-yl]-N-methylcarbamate (C174, 210 mg, 48%) as a solid. LCMS (ES, m/z): 522 [M+H] ⁺

Synthesis of Compound 387

C174 387 To a stirred solution of tert-butyl N-[(3R)-l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methyl carbamate (210 mg, 0.40 mmol, 1.0 equiv) in DCM (3 mL) was added TFA (1 mL) dropwise at 0 °C. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 1) to afford N-{8-fluoro-2- methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-methyl-4-[(3R)-3 -(methylamino)pyrrolidin- 1 -yl]indazole- 7-carboxamide (Compound 387, 32.4 mg, 19%) as a solid. LCMS (ES, m/z): 422 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.19 (d, J = 1.7 Hz, 1H), 8.83 (s, 1H), 8.11-7.79 (m, 2H), 7.31 (dd, J= 12.4, 1.7 Hz, 1H), 6.02 (d, J= 8.4 Hz, 1H), 4.27 (s, 3H), 3.76 (t, J= 15.2, 6.5 Hz, 2H), 3.66 (s, 1H), 3.43 (d, J= 10.8 Hz, 1H), 3.36 (d, J= 5.4 Hz, 1H), 2.35 (d, J= 1.5 Hz, 6H), 2.15 (dt, J= 12.8, 6.5 Hz, 1H), 1.93 (dd, J= 12.0, 6.3 Hz, 1H).

Example 138: Synthesis of Compound 388

Synthesis of Intermediate C175

To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (400 mg, 1.486 mmol, 1 equiv) and tert-butyl N-methyl-N-[(3R)-pyrrolidin-3-yl]carbamate (357.3 mg, 1.783 mmol, 1.2 equiv) in dioxane (8 mL) were added Cs ₂ CO ₃ (1.45 g, 4.458 mmol, 3.0 equiv) and RuPhos (138.7 mg, 0.297 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (124.3 mg, 0.149 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at 100 °C under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl (S)-4-(3-((tert-butoxycarbonyl)(methyl)amino)pyrrolidin-l-yl )-2- methyl-2H-indazole-7-carboxylate (C175, 650 mg, 112%) as a solid. LCMS (ES, m, z):389 [M+H] ⁺

Synthesis of Intermediate C176

To a stirred mixture of methyl (S)-4-(3-((tert-butoxycarbonyl)(methyl)amino)pyrrolidin-l- yl)-2-methyl-2H-indazole-7-carboxylate (650.0 mg, 1.673 mmol, 1 equiv) in THF (8 mL) were added H ₂ O (8 mL) and lithium hydroxide hydrate (561.7 mg, 13.384 mmol, 8.0 equiv) at room temperature. The resulting mixture was stirred for 16 hr at 50 °C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with water (10 mL). The mixture was acidified to pH 6 with HCl (2 M). The resulting mixture was extracted with ethyl acetate (3 x 10 mL). The combined organic layers were washed with water (2 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford (S)-4-(3-((tert-butoxycarbonyl)(methyl)amino)pyrrolidin-l-yl )-2-methyl-2H-indazole-7- carboxylic acid (C176, 570 mg, 90%) as a solid. LCMS (ES, m/z):375 [M+H] ⁺ Synthesis of Intermediate C177

To a stirred mixture of (S)-4-(3-((tert-butoxycarbonyl)(methyl)amino)pyrrolidin-l-yl )-2- methyl-2H-indazole-7-carboxylic acid (200.0 mg, 0.534 mmol, 1.0 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine (132.3 mg, 0.801 mmol, 1.5 equiv) in DMF (2.5 mL) were added DIEA (276.1 mg, 2.136 mmol, 4.0 equiv) and HATU (243.7 mg, 0.641 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred for 16 hr at 50 °C. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with ethyl acetate (3x10 mL). The combined organic layers were washed with water (3 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl (S)-(l-(7-((8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl)carbamoyl)-2-methyl-2H-indazol-4-yl)pyrrolidi n-3-yl)(methyl)carbamate (C ₁ 77,

130 mg, 46%) as a solid. LCMS (ES, m, z):522 [M+H] ⁺

Synthesis of Compound 388

To a stirred mixture of tert-butyl (S)-(l-(7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl)carbamoyl)-2-methyl-2H-indazol-4-yl)pyrrolidin-3-yl)(meth yl)carbamate (110 mg, 0.211 mmol, 1 equiv) in DCM (2.5 mL) was added TFA (0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 1) to afford (S)-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-methyl -4-(3- (methylamino)pyrrolidin-l-yl)-2H-indazole-7-carboxamide (Compound 388, 55 mg, 61%) as a solid. LCMS (ES, m, z):422 [M+H] ⁺¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.19 (d, J = 1.6 Hz, 1H), 8.82 (s, 1H), 7.96-7.86 (m, 2H), 7.29 (dd, J= 12.4, 1.7 Hz, 1H), 6.01 (d, J= 8.4 Hz, 1H), 4.27 (t, 3H), 3.75 (dq, J= 21.5, 7.5, 6.8 Hz, 2H), 3.64 (d, J= 7.5 Hz, 1H), 3.42 (dd, J= 10.6, 4.0 Hz, 1H), 3.35 (d, J= 10.5 Hz, 1H), 2.35 (s, 6H), 2.21-2.11 (m, 1H), 1.92 (dq, J= 12.3, 6.2 Hz, 1H).

Example 139: Synthesis of Compound 389

Synthesis of Intermediate C178

C178

To a stirred solution of {6-bromo-8-fluoroimidazo[1,2-a]pyridin-2-yl (methanol (60 mg, 0.245 mmol, 1 equiv) and tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l- carboxylate (88.01 mg, 0.245 mmol, 1 equiv) and Cs ₂ CO ₃ (239.33 mg, 0.735 mmol, 3.0 equiv) in Dioxane (2 mL) were added XantPhos (14.17 mg, 0.025 mmol, 0.1 equiv) and Pd2(dba)3 (11.21 mg, 0.012 mmol, 0.05 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 16 hr at 100 °C under nitrogen atmosphere. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford tert-butyl 4-(7-{[8-fluoro-2- (hydroxymethyl)imidazo[1,2-a]pyridin-6-yl]carbamoyl}-2-methy lindazol-4-yl)piperazine-l- carboxylate (C ₁ 78, 40 mg, 31%) as a solid. LCMS (ES, m/z): 524 [M+H] ⁺

Synthesis of Compound 389 C ₁ 78 389

A mixture of tert-butyl 4-(7-{[8-fluoro-2-(hydroxymethyl)imidazo[1,2-a]pyridin-6- yl]carbamoyl}-2-methylindazol-4-yl)piperazine-l -carboxylate (35 mg, 0.067 mmol, 1 equiv) in DCM (2 mL) and TFA (1 mL) was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 4, Gradient 1) to afford N-[8-fluoro-2-(hydroxymethyl)imidazo[1,2- a]pyridin-6-yl]-2-methyl-4-(piperazin-l-yl)indazole-7-carbox amide; trifluoroacetic acid (Compound 389, 18 mg, 50%) as a solid. LCMS (ES, m/z): 424 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.12 (s, 1H), 9.35(s, 1H), 8.89-8.82(m, 3H), 8.10 (s, 1H), 8.03-8.01(d, ./=8 Hz, 1H), 7.54-7.53 (br, 1H), 6.62-6.60 (d, ./=8 Hz, 1H), 4.66 (s, 2H), 4.32 (s, 3H), 3.60-3.52 (m, 4H), 3.40-3.25 (m, 4H).

Example 140: Synthesis of Compound 387

Synthesis of Compound 387

²⁹⁸ 387 Compound 298 was separated by prep-chiral -HPLC (Condition 2, Gradient 1) to yield (R)- N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-methyl-4-( 3-(methylamino)pyrrolidin-l-yl)- 2H-indazole-7-carboxamide (5.9 mg, 25%) as a solid. LCMS (ES, m, z):422 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 9.00 (s, 1H), 8.53 (s, 1H), 8.03 (d, J= 8.3 Hz, 1H), 7.70 (d, J= 3.0

Hz, 1H), 7.13 (d, J= 12.4 Hz, 1H), 6.07 (d, J= 8.4 Hz, 1H), 4.30 (s, 3H), 3.90-3.77 (m, 2H), 3.73-3.67 (m, 1H), 3.53-3.52 (m, 2H), 2.53 (s, 3H), 2.44 (s, 3H), 2.41-2.33 (m, 1H), 2.09-2.03 (m, 1H).

Example 141: Synthesis of Compound 388

Synthesis of Compound 388

Compound 298 was separated by prep-chiral -HPLC (Condition 2, Gradient 1) to yield (S)- N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-methyl-4-( 3-(methylamino)pyrrolidin-l-yl)- 2H-indazole-7-carboxamide (5.2 mg, 23%) as a solid. LCMS (ES, m, z):422 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 8.99 (d, J= 1.6 Hz, 1H), 8.51 (s, 1H), 8.03 (d, J= 8.4 Hz, 1H), 7.69 (d, J= 2.9 Hz, 1H), 7.11 (dd, J= 11.9, 1.6 Hz, 1H), 6.07 (d, J= 8.4 Hz, 1H), 4.29 (s, 3H), 3.94-3.76 (m, 2H), 3.72-3.66 (m, 1H), 3.54-3.53 (m, 2H), 2.54 (s, 3H), 2.44 (s, 3H), 2.40- 2.34 (m, 1H), 2.10-2.02 (m, 1H).

Example 142: Synthesis of Compound 391

Synthesis of Intermediate C179 C ₁ 79 To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and iodocyclobutane (55.3 mg, 0.30 mmol, 1.5 equiv) in DMF (2 mL) was added Cs ₂ CO ₃ (198.0 mg, 0.60 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with water. The resulting mixture was extracted with ethyl acetate (3 x 15 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :4) to afford tert-butyl 4-[2-cyclobutyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6 - yl} carbarnoyl)indazol -4-yl] piperazine- 1 -carboxylate (C ₁ 79, 59 mg, 53%) as a solid. LCMS (ES, m/z): 548 [M+H] ⁺

Synthesis of Compound 391 C ₁ 79 391

A solution of tert-butyl 4-[2-cyclobutyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6 - yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (59.0 mg, 0.10 mmol, 1.0 equiv) in DCM (0.6 mL) was treated with TFA (0.6 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 3) to afford 2-cyclobutyl-N- { 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -4-(piperazin- 1 -yl)indazole-7-carboxamide (Compound 391, 9.7 mg, 20%) as a solid. LCMS (ES, m/z): 448 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.12 (s, 1H), 9.22 (s, 1H), 8.89 (s, 1H), 7.99 (d, J= 7.8 Hz, 1H), 7.92 (s, 1H), 7.24 (d, J= 12.3 Hz, 1H), 6.50 (d, J= 8.1 Hz, 1H), 5.35-5.28 (m, 1H), 3.37-3.34 (m, 5H), 2.95-2.93 (m, 4H), 2.82-2.71 (m, 2H), 2.60-2.59 (m, 2H), 2.36 (s, 3H), 1.96 (q, J= 11.5, 11.1 Hz, 2H).

Example 143: Synthesis of Compound 392

Synthesis of Intermediate C180

C ₁ 80

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and allyl bromide (36.7 mg, 0.30 mmol, 1.5 equiv) in DMF (2 mL) was added Cs ₂ CO ₃ (198.0 mg, 0.61 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with water. The resulting mixture was extracted with ethyl acetate (2 x 10 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :4) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- (prop-2-en-l-yl)indazol-4-yl] piperazine- 1 -carboxylate (C180, 52 mg, 48%) as a solid. LCMS (ES, m/z): 534 [M+H] ⁺

Synthesis of Compound 392

A solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- (prop-2-en-l-yl)indazol-4-yl]piperazine-l -carboxylate (52 mg, 0.10 mmol, 1 equiv) in DCM (0.5 mL) was treated with TFA (0.5 mL) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 3) to afford N-{8-fluoro-2- methylimidazo[ 1 ,2-a]pyridin-6-yl } -4-(piperazin- 1 -yl)-2-(prop-2-en- 1 -yl)indazole-7-carboxamide (Compound 392, 12.7 mg, 30%) as a solid. LCMS (ES, m/z): 434 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.13 (s, 1H), 9.22 (d, J= 1.6 Hz, 1H), 8.82 (s, 1H), 7.99 (d, J= 8.1 Hz, 1H), 7.91 (d, J= 3.1 Hz, 1H), 7.24 (dd, J= 12.3, 1.7 Hz, 1H), 6.50 (d, J = 8.1 Hz, 1H), 6.26 (ddd, J= 16.4, 10.3, 6.0 Hz, 1H), 5.45-5.29 (m, 2H), 5.22 (d, J= 6.1 Hz, 2H), 3.36 (t, J= 5.0 Hz, 4H), 2.92 (t, J = 4.9 Hz, 4H), 2.35 (s, 3H).

Example 144: Synthesis of Compound 394

Synthesis of Intermediate C181 C ₁ 81

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole- 7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and tert-butyl l,7-diazaspiro[3.5]nonane-l-carboxylate (49 mg, 0.22 mmol, 1 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (211 mg, 0.66 mmol, 3 equiv), RuPhos (20 mg, 0.044 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 90 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was dissolved in water (20 mL). The resulting mixture was extracted with ethyl acetate (3 x 5 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 1) to afford tert-butyl 7-[2-ethyl-7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]-l,7 -diazaspiro[3.5]nonane-l-carboxylate (75 mg, 61 %) as a solid. LCMS (ES, m/z): 562 [M+H] ⁺

Synthesis of Compound 394

To a stirred solution of tert-butyl 7-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-l,7-diazaspiro[3.5]nonane-l-carbo xylate (90 mg, 0.16 mmol, 1 equiv) and DIEA (31 mg, 0.24 mmol, 1.5 equiv) in DCM (5 mL) was added Trimethyl silyl trifluoromethanesulfonate (107 mg, 0.48 mmol, 3 equiv) dropwise at 0 °C under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at room temperature. The reaction was quenched with water (2 mL) at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by prep-HPLC (Condition 12, Gradient 1) to afford 4-{ l,7- diazaspiro[3.5]nonan-7-yl}-2-ethyl-N-{8-fluoro-2-methylimida zo[1,2-a]pyridin-6-yl}indazole-7- carboxamide (Compound 394, 30 mg, 40%) as a solid. LCMS (ES, m/zy. 462 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.80 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.91 (d, J= 3.1 Hz, 1H), 7.30 (dd, J= 12.4, 1.7 Hz, 1H), 6.50 (d, J = 8.2 Hz, 1H), 4.60 (q, J = 7.2 Hz, 2H), 3.99-3.70 (m, 1H), 3.60-3.40 (m, 3H), 3.29 (s, 2H), 2.35 (s, 3H), 2.07 (t, J= 7.5 Hz, 2H), 1.96-1.77 (m, 4H), 1.62 (t, J= 7.2 Hz, 3H).

Example 145: Synthesis of Compound 395

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and N,N-dimethylpiperidin-4-amine (28 mg, 0.22 mmol, 1 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (211 mg, 0.66 mmol, 3 equiv), RuPhos (20 mg, 0.044 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90°C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was dissolved in water (20 mL). The resulting mixture was extracted with ethyl acetate (3 x 5 mL). The combined organic layers were washed with brine (1x10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 12, Gradient 1) to afford 4-[4- (dimethylamino)piperi din- l-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyri din-6- yl}indazole-7-carboxamide (Compound 395, 30 mg, 29%) as a solid. LCMS (ES, m/z): 464 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.81 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.30 (dd, J= 12.4, 1.7 Hz, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.60 (q, J= 7.3 Hz, 2H), 3.96 (d, J= 12.5 Hz, 2H), 2.97 (t, J= 11.8 Hz, 2H), 2.35 (s, 4H), 2.22 (s, 6H), 1.90 (d, J= 12.2 Hz, 2H), 1.62 (t, J= 7.2 Hz, 4H).

Example 146: Synthesis of Compound 396

Synthesis of Intermediate C182 C ₁ 82

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (180 mg, 0.43 mmol, 1 equiv) and tert-butyl N-ethyl-N-(pyrrolidin- 3-yl)carbamate (93 mg, 0.43 mmol, 1 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (423 mg, 1.29 mmol, 3 equiv), RuPhos (40 mg, 0.086 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was dissolved in water (20 mL). The resulting mixture was extracted with ethyl acetate (3 x 5 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl N-ethyl-N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl] carbarnoyl)indazol-4-yl]pyrrolidin-3-yl] carbamate (Cl 82, 100 mg, 42%) as a solid. LCMS (ES, m/z): 550 [M+H] ⁺

Synthesis of Compound 396

A solution of tert-butyl N-ethyl-N-{l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyr idin-6- yl}carbamoyl)indazol-4-yl]pyrrolidin-3-yl} carbamate (140 mg, 0.255 mmol, 1 equiv) in trifluoroacetic acid (3 mL) and DCM (3 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NFh(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by prep-HPLC (Condition 12, Gradient 1) to afford 2-ethyl-4-[3-(ethylamino)pyrrolidin-l-yl]-N-{8-fluoro-2-meth ylimidazo[1,2- a]pyridin-6-yl}indazole-7-carboxamide (Compound 396, 60 mg, 52%) as a solid. LCMS (ES, m/z): 450 [M+H] ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.05 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.84 (s, 1H), 7.93 (d, J = 8.3 Hz, 1H), 7.89 (d, J= 3.1 Hz, 1H), 7.26 (dd, J= 12.4, 1.7 Hz, 1H), 6.01 (d, J= 8.4 Hz, 1H), 4.57 (q, J= 7.3 Hz, 2H), 3.77 (dd, J= 13.6, 7.0 Hz, 2H), 3.70 - 3.57 (m, 1H), 3.53-3.37 (m, 2H), 2.63 (q, J= 7.1 Hz, 2H), 2.35 (s, 3H), 2.16 (dd, J= 12.3, 6.0 Hz, 1H), 1.90 (dd, J= 12.1, 6.3 Hz, 1H), 1.61 (t, J= 7.2 Hz, 3H), 1.05 (t, J = 7.1 Hz, 3H).

Example 147: Synthesis of Compound 397

Synthesis of Intermediate C183 C183 To a stirred solution of 4-[(tert-butoxycarbonyl)amino]piperidine-4-carboxylic acid (1.5 g, 6.140 mmol, 1.0 equiv) and sodium methaneperoxoate sodium (1.3 g, 12.280 mmol, 2.0 equiv) in tetrahydrofuran (15 mL), water (15 mL) was added benzyl chloroformate (1.2 g, 7.368 mmol, 1.2 equiv) dropwise at 0 °C under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was diluted with water (30 mL). The mixture was acidified to PH 5 with HCl (aq.). The resulting mixture was extracted with ethyl acetate (2 x 50 mL). The combined organic layers were washed with brine (1 x 30 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (10: 1) to afford 1- [(benzyloxy)carbonyl]-4-[(tert-butoxycarbonyl)amino]piperidi ne-4-carboxylic acid (C183, 1.4 g, 55%) as an oil. LCMS (ES, m/z): 379 [M+H] ⁺

Synthesis of Intermediate C184

Boc C183 C184

To a stirred solution of l-[(benzyloxy)carbonyl]-4-[(tert-butoxycarbonyl)amino]piperi dine- 4-carboxylic acid (1.4 g, 3.700 mmol, 1.0 equiv) in tetrahydrofuran (15 mL) was added boranetetrahydrofuran complex, IM (40 mL) dropwise at room temperature under nitrogen atmosphere.

The resulting mixture was stirred for 16 hr at 0 °C under nitrogen atmosphere. The reaction was quenched with methanol at 0 °C. The resulting mixture was concentrated under reduced pressure.

The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (10: 1) to afford benzyl 4-amino-4-(hydroxymethyl)piperidine- 1-carboxylate (C184, 0.78 g, 71%) as an oil. LCMS (ES, m/z): 265 [M+H] ⁺

Synthesis of Intermediate C185 C184 C185

To a stirred mixture of benzyl 4-amino-4-(hydroxymethyl)piperidine-l -carboxylate (0.7 g,

2.762 mmol, 1.0 equiv) and triethylamine (0.8 g, 8.286 mmol, 3.0 equiv) in DCM (10 mL) was added di-tert-butyl dicarbonate (0.7 g, 3.314 mmol, 1.2 equiv) in portions at 0 °C under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford benzyl 4-[(tert-butoxy carbonyl) amino]-4- (hydroxymethyl) piperidine- 1 -carboxylate (C185, 0.8 g, 71%) as an oil. LCMS (ES, m/z): 365 [M+H] ⁺

Synthesis of Intermediate C186 C185 C186

To a stirred solution of benzyl 4-[(tert-butoxycarbonyl)amino]-4-(hydroxymethyl)piperidine- 1-carboxylate (700.0 mg, 1.921 mmol, 1.0 equiv) in DCM (8 mL) was added Diethylaminosulfur trifluoride (464.4 mg, 2.881 mmol, 1.5 equiv) dropwise at 0 °C under nitrogen atmosphere. The reaction was quenched with sat. NaHCO3 (aq.) at 0 °C. The resulting mixture was extracted with ethyl acetate (2 x 20 mL). The combined organic layers were washed with brine (1 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure.

LCMS (ES, m/z): 367 [M+H] ⁺

Synthesis of Intermediate Cl 87 C186 C187

To a solution of benzyl 4-[(tert-butoxycarbonyl)amino]-4-(fluoromethyl)piperidine-l- carboxylate (290.0 mg, 0.791 mmol, 1.0 equiv) in 10 mL methanol was added Pd/C (10%, 250 mg) under nitrogen atmosphere in a mL round-bottom flask. The mixture was hydrogenated at room temperature for overnight under hydrogen atmosphere using a hydrogen balloon. The mixture was filtered through a C ₆ lite pad and concentrated under reduced pressure to yield tertbutyl (4-(fluoromethyl)piperidin-4-yl)carbamate (Cl 87, 130 mg, 65%) as a solid. LCMS (ES, m/z): 233 [M+H] ⁺ Synthesis of Intermediate Cl 88

To a solution of tert-butyl N-[4-(fluoromethyl) piperidin-4-yl]carbamate (80.0 mg, 0.344 mmol, 1 equiv) and 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (138.5 mg, 0.344 mmol, 1.0 equiv) in dioxane (4 mL) were added Cs ₂ CO ₃ (280.5 mg, 0.860 mmol, 2.5 equiv) and Ruphos (32.1 mg, 0.069 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (28.8 mg, 0.034 mmol, 0.1 equiv) . After stirring for 3 hr at 80 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 /

MeOH (30: 1) to afford tert-butyl N-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]-4-(fluoromethyl)piperidi n-4-yl}carbamate (C188, 120 mg, 53.50%) as a solid. LCMS (ES, m/z): 554 [M+H] ⁺

Synthesis of Intermediate Compound 397

To a stirred solution of tert-butyl N-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]-4-(fluoromethyl)piperidi n-4-yl}carbamate (80.0 mg, 0.145 mmol, 1.0 equiv) in DCM (1 mL) was added trifluoroacetaldehyde (0.5 mL) dropwise at 0 °C . The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-[4-amino-4-(fluoromethyl)piperidin-l-yl]-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}- 2-methylindazole-7-carboxamide (C187, 9 mg, 13%) as a light yellow solid. LCMS (ES, m/z): 454 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.22 (d, J= 1.6 Hz, 1H), 8.82 (d, J= 5.8 Hz, 1H), 7.98 (d, J= 8.1 Hz, 1H), 7.91 (d, J= 3.2 Hz, 1H), 7.35 (dd, J= 12.3, 1.7 Hz, 1H), 6.55 (d, J= 8.2 Hz, 1H), 4.30 (s, 3H), 3.81 (d, J= 12.7 Hz, 2H), 3.25-3.24 (m, 4H), 2.76 (d, J= 19.4 Hz, 2H), 2.35 (s, 3H), 1.95-1.83 (m, 4H).

Example 148: Synthesis of Compound 398

Synthesis of Intermediate Cl 89

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (190 mg, 0.456 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N- (pyrrolidin-3-yl)carbamate (103 mg, 0.456 mmol, 1 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (446 mg, 1.368 mmol, 3 equiv), RuPhos (43 mg, 0.091 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (21 mg, 0.046 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl N-cyclopropyl-N-{ l-[2-ethyl-7- ({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)inda zol-4-yl]pyrrolidin-3- yljcarbamate (C189, 200 mg, 78%) as a solid. LCMS (ES, m/z): 562 [M+H] ⁺

Synthesis of Compound 398 A solution of tert-butyl N-cyclopropyl-N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl} carbarnoyl)indazol-4-yl]pyrrolidin-3-yl} carbamate (90 mg, 0.160 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in methanol. The resulting mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 10, Gradient 4) to afford 4-[3- (cyclopropylamino)pyrrolidin-l-yl]-2-ethyl-N-{8-fluoro-2-met hylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (Compound 398, 60 mg, 81%) as a solid. LCMS (ES, m/z): 462 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.04 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.83 (s, 1H), 7.97-7.85 (m, 2H), 7.25 (dd, J= 12.4, 1.7 Hz, 1H), 6.00 (d, J= 8.4 Hz, 1H), 4.57 (q, J= 13 Hz, 2H), 3.77 (dd, J= 12.8, 6.6 Hz, 2H), 3.69-3.41 (m, 3H), 2.71 (m, 1H)2.35 (s, 3H), 2.17 (td, J= 7.1, 6.5, 3.9 Hz, 2H), 1.98 (dd, J= 12.3, 6.2 Hz, 1H), 1.61 (t, J= 7.2 Hz, 3H), 0.42 (d, J= 6.6 Hz, 2H), 0.25 (dq, J= 9.7, 6.2, 4.7 Hz, 2H).

Example 149: Synthesis of Compounds 399 and 400

Compound 396 was separated by Prep-Chiral-HPLC (Condition 3, Gradient 1) to afford (R)-2-ethyl- 4-(3-(ethylamino)pyrrolidin-l-yl)-N-(8-fluoro-2-methylimidaz o[1,2-a]pyridin-6-yl)-2H-indazole-7- carboxamide (Compound 400, 18.4 mg, 30%) as a white solid and (S)-2 -ethyl -4-(3- (ethylamino)pyrrolidin-l-yl)-N-(8-fluoro-2-methylimidazo[1,2 -a]pyridin-6-yl)-2H-indazole-7- carboxamide (Compound 399, 18.4 mg, 30%) as a solid.

Example 150: Synthesis of Compound 401

401

To a stirred solution of 4-{l,7-diazaspiro[3.5]nonan-7-yl}-2-ethyl-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (280 mg, 0.607 mmol, 1 equiv) and 37% HCHO (91 mg, 3.035 mmol, 5 equiv) in ACN (5 mL) was added NaBH3CN (114.3 mg, 1.821 mmol, 3 equiv) in portions at room temperature . The resulting mixture was stirred for 30 min at room temperature. To the above mixture was added HOAc (364.3 mg, 6.070 mmol, 10 equiv) dropwise at room temperature. The resulting mixture was stirred for additional 2 hr at room temperature. The reaction was quenched with water (2 mL) at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 4) to afford 2-ethyl-N- (8-fhioro-2-methylimidazo[1,2-a]pyridin-6-yl)-4-(l-methyl-l, 7-diazaspiro[3.5]nonan-7-yl)-2H-indazole- 7-carboxamide 2,2,2-trifluoroacetate (Compound 401, 100 mg, 27%) as a solid. LCMS (ES, m/z)'. 476 [M+H] ^{+ 1} H NMR (300 MHz, Methanol-d ₄ ) δ 9.52 (d, J= 1.6 Hz, 1H), 8.64 (s, 1H), 8.20-8.07 (m, 2H), 7.99 (dd, J= 11.3, 1.6 Hz, 1H), 6.64 (d, J= 8.1 Hz, 1H), 4.67 (q, J= 13 Hz, 2H), 4.33- 4.21 (m, 1H), 4.16-4.01 (m, 2H), 3.96 (d, J= 10.3 Hz, 1H), 3.16 (q, J= 12.5 Hz, 2H), 2.87 (s, 3H), 2.68-2.56 (m, 5H), 2.44 (d, J= 12.2 Hz, 1H), 2.37-2.23 (m, 3H), 1.73 (t, J= 13 Hz, 3H).

Example 151: Synthesis of Compound 402

Synthesis of Intermediate C190 , C ₁ 90

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1 equiv) and tert-butyl N-(piperidin-4- yl)carbamate (35.85 mg, 0.179 mmol, 1.2 equiv) in dioxane (1 mL) was added Cs ₂ CO ₃ (145.81 mg, 0.447 mmol, 3 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 hr at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (10: 1) to afford tert-butyl N-{ l-[7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2-methylindazol-4-yl]piperidin-4-yl} carbamate (C ₁ 90, 50 mg, 64%) as a solid. LCMS (ES, m/z): 522 [M+H] ⁺

Synthesis of Compound 402

To a stirred solution of tert-butyl N-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperidin-4-yl} carbamate (50 mg, 0.096 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford 4-(4- aminopiperidin-l-yl)-N-{8-fluoro-2-methylimidazo[1,2-a]pyrid in-6-yl}-2-methylindazole-7- carboxamide (Compound 402, 8.6 mg, 21%) as solid. LCMS (ES, m/z) 422 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.77 (s, 1H), 7.96 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.0 Hz, 1H), 7.34 (dd, J= 12.4, 1.7 Hz, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.30 (s, 3H), 3.89 (d, J= 12.8 Hz, 2H), 3.05 (t, J= 11.8 Hz, 2H), 2.85 (s, 1H), 2.35 (s, 3H), 1.88 (d, J= 12.8 Hz, 2H), 1.43 (q, J= 10.7, 10.3 Hz, 2H).

Example 152: Synthesis of Compound 403

Synthesis of Intermediate C191

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7- carboxamide (1 g, 2.402 mmol, 1 equiv) and tert-butyl 2-(hydroxymethyl)piperazine-l -carboxylate (0.57 g, 2.642 mmol, 1.1 equiv) in dioxane (20 mL) were added Cs ₂ CO ₃ (2.35 g, 7.206 mmol, 3.0 equiv) , RuPhos Palladacycle Gen.3 (0.4 g, 0.480 mmol, 0.2 equiv) and RuPhos (0.22 g, 0.480 mmol, 0.2 equiv). After stirring for 3 hr at 90 °C under a nitrogen atmosphere. The resulting mixture was diluted with H ₂ O (20 mL). The resulting mixture was extracted with EA (3 x 20 mL). The combined organic layers were washed with NaCl (1 x 10 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl 4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-2-(hydroxymethyl)piperazine-l-car boxylate (C ₁ 91, 500 mg, 37%) as a solid. LCMS (ES, m/z): 552 [M+H]

Synthesis of Compound 403

A solution of tert-butyl 4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-2-(hydroxymethyl)piperazine-l-car boxylate (50 mg, 0.091 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 hr at room temperature. The mixture was neutralized to pH 8 with ammonia in methanol. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 3) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[3 - (hydroxymethyl)piperazin-l-yl]indazole-7-carboxamide (Compound 403, 10 mg, 24%) as a solid.

LCMS (ES, HI :): 452 [M+H] ⁺¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.80 (s, 1H), 7.98 (d, J= 8.1 Hz, 1H), 7.91 (dd, J= 3.2, 1.0 Hz, 1H), 7.31 (dd, J= 12.3, 1.7 Hz, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.73 (s, 1H), 4.60 (q, J= 7.3 Hz, 2H), 3.79 (d, J= 10.5 Hz, 2H), 3.44 (s, 2H), 3.09-2.98 (m, 1H), 2.91 (q, J= 10.3, 9.3 Hz, 3H), 2.77-2.63 (m, 1H), 2.39-2.32 (m, 3H), 1.62 (t, J= 7.3 Hz, 3H).

Example 153: Synthesis of Compound 404

Synthesis of Intermediate 192

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole- 7-carboxamide (172 mg, 0.413 mmol, 1 equiv) and tert-butyl N-(4-ethylpiperidin-4-yl)carbamate (94 mg, 0.413 mmol, 1 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (404 mg, 1.239 mmol, 3 equiv) and RuPhos Palladacycle Gen.3 (19 mg, 0.041 mmol, 0. 1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 hr at 90 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE / EA (1:5) to afford tert-butyl N-{4-ethyl-l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyr idin-6- yl}carbamoyl)indazol-4-yl]piperidin-4-yl} carbamate (C ₁ 92, 150 mg, 64%) as a solid. LCMS (ES, m/z): 564 [M+H] ⁺

Synthesis of Compound 404

A solution of tert-butyl N-{4-ethyl-l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyr idin-6- yl}carbamoyl)indazol-4-yl]piperidin-4-yl} carbamate (140 mg, 0.248 mmol, 1 equiv) in 2,2,2- trifluoroacetic acid (5 mL) and DCM (5 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3 (g) in methanol. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 4) to afford 4-(4-amino-4-ethylpiperidin-l-yl)-2 -ethyl -N- {8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carb oxamide (Compound 402, 30 mg, 26%) as a solid. LCMS (ES, mz): 464 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.20 (d, J= 1.6 Hz, 1H), 8.79 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.29 (dd, J= 12.4, 1.7 Hz, 1H), 6.48 (d, J= 8.2 Hz, 1H), 4.59 (q, J= 7.3 Hz, 2H), 3.62 (dt, J= 13.1, 4.2 Hz, 2H), 3.51-3.36 (m, 2H), 2.35 (s, 3H), 1.62 (t, J= 7.2 Hz, 6H), 1.54-1.46 (m, 2H), 1.40 (q, J= 7.5 Hz, 2H), 0.88 (t, J= 7.4 Hz, 3H).

Example 154: Synthesis of Compound 405

Synthesis of Intermediate C193

A solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (35 mg, 0.097 mmol, 1 equiv), 6-chloro-2,4-dimethyl-[l,3]oxazolo[4,5-c]pyridine (21.34 mg, 0.116 mmol, 1.2 equiv), Pd2(dba)3 (8.92 mg, 0.010 mmol, 0.1 equiv), BINAP (12.13 mg, 0.019 mmol, 0.2 equiv) and tert-butoxysodium (28.08 mg, 0.291 mmol, 3 equiv) in dioxane (1 mL) was stirred for 3 hr at 80 °C under nitrogen atmosphere. The resulting mixture was extracted with DCM and water. The combined organic layers dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA = 3: 1 to afford tert-butyl 4-[7-({2,4-dimethyl- [ 1 ,3 ]oxazolo[4,5-c]pyridin-6-yl } carbarnoyl)-2-methylindazol-4-yl]piperazine- 1 -carboxylate

(C ₁ 93, 28 mg, 56%) as a solid. LCMS (ES, m/z): 524 [M+H] ⁺ C ₁ 93 405

A solution of tert-butyl 4-[7-({2,4-dimethyl-[l,3]oxazolo[4,5-c]pyridin-6-yl}carbamoy l)-2- methylindazol-4-yl]piperazine-l -carboxylate (28 mg, 0.055 mmol, 1 equiv) in DCM (1 mL) was treated with DIEA (85.90 mg, 0.660 mmol, 12 equiv) and trimethyl silyl tritiate (123.09 mg, 0.550 mmol, 10 equiv) for Ih at room temperature. The mixture was basified to pH 9 with NaHCO3. The resulting mixture was extracted with DCM and water. The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (Condition 1, Gradient 1) to afford N-{2,4-dimethyl- [l,3]oxazolo[4,5-c]pyridin-6-yl}-2-methyl-4-(piperazin-l-yl) indazole-7-carboxamide (Compound 405, 7.3 mg, 32%) as a solid. LCMS (ES, m/z): 406 [M+H] IH NMR (300 MHz, DMSO-d ₆ ) δ 11.60 (s, IH), 8.82 (s, IH), 8.45 (s, IH), 8.05 (d, J= 8.1 Hz, IH), 6.51 (d, J = 8.3 Hz, IH), 4.28 (s, 3H), 3.42 - 3.37 (m, 4H), 2.93 (t, J= 5.0 Hz, 4H), 2.66 (s, 3H), 2.64 (s, 3H).

Example 155: Synthesis of Compound 406

Synthesis of Intermediate C194 C ₁ 94

A solution of (6-bromo-4-fluoro-l,3-benzoxazol-2-yl)methyl acetate (100 mg, 0.347 mmol, 1 equiv), tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (149.73 mg, 0.416 mmol, 1.2 equiv), Pd2(dba)3 (31.79 mg, 0.035 mmol, 0.1 equiv), Xantphos (40.17 mg, 0.069 mmol, 0.2 equiv) and caesio methaneperoxoate caesium (340.36 mg, 1.041 mmol, 3 equiv) in dioxane (2 mL) was stirred for 4 hr at 80 °C under nitrogen atmosphere. The resulting mixture was extracted with DCM and water. The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA = 3: 1 to afford tert-butyl 4-[7- ({2-[(acetyloxy)methyl]-4-fluoro-l,3-benzoxazol-6-yl}carbamo yl)-2-methyli ndazol-4- yl]piperazine-l -carboxylate (C ₁ 94, 83 mg, 42%) as a solid. LCMS (ES, m/z): 567 [M+H] ⁺ Synthesis of Intermediate C195 C ₁ 94 C ₁ 95

A solution of tert-butyl 4-[7-({2-[(acetyloxy)methyl]-4-fluoro-l,3-benzoxazol-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (63 mg, 0.111 mmol, 1 equiv) in methanol (2 mL) was treated with potassium methaneperoxoate potassium (46.44 mg, 0.333 mmol, 3 equiv) for 2 hr at room temperature. The resulting mixture was filtered, the filter cake was washed with DCM. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA = 1 : 1 to afford tert-butyl 4-(7-{ [4-fluoro- 2-(hydroxymethyl)- 1 ,3 -benzoxazol-6-yl]carbamoyl } -2-methylindazol-4-yl)piperazine- 1 - carboxylate (Cl 95, 42 mg, 72%) as a solid. LCMS (ES, m/z): 525 [M+H] ⁺

Synthesis of Compound 406

A solution of tert-butyl 4-(7-{[4-fluoro-2-(hydroxymethyl)-l,3-benzoxazol-6- yl]carbamoyl}-2-methylind azol-4-yl)piperazine-l -carboxylate (42 mg, 0.080 mmol, 1 equiv) in DCM (1 mL) was treated with DIEA (124.18 mg, 0.960 mmol, 12 equiv), trimethyl silyl tritiate (177.95 mg, 0.800 mmol, 10 equiv) for 1 hr at room temperature. The mixture was basified to pH 9 with NaHCO,. The resulting mixture was extracted with DCM and water. The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (Condition 1, Gradient 1) to afford N-[4- fluoro-2-(hydroxymethyl)-l,3-benzoxazol-6-yl]-2-methyl-4-(pi perazin-l-yl)indazole-7- carboxamide (Compound 406, 8.1 mg, 23%) as a solid. LCMS (ES, m 425 [M+H] ⁺ 1H NMR (300 MHz, DMSO-d ₆ ) δ 11.47 (s, 1H), 8.80 (s, 1H), 8.19 (d, J= 1.6 Hz, 1H), 8.00 (d, J= 8.1 Hz, 1H), 7.66 (dd, J= 12.1, 1.7 Hz, 1H), 6.49 (d, J = 8.2 Hz, 1H), 5.95 (s, 1H), 4.71 (s, 2H), 4.30 (s, 3H), 2.91 (t, J= 5.0 Hz, 4H), 2.51 (t, J= 3.7 Hz, 4H).

Example 156: Synthesis of Compounds 407 and 408

Synthesis of Intermediate C196

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole- 7-carboxamide (90 mg, 0.22 mmol, 1 equiv) and N,N-dimethylpyrrolidin-3-amine (25 mg, 0.22 mmol, 1 equiv) in dioxane (5 mL) were added Cs ₂ CO ₃ (211 mg, 0.66 mmol, 3 equiv), RuPhos (20 mg, 0.044 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (18 mg, 0.022 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90°C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was dissolved in water (20 mL). The resulting mixture was extracted with ethyl acetate (3 x 5 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 12, Gradient 2) to afford 4-[3- (dimethylamino)pyrrolidin- 1 -yl] -2 -ethyl -N- { 8-fluoro-2-methylimidazo [ 1 ,2-a]pyridin-6-yl } indazole-7 - carboxamide (70 mg, 71%) as a solid. LCMS (ES, m/z): 450 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.06 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.88 (s, 1H), 7.98-7.86 (m, 2H), 7.27 (dd, J= 12.4, 1.7 Hz, 1H), 6.05 (d, J= 8.4 Hz, 1H), 4.57 (q, J = 1.3 Hz, 2H), 3.81 (dt, J= 19.0, 9.0 Hz, 2H), 3.65 (q, J = 9.5, 9.0 Hz, 1H), 3.46 (t, J = 9.0 Hz, 1H), 2.91 (s, 1H), 2.35 (s, 3H), 2.28 (s, 6H), 2.23 (s, 1H), 1.93 (q, J = 11.6, 10.7 Hz, 1H), 1.61 (t, J= 7.2 Hz, 3H). Synthesis of Compounds 407 and 408

C196 408

Cl 96 was separated by Prep-Chiral -HPLC (Condition 4, Gradient 1) to afford (R)-4-(3- (dimethylamino)pyrrolidin- 1 -yl)-2 -ethyl -N-(8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl)-2H-indazole- 7-carboxamide (Compound 407, 23.9 mg, 36%) as a white solid and (S)-4-(3-(dimethylamino)pyrrolidin- l-yl)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl )-2H-indazole-7-carboxamide (Compound

408, 25.7 mg, 39%) as a solid.

Example 157: Synthesis of Compounds 398, 409, and 410

Synthesis of Intermediate C197 C ₁ 97 To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole- 7-carboxamide (190 mg, 0.456 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N-(pyrrolidin-3- yl)carbamate (103 mg, 0.456 mmol, 1 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (446 mg, 1.368 mmol, 3 equiv), RuPhos (43 mg, 0.091 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (21 mg, 0.046 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90°C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl N-cyclopropyl-N-{ 1 -[2-ethyl- 7 -( { 8-fluoro-2-methylimidazo [ 1 ,2-a]pyridin-6-yl } carbamoyl)indazol-4-yl]pyrrolidin-3 -yl } carbamate (C197, 200 mg, 78%) as a solid. LCMS (ES, m/zy 562 [M+H] ⁺

Synthesis of Compound 398

A solution of tert-butyl N-cyclopropyl-N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]pyrrolidin-3-yl} carbamate (90 mg, 0.160 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 10, Gradient 4) to afford 4-[3-(cyclopropylamino)pyrrolidin-l-yl]-2-ethyl-N-{8-fluoro- 2- methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (Compound 398, 60 mg, 81.13%) as a solid. LCMS (ES, m/z): 462 [M+H] ⁺¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.04 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.83 (s, 1H), 7.97-7.85 (m, 2H), 7.25 (dd, J= 12.4, 1.7 Hz, 1H), 6.00 (d, J= 8.4 Hz, 1H), 4.57 (q, J= 7.3 Hz, 2H), 3.77 (dd, J= 12.8, 6.6 Hz, 2H), 3.69-3.41 (m, 3H), 2.71 (m, 1H)2.35 (s, 3H), 2.17 (td, J= 7.1, 6.5, 3.9 Hz, 2H), 1.98 (dd, J= 12.3, 6.2 Hz, 1H), 1.61 (t, J= 7.2 Hz, 3H), 0.42 (d, J= 6.6 Hz, 2H), 0.25 (dq, J= 9.7, 6.2, 4.7 Hz, 2H).

Synthesis of Compounds 409 and 410

Compound 398 was chiral -separation by Prep-Chiral-HPLC (Condition 5, Gradient 1) to afford (R)- 4-(3-(cyclopropylamino)pyrrolidin-l-yl)-2-ethyl-N-(8-fluoro- 2-methylimidazo[1,2-a]pyridin-6-yl)-2H- indazole-7-carboxamide (Compound 409, 20 mg, 35%) as a solid and (S)-4-(3- (cyclopropylamino)pyrrolidin- 1 -yl)-2 -ethyl -N-(8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl)-2H- indazole-7-carboxamide (Compound 410, 18 mg, 31%) as a solid.

Example 158: Synthesis of Compounds 411 and 412

Synthesis of Intermediate C198 , C ₁ 98

To a stirred solution of ethanamine hydrochloride (22.32 g, 273.672 mmol, 3 equiv) in DCM (300 mL) was added triethyl amine (27.69 g, 273.672 mmol, 3.0 equiv) at room temperature. The mixture was stirred for 10 min at room temperature. To the above mixture was added benzyl 3-oxopyrrolidine-l-carboxylate (20 g, 91.224 mmol, 1.0 equiv), NaBH(OAc)3 (29.00 g, 136.836 mmol, 1.5 equiv) in portions over 10 min at 0 °C. The resulting mixture was stirred for additional 16 hr at room temperature. The reaction was quenched with water at 0 °C and diluted with water (200 mL). The resulting mixture was extracted with CH ₂ Q2 (3x200 mL). The combined organic layers were washed with water (3 x 200 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford benzyl 3- (ethylamino)pyrrolidine-l -carboxylate (C ₁ 98, 47 g, 99%) as an oil. LCMS (ES, m, z):249 [M+H]

Synthesis of Intermediate C199 C ₁ 98 C ₁ 99

To a stirred mixture of benzyl 3 -(ethylamino)pyrrolidine-l -carboxylate (47.00 g, 189.267 mmol, 1 equiv) in DCM (940 mL) were added Et3N (57.46 g, 567.801 mmol, 3 equiv) and BOC ₂ O (61.96 g, 283.900 mmol, 1.5 equiv) in portions at room temperature. The resulting mixture was stirred for 4 h at room temperature. The resulting mixture was diluted with water (900 mL). The resulting mixture was extracted with CH ₂ CI ₂ (3 x 500 mL). The combined organic layers were washed with water (2 x 400 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford benzyl 3 -[(tert- butoxycarbonyl)(ethyl)amino]pyrrolidine-l -carboxylate (Cl 99, 27 mg, 40%) as an oil. LCMS (ES, m, z):349 [M+H] ⁺ Synthesis of Intermediate C200 C ₁ 99 C ₂ 00

To a solution of benzyl 3 -[(tert-butoxycarbonyl)(ethyl)amino]pyrrolidine-l -carboxylate (10 g, 28.699 mmol, 1 equiv) in methanol (100 mL) was added Pd/C (2 g 20%W) in a pressure tank. The mixture was hydrogenated at room temperature under 30 psi of hydrogen pressure for 16 hr. The resulting mixture was filtered and the precipitated solids was washed with MeOH (3x50 mL). The combined filtrate was concentrated under vacuum to afford tert-butyl N-ethyl-N- (pyrrolidin-3-yl)carbamate (C ₂ 00, 5.1 g, 82%) as an oil. LCMS (ES, m/z):214 [M+H] ⁺ Synthesis of Intermediate C201

To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (2.5 g, 9.801 mmol, 1 equiv) and tert-butyl N-ethyl-N-(pyrrolidin-3-yl)carbamate (3.15 g, 14.701 mmol, 1.5 equiv) in toluene (50 mL) were added K ₂ CO ₃ (4.06 g, 29.403 mmol, 3 equiv) and BINAP (1.22 g, 1.960 mmol, 0.2 equiv) and Pd(AcO)2 (0.22 g, 0.980 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 16 hr at 100 °C under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE / EA (2:1) to afford methyl 4-{3-[(tert- butoxycarbonyl)(ethyl)amino]pyrrolidin-l-yl}-2H-indazole-7-c arboxylate (C ₂ 01, 3.2 g, 84%) as a solid. LCMS (ES, m, z):389 [M+H] ⁺ Synthesis of Intermediate C202 C ₂ 01 C ₂ 02

To a stirred mixture of methyl 4-{3-[(tert-butoxycarbonyl)(ethyl)amino]pyrrolidin-l-yl}- 2H-indazole-7-carboxylate (3.2 g, 8.237 mmol, 1 equiv) in THF (32 mL) were added H ₂ O (32 mL) and LiOEEELO (1.58 g, 65.896 mmol, 8 equiv) at room temperature. The resulting mixture was stirred for 3 hr at 50 °C. The mixture was acidified to pH 6 with 1 N of HCl. The resulting mixture was extracted with ethyl acetate (4 x4 0 mL). The combined organic layers were washed with water (3x30 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-{3-[(tert- butoxycarbonyl) (ethyl)amino] pyrrolidin-l-yl}-2H-indazole-7-carboxylic acid (C ₂ 02, 2.48 g, 80%) as a solid. LCMS (ES, m/z):375 [M+H] ⁺

Synthesis of Intermediate C203

To a stirred mixture of 4-{3-[(tert-butoxycarbonyl)(ethyl)amino]pyrrolidin-l-yl}-2H- indazole-7-carboxylic acid (1.8 g, 4.807 mmol, 1.00 equiv) and 8-fluoro-2-methylimidazo[1,2- a]pyridin-6-amine (0.95 g, 5.768 mmol, 1.2 equiv) in pyridine (36 mL) was added EDCI (1.38 g, 7.211 mmol, 1.5 equiv) in portions at room temperature. The resulting mixture was stirred for 16 hr at room temperature. The resulting mixture was diluted with water (60 mL). The resulting mixture was extracted with ethyl acetate (3x60 mL). The combined organic layers were washed with water (3 x 50 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl N-ethyl-N-{ l-[7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2H-indazol-4-yl]pyrrolidin-3-yl} carbamate (C203, 420 mg, 16%) as a solid. LCMS (ES, m, z):522 [M+H] ⁺ Synthesis of Intermediate C203

To a stirred mixture of tert-butyl N-ethyl-N-{ l-[7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]pyrrolidin-3-yl}ca rbamate (400 mg, 0.767 mmol, 1 equiv) and 2-bromoethyl methyl ether (159.88 mg, 1.151 mmol, 1.5 equiv) in DMF (8 mL, 103.372 mmol, 134.80 equiv) was added Cs ₂ CO ₃ (749.59 mg, 2.301 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was diluted with water (20 mL). The resulting mixture was extracted with ethyl acetate (3 x 20 mL). The combined organic layers were washed with water (3 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N- ethyl-N-{ 1 -[7 -({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbamoyl)-2-(2- methoxyethyl)indazol-4-yl]pyrrolidin-3-yl} carbamate (210 mg, 47.24%) as a solid. LCMS (ES, m/z):580[M+H] ⁺

Synthesis of Intermediates C204 and C205

C203 C204 ^C205

Intermediate C ₂ 03 was separated by Chiral-Prep HPLC (Condition 4, Gradient 1) to yield intermediates C ₂ 04 and C ₂ 05.

Synthesis of Compound 412

To a stirred mixture of tert-butyl N-ethyl-N-[(3R)-l-[7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl] carbarnoyl)-2-(2 -methoxy ethyl)indazol-4-yl]pyrrolidin-3-yl]carbamate (65 mg, 0.112 mmol, 1 equiv) in DCM (2 mL) was added TFA (0.4 mL) dropwise at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4-[(3R)-3-(ethylamino)pyrrolidin-l-yl]-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethyl)indazole -7-carboxamide (Compound 412, 23.8 mg, 44%) as a solid. LCMS (ES, m, z):422 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.05 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.82 (s, 1H), 7.94 (d, J= 8.3 Hz, 1H), 7.89 (d, J= 3.1 Hz, 1H), 7.28 (dd, J= 12.4, 1.7 Hz, 1H), 6.02 (d, J= 8.4 Hz, 1H), 4.71 (t, J= 5.2 Hz, 2H), 3.94 (t, J = 5.2 Hz, 2H), 3.83-3.73 (m, 2H), 3.64 (d, J= 8.0 Hz, 1H), 3.52-3.42 (m, 2H), 3.32 (s, 3H), 2.65

(q, J= 7.0 Hz, 2H), 2.35 (s, 3H), 2.18 (dd, J= 12.6, 6.3 Hz, 1H), 1.93 (dt, J= 12.3, 6.3 Hz, 1H),

1.06 (t, J = 7.1 Hz, 3H).

Synthesis of Compound 411

C205 411

To a stirred mixture of tert-butyl N-ethyl-N-[(3S)-l-[7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl} carbarnoyl)-2-(2 -methoxy ethyl)indazol-4-yl]pyrrolidin-3-yl]carbamate (70 mg, 0.121 mmol, 1 equiv) in DCM (2 mL) was added TFA (0.4 mL) dropwise at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4-[(3S)-3-(ethylamino)pyrrolidin-l-yl]-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-(2-methoxyethyl)indazole -7-carboxamide (Compound 411, 28.4 mg, 49%) as a solid. LCMS (ES, m, z):422 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.05 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.82 (s, 1H), 7.94 (d, J= 8.3 Hz, 1H), 7.89 (d, J= 3.0 Hz, 1H), 7.28 (dd, J= 12.4, 1.7 Hz, 1H), 6.02 (d, J= 8.4 Hz, 1H), 4.71 (t, J= 5.2 Hz, 2H), 3.94 (t, J = 5.2 Hz, 2H), 3.83-3.73 (m, 2H), 3.64 (d, J= 8.2 Hz, 1H), 3.50-3.40 (m, 2H), 3.32 (s, 3H), 2.68- 2.58 (m, 2H), 2.35 (s, 3H), 2.17 (dt, J= 12.7, 6.1 Hz, 1H), 1.92 (dd, J= 12.1, 6.4 Hz, 1H), 1.05 (t, J= 1A Hz, 3H).

Example 159: Synthesis of Compound 413

Synthesis of Intermediate C206 C ₂ 06

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (100.0 mg, 0.20 mmol, 1.0 equiv) and 2-bromoacetonitrile (36.4 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) was added Cs ₂ CO ₃ (198.0 mg, 0.61 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with water. The resulting mixture was extracted with ethyl acetate (3 x 20 mL). The combined organic layers were washed with brine (1 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[2-(cyanomethyl)-7-({8-fluoro-2-methylimidazo[1,2-a]pyridi n-6- yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (C206, 56 mg, 51%) as a solid. LCMS (ES, m/z): 533 [M+H]+ Synthesis of Compound 413

A solution of tert-butyl 4-[2-(cyanomethyl)-7-({8-fluoro-2-methylimidazo[1,2-a]pyridi n-6- yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (56.0 mg, 0.10 mmol, 1.0 equiv) in DCM (0.5 mL) was treated with TFA (0.5 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 6) to afford 2-(cyanomethyl)- N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin -l-yl)indazole-7-carboxamide (Compound 413, 6.1 mg, 13%) as a solid. LCMS (ES, m/z): 433 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 10.94 (s, 1H), 9.26 (s, 1H), 9.01 (s, 1H), 8.03 (s, 1H), 7.92 (s, 1H), 7.27 (s, 1H), 6.54 (s, 1H), 5.94 (s, 2H), 3.33-3.32 (m, 4H), 2.92-2.94 (m, 4H), 2.35 (s, 3H). Example 160: Synthesis of Compound 414

Synthesis of Intermediate C207 C ₂ 07

To a stirred mixture of methyl 3 -hydroxybicyclo[l .l. l]pentane-l -carboxylate (500.0 mg, 3.51 mmol, 1.0 equiv) and imidazole (478.9 mg, 7.03 mmol, 2.0 equiv) in DMF (5 mL) was added TBSC ₁ (636.1 mg, 4.22 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred for overnight at room temperature. The reaction was monitored by TLC. The resulting mixture was diluted with water. The resulting mixture was extracted with ethyl acetate (3 x 20 mL). The combined organic layers were washed with brine (1x10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The crude product was used in the next step directly without further purification to afford methyl 3 -[(tert- butyldimethylsilyl)oxy]bicyclo[l.l. l]pentane-l-carboxylate (C207, 900 mg, 99%) as a solid. ¹ H NMR (400 MHz, Chloroform-d) δ 3.69 (s, 3H), 2.22 (s, 6H), 0.90 (s, 9H), 0.12 (s, 6H). Synthesis of Intermediate C208 C ₂ 07 C ₂ 08

To a stirred solution of LiAlH4 (266.4 mg, 7.02 mmol, 2.0 equiv) in THF (9 mL) was added methyl 3-[(tert-butyldimethylsilyl)oxy]bicyclo[l. l.l]pentane-l-carboxylate (900 mg, 3.51 mmol, 1.0 equiv) dropwise at 0 °C under nitrogen atmosphere. The resulting mixture was stirred for 1 hr at 0 °C under nitrogen atmosphere. The reaction was quenched with water (0.3 mL) and NaOH (15%) (0.3mL) at 0 °C. The resulting mixture was dried over anhydrous MgSCh. After filtration, the filtrate was concentrated under reduced pressure. The crude product was used in the next step directly without further purification to afford { 3 -[(tert- butyldimethylsilyl)oxy]bicyclo[l.l. l]pentan-l-yl}methanol (C208, 700 mg, 87%) as a oil. ¹ H NMR (400 MHz, Chloroform-d) δ 3.76 (s, 2H), 1.88 (s, 6H), 0.91 (s, 8H), 0.12 (s, 6H). Synthesis of Intermediate C209 C ₂ 08 C ₂ 09

To a stirred mixture of {3-[(tert-butyldimethylsilyl)oxy]bicyclo[l.l. l]pentan-l-yl}methanol (300 mg, 1.31 mmol, 1.0 equiv) and Et3N (199.3 mg, 1.97 mmol, 1.5 equiv) in DCM (3 mL) was added MsCI (165.4 mg, 1.44 mmol, 1.1 equiv) dropwise at 0 °C under nitrogen atmosphere. The resulting mixture was stirred for 1 hr at room temperature under nitrogen atmosphere. The reaction was quenched with water. The resulting mixture was extracted with ethyl acetate (3 x 20 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford {3-[(tert- butyldimethylsilyl)oxy]bicyclo[l.l. l]pentan-l-yl}methyl methanesulfonate (C ₂ 09, 235 mg, 58%) as a colorless oil without further purification.

Synthesis of Intermediate C210

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (235.0 mg, 0.476 mmol, 1.0 equiv) and {3-[(tert-butyldimethylsilyl)oxy]bicyclo[l.l. l]pentan-l-yl}methyl methanesulfonate (175.1 mg, 0.57 mmol, 1.2 equiv) in DMF (1.5 mL) was added Cs ₂ CO ₃ (465.4 mg, 1.42 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 hr at room temperature. The resulting mixture was diluted with water. The resulting mixture was extracted with ethyl acetate (3 x 20 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[2-({3-[(tert- butyldimethylsilyl)oxy]bicyclo[ 1.1.1 ]pentan- 1 -yl }methyl)-7-({ 8-fluoro-2-methylimidazo[ 1 ,2- a]pyridin-6-yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate hydrofluoride (C ₂ 10, 130 mg, 37%) as a solid. LCMS (ES, m/z): 704 [M+H] ⁺

Synthesis of Compound 414

C210 414

A solution of tert-butyl 4-[2-({3-[(tert-butyldimethylsilyl)oxy]bicyclo[l.l.l]pentan- l- yl }methyl)-7-({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)indazol-4- yl]piperazine-l -carboxylate (130 mg, 0.18 mmol, 1.0 equiv) in DCM (1 mL)was treated with TFA (1 mL) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 14, Gradient 1) to afford N-{ 8-fluoro-2-methylimidazo[ 1,2-a]pyridin- 6-yl}-2-({3-hydroxybicyclo[l.l.l]pentan-l-yl}methyl)-4-(pipe razin-l-yl)indazole-7- carboxamide 2,2,2-trifluoroacetate (Compound 414, 52 mg, 46%) as a solid. LCMS (ES, m/z): 490 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.35 (s, 1H), 9.48 (d, J= 1.5 Hz, 1H), 8.97 (s, 2H), 8.89 (s, 1H), 8.18 (dd, J = 2.6, 1.2 Hz, 1H), 8.05 (d, J = 8.0 Hz, 1H), 7.66 (d, J= 11.6 Hz, 1H), 6.63 (d, J = 8.1 Hz, 1H), 4.79 (s, 2H), 3.61 (t, J= 5.1 Hz, 4H), 3.37-3.35 (m 4H), 2.45 (d, J= 1.0 Hz, 3H), 1.80 (s, 6H).

Example 161: Synthesis of Compound 415

C191 415

To a stirred solution of tert-butyl 4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-2-(hydroxymethyl)piperazine-l-car boxylate (100 mg, 0.181 mmol, 1 equiv) in DCM (2 mL) was added DAST (60 mg, 0.372 mmol, 2.05 equiv) dropwise at -78 °C under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at room temperature. The mixture was basified to pH 8 with NaHCO ₃ aq. The resulting mixture was extracted with EA (3 x 5 mL). The combined organic layers were washed with NaCl (1 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (condition 3, Gradient 2) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin- 6-yl}-4-{3-oxo-tetrahydro-lH-[l,3]oxazolo[3,4-a]pyrazin-7-yl }indazole-7-carboxamide (Compound 415, 20 mg, 23%) as a solid. LCMS (ES, m/z): 478 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.22 (d, J= 1.6 Hz, 1H), 8.88 (s, 1H), 8.00 (d, J= 8.0 Hz, 1H), 7.91 (dd, J = 32, 1.0 Hz, 1H), 7.32 (dd, J = 12.4, 1.7 Hz, 1H), 6.59 (d, J= 8.1 Hz, 1H), 4.61 (q, J= 7.3 Hz, 2H), 4.47 (t, J= 7.9 Hz, 1H), 4.20-4.01 (m, 3H), 3.89 (d, J = 12.5 Hz, 1H), 3.79-3.68 (m, 1H), 3.02- 2.82 (m, 2H), 2.36 (d, J= 0.8 Hz, 3H), 1.64

(t, J= 7.3 Hz, 3H).

Example 162: Synthesis of Compound 416

Synthesis of Intermediate 211

C211

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (200.0 mg, 0.40 mmol, 1.0 equiv) and 2-bromo-l -propene (73.5 mg, 0.60 mmol, 1.5 equiv) in DMF (4 mL) were added CS ₂ CO ₃ (396.1 mg, 1.21 mmol, 3.0 equiv), (lR,2R)-cyclohexane-1,2-diamine (9.2 mg, 0.08 mmol, 0.2 equiv) and Cui (7.7 mg, 0.04 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 3 hr at 100 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water and extracted with ethyl acetate (3 x 20 mL). The combined organic layers were washed with water (1x10 mL), brine (1x10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbamoyl)- 1 -(prop- 1 -en- 2-yl)indazol-4-yl]piperazine-l -carboxylate (C2 11, 108 mg, 49%) as a solid. LCMS (ES, m/z): 534 [M+H] ⁺

Synthesis of Compound 416

To a stirred mixture of tert-butyl 4-(7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl)carbamoyl)-l-(prop-l-en-2-yl)-lH-indazol-4-yl)piperazine- l-carboxylate (65.0 mg, 0.122 mmol, 1.0 equiv) in DCM (2 mL) were added ZnBn (270.7 mg, 1.220 mmol, 10.0 equiv) at room temperature. The resulting mixture was stirred for 16 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep- HPLC (Condition 10, Gradient 7) to afford N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4- (piperazin-l-yl)-l-(prop-l-en-2-yl)-lH-indazole-7-carboxamid e (Compound 416, 27.4 mg, 51%) as a solid. LCMS (ES, m/z): 434 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 10.42 (s, 1H), 9.08 (d, J= 1.6 Hz, 1H), 8.35 (s, 1H), 7.95 (d, J= 3.0 Hz, 1H), 7.49 (d, J= 7.9 Hz, 1H), 7.14 (dd, J= 12.6, 1.6 Hz, 1H), 6.61 (d, J= 7.9 Hz, 1H), 5.01 (d, J= 1.6 Hz, 1H), 4.77 (s, 1H), 3.27 (t, J= 4.9 Hz, 1H), 2.94 (t, J= 4.8 Hz, 4H), 2.34 (s, 3H), 2.23 (s, 3H).

Example 163: Synthesis of Compound 417

Synthesis of Intermediate C212

To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (1.5 g, 5.574 mmol, 1 equiv) and tert-butyl N-methyl-N-(pyrrolidin-3-yl)carbamate (1.34 g, 6.689 mmol, 1.2 equiv) in dioxane (30 mL) were added Cs ₂ CO ₃ (5.45 g, 16.722 mmol, 3 equiv) and RuPhos (0.52 g, 1.115 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (0.47 g, 0.557 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at 100 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (10: 1) to afford methyl 4-{3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l-yl}-2- methylindazole-7-carboxylate (C ₂ 12, 2.45 g, 113%) as a solid. LCMS (ES, m, z):389 [M+H] ⁺

Synthesis of Intermediate C213

To a stirred mixture of methyl 4-{3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l-yl}- 2-methylindazole-7-carboxylate (2.4 g, 6.178 mmol, 1 equiv) in NH3(g) (7 M in MeOH) (200 mL) at room temperature. The resulting mixture was stirred for 72 hr at sealed 100 °C under NH3 atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N-[l-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl]-N- methylcarbamate (C ₂ 14, 1.87 g, 62%) as a solid.

LCMS (ES, m, z):374 [M+H] ⁺

Synthesis of Intermediate C215 C ₂ 15

To a stirred mixture of tert-butyl N-[l-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl]- N-methyl carbamate (280.0 mg, 0.577 mmol, 1 equiv) and 6-bromo-8-methoxy-2- methylimidazo[1,2-a]pyrazine (209.6 mg, 0.865 mmol, 1.5 equiv) in Dioxane (5.39 mL) were added Cs ₂ CO ₃ (564.3 mg, 1.731 mmol, 3.0 equiv) and XantPhos (66.8 mg, 0.115 mmol, 0.2 equiv) and Pd2(dba)3 (52.9 mg, 0.058 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at 100 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with ethyl acetate (3 x 5 mL). The combined organic layers were washed with brine (lx 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N-{ l-[7-({8-methoxy-2- methylimidazo[1,2-a]pyrazin-6-yl} carbarnoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}-N- methylcarbamate (C ₂ 15, 170 mg, 55%) as a solid. LCMS (ES, m, z):535 [M+H] ⁺ C ₂ 15 417

To a stirred mixture of tert-butyl N-[l-(7-{[8-(dimethylamino)-2-methylimidazo[1,2- a]pyrazin-6-yl]carbamoyl}-2-methylindazol-4-yl)pyrrolidin-3- yl]-N-methylcarbamate (160 mg,

0.292 mmol, 1 equiv) in DCM (3 mL) was added TFA (0.6 mL) dropwise at 0 °C. The resulting mixture was stirred for 30 min at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 8) to afford N-[8-(dimethylamino)-2-methylimidazo[1,2-a]pyrazin-6-yl]-2-m ethyl-4-[3- (methylamino)pyrrolidin-l-yl]indazole-7-carboxamide (85 mg, 65%) as a solid. LCMS (ES, m/z):435 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.20 (s, 1H), 8.99 (s, 1H), 8.83 (s, 1H), 7.95 (d, J= 8.3 Hz, 1H), 7.90 (d, J= 1.0 Hz, 1H), 6.02 (d, J= 8.5 Hz, 1H), 4.24 (s, 3H), 4.10 (s, 3H), 3.80-3.73 (m, 2H), 3.69 (d, J= 27.8 Hz, 1H), 3.43 (dd, J= 10.2, 4.0 Hz, 1H), 3.32 (s, 1H), 2.34 (d, J= 2.8 Hz, 6H), 2.15 (dp, J= 13.1, 7.2, 6.5 Hz, 1H), 1.92 (dd, J= 12.0, 6.5 Hz, 1H).

Example 164: Synthesis of Compounds 418, 431, and 432

Synthesis of Intermediate C216

To a stirred solution/mixture of methyl 4-bromo-2H-indazole-7-carboxylate (3.0 g, 11.761 mmol, 1.0 equiv) and Cs ₂ CO ₃ (7.6 g, 23.522 mmol, 2.0 equiv) in dimethylformamide (50 mL) were added 2-bromoethyl methyl ether (2.45 g, 17.642 mmol, 1.5 equiv) dropwise at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was diluted with water (50 mL). The resulting mixture was extracted with ethyl acetate (2 x 50 mL). The combined organic layers were washed with brine (1 x 50 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-bromo-2-(2-methoxyethyl) indazole-7-carboxylate (1.2 g, 29%) as a solid. LCMS (ES, m/z): 313 [M+H] ⁺

Synthesis of Intermediate C217

To a solution of methyl 4-bromo-2-(2-methoxyethyl)indazole-7-carboxylate (1.1 g, 3.513 mmol, 1.0 equiv) and tert-butyl N-methyl-N-(pyrrolidin-3-yl)carbamate (1.4 g, 7.026 mmol, 2.0 equiv) in toluene (20 mL) were added potassium methaneperoxoate potassium (0.9 g, 7.026 mmol, 2.0 equiv) and BINAP (0.4 g, 0.703 mmol, 0.2 equiv), Pd(OAc)2 (0.08 g, 0.351 mmol, 0.1 equiv). After stirring for 16 hr at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (30: 1) to afford methyl 4-{3-[(tert- butoxy carbonyl) (methyl)amino]pyrrolidin-l-yl}-2-(2-methoxyethyl)indazole-7- carboxylate (C ₂ 17, 1.5 g, 88%) as an oil. LCMS (ES, m/z): 433 [M+H] ⁺ Synthesis of Intermediate C218

To a solution of methyl 4-{3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l-yl}-2- (2- methoxyethyl)indazole-7-carboxylate (500.0 mg, 1.156 mmol, 1.0 equiv) was added NH3(g) in methanol (50 mL) in a pressure tank. The resulting mixture was stirred for 2 days at 100 °C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with C^CL/MeOH (30: 1) to afford tert-butyl N-{ l-[7- carbamoyl-2-(2- methoxyethyl)indazol-4- yl]pyrrolidin-3-yl}-N-methylcarbamate (C ₂ 18, 450 mg, 74%) as a solid. LCMS (ES, m/z): 418 [M+H] ⁺ Synthesis of Intermediate C219

To a solution of tert-butyl N-{ l-[7-carbamoyl-2-(2 -methoxy ethyl)indazol-4-yl]pyrrolidin- 3 -yl}-N-methyl carbamate (200.0 mg, 0.479 mmol, 1.0 equiv) and 6-bromo-8-methoxy-2- methylimidazo[1,2- a]pyrazine (150.7 mg, 0.623 mmol, 1.3 equiv) in dioxane (5 mL) were added caesio methaneperoxoate caesium (391.4 mg, 1.198 mmol, 2.5 equiv) and Pd ₂ (dba) ₃ (43.8 mg, 0.048 mmol, 0.1 equiv), Xantphos (55.4 mg, 0.096 mmol, 0.2 equiv). After stirring for 3 hr at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CELCl ₂ /MeOEl (40: 1) to afford tert-butyl N-{ l-[7-({8-methoxy-2- methylimidazo[1,2-a]pyrazin- 6-yl}carbamoyl)-2-(2-methoxyethyl)indazol-4-yl]pyrrolidin-3- yl}-N-methylcarbamate (C ₂ 19, 200 mg, 57%) as a solid. LCMS (ES, m/z): 579 [M+H] ⁺

To a stirred solution/mixture of tert-butyl N-{ l-[7-({8-methoxy-2-methylimidazo[1,2- a]pyrazin- 6-yl} carbarnoyl)-2-(2 -methoxy ethyl)indazol-4-yl]pyrrolidin-3-yl}-N- methylcarbamate (180.0 mg, 0.311 mmol, 1.0 equiv) in DCM (2 mL) were added TFA (1 mL) dropwise at room temperature . The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 3, Gradient 1) to afford N-{8-m ethoxy-2- methylimidazo[1,2- a]pyrazin-6-yl}-2-(2-methoxyethyl)-4-[3-(methylamino)pyrroli din-l-yl]indazole-7-carboxamide (Compound 418, 50 mg, 32%) as a solid. LCMS (ES, m/z): 479 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.33 (s, 1H), 8.98 (s, 1H), 8.86 (s, 1H), 7.96 (d, J= 8.3 Hz, 1H), 7.91 (d, J= 1.0 Hz, 1H), 6.04 (d, J= 8.4 Hz, 1H), 4.66 (t, J= 5.3 Hz, 2H), 4.10 (s, 3H), 4.03 (t, J= 5.3 Hz, 2H), 3.81-3.74 (m, 2H), 3.67-3.64 (m, 1H), 3.50-3.40 (m, 2H), 3.29 (s, 3H), 2.36 (d, J= 19.5 Hz, 6H), 2.24 -2.14 (m, 1H), 1.97-1.95 (m, 1H).

Synthesis of Compound 431

418 431

Compound 418 was separated by prep-chiral -HPLC (Condition 2, Gradient 2) to yield (R)- N-(8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl)-2-(2-methox yethyl)-4-(3- (methylamino)pyrrolidin-l-yl)-2H-indazole-7-carboxamide (Compound 431, 5.7 mg, 13%) as a solid. LCMS (ES, m/z): 479 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.33 (s, 1H), 8.98 (s,

1H), 8.86 (s, 1H), 7.96 (d, J= 8.3 Hz, 1H), 7.91 (d, J= 1.0 Hz, 1H), 6.04 (d, J= 8.4 Hz, 1H), 4.66 (t, J= 5.3 Hz, 2H), 4.10 (s, 3H), 4.03 (t, J= 5.3 Hz, 2H), 3.80-3.75 (m, 2H), 3.67-3.65 (m, 1H), 3.50-3.40 (m, 2H), 3.29 (s, 3H), 2.36 (d, J= 19.5 Hz, 6H), 2.24 -2.14 (m, 1H), 1.97-1.88 (m, 1H).

Synthesis of Compound 432 Compound 418 was separated by prep-chiral -HPLC (Condition 2, Gradient 2) to yield (S)- N-(8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl)-2-(2-methox yethyl)-4-(3- (methylamino)pyrrolidin-l-yl)-2H-indazole-7-carboxamide (Compound 432, 6.7 mg, 15%) as a solid. LCMS (ES, m/z): 479 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.33 (s, 1H), 8.98 (s, 1H), 8.86 (s, 1H), 7.96 (d, J= 8.3 Hz, 1H), 7.91 (d, J= 1.0 Hz, 1H), 6.04 (d, J= 8.4 Hz, 1H), 4.66 (t, J= 5.3 Hz, 2H), 4.10 (s, 3H), 4.03 (t, J= 5.3 Hz, 2H), 3.84-3.78 (m, 2H), 3.67-3.65 (m, 1H), 3.50-3.40 (m, 2H), 3.29 (s, 3H), 2.36 (d, J= 19.5 Hz, 6H), 2.24 -2.14 (m, 1H), 1.97-1.95 (m, 1H).

Example 165: Synthesis of Compound 419

Synthesis of Intermediate C220 110 C, 3 h C ₂ 20

To a stirred mixture of 3,5-dibromopyrazin-2-amine (10.00 g, 39.542 mmol, 1 equiv) and Dimethylamine hydrochloride (3.55 g, 43.496 mmol, 1.1 equiv) in DMSO (100 mL) was added DIEA (15.33 g, 118.626 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at 110 °C. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (200 mL). The resulting mixture was extracted with ethyl acetate (3 x 200 mL). The combined organic layers were washed with water (2 x 200 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (3 : 1) to afford 6- bromo-N2, N2-dimethylpyrazine-2, 3 -diamine (C ₂ 20, 6.5 g, 75%) as a solid. LCMS (ES, m/z):217 [M+H] ⁺

Synthesis of Intermediate C221 To a stirred mixture of 6-bromo-N2,N2-dimethylpyrazine-2,3-diamine (6.50 g, 29.944 mmol, 1 equiv) and 1 -bromo- 1,1 -dimethoxy ethane (6.07 g, 35.933 mmol, 1.2 equiv) in i-PrOH (130 mL) was added PPTS (0.75 g, 2.994 mmol, 0.1 equiv) in portions at room temperature. The resulting mixture was stirred for 16 hr at 80 °C. The mixture was allowed to cool down to room temperature. The resulting mixture was filtered and the filter cake was washed with i-PrOH (3 x 100 mL). The filter cake was dried to afford 6-bromo-N,N,2-trimethylimidazo[1,2-a]pyrazin-8- amine (C221, 5.1 g, 66%) as a solid. LCMS (ES, m, z):255 [M+H] ⁺ Synthesis of Intermediate C222

To a stirred mixture of tert-butyl N-[l-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl]- N-methyl carbamate (280.0 mg, 0.577 mmol, 1.0 equiv) and 6-bromo-N,N,2- trimethylimidazo[1,2-a]pyrazin-8-amine (220.9 mg, 0.865 mmol, 1.5 equiv) in dioxane (6 mL) were added Cs ₂ CO ₃ (564.3 mg, 1.731 mmol, 3 equiv) and XantPhos (66.8 mg, 0.115 mmol, 0.2 equiv) and Pd2(dba)3 (52.9 mg, 0.058 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at 100 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with ethyl acetate (3 x 5 mL). The combined organic layers were washed with brine (1 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N-[l-(7-{[8-(dimethylamino)-2- methylimidazo[1,2-a]pyrazin-6-yl]carbamoyl}-2-methylindazol- 4-yl)pyrrolidin-3-yl]-N- methylcarbamate (C222, 170 mg, 53%) as a solid. LCMS (ES, m, z):548 [M+H] ⁺ Synthesis of Compound 419

To a stirred mixture of tert-butyl N-[l-(7-{[8-(dimethylamino)-2-methylimidazo[1,2- a]pyrazin-6-yl]carbamoyl}-2-methylindazol-4-yl)pyrrolidin-3- yl]-N-methylcarbamate (160 mg, 0.292 mmol, 1 equiv) in DCM (3 mL) was added TFA (0.6 mL) dropwise at 0 °C. The resulting mixture was stirred for 30 min at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford N-[8-(dimethylamino)-2-methylimidazo[1,2-a]pyrazin-6-yl]-2-m ethyl-4-[3- (methylamino)pyrrolidin-l-yl]indazole-7-carboxamide (Compound 419, 85 mg, 65%) as a solid. LCMS (ES, m/z):448 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.06 (s, 1H), 8.81 (s, 1H), 8.62 (s, 1H), 7.92 (d, J= 8.3 Hz, 1H), 7.73 (d, J= 1.0 Hz, 1H), 6.00 (d, J= 8.4 Hz, 1H), 4.22 (s, 3H), 3.75 (dq, J= 22.4, 7.9, 6.9 Hz, 2H), 3.64 (q, J= 8.4, 7.8 Hz, 1H), 3.53 (s, 6H), 3.42 (dd, J= 9.9, 4.1 Hz, 1H), 3.35 (d, J= 5.5 Hz, 1H), 2.33 (d, J= 10.7 Hz, 6H), 2.14 (dt, J= 13.0, 6.5 Hz, 1H), 1.92 (dt, J= 11.6, 5.8 Hz, 1H).

Example 166: Synthesis of Compound 421

Synthesis of Intermediate C223

A solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (60 mg, 0.167 mmol, 1 equiv), 5-chloro-2,7-dimethylpyrazolo[l,5-a]pyrimidine (36.38 mg, 0.200 mmol, 1.2 equiv), Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv), XantPhos (19.32 mg, 0.033 mmol, 0.2 equiv) and Cs ₂ CO ₃ (163.17 mg, 0.501 mmol, 3 equiv) in dioxane (2 mL) was stirred for 4h at 80°C under N2 atmosphere. The resulting mixture was extracted with DCM and water. The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA = 5: 1 to afford tert-butyl 4-[7-({2,7-dimethylpyrazolo[l,5- a]pyrimidin-5-yl}carbamoyl)-2-methylindazol-4-yl]piperazine- l-carboxylate (C ₂ 23, 47 mg, 55%) as a solid. LCMS (ES, m/z): 505 [M+H] ⁺

Synthesis of Compound 421

A solution of tert-butyl 4-[7-({2,7-dimethylpyrazolo[l,5-a]pyrimidin-5-yl}carbamoyl)- 2- methylindazol-4-yl]piperazine-l -carboxylate (47 mg, 0.093 mmol, 1 equiv) in HCl (gas) in 1,4- di oxane (1 mL) for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by Prep-TLC (Condition 1, Gradient 2) to afford N- {2,7-dimethylpyrazolo[l,5-a]pyrimidin-5-yl}-2-methyl-4-(pipe razin-l-yl)indazole-7- carboxamide (C ₂ 24, 18 mg, 47%) as a solid.LCMS (ES, m/z): 405 [M+H] ⁺ 1H NMR (300 MHz, Methanol-d4) δ 8.54 (s, 1H), 8.13 (d, J= 8.2 Hz, 1H), 7.78 (s, 1H), 6.54 (d, J= 8.2 Hz, 1H), 6.29 (s, 1H), 4.38 (s, 3H), 3.58 - 3.49 (m, 4H), 3.09 (t, J= 5.0 Hz, 4H), 2.57 (d, J= 6.3 Hz, 6H).

Example 167: Synthesis of Compound 422

Synthesis of Intermediate C224 C ₂ 24

To a mixture of tert-butyl l,7-diazaspiro[3.5]nonane-7-carboxylate (210 mg, 0.928 mmol, 1 equiv) and HCHO (55.72 mg, 1.856 mmol, 2 equiv) in EtOH/MeCN (2: 1) (5 ml) was added Pd/C (100 mg, 0.094 mmol, 0.10 equiv, 10%) under nitrogen atmosphere in a 50 mL roundbottom flask. The mixture was hydrogenated at room temperature overnight under hydrogen atmosphere using a hydrogen balloon, filtered through filter paper and concentrated under reduced pressure to afford tert-butyl l-methyl-l,7-diazaspiro[3.5]nonane-7-carboxylate (C ₂ 24, 65 mg, 29%) as an oil. LCMS (ES, m/z): 241 [M+H] ⁺

Synthesis of Intermediate C225 C ₂ 24 C ₂ 25

To a stirred solution of tert-butyl l-methyl-l,7-diazaspiro[3.5]nonane-7-carboxylate (35 mg, 0.146 mmol, 1 equiv) in DCM (0.5 mL) was added TFA (0.5 mL, 6.732 mmol, 46.23 equiv) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was used in the next step directly without further purification. LCMS (ES, m/z): 141 [M+H] ⁺

Synthesis of Compound 422

422

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (65 mg, 0.162 mmol, 1 equiv) and Intermediate C ₂ 25 (27.19 mg, 0.194 mmol, 1.2 equiv) in dioxane (1 mL) were added Cs ₂ CO ₃ (157.96 mg, 0.486 mmol, 3 equiv), RuPhos (15.08 mg, 0.032 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (13.52 mg, 0.016 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 15, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-{ l-methyl-l,7- diazaspiro[3.5]nonan-7-yl}indazole-7-carboxamide; bis(trifluoroacetic acid) (Compound 422, 1.9 mg, 10%) as a solid. LCMS (ES, m/z): 462 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 9.47 (d, J= 1.5 Hz, 1H), 8.59 (s, 1H), 8.14 (d, J= 8.1 Hz, 1H), 8.07 - 8.02 (m, 1H), 7.92 (dd, J = 11.5, 1.5 Hz, 1H), 6.63 (d, J= 8.1 Hz, 1H), 4.37 (s, 3H), 4.28 (d, J= 8.7 Hz, 1H), 4.09 (d, J = 12.7 Hz, 1H), 3.98 (t, J= 14.2 Hz, 2H), 3.23 - 3.12 (m, 2H), 2.86 (s, 3H), 2.61 (t, J= 8.2 Hz, 2H), 2.57 (d, J= 1.0 Hz, 3H), 2.44 (d, J= 12.3 Hz, 1H), 2.31 (d, J= 13.1 Hz, 3H).

Example 168: Synthesis of Compound 427

Synthesis of Intermediate C226 C ₂ 26

To a stirred solution of 3 -bromobenzene- 1,2-diamine (4.0 g, 21.386 mmol, 1.0 equiv) in acetic acid (20 mL) and water (20 mL) were added sodium nitrite (1.6 g, 23.525 mmol, 1.1 equiv) in portions at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The precipitated solids were collected by filtration and washed with water (2 x 20 mL). The solid was dried and this resulted in 4-bromo-2H-1,2,3-benzotriazole (C226, 3.2 g, 71%) as a solid. LCMS (ES, m/z): 198 [M+H] ⁺ Synthesis of Intermediate C227 C ₂ 26 C ₂ 27

To a stirred mixture of 4-bromo-2H-1,2,3-benzotriazole (2.7 g, 13.635 mmol, 1.0 equiv) and K ₂ CO ₃ (3.76 g, 27.270 mmol, 2.0 equiv) in dimethylformamide (60 mL) were added methyl iodide (2.9 g, 20.453 mmol, 1.5 equiv) dropwise at 0 °C. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was diluted with water (200 mL). The resulting mixture was extracted with ethyl acetate (2 x 100 mL). The combined organic layers were washed with water (2 x 200 mL), brine (1 x 200 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2/PE (5: 1) to afford 4-bromo-2-methyl-1,2,3- benzotriazole (C ₂ 27, 0.9 g, 28%) as a solid. LCMS (ES, m/zy 212 [M+H] ⁺

Synthesis of Intermediate C228 dioxane, 80 C, 2 h C ₂ 27 C ₂ 28

To a solution of 4-bromo-2-methyl- 1,2, 3 -benzotri azole (0.8 g, 3.773 mmol, 1.0 equiv) and tert-butyl piperazine- 1 -carboxylate (0.9 g, 4.905 mmol, 1.3 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (3.0 g, 9.433 mmol, 2.5 equiv) and Ruphos (0.4 g, 0.755 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (0.2 g, 0.377 mmol, 0.1 equiv). After stirring for 2 hr at 80°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-(2 -methyl- 1,2, 3 -benzotriazol -4-yl) piperazine- 1 -carboxylate (C ₂ 28, 1.2 g, 90%) as a solid. LCMS (ES, m/zy 318 [M+H] ⁺ Synthesis of Intermediate C229

To a stirred solution of tert-butyl 4-(2-methyl-1,2,3-benzotriazol-4-yl) piperazine-1- carboxylate (850.0 mg, 2.678 mmol, 1.0 equiv) in ACN (15 mL) were added NBS (524.3 mg, 2.946 mmol, 1.1 equiv) in portions at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was diluted with water (30 mL). The resulting mixture was extracted with ethyl acetate (2 x 40mL). The combined organic layers were washed with water (2 x 30 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-(7-bromo-2-methyl-1,2,3- benzotriazol-4-yl) piperazine- 1 -carboxylate (C ₂ 29, 820.0 mg, 73%) as a solid. LCMS (ES, m/z)'. 396 [M+H] ⁺

Synthesis of Intermediate C230 C ₂ 29 C ₂ 30

To a solution of tert-butyl 4-(7-bromo-2-methyl-1,2,3-benzotriazol-4-yl) piperazine-1- carboxylate (250.0 mg, 0.631 mmol, 1.0 equiv) in MeOH (20 mL) was added Pd(dppf)Cl ₂ (46.1 mg, 0.063 mmol, 0.1 equiv), TEA (191.5 mg, 1.893 mmol, 3.0 equiv) in a pressure tank. The mixture was purged with nitrogen for 2 min and then was pressurized to 2 Mpa with carbon monoxide at 80°C for 16 h. The reaction mixture was cooled to room temperature and filtered to remove insoluble solids. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (30: 1) to afford methyl 7-[4-(tert-butoxycarbonyl) piperazin-l-yl]-2-methyl-1,2,3-benzotriazole-4- carboxylate as a solid. LCMS (ES, m/z): 376 [M+H] ⁺ Synthesis of Intermediate C231 C ₂ 30 C ₂ 31

To a stirred mixture of methyl 7-[4-(tert-butoxy carbonyl) piperazin-l-yl]-2-methyl-1,2,3- benzotri azole- 4-carboxylate (170.0 mg, 0.453 mmol, 1.0 equiv) in tetrahydrofuran (3 mL) and water (3 mL) was added LiOHH ₂ O (108.4 mg, 4.530 mmol, 10.0 equiv) in portions at room temperature. The resulting mixture was stirred for 3 hr at 50°C. The resulting mixture was diluted with deionized water (20 mL). The mixture was acidified to pH 6 with HCl (1 N). The resulting mixture was extracted with ethyl acetate (2 x 30mL). The combined organic layers were washed with brine (1x20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The resulting mixture was concentrated under reduced pressure. This resulted in 7-[4-(tert-butoxycarbonyl) piperazin-l-yl]-2-methyl-1,2,3- benzotriazole-4-carboxylic acid (C ₂ 31, 130 mg, 73%) as a solid. LCMS (ES, m/z)'. 362 [M+H] ⁺ Synthesis of Intermediate C232

To a stirred solution of 7-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-methyl-1,2,3- benzotri azole- 4-carboxylic acid (110.0 mg, 0.304 mmol, 1.0 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine (75.4 mg, 0.456 mmol, 1.5 equiv) in ACN (3 mL) were added TCFH (111.0 mg, 0.395 mmol, 1.3 equiv) and NMI (64.8 mg, 0.790 mmol, 2.6 equiv) in portions at room temperature. The resulting mixture was stirred for 3 hr at room temperature. The resulting mixture was extracted with ethyl acetate (2 x 20mL). The combined organic layers were washed with brine (2 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. This resulted in tert-butyl 4-[7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2-methyl- 1,2,3-benzotriazol-4-yl]piperazine-l- carboxylate (C ₂ 32, 100.0 mg, 58%) as a solid. LCMS (ES, m/z)'. 509 [M+H] ⁺ Synthesis of Compound 427 C ₂ 32 427

To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbamoyl)- 2-methyl-1,2,3-benzotriazol-4-yl]piperazine-l-carboxylate (100.0 mg, 0.197 mmol, 1.0 equiv) in DCM (2 mL) was added TFA (0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition

13, Gradient l) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-7-

(piperazin-l-yl)-1,2,3-benzotriazole-4-carboxamide (Compound 427, 19.7 mg, 23%) as a solid. LCMS (ES, m/z): 409 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 10.18 (s, 1H), 9.19 (d, J = 1.6 Hz, 1H), 8.00 (d, J= 8.3 Hz, 1H), 7.91 (d, J= 3.1 Hz, 1H), 7.39 (dd, J= 12.5, 1.7 Hz, 1H), 6.72

(d, J= 8.4 Hz, 1H), 4.61 (s, 3H), 3.72 (t, J= 5.0 Hz, 4H), 2.91 (t, J= 5.1 Hz, 4H), 2.35 (s, 3H).

Example 169: Synthesis of Compound 428

Synthesis of Intermediate C233

To a solution of methyl 3 -hydroxy-2 -nitrobenzoate (2 g, 10.145 mmol, 1 equiv) in HOAc (40 mL) was added with Br2 (2.4 g, 15.018 mmol, 1.48 equiv) dropwise at 0 °C. The resulting was stirred for 12 h at room temperature. The reaction was quenched with aq. Na ₂ S ₂ O ₃ (50 mL) at room temperature. The resulting mixture was extracted with EA (3 x 50 mL). The combined organic layers were washed with brine (1 x 20 mL), dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (4: 1) to afford methyl 4 -bromo -3 -hydroxy-2 -nitrobenzoate (C ₂ 33, 1 g, 35%) as a solid. LCMS (ES, m/z): 276 [M+H] ⁺

Synthesis of Intermediate C234 C ₂ 33 C ₂ 34

To a stirred solution of methyl 4-bromo-3-hydroxy-2-nitrobenzoate (1 g, 3.623 mmol, 1 equiv) in THF (15 mL) was added a solution of Na ₂ S ₂ O ₄ (3.15 g, 18.115 mmol, 5.0 equiv) in H ₂ O (15 mL) dropwise at room temperature. The resulting mixture was stirred at room temperature for 12 h. The resulting mixture was extracted with EA (3 x 20 mL). The combined organic layers were washed with brine (1x10 mL), dried over anhydrous Na ₂ S ₂ O ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (4: 1) to afford methyl 2-amino-4-bromo-3-hydroxybenzoate (C234, 500 mg, 56%) as a solid. LCMS (ES, m/z): 246 [M+H] ⁺

Synthesis of Intermediate C235

A solution of methyl 2-amino-4-bromo-3-hydroxybenzoate (400 mg, 1.626 mmol, 1 equiv) in toluene (25 mL) was treated with AcCI (153 mg, 1.951 mmol, 1.2 equiv), TEA (197.40 mg, 1.951 mmol, 1.2 equiv) and PPTS (122 mg, 0.488 mmol, 0.3 equiv) for 2 hr at 110 °C under nitrogen atmosphere. The resulting mixture was diluted with H ₂ O (10 mL). The resulting mixture was extracted with EA (2 x 10 mL). The combined organic layers were washed with NaCl (1 x 20 mL), dried over anhydrous Na ₂ S ₂ O ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (4: 1) to afford methyl 7-bromo-2- methyl-l,3-benzoxazole -4-carboxylate (C ₂ 35, 280 mg, 63%) as a solid. LCMS (ES, m/z): 270 [M+H] ⁺ Synthesis of Intermediate C236

To a solution of methyl 7-bromo-2 -methyl- 1, 3 -benzoxazole-4-carboxylate (280 mg, 1.037 mmol, 1 equiv) and tert-butyl piperazine -1 -carboxylate (289 mg, 1.555 mmol, 1.5 equiv) in dioxane (5 mL) were added Cs ₂ CO ₃ (1.01 g, 3.111 mmol, 3.0 equiv), RuPhos (96 mg, 0.207 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (48 mg, 0. 104 mmol, 0.1 equiv). After stirring for 1 hr at 85 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford methyl 7-[4-(tert- butoxycarbonyl)piperazin-l-yl]-2-methyl-l,3-benzoxazole-4-ca rboxylate (C ₂ 36, 200 mg, 51%) as a solid.

LCMS (ES, m/z): 376 [M+H] ⁺

Synthesis of Intermediate C237 C236 C237

A solution of methyl 7-[4-(tert-butoxycarbonyl)piperazin-l-yl] -2-methyl-l,3-benzoxazole-4- carboxylate (250 mg, 0.666 mmol, 1 equiv) in MeOH (1 mL) and THF (1 mL) was treated with a solution of LiOH.H ₂ O (167 mg, 3.996 mmol, 6 equiv) in H ₂ O (1 mL) for 1 hr at room temperature. The mixture was acidified to pH 3 with 1 M HCl. The resulting mixture was extracted with EA (2 x 5 mL). The combined organic layers were washed with brine (1 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford 7-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-methyl- l,3-benzoxazole-4-carboxylic acid (C237, 200 mg, 83%) as a solid. LCMS (ES, m/z): 362 [M+H] ⁺ Synthesis of Intermediate C238 C237 C238

To a stirred solution of 7-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2 -methyl -l,3-benzoxazole-4- carboxylic acid (240 mg, 0.664 mmol, 1 equiv) and HATU (757 mg, 1.992 mmol, 3.0 equiv) in DMF (7 mL) were added DIEA (257 mg, 1.992 mmol, 3.0 equiv) and NH4CI (355.22 mg, 6.640 mmol, 10 equiv) in portions at room temperature. The resulting mixture was stirred for 12 hr at room temperature. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford tert-butyl 4- (4-carbamoyl-2-methyl-l,3-benzoxazol-7-yl) piperazine- 1 -carboxylate (C238, 150 mg, 62%) as a solid. LCMS (ES, m/z): 361 [M+H] ⁺ Synthesis of Intermediate C239 C ₂ 38 C ₂ 39

To a solution of tert-butyl 4-(4-carbamoyl-2-methyl-l,3-benzoxazol-7-yl)piperazine-l-car boxylate (50 mg, 0.139 mmol, 1 equiv) and 6-bromo-8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridine (43 mg, 0.167 mmol, 1.2 equiv) in dioxane (1 mL) were added Cs ₂ CO ₃ (135 mg, 0.417 mmol, 3.0 equiv), XantPhos (16 mg, 0.028 mmol, 0.2 equiv) and Pd2(dba)3*CHCl3 (14 mg, 0.014 mmol, 0.1 equiv). After stirring for 1 h at 80 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (1: 1) to afford tert-butyl 4-[4-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6-yl }carbamoyl)-2 -methyl- l,3-benzoxazol-7-yl]piperazine-l-carboxylate (C239, 70 mg, 93%) as a solid. LCMS (ES, m/z)'. 539 [M+H] ⁺

Synthesis of Compound 428

A solution of tert-butyl 4-[4-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridine -6- yl}carbamoyl)-2-methyl-l,3-benzoxazol-7-yl]piperazine-l-carb oxylate (60 mg, 0.111 mmol, 1 equiv) and TFA (0.3 mL) in DCM (2 mL) was stirred for 1 hr at room temperature. The mixture was basified to pH 8 with NH3 in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford N-{8-fluoro-7- methoxy-2-methylimidazo [ 1 ,2-a]pyridin-6-yl } -2-methyl-7 -(piperazin- 1 -yl)- 1 ,3 -benzoxazole-4- carboxamide (Compound 428, 14 mg, 28%) as a solid. LCMS (ES, m/z). 439 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.32 (s, 1H), 9.43 (s, 1H), 7.92 (d, J= 8.6 Hz, 1H), 7.80 (d, J= 3.1 Hz, 1H), 6.95 (d, J= 8.8 Hz, 1H), 4.20 (d, J= 2.0 Hz, 3H), 3.48-3.39 (m, 4H), 2.90 (t, J= 5.0 Hz, 4H), 2.80 (s, 3H), 2.32 (s, 3H).

Example 170: Synthesis of Compound 429

Synthesis of Intermediate C240 C ₂ 40

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (1 g, 2.402 mmol, 1 equiv) and tert-butyl (R)-2- (hydroxymethyl)piperazine-l -carboxylate (0.57 g, 2.642 mmol, 1.1 equiv) in dioxane (20 mL) were added Cs ₂ CO ₃ (2.35 g, 7.206 mmol, 3.0 equiv), RuPhos Palladacycle Gen.3 (0.4 g, 0.480 mmol, 0.2 equiv) and RuPhos (0.22 g, 0.480 mmol, 0.2 equiv). After stirring for 3 hr at 90 °C under a nitrogen atmosphere. The resulting mixture was diluted with H ₂ O (20 mL). The resulting mixture was extracted with EA (3 x 20 mL). The combined organic layers were washed with NaCl (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl (R)-4-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl)-2-(hydroxymethyl) piperazine-l -carboxylate (C ₂ 40, 500 mg, 37%) as a solid. LCMS (ES, m/z): 552 [M+H]

Synthesis of Intermediate C241 C ₂ 40 429

A solution of tert-butyl (R)-4-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl)carbamoyl)-2H-indazol-4-yl)-2-(hydroxymethyl)piperazine-l -carboxylate (50 mg, 0.091 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was neutralized to pH 8 with ammonia in methanol. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 6) to afford (R)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)- 4-(3-(hydroxymethyl)piperazin-l-yl)-2H-indazole-7-carboxamid e (Compound 429, 10 mg, 24%) as a solid. LCMS (ES, m/z): 452 [M+H] ⁺¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.80 (s, 1H), 7.98 (d, J= 8.1 Hz, 1H), 7.91 (dd, J= 3.2, 1.0 Hz, 1H), 7.31 (dd, J= 12.3, 1.7 Hz, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.73 (s, 1H), 4.60 (q, J= 7.3 Hz, 2H),

3.79 (d, J= 10.5 Hz, 2H), 3.44 (s, 2H), 3.09-2.98 (m, 1H), 2.91 (q, J= 10.3, 9.3 Hz, 3H), 2.77-

2.63 (m, 1H), 2.39-2.32 (m, 3H), 1.62 (t, J= 7.3 Hz, 3H).

Example 171: Synthesis of Compound 430

Synthesis of Intermediate C241 C ₂ 41

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (1 g, 2.402 mmol, 1 equiv) and tert-butyl (S)-2- (hydroxymethyl)piperazine-l -carboxylate (0.57 g, 2.642 mmol, 1.1 equiv) in dioxane (20 mL) were added Cs ₂ CO ₃ (2.35 g, 7.206 mmol, 3.0 equiv), RuPhos Palladacycle Gen.3 (0.4 g, 0.480 mmol, 0.2 equiv) and RuPhos (0.22 g, 0.480 mmol, 0.2 equiv). After stirring for 3 hr at 90 °C under a nitrogen atmosphere. The resulting mixture was diluted with H ₂ O (20 mL). The resulting mixture was extracted with EA (3 x 20 mL). The combined organic layers were washed with NaCl (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl (S)-4-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl)-2-(hydroxymethyl) piperazine-l -carboxylate (500 mg, 37.73%) as a solid. LCMS (ES, m/z): 552 [M+H] Synthesis of Compound 430 C ₂ 41 430

A solution of tert-butyl (S)-4-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl)carbamoyl)-2H-indazol-4-yl)-2-(hydroxymethyl)piperazine-l -carboxylate (50 mg, 0.091 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was neutralized to pH 8 with ammonia in methanol. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 3) to afford (S)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)- 4-(3-(hydroxymethyl)piperazin-l-yl)-2H-indazole-7-carboxamid e (Compound 430, 11 mg, 25%) as a solid. LCMS (ES, m/z): 452 [M+H] ⁺¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.80 (s, 1H), 7.98 (d, J= 8.1 Hz, 1H), 7.91 (dd, J= 3.2, 1.0 Hz, 1H), 7.31 (dd, J= 12.3, 1.7 Hz, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.73 (s, 1H), 4.60 (q, J= 7.3 Hz, 2H), 3.79 (d, J= 10.5 Hz, 2H), 3.44 (s, 2H), 3.09-2.98 (m, 1H), 2.91 (q, J= 10.3, 9.3 Hz, 3H), 2.77-2.63 (m, 1H), 2.39-2.32 (m, 3H), 1.62 (t, J= 7.3 Hz, 3H).

Example 172: Synthesis of Compound 469

Synthesis of Intermediate C242 C ₂ 42

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole- 7-carboxamide (180 mg, 0.43 mmol, 1 equiv) and tert-butyl (R)-methyl(pyrrolidin-3-yl)carbamate (87 mg, 0.43 mmol, 1 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (423 mg, 1.29 mmol, 3 equiv), RuPhos (41 mg, 0.086 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90°C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The resulting mixture was added H ₂ O (20 mL) and extracted with ethyl acetate (3 x 10 mL). The combined organic layers were washed with brine (1 x 30 mL), dried over anhydrous Na ₂ S ₂ O ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl (R)-(l-(2-ethyl-7-((8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl) pyrrolidin-3-yl)(methyl)carbamate (C ₂ 42, 160 mg, 69%) as a solid. LCMS (ES, m/z): 536 [M+H] ⁺

Synthesis of Compound 469 C ₂ 42 469

A solution of tert-butyl tert-butyl (R)-(l-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6 - yl)carbamoyl)-2H-indazol-4-yl)pyrrolidin-3-yl)(methyl)carbam ate (135 mg, 0.25 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NHftg) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 12, Gradient 3) to afford (R)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin- 6-yl)-4-(3-(methylamino)pyrrolidin-l-yl)-2H-indazole-7-carbo xamide (Compound 469, 12 mg, 10%) as a solid. LCMS (ES, mz): 436 [M+H] ⁺ 1H NMR (300 MHz, DMSO-d ₆ ) δ 11.05 (s, 1H), 9.19 (d, J = 1.6 Hz, 1H), 8.84 (s, 1H), 7.97 - 7.85 (m, 2H), 7.26 (dd, J = 12.4, 1.6 Hz, 1H), 6.01 (d, J = 8.4 Hz, 1H), 4.57 (q, J = 7.3 Hz, 2H), 3.76 (dq, J = 13.7, 7.1, 6.3 Hz, 1H), 3.65 (d, J = 7.4 Hz, 3H), 3.42 (dd, J = 10.2, 4.0 Hz, 2H), 2.35 (s, 6H), 2.14 (dd, J = 11.2, 4.5 Hz, 1H), 1.92 (dd, J = 11.8, 6.1 Hz, 1H), 1.61 (t, J = 7.2 Hz, 3H).

Example 173: Synthesis of Compound 437

Synthesis of Intermediate C243

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole- 7-carboxamide (180 mg, 0.43 mmol, 1 equiv) and tert-butyl (S)-methyl(pyrrolidin-3-yl)carbamate (87 mg, 0.43 mmol, 1 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (423 mg, 1.29 mmol, 3 equiv), RuPhos (41 mg, 0.086 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The resulting mixture was added H ₂ O (20 mL) and extracted with ethyl acetate (3 x 10 mL). The combined organic layers were washed with brine (1 x 30 mL), dried over anhydrous Na ₂ S ₂ O ₄ . After fdtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl (S)-(l-(2-ethyl-7-((8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl) pyrrolidin-3-yl)(methyl)carbamate (C ₂ 43, 160 mg, 69%) as a solid. LCMS (ES, m/z): 536 [M+H] ⁺

Synthesis of Compound 437

A solution of tert-butyl tert-butyl (S)-(l-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6 - yl)carbamoyl)-2H-indazol-4-yl)pyrrolidin-3-yl)(methyl)carbam ate (135 mg, 0.25 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH;(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 12, Gradient 3) to afford (S)-2-ethyl-N-(8-fhioro-2-methylimidazo[1,2-a]pyridin- 6-yl)-4-(3-(methylamino)pyrrolidin-l-yl)-2H-indazole-7-carbo xamide (Compound 437, 13 mg, 11%) as a solid. LCMS (ES, mz): 436 [M+H] ⁺ 1H NMR (300 MHz, DMSO-d ₆ ) δ 11.05 (s, 1H), 9.19 (d, J = 1.6 Hz, 1H), 8.84 (s, 1H), 7.97 - 7.85 (m, 2H), 7.26 (dd, J = 12.4, 1.6 Hz, 1H), 6.01 (d, J = 8.4 Hz, 1H), 4.57 (q, J = 7.3 Hz, 2H), 3.76 (dq, J = 13.7, 7.1, 6.3 Hz, 1H), 3.65 (d, J = 7.4 Hz, 3H), 3.42 (dd, J = 10.2, 4.0 Hz, 2H), 2.35 (s, 6H), 2.14 (dd, J = 11.2, 4.5 Hz, 1H), 1.92 (dd, J = 11.8, 6.1 Hz, 1H), 1.61 (t, J = 7.2 Hz, 3H).

Example 174: Synthesis of Compounds 438 and 439

Synthesis of Compound 439

Compound 367 was separated by prep-chiral -HPLC (Condition 6, Gradient 1) to afford (S)- N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(2-methoxy propyl)-4-(piperazin-l-yl)-2H- indazole-7-carboxamide (Compound 438, 1.7 mg) as a solid. LCMS (ES, m/z): 466 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 9.10 (d, J = 1.7 Hz, 1H), 8.52 (s, 1H), 8.11 (d, J = 8.0 Hz, 1H), 7.73 (d, J= 3.0 Hz, 1H), 7.26 (dd, J= 11.8, 1.7 Hz, 1H), 6.55 (d, J= 8.2 Hz, 1H), 4.72-4.33 (m, 2H), 4.02 (qd, J= 6.5, 3.7 Hz, 1H), 3.46 (dd, J= 6.3, 3.7 Hz, 4H), 3.33 (p, J= 1.6 Hz, 3H), 3.08 (dd, J= 6.1, 3.6 Hz, 4H), 2.44 (s, 3H), 1.29 (d, J= 6.3 Hz, 3H).

Synthesis of Compound 438

Compound 367 (17 mg) was separated by prep-chiral -HPLC (Condition 6, Gradient 1) to afford (R)-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2-(2-met hoxypropyl)-4-(piperazin- l-yl)-2H-indazole-7-carboxamide (Compound 438, 1.2 mg) as a solid. LCMS (ES, m/z): 466 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 9.10 (d, J= 1.7 Hz, 1H), 8.52 (s, 1H), 8.11 (d, J= 8.0 Hz, 1H), 7.73 (d, J = 3.0 Hz, 1H), 7.26 (dd, J= 11.8, 1.7 Hz, 1H), 6.55 (d, J= 8.2 Hz, 1H), 4.72-4.33 (m, 2H), 4.02 (qd, J= 6.5, 3.7 Hz, 1H), 3.46 (dd, J= 6.3, 3.7 Hz, 4H), 3.33 (p, J= 1.6 Hz, 3H), 3.08 (dd, J= 6.1, 3.6 Hz, 4H), 2.44 (s, 3H), 1.29 (d, J= 6.3 Hz, 3H).

Example 175: Synthesis of Compound 443

Synthesis of Intermediate C244

To a solution of methyl 4-bromo-2-methylindazole-7-carboxylate (300.0 mg, 1.115 mmol, 1.0 equiv) and tert-butyl N-ethyl-N-(piperidin-4-yl) carbamate (305.4 mg, 1.338 mmol, 1.2 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (910.9 mg, 2.788 mmol, 2.5 equiv) and Ruphos (104.0 mg, 0.223 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (93.2 mg, 0.112 mmol, 0.1 equiv). After stirring for 3 h at 80°C under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (20: 1) to afford methyl 4-{4-[(tert- butoxycarbonyl) (ethyl)amino] piperidin-l-yl}-2-methylindazole-7-carboxylate (C ₂ 44, 320 mg, 63%) as a solid. LCMS (ES, m/z): 417 [M+H] ⁺ Synthesis of Intermediate C245

To a solution of methyl 4-{4-[(tert-butoxycarbonyl) (ethyl)amino] piperidin-l-yl}-2- methylindazole-7- carboxylate (300.0 mg, 0.720 mmol, 1.0 equiv) was added NH3(g) in MeOH (50 mL) in a pressure tank. The resulting mixture was stirred for 2 days at 100 °C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (30: 1) to afford tert-butyl N-[l-(7-carbamoyl-2- methylindazol-4-yl) piperidin-4-yl]-N-ethylcarbamate (C ₂ 45, 280 mg, 87%) as a solid.

LCMS (ES, m/zy. 402 [M+H] ⁺

Synthesis of Intermediate C246

To a solution of tert-butyl N-[l-(7-carbamoyl-2-methylindazol-4-yl) piperidin-4-yl]-N- ethylcarbamate (130.0 mg, 0.324 mmol, 1.0 equiv) and 6-bromo-4-fluoro-2-methyl-l,3- benzothiazole (95.6 mg, 0.389 mmol, 1.2 equiv) in dioxane (4 mL) were added Cs ₂ CO ₃ (264.5 mg, 0.810 mmol, 2.5 equiv) and Xantphos (37.4 mg, 0.065 mmol, 0.2 equiv), Pd2(dba)3 (29.6 mg, 0.032 mmol, 0.1 equiv). After stirring for 2 hr at 100°C under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (30: 1) to afford tert-butyl N-ethyl-N- (l-{7-[(4-fluoro-2-methyl-l,3-benzothiazol-6-yl) carbamoyl]-2-methylindazol-4- yl } piperidin- 4-yl)carbamate (C ₂ 46, 100.0 mg, 54%) as a solid. LCMS (ES, m z): 567 [M+H] ⁺ Synthesis of Compound 443

To a stirred solution of tert-butyl N-ethyl-N-(l-{7-[(4-fluoro-2-methyl-l,3-benzothiazol-6- yl)carbamoyl]-2-methylindazol-4-yl}piperidin-4-yl)carbamate (110.0 mg, 0.194 mmol, 1.0 equiv) in DCM (2 mL) was added TFA (0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 hr at room temperature under nitrogen atmosphere. The reaction was monitored by LCMS. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-[4-(ethylamino) piperidin-l-yl]-N- (4-fluoro-2-methyl-l,3-benzothiazol-6-yl)-2- methylindazole-7-carboxamide (Compound 443, 27 mg, 29%) as a solid. LCMS (ES, m/z): 467 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.43 (s, 1H), 8.78 (s, 1H), 8.30 (d, J= 1.9 Hz, 1H), 7.99 (d, J = 8.2 Hz, 1H), 7.89 (dd, J= 12.9, 1.9 Hz, 1H), 6.50 (d, J= 8.3 Hz, 1H), 4.31 (s, 3H), 3.91 (d, J= 12.9 Hz, 2H), 3.07 (t, J= 11.4 Hz, 2H), 2.81 (s, 3H), 2.73-2.72 (m, 1H), 2.63 (t, J= 7.1 Hz, 2H), 1.97 (d, J= 12.4 Hz, 2H), 1.46 (q, J= 11.0 Hz, 2H), 1.05 (t, J= 1A Hz, 3H).

Example 176: Synthesis of Compound 444

Synthesis of Intermediate C247 C ₂ 47

To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl) piperazine- 1 -carboxylate (300 mg, 0.835 mmol, 1 equiv) and 6-bromo-2-methylimidazo[1,2-a]pyridine-7-carbonitrile (197.04 mg, 0.835 mmol, 1 equiv) in dioxane (5 mL) were added Cs ₂ CO ₃ (815.84 mg, 2.505 mmol, 3 equiv), Pd2(dba)3 (76.43 mg, 0.084 mmol, 0.1 equiv) and XantPhos (48.30 mg, 0.084 mmol, 0.1 equiv). After stirring for 2 hr at 100 °C under a nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (1 : 1-1 : 10) to afford tert-butyl 4-[7-({7-cyano-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (C ₂ 47, 400 mg, 93%) as a solid. ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.47 (s, 1H), 9.66 (s, 1H), 8.85 (s, 1H), 8.29 (s, 1H), 8.06 - 7.96 (m, 2H), 6.52 (d, J = 8.2 Hz, 1H), 4.26 (s, 3H), 3.57 (d, J = 5.7 Hz, 5H), 3.48 (d, J = 5.7 Hz, 3H), 2.40 (s, 3H), 1.45 (s, 9H).

Synthesis of Compound 444 A solution of tert-butyl 4-[7-({7-cyano-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) -2- methylindazol-4-yl]piperazine-l -carboxylate (80 mg, 0.155 mmol, 1 equiv) in DCM (4 mL) was added TFA (1 mL) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 4) to afford N-{7-cyano-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-l-yl )indazole-7-carboxamide (Compound 444, 4 mg, 6%) as a solid. LCMS (ES, m/z): 515 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 11.48 (s, 1H), 9.67 (s, 1H), 8.82 (s, 1H), 8.29 (s, 1H), 8.08 - 7.97 (m, 2H), 6.51 (d, J = 8.2 Hz, 1H), 4.25 (s, 3H), 3.39 (t, J = 5.0 Hz, 4H), 2.91 (t, J = 5.0 Hz, 4H), 2.40 (s, 3H).

Example 177: Synthesis of Compound 445

Synthesis of Intermediate C248

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (300.0 mg, 0.608 mmol, 1.0 equiv) and Cs ₂ CO ₃ (396.1 mg, 1.216 mmol, 2.0 equiv) in DMF (6 mL) was added propylene oxide (52.9 mg, 0.912 mmol, 1.5 equiv) dropwise at room temperature. The resulting mixture was stirred for 16 h at 80 °C. The resulting mixture was diluted with water (20 mL). The resulting mixture was extracted with ethyl acetate (2 x 20 mL). The combined organic layers were washed with water (2 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :9) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- (2-hydroxypropyl)indazol-4-yl]piperazine-l -carboxylate (C248, 200 mg, 59%) as a solid. LCMS (ES, m/z): 552 [M+H] ⁺

Synthesis of Intermediate C249 C ₂ 48 C ₂ 49

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-(2-hydroxypropyl)indazol-4-yl]piperazine-l -carboxylate (210.0 mg, 0.381 mmol, 1.0 equiv) and Et3N (77.0 mg, 0.762 mmol, 2.0 equiv) in DCM (4 mL) was added MsCI (52.3 mg, 0.457 mmol, 1.2 equiv) dropwise at 0 °C. The resulting mixture was stirred for 1 hr at 0 °C. The resulting mixture was washed with 1 x 4 mL of water. The organic layer was dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure.

The resulting mixture was concentrated under vacuum to afford tert-butyl 4-[7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2-[2-(methanesulfonyloxy)propyl]indazol-4- yl]piperazine-l -carboxylate (C ₂ 49, 200 mg, 83%) as a solid. LCMS (ES, m/z): 630 [M+H] ⁺ Synthesis of Intermediate C250

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-[2-(methanesulfonyloxy)propyl]indazol-4-yl]p iperazine-l-carboxylate (210.0 mg, 0.333 mmol, 1.0 equiv) in THF (2 mL) was added t-BuOK (74.8 mg, 0.666 mmol, 2.0 equiv) at room temperature. The resulting mixture was stirred for 16 hr at room temperature. The resulting mixture was diluted with water (4 mL). The resulting mixture was extracted with ethyl acetate (2 x 4 mL). The combined organic layers were washed with water (1 x 4 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :9) to afford tert-butyl 4-[7-({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)-2-[( lE)-prop- 1 -en- 1 - yl]indazol-4-yl]piperazine-l -carboxylate (C ₂ 50, 130 mg, 73%) as a solid. LCMS (ES, m/z): 534 [M+H] ⁺

Synthesis of Compound 445

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-[(lE)-prop-l-en-l-yl]indazol-4-yl]piperazine -l-carboxylate (80.0 mg, 0.150 mmol, 1.0 equiv) in DCM (2 mL) was added ZnBn (337.6 mg, 1.500 mmol, 10.0 equiv) at room temperature. The resulting mixture was stirred for 16 hr at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 9) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4- (piperazin-l-yl)-2-[(lE)-prop-l-en-l-yl]indazole-7-carboxami de (Compound 445, 18 mg, 27%) as a solid.

LCMS (ES, m/z): 434 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 10.91 (s, 1H), 9.25-9.15 (m, 1H), 8.98 (s, 1H), 8.01 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.47 (dd, J= 14.1, 1.9 Hz, 1H), 7.38-7.29 (m, 1H), 6.78 (dq, J= 14.0, 6.9 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 3.37 (t, J= 5.1 Hz, 4H), 2.92 (t, J= 5.0 Hz, 4H), 2.36 (s, 3H), 1.96 (dd, J= 7.0, 1.8 Hz, 3H).

Example 178: synthesis of Compound 446 and 447

Synthesis of Intermediate C251

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (100 mg, 0.249 mmol, 1 equiv) and tert-butyl (3S)-3- methylpiperazine- 1 -carboxylate (59.75 mg, 0.299 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (243.01 mg, 0.747 mmol, 3 equiv), RuPhos (23.20 mg, 0.050 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (20.79 mg, 0.025 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 hr at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (10: 1) to afford tertbutyl (3S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carb amoyl)-2-methylindazol-4- yl]-3-methylpiperazine-l-carboxylate (C251, 70 mg, 53%) as solid. LCMS (ES, m/z): 522 [M+H] ⁺

Synthesis of Compound 446 C ₂ 51 446

To a stirred solution of tert-butyl (3S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]-3-methylpiperazine-l-car boxylate (70 mg, 0.134 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford N- {8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[(2 S)-2-methylpiperazin-l- yl]indazole-7-carboxamide (Compound 44614.9 mg, 26%) as solid. LCMS (ES, m/z): 422 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 9.11 (d, J= 1.6 Hz, 1H), 8.55 (s, 1H), 8.11 (d, J= 8.1 Hz, 1H), 7.74 (d, J= 3.0 Hz, 1H), 7.33 - 7.25 (m, 1H), 6.57 (d, J= 8.2 Hz, 1H), 4.34 (s, 3H), 4.28 (dd, J= 6.8, 3.4 Hz, 1H), 3.49 - 3.37 (m, 2H), 3.25 (dd, J= 12.8, 3.9 Hz, 1H), 3.16 (d, J= 12.9 Hz, 1H), 3.03 - 2.90 (m, 2H), 2.45 (d, J= 0.9 Hz, 3H), 1.20 (d, J= 6.7 Hz, 3H).

Synthesis of Intermediate C252 , C ₂ 52

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (100 mg, 0.249 mmol, 1 equiv) and tert-butyl (3R)-3- m ethylpiperazine- 1 -carboxylate (59.75 mg, 0.299 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (243.01 mg, 0.747 mmol, 3 equiv), RuPhos (23.20 mg, 0.050 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (20.79 mg, 0.025 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 hr at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (10: 1) to afford tertbutyl (3R)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carb amoyl)-2-methylindazol-4- yl]-3-methylpiperazine-l-carboxylate (C252, 80 mg, 61%) as solid. LCMS (ES, m/z): 522 [M+H] ⁺

Synthesis of Compound 447 C ₂ 52 447

To a stirred solution of tert-butyl (3R)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]-3-methylpiperazine-l-car boxylate (80 mg, 0.153 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford N- { 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-methyl-4-[(2R)-2-methylpiperazin- 1 - yl]indazole-7-carboxamide (Compound 447, 21.6 mg, 33%) as solid. LCMS (ES, m/z): 422 [M+H] ⁺

' H NMR (400 MHz, Methanol-d ₄ ) δ 9.12 - 9.05 (m, 1H), 8.52 (d, J= 4.8 Hz, 1H), 8.09 (dd, J=

8.2, 3.1 Hz, 1H), 7.72 (s, 1H), 7.30 - 7.21 (m, 1H), 6.55 (dd, J= 8.1, 3.8 Hz, 1H), 4.33 (d, J=

2.1 Hz, 3H), 4.26 (s, 1H), 3.43 (q, J= 14.7, 13.4 Hz, 2H), 3.28 - 3.19 (m, 1H), 3.15 (d, J= 12.6

Hz, 1H), 3.03 - 2.89 (m, 2H), 2.46 - 2.41 (m, 3H), 1.19 (d, J= 6.7 Hz, 3H).

Example 179: synthesis of Compound 455

Synthesis of Intermediate C253 C ₂ 53

To a stirred solution of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4- formylindazole-7-carboxamide (70 mg, 0.192 mmol, 1 equiv) and tert-butyl N-(l,3- dihydroxypropan-2-yl)carbamate (73 mg, 0.384 mmol, 2.0 equiv) in DCM (3.5 mL) and THF (0.3 mL) were added p-TsOH (50 mg, 0.288 mmol, 1.5 equiv) and Na ₂ SO ₄ (41 mg, 0.288 mmol, 1.5 equiv) in portions at room temperature. The resulting mixture was stirred for 12 hr at room temperature. The resulting mixture was diluted with H ₂ O (5 mL). The resulting mixture was extracted with EA (3 x 5 mL). The combined organic layers were washed with brine (1 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford tert-butyl N-{2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-l,3-dioxan-5-yl}carbamate (C ₂ 53, 30 mg, 29%) as a solid. LCMS (ES, m/z): 539 [M+H] ⁺ Synthesis of Compound 455

A solution of tert-butyl N-{2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-l,3-dioxan-5-yl}carbamate (30 mg, 0.056 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3 in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 4-(5- amino-l,3-dioxan-2-yl)-2-ethyl-N-{8-fluoro-2-methylimidazo[1 ,2-a]pyridin-6-yl}indazole-7- carboxamide (Compound 445, 10 mg, 40%) as a solid. LCMS (ES, m/z) 439 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.22 (d, J= 3.6 Hz, 1H), 9.25 (d, J= 1.7 Hz, 1H), 8.81 (s, 1H), 8.08 (dd, J= 13, 4.0 Hz, 1H), 7.95 (d, J= 3.2 Hz, 1H), 7.41-7.28 (m, 2H), 5.87 (s, 1H), 4.76-4.62 (m, 2H), 4.18 (t, J= 9.7 Hz, 2H), 3.93 (d, J= 11.1 Hz, 2H), 3.51 (t, J= 10.6 Hz, 1H), 2.77 (s, 1H), 2.36 (s, 3H), 1.69-1.58 (m, 3H).

Example 180: Synthesis of Compound 460

Synthesis of Intermediate C254

To a stirred mixture of 4-bromo-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6 - yl}-2-methylindazole-7-carboxamide (100 mg, 0.238 mmol, 1 equiv) and tert-butyl N-ethyl-N- (piperidin-4-yl)carbamate (54.34 mg, 0.238 mmol, 1 equiv), Cs ₂ CO ₃ (227.19 mg, 0.696 mmol, 3 equiv) in 1,4-dioxane (2 mL) was added Ruphos (11.10 mg, 0.024 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (19.90 mg, 0.024 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (20: 1) to afford tert-butyl N-ethyl-N-{ 1- [6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}ca rbamoyl)-2-methylindazol-4- yl]piperidin-4-yl} carbamate (C254, 80 mg, 59%) as a solid. LCMS (ES, m z) \ 568 [M+H] ⁺

Synthesis of Compound 460

To a stirred solution of tert-butyl N-ethyl-N-{ l-[6-fluoro-7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2-methylindazol-4-yl]piperidin-4-yl} carbamate (70 mg, 0.123 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by Prep-HPLC (Condition 15, Gradient 2) to afford 4-[4-(ethylamino)piperidin-l-yl]-6-fluoro-N-{8-fluoro-2-meth ylimidazo[1,2-a]pyridin- 6-yl}-2-methylindazole-7-carboxamide; bis(trifluoroacetic acid) (Compound 460, 22.9 mg, 26%) as solid. LCMS (ES, m/z): 468 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 9.41 (s, 1H), 8.59 (s, 1H), 8.02 (s, 1H), 7.82 (t, J= 9.5 Hz, 1H), 6.37 (d, J= 15.4 Hz, 1H), 4.30 (s, 3H), 4.17 (d, J= 13.2 Hz, 2H), 3.50 - 3.39 (m, 1H), 3.24 - 3.11 (m, 4H), 2.56 (s, 3H), 2.28 (d, J= 12.2 Hz, 2H), 1.84 (tt, J= 12.6, 6.4 Hz, 2H), 1.42 - 1.28 (m, 3H).

Example 181: Synthesis of Compound 440

Synthesis of Intermediate C255 C ₂ 55 To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine- 1-carboxylate (800.0 mg, 1.621 mmol, 1.0 equiv) and methyl 2-bromopropanoate (406.0 mg, 2.431 mmol, 1.5 equiv) in DMF (20 mL) was added Cs ₂ CO ₃ (1056.2 mg, 3.242 mmol, 2.0 equiv) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was diluted with water (60 mL). The resulting mixture was extracted with ethyl acetate (3 x 50mL). The combined organic layers were washed with water (3 x 50 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl } carbarnoyl)-2-( 1 -methoxy- 1 -oxopropan-2-yl)indazol-4-yl]piperazine- 1 - carboxylate (C255, 520 mg, 55%) as a solid. LCMS (ES, m/z): 580 [M+H] ⁺

Synthesis of Intermediate C256 C ₂ 56

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl } carbarnoyl)-2-(l -methoxy- 1 -oxopropan-2-yl)indazol-4-yl]piperazine- 1 -carboxylate (520.0 mg, 0.897 mmol, 1.0 equiv) in THF (10 mL) was added LiBH ₄ (58.6 mg, 2.691 mmol, 3.0 equiv) at 0 °C under nitrogen atmosphere. The resulting mixture was stirred for 1 hr at 0 °C under nitrogen atmosphere. The reaction was quenched with water/ice at 0 °C. The resulting mixture was extracted with ethyl acetate (2 x 20 mL). The combined organic layers were washed with water (1 x 30 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :9) to afford tert-butyl 4-[7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2-(l-hydroxypropan-2-yl)indazol-4-yl]piperazine- 1-carboxylate (C256, 420 mg, 84%) as a solid. LCMS (ES, m z): 552 [M+H] ⁺ Synthesis of Intermediate C257 C ₂ 56 C ₂ 57

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-(l-hydroxypropan-2-yl)indazol-4-yl]piperazin e-l-carboxylate (420.0 mg, 0.761 mmol, 1.0 equiv) and Et3N (231.1 mg, 2.283 mmol, 3.0 equiv) in DCM (8 mL) was added MsCl (104.6 mg, 0.913 mmol, 1.2 equiv) dropwise at 0 °C under nitrogen atmosphere. The resulting mixture was stirred for 1 hr at 0 °C under nitrogen atmosphere. The reaction was quenched with water/ice at 0 °C. The resulting mixture was extracted with CH ₂ Q2 (2xl0mL). The combined organic layers were washed with water (1 x 20mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :9) to afford tert-butyl 4-[7-({8-fluoro-2- methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)-2-[ 1 -(methanesulfonyloxy)propan-2-yl]indazol-4- yl]piperazine-l -carboxylate (C257, 450 mg, 93%) as a solid. LCMS (ES, m/z): 630 [M+H] ⁺

Synthesis of Intermediate C258

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-[l-(methanesulfonyloxy)propan-2-yl]indazol-4 -yl]piperazine-l-carboxylate (450.0 mg, 0.715 mmol, 1.0 equiv) in THF (9 mL) was added tert-butoxypotassium (160.4 mg, 1.430 mmol, 2.0 equiv) at room temperature. The resulting mixture was stirred for 16 h at room temperature. The resulting mixture was diluted with water (20 mL). The resulting mixture was extracted with ethyl acetate (2 x 20mL). The combined organic layers were washed with water (1x40 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :9) to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- (prop-l-en-2-yl)indazol-4-yl]piperazine-l -carboxylate (C258, 210 mg, 55%) as a solid. LCMS (ES, m/z): 534 [M+H] ⁺

Synthesis of Compound 440

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-(prop-l-en-2-yl)indazol-4-yl]piperazine-l -carboxylate (100 mg, 0.187 mmol, 1.0 equiv) in DCM (2 mL) was added ZnBn (422.1 mg, 1.870 mmol, 10.0 equiv) at room temperature. The resulting mixture was stirred for 16 hr at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 9) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4- (piperazin-l-yl)-2-(prop-l-en-2-yl)indazole- 7-carboxamide (Compound 440, 6 mg, 7%) as a solid. LCMS (ES, m/z): 434 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 10.93 (s, 1H), 9.20 (d, J = 1.6 Hz, 1H), 8.99 (s, 1H), 8.03 (d, J= 8.1 Hz, 1H), 7.97-7.83 (m, 1H), 7.20 (dd, J= 12.2, 1.7 Hz, 1H), 6.52 (d, J= 8.2 Hz, 1H), 6.01 (s, 1H), 5.23 (s, 1H), 3.39 (t, J= 5.0 Hz, 4H), 2.93 (t, J= 4.9 Hz, 4H), 2.54 (s, 3H), 2.35 (s, 3H).

Example 182: Synthesis of Compound 450

Synthesis of Intermediate C259 To a solution of methyl 4-bromo-2-ethylindazole-7-carboxylate (1 g, 3.532 mmol, 1 equiv) and 1 -methylpiperazine (0.42 g, 4.238 mmol, 1.2 equiv) in dioxane (20 mL) were added Cs ₂ CO ₃ (3.45 g, 10.596 mmol, 3.0 equiv), RuPhos (0.16 g, 0.353 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (0.3 g, 0.353 mmol, 0.1 equiv). After stirring for 1 hr at 90 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford methyl 2-ethyl-4-(4-methylpiperazin-l-yl)indazole-7-carboxylate (C ₂ 59, 1 g, 93%) as a solid. LCMS (ES, m/z): 303 [M+H] ⁺

Synthesis of Intermediate C260

A solution of methyl 2-ethyl-4-(4-methylpiperazin-l-yl)indazole-7-carboxylate (200 mg, 0.661 mmol, 1 equiv) in 7 N NH3(g) in MeOH (40 mL) was stirred for 3 days at 100 °C. The resulting mixture was concentrated under reduced pressure. The crude product was used in the next step directly without further purification. LCMS (ES, m/z): 288 [M+H] ⁺

Synthesis of Intermediate C261

To a solution of 2-ethyl-4-(4-methylpiperazin-l-yl)indazole-7-carboxamide (200 mg, 0.696 mmol, 1 equiv) and (6-bromo-4-fluoro-l,3-benzoxazol-2-yl)methyl acetate (240 mg, 0.833 mmol, 1.20 equiv) in dioxane (6 mL) were added Cs ₂ CO ₃ (680 mg, 2.088 mmol, 3.0 equiv), XantPhos (81 mg, 0.139 mmol, 0.2 equiv) and Pd2(dba)3 (64 mg, 0.070 mmol, 0.1 equiv). After stirring for 2 h at 80 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford{6-[2-ethyl-4-(4-methylpiperazin-l-yl)indazole-7-amido ]-4-fluoro-l,3- benzoxazol -2 -yl (methyl acetate (C ₂ 61, 100 mg, 29%) as a solid. LCMS (ES, m/z): 495 [M+H] ⁺

Synthesis of Compound 450

A solution of {6-[2-ethyl-4-(4-methylpiperazin-l-yl)indazole-7-amido]-4-fl uoro-l,3- benzoxazol -2 -yl (methyl acetate (100 mg, 0.202 mmol, 1 equiv) and K ₂ CO ₃ (167 mg, 1.212 mmol, 6.0 equiv) in methanol (3 mL) was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford 2-ethyl-N-[4-fluoro-2-(hydroxymethyl)-l,3- benzoxazol-6-yl]-4-(4-methylpiperazin-l-yl)indazole-7-carbox amide (Compound 450, 24.8 mg, 27%) as a solid. LCMS (ES, m/z): 453 [M+H] ⁺¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.53 (s, 1H), 8.85 (s, 1H), 8.18 (d, J= 1.6 Hz, 1H), 8.01 (d, J= 8.1 Hz, 1H), 7.65 (dd, J= 12.1, 1.7 Hz, 1H), 6.52 (d, J= 8.2 Hz, 1H), 5.93 (s, 1H), 4.72 (s, 2H), 4.61 (q, J= 7.2 Hz, 2H), 3.45 (t, J= 4.9 Hz, 4H), 2.55 (d, J= 4.9 Hz, 4H), 2.28 (s, 3H), 1.63 (t, J= 7.3 Hz, 3H).

Example 183: Synthesis of Compound 451

Synthesis of Intermediate C262 C ₂ 62

A solution of 5-bromo-4-methoxypyrimidin-2-amine (20 g, 98.026 mmol, 1 equiv) in isopropanol (480 mL) was treated with l-bromo-2,2-dimethoxypropane (26.91 g, 147.039 mmol, 1.5 equiv) and PPTS (2.46 g, 9.803 mmol, 0.1 equiv) for 48 hours at 80 °C. The precipitated solids were collected by filtration and washed with isopropanol (50 mL). To afford 6-bromo-2- methyl-8H-imidazo[1,2-a]pyrimidin-7-one (17.5 g, 69.32%) as a solid. LCMS (ES, m/z): 228 [M+H] ⁺

Synthesis of Intermediate C263 C ₂ 62 C ₂ 63

A solution of 6-bromo-2-methyl-8H-imidazo[1,2-a]pyrimidin-7-one (2 g, 8.770 mmol, 1 equiv) in MeCN (40 mL) was treated with K ₂ CO ₃ (3.64 g, 26.310 mmol, 3 equiv), CH ₃ I (1.87 g, 13.155 mmol, 1.5 equiv) for 8 hours at 50 °C. The resulting mixture was diluted with MeOH (100 mL). The residue was purified by silica gel column chromatography, eluted with DCM:MeOH (20/1) to afford 6-bromo-2,8-dimethylimidazo[1,2-a]pyrimidin-7-one (C ₂ 63, 800 mg, 37%) as a solid. LCMS (ES, m/z): 242 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 8.67 (d, J = 9.3 Hz, 1H), 7.10 (dd, J = 10.7, 1.4 Hz, 1H), 4.95 (s, 1H), 3.37 (d, J = 14.2 Hz, 13H), 2.29 - 2.21 (m, 3H), 2.10 (d, J = 1.3 Hz, 1H) Synthesis of Intermediate C264

A solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (445 mg, 1.239 mmol, 1 equiv) in toluene (10 mL) as treated with 6-bromo-2,8-dimethylimidazo[1,2- a]pyrimidin-7-one (300 mg, 1.239 mmol, 1.00 equiv), methyl[2-(methylamino)ethyl]amine (218 mg, 2.478 mmol, 2 equiv), Cu (78 mg, 1.239 mmol, 1 equiv), K ₂ CO ₃ (342 mg, 2.478 mmol, 2 equiv) for 8 hours at 100°C under nitrogen atmosphere. The resulting mixture was filtered and the filter cake was washed with MeOH (100 mL). The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with MeOH/DCM (1/10) to afford tert-butyl 4-[7-({2,8-dimethyl-7-oxoimidazo[1,2-a]pyrimidin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (100 mg, 15%) as a solid. LCMS (ES, m/z): 521 [M+H] ⁺

A solution of tert-butyl 4-[7-({2,8-dimethyl-7-oxoimidazo[1,2-a]pyrimidin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (100 mg, 0.192 mmol, 1 equiv) in DCM (20 mL) was treated with TFA (2 mL) for 1 hour at 20 °C. The residue was purified by reverse flash chromatography (Condition 2, Gradient 1) to afford N-{2,8-dimethyl-7- oxoimidazof 1 ,2-a]pyrimidin-6-yl } -2-methyl-4-(piperazin- 1 -yl)indazole-7-carboxamide (Compound 451, 10 mg, 12%) as a solid. LCMS (ES, m/z): 421 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.47 (s, 1H), 9.25 (s, 1H), 8.75 (s, 1H), 7.97 (d, J = 8.1 Hz, 1H), 7.31 (d, J = 1.5 Hz, 1H), 6.47 (d, J = 8.2 Hz, 1H), 4.24 (s, 3H), 3.46 (s, 3H), 3.35 (s, 15H), 2.92 (d, J = 6.0 Hz, 3H), 2.26 (d, J = 1.3 Hz, 3H)

453

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv) and 2-(fluoromethyl)piperazine (125 mg, 1.056 mmol, 2.2 equiv) in dioxane (5 mL) were added Cs ₂ CO ₃ (469.64 mg, 1.440 mmol, 3.0 equiv), RuPhos (45 mg, 0.096 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (41 mg, 0.048 mmol, 0.1 equiv). After stirring for 3 hr at 90 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography(condition 6, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}-4-[3-(fluoromethyl)piperazin-l-yl]indazole-7 -carboxamide (Compound 453, 54 mg, 24%) as a solid. LCMS (ES, m/z): 454 [M+H] ⁺¹ H NMR (300 MHz) 9.15 (d, J= 13.9 Hz, 2H), 8.55 (d, J= 8.4 Hz, 1H), 8.06 (d, J= 10.0 Hz, 1H), 7.97 (s, 1H), 7.13 (d, J= 8.5 Hz, 1H), 5.01-4.99 (m, 4H), 4.31 (d, J= 12.7 Hz, 3H), 4.03-3.87(m, 4H), 2.75 (d, J= 1.1 Hz, 3H), 1.92 (t, J= 7.2 Hz, 3H).

Example 185: Synthesis of Compound 454

Synthesis of Intermediate C265 C ₂ 65

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (500 mg, 1.201 mmol, 1 equiv) and potassium ethenyltrifluoroboranuide (193 mg, 1.441 mmol, 1.2 equiv) in dioxane (8 mL) and H ₂ O (2 mL) were added K ₂ CO ₃ (498 mg, 3.603 mmol, 3.0 equiv) and Pd(dtbpf)Cl ₂ (78 mg, 0.120 mmol, 0.1 equiv) . After stirring for 1 hr at 80 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford 4-ethenyl-2-ethyl-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (C ₂ 65, 400 mg, 91%) as a solid. LCMS (ES, m/z): 364 [M+H] ⁺ Synthesis of Intermediate C266 C ₂ 65 C ₂ 66 To a solution of 4-ethenyl-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin- 6- yl}indazole-7-carboxamide (200 mg, 0.550 mmol, 1 equiv) and NalO ₄ (235.4 mg, 1.100 mmol, 2.0 equiv) in dioxane (6 mL) and H ₂ O (2 mL) were added K ₂ O _S O ₄ .2H ₂ O (20.3 mg, 0.055 mmol, 0.1 equiv). After stirring for 1 hr at room temperature under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (4: 1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}-4-formylindazole-7-carboxamide (C ₂ 66, 40 mg, 19%) as a solid. LCMS (ES, m/zy 366 [M+H] ⁺

Synthesis of Intermediate C267

C266 C267

To a stirred solution of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4- formylindazole-7-carboxamide (40 mg, 0.109 mmol, 1 equiv) and tert-butyl N-(l,3-dihydroxy-2- methylpropan-2-yl)carbamate (80 mg, 0.390 mmol, 3.56 equiv) in DCM (2 mL) and THF (0.2 mL) were added p-TsOH (56 mg, 0.325 mmol, 2.97 equiv) and Na ₂ SO ₄ (80 mg, 0.563 mmol, 5.14 equiv) in portions at room temperature. The resulting mixture was stirred for 12 h at room temperature. The resulting mixture was diluted with H ₂ O (5 mL). The resulting mixture was extracted with EA (3 x 5 mL). The combined organic layers were washed with brine (1 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The crude product was used in the next step directly without further purification.

LCMS (ES, m/z): 553 [M+H] ⁺

Synthesis of Compound 454 C ₂ 67 454 A solution of tert-butyl N-{2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-5-methyl-l,3-dioxan-5-yl}carbamat e (20 mg, 0.036 mmol, 1 equiv) and TFA (0.2 mL) in DCM (3 mL) was stirred for 1 hr at room temperature. The mixture was basified to pH 8 with NH3 in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 6, Gradient 1) to afford 4-(5-amino-5-methyl-l,3-dioxan-2-yl)-2-ethyl-N-{8-fluoro-2-m ethylimidazo[1,2- a]pyridin-6-yl}indazole-7-carboxamide (Compound 454, 5 mg, 30%) as a solid. LCMS (ES, m/z): 453 [M+H] ^{+ 1} H NMR (300 MHz, Methanol-d ₄ ) δ 9.14 (d, J= 1.7 Hz, 1H), 8.58 (s, 1H), 8.17 (d, J= 7.4 Hz, 1H), 7.73 (dd, J= 3.1, 1.0 Hz, 1H), 7.39 (dd, J= 7.4, 0.8 Hz, 1H), 7.23 (dd, J = 11.7, 1.7 Hz, 1H), 5.81 (s, 1H), 4.68 (q, J= 7.3 Hz, 2H), 4.00 (d, J= 11.0 Hz, 2H), 3.90 (d, J= 10.9 Hz, 2H), 2.44 (d, J= 0.9 Hz, 3H), 1.73 (t, J= 7.3 Hz, 3H), 1.05 (s, 3H).

Example 186: Synthesis of Compounds 456 and 484

Synthesis of Intermediate C268 C ₂ 68

A solution of 2-fluoro-4-methoxy-l -methylbenzene (10 g, 71.349 mmol, 1 equiv) and NBS (13.3 g, 74.916 mmol, 1.05 equiv) in MeCN (200 mL) was stirred for 4 h at room temperature. The reaction was quenched with water (200 mL) at room temperature. The resulting mixture was extracted with ethyl acetate (3 x 200 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (5: 1) to afford 1- bromo-4-fluoro-2-methoxy-5-methylbenzene (C268, 12 g, 76%) as a solid. ¹ H NMR (300 MHz, DMSO-d6) 6 7.50 (dd, J = 8.3, 0.8 Hz, 1H), 7.01 (d, J = 11.6 Hz, 1H), 3.83 (s, 3H), 2.15 (dd, J = 2.0, 0.7 Hz, 3H).

Synthesis of Intermediate C269 C ₂ 68 C ₂ 69

To a stirred mixture of l-bromo-4-fluoro-2-methoxy-5-methylbenzene (12 g, 54.781 mmol, 1 equiv) in THF (240 mL) was added LDA (in 2M THF) (36 mL, 71.1 mmol, 1.3 equiv) dropwise at -78 °C under nitrogen atmosphere. The resulting mixture was stirred for 1 hr at -78 °C under nitrogen atmosphere. Then the mixture was added DMF (20.02 g, 273.905 mmol, 5 equiv) dropwise at -78 °C under nitrogen atmosphere and stirred at room temperature for 16 hr. The reaction was quenched with sat. NH4CI (aq.) (100 mL) at room temperature. The resulting mixture was extracted with ethyl acetate (3 x 100 mL). The combined organic layers dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (5: 1) to afford 3- bromo-6-fluoro-2-methoxy-5-methylbenzaldehyde (C269, 9 g, 66%) as an oil. ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 10.21 (d, J = 1.1 Hz, 1H), 7.95 (m, 1H), 3.87 (s, 3H), 2.23 (dd, J = 2.4, 0.8 Hz, 4H).

Synthesis of Intermediate C270 C ₂ 69 C ₂ 70

A mixture of 3 -bromo-6-fluoro-2-methoxy-5 -methylbenzaldehyde (8 g, 32.380 mmol, 1 equiv), O-methylhydroxylamine (1.68 g, 35.618 mmol, 1.1 equiv) and K ₂ CO ₃ (6.71 g, 48.570 mmol, 1.5 equiv) in DME (80 mL) was stirred for 4 hr at 60 °C. The reaction was quenched with water (100 mL) at room temperature. The resulting mixture was extracted with ethyl acetate (3 x 100 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford (E)-[(3-bromo-6-fluoro-2-methoxy-5- methylphenyl)methylidene](methoxy)amine (C270, 7 g, 78%) as a solid. LCMS (ES, m/z): 276 [M+H] ⁺ Synthesis of Intermediate C271

A mixture of 3 -bromo-6-fluoro-2-methoxy-5 -methylbenzaldehyde O-methyl (6 g, 21.82 mmol, 1 equiv) in DMSO (70 mL) and N2H4.H ₂ O (70 mL) was stirred for 4 h at 140 °C. The reaction was quenched with water (100 mL) at room temperature. The resulting mixture was extracted with ethyl acetate (3 x 100 mL). The combined organic layers were dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :1) to afford 5- bromo-4-methoxy-7-methyl-2H-indazole (C271, 1.0 g, 19%) as a solid. LCMS (ES, m/z): 241 [M+H] ⁺

Synthesis of Intermediate C272 C ₂ 71 C ₂ 72

A mixture of 5-bromo-4-methoxy-7-methyl-2H-indazole (300 mg, 1.244 mmol, 1 equiv) and tetrafluoroboranuide; trimethyloxidanium (920.3 mg, 6.220 mmol, 5 equiv) in EA (3 mL) was stirred for 2 hr at 25 °C under N2 atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA to afford 5-bromo-4-methoxy-2,7-dimethylindazole (C272, 270 mg, 85%) as a solid. LCMS (ES, m/z): 255 [M+H] ⁺ Synthesis of Intermediate C273

A mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (200 mg, 0.556 mmol, 1 equiv) and 5-bromo-4-methoxy-2,7-dimethylindazole (170.4 mg, 0.667 mmol, 1.2 equiv), methyl[2-(methylamino)ethyl]amine (24.5 mg, 0.278 mmol, 0.5 equiv), Cu (17.7 mg, 0.278 mmol, 0.5 equiv), K ₂ CO ₃ (230.7 mg, 1.668 mmol, 3 equiv) in xylene (2 mL) was stirred for 16 h at 120 °C under N2 atmosphere. The residue was purified by silica gel column chromatography, eluted with DCM/MeOH to afford tert-butyl 4-{7-[(4-methoxy-2,7- dimethylindazol-5-yl)carbamoyl]-2-methylindazol-4-yl (piperazine- 1 -carboxylate (C ₂ 73, 70 mg, 23%) as a solid. LCMS (ES, m/z): 533 [M+H] ⁺

A mixture of tert-butyl 4-{7-[(4-methoxy-2,7-dimethylindazol-5-yl)carbamoyl]-2- methylindazol-4-yl (piperazine- 1 -carboxylate (70 mg, 0.131 mmol, 1 equiv) and TFA (0.2 mL, 2.693 mmol, 20.53 equiv) in DCM (1 mL) was stirred for 1 hr at 25 °C under N2 atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 10, Gradient 1) to afford N-(4-hydroxy-2,7- dimethylindazol-5-yl)-2-methyl-4-(piperazin-l-yl)indazole-7- carboxamide (Compound 456, 5 mg) as a solid. LCMS (ES, m/z): 434[M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.30 (s, 1H), 8.75 (s, 1H), 8.53 (s, 1H), 8.28 (d, J = 1.3 Hz, 1H), 7.99 (d, J = 8.0 Hz, 1H), 6.48 (d, J = 8.1 Hz, 1H), 4.27 (s, 3H), 4.15 (d, J = 15.7 Hz, 6H), 3.30 (s, 1H), 2.92 (t, J = 4.9 Hz, 4H), 2.47 (d, J = 1.1 Hz, 3H).

Synthesis of Compound 484

A mixture of tert-butyl 4-{7-[(4-methoxy-2,7-dimethylindazol-5-yl)carbamoyl]-2- methylindazol-4-yl (piperazine- 1 -carboxylate (45 mg, 0.084 mmol, 1 equiv) and BBr, (0.5 mL, 5.289 mmol, 62.72 equiv) in DCM (0.5 mL) was stirred for 16 h at 25°C under N2 atmosphere. The product was precipitated by the addition of MeOH. The precipitated solids were collected by filtration and washed with MeOH. The residue was purified by reverse flash chromatography (Condition 10, Gradient 1) to afford N-(4-hydroxy-2,7-dimethylindazol-5-yl)-2-methyl-4- (piperazin-l-yl)indazole-7-carboxamide (Compound 484, 11 mg, 31%) as a solid. LCMS (ES, m/z): 420[M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 10.34 (s, 1H), 8.91 (d, J = 9.3 Hz, 3H), 8.32 (s, 1H), 8.05 (d, J = 8.0 Hz, 1H), 7.45 (d, J = 1.2 Hz, 1H), 6.62 (d, J = 8.1 Hz, 1H), 4.29 (s, 3H), 4.16 (s, 3H), 3.36 (s, 4H), 2.43 (d, J = 1.0 Hz, 3H).

Example 187: Synthesis of Compound 457

Synthesis of Intermediate C274 C ₂ 74

A solution of 2-methyl-6-nitroimidazo[1,2-a]pyridine (150 mg, 0.847 mmol, 1 equiv) in MeOH (20 mL) was treated with PtO ₂ (75 mg, 0.330 mmol, 0.39 equiv) for 8 hr at 80 °C under 20 atm hydrogen atmosphere. The resulting mixture was filtered and the filter cake was washed with methanol. The filtrate was concentrated under reduced pressure. The crude product 2- methyl-5H,6H,7H,8H-imidazo[1,2-a]pyridin-6-amine (C274, 146 mg, 66%) was used in the next step directly without further purification. LCMS (ES, m/z): 152[M+H] ⁺

1. Synthesis of Intermediate c275 C ₂ 74 C ₂ 75

A solution of 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-methylindazole-7 -carboxylic acid (100 mg, 0.277 mmol, 1.00 equiv) in DMF (3 mL) was treated with 2-methyl-5H,6H,7H,8H- imidazo[1,2-a]pyridin-6-amine (100 mg, 0.661 mmol, 2.38 equiv), HATU (126 mg, 0.332 mmol, 1.2 equiv), DIEA (107 mg, 0.831 mmol, 3 equiv) for 8 hr at 20 °C. The residue was purified by reverse flash chromatography (Condition 1, Gradient 1) to afford tert-butyl 4-[2-methyl-7-({2- methyl-5H,6H,7H,8H-imidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)indazol-4-yl]piperazine- 1 - carboxylate (C ₂ 75, 60 mg, 43%) as a solid. LCMS (ES, m/z): 494 [M+H] ⁺

Synthesis of Compound 457

A solution of tert-butyl 4-[2-methyl-7-({2-methyl-5H,6H,7H,8H-imidazo[1,2-a]pyridin-6 - yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (50 mg, 0.101 mmol, 1 equiv) in DCM (10 mL) was treated with TFA (1 mL) for 1 hr at 0 °C. The resulting mixture was diluted with water and concentrated under reduced pressure to afford 2-methyl-N-{2-methyl-5H,6H,7H,8H- imidazo[1,2-a]pyridin-6-yl}-4-(piperazin-l-yl)indazole-7-car boxamide (Compound 457, 30 mg, 75%) as a solid. LCMS (ES, m/z): 394 [M+H] ⁺¹ H NMR (300 MHz, DMSO-d ₆ ) δ 14.17 (s, 1H), 9.19 (d, J = 7.0 Hz, 2H), 8.93 (s, 2H), 8.82 (s, 2H), 7.92 (d, J = 7.9 Hz, 2H), 7.31 (d, J = 1.3 Hz, 2H), 6.55 (d, J = 8.0 Hz, 2H), 4.62 (s, 2H), 4.41 (dd, J = 12.9, 4.4 Hz, 2H), 4.15 (s, 8H), 3.30 - 3.06 (m, 6H), 2.30 - 2.13 (m, 10H)

Example 188: Synthesis of Compound 458 Synthesis of Intermediate C276

To a stirred solution of 5-bromo-3-fluoropyridin-2-amine (2 g, 10.471 mmol, 1 equiv) and 3-bromo-2-butanone (1.58 g, 10.471 mmol, 1 equiv) in n-BuOH (1 mL) was added pyridinium p-toluenesulfonate (263.14 mg, 1.047 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 72 hr at 120 °C. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash (Condition 7, Gradient 1) to afford 6-bromo- 8-fluoro-2,3-dimethylimidazo[1,2-a]pyridine (C276, 300 mg, 11%) as a solid. LCMS (ES, m/z): 243 [M+H] ⁺

Synthesis of Intermediate C277

To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l-carboxylate (200 mg, 0.556 mmol, 1 equiv) and 6-bromo-8-fluoro-2,3-dimethylimidazo[1,2-a]pyridine (162.31 mg, 0.667 mmol, 1.2 equiv) in dioxane (10 mL) were added Pd2(dba)3 (50.95 mg, 0.056 mmol, 0.1 equiv), XantPhos (32.20 mg, 0.056 mmol, 0.1 equiv) and Cs ₂ CO ₃ (543.89 mg, 1.668 mmol, 3 equiv). After stirring for 3 hr at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM:MeOH (10: 1) to afford tert-butyl 4-[7-({8-fluoro-2,3- dimethylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (C ₂ 77, 200 mg, 68%) as a solid. LCMS (ES, m/z): 522 [M+H] ⁺

Synthesis of Compound 458 C ₂ 77 458

A solution of tert-butyl 4-[7-({8-fluoro-2,3-dimethylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (110 mg, 0.211 mmol, 1 equiv) in DCM (4 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 7, Gradient 2) to afford N- { 8-fluoro-2,3 -dimethylimidazo[ 1 ,2-a]pyridin-6-yl } -2-methyl-4-(piperazin- 1 -yl)indazole-7- carboxamide (Compound 458, 13 mg, 14%) as a solid. LCMS (ES, m/z): 422 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 11.12 (s, 1H), 8.91 (d, J= 1.6 Hz, 1H), 8.80 (s, 1H), 7.98 (d, J= 8.1 Hz, 1H), 7.32 (dd, J= 12.4, 1.7 Hz, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.30 (s, 3H), 3.36 (d, J= 5.9 Hz, 4H), 2.92 (t, J= 5.0 Hz, 4H), 2.42 (s, 3H), 2.34 (s, 3H).

Example 189: Synthesis of Compound 459

Synthesis of Intermediate C278 oc Boc C278

To a solution of tert-butyl N-[l-(7-carbamoyl-2-methylindazol-4-yl) piperidin-4-yl]-N- ethylcarbamate (150.0 mg, 0.374 mmol, 1.0 equiv) and 6-bromo-8-fluoro-7-m ethoxy -2- methylimidazo[1,2-a] pyridine (116.1 mg, 0.449 mmol, 1.2 equiv) in dioxane (4 mL) were added Cs ₂ CO ₃ (305.2 mg, 0.935 mmol, 2.5 equiv) and Xantphos (43.2 mg, 0.075 mmol, 0.2 equiv), Pd2(dba)3 (34.2 mg, 0.037 mmol, 0.1 equiv). After stirring for 2 h at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (20: 1) to afford tert-butyl N-ethyl-N-{ l-[7-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a] pyridin-6-yl} carbamoyl)-2-methylindazol-4-yl] piperidin-4-yl} carbamate (C278, 130 mg, 48%) as a solid.

LCMS (ES, m/z): 580 [M+H] ⁺

Synthesis of Intermediate Compound 459

Into a 40 mL vial were added tert-butyl N-ethyl-N-{ l-[7-({8-fluoro-7-methoxy-2- methylimidazo[1,2- a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperidin-4-y l}carbamate (90.0 mg, 0.155 mmol, 1.0 equiv), DCM (2 mL) and TFA (0.5 mL) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-[4-(ethylamino)piperidin-l-yl]-N-{8-fluoro-7-methoxy-2- methylimidazo [1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxamide (Compound 459, 8.0 mg, 11%) as a solid. LCMS (ES, m/z): 480 [M+H] ^{+ 1} H NMR (400 MHz, Chloroform-d) δ 11.48 (s, 1H), 9.47 (d, J= 1.3 Hz, 1H), 8.21 (d, J= 8.0 Hz, 1H), 8.05 (s, 1H), 7.30 (d, J= 3.0 Hz, 1H), 6.52 (d, J= 8.1 Hz, 1H), 4.32 (s, 3H), 4.27 (d, J= 2.3 Hz, 3H), 3.90 (d, J= 12.7 Hz, 2H), 3.03 (t, J= 11.8 Hz, 2H), 2.84 (q, J= 7.0 Hz, 3H), 2.61-2.35 (m, 3H), 2.15 (d, J= 12.5 Hz, 2H), 1.76- 1.68 (m, 2H), 1.24 (t, J= 7.1 Hz, 3H).

Example 190: Synthesis of Compound 460

Synthesis of Intermediate C279 C ₂ 79 To a stirred mixture of methyl 4-bromo-6-fluoro-2-methylindazole-7-carboxylate (110 mg, 0.383 mmol, 1 equiv) and tert-butyl N-ethyl-N-(piperidin-4-yl)carbamate (87.49 mg, 0.383 mmol, 1 equiv), Cs ₂ CO ₃ (374.52 mg, 1.149 mmol, 3 equiv) in 1,4-dioxane (2 mL) was added RuPhos (35.76 mg, 0.077 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (32.05 mg, 0.038 mmol, 0.10 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :2) to afford methyl 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-l-yl}-6-fl uoro- 2-methylindazole-7-carboxylate (C279, 145 mg, 87%) as a solid. LCMS (ES, m/z): 435 [M+H] ⁺ Synthesis of Intermediate 280 C ₂ 80

To a stirred solution of methyl 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-l-yl}-6- fluoro-2-methylindazole-7-carboxylate (145 mg, 0.334 mmol, 1 equiv) in THF (1.2 mL) and H ₂ O (0.4 mL) was added lithiumol hydrate (42.01 mg, 1.002 mmol, 3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with water. The mixture was acidified to pH 4 with citric acid. The resulting mixture was extracted with DCM (3 x lOmL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-l-yl}-6-fl uoro-2-methylindazole-7-carboxylic acid (C280, 130 mg, 92%) as a solid. LCMS (ES, m/z): 421 [M-H] ’

Synthesis of Intermediate C281

C280 C281 To a stirred mixture of 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-l-yl}-6-fl uoro-2- methylindazole-7-carboxylic acid (130 mg, 0.309 mmol, 1 equiv) and NH4CI (66.15 mg, 1.236 mmol, 4 equiv) in DCM (2 mL) was added HATU (141.07 mg, 0.371 mmol, 1.2 equiv) and DIEA (199.79 mg, 1.545 mmol, 5 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :4) to afford tert-butyl N-[l-(7-carbamoyl-6-fluoro-2-methylindazol-4-yl)piperidin-4- yl]-N-ethylcarbamate (C281, 110 mg, 84%) as solid. LCMS (ES, m/z): 420 [M-H] ’

Synthesis of Intermediate C282

To a stirred mixture of tert-butyl N-[l-(7-carbamoyl-6-fluoro-2-methylindazol-4- yl)piperidin-4-yl]-N-ethylcarbamate (90 mg, 0.215 mmol, 1 equiv) and 6-bromo-8-fluoro-7- methoxy-2-methylimidazo[1,2-a]pyridine (66.70 mg, 0.258 mmol, 1.2 equiv) in 1,4-dioxane (2 mL) was added Cs ₂ CO ₃ (209.70 mg, 0.645 mmol, 3 equiv), X-Phos (20.46 mg, 0.043 mmol, 0.2 equiv) and Pd2(dba)3 (19.65 mg, 0.022 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (10: 1) to afford tert-butyl N- ethyl-N-{ l-[6-fluoro-7-({8-fluoro-7-m ethoxy -2-methylimidazo[1,2-a]pyridin-6-yl (carbamoyl)- 2-methylindazol-4-yl]piperidin-4-yl} carbamate (C282, 65 mg, 50%) as a solid. LCMS (ES, m/z): 596 [M-H] ’

Synthesis of Compound 460

To a stirred solution of tert-butyl N-ethyl-N-{ l-[6-fluoro-7-({8-fluoro-7-methoxy-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2-methylindazol-4-yl]piperidin-4-yl} carbamate (65 mg, 0.109 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 10) to afford 4-[4-(ethylamino)piperidin-l-yl]-6-fluoro-N-{8-fluoro-7-meth oxy-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxa mide (Compound 460, 15.3 mg, 28%) as a solid. LCMS (ES, m/z): 498 [M+H] ⁺¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.56 (s, 1H), 9.46 (s, 1H), 8.83 (s, 1H), 7.76 (d, J= 3.0 Hz, 1H), 6.23 (d, J= 16.2 Hz, 1H), 4.27 - 4.17 (m, 6H), 3.93 (d, J= 13.0 Hz, 2H), 3.14 (t, J= 11.7 Hz, 2H), 2.71 (dd, J= 8.8, 4.7 Hz, 1H), 2.60 (q, J= 7.1 Hz, 2H), 2.31 (s, 3H), 1.99 - 1.90 (m, 2H), 1.40 (q, J= 9.6 Hz, 2H), 1.04 (t, J= 7.1 Hz, 3H).

Example 191: Synthesis of Compound 462

Synthesis of Intermediate C283

A solution of 5-bromo-3-fluoro-2-iminopyridin-l-amine (1.5 g, 7.281 mmol, 1 equiv), EtsN (3.68 g, 36.405 mmol, 5 equiv) and AC2O (3.72 g, 36.405 mmol, 5 equiv) in toluene (30 mL) was stirred for 16 h at 100 °C. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford 6-bromo-8- fluoro-2-methyl-[1,2,4]triazolo[l,5-a]pyridine (C ₂ 83, 1 g, 59%) as a solid. LCMS (ES, m/z): 230 [M+H] ⁺

C ₂ 84

A mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (150 mg, 0.417 mmol, 1 equiv) and 6-bromo-8-fluoro-2-methyl-[1,2,4]triazolo[l,5-a]pyridine (115.20 mg, 0.500 mmol, 1.2 equiv), XantPhos (24.15 mg, 0.042 mmol, 0.1 equiv), Pd2(dba)3,(38.22 mg , 0.042mmoL 0.1 equiv), Cs ₂ CO ₃ (407.92 mg, 1.251 mmol, 3 equiv) in dioxane (2 mL) was stirred for 16 h at 100 °C under N2 atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM/MeOH to afford tert-butyl 4-[7-({8-fluoro-2-methyl-[1,2,4]triazolo[l,5-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (C284, 150 mg) as a solid. LCMS (ES, m/z): 509 [M+H] ⁺

Synthesis of Compound 462

A mixture of tert-butyl 4-[7-({8-fluoro-2-methyl-[1,2,4]triazolo[l,5-a]pyridin-6-yl} carbamoyl)-2- methylindazol-4-yl]piperazine-l -carboxylate (150 mg, 0.295 mmol, 1 equiv) and TFA (0.4 mL, 5.385 mmol, 18.26 equiv) in DCM (2 mL) was stirred for 1 hr at 25 °C under N2 atmosphere. The resulting mixture was concentrated under vacuum. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 12) to afford N-{8-fluoro-2-methyl-[1,2,4]triazolo[l,5-a]pyridin-6-yl}-2-m ethyl-4- (piperazin-l-yl)indazole-7-carboxamide (Compound 462, 63 mg, 52%) as a solid. LCMS (ES, m/z): 409 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.29 (s, 1H), 9.50 (d, J = 1.6 Hz, 1H), 8.80 (s, 1H), 7.98 (d, J = 8.1 Hz, 1H), 7.87 (dd, J = 11.7, 1.7 Hz, 1H), 6.48 (d, J = 8.2 Hz, 1H), 4.30 (s, 3H), 3.37 (t, J = 4.9 Hz, 4H), 2.91 (t, J = 4.8 Hz, 4H).

Example 192: Synthesis of Compound 463

To a stirred mixture of 4-bromo-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6 - yl}-2-methylindazole-7-carboxamide (80 mg, 0.190 mmol, 1 equiv) and (3R)-N,N- dimethylpyrrolidin-3 -amine (21.74 mg, 0.190 mmol, 1 equiv), Cs ₂ CO ₃ (186.09 mg, 0.570 mmol, 3 equiv) in 1,4-dioxane (1 mL) was added Ruphos (8.88 mg, 0.019 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (15.92 mg, 0.019 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (10: 1) to afford 4-[(3R)-3- (dimethylamino)pyrrolidin-l-yl]-6-fluoro-N-{8-fluoro-2-methy limidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (55 mg, crude). The crude product was purified was purified by Prep-HPLC (Condition 10, Gradient 11) to afford 4-[(3R)-3-(dimethylamino)pyrrolidin-l-yl]-6- fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-met hylindazole-7-carboxamide (Compound 463, 25.4 mg, 29%) as a solid. LCMS (ES, m/z): 454 [M-H] - 1H NMR (400 MHz, DMSO-d ₆ ) δ 11.02 (s, 1H), 9.18 (d, J= 1.6 Hz, 1H), 8.83 (s, 1H), 7.87 (d, J= 3.1 Hz, 1H), 7.25 (dd, J= 12.5, 1.7 Hz, 1H), 5.81 (d, J= 16.0 Hz, 1H), 4.22 (s, 3H), 3.77 (dt, J= 26.1, 9.0 Hz, 2H), 3.61 (d, J= 8.0 Hz, 1H), 3.42 (d, J= 9.0 Hz, 1H), 2.86 (p, J= 7.6 Hz, 1H), 2.35 (s, 3H), 2.26 (s, 7H), 1.96 - 1.82 (m, 1H).

Example 193: Synthesis of Compound 464

To a stirred mixture of 4-bromo-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6 - yl}-2-methylindazole-7-carboxamide (80 mg, 0.190 mmol, 1 equiv) and (3S)-N,N- dimethylpyrrolidin-3 -amine (21.74 mg, 0.190 mmol, 1 equiv), Cs ₂ CO ₃ (186.09 mg, 0.570 mmol, 3 equiv) in 1,4-dioxane (1 mL) was added Ruphos (8.88 mg, 0.019 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (15.92 mg, 0.019 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (10: 1) to afford 4-[(3S)-3- (dimethylamino)pyrrolidin-l-yl]-6-fluoro-N-{8-fluoro-2-methy limidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (50 mg, crude). The crude product was purified was purified by Prep-HPLC (Condition 10, Gradient 11) to afford 4-[(3S)-3-(dimethylamino)pyrrolidin-l-yl]-6- fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-met hylindazole-7-carboxamide (Compound 464, 25.2 mg, 29%) as a solid.

LCMS (ES, m/z): 454 [M-H] - 1H NMR (400 MHz, DMSO-d ₆ ) δ 11.02 (s, 1H), 9.18 (d, J = 1.6 Hz, 1H), 8.83 (s, 1H), 7.87 (d, J= 3.1 Hz, 1H), 7.25 (dd, J= 12.5, 1.7 Hz, 1H), 5.81 (d, J= 16.0 Hz, 1H), 4.22 (s, 3H), 3.77 (dt, J= 26.1, 9.0 Hz, 2H), 3.61 (d, J= 8.0 Hz, 1H), 3.42 (d, J= 9.0 Hz, 1H), 2.86 (p, J= 7.6 Hz, 1H), 2.35 (s, 3H), 2.26 (s, 7H), 1.96 - 1.82 (m, 1H).

Example 194: Synthesis of Compound 470

Synthesis of Intermediate C285 , xy ene C ₂ 85 A solution of 6-bromo-3-methyl-[1,2,4]triazolo[4,3-a]pyridine (2 g, 9.432 mmol, 1 equiv) in dioxane (20 mL) was treated with acetamide (0.84 g, 14.148 mmol, 1.5 equiv), Pd2(dba)3 (0.86 g, 0.943 mmol, 0.1 equiv) xantphos (1.09 g, 1.886 mmol, 0.2 equiv), Cs ₂ CO ₃ (6.15 g, 18.864 mmol, 2 equiv) for 8 hours at 80 °C under nitrogen atmosphere. The resulting mixture was filtered, the filter cake was washed with MeOH (3 x 50 mL). The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (10%-50%) to afford N-{3-methyl-[1,2,4]triazolo[4,3-a]pyridin-6-yl}acetamide (C ₂ 85, 1.7 g,

94%) as a solid. LCMS (ES, m/z): 191 [M+H] ⁺

Synthesis of Intermediate C286 C ₂ 85 C ₂ 86

A solution N-{3-methyl-[l, 2, 4]triazolo[4,3-a]pyridin-6-yl}acetamide (1.5 g, 7.886 mmol, 1 equiv) and Pd(OH)2/C (1.66 g, 11.829 mmol, 1.5 equiv) in EtOH (15 mL) was stirred for 120 °C at 16 hr under H2 (30 atm) atmosphere. The resulting mixture was filtered and the filter cake was washed with ethanol (20 mL x 3). The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA to afford N-{3- methyl-5H,6H,7H,8H-[1,2,4]triazolo[4,3-a]pyridin-6-yl}acetam ide (C286, 900 mg, 58%) as a solid. LCMS (ES, m/z): 195 [M+H] ⁺

Synthesis of Intermediate C287 C ₂ 86 C ₂ 87

A mixture of N-{3-methyl-5H,6H,7H,8H-[1,2,4]triazolo[4,3-a]pyridin-6-yl}a cetamide (300 mg, 1.544 mmol, 1 equiv) in NaOH (4 M, 3 mL) was stirred for 2 h at 100°C under N2 atmosphere. The resulting mixture was concentrated under reduced pressure to afford 3-methyl- 5H,6H,7H,8H-[1,2,4]triazolo[4,3-a]pyridin-6-amine (C287, 300 mg crude) as a solid. LCMS (ES, m/z): 153 [M+H] ⁺ Synthesis of Intermediate C288 C ₂ 88

A solution4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-methylin dazole-7-carboxylic acid (150 mg, 0.416 mmol, 1 equiv) and 3-methyl-5H,6H,7H,8H-[1,2,4]triazolo[4,3-a]pyridin-6-amine (C ₂ 87, 190.03 mg, 1.248 mmol, 3 equiv), HATU (189.90 mg, 0.499 mmol, 1.2 equiv), DIEA (161.37 mg, 1.248 mmol, 3 equiv) in DMF (2 mL) was stirred for 2 hr at 25

°C under N2 atmosphere. The residue was purified by silica gel column chromatography, eluted with DCM/MeOH to afford tert-butyl 4-[2-methyl-7-({3-methyl-5H,6H,7H,8H-

[1,2,4]triazolo[4,3-a]pyridin-6-yl}carbamoyl)indazol-4-yl ]piperazine-l-carboxylate (C288, 140 mg, 68%) as a solid. LCMS (ES, m/z): 495 [M+H] ⁺

Synthesis of Compound 470 C ₂ 88 470

A mixture of tert-butyl 4-[2-methyl-7-({3-methyl-5H,6H,7H,8H-[1,2,4]triazolo[4,3-a]p yridin-6- yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (120 mg, 0.243 mmol, 1 equiv) and TFA (0.2 mL, 2.693 mmol, 11.10 equiv) in DCM (1 mL) was stirred for 2 h at 25°C. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 8, Gradient 1) to afford 2-methyl-N-{3-methyl-5H,6H,7H,8H- [1,2,4]triazolo[4,3-a]pyridin-6-yl}-4-(piperazin-l-yl)indazo le-7-carboxamide (Compound 470, 23 mg, 24%) as a solid. LCMS (ES, m/z): 395 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 9.27 (d, J = 7.2 Hz, 1H), 8.69 (s, 1H), 7.89 (d, J = 8.0 Hz, 1H), 6.42 (d, J = 8.1 Hz, 1H), 4.57 (d, J = 6.2 Hz, 1H), 4.17 (dd, J = 12.3, 4.6 Hz, 1H), 4.11 (s, 3H), 3.91 (dd, J = 12.3, 5.8 Hz, 1H), 3.27 (s, 3H), 3.02 (t, J = 6.9 Hz, 2H), 2.90 (s, 3H), 2.28 (s, 3H), 2.11 (d, J = 7.2 Hz, 2H).

Example 195: Synthesis of Compound 472

472

To a stirred mixture of 4-bromo-2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}indazole-7-carboxamide (250 mg, 0.576 mmol, 1 equiv), (3S)-N,N- dimethylpyrrolidin-3 -amine (62.45 mg, 0.547 mmol, 0.95 equiv) and Cs ₂ CO ₃ (562.73 mg, 1.728 mmol, 3 equiv) in 1,4-dioxane (5 mL) was added Ruphos (26.87 mg, 0.058 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (48.15 mg, 0.058 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH2Cl ₂ /MeOH (10: 1) to afford 4-[(3S)-3- (dimethylamino)pyrrolidin- 1 -yl]-2-ethyl-6-fluoro-N-{ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6- yl}indazole-7-carboxamide (35 mg, crude). The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford 4-[(3S)-3-(dimethylamino)pyrrolidin-l-yl]-2-ethyl-6-fluoro- N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-ca rboxamide (Compound 472, 7 mg, 2%) as solid. LCMS (ES, m/z): 468 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 9.05 (d, J = 1.6 Hz, 1H), 8.61 (s, 1H), 7.71 (d, J= 2.9 Hz, 1H), 7.14 (dd, J= 11.8, 1.6 Hz, 1H), 5.84 (d, J= 16.2 Hz, 1H), 4.56 (q, J= 7.3 Hz, 2H), 3.87 (dt, J= 16.6, 9.0 Hz, 2H), 3.71 (q, J= 10.2, 9.6 Hz, 1H), 3.49 (t, J= 8.6 Hz, 1H), 3.03 (p, J= 7.6 Hz, 1H), 2.43 (d, J= 12.5 Hz, 9H), 2.38 (d, J= 6.8 Hz, 1H), 2.02 (p, J= 10.0 Hz, 1H), 1.69 (t, J= 7.3 Hz, 3H),

Example 196: Synthesis of Compound 473

Synthesis of Intermediate C289

To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (160 mg, 0.531 mmol, 1 equiv) and (3R)-N,N-dimethylpyrrolidin-3-amine (72.81 mg, 0.637 mmol, 1.2 equiv) in dioxane (3 mL) was added Cs ₂ CO ₃ (519.38 mg, 1.593 mmol, 3 equiv), Ruphos (49.59 mg, 0.106 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (44.44 mg, 0.053 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (10: 1) to afford methyl 4-[(3R)-3-(dimethylamino)pyrrolidin-l-yl]-2-ethyl-6- fluoroindazole-7-carboxylate (C ₂ 89, 135 mg, 75%) as solid. LCMS (ES, m/z): 335 [M+H] ⁺

Synthesis of Intermediate C290 C ₂ 89 C290

To a stirred solution of methyl 4-[(3R)-3-(dimethylamino)pyrrolidin-l-yl]-2-ethyl-6- fluoroindazole-7-carboxylate (135 mg, 0.404 mmol, 1 equiv) in THF (1.2 mL) and H ₂ O (0.4 mL) was added lithiumol hydrate (33.88 mg, 0.808 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30 °C. The resulting mixture was concentrated under vacuum. The residue was dissolved in methanol (5 mL). The solution was added HCl(g) in MeOH (1 mL) dropwise at 0°C. The resulting mixture was stirred for 10 min at room temperature. The resulting mixture was concentrated under vacuum to afford 4-[(3R)-3- (dimethylamino)pyrrolidin-l-yl]-2-ethyl-6-fluoroindazole-7-c arboxylic acid (C ₂ 90, 150 mg) as a solid. LCMS (ES, m/z): 319 [M-H] - Synthesis of Compound 473

C289 473

To a stirred mixture of 4-[(3R)-3-(dimethylamino)pyrrolidin-l-yl]-2-ethyl-6-fluoroin dazole- 7-carboxylic acid (150 mg, 0.468 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6- amine hydrochloride (103.85 mg, 0.515 mmol, 1.1 equiv) in DCM (1.5 mL) was added HATU (231.44 mg, 0.608 mmol, 1.3 equiv) and DIEA (302.57 mg, 2.340 mmol, 5 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (10: 1) to afford 4-[(3R)-3- (dimethylamino)pyrrolidin- 1 -yl]-2-ethyl-6-fluoro-N-{ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6- yl}indazole-7-carboxamide (30 mg, crude). The crude product was purified by Prep-HPLC (Condition 15, Gradient 3) to afford 4-[(3R)-3-(dimethylamino)pyrrolidin-l-yl]-2-ethyl-6-fluoro- N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-ca rboxamide; bis(trifluoroacetic acid) (Compound 473, 16.9 mg, 5%) as a solid. LCMS (ES, m/z): 468 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 9.41 (d, J= 1.5 Hz, 1H), 8.72 (s, 1H), 8.05 (dd, J= 2.4, 1.2 Hz, 1H), 7.84 (dd, J= 11.4, 1.5 Hz, 1H), 5.98 (d, J= 15.8 Hz, 1H), 4.60 (q, J= 13 Hz, 2H), 4.18 (p, J = 7.1 Hz, 2H), 4.03 (td, J= 9.5, 3.2 Hz, 1H), 3.96 - 3.79 (m, 2H), 3.08 (s, 6H), 2.75 - 2.67 (m, 1H), 2.57 (d, J= 0.9 Hz, H), 2.42 (dq, J= 12.5, 8.5 Hz, 1H), 1.70 (t, J= 13 Hz, 3H).

Example 197: Synthesis of Compound 474

Synthesis of Intermediate C290 To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (110 mg, 0.365 mmol, 1 equiv) and tert-butyl piperazine- 1 -carboxylate (81.65 mg, 0.438 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (357.07 mg, 1.095 mmol, 3 equiv), Ruphos (34.09 mg, 0.073 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.55 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-ethyl-6-fluoroin dazole-7-carboxylate (90 mg, 60.61%) as a solid. LCMS (ES, m/z): 407 [M+H] ⁺

Synthesis of Intermediate C291

C290 C291

To a stirred solution of methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-ethyl-6- fluoroindazole-7-carboxylate (90 mg, 0.221 mmol, 1 equiv) in THF (1.2 mL) and H ₂ O (0.4 mL) was added lithiumol hydrate (18.58 mg, 0.442 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30 °C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with H ₂ O (5mL). The mixture was acidified to pH 4 with citric acid. The resulting mixture was extracted with DCM (3 x lOmL). The combined organic layers were washed with brine (1 x lOmL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-[4-(tert- butoxycarbonyl)piperazin-l-yl]-2-ethyl-6-fluoroindazole-7-ca rboxylic acid (C ₂ 91, 65 mg, 74%) as a solid. LCMS (ES, m/z): 391 [M-H] ’

Synthesis of Intermediate C292 C ₂ 92

To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-ethyl-6-fluoroin dazole- 7-carboxylic acid (65 mg, 0.166 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6- amine hydrochloride (36.74 mg, 0.183 mmol, 1.1 equiv) in DCM (1 mL) was added DIEA (107.04 mg, 0.830 mmol, 5 equiv) and HATU (81.87 mg, 0.216 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (2: 1) to afford tert-butyl 4-[2-ethyl-6-fluoro-7-({8-fluoro- 2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]pi perazine-l-carboxylate (C ₂ 92, 70 mg, 78%) as a solid. LCMS (ES, m/z): 540 [M-H] ’

Synthesis of Compound 474

To a stirred solution of tert-butyl 4-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (70 mg, 0.130 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford 2-ethyl-6-fluoro- N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin -l-yl)indazole-7-carboxamide (Compound 473, 13.7 mg, 24%) as solid. LCMS (ES, m/z): 440 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 10.94 (s, 1H), 9.20 (d, J= 1.6 Hz, 1H), 8.79 (s, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.21 (dd, J= 12.4, 1.7 Hz, 1H), 6.23 (d, J= 15.2 Hz, 1H), 4.50 (q, J= 7.3 Hz, 2H), 3.36 (d, J= 10.0

Hz, 4H), 2.90 (t, J= 4.9 Hz, 4H), 2.35 (s, 3H), 1.56 (t, J = 7.3 Hz, 3H).

Example 198: Synthesis of Compound 476

Synthesis of Intermediate C293

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv) and tert-butyl 4-aminopiperidine-l- carboxylate (288.6 mg, 1.440 mmol, 3.0 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (469.6 mg, 1.440 mmol, 3.0 equiv), RuPhos (22.4 mg, 0.048 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (80.3 mg, 0.096 mmol, 0.2 equiv). After stirring for 3 h at 100°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 5) to afford tert-butyl 4-{[2-ethyl-7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]amin o}piperidine-l -carboxylate (C ₂ 93, 120 mg, 46%) as a solid. LCMS (ES, m/z): 536 [M+H] ⁺ Synthesis of Compound 476

A solution of tert-butyl 4-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]amino}piperidine-l-carboxylate (70 mg, 0.131 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 7) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(p iperidin-4- ylamino)indazole-7-carboxamide (Compound 476, 27.4 mg, 48%) as a solid. LCMS (ES, m/z): 436 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 10.90 (s, 1H), 9.18 (d, J = 1.6 Hz, 1H), 8.74 (s, 1H), 7.96-7.86 (m, 2H), 7.27 (dd, J= 12.4, 1.7 Hz, 1H), 6.89 (d, J= 7.6 Hz, 1H), 6.19 (d, J= 8.3 Hz, 1H), 4.56 (q, J= 7.2 Hz, 2H), 3.55 (s, 1H), 3.00 (d, J= 12.4 Hz, 2H), 2.60 (t, J= 11.6 Hz, 2H), 2.35 (s, 3H), 1.95 (d, J= 12.0 Hz, 2H), 1.61 (t, J= 13 Hz, 3H), 1.39 (td, J= 13.7, 12.2, 6.3 Hz, 2H).

Example 199: Synthesis of Compound 477

Synthesis of Intermediate C294

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (150 mg, 0.360 mmol, 1 equiv) and tert-butyl 2,6- diazaspiro[3.3]heptane-2-carboxylate (214.3 mg, 1.080 mmol, 3.0 equiv) in dioxane (4 mL) were added Cs ₂ CO ₃ (82.3 mg, 1.080 mmol, 3.0 equiv), RuPhos (16.8 mg, 0.036 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (60.2 mg, 0.072 mmol, 0.2 equiv). After stirring for 12 hr at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tertbutyl 6-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}c arbamoyl)indazol-4-yl]-2,6- diazaspiro[3.3]heptane-2-carboxylate (C294, 160 mg, 83%) as a solid. LCMS (ES, m/z): 534 [M+H] ⁺

Synthesis of Compound 477 C ₂ 94 477

A solution of tert-butyl 6-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-2,6-diazaspiro[3.3]heptane-2-carb oxylate (60 mg, 0.112 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography with the following conditions: column, Cl 8 silica gel; mobile phase, CH ₃ CN in water (0.05% NH3*H ₂ O), 20% to 60% gradient in 10 min; detector, UV 254 nm. This resulted in 4-{2,6-diazaspiro[3.3]heptan-2- yl}-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}i ndazole-7-carboxamide (27.4 mg, 56.21%) as a light yellow solid..

LCMS (ES, m/z): 434 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 10.96 (s, 1H), 9.18 (d, J= 1.6 Hz, 1H), 8.67 (s, 1H), 7.97-7.86 (m, 2H), 7.27 (dd, J= 12.4, 1.7 Hz, 1H), 5.90 (d, J= 8.2 Hz, 1H), 4.58 (q, J= 7.2 Hz, 2H), 4.35 (s, 4H), 4.07 (s, 1H), 3.77 (s, 3H), 2.38-2.32 (m, 3H), 1.61 (t, J= 13 Hz, 3H).

Example 200: Synthesis of Compound 478

Synthesis of Intermediate C295 C ₂ 95 To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (110 mg, 0.365 mmol, 1 equiv) and tert-butyl N-methyl-N-[(3S)-pyrrolidin-3-yl]carbamate (87.80 mg, 0.438 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (357.07 mg, 1.095 mmol, 3 equiv), Ruphos (34.09 mg, 0.073 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.55 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :1) to afford methyl 4-[(3S)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l- yl]-2-ethyl-6-fluoroindazole-7-carboxylate (C295, 85 mg, 55%) as a solid. LCMS (ES, m z): 421 [M+H] ⁺

Synthesis of Intermediate C296

Boc Boc C ₂ 95 C ₂ 96

To a stirred solution of methyl 4-[(3S)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l- yl]-2-ethyl-6-fluoroindazole-7-carboxylate (85 mg, 0.202 mmol, 1 equiv) in THF (1.2 mL) and H ₂ O (0.4 mL) was added lithium hydroxide hydrate (18.35 mg, 0.438 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30 °C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with H ₂ O (5 mL). The mixture was acidified to pH 4 with citric acid. The resulting mixture was extracted with DCM (3 x 10 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(3S)-3- [(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l-yl]-2-ethyl -6-fluoroindazole-7-carboxylic acid (C ₂ 96, 60 mg, 73%) as solid. LCMS (ES, m/z): 405 [M-H] ’

Synthesis of Intermediate C297

To a stirred mixture of 4-[(3S)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l-y l]-2- ethyl-6-fluoroindazole-7-carboxylic acid (60 mg, 0.148 mmol, 1 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine hydrochloride (32.74 mg, 0.163 mmol, 1.1 equiv) in DCM (2 mL) was added DIEA (95.40 mg, 0.740 mmol, 5 equiv) and HATU (72.97 mg, 0.192 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (2:1) to afford tert-butyl N-[(3S)-l-[2- ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4- yl]pyrrolidin-3-yl]-N-methylcarbamate (C297, 70 mg, 85%) as a solid. LCMS (ES, m/z): 554 [M+H] ⁺

To a stirred solution of tert-butyl N-[(3S)-l-[2-ethyl-6-fluoro-7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]pyrr olidin-3-yl]-N-methylcarbamate (70 mg, 0.126 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by Prep-HPLC (Condition 15, Gradient 3) to afford 2-ethyl-6-fluoro-N-{ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -4-[(3 S)-3 - (methylamino)pyrrolidin-l-yl]indazole-7-carboxamide; bis(trifluoroacetic acid) (Compound 478, 14.6 mg, 16%) as solid. LCMS (ES, m/z): 454 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 9.47 (d, J= 1.6 Hz, 1H), 8.71 (s, 1H), 8.09 (dd, J= 2.4, 1.2 Hz, 1H), 7.93 (dd, J= 11.3, 1.5 Hz, 1H), 5.99 (d, J= 15.8 Hz, 1H), 4.60 (q, J= 7.3 Hz, 2H), 4.15 - 4.01 (m, 2H), 4.03 - 3.95 (m, 1H), 3.90 (h, J= 6.7, 6.2 Hz, 2H), 2.88 (s, 3H), 2.65 (dt, J= 13.5, 6.9 Hz, 1H), 2.59 (d, J= 1.0 Hz, 3H), 2.41 (dt, J= 11.9, 6.4 Hz, 1H), 1.70 (t, J= 7.3 Hz, 3H).

Example 201: Synthesis of Compound 479

Synthesis of Intermediate C298

C298

To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (110 mg, 0.365 mmol, 1 equiv) and tert-butyl N-methyl-N-[(3R)-pyrrolidin-3-yl]carbamate (87.80 mg, 0.438 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (357.07 mg, 1.095 mmol, 3 equiv), Ruphos (34.09 mg, 0.073 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.55 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin- l-yl]-2-ethyl-6-fluoroindazole-7-carboxylate (80 mg, 52%) as a solid. LCMS (ES, m/z): 421 [M+H] ⁺

Synthesis of Intermediate C299 To a stirred solution of methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l- yl]-2-ethyl-6-fluoroindazole-7-carboxylate (80 mg, 0.190 mmol, 1 equiv) in THF (1.2 mL) and H ₂ O (0.4 mL) was added lithiumol hydrate (15.97 mg, 0.380 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30 °C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with H ₂ O (5 mL). The mixture was acidified to pH 4 with citric acid. The resulting mixture was extracted with DCM (3 x 10 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(3R)-3- [(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l-yl]-2-ethyl -6-fluoroindazole-7-carboxylic acid (C299, 55 mg, 71%) as a solid. LCMS (ES, m/z): 405 [M-H] ’

Synthesis of Intermediate C300

To a stirred mixture of 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l-y l]-2- ethyl-6-fluoroindazole-7-carboxylic acid (55 mg, 0.135 mmol, 1 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine hydrochloride (30.01 mg, 0.149 mmol, 1.1 equiv) in DCM (1 mL) was added DIEA (87.45 mg, 0.675 mmol, 5 equiv) and HATU (66.89 mg, 0.176 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (2:1) to afford tert-butyl N-[(3R)-l-[2- ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4- yl]pyrrolidin-3-yl]-N-methylcarbamate (C300, 65 mg, 86%) as solid. LCMS (ES, m z): 554 [M+H] ⁺

Synthesis of Compound 479

To a stirred solution of tert-butyl N-[(3R)-l-[2-ethyl-6-fluoro-7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]pyrr olidin-3-yl]-N-methylcarbamate (65 mg, 0.117 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by Prep-HPLC (Condition 15, Gradient 3) to afford 2-ethyl-6-fluoro-N-{ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -4-[(3R)-3 - (methylamino)pyrrolidin-l-yl]indazole-7-carboxamide; trifluoroacetic acid (Compound 479, 23.6 mg, 35%) as a solid. LCMS (ES, m/z): 454 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.20 (s, 1H), 9.38 (s, 1H), 8.88 (s, 1H), 8.84 (s, 3H), 8.07 (s, 1H), 7.60 (s, 1H), 5.91 (d, 15.6

Hz, 1H), 4.55 (q, J= 13 Hz, 2H), 3.96 (dd, J= 19.8, 8.5 Hz, 2H), 3.87 (d, J= 8.8 Hz, 1H), 3.77 (d, J= 10.0 Hz, 2H), 2.75 - 2.68 (m, 3H), 2.42 (s, 4H), 2.35 - 2.21 (m, 1H), 1.59 (t, J = 7.2 Hz, 3H).

Example 202: Synthesis of Compound 480

Synthesis of Intermediate C301 C ₃ 01

A solution of amino 2,4,6-trimethylbenzenesulfonate (5.41 g, 25.130 mmol, 1.2 equiv) in DCM (60 mL) was treated with 5-bromo-3-fluoropyridin-2-amine (4 g, 20.942 mmol, 1 equiv) for 10 mins at 0°C. The mixture was stirred for 8 hr at 20 °C. The precipitated solids were collected by filtration and washed with DCM (20 mL). The residue was purified by trituration with ether (20 mL) to afford 5-bromo-3-fluoro-2-iminopyridin-l-amine (C301, 3.8 g, 88%) as a solid. LCMS (ES, m/z): 206 [M+H] ⁺

Synthesis of Intermediate C302 C ₃ 01 C ₃ 02

A solution of 5-bromo-3-fluoro-2-iminopyridin-l-amine (2 g, 9.708 mmol, 1 equiv) in EtOH (60 mL) was treated with ethyl chloroacetate (2.38 g, 19.416 mmol, 2 equiv), K ₂ CO ₃ (2.68 g, 19.416 mmol, 2 equiv) for 4 hr at 80 °C. The residue was purified by silica gel column chromatography, eluted with PE:EA (70%) to afford 6-bromo-2-(chloromethyl)-8-fluoro- [1,2,4]triazolo[l,5-a]pyridine (C302, 1 g, 38%) as a solid. LCMS (ES, m/z): 264 [M+H] ⁺ Synthesis of Intermediate C303 C ₃ 02 C ₃ 03

A solution of 6-bromo-2-(chloromethyl)-8-fluoro-[1,2,4]triazolo[l,5-a]pyri dine (831 mg, 3.142 mmol, 1 equiv) in DMF (20 mL) was treated with AcONa (386 mg, 4.713 mmol, 1.5 equiv) for 8 hr at 20 °C. The residue was purified by reverse flash chromatography (Condition 1, Gradient 1) to afford {6-bromo-8-fluoro-[1,2,4]triazolo[l,5-a]pyridin-2-yl}methyl acetate (C303, 500 mg, 55%) as a solid. LCMS (ES, m/z): 288 [M+H] ⁺ Synthesis of Intermediate C304 C ₃ 04 A solution of {6-bromo-8-fluoro-[1,2,4]triazolo[l,5-a]pyridin-2-yl}methyl acetate (270 mg, 0.937 mmol, 1.5 equiv) in dioxane (5 mL) was treated with tert-butyl 4-(7-carbamoyl-2- methylindazol-4-yl)piperazine-l -carboxylate (224 mg, 0.625 mmol, 1.00 equiv), XantPhos (72 mg, 0.125 mmol, 0.2 equiv), Pd2(dba)3 (57 mg, 0.062 mmol, 0.1 equiv), Cs ₂ CO ₃ (407 mg, 1.249 mmol, 2 equiv) for 8 hours at 110 °C under nitrogen atmosphere. The resulting mixture was washed with water 100 mL. The residue was purified by silica gel column chromatography, eluted with DCM/MeOH 10:1. tert-butyl 4-[7-({2-[(acetyloxy)methyl]-8-fluoro- [1,2,4]triazolo[l,5-a]pyridin-6-yl}carbamoyl)-2-methylindazo l-4-yl]piperazine-l-carboxylate

(C ₃ 04, 300 mg, 84%) as a solid. LCMS (ES, m/z): 567 [M+H] ⁺ Synthesis of Intermediate C305 C ₃ 04 C ₃ 05

A solution of tert-butyl 4-[7-({2-[(acetyloxy)methyl]-8-fluoro-[1,2,4]triazolo[l,5-a] pyridin- 6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-l-carboxylat e (330 mg, 0.582 mmol, 1 equiv) in CH ₃ OH (10 mL) was treated with K ₂ CO ₃ (241.48 mg, 1.746 mmol, 3 equiv) for 1 hour at 80°C. The resulting mixture was filtered, the filter cake was washed with CH ₃ OH (3x10 mL). The filtrate was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 15, Gradient 4) to afford tert-butyl 4-(7-{[8-fluoro-2-(hydroxymethyl)- [1,2,4]triazolo[l,5-a]pyridin-6-yl]carbamoyl}-2-methylindazo l-4-yl)piperazine-l-carboxylate (C ₃ 05, 280 mg, 91%) as a solid.

LCMS (ES, m/z): 525 [M+H] ⁺

Synthesis of Compound 480

A solution of tert-butyl 4-(7-{[8-fluoro-2-(hydroxymethyl)-[1,2,4]triazolo[l,5-a]pyri din-6- yl]carbamoyl}-2-methylindazol-4-yl)piperazine-l -carboxylate (240 mg, 0.458 mmol, 1 equiv) in 1,4-di oxane (4 mL) was treated with HCl (4 mL) for 2 hr at 20 °C. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 1, Gradient l) to afford N-[8-fluoro-2-(hydroxymethyl)-[ 1,2, 4]triazolo[l, 5-a]pyridin- 6-yl]-2-methyl-4-(piperazin-l-yl)indazole-7-carboxamide (Compound 480, 2.2 mg, 1%) as a solid.

LCMS (ES, m/z): 425 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.33 (s, 1H), 9.57 (s, 1H), 8.82 (s, 1H), 7.97 (dd, J = 17.9, 9.8 Hz, 2H), 6.50 (d, J = 8.2 Hz, 1H), 5.55 (d, J = 6.3 Hz, 1H), 4.67 (d, J = 6.1 Hz, 2H), 4.31 (s, 3H), 2.91 (s, 4H).

Example 203: Synthesis of Compound 481

Synthesis of Intermediate C306 C ₃ 06

To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (110 mg, 0.365 mmol, 1 equiv) and piperazine, 1-methyl- (43.91 mg, 0.438 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (357.07 mg, 1.095 mmol, 3 equiv), Ruphos (34.09 mg, 0.073 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.55 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 2- ethyl-6-fluoro-4-(4-methylpiperazin-l-yl)indazole-7-carboxyl ate (C ₃ 06, 90 mg, 76%) as a solid.

LCMS (ES, m/z): 421 [M+H] ⁺

Synthesis of Intermediate C307 C ₃ 06 C ₃ 07

To a stirred solution of methyl 2-ethyl-6-fluoro-4-(4-methylpiperazin-l-yl)indazole-7- carboxylate (90 mg, 0.281 mmol, 1 equiv) in THF (1.2 mL) and H ₂ O (0.4 mL) was added lithium hydroxide hydrate (23.58 mg, 0.562 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30 °C. The resulting mixture was concentrated under vacuum. The residue was dissolved in methanol (5 mL). The solution was added HCl(gas) in MeOH (1 mL) dropwise at 0°C. The resulting mixture was stirred for 10 min at room temperature. The resulting mixture was concentrated under vacuum to afford 2-ethyl-6-fluoro-4-(4-methylpiperazin-l- yl)indazole-7-carboxylic acid (C ₃ 07, 145 mg, 84%) as a solid. LCMS (ES, m/z): 307 [M+H] ⁺

Synthesis of Compound 481

To a stirred mixture of 2-ethyl-6-fluoro-4-(4-methylpiperazin-l-yl)indazole-7-carbox ylic acid (145 mg, 0.237 mmol, 1 equiv, 50%) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine hydrochloride (52.49 mg, 0.261 mmol, 1.1 equiv) in DCM (3 mL) was added HATU (116.98 mg, 0.308 mmol, 1.3 equiv) and DIEA (152.94 mg, 1.185 mmol, 5 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (20: 1) to afford crude product. The crude product was purified by Prep-HPLC (Condition 10, Gradient 12) to afford 2-ethyl-6-fluoro-N-{8-fluoro- 2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-methylpiperazin-l-y l)indazole-7-carboxamide (Compound 481, 5.7 mg, 5%) as a solid. LCMS (ES, m/z): 454 [M+H] ⁺¹ H NMR (400 MHz, Methanol-d ₄ ) δ 9.10 (d, J= 1.6 Hz, 1H), 8.59 (s, 1H), 7.74 (d, J= 2.9 Hz, 1H), 7.21 (dd, J= 11.9, 1.7 Hz, 1H), 6.31 (d, J= 15.5 Hz, 1H), 4.58 (q, J= 7.3 Hz, 2H), 3.55 (t, J= 5.0 Hz, 4H), 2.74 - 2.67 (m, 4H), 2.43 (d, J= 12.4 Hz, 6H), 1.69 (t, J= 7.3 Hz, 3H).

Example 204: Synthesis of Compound 482

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (150 mg, 0.360 mmol, 1 equiv) and tert-butyl 2,5- diazaspiro[3.4]octane-5-carboxylate (153 mg, 0.720 mmol, 3.0 equiv) in dioxane (4 mL) were added Cs ₂ CO ₃ (82.3 mg, 1.080 mmol, 3.0 equiv), RuPhos (16.8 mg, 0.036 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (60.2 mg, 0.072 mmol, 0.2 equiv). After stirring for 12 hr at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford 2-[2- ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbam oyl)indazol-4-yl]-2,5- diazaspiro[3.4]octane-5-carboxylate (C308, 120 mg, 91%) as a solid. LCMS (ES, m/z): 548 [M+H] ⁺

Synthesis of Compound 482

A solution of tert-butyl 2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-2,5-diazaspiro[3.4]octane-5-carbo xylate (100 mg, 0.183 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NHs(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography with the following conditions: column, Cl 8 silica gel; mobile phase, CH ₃ CN in water (0.05% NH3.H2O, 20% to 60% gradient in 10 min; detector, UV 254 nm. This resulted in 4-{2,5-diazaspiro[3.4]octan-2- yl}-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}i ndazole-7-carboxamide (Compound 481, 25 mg, 30%) as a solid.. LCMS (ES, m/z): 448 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 10.97 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.67 (s, 1H), 7.98-7.86 (m, 2H), 7.27 (dd, J = 12.4, 1.7 Hz, 1H), 5.90 (d, J= 8.1 Hz, 1H), 4.57 (q, J= 7.3 Hz, 2H), 4.25 (d, J= 8.2 Hz, 2H), 4.13 (d, J= 8.2 Hz, 2H), 2.91 (t, J= 6.9 Hz, 2H), 2.35 (s, 3H), 2.02 (dd, J= 8.3, 6.4 Hz, 2H), 1.77 (p, J= 7.1 Hz, 2H), 1.61 (t, J = 7.3 Hz, 3H).

Example 205: Synthesis of Compound 390

390

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (50 mg, 0.124 mmol, 1 equiv) and lH,4H,5H,6H,7H-pyrrolo[3,2- c]pyridine (18.22 mg, 0.149 mmol, 1.2 equiv) in dioxane (1 mL) was added Cs ₂ CO ₃ (121.51 mg, 0.372 mmol, 3 equiv), RuPhos (11.60 mg, 0.025 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (10.40 mg, 0.012 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 hr at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (10: 1) to afford crude product. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-{ lH,4H,6H,7H-pyrrolo[3,2-c]pyridin-5- yl}indazole-7-carboxamide (Compound 390, 16 mg, 29%) as solid. LCMS (ES, m/z): 444 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.06 (s, 1H), 10.56 (s, 1H), 9.21 (s, 1H), 8.85 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.34 (d, J= 12.7 Hz, 1H), 6.62 (t, J= 2.6 Hz, 1H), 6.53 (d, J= 8.4 Hz, 1H), 5.90 (t, J= 2.5 Hz, 1H), 4.46 (s, 2H), 4.32 (s, 3H), 3.86 (t, J= 5.5 Hz, 2H), 2.87 (t, J= 5.4 Hz, 2H), 2.35 (s, 3H).

Example 206: Synthesis of Compound 143

Synthesis of Intermediate C309 C ₃ 09

To a stirred mixture of 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-methylindazole-7 - carboxylic acid (500 mg, 1.387 mmol, 1 equiv) and HATU (633.00 mg, 1.664 mmol, 1.2 equiv) in DMF (10 mL) was added DIEA (537.91 mg, 4.161 mmol, 3 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine hydrochloride (335.66 mg, 1.664 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was filtered. The filter cake was washed with methyl tert butyl ether (3 x 10 mL) and dried under infrared light to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}carbamoyl)-2-methylindazol-4-yl]piperazine-l- carboxylate (C ₃ 09, 460 mg, 65%) as solid. LCMS (ES, m/z): 508[M+H] ⁺

Synthesis of Compound 143

C ₃ 09 143

To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (460 mg, 0.906 mmol, 1 equiv) in dioxane (5 mL) was added HCl (gas) in 1,4-di oxane (5 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The resulting mixture was diluted with water (30 mL). The mixture was neutralized to pH 7 with saturated NaHCO3 (aq.). The aqueous layer was extracted with di chloromethane (3 x 100 mL). The combined organic layers were concentrated under reduced pressure to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-( piperazin-l- yl)indazole-7-carboxamide (Compound 143, 297.7 mg, 80%) as solid. LCMS (ES, m/z): 408 [M+H] ⁺¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.80 (s, 1H), 7.98 (d, J= 8.0 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.34 (dd, J= 12.4, 1.7 Hz, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.30 (s, 3H), 3.36 (t, J= 5.0 Hz, 4H), 2.96 - 2.89 (m, 4H), 2.35 (s, 3H).

Example 207: Synthesis of Compound 468

Synthesis of Intermediate C310 C ₃ 10

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (180 mg, 0.432 mmol, 1 equiv) and tert-butyl N-methyl-N-(4- methylpiperidin-4-yl)carbamate (99 mg, 0.432 mmol, 1 equiv) in dioxane (5 mL) were added Cs ₂ CO ₃ (423 mg, 1.296 mmol, 3 equiv), RuPhos (40 mg, 0.086 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90°C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 10) to afford tert-butyl N-{ l-[2-ethyl-7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]-4-m ethylpiperidin-4-yl}-N- methylcarbamate (C ₃ 10, 210 mg, 86%) as a solid. LCMS (ES, m z) 564 [M+H] ⁺

Synthesis of Compound 460

A solution of tert-butyl N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-4-methylpiperidin-4-yl}-N-methylc arbamate (200 mg, 0.355 mmol, 1 equiv) in TFA (2 mL) and DCM (2 mL) was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 8) to afford 2-ethyl-N-{8- fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -4-[4-methyl-4-(methylamino)piperidin- 1 - yl]indazole-7-carboxamide (Compound 460, 50 mg, 30%) as a solid.

LCMS (ES, m zy 464 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.20 (d, J= 1.6 Hz, 1H), 8.80 (s, 1H), 7.96 (d, J= 8.1 Hz, 1H), 7.90 (dd, J= 3.2, 1.0 Hz, 1H), 7.29 (dd, J= 12.3, 1.7 Hz, 1H), 6.47 (d, J= 8.2 Hz, 1H), 4.59 (q, J= 7.3 Hz, 2H), 3.55-3.43 (m, 4H), 2.38-2.33 (m, 3H), 2.23 (s, 3H), 1.70 (dt, J= 13.3, 4.6 Hz, 2H), 1.61 (q, J= 1A Hz, 5H), 1.09 (s, 3H).

Example 208: Synthesis of Compound 496

Synthesis of Intermediate C311

C ₃ 11

To a stirred mixture of G'.s-tert-butyl 4-(7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl)carbamoyl)-2-((ls,3s)-3-hydroxycyclobutyl)-2H-indazol-4-y l)piperazine-l-carboxylate (270.0 mg, 0.479 mmol, 1.0 equiv) and K ₂ CO ₃ (133.3 mg, 0.958 mmol, 2.0 equiv), DMF (5 mL) were added methyl iodide (101.9 mg, 0.718 mmol, 1.5 equiv) dropwise at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 6 hr at 50 °C under nitrogen atmosphere. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting mixture was extracted with ethyl acetate (2 x 20 mL). The combined organic layers were washed with brine (1 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (20: 1) to afford CA-tert-butyl 4-(7-((8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl)carbamoyl)-2-((ls,3s)-3- methoxycyclobutyl)-2H-indazol-4- yl)piperazine-l -carboxylate (C3 11, 150 mg, 49%) as a solid. LCMS (ES, m/z): 578 [M+H] ⁺

Synthesis of Compound 496

To a stirred mixture of Cis -tert-butyl 4-(7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl)carbamoyl)-2-((ls,3s)-3-methoxycyclobutyl)-2H-indazol-4-y l)piperazine-l-carboxylate (150.0 mg, 0.260 mmol, 1.0 equiv) in DCM (2 mL) were added TFA (1 mL) dropwise at room temperature. The resulting mixture was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep- HPLC (Condition 14, Gradient 2) to afford C/s-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl)-2-((ls,3s)-3-methoxycyclobutyl)-4-(piperazin-l-yl)-2H-in dazole-7-carboxamide 2,2,2- trifluoroacetate (Compound 496, 70 mg, 44%) as a solid. LCMS (ES, m z): 478 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.52 (s, 1H), 9.68 (d, J= 1.6 Hz, 1H), 9.11-9.07 (m, 2H), 9.03 (s, 1H), 8.41 (d, J= 1.4 Hz, 1H), 8.12-8.02 (m, 2H), 6.64 (d, J= 8.1 Hz, 1H), 5.62 (s, 1H), 4.96-4.84 (m, 1H), 4.17 (p, J= 7.1 Hz, 1H), 4.01 (d, J= 1.2 Hz, 3H), 3.63 (t, J= 5.1 Hz, 4H), 3.37 (d, J= 5.8 Hz, 4H), 2.98 (dhept, J= 92, 2.5, 2.0 Hz, 2H), 2.66 (tdd, J= 9.0, 7.5, 2.8 Hz, 2H), 2.55-2.50 (m, 3H).

Example 209: Synthesis of Compound 420

Synthesis of Intermediate C312 C ₃ 12

To a stirred solution of NaH (1.42 g, 59.313 mmol, 1.5 equiv) in THF (100 mL) was added ethanol (2.19 g, 47.450 mmol, 1.2 equiv) dropwise at 0 °C under nitrogen atmosphere. The resulting mixture was stirred for 0.5 h at room temperature under nitrogen atmosphere. To the above mixture was added 3,5-dibromopyrazin-2-amine (10.0 g, 39.542 mmol, 1.0 equiv) at room temperature. The resulting mixture was stirred for additional 16 hr at 50 °C. The reaction was quenched with water at 0 °C. The resulting mixture was extracted with ethyl acetate (2 x 100 mL). The combined organic layers were washed with water (l x 200 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (2: 1) to afford 5-bromo-3- ethoxypyrazin-2-amine (C3 12, 6 g, 69%) as a solid. LCMS (ES, m/z):218 [M+H] ⁺ Synthesis of Intermediate C313

To a stirred mixture of 5-bromo-3-ethoxypyrazin-2-amine (3.40 g, 15.592 mmol, 1 equiv) and l-bromo-2,2-dimeth oxypropane (3.42 g, 18.710 mmol, 1.2 equiv) in i-PrOH (60 mL) was added PPTS (0.39 g, 1.559 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 16 hr at 80 °C under nitrogen atmosphere. The mixture was neutralized to pH 7 with saturated NaHCCL (aq.). The organic solvent was concentrated under vacuum. The residue was extracted with ethyl acetate (3 x 100 mL). The combined organic layers were washed with water (1 x 200 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (3: 1) to afford 6-bromo-8-ethoxy-2-methylimidazo[1,2-a]pyrazine (C3 13, 1.9 g, 47%) as a solid. LCMS (ES, m/z):256 [M+H] ⁺ Synthesis of Intermediate C314 C ₃ 14

To a stirred mixture of tert-butyl N-[l-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl]- N-methyl carbamate (280.0 mg, 0.577 mmol, 1 equiv, 77%) and 6-bromo-8-ethoxy-2- methylimidazo[1,2-a]pyrazine (221.8 mg, 0.865 mmol, 1.5 equiv) in dioxane (6 mL) were added Cs ₂ CO ₃ (564.3 mg, 1.731 mmol, 3 equiv) and XantPhos (66.8 mg, 0.115 mmol, 0.2 equiv) and Pd2(dba)3 (52.9 mg, 0.058 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 hr at 100 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with ethyl acetate (3 x 5 mL). The combined organic layers were washed with brine (1 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N-{ l-[7-({8-ethoxy-2-methylimidazo[1,2- a]pyrazin-6-yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3- yl}-N-m ethylcarbamate (C ₃ 14, 180 mg, 56%) as a solid. LCMS (ES, m, z):549 [M+H] ⁺ Synthesis of Compound 420 C ₃ 14 420

To a stirred mixture of tert-butyl N-{ l-[7-({8-ethoxy-2-methylimidazo[1,2-a]pyrazin-6- yl} carbarnoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl}-N-m ethylcarbamate (170 mg, 0.310 mmol, 1 equiv) in DCM (3 mL) was added TFA (0.6 mL) dropwise at 0 °C. The resulting mixture was stirred for 30 min at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N- {8-ethoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-methyl-4-[3- (methylamino)pyrrolidin-l- yl]indazole-7-carboxamide (80 mg, 57%) as a solid. LCMS (ES, m, z):449 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.18 (s, 1H), 8.97 (s, 1H), 8.83 (s, 1H), 7.94 (d, J= 8.3 Hz, 1H), 7.89 (d, J= 1.0 Hz, 1H), 6.02 (d, J= 8.4 Hz, 1H), 4.57 (q, J= 7.1 Hz, 2H), 4.24 (s, 3H), 3.83-3.73 (m, 2H), 3.65 (d, J= 7.5 Hz, 1H), 3.44-3.31 (m, 2H), 2.50 (s, 3 H), 2.49 (s, 3H), 2.16 (dt, J= 13.0, 6.3 Hz, 1H), 1.94 (dt, J= 11.8, 6.0 Hz, 1H), 1.47 (t, J = 7.1 Hz, 3H).

Example 210: Synthesis of Compound 483

Synthesis of Intermediate C315 C ₃ 15 A solution of methyl 3-fluoro-lH-pyrrole-2-carboxylate (10 g, 69.873 mmol, 1 equiv) in THF (100 mL) was treated with NaH (2.52 g, 104.810 mmol, 1.5 equiv) for 0.5 h at 0°C under nitrogen atmosphere followed by the addition of SESC ₁ (16.83 g, 83.848 mmol, 1.2 equiv) dropwise at 25 °C was stirred for 2 hr. The resulting mixture was extracted with EA (50 mL x 2 ). The combined organic layers were washed with brine (20 mL x 2), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (0% ~ 50%) to afford methyl 3-fluoro-l-{[2-(trimethylsilyl)ethoxy]methyl}pyrrole-2-carbo xylate (C ₃ 15, 18 g, 94%) as a solid. ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 11.68 (s, 1H), 6.87 (ddd, J = 4.7, 3.8, 2.9 Hz, 1H), 6.03 (t, J = 2.8 Hz, 1H), 4.24 (q, J = 7.1 Hz, 2H), 1.27 (t, J = 7.1 Hz, 3H).

Synthesis of Intermediate C316

A solution of methyl 3-fluoro-l-{[2-(trimethylsilyl)ethoxy]methyl}pyrrole-2-carbo xylate (19 g, 69.501 mmol, 1 equiv) and N-bromosuccinimide (13.61 g, 76.451 mmol, 1.1 equiv) in HOAc (150 mL, 2617.731 mmol, 37.66 equiv) was stirred for 2 hr at 25 °C under N2 atmosphere. The mixture was basified to pH 8 with Na2CO3 . The residue was purified by silica gel column chromatography, eluted with PE:EA (0%~40%) to afford methyl 4-bromo-3-fluoro- l-{[2-(trimethylsilyl)ethoxy]methyl}pyrrole-2-carboxylate (C ₃ 16, 3 g, 12%) as a solid. ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 7.54 (d, J = 4.8 Hz, 1H), 5.54 (d, J = 1.0 Hz, 2H), 4.26 (q, J = 7.1 Hz, 2H), 3.45 (t, J = 7.8 Hz, 2H), 1.27 (t, J = 7.1 Hz, 3H), 0.80 (t, J = 7.8 Hz, 2H), 0.06 (s, 8H).

Synthesis of Intermediate C317

A solution of methyl 4-bromo-3-fluoro-l-{[2-(trimethylsilyl)ethoxy]methyl}pyrrole -2- carboxylate (3 g, 8.516 mmol, 1 equiv) and LiOH (1.02 g, 42.580 mmol, 5 equiv) in MeOH (10 mL), THF (10 mL), H ₂ O (10 mL) was stirred for 2 hr at 25 °C under N2 atmosphere. The resulting mixture was extracted with EA (20 mL x 2). The combined organic layers were washed with brine (10 mL x 2), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-bromo-3-fluoro-l-{[2- (trimethylsilyl)ethoxy]methyl}pyrrole-2-carboxylic acid (C ₃ 17, 2.7 g, 93%) as a solid. LCMS (ES, m/z): 338 [M+H] ⁺ Synthesis of Intermediate C318

A solution 4-bromo-3-fluoro-l-{[2-(trimethylsilyl)ethoxy]methyl}pyrrole -2-carboxylic acid (2.7 g, 7.982 mmol, 1 equiv) and N,O-dimethylhydroxylamine (0.73 g, 11.973 mmol, 1.5 equiv), HATU (9.11 g, 23.946 mmol, 3 equiv), DIEA (3.10 g, 23.946 mmol, 3 equiv) in DCM (30 mL) was stirred for 2 hr at 25 °C under nitrogen atmosphere. The resulting mixture was extracted with EA (20 mL x 2). The combined organic layers were washed with brine (10 mL x 2), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (0%~50%) to afford 4-bromo-3-fluoro-N-methoxy-N-methyl-l-{[2-(trimethylsilyl) ethoxy] methyl }pyrrole-2-carboxamide (C ₃ 18, 2.6 g, 85%) as a solid. ¹ H NMR (300 MHz, DMSO-d ₆ ) δ 7.40 (d, J = 4.5 Hz, 1H), 5.36 (d, J = 1.1 Hz, 2H), 3.61 (s, 3H), 3.37 (d, J = 8.0 Hz, 2H), 2.08 (s, OH), 0.79 (dd, J = 8.9, 7.5 Hz, 2H).

Synthesis of Intermediate C319 C ₃ 18 C ₃ 19

A mixture of 4-bromo-3-fluoro-N-methoxy-N-methyl-l-{[2- (trimethylsilyl)ethoxy]methyl}pyrrole-2-carboxamide (2.6 g, 6.818 mmol, 1 equiv) and MeMgBr (2.44 g, 20.454 mmol, 3 equiv) in THF (30 mL) was stirred for 12 h at 50°C under N2 atmosphere. The resulting mixture was extracted with EA (20 mL x 2). The combined organic layers were washed with brine (10 mL x 2), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (0%~50%) to afford l-(4-bromo-3-fluoro- l-{[2-(trimethylsilyl)ethoxy]methyl}pyrrol-2-yl)ethanone (C ₃ 19, 1.4 g, 61%) as a solid. LCMS (ES, m/z): 334 [M-H] ’

Synthesis of Intermediate C320 C ₃ 19 C ₃ 20

A solution of l-(4-bromo-3-fluoro-l-{[2-(trimethylsilyl)ethoxy]methyl}pyrr ol-2- yl)ethanone (1.4 g, 4.163 mmol, 1 equiv) and TFA (2.37 g, 20.815 mmol, 5 equiv) in DCM (14 mL) was stirred for 2 hr at 25 °C under N2 atmosphere. The resulting mixture was concentrated under reduced pressure to afford l-(4-bromo-3-fluoro-lH-pyrrol-2-yl)ethanone (C ₃ 20, 700 mg, 81%) as a solid. H NMR (300 MHz, DMSO-d ₆ ) δ 12.12 (s, 2H), 7.20 (d, J = 4.2 Hz, 2H), 2.36 (d, J = 2.5 Hz, 7H), 1.24 (s, 1H).

Synthesis of Intermediate C321

A solution of l-(4-bromo-3-fluoro-lH-pyrrol-2-yl)ethanone (700 mg, 3.398 mmol, 1 equiv) and bromoacetone (698.13 mg, 5.097 mmol, 1.5 equiv) in ACN (7 mL) was stirred for 12 hr at 50 °C under N2 atmosphere. The resulting mixture was extracted with EA (10 mL x 2). The combined organic layers were washed with brine (5 mL x 2), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure The residue was purified by silica gel column chromatography, eluted with PE:EA (0%~50%) to afford l-(2-acetyl-4-bromo-3-fluoropyrrol-l-yl)propan-2-one (C ₃ 21, 430 mg, 48%) as a solid. LCMS (ES, m/z): 262 [M+H] ⁺ Synthesis of Intermediate C322

A solution l-(2-acetyl-4-bromo-3-fluoropyrrol-l-yl)propan-2-one (430 mg, 1.641 mmol, 1 equiv) and NELOAc (2529.45 mg, 32.820 mmol, 20 equiv) in AcOH (4 mL, 69.806 mmol, 42.55 equiv) was stirred for 12 hr at 120 °C under N2 atmosphere. The resulting mixture was extracted with EA (10 mL x 2). The combined organic layers were washed with brine (5 mL x 2), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (0%~50%) to afford 7-bromo-8-fluoro-l,3-dimethylpyrrolo[1,2-a]pyrazine (C ₃ 22, 270 mg, 67%) as a solid. LCMS (ES, m/z): 243 [M+H] ⁺ Synthesis of Intermediate C323

A mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (150 mg, 0.417 mmol, 1 equiv) and 7-bromo-8-fluoro-l,3-dimethylpyrrolo[1,2-a]pyrazine (121.73 mg, 0.500 mmol, 1.2 equiv), XantPhos (24.15 mg, 0.042 mmol, 0.1 equiv), Pd2(dba)3 (38.22 mg,

0.042 mmol, 0.1 equiv), Cs ₂ CO ₃ (407.92 mg, 1.251 mmol, 3 equiv) in dioxane (3 mL) was stirred for 12 h at 100°C under N2 atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (0%~80%) to afford tert-butyl 4-[7-({8-fluoro-l,3-dimethylpyrrolo[1,2-a]pyrazin-7- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (C323, 40 mg, 18%) as a solid LCMS (ES, m/z): 522 [M+H] ⁺ C ₃ 23 483

A mixture of tert-butyl 4-[7-({8-fluoro-l,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl}carba moyl)- 2-methylindazol-4-yl]piperazine-l -carboxylate (40 mg, 0.077 mmol, 1 equiv) and TFA (43.72 mg, 0.385 mmol, 5 equiv) in DCM (2 mL) was stirred for 1 hr at 25

°C under N2 atmosphere. The residue was purified by reverse flash chromatography (Condition

9, Gradient l) to afford N-{8-fluoro-l,3-dimethylpyrrolo[1,2-a]pyrazin-7-yl}-2-methyl -4- (piperazin-l-yl)indazole-7-carboxamide (Compound 483, 3 mg, 9%) as a solid. LCMS (ES, m/z): 422 [M+H] ⁺ H NMR (300 MHz, DMSO-d ₆ ) δ 11.40 (s, 1H), 9.08 (s, 2H), 8.94 (s, 1H), 8.60 (s, 1H), 8.21 (s, 1H), 8.06 (d, J = 7.8 Hz, 1H), 6.63 (d, J = 8.0 Hz, 1H), 4.28 (s, 3H), 3.62 (s, 4H), 3.35 (s, 4H), 2.80 (s, 3H), 2.34 (s, 3H). Example 211: Synthesis of Compound 485

Synthesis of Intermediate C234 C ₃ 34

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv) and tert-butyl 3-hydroxypyrrolidine-

1-carboxylate (269.8 mg, 1.440 mmol, 3.0 equiv) in dioxane (5 mL) were added K3PO4 (305.9 mg, 1.440 mmol, 3.0 equiv), BINAP (29.9 mg, 0.048 mmol, 0.1 equiv) and Binap Palladacycle Gen. 2 (44.8 mg, 0.048 mmol, 0.1 equiv). After stirring for 12 hr at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography(Condition 3, Gradient 1) to afford tert-butyl 3-{ [2- ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbam oyl)indazol-4-yl]oxy (pyrrolidine- 1-carboxylate (C234, 80 mg, 31%) as a solid. LCMS (ES, m/z): 523 [M+H] ⁺

Synthesis of Compound 485

A solution of tert-butyl 3-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]oxy}pyrrolidine-l-carboxylate (80 mg, 0.153 mmol, 1 equiv) and TFA (0.2 mL, 2.693 mmol) in DCM (2 mL) was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography(Condition 6, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-4-(pyrrolidin-3-yloxy)inda zole-7-carboxamide (Compound 485, 30 mg, 46%) as a solid. LCMS (ES, m z): 423 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.41 (d, J= 1.5 Hz, 1H), 9.29 (s, 1H), 9.13 (s, 1H), 8.68 (s, 1H), 8.10 (d, J= 8.1 Hz, 2H), 7.71 (d, J= 12.0 Hz, 1H), 6.75 (d, J= 8.2 Hz, 1H), 5.43 (s, 1H), 4.64 (q, J= 13 Hz, 2H), 3.65-3.35 (m, 4H), 3.51 (s, 1H), 2.43 (d, J= 0.9 Hz, 3H), 2.41-2.20 (m, 2H), 1.62 (t, J= 13 Hz, 3H).

Example 212: Synthesis of Compound 486 ,

486

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (100.0 mg, 0.24 mmol, 1.0 equiv) and morpholine (43.3 mg, 0.49 mmol, 2.0 equiv) in dioxane (1 mL) were added Cs ₂ CO ₃ (243.0 mg, 0.74 mmol, 3.0 equiv), RuPhos (23.2 mg, 0.05 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (20.7 mg, 0.025 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 100 °C under nitrogen atmosphere. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (10: 1) to afford N-{8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}-2-methyl-4-(morpholin-4-yl)indazole-7-carbox amide (Compound 486, 21 mg, 20%) as a solid. LCMS (ES, m/z): 409 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.08 (s, 1H), 9.22 (d, J= 1.6 Hz, 1H), 8.87 (s, 1H), 8.00 (d, J= 8.0 Hz, 1H), 7.91 (d, J= 2.7 Hz, 1H), 7.35 (dd, J= 12.5, 1.7 Hz, 1H), 6.53 (d, J= 8.1 Hz, 1H), 4.30 (s, 3H), 3.88-3.75 (m, 4H), 3.41 (t, J= 4.8 Hz, 4H), 2.38-2.31 (m, 3H).

Example 213: Synthesis of Compound 487 100 C, 3 h

487

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (100.0 mg, 0.25 mmol, 1.0 equiv) and pyrrolidine (35.3 mg, 0.50 mmol, 2.0 equiv) in dioxane (1 mL) were added Cs ₂ CO ₃ (243.0 mg, 0.74 mmol, 3.0 equiv), RuPhos (23.2 mg, 0.05 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (20.8 mg, 0.025 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 100 °C under nitrogen atmosphere. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (10: 1) to afford N-{8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}-2-methyl-4-(pyrrolidin-l-yl)indazole-7-carbo xamide (Compound 487, 47.5 mg, 48%) as a solid.

LCMS (ES, m/z): 393 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.19 (d, J= 1.7 Hz, 1H), 8.82 (s, 1H), 7.93 (d, J= 8.3 Hz, 1H), 7.88 (d, J= 3.1 Hz, 1H), 7.30 (dd, J= 12.5, 1.7 Hz, 1H), 6.04 (d, J= 8.4 Hz, 1H), 4.27 (s, 3H), 3.64 (t, J= 4.9 Hz,4H), 2.35 (s, 3H), 2.23-1.91 (m, 4H).

Example 214: Synthesis of Compound 488

Synthesis of Intermediate C235

C ₃ 35

To a solution of 6-bromo-3-methyl-[1,2,4]triazolo[4,3-a]pyridine (100 mg, 0.472 mmol, 1 equiv) and tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (203.40 mg, 0.566 mmol, 1.2 equiv) in dioxane (4 mL) were added Cs ₂ CO ₃ (460.9 mg, 1.416 mmol, 3.0 equiv), XantPhos (27.2 mg, 0.047 mmol, 0.1 equiv) and Pd2(dba)3 (43.1 mg, 0.047 mmol, 0.1 equiv). After stirring for 3 h at 100°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford in tert-butyl 4-[2-methyl-7-({3-methyl-[1,2,4]triazolo[4,3- a]pyridin-6-yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (C ₂ 35, 200 mg, 86%) as a solid. LCMS (ES, m/z): 491 [M+H] ⁺

Synthesis of Compound 488 C ₃ 35 488

A solution of tert-butyl 4-[2-methyl-7-({3-methyl-[1,2,4]triazolo[4,3-a]pyridin-6- yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (80 mg, 0.163 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 hr at room temperature. The mixture was basified to pH 8 with NH3(g) in methanol. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford 2- methyl-N-{3-methyl-[1,2,4]triazolo[4,3-a]pyridin-6-yl}-4-(pi perazin-l-yl)indazole-7- carboxamide (Compound 488, 30 mg, 47%) as a solid. LCMS (ES, m/z): 391 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-t/e) 8 11.24 (s, 1H), 9.19-9.12 (m, 1H), 8.82 (s, 1H), 8.00 (d, J= 8.1 Hz, 1H), 7.80 (dd, J= 9.7, 1.0 Hz, 1H), 7.44 (dd, J= 9.7, 1.8 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 4.30 (s, 3H), 3.54 (s, 1H), 3.41-3.33 (m, 4H), 2.92 (d, J= 5.6 Hz, 3H), 2.69 (s, 3H).

Example 215: Synthesis of Compound 489

Synthesis of Intermediate C236 C ₃ 36

To a solution of 7-bromo-2-methyl-[1,2,4]triazolo[l,5-a]pyridine (100 mg, 0.472 mmol, 1 equiv) and tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (203.4 mg, 0.566 mmol, 1.2 equiv) in dioxane (4 mL) were added Cs ₂ CO ₃ (460.9 mg, 1.416 mmol, 3.0 equiv), XantPhos (54.5 mg, 0.094 mmol, 0.2 equiv) and Pd2(dba)3 (27.1 mg, 0.047 mmol, 0.1 equiv). After stirring for 1 hr at 80 °C under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford tert-butyl 4-[2-methyl-7-({2-methyl-[1,2,4]triazolo[l,5- a]pyridin-7-yl}carbamoyl)indazol-4-yl]piperazine-l-carboxyla te (C ₂ 36, 200 mg, 86%) as a solid. LCMS (ES, m/z): 491 [M+H] ⁺ Synthesis of Compound 489

A solution of tert-butyl 4-[2-methyl-7-({2-methyl-[1,2,4]triazolo[l,5-a]pyridin-7- yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (60 mg, 0.122 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 hr at room temperature. The mixture was basified to pH 8 with NH3(g) in methanol. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford 2- methyl-N-{2-methyl-[l, 2, 4]tri azolof l,5-a]pyridin-7-yl}-4-(piperazin-l-yl)indazole-7- carboxamide (Compound 489, 20 mg, 41%) as a solid. LCMS (ES, m/z): 391 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.52 (s, 1H), 8.85-8.73 (m, 2H), 8.34-8.27 (m, 1H), 8.01 (d, J= 8.2 Hz, 1H), 7.31 (dd, J= 7.4, 2.3 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 4.30 (s, 3H), 3.38 (t, J= 4.9 Hz, 4H), 2.92 (t, J= 4.9 Hz, 4H), 2.44 (s, 3H).

Example 216: Synthesis of Compound 490

To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (60.0 mg, 0.122 mmol, 1 equiv) in DCM (2 mL) was added TFA (0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 14, Gradient 2) to afford N- {8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}-4-(piperazin-l-yl)-2H-indazole-7-carboxamide (Compound 490, 22.1 mg, 44%) as a solid. LCMS (ES, m/z): 394 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 13.14 (m, 1H), 10.43 (m, 1H), 9.23-9.17 (m, 1H), 8.88 (s, 2H), 8.38 (s, 1H), 8.12- 8.01 (m, 2H), 7.67 (s, 1H), 6.68 (d, J= 8.2 Hz, 1H), 3.65 (t, J= 5.1 Hz, 4H), 3.37 (m, 4H), 2.42 (s, 3H).

Example 217: Synthesis of Compound 491

Synthesis of Intermediate C237

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (140 mg, 0.336 mmol, 1 equiv), Cs ₂ CO ₃ (329 mg, 1.008 mmol, 3 equiv) and tert-butyl 2,6-diazaspiro[3.4]octane-6-carboxylate (214 mg, 1.008 mmol, 3 equiv) in dioxane (2 mL) were added RuPhos (117 mg, 0.034 mmol, 0.1 equiv) and RuPhos Palladacycle

Gen.3 (112 mg, 0.134 mmol, 0.4 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 hr at 100 °C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA / MeOH (10: 1) to afford tert-butyl 2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-2,6-diazaspiro[3.4]octane-6-carbo xylate (C ₂ 37, 120 mg, 65%) as a solid. LCMS (ES, m/z): 548 [M+H] ⁺

Synthesis of Compound 491 C ₃ 37 491 A solution of tert-butyl 2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-2,6-diazaspiro[3.4]octane-6-carbo xylate (120 mg, 0.219 mmol, 1 equiv) in trifluoroacetic acid (5 mL) and DCM (5 mL) was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7M NHs(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 8) to afford 4-{2,6- diazaspiro[3.4]octan-2-yl}-2-ethyl-N-{8-fluoro-2-methylimida zo[1,2-a]pyridin-6-yl}indazole-7- carboxamide (491, 18 mg, 18%) as an solid. LCMS (ES, m/z): 448 [M+H] ^{+ 1} H NMR (300 MHz, Chloroform-d) δ 11.00 (s, 1H), 9.26 (d, J = 1.6 Hz, 1H), 8.20 (d, J = 8.0 Hz, 1H), 8.00 (s, 1H), 7.47 - 7.39 (m, 1H), 6.83 (dd, J = 11.3, 1.6 Hz, 1H), 5.96 (d, J = 8.1 Hz, 1H), 4.53 (q, J = 7.3 Hz, 2H), 4.23 (d, J = 1.5 Hz, 4H), 3.27 (s, 2H), 3.13 (t, J = 7.1 Hz, 2H), 2.49 (d, J = 0.8 Hz, 3H), 2.18 (t, J = 7.1 Hz, 2H), 1.73 (d, J = 14.6 Hz, 3H).

Example 218: Synthesis of Compound 492

Synthesis of Intermediate C238 C ₃ 38

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (500 mg, 1.201 mmol, 1 equiv) and tert-butyl 2,7- diazaspiro[3.5]nonane-7-carboxylate (407.78 mg, 1.802 mmol, 1.5 equiv) in dioxane (12 mL) were added Cs ₂ CO ₃ (1.17 g, 3.603 mmol, 3.0 equiv), RuPhos (56.1 mg, 0.120 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (200.9 mg, 0.240 mmol, 0.2 equiv). After stirring for 12 hr at 100 °C under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The resulting mixture was diluted with H ₂ O (20 mL). The resulting mixture was extracted with DCM (3 x 20 mL). The combined organic layers were washed with brine (1 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl 2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-2,7-diazaspiro [3.5] nonane-7-carboxylate (C ₂ 38, 500 mg, 74.11%) as a solid. LCMS (ES, m/z): 562 [M+H] ⁺

Synthesis of Compound 492

A solution of tert-butyl 2-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyri din-6- yl}carbamoyl)indazol-4-yl]-2,7-diazaspiro[3.5]nonane-7-carbo xylate (100 mg, 0.178 mmol, 1 equiv) and TFA (0.4 mL) in DCM (4 mL) was stirred for 1 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 7, Gradient 3) to afford 4-{2,7-diazaspiro[3.5]nonan-2-yl}-2-ethyl- N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-ca rboxamide (Compound 492, 40 mg, 48%) as a solid. LCMS (ES, m/z): 462[M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 10.96 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.71 (s, 1H), 7.97-7.86 (m, 2H), 7.27 (dd, J= 12.4, 1.7 Hz, 1H), 5.88 (d, J= 8.2 Hz, 1H), 4.57 (q, J= 7.3 Hz, 2H), 3.97 (s, 4H), 2.69 (s, 4H), 2.35 (s, 3H), 1.72 (d, J= 5.6 Hz, 4H), 1.61 (t, J = 7.3 Hz, 3H).

Example 219: Synthesis of Compound 493

Synthesis of Intermediate C339 C ₃ 39

To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (110 mg, 0.365 mmol, 1 equiv) and tert-butyl (2R,6S)-2,6-dimethylpiperazine-l -carboxylate (93.95 mg, 0.438 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (357.07 mg, 1.095 mmol, 3 equiv), Ruphos (34.09 mg, 0.073 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.55 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-l- yl]-2-ethyl-6-fluoroindazole-7-carboxylate (C ₃ 39, 95 mg, 59%) as a solid. LCMS (ES, m/z): 435 [M+H] ⁺

Synthesis of Intermediate C340 C ₃ 39 C ₃ 40

To a stirred solution of methyl 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-l- yl]-2-ethyl-6-fluoroindazole-7-carboxylate (95 mg, 0.219 mmol, 1 equiv) in THF (1.2 mL) and H ₂ O (0.4 mL) was added lithiumol hydrate (18.35 mg, 0.438 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30 °C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with H ₂ O (5 mL). The mixture was acidified to pH 4 with citric acid and extracted with DCM (3 x lOmL). The combined organic layers were washed with brine (1 x lOmL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(3R,5S)-4-(tert- butoxycarbonyl)-3,5-dimethylpiperazin-l-yl]-2-ethyl-6-fluoro indazole-7-carboxylic acid (C ₃ 40, 85 mg, 92%) as a solid. LCMS (ES, m/z): 419 [M-H] ’ Synthesis of Intermediate C341

C ₃ 40 C ₃ 41

To a stirred mixture of 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-l-y l]-2- ethyl-6-fluoroindazole-7-carboxylic acid (85 mg, 0.202 mmol, 1 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine hydrochloride (44.83 mg, 0.222 mmol, 1.10 equiv) in DCM (2 mL) was added DIEA (130.63 mg, 1.010 mmol, 5 equiv) and HATU (99.92 mg, 0.263 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (2: 1) to afford tert-butyl (2R,6S)-4-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2 -a]pyri din-6- yl}carbamoyl)indazol-4-yl]-2,6-dimethylpiperazine-l-carboxyl ate (C ₃ 41, 80 mg, 69%) as a solid.

LCMS (ES, m/z): 568 [M-H] ’

Synthesis of Compound 493 C ₃ 41 493

To a stirred solution of tert-butyl (2R,6S)-4-[2-ethyl-6-fluoro-7-({8-fluoro-2- methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)indazol-4-yl]-2,6-dimethylpiperazine- 1 - carboxylate (80 mg, 0.141 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep- HPLC (Condition 15, Gradient 3) to afford 4-[(3R,5S)-3,5-dimethylpiperazin-l-yl]-2-ethyl-6- fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazo le-7-carboxamide; trifluoroacetic acid (Compound 493, 31.4 mg, 38%) as a solid. LCMS (ES, m/z): 468 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.40 (s, 1H), 9.19 (s, 1H), 8.91 (s, 1H), 8.56 (d, J= 11.5 Hz, 1H), 8.11 (s, 1H), 7.58 (d, J= 12.2 Hz, 1H), 6.48 (d, J= 14.4 Hz, 1H), 4.52 (q, J = 7.3 Hz, 2H), 4.04 (d, J= 13.2 Hz, 2H), 2.95 (t, J= 12.4 Hz, 2H), 2.44 (d, J= 4.9 Hz, 3H), 1.58 (t, J= 13 Hz, 3H), 1.32 (d, J = 6.4 Hz, 6H).

Example 220: Synthesis of Compound 494

Synthesis of Intermediate C342

To a solution of methyl 4-bromo-2-methylindazole-7-carboxylate (3 g, 11.148 mmol, 1 equiv) and piperazine, 1-methyl- (1.68 g, 16.722 mmol, 1.5 equiv) in dioxane (5 mL) were added Cs ₂ CO ₃ (9.08 g, 27.870 mmol, 2.5 equiv), RuPhos Palladacycle Gen.3 (932 mg, 1.115 mmol, 0.1 equiv) and RuPhos (520 mg, 1.115 mmol, 0.1 equiv). After stirring for 16 hr at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM:MeOH (10: 1) to afford methyl 2-methyl-4-(4-methylpiperazin-l-yl)indazole-7-carboxylate (C342, 2.5 g, 77%) as an oil. LCMS (ES, m/z): 289 [M+H] ⁺ Synthesis of Intermediate C343

A solution of methyl 2-methyl-4-(4-methylpiperazin-l-yl)indazole-7-carboxylate (500 mg,

1.734 mmol, 1 equiv) in NH3(g) in MeOH (40 mL) was stirred for 48 h at 100°C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM:MeOH (10:1) to afford 2-methyl-4-(4-methylpiperazin-l- yl)indazole-7-carboxamide (400 mg, 84.39%) as a solid. LCMS (ES, m/z): 274 [M+H] ⁺ Synthesis of Intermediate C344 C ₃ 44

To a solution of 2-methyl-4-(4-methylpiperazin-l-yl)indazole-7-carboxamide (300 mg, 1.098 mmol, 1 equiv) and 6-bromo-4-fluoro-2-(m ethoxymethyl)- 1,3 -benzoxazole (428 mg, 1.647 mmol, 1.5 equiv) in dioxane (10 mL), were added Cs ₂ CO ₃ (893.99 mg, 2.745 mmol, 2.5 equiv), Pd2(dba)3 (100 mg, 0.110 mmol, 0.1 equiv) and XantPhos (63 mg, 0.110 mmol, 0.1 equiv). After stirring for 4 h at 100°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM:MeOH (10:1) to afford N-[4-fluoro-2-(methoxymethyl)-l,3- benzoxazol-6-yl]-2-methyl-4-(4-methylpiperazin-l-yl)indazole -7-carboxamide (C ₃ 43, 200 mg, 40%) as a solid. ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.24 (s, 1H), 8.80 (s, 1H), 7.96 (d, J= 8.1 Hz, 1H), 7.41 (dd, J= 12.2, 2.2 Hz, 1H), 7.24 (t, J= 1.7 Hz, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.72 (s, 2H), 4.28 (s, 3H), 3.91 (s, 3H), 3.42 (t, J= 4.9 Hz, 4H), 2.54 (d, J= 5.1 Hz, 4H), 2.27 (s, 3H). Synthesis of Compound 494 To a stirred solution of N-[4-fluoro-2-(methoxymethyl)-l,3-benzoxazol-6-yl]-2-methyl- 4- (4-methylpiperazin-l-yl)indazole-7-carboxamide (150 mg, 0.331 mmol, 1 equiv) in DCM (5 mL) was added TFA (1 mL) dropwise at room temperature. The resulting mixture was stirred for 2h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by trituration with DMSO (5 mL) to afford N-[4-fluoro-2-(hydroxymethyl)- l,3-benzoxazol-6-yl]-2-methyl-4-(4-methylpiperazin-l-yl)inda zole-7-carboxamide (Compound 494, 120 mg, 82%) as a solid. LCMS (ES, m/z): 439 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 10.96 (s, 1H), 8.76 (s, 1H), 7.93 (d, J= 8.0 Hz, 1H), 7.20 (dd, J= 12.6, 2.3 Hz, 1H), 6.93 (t, J= 1.9 Hz, 1H), 6.47 (d, J= 8.2 Hz, 1H), 4.27 (s, 3H), 4.20 (s, 2H), 3.39 (t, J= 5.0 Hz, 4H), 2.53 (d, J= 5.6 Hz, 4H), 2.27 (s, 3H).

Example 221: Synthesis of Compound 495

Synthesis of Intermediate C345 C ₈₂ CO ₃ , dioxane C ₃ 45

A solution of 7-bromo-2-methyl-[1,2,4]triazolo[l,5-a]pyridine (1.6 g, 7.545 mmol, 1 equiv) in dioxane (30 mL) was treated with acetamide (0.89 g, 15.090 mmol, 2 equiv), Pd(OAc)2 (0.17 g, 0.755 mmol, 0.1 equiv) X-Phos (0.72 g, 1.509 mmol, 0.2 equiv), Cs ₂ CO ₃ (4.92 g, 15.090 mmol, 2 equiv) for 8 hr at 100 °C under nitrogen atmosphere. The resulting mixture was washed with NaHCO3 (3 x 100 mL). The residue was purified by silica gel column chromatography, eluted with PE:EA (50%) to afford N-{2-methyl-[1,2,4]triazolo[l,5-a]pyridin-7-yl}acetamide (2 g, 77%) as a solid. LCMS (ES, m/z): 191 [M+H] ⁺

Synthesis of Intermediate C346 C ₃ 45 C ₃ 46

A solution of N-{2-methyl-[1,2,4]triazolo[l,5-a]pyridin-7-yl}acetamide (1.6 g, 8.412 mmol, 1 equiv) in EtOH (200 mL) was treated with PtCF (0.80 g, 3.533 mmol, 0.42 equiv), TFA (0.80 g, 6.982 mmol, 0.83 equiv) for 16 hr at 100 °C under H2 (30 atm). The resulting mixture was filtered, the filter cake was washed with 100 mL of methanol. The filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA/PE 1 :3 to afford N-{2-methyl-5H,6H,7H,8H-[l, 2, 4]triazolo[l,5-a]pyridin-7- yl}acetamide (C ₃ 46, 1 g, 61%, crude) as an oil. LCMS (ES, m/z): 195 [M+H] ⁺

Synthesis of Intermediate C347 C ₃ 46 C ₃ 47

A solution of N-{2-methyl-5H,6H,7H,8H-[1,2,4]triazolo[l,5-a]pyridin-7-yl}a cetamide (300 mg, 1.544 mmol, 1 equiv) in methanol (5 mL) was treated with HCl (5 mL, 15.000 mmol, 9.71 equiv) for 1 hr at 20 °C. The residue was acidified to pH 7 with ammonia. The residue was purified by reverse flash chromatography (Condition 1, Gradient 1) to afford 2-methyl-

5H,6H,7H,8H-[1,2,4]triazolo[l,5-a]pyridin-7-amine (C347, 200 mg, 85%) as a solid. LCMS

(ES, m/z): 153 [M+H] ⁺

Synthesis of Intermediate C348 C ₃ 48

A solution of 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-methylindazole-7 -carboxylic acid (100 mg, 0.277 mmol, 1.00 equiv) in DMF (5 mL) was treated with 2-methyl-5H,6H,7H,8H- [1,2,4]triazolo[l,5-a]pyridin-7-amine (42 mg, 0.277 mmol, 1.00 equiv), HATU (126 mg, 0.332 mmol, 1.20 equiv), DIEA (107 mg, 0.828 mmol, 2.99 equiv) for 2 hours at 20 °C. The residue was purified by reverse flash chromatography (Condition 1, Gradient 1) to afford tert-butyl 4-[2- methyl-7-({2-methyl-5H,6H,7H,8H-[1,2,4]triazolo[l,5-a]pyridi n-7-yl}carbamoyl)indazol-4- yl]piperazine-l-carboxylate-(C ₃ 48, 60 mg, 43%) as a solid. LCMS (ES, m/z): 495 [M+H] ⁺ Synthesis of Compound 495 C ₃ 48 495

A solution of tert-butyl-4-[2-methyl-7-({2-methyl-5H,6H,7H,8H-[1,2,4]triaz olo[l,5- a]pyridin-7-yl}carbamoyl)indazol-4-yl]piperazine-l-carboxyla te (100 mg, 0.202 mmol, 1 equiv) in DCM (5 mL) was treated with HCl (gas) in 1,4-dioxane (10 mL, 329.128 mmol, 1627.87 equiv) for 30 mins at 20°C. Desired product could be detected by LCMS. The mixture was neutralized to pH 7 with NaHCO3. The resulting solution was dried N2 gas. The residue was purified by prep-(Condition 16, Gradient 1) to afford 2-methyl-N-{2-methyl-5H,6H,7H,8H- [1,2,4]triazolo[l,5-a]pyridin-7-yl}-4-(piperazin-l-yl)indazo le-7-carboxamide (Compound 495, 6 mg, 7%) as a solid.

LCMS (ES, m/z): 395 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 9.21 (d, J = 7.1 Hz, 1H), 8.67 (s, 1H), 7.87 (d, J = 7.9 Hz, 1H), 6.41 (d, J = 8.1 Hz, 1H), 4.52 (t, J = 7.2 Hz, 1H), 4.20 (hept, J = 7.6, 6.7 Hz, 2H), 4.11 (s, 3H), 3.26 (t, J = 5.0 Hz, 5H), 3.17 (d, J = 5.4 Hz, 2H), 2.91 (dt, J = 9.5, 5.4 Hz, 4H), 2.55 - 2.47 (m, 1H), 2.39 - 2.23 (m, 1H), 2.28 (s, 1H), 2.21 (s, 3H).

Example 222: Synthesis of Compound 435

Synthesis of Intermediate C349 C ₃ 49

To a stirred solution of 4-bromo-2H- 1,2, 3 -benzotri azole (2.7 g, 13.635 mmol, 1.0 equiv) and K ₂ CO ₃ (3.8 g, 27.270 mmol, 2.0 equiv) in dimethylformamide (60 mL) were added methyl iodide (2.9 g, 20.453 mmol, 1.5 equiv) dropwise at 0 °C. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was diluted with water (200 mL). The resulting mixture was extracted with ethyl acetate (2 x 200 mL). The combined organic layers were washed with water (2 x 200 mL), brine (2 x 200 mL) and dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / PE (5: 1) to afford 4-bromo-l-methyl-1,2,3- benzotriazole (C349, 0.8 g, 25%) as a solid. LCMS (ES, m/z): 212 [M+H] ⁺

Synthesis of Intermediate C350 , , C ₃ 49 C ₃ 50

To a solution of 4-bromo-l -methyl- 1,2, 3 -benzotri azole (0.8 g, 3.773 mmol, 1.0 equiv) and tert-butyl piperazine- 1 -carboxylate (0.9 g, 4.905 mmol, 1.3 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (3.0 g, 9.433 mmol, 2.5 equiv) and Ruphos (0.3 g, 0.755 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (0.2 g, 0.377 mmol, 0.1 equiv). After stirring for 2 hr at 80 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-(l-methyl-1,2,3-benzotriazol-4-yl) piperazine- 1 -carboxylate (C ₃ 50, 0.83 g, 63%) as a solid. LCMS (ES, m/z): 318 [M+H] ⁺

Synthesis of Intermediate C351 C ₃ 50 C ₃ 51

To a stirred solution of tert-butyl 4-(l-methyl-1,2,3-benzotriazol-4-yl) piperazine-1- carboxylate (850.0 mg, 2.678 mmol, 1.0 equiv) in ACN (15 mL) were added NBS (524.3 mg, 2.946 mmol, 1.1 equiv) in portions at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was diluted with deionized water (30 mL). The resulting mixture was extracted with ethyl acetate (2 x 40mL). The combined organic layers were washed with water (2 x 30 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to affordtert-butyl 4-(7-bromo-l-methyl-1,2,3- benzotriazol-4-yl) piperazine- 1 -carboxylate (C ₃ 51 800 mg, 69%) as a solid. LCMS (ES, m/z):

396 [M+H] ⁺

Synthesis of Intermediate C352 C ₃ 51 C ₃ 52

To a solution of tert-butyl 4-(7-bromo-l-methyl-1,2,3-benzotriazol-4-yl)piperazine-l- carboxylate (250 .Omg, 0.631 mmol, 1.0 equiv) in MeOH (20 mL) was added Pd(dppf)Cl ₂ (46.1 mg, 0.063 mmol, 0.1 equiv), TEA (191.5 mg, 1.893 mmol, 3.0 equiv) in a pressure tank. The mixture was purged with nitrogen for 2 min and then was pressurized to 2 Mpa with carbon monoxide at 80 °C for 16 hr. The reaction mixture was cooled to room temperature and filtered to remove insoluble solids. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / MeOH (30: 1) to afford methyl 7-[4-(tert-butoxycarbonyl) piperazin-l-yl]-3-methyl-1,2,3-benzotriazole-4- carboxylate (240.0 mg, 94.24%) as a solid. LCMS (ES, m/z): 376 [M+H] ⁺ Synthesis of Intermediate C353 C ₃ 52 C ₃ 53

To a stirred mixture of methyl 7-[4-(tert-butoxy carbonyl) piperazin-l-yl]-3-methyl-1,2,3- benzotriazole-4-carboxylate (170.0 mg, 0.453 mmol, 1.0 equiv) in tetrahydrofuran (3 mL) and water (3 mL) was added LiOH.H ₂ O (108.4 mg, 4.530 mmol, 10.0 equiv) in portions at room temperature. The resulting mixture was stirred for 3 hr at 50 °C. The resulting mixture was diluted with water (20 mL). The mixture was acidified to pH 6 with HCl (1 N). The resulting mixture was extracted with ethyl acetate (2 x 30mL). The combined organic layers were washed with brine (1x20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The resulting mixture was concentrated under reduced pressure. This resulted in 7-[4-(tert-butoxycarbonyl) piperazin-l-yl]-3-methyl-1,2,3- benzotri azole- 4-carboxylic acid (C ₃ 53, 150 mg, 85%) as a solid. LCMS (ES, m/z): 362 [M+H] ⁺ Synthesis of Intermediate C354 C ₃ 53 C ₃ 54

To a stirred solution of 7-[4-(tert-butoxy carbonyl) piperazin-l-yl]-3-methyl-1,2,3- benzotri azole- 4-carboxylic acid (110.0 mg, 0.304 mmol, 1.0 equiv) and 8-fluoro-2- methylimidazo[1,2-a] pyridin-6-amine (75.4 mg, 0.456 mmol, 1.5 equiv) in ACN (3 mL) were added TCFH (111.0 mg, 0.395 mmol, 1.3 equiv) and NMI (64.8 mg, 0.790 mmol, 2.6 equiv) in portions at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was extracted with ethyl acetate (2 x 20mL). The combined organic layers were washed with brine (2 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. This resulted in tert-butyl 4-[7-({8-fluoro-2- methylimidazo[1,2-a] pyridin-6-yl} carbamoyl)-l-methyl-1,2,3- benzotriazol-4-yl]piperazine-l- carboxylate (C ₃ 54, 110 mg, 66%) as a solid. LCMS (ES, m/z): 509 [M+H] ⁺ Synthesis of Compound 435 C ₃ 54 435

To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a] pyridin-6- yl} carbamoyl)-! -methyl-1,2,3-benzotriazol-4-yl]piperazine-l-carboxylate (100.0 mg, 0.197 mmol, 1.0 equiv) in DCM (2 mL) was added TFA(0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 hr at room temperatureThe resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient l) to afford N-{8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl}-3-methyl-7-(piperazin- 1-yl)- 1,2,3-benzotriazole-4-carboxamide (Compound 435, 26.8 mg, 32%) as a solid. LCMS (ES, m, z):409 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 10.87 (s, 1H), 9.18 (d, J= 1.7 Hz, 1H), 8.00 (d, J= 7.9 Hz, 1H), 7.93 (dd, J= 3.2, 1.0 Hz, 1H), 7.39 (dd, J= 12.4, 1.7 Hz, 1H), 7.24 (d, J = 7.9 Hz, 1H), 4.58 (s, 3H), 3.04-2.97 (m, 8H), 2.36 (s, 3H).

Example 223: Synthesis of Compound 436

Synthesis of Intermediate C355 C ₃ 55

To a stirred solution of 4-bromo-2H- 1,2, 3 -benzotri azole (2.7 g, 13.635 mmol, 1.0 equiv) and K ₂ CO ₃ (3.8 g, 27.270 mmol, 2.0 equiv) in dimethylformamide (60 mL) were added methyl iodide (2.9 g, 20.453 mmol, 1.5 equiv) dropwise at 0°C. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was diluted with deionized water (100 mL). The resulting mixture was extracted with ethyl acetate (2 x 100 mL). The combined organic layers were washed with brine (2 x 100 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Q2 / PE (5: 1) to afford 7-bromo-l-methyl-1,2,3-benzotriazole (C355, 1 g, 31%) as a solid. LCMS (ES, m/z): 212 [M+H] ⁺ Synthesis of Intermediate C356 dioxane, 80 C, 4 h C ₃ 55 C ₃ 56 To a solution of 7-bromo-l-methyl-1,2,3-benzotriazole (0.8 g, 3.773 mmol, 1.0 equiv) and tert-butyl piperazine- 1 -carboxylate (0.91 g, 4.905 mmol, 1.3 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (3.1 g, 9.433 mmol, 2.5 equiv) and Ruphos (0.3 g, 0.755 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (0.2 g, 0.377 mmol, 0.1 equiv). After stirring for 2 h at 80°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-(3 -methyl- 1,2, 3 -benzotriazol-4-yl) piperazine- 1 -carboxylate (C356, 780 mg, 61%) as a solid. LCMS (ES, m/z): 318 [M+H] ⁺ Synthesis of Intermediate C357 C ₃ 56 C ₃ 57

To a stirred solution of tert-butyl 4-(3-methyl-1,2,3-benzotriazol-4-yl) piperazine-1- carboxylate (850.0 mg, 2.678 mmol, 1.0 equiv) in ACN (15 mL) were added NBS (524.3 mg, 2.946 mmol, 1.1 equiv) in portions at room temperature. The resulting mixture was diluted with water (30 mL). The resulting mixture was extracted with ethyl acetate (2 x 40mL). The combined organic layers were washed with brine (1 x 30 mL), dried over anhydrous Na ₂ SO ₄ .

After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford tert-butyl 4-(7-bromo-3- methyl-1,2,3-benzotriazol-4-yl)piperazine-l-carboxylate (C357, 830 mg, 72%) as a solid..

LCMS (ES, m/z): 396 [M+H] ⁺

Synthesis of Intermediate C358

To a solution of tert-butyl 4-(7-bromo-3-methyl-1,2,3-benzotriazol-4-yl) piperazine-1- carboxylate (250 mg, 0.631 mmol, 1 equiv) in 20 mL MeOH was added Pd(dppf)Cl ₂ CH ₂ Cl ₂ (46.1 mg, 0.063 mmol, 0.1 equiv), TEA (191.5 mg, 1.893 mmol, 3.0 equiv) in a pressure tank. The mixture was purged with nitrogen for 2 min and then was pressurized to 2 Mpa with carbon monoxide at 80 °C for 16 hr. The reaction mixture was cooled to room temperature and filtered to remove insoluble solids. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2 C12 / MeOH (30: 1) to afford methyl 7-[4-(tert-butoxycarbonyl)piperazin-l-yl]-l-methyl-1,2,3-ben zotriazole-4- carboxylate (C358, 230 mg, 87%) as a solid. LCMS (ES, m/z): 376 [M+H] ⁺

Synthesis of Intermediate C359 C ₃ 58 C ₃ 59

To a stirred mixture of methyl 7-[4-(tert-butoxy carbonyl) piperazin-l-yl]-l-methyl-1,2,3- benzotriazole-4-carboxylate (170.0 mg, 0.453 mmol, 1.0 equiv) in tetrahydrofuran (3 mL) and water (3 mL) was added LiOH.H2O (108.4 mg, 4.530 mmol, 10.0 equiv) in portions at room temperature. The resulting mixture was stirred for 3 hr at 50 °C. The resulting mixture was diluted with deionized water (20 mL). The mixture was acidified to pH 6 with HCl (1 N). The resulting mixture was extracted with ethyl acetate (2 x 30 mL). The combined organic layers were washed with brine (1 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The resulting mixture was concentrated under reduced pressure. This resulted in 7-[4-(tert-butoxycarbonyl) piperazin-l-yl]-l-methyl-1,2,3- benzotri azole- 4-carboxylic acid (C359, 145 mg, 83%) as a solid. LCMS (ES, m/z): 362 [M+H] ⁺ Synthesis of Intermediate C360 C359 C ₃ 60 To a stirred solution of 7-[4-(tert-butoxycarbonyl) piperazin-l-yl]-l-methyl-1,2,3- benzotri azole- 4-carboxylic acid (110.0 mg, 0.304 mmol, 1.0 equiv) and 8-fluoro-2- methylimidazo[1,2-a] pyridin-6-amine (75.4 mg, 0.456 mmol, 1.5 equiv) in ACN (3 mL) were added TCFH (111.0 mg, 0.395 mmol, 1.3 equiv) and NMI (64.8 mg, 0.790 mmol, 2.6 equiv) in portions at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was extracted with ethyl acetate (2 x 20 mL). The combined organic layers were washed with brine (2 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. This resulted in tert-butyl 4-[7-({8-fluoro-2- methylimidazo[1,2-a] pyridin-6-yl} carbamoyl)-3-methyl-1,2,3- benzotriazol-4-yl]piperazine-l- carboxylate (C ₃ 60, 120 mg, 72%) as a solid. LCMS (ES, m z): 509 [M+H] ⁺

Synthesis of Compound 436 C ₃ 60 436

To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a] pyridin-6- yl} carbarnoyl)-3- methyl-1,2,3-benzotriazol-4-yl]piperazine-l-carboxylate (100.0 mg, 0.197 mmol, 1.0 equiv) in DCM (2 mL) was added TFA (0.5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient l) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-l-methyl-7- (piperazin- l-yl)-1,2,3-benzotriazole-4-carboxamide (Compound 436, 41.4 mg, 51%) as a solid. LCMS (ES, m, z):409 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 10.53 (s, 1H), 9.14 (d, J= 1.6 Hz, 1H), 7.98-7.91 (m, 1H), 7.75 (d, J= 8.2 Hz, 1H), 7.27 (dd, J= 12.7, 1.6 Hz, 1H), 6.67 (d, J= 8.3 Hz, 1H), 4.31 (s, 3H), 3.80 (dd, J= 6.1, 3.9 Hz, 4H), 2.94 (dd, J= 6.2, 3.8 Hz, 4H), 2.35 (d, J = 0.8 Hz, 3H).

Example 224: Synthesis of Compound 448

Synthesis of Intermediate C361

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (110 mg, 0.273 mmol, 1 equiv) and tert-butyl N-methyl-N- (piperidin-4-yl)carbamate (70.33 mg, 0.328 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (267.31 mg, 0.819 mmol, 3 equiv), RuPhos (25.52 mg, 0.055 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (22.87 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 hr at 80 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (10: 1) to afford tertbutyl N-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-methylindazol-4- yl]piperidin-4-yl}-N-methylcarbamate (C ₄ 61, 80 mg, 54%) as a solid. LCMS (ES, m z): 536 [M+H] ⁺

Synthesis of Compound 448

To a stirred solution of tert-butyl N-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperidin-4-yl}-N-methylcar bamate (80 mg, 0.149 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 hr at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 13) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[ 4-(methylamino)piperidin-l- yl]indazole-7-carboxamide (Compound 448, 29 mg, 44%) as a solid. LCMS (ES, m/z): 436 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.06 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.77 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.34 (dd, J= 12.4, 1.7 Hz, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.30 (s, 3H), 3.88 (d, J= 12.9 Hz, 2H), 3.13 - 3.02 (m, 2H), 2.61 - 2.52 (m, 1H), 2.35 (s, 3H), 2.33 (s, 3H), 2.01 - 1.93 (m, 2H), 1.41 (dd, J= 16.9, 7.3 Hz, 2H).

Example 225: Synthesis of Compound 449

373 449

Compound 373 (50 mg) was purified by Prep-Chiral HPLC (Condition 17, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[(3S)-3-{[ l- (fluoromethyl)cyclopropyl]amino}pyrrolidin-l-yl]-2-methylind azole-7-carboxamide (Compound 449, 15.1 mg, 29%, assumed) as a solid. LCMS (ES, m/z): 480 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 9.05 (s, 1H), 8.55 (s, 1H), 8.04 (d, J= 8.7 Hz, 1H), 7.72 (s, 1H), 7.24 (d, J= 11.8 Hz, 1H), 6.07 (d, J= 8.3 Hz, 1H), 4.52 (s, 1H), 4.40 (s, 1H), 4.30 (s, 3H), 3.90 (d, J= 6.0 Hz, 3H), 3.84 (s, 1H), 3.72 (d, J = 9.7 Hz, 1H), 2.44 (s, 3H), 2.36 - 2.31 (m, 1H), 2.05 (s, 1H), 0.82 - 0.70 (m, 4H).

Example 226: Synthesis of Compound 461

373 461 Compound 373 (50 mg) was purified by Prep-Chiral HPLC (Condition 17, Gradient 1) to affordN- { 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -4-[(3R)-3 - { [ 1 - (fluoromethyl)cyclopropyl]amino}pyrrolidin-l-yl]-2-methylind azole-7-carboxamide (Compound 461, 17.9 mg, 33%) as a solid. LCMS (ES, m/z): 480 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 9.02 (d, J= 1.7 Hz, 1H), 8.51 (s, 1H), 8.03 (d, J= 8.5 Hz, 1H), 7.70 (d, J= 2.9 Hz, 1H), 7.18 (d, J= 11.9 Hz, 1H), 6.04 (d, J = 8.4 Hz, 1H), 4.52 (s, 1H), 4.40 (s, 1H), 4.29 (s, 3H), 3.94 - 3.76 (m, 3H), 3.69 (q, J= 8.1 Hz, 1H), 3.47 (s, 1H), 2.44 (d, J= 0.9 Hz, 3H), 2.33 (dd, J = 12.1, 6.4 Hz, 1H), 2.04 (dd, J= 12.4, 6.7 Hz, 1H), 0.85 - 0.66 (m, 4H).

Example 227: Synthesis of Compounds

4- [3 -(dimethylamino)pyrrolidin- 1 -yl]-N- { 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2- methylindazole-7-carboxamide (20 mg) was purified by PREP-CHIRAL-HPLC with the following conditions (Column: CHIRAL ART cell ulose-SB, 2 x 25 cm, 5 um; Mobile Phase A: MtBE(0.1% DEA)-HPLC-Imported, Mobile Phase B: EtOH— HPLC; Flow rate: 20 mL/min; Gradient: 10% B to 10% B in 7.5 min; Wave Length: 220/254 nm; RTl(min): 5.9; RT2(min): 6.4; Sample Solvent: MeOH: DCM=2: 1; Injection Volume: 0.2 mL; Number Of Runs: 18) to afford Compound 351(5 mg) as a solid and Compound 350(Second peak, 5 mg) as a solid. Compound 351: LCMS: (ES, m, z):436 [M+H] ^{+ 1} H NMR: (400 MHz, DMSO-d ₆ ) δ 11.02 (d, J = 2.4 Hz, 1H), 9.20 (t, J = 2.1 Hz, 1H), 8.87 (d, J = 2.4 Hz, 1H), 7.97 - 7.86 (m, 2H), 7.36 - 7.28 (m, 1H), 6.05 (dd, J = 8.3, 2.4 Hz, 1H), 4.28 (d, J = 2.4 Hz, 3H), 3.85 (s, 1H), 3.77 (s, 1H), 3.65 (d, J = 9.3 Hz, 1H), 3.46 (s, 2H), 2.89 (s, 1H), 2.35 (d, J = 2.4 Hz, 6H), 2.29 (s, 3H), 1.92 (s, 1H). Compound 350 LCMS: (ES, m, z):436 [M+H] ^{+ 1} H NMR: (400 MHz, DMSO-d ₆ ) δ 11.02 (s, 1H), 9.20 (d, J = 1.7 Hz, 1H), 8.87 (s, 1H), 7.96 - 7.86 (m, 2H), 7.31 (dd, J = 12.4, 1.7 Hz, 1H), 6.05 (d, J = 8.4 Hz, 1H), 4.28 (s, 3H), 3.85 (t, J = 8.6 Hz, 1H), 3.77 (t, J = 9.4 Hz, 1H), 3.64 (q, J = 8.9 Hz, 1H), 3.48 (d, J = 9.0 Hz, 2H), 2.91 (s, 1H), 2.37 - 2.33 (m, 3H), 2.29 (s, 6H), 1.92 (t, J = 10.3 Hz, 1H).

Example 228: Synthesis of Compound 304 Synthesis of Intermediate C363

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (100 mg, 0.20 mmol, 1.0 equiv) and 4- iodooxane (64.4 mg, 0.30 mmol, 1.5 equiv) in DMF (1 mL) were added Cs ₂ CO ₃ (198.0 mg, 0.61 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The reaction was quenched by the addition of water at room temperature. The resulting mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with brine (1x5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl} carbarnoyl)-2-(oxan-4-yl)indazol-4-yl]piperazine-l -carboxylate (41 mg, 35%) as a solid. LCMS (ES, m/z): 578 [M+H] ⁺

Synthesis of Compound 304

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-(oxan-4-yl)indazol-4-yl]piperazine-l -carboxylate (40 mg, 0.07 mmol, 1.0 equiv) in DCM (0.4 mL) was added TFA (0.4 mL) at room temperature .The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 14, Gradient 1) to afford N- { 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2-(oxan-4-yl)-4-(piperazin- 1 -yl)indazole-7 - carboxamide trifluoroacetic acid salt (22.8 mg, 50%) as a solid. LCMS (ES, m/z): 478 [M+H] ⁺ Hl NMR (300 MHz, DMSO-d ₆ ) δ 11.17 (s, 1H), 9.44 (d, J= 1.6 Hz, 1H), 9.15 (s, 2H), 9.00 (s, 1H), 8.13 (d, J= 2.6 Hz, 1H), 8.04 (d, J= 8.0 Hz, 1H), 7.71 (dd, J= 11.8, 1.6 Hz, 1H), 6.62 (d, J = 8.1 Hz, 1H), 4.95 (tt, J= 10.4, 5.5 Hz, 1H), 4.10 (dt, J= 11.2, 3.2 Hz, 2H), 3.69-3.51 (m, 6H), 3.37-3.35 (m, 4H), 2.44 (s, 3H), 2.25 (td, J= 10.3, 9.5, 4.1 Hz, 4H).

Example 229: Synthesis of Compound 342

Synthesis of Intermediate C365

To a stirred mixture of methyl 4-bromo-2H-indazole-7-carboxylate (5.0 g, 19.602 mmol, 1 equiv) and in EA (150 mL) was added tetrafluoroboranuide; trimethyloxidanium (14.50 g, 98.010 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 3h at room temperature. The resulting mixture was diluted with EA (150mL) and washed with water (3x200 mL). The organic phase was dried over anhydrous Na2SO4. After filtration, the filtrate was concentrated under reduced pressure to afford methyl 4-bromo-2-methylindazole- 7-carboxylate (4.8 g, 91%) as a solid. LCMS (ES, m/z): 269[M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 8.62 (s, 1H), 7.84 (d, J= 7.6 Hz, 1H), 7.42 (d, J= 7.7 Hz, 1H), 4.25 (s, 3H), 3.89 (s, 3H).

Synthesis of Intermediate C366 To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (4.5 g, 16.723 mmol, 1 equiv) and tert-butyl piperazine- 1 -carboxylate (6.23 g, 33.446 mmol, 2 equiv) in dioxane (90 mL) was added Cs2CO ₃ (16.35 g, 50.169 mmol, 3 equiv), RuPhos (1.56 g, 3.345 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (1.40 g, 1.672 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for

2h at 100°C under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-methylindazole-7 -carboxylate (5.2 g, 83%) as a solid. LCMS (ES, m/z)-. 375[M+H] ⁺

Synthesis of Intermediate C367

A solution of methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-methylindazole-7 - carboxylate (2.5 g, 6.677 mmol, 1 equiv) in NH3(g) in MeOH (70 mL) was stirred for 2days at 100°C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 1) to afford tert-butyl 4-(7- carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (1.35 g, 56%) as an solid.

LCMS (ES, m/z): 360[M+H] ⁺

Synthesis of Intermediate C368 To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l-carboxylate (60 mg, 0.167 mmol, 1 equiv) and 6-bromo-8-methoxy-2-methylimidazo[1,2-a]pyrazine (48.49 mg, 0.200 mmol, 1.2 equiv) in dioxane (2 mL) and Cs ₂ CO ₃ (108.78 mg, 0.334 mmol, 2 equiv) were added Xantphos (19.32 mg, 0.033 mmol, 0.2 equiv) and Pd2(dba)3 (15.29 mg, 0.017 mmol, 0.1 equiv). After stirring for overnight at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :2) to afford tert-butyl 4-[7-({8-methoxy-2- methylimidazof 1 ,2-a]pyrazin-6-yl } carbarnoyl)-2-methylindazol-4-yl]piperazine- 1 -carboxylate (35 mg, 40%) as a solid. LCMS (ES, m/z): 521 [M+H] ⁺

Synthesis of Compound 342 C ₃ 68 342

A solution of tert-butyl 4-[7-({8-methoxy-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoy l)- 2-methylindazol-4-yl]piperazine-l -carboxylate (20 mg, 0.038 mmol, 1 equiv) in 1,4-di oxane was treated with HBr in AcOH (0.5 mL, 17.117 mmol, 445.56 equiv) for 2 h at 80 °C. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep- HPLC (Condition 17, Gradient 1) to afford N-{8-hydroxy -2-methylimidazo[ 1, 2-a]pyrazin-6-yl }- 2-methyl-4-(piperazin-l-yl)indazole-7-carboxamide (6.5 mg, 31%) as a solid . LCMS (ES, m/z): 407 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 10.94 (s, 1H), 8.90 (s, 3H), 8.33 (s, 1H), 8.01 (d, J= 8.0 Hz, 1H), 7.78 (s, 1H), 6.61 (d, J= 8.1 Hz, 1H), 4.30 (s, 3H), 3.62 (t, 4H), 3.35 (t, 4H), 2.34 (s, 3H). ¹⁹ F NMR (400 MHz, DMSO-d ₆ ) δ -73.89

Example 230: Synthesis of Compound 393

Synthesis of IntermediateC370 C ₃ 69 C ₃ 70

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (180 mg, 0.43 mmol, 1 equiv) and tert-butyl (R)-methyl(pyrrolidin- 3-yl)carbamate (87 mg, 0.43 mmol, 1 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (423 mg, 1.29 mmol, 3 equiv), RuPhos (41 mg, 0.086 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90°C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The resulting mixture was added H ₂ O (20 mL) and extracted with EtOAc (3 x 10 mL). The combined organic layers were washed with brine (1 x 30 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl (R)-(l-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2-a]pyridin-6 - yl)carbamoyl)-2H-indazol-4-yl)pyrrolidin-3-yl)(methyl)carbam ate (160 mg, 69%) as a solid.LCMS (ES, m/z): 536 [M+H] ⁺

Synthesis of Compound 393 C ₃ 70 393

A solution of tert-butyl tert-butyl (R)-(l-(2-ethyl-7-((8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl)carbamoyl)-2H-indazol-4-yl)pyrrolidin-3-yl)(m ethyl)carbamate (135 mg, 0.25 mmol, 1 equiv) in trifluoroacetic acid (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (Condition 12, Gradient 3) to afford (R)-2-ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)- 4-(3-(methylamino)pyrrolidin-l- yl)-2H-indazole-7-carboxamide (12 mg, 11%) as a solid. LCMS (ES, m/z): 436 [M+H] ⁺ 1H NMR (300 MHz, DMSO-d ₆ ) δ 11.05 (s, 1H), 9.19 (d, J = 1.6 Hz, 1H), 8.84 (s, 1H), 7.97 - 7.85 (m, 2H), 7.26 (dd, J = 12.4, 1.6 Hz, 1H), 6.01 (d, J = 8.4 Hz, 1H), 4.57 (q, J = 7.3 Hz, 2H), 3.76 (dq, J = 13.7, 7.1, 6.3 Hz, 1H), 3.65 (d, J = 7.4 Hz, 3H), 3.42 (dd, J = 10.2, 4.0 Hz, 2H), 2.35 (s, 6H), 2.14 (dd, J = 11.2, 4.5 Hz, 1H), 1.92 (dd, J = 11.8, 6.1 Hz, 1H), 1.61 (t, J = 7.2 Hz, 3H).

Example 231: Synthesis of Compound 423

Synthesis of Intermediate C371 C ₃ 69 C ₃ 71

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (180 mg, 0.432 mmol, 1 equiv) and tert-butyl N-methyl-N-(4- methylpiperidin-4-yl)carbamate (99 mg, 0.432 mmol, 1 equiv) in dioxane (5 mL) were added Cs ₂ CO ₃ (423 mg, 1.296 mmol, 3 equiv), RuPhos (40 mg, 0.086 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (36 mg, 0.043 mmol, 0.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 90 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 10) to afford tert-butyl N-{ l-[2-ethyl-7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]-4-m ethylpiperidin-4-yl}-N- methylcarbamate (210 mg, 86%) as a solid. LCMS (ES, m/z): 564 [M+H] ⁺

Synthesis of Compound 423 C ₃ 71 423

A solution of tert-butyl N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-4-methylpiperidin-4-yl}-N-methylc arbamate (200 mg, 0.355 mmol, 1 equiv) in TFA (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NH3(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 8) to afford 2-ethyl-N-{8- fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -4-[4-methyl-4-(methylamino)piperidin- 1 - yl]indazole-7-carboxamide (50 mg, 30%) as a solid. LCMS (ES, m/zy 464 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.20 (d, J= 1.6 Hz, 1H), 8.80 (s, 1H), 7.96 (d, J= 8.1 Hz, 1H), 7.90 (dd, J= 3.2, 1.0 Hz, 1H), 7.29 (dd, J= 12.3, 1.7 Hz, 1H), 6.47 (d, J= 8.2 Hz, 1H), 4.59 (q, J= 13 Hz, 2H), 3.55-3.43 (m, 4H), 2.38-2.33 (m, 3H), 2.23 (s, 3H), 1.70 (dt, J= 13.3, 4.6 Hz, 2H), 1.61 (q, J = 7.4 Hz, 5H), 1.09 (s, 3H).

Example 232: Synthesis of Compound 452

Synthesis of Intermediate C373 C ₃ 72 C ₃ 73

To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl) piperazine- 1 -carboxylate (300 mg, 0.835 mmol, 1 equiv) and 6-bromo-2-methylimidazo[1,2-a]pyridine-7-carbonitrile (197.04 mg, 0.835 mmol, 1 equiv) in dioxane (5 mL) were added Cs ₂ CO ₃ (815.84 mg, 2.505 mmol, 3 equiv), Pd2(dba)3 (76.43 mg, 0.084 mmol, 0.1 equiv) and XantPhos (48.30 mg, 0.084 mmol, 0.1 equiv). After stirring for 2 h at 100 °C under a nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (1 : 1-1 : 10) to afford tert-butyl 4-[7-({7-cyano-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (400 mg, 93.13%) as a solid. ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.47 (s, 1H), 9.66 (s, 1H), 8.85 (s, 1H), 8.29 (s, 1H), 8.06 - 7.96 (m, 2H), 6.52 (d, J = 8.2 Hz, 1H), 4.26 (s, 3H), 3.57 (d, J = 5.7 Hz, 5H), 3.48 (d, J = 5.7 Hz, 3H), 2.40 (s, 3H), 1.45 (s, 9H).

Synthesis of Compound 452

A solution of tert-butyl 4-[7-({7-cyano-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl) -2- methylindazol-4-yl]piperazine-l -carboxylate (80 mg, 0.155 mmol, 1 equiv) in DCM (4 mL) was added TFA (1 mL) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 4) to afford N-{7-cyano-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-(piperazin-l-yl )indazole-7-carboxamide (4 mg, 6%) as a solid. LCMS (ES, m/z): 515 [M+H] ⁺¹ H NMR (400 MHz, Methanol-d ₄ ) δ 11.48 (s, 1H), 9.67 (s, 1H), 8.82 (s, 1H), 8.29 (s, 1H), 8.08 - 7.97 (m, 2H), 6.51 (d, J = 8.2 Hz, 1H), 4.25 (s, 3H), 3.39 (t, J = 5.0 Hz, 4H), 2.91 (t, J = 5.0 Hz, 4H), 2.40 (s, 3H).

Example 233: Synthesis of Compound 475

Synthesis of Intermediate C375 C ₃ 75

To a stirred mixture of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (110 mg, 0.365 mmol, 1 equiv) and tert-butyl (2R,6S)-2,6-dimethylpiperazine-l -carboxylate (93.95 mg, 0.438 mmol, 1.2 equiv) in dioxane (2 mL) was added Cs ₂ CO ₃ (357.07 mg, 1.095 mmol, 3 equiv), Ruphos (34.09 mg, 0.073 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.55 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 80°C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE ZEA (1 : 1) to afford methyl 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-l- yl]-2-ethyl-6-fluoroindazole-7-carboxylate (95 mg, 60%) as a solid. LCMS (ES, m/z): 435 [M+H] ⁺

Synthesis of Intermediate C376 C ₃ 75 C ₃ 76

To a stirred solution of methyl 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-l- yl]-2-ethyl-6-fluoroindazole-7-carboxylate (95 mg, 0.219 mmol, 1 equiv) in THF (1.2 mL) and H ₂ O (0.4 mL) was added lithiumol hydrate (18.35 mg, 0.438 mmol, 2 equiv) at room temperature. The resulting mixture was stirred overnight at 30°C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with H ₂ O (5 mL). The mixture was acidified to pH 4 with citric acid and extracted with DCM (3 x lOmL). The combined organic layers were washed with brine (lx lOmL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(3R,5S)-4-(tert- butoxycarbonyl)-3,5-dimethylpiperazin-l-yl]-2-ethyl-6-fluoro indazole-7-carboxylic acid (85 mg, 92%) as a solid. LCMS (ES, m/z): 419 [M-H] ’

Synthesis of Intermediate C377 C ₃ 76 C ₃ 77

To a stirred mixture of 4-[(3R,5S)-4-(tert-butoxycarbonyl)-3,5-dimethylpiperazin-l-y l]-2- ethyl-6-fluoroindazole-7-carboxylic acid (85 mg, 0.202 mmol, 1 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine hydrochloride (44.83 mg, 0.222 mmol, 1.10 equiv) in DCM (2 mL) was added DIEA (130.63 mg, 1.010 mmol, 5 equiv) and HATU (99.92 mg, 0.263 mmol, 1.3 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (2: 1) to afford tert-butyl (2R,6S)-4-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2 -a]pyri din-6- yl}carbamoyl)indazol-4-yl]-2,6-dimethylpiperazine-l-carboxyl ate (80 mg, 70%) as a solid. LCMS (ES, m/z): 568 [M-H] -

Synthesis of Compound 475 C ₃ 77 475 To a stirred solution of tert-butyl (2R,6S)-4-[2-ethyl-6-fluoro-7-({8-fluoro-2- methylimidazof 1 ,2-a]pyridin-6-yl } carbarnoyl)indazol-4-yl]-2,6-dimethylpiperazine- 1 - carboxylate (80 mg, 0.141 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 15, Gradient 3) to afford 4-[(3R,5S)-3,5-dimethylpiperazin-l-yl]-2-ethyl-6-fluoro-N- { 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl }indazole-7 -carboxamide; trifluoroacetic acid (31.4 mg, 38%) as a solid. LCMS (ES, m/z): 468 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.40 (s, 1H), 9.19 (s, 1H), 8.91 (s, 1H), 8.56 (d, J= 11.5 Hz, 1H), 8.11 (s, 1H), 7.58 (d, J= 12.2 Hz, 1H), 6.48 (d, J= 14.4 Hz, 1H), 4.52 (q, J= 13 Hz, 2H), 4.04 (d, J= 13.2 Hz, 2H), 2.95 (t, J= 12.4 Hz, 2H), 2.44 (d, J= 4.9 Hz, 3H), 1.58 (t, J= 13 Hz, 3H), 1.32 (d, J= 6.4 Hz, 6H).

Example 234: Synthesis of Compound 497

Synthesis of Intermediate C378 C ₃ 78

To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2H-indazol-4-yl]piperazine-l -carboxylate (110 mg, 0.223 mmol, 1.0 equiv) and 3-(iodomethyl)oxetane (66.20 mg, 0.335 mmol, 1.5 equiv) in DMF (2.2 mL) was added Cs ₂ CO ₃ (217.8 mg, 0.669 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was diluted with water (10 mL) and extracted with EtOAc (3 x 10 mL). The combined organic layer was washed with water (3 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA (100%) to afford tertbutyl 4-[7-({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)-2-(oxetan-3 - ylmethyl)indazol-4-yl]piperazine-l -carboxylate (65 mg, 52%) as a solid. LCMS (ES, m/z):423.2 [M+H] ⁺

Synthesis of Compound 497

To a stirred solution of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-(oxetan-3-ylmethyl)indazol-4-yl]piperazine-l -carboxylate (20 mg, 0.035 mmol, 1.0 equiv) in DCM (0.5 mL) was added ZnBn (79.91 mg, 0.350 mmol, 10 equiv) at room temperature. The resulting mixture was stirred for 16 h at room temperature. The resulting mixture was diluted with water (2 mL) and extracted with CH ₂ Q2 (2x2 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-fluoro-2- methylimidazof 1 ,2-a]pyridin-6-yl } -2-(oxetan-3 -ylmethyl)-4-(piperazin- 1 -yl)indazole-7- carboxamide (5.6 mg, 34%) as a solid. LCMS (ES, m, z):403.2 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 9.02 (s, 1H), 8.55 (s, 1H), 8.06 (d, J= 8.0 Hz, 1H), 7.69-7.63 (m, 1H), 7.14 (d, J = 11.8 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 4.95-4.82 (m, 4H), 4.71 (t, J= 6.1 Hz, 2H), 3.82-3.72 (m, 1H), 3.42 (t, J= 4.9 Hz, 4H), 3.07 (m, 4H), 2.42 (s, 3H)).

Example 235: Synthesis of Compound 498

Synthesis of Intermediate C379

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv) and tert-butyl 3-hydroxypyrrolidine- 1-carboxylate (269.8 mg, 1.440 mmol, 3.0 equiv) in dioxane (5 mL) were added K3PO4 (305.9 mg, 1.440 mmol, 3.0 equiv), BINAP (29.9 mg, 0.048 mmol, 0.1 equiv) and Binap Palladacycle Gen. 2 (44.8 mg, 0.048 mmol, 0.1 equiv). After stirring for 12 h at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford tert-butyl 3-{ [2- ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbam oyl)indazol-4-yl]oxy (pyrrolidine- 1-carboxylate (80 mg, 32%) as a solid. LCMS (ES, m z): 523 [M+H] ⁺

Synthesis of Compound 498

A solution of tert-butyl 3-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]oxy}pyrrolidine-l-carboxylate (80 mg, 0.153 mmol, 1 equiv) and TFA (0.2 mL, 2.693 mmol) in DCM (2 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 6, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-4-(pyrrolidin-3-yloxy)inda zole-7-carboxamide (30 mg, 46%) as a solid. LCMS (ES, m/z): 423 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.41 (d, J= 1.5 Hz, 1H), 9.29 (s, 1H), 9.13 (s, 1H), 8.68 (s, 1H), 8.10 (d, J= 8.1 Hz, 2H), 7.71 (d, J= 12.0 Hz, 1H), 6.75 (d, J= 8.2 Hz, 1H), 5.43 (s, 1H), 4.64 (q, J= 13 Hz, 2H), 3.65- 3.35 (m, 4H), 3.51 (s, 1H), 2.43 (d, J= 0.9 Hz, 3H), 2.41-2.20 (m, 2H), 1.62 (t, J= 13 Hz, 3H).

Example 236: Synthesis of Compound 499

Synthesis of Intermediate C380 C ₃ 80

To a solution of 6-bromo-3-methylbenzo[d]oxazol-2(3H)-one (150 mg, 0.658 mmol, 1 equiv) and tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (263 mg, 0.658 mmol, 1 equiv) in dioxane (8 mL) were added Cs ₂ CO ₃ (643 mg, 1.974 mmol, 3.0 equiv), XantPhos (76 mg, 0.131 mmol, 0.2 equiv) and Pd2(dba)3 (60 mg, 0.0658 mmol, 0.1 equiv). After stirring for 3 h at 90 °C under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (0: 100) to tert-butyl 4-(2-methyl-7-((3-methyl-2-oxo-2,3-dihydrobenzo[d]oxazol-6- yl)carbamoyl)-2H-indazol-4-yl)piperazine-l -carboxylate (150 mg, 43%) as a solid.

LCMS (ES, m/zy. 507 [M+H] ⁺

Synthesis of Compound 499 C ₃ 80 499 A solution of tert-butyl 4-(2-methyl-7-((3-methyl-2-oxo-2,3-dihydrobenzo[d]oxazol-6- yl)carbamoyl)-2H-indazol-4-yl)piperazine-l -carboxylate (150 mg, 0.296 mmol, 1 equiv) and TFA (0.5 mL) in DCM (4 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 2- methyl-N-(3-methyl-2-oxo-2,3-dihydrobenzo[d]oxazol-6-yl)-4-( piperazin-l-yl)-2H-indazole-7- carboxamide (80 mg, 67%) as a solid. LCMS (ES, m z): 407 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.23 (s, 1H), 8.78 (s, 1H), 8.03 (d, J= 1.9 Hz, 1H), 7.98 (d, J= 8.0 Hz, 1H), 7.47 (dd, J= 8.4, 2.0 Hz, 1H), 7.25 (d, J= 8.4 Hz, 1H), 6.47 (d, J= 8.1 Hz, 1H), 4.28 (s, 3H), 3.35 (s, 4H), 3.32 (s, 3H), 2.91 (t, J= 4.8 Hz, 4H).

Example 237: Synthesis of Compound 500

Synthesis of Intermediate C381 C ₃ 81

A solution of methyl 4-bromo-2-methylindazole-7-carboxylate (550 mg, 2.044 mmol, 1.0 equiv) in THF (6 mL) was treated with DIBAL-H (6.13 mL, 6.132 mmol, 3.0 equiv) at 0°C under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 0°C under nitrogen atmosphere. The reaction was quenched with water at 0 °C. The resulting mixture was extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford (4-bromo-2-methylindazol-7-yl)methanol (505 mg, 100%) as a solid. LCMS (ES, m/z): 241 [M+H] ⁺

Synthesis of Intermediate C382 C ₃ 81 C ₃ 82

A solution of (4-bromo-2-methylindazol-7-yl)methanol (505 mg, 2.095 mmol, 1 equiv) in DCM (5 mL) was treated with manganese dioxide (1821.0 mg, 20.950 mmol, 10 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 4 h at room temperature under nitrogen atmosphere. The resulting mixture was filtered and the filter cake was washed with DCM (2 x 5 mL). The filtrate was concentrated under reduced pressure to afford 4-bromo-2-methylindazole-7-carbaldehyde (440 mg, 88%) as a solid. LCMS (ES, m/z): 239 [M+H] ⁺

Synthesis of Intermediate C383 C ₃ 8

To a stirred mixture of 4-bromo-2-methylindazole-7-carbaldehyde (440 mg, 1.840 mmol, 1.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (364.8 mg, 2.208 mmol, 1.2 equiv) in DCM (5 mL) was added NaBH(OAc)3 (780.1 mg, 3.680 mmol, 2.0 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at room temperature under nitrogen atmosphere. The reaction was quenched with Water at room temperature. The resulting mixture was extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford N-[(4-bromo-2-methylindazol-7- yl)methyl]-8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (610 mg, 85%) as a solid. LCMS (ES, m/z): 388 [M+H] ⁺ Synthesis of Intermediate C385

To a stirred mixture of N-[(4-bromo-2-methylindazol-7-yl)methyl]-8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine (300 mg, 0.773 mmol, 1.0 equiv) and tert-butyl N-ethyl- N-(piperidin-4-yl)carbamate (264.7 mg, 1.159 mmol, 1.5 equiv) in dioxane (3 mL) were added Cs ₂ CO ₃ (755.3 mg, 2.319 mmol, 3.0 equiv), RuPhos (72.1 mg, 0.155 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (64.6 mg, 0.077 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 4 h at 100°C under nitrogen atmosphere. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (10: 1) to afford tert-butyl N-ethyl-N-(l-{7-[({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}amino)methyl]-2-methylindazol-4-yl}piperidin-4-yl)carbama te (180 mg, 43%) as a solid. LCMS (ES, m/z): 536 [M+H] ⁺

Synthesis of Compound 500

A solution of tert-butyl N-ethyl-N-(l-{7-[({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}amino)methyl]-2-methylindazol-4-yl}piperidin-4-yl)carbama te (160 mg, 0.299 mmol, 1.0 equiv) in DCM (2 mL) was treated with ZnBn (336.3 mg, 1.495 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The crude product was purified by Prep-HPLC (Condition 10, Gradient 3) to afford N-ethyl-l-[7-({[(6E)-8-fluoro- 2-methyl-5H-imidazo[1,2-a]pyridin-6-ylidene]amino}methyl)-2- methylindazol-4-yl]piperidin-4- amine (8 mg, 6.15%) as a brown solid. LCMS (ES, m/z): 436 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 8.40 (s, 1H), 7.41 (d, J= 3.2 Hz, 1H), 6.84 (d, J= 12.9 Hz, 1H), 6.71 (d, J= 7.4 Hz, 1H), 6.17 (d, J= 7.5 Hz, 1H), 5.18 (s, 2H), 4.33 (s, 2H), 4.20 (s, 3H), 3.54 (d, J= 12.0 Hz, 2H), 2.68 (t, J= 11.7 Hz, 2H), 2.58 (d, J= 1A Hz, 3H), 2.21 (s, 3H), 1.91 (d, J= 12.3 Hz, 2H), 1.42 (q, J= 11.0 Hz, 2H), 1.02 (t, J= 7.1 Hz, 3H).

Example 238: Synthesis of Compound 501

Synthesis of Intermediate C387 C ₃ 86 C ₃ 87

To a stirred solution of methyl 4-bromo-2-hydroxybenzoate (10 g, 43.282 mmol, 1 equiv) and K ₂ CO ₃ (17.95 g, 129.846 mmol, 3.0 equiv) in DMF (150 mL) was added propargyl bromide (7.72 g, 64.923 mmol, 1.5 equiv) dropwise at room temperature. The resulting mixture was stirred for 16 h at 50 °C. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (500 mL). The resulting mixture was extracted with EA (3x100 mL). The combined organic layers were washed with brine (2 x 50 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford methyl 4-bromo-2-(prop-2-yn-l-yloxy)benzoate (10.1 g, 87%) as a solid. ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 7.62 (d, J= 8.2 Hz, 1H), 7.45 (d, J= 1.8 Hz, 1H), 7.29 (dd, J= 8.3, 1.8 Hz, 1H), 4.96 (d, J= 2.4 Hz, 2H), 3.80 (s, 3H), 3.65 (t, J= 2.4 Hz, 1H).

Synthesis of Intermediate C388 C ₃ 87 C ₃ 88

A mixture of methyl 4-bromo-2-(prop-2-yn-l-yloxy)benzoate (5.0 g, 18.581 mmol, 1 equiv) and CsF (2.82 g, 18.581 mmol, 1.0 equiv) in DMA (50 mL) was irradiated with microwave for 4 h at 190°C. The reaction was quenched with water (200 mL). The resulting mixture was extracted with EA (3x100 mL). The combined organic layers were washed with brine (2x100 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (3:1) to afford methyl 4-bromo-2-methyl-l-benzofuran-7-carboxylate (2.0 g, 40%) as a solid. LCMS (ES, m/z): 269 [M+H] ⁺

Synthesis of Intermediate C389

To a solution of methyl 4-bromo-2-methyl-l-benzofuran-7-carboxylate (670 mg, 2.490 mmol, 1 equiv) and tert-butyl N-ethyl-N-(piperidin-4-yl)carbamate (852.78 mg, 3.735 mmol, 1.5 equiv) in dioxane (20 mL) were added Cs ₂ CO ₃ (1622.47 mg, 4.980 mmol, 2.0 equiv), RuPhos (116.03 mg, 0249 mmol, 0.1 equiv) and 3rd Generation RuPhos precatalyst (208.24 mg, 0.249 mmol, 0.1 equiv). After stirring for 4 h at 90 °C under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 10) to afford methyl 4-{4-[(tert- butoxycarbonyl)(ethyl)amino]piperidin-l-yl}-2-methyl-l-benzo furan-7-carboxylate (750 mg, 72%) as a solid. LCMS (ES, m/z): 417 [M+H] ⁺

Synthesis of Intermediate C390 C ₃ 89 C ₃ 90

To a stirred solution of methyl 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-l- yl}-2-methyl-l-benzofuran-7-carboxylate (720 mg, 1.729 mmol, 1 equiv) in H ₂ O (5 mL), MeOH (10 mL) and THF (10 mL) were added LiOH (248.40 mg, 10.374 mmol, 6.0 equiv) in portions at room temperature. The resulting mixture was stirred for 2 h at 50 °C. The resulting mixture was concentrated under reduced pressure. The residue was acidified to pH 6 with 1 N HCl. The precipitated solids were collected by filtration and washed with water (2 x 20 mL). The resulting solids were dried to afford 4-{4-[(tert- butoxycarbonyl)(ethyl)amino]piperidin-l-yl}-2-methyl-l-benzo furan-7-carboxylic acid (650 mg, 93%) as a solid. LCMS (ES, m/z): 403 [M+H] ⁺

Synthesis of Intermediate C391 C ₃ 90 C ₃ 91

To a stirred solution of 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-l-yl}-2-me thyl- l-benzofuran-7-carboxylic acid (650 mg, 1.615 mmol, 1 equiv) and DIEA (417.45 mg, 3.230 mmol, 2.0 equiv) in DMF (6 mL) were added HATU (736.87 mg, 1.938 mmol, 1.2 equiv) and NH4CI (856 mg, 16.15 mmol, 10.0 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The reaction was quenched with water (50 mL) at room temperature. The precipitated solids were collected by filtration and washed with water (2x10 mL) to afford tert-butyl N-[l-(7-carbamoyl-2-methyl-l-benzofuran-4-yl)piperidin-4-yl] -N- ethylcarbamate (450 mg, 69%) as a solid. LCMS (ES, m/z): 402[M+H] ⁺

Synthesis of Intermediate C392

To a solution of 6-bromo-8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridine (154.86 mg, 0.598 mmol, 1.2 equiv) and tert-butyl N-[l-(7-carbamoyl-2-methyl-l-benzofuran-4-yl)piperidin- 4-yl]-N-ethyl carbamate (200 mg, 0.498 mmol, 1 equiv) in 1,4-di oxane (5 mL) were added Cs ₂ CO ₃ (323.78 mg, 0.996 mmol, 2.0 equiv), RuPhos (23.24 mg, 0.050 mmol, 0.1 equiv) and 3rd Generation RuPhos precatalyst (41.66 mg, 0.050 mmol, 0.1 equiv). After stirring for 5 h at 90°C under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :3) to afford tert-butyl N-ethyl-N-{ l-[7-({8-fluoro-7-methoxy-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methyl-l-benzofuran-4-yl]piperidin-4-yl}carb amate (200 mg, 69%) as a solid. LCMS (ES, m/z): 580 [M+H] ⁺

Synthesis of Compound 501

A solution of tert-butyl N-ethyl-N-{ l-[7-({8-fluoro-7-methoxy-2-methylimidazo[1,2- a]pyridin-6-yl } carbarnoyl)-2-m ethyl- 1 -benzofuran -4-yl]piperidin-4-yl } carbamate (100 mg, 0.173 mmol, 1 equiv) in TFA (3 mL, 40.389 mmol, 234.13 equiv) and DCM (3 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7M NH3(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 6, Gradient 2) to afford 4-(4-(ethylamino)piperidin-l-yl)-N-(8-fluoro-7-methoxy-2-met hylimidazo[1,2- a]pyridin-6-yl)-2-methylbenzofuran-7-carboxamide 2,2,2-trifluoroacetate (30 mg, 36%) as a solid. LCMS (ES, m/z): 480 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 9.94 (s, 1H), 9.65 (d, J = 1.1 Hz, 1H), 8.75 (s, 2H), 8.08 (dd, J= 2.6, 1.3 Hz, 1H), 7.82 (d, J= 8.5 Hz, 1H), 6.90-6.80 (m, 2H), 4.39 (d, J= 4.0 Hz, 3H), 3.87 (d, J= 12.6 Hz, 2H), 3.31 (s, 1H), 3.05 (q, J= 6.8 Hz, 2H), 2.95 (t, J= 12.3 Hz, 2H), 2.60 (s, 3H), 2.47-2.40 (m, 3H), 2.21-2.10 (m, 2H), 1.73 (td, J= 12.8, 9.1 Hz, 2H), 1.24 (t, J= 7.2 Hz, 3H).

Example 239: Synthesis of Compound 502

Synthesis of Intermediate C393 C ₃ 93

To a stirred solution of methyl 4-bromo-2H-indazole-7-carboxylate (1 g, 3.920 mmol, 1 equiv), K ₂ CO ₃ (1.63 g, 11.760 mmol, 3 equiv) and tert-butyl N-methyl-N-(piperidin-4- yl)carbamate (1.68 g, 7.840 mmol, 2 equiv) in Toluene (10 mL) were added Pd(OAc)2 (0.09 g, 0.392 mmol, 0.1 equiv) and BINAP (0.49 g, 0.784 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 100°C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (3: 1) to afford methyl 4-{4-[(tert- butoxycarbonyl)(methyl)amino]piperidin-l-yl}-2H-indazole-7-c arboxylate (500 mg, 33%) as a solid. LCMS (ES, m/z): 389 [M+H] ⁺

Synthesis of Intermediate C394 C ₃ 94

A solution of methyl 4-{4-[(tert-butoxycarbonyl)(methyl)amino]piperidin-l-yl}-2H- indazole-7-carboxylate (1 g, 2.574 mmol, 1 equiv) and lithiumol (0.31 g, 12.870 mmol, 5 equiv) in THF (5 mL), H ₂ O (5 mL) and MeOH (1 mL) was stirred for 3 h at 40 °C. The resulting mixture was concentrated under reduced pressure. The mixture was acidified to pH 4 with HCl (Imol/L, aq.). The precipitated solids were collected by filtration and washed with water (3x5 mL) to afford 4-{4-[(tert-butoxycarbonyl)(methyl)amino]piperidin-l-yl}-2H- indazole-7- carboxylic acid (600 mg, 62%) as a solid. LCMS (ES, m/z): 375 [M+H] ⁺

Synthesis of Intermediate C395

Boc C ₃ 94 C ₃ 95

To a stirred solutionof 4-{4-[(tert-butoxycarbonyl)(methyl)amino]piperidin-l-yl}-2H- indazole-7-carboxylic acid (500 mg, 1.335 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2- a]pyridin-6-amine (264.67 mg, 1.602 mmol, 1.2 equiv) in MeCN (10 mL) were added TCFH (487.06 mg, 1.736 mmol, 1.3 equiv) and NMI (383.73 mg, 4.672 mmol, 3.5 equiv) at room temperature . The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (0: 1) to afford tert-butyl N-{ l-[7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2H-indazol-4-yl]piperidin-4-yl}-N- methylcarbamate (300 mg, 43%) as an oil. LCMS (ES, m/z): 522 [M+H] ⁺ Synthesis of Intermediate C396 C ₃ 95 C ₃ 96

To a stirred solution of tert-butyl N-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2H-indazol-4-yl]piperidin-4-yl}-N-methylcarbam ate (100 mg, 0.192 mmol, 1 equiv) and l-chloro-2-iodoethane (55 mg, 0.288 mmol, 1.5 equiv) in DMF (5 mL) was added NaOH (39 mg, 0.960 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 16 h at room temperature. The reaction mixture was purified by reverse flash chromatography (Condition 3, Gradient 9) to afford tert-butyl N-{ l-[2-ethenyl-7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl} carbarnoyl)indazol-4-yl]piperidin-4-yl}-N-m ethylcarbamate (60 mg, 57%) as a solid. LCMS (ES, m/z): 548 [M+H] ⁺

Synthesis of Compound 502 C ₃ 96 502

A solution of tert-butyl N-{l-[2-ethenyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6 - yl} carbarnoyl)indazol-4-yl]piperidin-4-yl}-N-m ethylcarbamate (60 mg, 0.109 mmol, 1 equiv) and trifluoroacetic acid (2 mL) in DCM (5 mL ) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 10) to afford 2-ethenyl-N-{8-fluoro-2- methylimidazof 1 ,2-a]pyridin-6-yl } -4-[4-(methylamino)piperidin- 1 -yl]indazole-7-carboxamide (11 mg, 22%) as a solid. LCMS (ES, m/z): 448 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 10.91 (s, 1H), 9.22 (s, 1H), 9.08 (s, 1H), 8.03 (d, J = 8.2 Hz, 1H), 7.91 (d, J = 3.3 Hz, 1H), 7.68 (dd, J = 15.5, 8.7 Hz, 1H), 7.35 (d, J = 12.8 Hz, 1H), 6.52 (d, J = 8.1 Hz, 1H), 6.26 (d, J = 15.7 Hz, 1H), 5.36 (d, J = 8.5 Hz, 1H), 3.93 (d, J = 12.7 Hz, 2H), 3.11 (t, J = 11.9 Hz, 2H), 2.65 (s, 1H), 2.36 (d, J = 1.7 Hz, 6H), 1.99 (d, J = 13.2 Hz, 2H), 1.48 (d, J = 11.0 Hz, 2H).

Example 240: Synthesis of Compound 503

Synthesis of Intermediate C397

To a solution of methyl 4-bromo-2H-indazole-7-carboxylate (1 g, 3.920 mmol, 1 equiv) and tert-butyl N-ethyl-N-(piperidin-4-yl)carbamate (1.79 g, 7.840 mmol, 2.0 equiv) in Toluene (20 mL) were added K ₂ CO ₃ (1.63 g, 11.760 mmol, 3.0 equiv), BINAP (0.49 g, 0.784 mmol, 0.2 equiv) and Pd(OAc)2 (0.09 g, 0.392 mmol, 0.1 equiv). After stirring for 12 h at 100°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 1) to afford methyl 4- {4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-l-yl}-2H-ind azole-7-carboxylate (1 g, 63%) as a solid. LCMS (ES, m/z): 403 [M+H] ⁺

Synthesis of Intermediate C398 To a stirred solution of methyl 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-l-yl}-2H- indazole-7-carboxylate (1 g, 2.485 mmol, 1 equiv) in THF (9 mg) and MeOH (9 mL) was added a solution of LiOH.EbO (0.6 g, 24.850 mmol, 10 equiv) in H ₂ O (9 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The mixture was acidified to pH 2 with 2 M HCl. The precipitated solids were collected by filtration and washed with H ₂ O (1x10 mL). This resulted in 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-l-yl}- 2H-indazole-7-carboxylic acid (0.8 g, 83%) as a solid. LCMS (ES, m/z): 389[M+H] ⁺

Synthesis of Intermediate C399

To a stirred solution of 4-{4-[(tert-butoxycarbonyl)(ethyl)amino]piperidin-l-yl}-2H- indazole-7-carboxylic acid (300 mg, 0.772 mmol, 1 equiv) and 8-fluoro-2-methylimidazo[1,2- a]pyridin-6-amine (191.3 mg, 1.158 mmol, 1.5 equiv) in CH ₃ CN (6 mL) were added TCFH (281.6 mg, 1.004 mmol, 1.3 equiv) and NMI (221.9 mg, 2.702 mmol, 3.5 equiv) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 8) to afford tert-butyl N-ethyl-N-{ l-[7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2H-indazol-4-yl]piperidin-4-yl} carbamate (183 mg, 44%) as a solid. LCMS (ES, m/z): 536[M+H] ⁺

Synthesis of Intermediate C400 To a stirred solution of tert-butyl N-ethyl-N-{ l-[7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}carbamoyl)-2H-indazol-4-yl]piperidin-4-yl}car bamate (180 mg, 0.336 mmol, 1 equiv) and l-chloro-2-iodoethane (95.9 mg, 0.504 mmol, 1.5 equiv) in DMF (3 mL) was added KOH (113.1 mg, 2.016 mmol, 6.0 equiv) in portions at room temperature. The resulting mixture was stirred for 12 h at 80 °C. The mixture was allowed to cool down to room temperature. The resulting mixture was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl N-{ l-[2-ethenyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)indazol-4-yl]piperidin-4-yl}-N-ethylcarbamate (80 mg, 42%) as a solid. LCMS (ES, m/z): 562[M+H] ⁺

Synthesis of Compound 503 C ₄ 00 503

A solution of tert-butyl N-{ l-[2-ethenyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)indazol-4-yl]piperidin-4-yl}-N-ethylcarbamate (80 mg, 0.142 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 10) to afford 2-ethenyl-4-[4-(ethylamino)piperidin-l-yl]-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (18 mg, 27%) as a solid. LCMS (ES, m/z): 462[M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 9.15 (t, J= 1.7 Hz, 1H), 9.01 (d, J= 1.5 Hz, 1H), 8.01 (d, J= 8.1 Hz, 1H), 7.87 (d, J= 3.1 Hz, 1H), 7.64 (dd, J= 15.5, 8.7 Hz, 1H), 7.32 (dd, J= 12.3, 1.5 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 6.22 (d, J= 15.5 Hz, 1H), 5.34 (d, J= 8.5 Hz, 1H), 3.94 (d, J= 12.9 Hz, 2H), 3.06 (t, J = 12.1 Hz, 2H), 2.80 - 2.71 (m, 1H), 2.64 (q, J= 7.1 Hz, 2H), 2.34 (s, 3H), 1.99 (d, J= 12.6 Hz, 2H), 1.48 (q, J= 11.4 Hz, 2H), 1.06 (t, J= 7.1 Hz, 3H). Example 241: Synthesis of Compound 504

Synthesis of Intermediate C402 C ₄ 01 C ₄ 02

A solution of 2-fluoro-6-methoxyaniline (15 g, 106.274 mmol, 1 equiv) in CH ₃ CN (200 mL) was treated with NBS (28.37 g, 159.411 mmol, 1.5 equiv) for 8 hours at 20°C. The mixture was neutralized to pH 7 with NaHCCL. The aqueous layer was extracted with DCM 500 mL x 3 times. The combined organic layers were washed with water (1x500 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (3: 1) to afford 4-bromo-2- fluoro-6-methoxyaniline (5 g, 21%) is given with solid. LCMS (ES, m/z): 220 [M+H] ⁺

Synthesis of Intermediate C403

To a solution of 4-bromo-2-fluoro-6-methoxyaniline (5 g, 22.723 mmol, 1 equiv) in DCM (50 mL) was added BBr, (8.54 g, 34.084 mmol, 1.5 equiv) dropwise at 0°C. The resulting mixture was stirred for 16 h at room temperature. The resulting mixture was diluted with water (100 mL). The mixture was neutralized to pH 7 with NaHCO3. The resulting mixture was extracted with EtOAc (3x200 mL). The combined organic layers were washed with water (1x500 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with MeOH/DCM (1/20) to afford 2-amino-5-bromo-3-fluorophenol (3.7 g, 79%) as an oil. LCMS (ES, m/z): 206 [M+H] ⁺

Synthesis of Intermediate C404 C ₄ 03 C ₄ 04

A solution of 2-amino-5-bromo-3-fluorophenol (4 g, 19.416 mmol, 1 equiv) in MeOH (100 mL) was treated with 2-chl oro-1, 1,1 -trimethoxy ethane (6.00 g, 38.832 mmol, 2.00 equiv) for 8 huors at 80 °C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (3/1) to afford 6-bromo-2-(chloromethyl)-4-fluoro-l,3-benzoxazole (4.5 g, 88%) as a solid. LCMS (ES, m/z): 264 [M+H] ⁺

Synthesis of Intermediate C405 C ₄ 04 C ₄ 05

A solution of 6-bromo-2-(chloromethyl)-4-fluoro-l,3-benzoxazole (2.26 g, 8.545 mmol, 1 equiv) in MeOH (20 mL) was treated with sodium methoxide (4.62 g, 85.450 mmol, 10 equiv) for 8 hours at 26°C. The resulting mixture was diluted with water (100 mL). The aqueous layer was extracted with DCM (3x100 mL). The resulting mixture was washed with 2x200 mL of brine. The resulting organic layer was dried by Na ₂ SO ₄ and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (3/1) to afford 6-bromo-4-fluoro-2-(methoxymethyl)-l,3-benzoxazole (2 g, 90%) as a solid. LCMS (ES, m/z): 260 [M+H] ⁺

Synthesis of Intermediate C406 C ₄ 06 A solution of 6-bromo-4-fluoro-2-(methoxymethyl)-l,3-benzoxazole (200 mg, 0.769 mmol, 1 equiv) in dioxane (5 mL) was treated with tert-butyl 4-(7-carbamoyl-2-methylindazol-4- yl)piperazine-l -carboxylate (360 mg, 1.002 mmol, 1.30 equiv), Pd2(dba)3 (70 mg, 0.076 mmol, 0.10 equiv), Cs ₂ CO ₃ (501 mg, 1.538 mmol, 2.00 equiv), XantPhos (89 mg, 0.154 mmol, 0.20 equiv) for 8 hours at 110 °C under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with MeOH /DCM (1/10) to afford tert-butyl 4-(7-{[4-fluoro-2-(methoxymethyl)-l,3-benzoxazol-6- yl]carbamoyl}-2-methylindazol-4-yl)piperazine-l -carboxylate (380 mg, 91%) as a solid. LCMS (ES, m/z): 539 [M+H] ⁺

Synthesis of Compound 504 C ₄ 06 504

To a stirred mixture of tert-butyl 4-(7-{[4-fluoro-2-(methoxymethyl)-l,3- benzoxazol-6-yl]carbamoyl}-2-methylindazol-4-yl)piperazine-l -carboxylate (80 mg, 0.149 mmol, 1 equiv) in DCM (2 mL) was added ZnBn (194.2 mg, 2.980 mmol, 20 equiv) at room temperature. The resulting mixture was stirred for 16 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 7) to afford N-[4-fluoro-2- (m ethoxymethyl)- 1 ,3 -benzoxazol-6-yl]-2-methyl-4-(piperazin- 1 -yl)indazole-7- carboxamide (8 mg, 12%) as a a solid. LCMS (ES, m/z): 439 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.24 (s, 1H), 8.78 (s, 1H), 7.96 (d, J= 8.1 Hz, 1H), 7.41 (dd, J= 12.2, 2.3 Hz, 1H), 7.24 (t, J= 1.8 Hz, 1H), 6.47 (d, J= 8.2 Hz, 1H), 4.73 (s, 2H), 4.28 (s, 3H), 3.91 (s, 3H), 3.38-3.32 (m, 4H), 2.94-2.87 (m, 4H).

Example 242: Synthesis of Compound 505

Synthesis of Intermediate C407

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv) and tert-butyl 4-hydroxypiperidine- 1-carboxylate (290.1 mg, 1.440 mmol, 3.0 equiv) in dioxane (0.5 mL) were added K3PO4 (305.9 mg, 1.440 mmol, 3.0 equiv), BINAP (29.9 mg, 0.048 mmol, 0.1 equiv) and Binap Palladacycle Gen. 2 (44.8 mg, 0.048 mmol, 0.1 equiv). After stirring for 12 h at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography(Condition 3, Gradient 8) to afford tert-butyl 4-{ [2- ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbam oyl)indazol-4-yl]oxy (piperidine- 1-carboxylate (100 mg, 39%) as a solid. LCMS (ES, m/z): 537 [M+H] ⁺

Synthesis of Compound 505

A solution of tert-butyl 4-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]oxy}piperidine-l-carboxylate (100 mg, 0.186 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(p iperi din-4- yloxy)indazole-7-carboxamide (45 mg, 55%) as a solid. LCMS (ES, m z): 437 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 10.95 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.72 (s, 1H), 8.05 (d, J= 8.0 Hz, 1H), 7.92 (d, J= 3.1 Hz, 1H), 7.33 (dd, J= 12.3, 1.7 Hz, 1H), 6.74 (d, J = 8.2 Hz, 1H), 4.73 (d, J= 8.7 Hz, 1H), 4.61 (q, J= 13 Hz, 2H), 3.01 (d, J= 12.8 Hz, 2H), 2.65 (t, J= 9.9 Hz, 2H), 2.39-2.33 (m, 3H), 2.03 (d, J= 12.0 Hz, 2H), 1.61 (t, J= 13 Hz, 5H).

Example 243: Synthesis of Compound 506

Synthesis of Intermediate C408

C408

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (100 mg, 0.240 mmol, 1 equiv) and tert-butyl 4-(4,4,5,5-tetramethyl- l,3,2-dioxaborolan-2-yl)-3,6-dihydro-2H-pyridine-l-carboxyla te (89.1 mg, 0.288 mmol, 1.2 equiv) in dioxane (2 mL) were added K3PO4 (152.9 mg, 0.720 mmol, 3.0 equiv) and Pd(dppf)Cl ₂ CH ₂ Cl ₂ (19.5 mg, 0.024 mmol, 0.1 equiv). After stirring for 1 h at 80°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl 4-[2- ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbam oyl)indazol-4-yl]-3,6-dihydro- 2H-pyridine-l -carboxylate (100 mg, 80%) as a solid. LCMS (ES, m z): 519 [M+H] ⁺

Synthesis of Compound 506

C408 506

A solution of tert-butyl 4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-3,6-dihydro-2H-pyridine-l-carboxy late (80 mg, 0.154 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(1 ,2,3,6- tetrahydropyridin-4-yl)indazole-7-carboxamide (25 mg, 38%) as a solid. LCMS (ES, m/z): 419[M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.34 (s, 1H), 9.43 (s, 1H), 8.98 (d, J= 14.9 Hz, 3H), 8.12 (s, 1H), 8.12 (d, J= 7.5 Hz, 1H), 7.72 (s, 1H), 7.32 (d, J= 7.5 Hz, 1H), 6.47 (s, 1H), 4.69 (q, J= 13 Hz, 2H), 3.90 (s, 2H), 2.83 (s, 2H), 2.83 (s, 2H), 2.43 (t, J= 1.1 Hz, 3H), 1.65 (t, J = 7.3 Hz, 3H).

Example 244: Synthesis of Compound 507

Synthesis of Intermediate C410 C ₄ 10

A solution of 3-bromo-5-chloropyrazin-2-amine (1 g, 4.798 mmol, 1.0 equiv) in isopropanol (30 mL) was treated with PPTS (120 mg, 0.480 mmol, 0.1 equiv) and bromoacetone (1.97 g, 14.394 mmol, 3.0 equiv) for 48 hours at 80 °C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (50%) to afford 8-bromo-6-chloro-2-methylimidazo[1,2-a]pyrazine (600 mg, 51%) as a solid. LCMS (ES, m/z): 246 [M+H] ⁺

Synthesis of Intermediate C411

To a solution of 8-bromo-6-chloro-2-methylimidazo[1,2-a]pyrazine (450 mg, 1.826 mmol,

1 equiv) in DMF (5 mL) were added Zn(CN)2 (1071 mg, 9.130 mmol, 5.0 equiv) and Pd(PPh3)4 (210 mg, 0.183 mmol, 0.1 equiv). After stirring for 16 h at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with DCM/MeOH (10:1) to afford 6-chloro-2- methylimidazo[1,2-a]pyrazine-8-carbonitrile (200 mg, 57%) as a solid. LCMS (ES, m/z): 193 [M+H] ^{+ 1} H NMR (300 MHz, Chloroform-d) δ 8.31 (s, 1H), 7.69 (s, 1H), 2.64 (d, J= 0.7 Hz, 3H).

Synthesis of Intermediate C412

To a stirred mixture of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l- carboxylate (150 mg, 0.417 mmol, 1.0 equiv) and 6-bromo-2-methylimidazo[1,2-a]pyrazine-8- carbonitrile (98.9 mg, 0.417 mmol, 1.0 equiv) in dioxane (3 mL) were added Cs ₂ CO ₃ (407.9 mg, 1.251 mmol, 3.0 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 16 h at 100 °C under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :9) to afford tert-butyl 4-[7-({8-cyano-2-methylimidazo[1,2-a]pyrazin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (40 mg, 19%) as a solid. LCMS (ES, m/z): 516 [M+H] ⁺

Synthesis of Compound 507 C ₄ 12

507 To a stirred mixture of tert-butyl 4-[7-({8-cyano-2-methylimidazo[1,2-a]pyrazin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (30 mg, 0.058 mmol, 1 equiv) in DCM (1 mL) was added HCl(gas)in 1,4-dioxane (0.25 mL, 4M) dropwise at room temperature under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 14, Gradient 2) to afford N-{8-cyano-2- methylimidazo[1,2-a]pyrazin-6-yl}-2-methyl-4-(piperazin-l-yl )indazole-7-carboxamide (8.6 mg, 36%) as a solid. LCMS (ES, m/z): 416 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.51 (s, 1H), 9.79 (s, 1H), 8.93 (s, 1H), 8.84 (s, 2H), 8.32 (s, 1H), 8.10 (d, J = 8.0 Hz, 1H), 6.64 (d, J = 8.1 Hz, 1H), 4.32 (s, 3H), 3.62 (t, J= 5.1 Hz, 4H), 3.36 (d, J= 5.1 Hz, 4H), 2.50 (s, 3H).

Example 245: Synthesis of Compound 508

To a stirred solution of 4-(4-amino-4-ethylpiperidin-l-yl)-2-ethyl-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (130 mg, 0.28 mmol, 1 equiv) and aq.HCHO (105 mg, 1.4 mmol, 5 equiv, 40% HCHO in water) in MeCN (5 mL) was added NaBH(OAc)3 (178 mg, 0.84 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for 0.5 h at room temperature. To the above mixture was added HOAc (170 mg, 2.8 mmol, 10 equiv) dropwise at room temperature. The resulting mixture was stirred for additional 3 h at room temperature. The reaction was quenched by the addition of water (5 mL) at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 4-[4-(dimethylamino)-4- ethylpiperidin-l-yl]-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2 -a]pyridin-6-yl}indazole-7- carboxamide (42.2 mg, 31%) as a solid. LCMS (ES, m/z): 492 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.20 (d, J= 1.7 Hz, 1H), 8.82 (s, 1H), 7.96 (d, J= 8.1 Hz, 1H), 7.89 (d, J= 3.1 Hz, 1H), 7.27 (dd, J= 12.3, 1.7 Hz, 1H), 6.43 (d, J= 8.3 Hz, 1H), 4.58 (q, J= 7.3 Hz, 2H), 3.53 (dt, J= 11.8, 4.5 Hz, 2H), 3.41 (ddd, J= 12.4, 9.9, 2.9 Hz, 2H), 2.35 (s, 3H), 2.23 (s, 6H), 1.91-1.77 (m, 2H), 1.70-1.54 (m, 5H), 1.50 (q, J= 7.5 Hz, 2H), 0.85 (t, J= 7.5 Hz, 3H).

Example 246: Synthesis of Compound 510

Synthesis of Intermediate C413 C ₄ 13

A solution of 4-[4-(tert-butoxycarbonyl) piperazin- l-yl]-2-(2-methoxy ethyl) indazole-7- carboxylic acid (480 mg, 1.187 mmol, 1 equiv) in DMF (1 mL) was added NH4CI (317.4 mg, 5.935 mmol, 5.0 equiv), HATU (676.8 mg, 1.780 mmol, 1.5 equiv) and DIEA (460.1 mg, 3.561 mmol, 3.0 equiv). The mixture was strried at room temperature for 1 h and washed with 2 x 10 mL of water, extracted with EtOAc (3 x 20 mL), and dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (65%) to afford tert-butyl 4-[7-carbamoyl-2-(2- methoxy ethyl) indazol-4-yl] piperazine- 1 -carboxylate (520 mg, 99%) as an oil. LCMS (ES, m, z):404 [M+H] ⁺

Synthesis of Intermediate C414

C413 C414

A solution of tert-butyl 4-[7-carbamoyl-2-(2-methoxyethyl) indazol-4-yl] piperazine-1- carboxylate (200 mg, 0.496 mmol, 1 equiv) in dioxane (3 mL) was added 6-bromo-8-methoxy-2- methylimidazo[1,2-a] pyrazine (179.9 mg, 0.744 mmol, 1.5 equiv), Cs ₂ CO ₃ (323.0 mg, 0.992 mmol, 2 equiv), XantPhos (57.3 mg, 0.099 mmol, 0.2 equiv) and Pd2(dba)3 (45.3 mg, 0.050 mmol, 0.1 equiv) under nitrogen atmosphere. The mixture was stirred at 100 °C for 1 h to give a black solution. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (95%) to afford N-{8-methoxy-2- methylimidazof 1 ,2-a]pyrazin-6-yl } -2-(2 -m ethoxy ethyl)-4-(piperazin- 1 -yl)indazole-7 - carboxamide (100 mg, 43%) as a oil. LCMS (ES, m/z): 565 [M+H] ⁺

Synthesis of Compound 510

A solution of tert-butyl 4-[7-({8-methoxy-2-methylimidazo[1,2-a] pyrazin-6-yl} carbamoyl)-2-(2 -methoxyethyl) indazol-4-yl] piperazine- 1 -carboxylate (100 mg, 0.177 mmol, 1 equiv) in DCM (3 mL) was added HCl (gas) in 1,4-dioxane (1.5 mL, 4M). The mixture was strried for 1 h at 25 °C. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC with the following conditions (SunFire Prep Cl 8 OBD Columnl9*150 mm, 5μm 10 nm, mobile phase, MeCN in water (0.05% TFA), 20% to 40% gradient in 7 min; detector, UV 254 nm) to afford N-{8-methoxy-2-methylimidazo[1,2-a] pyrazin-6-yl}-2-(2-methoxyethyl)-4-(piperazin-l-yl) indazole-7-carboxamide (36.5 mg, 44%) as a solid. LCMS (ES, m/z): 465 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.48 (d, J= 6.6 Hz, 1H), 9.10 (d, J= 7.6 Hz, 1H), 8.94 (s, 1H), 8.83-8.80 (m, 1H), 8.06-8.00 (m, 2H), 6.64 (d, J= 8.1 Hz, 1H), 4.70 (t, J= 5.1 Hz, 2H), 4.15 (d, J = 2.2 Hz, 4H), 4.05 (t, J= 5.2 Hz, 2H), 3.61 (d, J = 6.3 Hz, 4H), 3.36-3.35 (m, 4H), 3.29 (s, 3H), 2.39 (s, 3H).

Example 247: Synthesis of Compound 511

Synthesis of Intermediate C415 C ₄ 15

Into a 100 mL 3-necked round-bottom flask were added 2,6-dichloro-4-methylpyridin-3- amine (5.0 g, 28.244 mmol, 1.0 equiv) and acetic anhydride (30 mL) at room temperature. The resulting mixture was stirred for 1 h at 90 °C. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford N-(2,6-dichloro-4-methylpyridin-3-yl) acetamide (2.5 g, 37%) as a solid. LCMS (ES, m/z): 219 [M+H] ⁺

Synthesis of Intermediate C416

100°C, 3 h C ₄ 15 C ₄ 16

Into a 40 mL vial were added N-(2,6-dichloro-4-methylpyridin-3-yl) acetamide (1.0 g, 4.565 mmol, 1.0 equiv), copper(I) iodide (90.0 mg, 0.457 mmol, 0.1 equiv), (1R,2R)-N1,N2- dimethylcyclohexane-1,2-diamine (130.0 mg, 0.913 mmol, 0.2 equiv), K ₂ CO ₃ (1.3 g, 9.130 mmol, 2.0 equiv) and dioxane (20 mL) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (5: 1) to afford 5-chloro-2,7-dimethyl-[l,3] oxazolo[5,4- b]pyridine (0.8 g, 86%) as a solid. LCMS (ES, m/z): 183 [M+H] ⁺

Synthesis ofIntermediateC417

C416 C417

To a solution of 5-chloro-2,7-dimethyl-[l,3] oxazolo[5,4-b]pyridine (110.0 mg, 0.602 mmol, 1.0 equiv) and tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l -carboxylate (238.1 mg, 0.662 mmol, 1.1 equiv) in dioxane (3 mL) were added Cs ₂ CO ₃ (393.7 mg, 1.204 mmol, 2.0 equiv) and Pd2(dba)3 (55.1 mg, 0.060 mmol, 0.1 equiv) . After stirring for 2 h at 100°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :3) to afford tert-butyl 4-[7-({2,7-dimethyl-[l,3] oxazolo[5,4-b]pyridin-5-yl}carbamoyl)-2- methylindazol-4-yl]piperazine-l -carboxylate (120 mg, 37%) as a solid. LCMS (ES, m z): 506 [M+H] ⁺

Synthesis of Compound 511

To a stirred solution of tert-butyl 4-[7-({2,7-dimethyl-[l,3]oxazolo[5,4-b]pyridin-5-yl} carbamoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (70.0 mg, 0.138 mmol, 1.0 equiv) in DCM (2 mL) was added trimethyl silyl tritiate (123.0 mg, 0.552 mmol, 4.0 equiv) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The reaction was monitored by LCMS. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford N-{2,7-dimethyl- [ 1 ,3 ]oxazolo[5,4-b]pyridin-5-yl } -2-methyl-4-(piperazin- 1 -yl)indazole-7-carboxamide (35 mg, 61%) as a solid. LCMS (ES, m/z): 406 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.58 (s, 1H), 8.82 (s, 1H), 8.35 (s, 1H), 8.05 (d, J= 8.1 Hz, 1H), 6.51 (d, J= 8.2 Hz, 1H), 4.28 (s, 3H), 3.38-

3.37 (m, 4H), 2.97-2.90 (m, 4H), 2.62 (s, 3H), 2.57 (s, 3H).

Example 248: Synthesis of Compound 512

Synthesis of Intermediate C418

To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (150 mg, 0.360 mmol, 1 equiv) and tert-butyl 6-(trifluoro-lambda4- boranyl)-3-azabicyclo[4.1.0]heptane-3-carboxylate potassium (120.2 mg, 0.396 mmol, 1.1 equiv) in Toluene (7.5 mL) and H ₂ O (0.75 mL) were added Cs ₂ CO ₃ (176.1 mg, 0.540 mmol, 1.5 equiv) and Cata Pd G3 (26.2 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 10 h at 90°C under nitrogen atmosphere. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with EtOAc (3x10 mL). The combined organic layers were washed with water (3 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tertbutyl 6-[2-ethyl-7-({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbamoyl)indazol-4-yl]-3 - azabicyclo[4.1.0]heptane-3-carboxylate (90 mg, 47%) as a solid. LCMS (ES, m, z):533 [M+H] ⁺

Synthesis of Compound 512 To a stirred mixture of tert-butyl 6-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-3-azabicyclo[4.1.0]heptane-3-carb oxylate (90 mg, 0.169 mmol, 1 equiv) in DCM (2 mL) was added TMSOTf (150.2 mg, 0.676 mmol, 4 equiv) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 14, Gradient 2) to afford 4-{3-azabicyclo[4.1.0]heptan-6-yl}-2-ethyl-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide 2,2,2-trifluoroacetate (35.4 mg, 48%) as a solid. LCMS (ES, m, z):433 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.28 (s, 1H), 9.42 (d, J= 1.6 Hz, 1H), 8.98 (s, 1H), 8.79 (d, J= 12.3 Hz, 1H), 8.67-8.66 (m, 1H), 8.14-8.09 (m, 1H), 8.05 (d, J= 7.3 Hz, 1H), 7.71 (d, J= 11.9 Hz, 1H), 7.23 (d, J= 7.3 Hz, 1H), 4.67 (q, J= 7.3 Hz, 2H), 3.78 (dd, J= 12.6, 7.1 Hz, 1H), 3.18 (dd, J= 12.2, 5.7 Hz, 1H), 2.96 (d, J= 9.1 Hz, 1H), 2.43 (s, 3H), 2.36 (dt, J= 14.4, 4.9 Hz, 1H), 2.20 (ddd, J= 14.6, 9.4, 5.5 Hz, 1H), 1.67 (t, J = 7.2 Hz, 3H), 1.60 (q, J= 6.7 Hz, 1H), 1.28 (t, J= 5.5 Hz, 1H), 1.20 (dd, J= 9.3, 5.2 Hz, 1H).

Example 249: Synthesis of Compound 514

Synthesis of Intermediate C419

A solution of ethyl 2-fluoroethanimidate hydrochloride (140 mg, 0.989 mmol, 1 equiv) and 2-amino-5-bromo-3 -fluorophenol (142.6 mg, 0.692 mmol, 0.7 equiv) in EtOH (4 mL) was stirred for 1 h at 60 °C. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was used in the next step directly without further purification. LCMS (ES, m/z): 248 [M+H] ⁺

Synthesis of Intermediate C420

To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l-carboxylate (100 mg, 0.278 mmol, 1 equiv) and 6-bromo-4-fluoro-2-(fluoromethyl)-l,3-benzoxazole (100 mg, 0.403 mmol, 1.45 equiv) in dioxane (4 mL) were added Cs ₂ CO ₃ (271.9 mg, 0.834 mmol, 3.0 equiv), XantPhos (32.2 mg, 0.056 mmol, 0.2 equiv) and Pd2(dba)3 (25.4 mg, 0.028 mmol, 0.1 equiv). After stirring for 3 h at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl 4-(7-{[4-fluoro-2-(fluoromethyl)-l,3-benzoxazol-6- yl]carbamoyl}-2-methylindazol-4-yl)piperazine-l -carboxylate (100 mg, 68%) as a solid. LCMS (ES, m/z): 527[M+H] ⁺

Synthesis of Compound 514 514

A solution of tert-butyl 4-(7-{[4-fluoro-2-(fluoromethyl)-l,3-benzoxazol-6-yl]carbamo yl}- 2-methylindazol-4-yl)piperazine-l -carboxylate (80 mg, 0.152 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to affordN-[4- fluoro-2-(fluoromethyl)-l,3-benzoxazol-6-yl]-2-methyl-4-(pip erazin-l-yl)indazole-7- carboxamide (24 mg, 37.04%) as a solid. LCMS (ES, m/z): 427 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.53 (s, 1H), 8.81 (s, 1H), 8.28 (d, J= 1.6 Hz, 1H), 8.01 (d, J= 8.1 Hz, 1H), 7.73 (dd, J= 12.1, 1.7 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 5.81 (s, 1H), 5.66 (s, 1H), 4.31 (s, 3H), 3.37 (d, J= 5.0 Hz, 4H), 2.92 (t, J= 5.1 Hz, 4H).

Example 250: Synthesis of Compound 515

Synthesis of Intermediate C421

To a solution of methyl 4-bromo-2-ethylindazole-7-carboxylate (500 mg, 1.766 mmol, 1 equiv) and tert-butyl N-(4-ethylpiperidin-4-yl)carbamate (604.8 mg, 2.649 mmol, 1.5 equiv) in dioxane (20 mL) were added Cs ₂ CO ₃ (1.73 g, 5.298 mmol, 3.0 equiv), RuPhos (164.8 mg, 0.353 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (147.7 mg, 0.177 mmol, 0.1 equiv). After stirring for 1 h at 80 °C under a nitrogen atmosphere, the mixture was allowed to cool down to room temperature. The resulting mixture was diluted with H ₂ O (20 mL). The resulting mixture was extracted with EA (3 x 20 mL). The combined organic layers were washed with brine (1x30 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford methyl 4-{4-[(tert-butoxycarbonyl)amino]-4-ethylpiperidin-l-yl}-2-e thylindazole-7- carboxylate (300 mg, 39%) as a solid. LCMS (ES, m/z): 431 [M+H] ⁺

Synthesis of Intermediate C422 A solution of methyl 4-{4-[(tert-butoxycarbonyl)amino]-4-ethylpiperidin-l-yl}-2- ethylindazole-7-carboxylate (300 mg, 0.697 mmol, 1 equiv) in DMF (4 mL) was treated with NaH (55.7 mg, 1.394 mmol, 2.0 equiv, 60%) for 30 min at 0 °C followed by the addition of CH ₃ I (148.3 mg, 1.045 mmol, 1.5 equiv) dropwise at 0°C. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was diluted with H ₂ O (5 mL). The resulting mixture was extracted with EA (3x10 mL). The combined organic layers were washed with brine (1x5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford methyl 4-{4-[(tert-butoxycarbonyl)(methyl)amino]-4-ethylpiperidin-l -yl}- 2-ethylindazole-7-carboxylate (170 mg, 55%) as a solid. LCMS (ES, m/z): 445 [M+H] ⁺

Synthesis of Intermediate C423

To a solution of methyl 4-{4-[(tert-butoxycarbonyl)(methyl)amino]-4-ethylpiperidin-l -yl}- 2-ethylindazole-7-carboxylate (170 mg, 0.382 mmol, 1 equiv) in MeOH (2 mL) and THF (2 mL) was added a solution of LiOH.H2O (96.2 mg, 2.292 mmol, 6.0 equiv) in H ₂ O (2 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The mixture was acidified to pH 2 with 2 M HCl. The resulting mixture was extracted with EA (3 x 5 mL). The combined organic layers were washed with brine (1 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 6) to afford 4-{4-[(tert- butoxycarbonyl)(methyl)amino]-4-ethylpiperidin-l-yl}-2-ethyl indazole-7-carboxylic acid (141 mg, 85%) as a solid. LCMS (ES, m/z): 431 [M+H] ⁺

Synthesis of Intermediate C424

To a stirred solution of 4-{4-[(tert-butoxycarbonyl)(methyl)amino]-4-ethylpiperidin-l -yl}- 2-ethylindazole-7-carboxylic acid (140 mg, 0.325 mmol, 1 equiv) and TCFH (118.6 mg, 0.423 mmol, 1.3 equiv) in CH ₃ CN (3 mL) were added NMI (93.4 mg, 1.137 mmol, 3.5 equiv) and 8- fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (64.4 mg, 0.390 mmol, 1.2 equiv) in portions at room temperature. The resulting mixture was stirred for 2 h at room temperature. The precipitated solids were collected by filtration and washed with H ₂ O (1 x 5 mL). The crude product was used in the next step directly without further purification. LCMS (ES, m/z): 578 [M+H] ⁺

Synthesis of Compound 515 C ₄ 24 515

A solution of tert-butyl N-{4-ethyl-l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyr idin- 6-yl}carbamoyl)indazol-4-yl]piperidin-4-yl}-N-methylcarbamat e (70 mg, 0.121 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 2-ethyl-4-[4-ethyl-4-(methylamino)piperidin-l-yl]-N-{8-fluor o-2- methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (28 mg, 48%) as a solid. LCMS (ES, m/zy. 478 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.80 (s, 1H), 7.96 (d, J= 8.1 Hz, 1H), 7.90 (dd, J= 3.2, 1.0 Hz, 1H), 7.29 (dd, J= 12.3, 1.7 Hz, 1H), 6.46 (d, J= 8.3 Hz, 1H), 4.59 (q, J= 13 Hz, 2H), 3.58 (d, J= 12.5 Hz, 2H), 3.49-3.30 (m, 2H), 2.38-2.32 (m, 3H), 2.16 (s, 3H), 1.72-1.48 (m, 7H), 1.42 (q, J= 1A Hz, 2H), 0.80 (t, J= 1A Hz, 3H).

Example 251: Synthesis of Compounds 516 and 517

Synthesis of Intermediate C425

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (300 mg, 0.721 mmol, 1 equiv), tert-butyl N-(4-methylpiperidin-4- yl)carbamate (154 mg, 0.721 mmol, 1 equiv) and Cs ₂ CO ₃ (470 mg, 1.442 mmol, 2.0 equiv) in dioxane (5 mL) were added RuPhos (67.26 mg, 0.144 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (60.28 mg, 0.072 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100°C. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA/MeOH (20:1) to afford tert-butyl N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-4-methylpiperidin-4-yl}carbamate (260 mg, 66%) as a solid. LCMS (ES, m/z) 550 [M+H] ⁺

Synthesis of Intermediate C426 A solution of tert-butyl N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]-4-methylpiperidin-4-yl}carbamate (250 mg, 0.455 mmol, 1 equiv) and trifluoroacetic acid (3 mL) in DCM (6 mL) was stirred for 2 h at room temperature under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 9) to afford 4-(4-amino-4- methylpiperidin-l-yl)-2-ethyl-N-{8-fluoro-2-methylimidazo[1, 2-a]pyridin-6-yl}indazole-7- carboxamide (130 mg, 64%) as a solid. LCMS (ES, m/z): 450 [M+H] ⁺

Synthesis of Compounds 516 and 517

To a stirred solution of 4-(4-amino-4-methylpiperidin-l-yl)-2-ethyl-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (150 mg, 0.334 mmol, 1 equiv) and acetaldehyde (73.50 mg, 1.670 mmol, 5 equiv) in DCE (5 mL) were added HO Ac (60.11 mg, 1.002 mmol, 3 equiv) and NaBHsCN (104.84 mg, 1.670 mmol, 5 equiv) portions at room temperature. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched by the addition of water (2 mL) at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 2-ethyl-4-[4-(ethylamino)-4-methylpiperidin-l-yl]-N-{8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxa mide (3 mg, 2%) as a solid and 4- [4-(diethylamino)-4-methylpiperidin-l-yl]-2-ethyl-N-{8-fluor o-2-methylimidazo[1,2-a]pyridin- 6-yl}indazole-7-carboxamide trifluoroacetic acid (25 mg, 12%) as a solid which was further purified by reverse flash chromatography (Condition 3, Gradient 3). Compound 516: LCMS (ES, m/z): 408 [M+H] ⁺¹ H NMR (300 MHz, Methanol-d ₄ ) δ 9.11 (s, 1H), 8.55 (s, 1H), 8.10 (d, J = 8.2 Hz, 1H), 7.74 (s, 1H), 7.25 (d, J = 12.1 Hz, 1H), 6.56 (d, J= 8.1 Hz, 1H), 4.63 (q, J= 7.1 Hz, 2H), 3.81 (d, J= 12.9 Hz, 2H), 3.20 (d, J= 12.7 Hz, 2H) ,2.80 (d, J= 5.9 Hz, 2H), 2.44 (s, 3H), 1.97-1.83 (m, 4H), 1.72 (t, J= 7.3 Hz, 3H), 1.33 (s, 3H), 1.22 (t, J = 7.1 Hz, 3H). Compound 517: LCMS (ES, m/z): 506 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.27 (s, 1H), 9.44 (s, 1H), 8.92 (s, 1H), 8.30 (s, 1H), 8.13 (s, 1H), 8.03 (d, J= 8.1 Hz, 1H), 7.76 (d, J= 12.0 Hz, 1H), 6.58 (d, J= 8.2 Hz, 1H), 4.63 (q, J = 7.2 Hz, 2H), 4.03 (d, J= 13.2 Hz, 2H), 3.49 (dd, J= 13.3, 7.0 Hz, 2H), 3.20 (d, J= 12.7 Hz, 2H) ,3.06 (dt, J= 13.5, 6.7 Hz, 2H), 2.44 (s, 3H), 2.09 (s, 4H), 1.64 (t, J= 7.3 Hz, 3H), 1.45 (s, 3H), 1.31 (t, J = 7.2 Hz, 6H).

Example 252: Synthesis of Compound 518

Synthesis of Intermediate C427 C ₄ 27

To a solution of 6-bromo-2-methylimidazo[1,2-a]pyridine (100 mg, 0.474 mmol, 1 equiv) and tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l-carboxylate (170.30 mg, 0.474 mmol, 1.0 equiv) in 1,4-dioxane (5 mL) were added Cs ₂ CO ₃ (308.74 mg, 0.948 mmol, 2.0 equiv), XantPhos (54.83 mg, 0.095 mmol, 0.2 equiv) and Pd2(dba)3 (43.39 mg, 0.047 mmol, 0.1 equiv). After stirring for 5 h at 90 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 10) to afford tert-butyl 4-[2-methyl-7-({2- methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)indazol-4-yl]piperazine- 1 -carboxylate (100 mg, 43%) as a solid. LCMS (ES, m/z): 490 [M+H] ⁺

Synthesis of Compound 518

C427 518

A solution of tert-butyl 4-[2-methyl-7-({2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (100 mg, 0.204 mmol, 1 equiv) and TFA (3 mL) in DCM (3 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7M NH3(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 10) to afford 2-methyl-N-{2- methylimidazo[1,2-a]pyridin-6-yl}-4-(piperazin-l-yl)indazole -7-carboxamide (30 mg, 37.71%) as a solid. LCMS (ES, m/z): 390 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.35 (dd, J= 2.1, 0.9 Hz, 1H), 8.80 (s, 1H), 7.99 (d, J= 8.1 Hz, 1H), 7.76 (s, 1H), 7.48 (d, J= 9.5 Hz, 1H), 7.25 (dd, J= 9.5, 2.0 Hz, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.29 (s, 3H), 3.35 (d, J= 5.3 Hz, 4H), 2.93 (dd, J= 6.0, 3.6 Hz, 4H), 2.33 (d, J= 0.9 Hz, 3H).

Example 253: Synthesis of Compound 520

Synthesis of Intermediate C428

To a solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7- carboxamide (120.0 mg, 0.298 mmol, 1.0 equiv) and tert-butyl N-ethyl-N- [(3R)-pyrrolidin-3-yl]carbamate (83.1 mg, 0.387 mmol, 1.3 equiv) in dioxane (1 mL) were added Cs ₂ CO ₃ (194.4 mg, 0.596 mmol, 2 .Oequiv) 184and Ruphos (27.8 mg, 0.060 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (24.9 mg, 0.030 mmol, 0.1 equiv). After stirring for 2 h at 85°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ / MeOH (20: 1) to afford tert-butyl N-ethyl-N-[(3R)- 1 -[7-({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (130 mg, 80%) as a solid. LCMS (ES, m/z): 536 [M+H] ⁺

Synthesis of Compound 520

Into a 40 mL vial were added tert-butyl N-ethyl-N-[(3R)-l-[7-({8-fluoro-2- methylimidazo[1,2-a]pyridin- 6-yl} carbarnoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (120.0 mg, 0.224 mmol, 1.0 equiv), DCM (2 mL) and HCl(gas)in 1,4-dioxane (1 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The reaction was monitored by LCMS. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-[(3R)-3- (ethylamino)pyrrolidin- 1 -yl]-N-{ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2- methylindazole-7-carboxamide (25 mg, 25.34%) as a solid. LCMS (ES, m/z): 436 [M+H] ⁺ 1H NMR (400 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.83 (s, 1H), 7.96-7.86 (m, 2H), 7.30 (dd, J= 12.4, 1.7 Hz, 1H), 6.01 (d, J= 8.4 Hz, 1H), 4.27 (s, 3H), 3.84-3.70 (m, 2H), 3.63 (d, J= 8.4 Hz, 1H), 3.45 (dd, J= 10.3, 5.1 Hz, 2H), 2.63 (q, J= 7.1 Hz, 2H), 2.35 (s, 3H), 2.17 (dq, J= 12.8, 6.6 Hz, 1H), 1.91 (dt, J= 12.2, 6.3 Hz, 2H), 1.05 (t, J= 7.1 Hz, 3H).

Example 254: Synthesis of Compound 522

Into a 8 mL vial were added (3S)-l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbamoyl)- 2-methylindazol-4-yl]pyrrolidin-3-yl 4-nitrobenzenesulfonate (100.0 mg, 0.168 mmol, 1.0 equiv), DMSO (0.5 mL) and 1-cyclopropylmethanamine (47.9 mg, 0.672 mmol, 4.0 equiv) at room temperature. The resulting mixture was stirred for overnight at 60 °C. The resulting mixture was diluted with water (3 mL). The resulting mixture was extracted with CH ₂ Q2 (2x5 mL). The combined organic layers were washed with brine (1 x 3 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by Prep-TLC (THF) to afford 4-[(3R)-3- [(cyclopropylmethyl)amino]pyrrolidin- 1 - yl]-N- { 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } - 2-methylindazole-7-carboxamide (50 mg, 25%) as a solid. The crude product (50 mg) was purified by Chiral Prep- HPLC w(Condition 8, Gradient 1) to afford 4-[(3R)-3- [(cyclopropylmethyl)amino]pyrrolidin- 1 -yl]-N-{ 8-fluoro-2- methylimidazof 1 ,2-a]pyridin-6-yl } - 2-methylindazole-7-carboxamide (20 mg, 25%) as a solid. LCMS (ES, m, z):462 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.02 (s, 1H), 9.20 (d, J= 1.7 Hz, 1H), 8.83 (s, 1H), 7.93 (d, J= 8.3 Hz, 1H), 7.89 (d, J = 3.1 Hz, 1H), 7.31 (dd, 12.5, 1.7 Hz, 1H), 6.02 (d, J = 8.4 Hz, 1H), 4.27 (s, 3H), 3.84-3.71 (m, 2H), 3.64 (s, 1H), 3.50 (d, J= 30.5 Hz, 2H), 2.35 (s, 3H), 2.18 (s, 1H), 1.95 (s, 1H), 1.24 (s, 1H), 0.89 (d, J= 22.6 Hz, 1H), 0.43 (d, J= 7.7 Hz, 2H), 0.16 (d, J = 4.6 Hz, 2H).

Example 255: Synthesis of Compound 524

Synthesis of Intermediate C429

A solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2 -methylindazole- 7-carboxamide (100 mg, 0.249 mmol, 1 equiv) in dioxane (1 mL) was added tert-butyl N- isopropyl-N-[(3R)-pyrrolidin-3-yl] carbamate (85.1 mg, 0.373 mmol, 1.5 equiv), Cs ₂ CO ₃ (202.5 mg, 0.623 mmol, 2.5 equiv) and Ruphos (23.3 mg, 0.050 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (20.8 mg, 0.025 mmol, 0.1 equiv) under nitrogen atmosphere. The reaction was strried for 1 h at 80°C to give a black solution. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (60%) to afford tert-butyl N-[(3R)- 1 -[7 -({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)-2- methylindazol-4-yl] pyrrolidin-3-yl]-N-isopropylcarbamate (135 mg, 99%) as an oil. LCMS

(ES, m, z):550 [M+H] ⁺

Synthesis of Compound 524 C ₄ 29 524

A solution of tert-butyl N-[(3R)-l-[7-({8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl} carbamoyl)-2-methylindazol-4-yl] pyrrolidin-3-yl]-N-isopropylcarbamate (150 mg, 0.273 mmol, 1 equiv) in DCM (2 mL) was added HCl(gas)in 1,4-dioxane (1 mL, 4M). The mixture was strried for 1 h at 20°C. The reaction was monitored by LCMS. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 3) to afford N-{8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl}-4-[(3R)-3- (isopropylamino) pyrrolidin-l-yl]-2-methylindazole-7-carboxamide (60 mg, 49%) as a solid. LCMS (ES, m, z):450 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.20 (d, J= 1.6 Hz, 1H), 8.83 (s, 1H), 7.93 (d, J= 8.3 Hz, 1H), 7.88 (s, 1H), 7.31 (dd, J= 12.4, 1.7 Hz, 1H), 6.02 (d, J= 8.4 Hz, 1H), 4.27 (s, 3H), 3.83 (t, J= 8.4 Hz, 1H), 3.74 (m, 1H), 3.69 - 3.51 (m, 2H), 3.37 (d, J= 13.2 Hz, 2H), 2.89 (p, J= 6.2 Hz, 1H), 2.35 (s, 3H), 2.18 (dt, J= 12.6, 6.2 Hz, 1H), 1.87 (dt, J= 12.5, 6.9 Hz, 1H), 1.03 (t, J= 5.8 Hz, 6H).

Example 256: Synthesis of Compound 525

Synthesis of Intermediate C430 C ₄ 30 To a stirred solution of tert-butyl 4-amino-4-methylpiperidine-l -carboxylate (1 g, 4.666 mmol, 1 equiv) and (1 -ethoxy cyclopropoxy) trimethylsilane (1.63 g, 9.332 mmol, 2 equiv) in tetrahydrofuran (20 mL) were added HOAc (0.84 g, 13.998 mmol, 3 equiv) and NaBH3CN (0.88 g, 13.998 mmol, 3 equiv) at room temperature. The resulting mixture was stirred for overnight at 60°C. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting mixture was extracted with EtOAc (3x30 mL). The combined organic layers were washed with brine (2x10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford tert-butyl 4-(cyclopropylamino)-4-methylpiperidine-l- carboxylate (260 mg, 22%) as an oil. LCMS (ES, m/z): 255 [M+H] ⁺

Synthesis of Intermediate C431 C ₄ 30 C ₄ 31

Into a 40 mL vial were added tert-butyl 4-(cyclopropylamino)-4-methylpiperidine-l- carboxylate (260 mg, 1.022 mmol, 1 equiv) and HCl(gas) in 1,4-dioxane (5 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was used in the next step directly without further purification. LCMS (ES, m/z): 155 [M+H] ⁺

Synthesis of Compound 525 C ₄ 31 525 To a stirred solution of N-cyclopropyl-4-methylpiperidin-4-amine hydrochloride (100 mg, 0.524 mmol, 1 equiv) and 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (327 mg, 0.786 mmol, 1.5 equiv) in 1,4-dioxane (10 mL) were added Cs ₂ CO ₃ (512 mg, 1.572 mmol, 3 equiv) and Pd-PEPP SI-IP entCl 2-methylpyridine (o-picoline (22 mg, 0.026 mmol, 0.05 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 48 h at 100°C. The mixture was allowed to cool down to room temperature. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting mixture was extracted with EtOAc (2x30 mL). The combined organic layers were washed with brine (3x5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 4-[4-(cyclopropylamino)-4-methylpiperidin-l-yl]-2-ethyl-N- {8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carb oxamide (19 mg, 7%) as a solid. LCMS (ES, m/z): 490 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.21 (s, 1H), 8.80 (s, 1H), 8.01-7.88 (m, 2H), 7.30 (d, J= 12.4 Hz, 1H), 6.48 (d, J= 8.7 Hz, 1H), 4.59 (d, J= 7.4 Hz, 2H), 3.36-3.29 (m, 4H), 2.49 (s, 1H), 2.36 (d, J= 2.6 Hz, 3H), 2.11 (s, 1H), 1.81 (d, J= 13.2 Hz, 2H), 1.63 (dt, J= 9.0, 4.5 Hz, 5H), 1.21 (d, J= 2.6 Hz, 3H), 0.42 (d, J= 3.6 Hz, 2H), 0.24 (s, 2H).

Example 256: Synthesis of Compound 526

Synthesis of Intermediate C432 C ₄ 32

A solution of methyl 4-bromo-2-ethylindazole-7-carboxylate (500 mg, 1.766 mmol, 1.00 equiv) in dixoane/H2O (4: 1) (1 mL) were added tert-butyl 3-(4,4,5,5-tetramethyl-l,3,2- dioxaborolan-2-yl)-4,5-dihydropyrrole-l-carboxylate (781.96 mg, 2.649 mmol, 1.5 equiv), K3PO4 (749.7 mg, 3.532 mmol, 2.0 equiv) and Pd(dppf)Cl ₂ (129.2 mg, 0.177 mmol, 0.1 equiv) under nitrogen atmosphere. The mixture was stirred at 80 °C for 1 h. The resulting mixture was concentrated under vacuum to give the crude product. The residue was purified by silica gel column chromatography, eluted with PE/EA (65%) to afford methyl 4-[l-(tert-butoxycarbonyl)- 4,5-dihydropyrrol-3-yl]-2-ethylindazole-7-carboxylate (500 mg, 76%) as an oil. LCMS (ES, m/z):372 [M+H] ⁺

Synthesis of Intermediate C433 C ₄ 32 C ₄ 33

A solution of methyl 4-[l-(tert-butoxycarbonyl)-4,5-dihydropyrrol-3-yl]-2-ethylin dazole-7- carboxylate (500 mg, 1.346 mmol, 1 equiv) in MeOH (15 mL) was added Pd/C (200 mg, 10%w/w). The mixture was stirred for 3 h at room temperature under hydrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1/1) to afford methyl 4-[l-(tert-butoxy carbonyl) pyrrolidin- 3-yl]-2-ethylindazole-7-carboxylate (270 mg, 54%) as an oil. LCMS (ES, m/z):374 [M+H] ⁺

Synthesis of Intermediate C434 C ₄ 33 C ₄ 34

A solution of methyl 4-[l-(tert-butoxycarbonyl) pyrrolidin-3-yl]-2-ethylindazole-7- carboxylate (270 mg, 0.723 mmol, 1 equiv) in THF/MeOH/H2O O (1 : 1 : 1) (6 mL) was added LiOH.H2O (303.36 mg, 7.230 mmol, 10.0 equiv). The mixture was strried for 1 h at 50°C to give a yellow mixture. The reaction was monitored by LCMS. The resulting mixture was concentrated under vacuum and acidified to pH 5-6 with IM HCl. The resulting mixture was extracted with EtOAc (3 x 30 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford4-[l-(tert-butoxycarbonyl) pyrrolidin-3-yl]-2- ethylindazole-7-carboxylic acid (170 mg, 65%) as a oil. LCMS (ES, m/z):360 [M+H] ⁺

Synthesis of Intermediate C435 C ₄ 34 C ₄ 35

A solution of 4-[l-(tert-butoxy carbonyl) pyrrolidin-3-yl]-2-ethylindazole-7-carboxylic acid (170 mg, 0.473 mmol, 1 equiv) in DMF (1.5 mL) was added NH4CI (126.5 mg, 2.365 mmol, 5 equiv), HATU (539.5 mg, 1.419 mmol, 3 equiv) and DIEA (91.7 mg, 0.710 mmol, 1.5 equiv). The mixture was strried at room temperature for 1 h. The resulting mixture was washed with 2 x 10 mL of water. Then extracted with EtOAc (3x20 mL), and dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE in EA (55%) to afford tert-butyl 3-(7-carbamoyl-2- ethylindazol-4-yl) pyrrolidine- 1 -carboxylate (125 mg, 74%) as an oil. LCMS (ES, m/z):359 [M+H] ⁺

Synthesis of Intermediate C436 C ₄ 35

A solution of tert-butyl 3-(7-carbamoyl-2-ethylindazol-4-yl) pyrrolidine- 1 -carboxylate (125 mg, 0.349 mmol, 1 equiv) in dioxane (1.5 mL) was added 6-bromo-8-fluoroimidazo[1,2-a] pyridine (112.4 mg, 0.523 mmol, 1.5 equiv), Cs ₂ CO ₃ (227.2 mg, 0.698 mmol, 2 equiv), XantPhos (40.3 mg, 0.070 mmol, 0.2 equiv) and Pd2(dba)3 (31.9 mg, 0.035 mmol, 0.1 equiv) under nitrogen atmosphere. The mixture was stirred at 100°C for 1 h to give a black solution. The reaction was monitored by LCMS. The resulting mixture was concentrated under vacuum The residue was purified by silica gel column chromatography, eluted with PE / EA (40%) to afford tert-butyl 3-[2-ethyl-7-({8-fluoroimidazo[1,2-a] pyridin-6-yl} carbamoyl) indazol-4-yl] pyrrolidine- 1 -carboxylate (50 mg, 29%) as an oil. LCMS (ES, m/z):493 [M+H] ⁺

Synthesis of Compound 526

A solution of tert-butyl 3-[2-ethyl-7-({8-fluoroimidazo[1,2-a] pyridin-6-yl} carbamoyl) indazol-4-yl] pyrrolidine- 1 -carboxylate (50 mg, 0.102 mmol, 1 equiv) in DCM (1 mL) was added HCl(gas)in 1,4-dioxane (1 mL, 4M). The mixture was stirred for 1 h at 20°C. The reaction was monitored by LCMS. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford2-ethyl-N-{8- fluoroimidazo[1,2-a] pyridin-6-yl}-4-(pyrrolidin-3-yl) indazole-7-carboxamide (6.8 mg, 17%) as a solid. LCMS (ES, m, z):393 [M+H] ^{+ 1} H NMR (400 MHz, Methanol-d ₄ ) δ 9.29 (d, J= 1.8 Hz, 1H), 8.66 (d, J= 1.3 Hz, 1H), 8.18 (d, J = 7.4 Hz, 1H), 8.03 (dd, J = 3.0, 1.4 Hz, 1H), 7.64 (d, J = 1.3 Hz, 1H), 7.46 (t, J= 7.8 Hz, OH), 7.34 (dd, J= 11.7, 2.1 Hz, 1H), 7.20 (d, J= 7.4 Hz, 1H), 4.69 (t, J= 7.3 Hz, 2H), 3.84-3.74 (m, 1H), 3.60-3.45 (m, 1H), 3.29 (d, J= 4.8 Hz, 1H), 3.25- 3.07 (m, 2H), 2.50-2.37 (m, 1H), 2.24-2.06 (m, 1H), 1.75 (td, J= 7.3, 3.1 Hz, 3H).

Example 257: Synthesis of Compound 527

Synthesis of Intermediate C437

To a stirred mixture of methyl 4-bromo-2-methylindazole-7-carboxylate (310 mg, 1.152 mmol, 1 equiv) and tert-butyl 4-aminopiperidine-l -carboxylate (276.8 mg, 1.382 mmol, 1.2 equiv) in 1,4-dioxane (3 mL) were added Cs ₂ CO ₃ (1.12 mg, 3.456 mmol, 3 equiv), RuPhos (107.5 mg, 0.230 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (96.4 mg, 0.115 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 12 h at 100 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 1) to afford methyl 4-{[l-(tert-butoxycarbonyl)piperidin-4-yl]amino}-2-methylind azole-7- carboxylate (300 mg, 67%) as a solid. LCMS (ES, m, z):389 [M+H] ⁺

Synthesis of Intermediate C438

To a solution of methyl 4-{[l-(tert-butoxycarbonyl)piperidin-4-yl]amino}-2- methylindazole-7-carboxylate (110 mg, 0.283 mmol, 1 equiv) in THF (2 mL) was added NaH (17.0 mg, 0.424 mmol, 1.5 equiv, 60%) at 0 °C. The mixture was stirred for 30 min and ethyl iodide (44.2 mg, 0.283 mmol, 1.0 equiv) was added and the mixture was allowed to warm to rt and stirred for 2 h. The reaction was quenched with MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford methyl 4-{ [ 1 -(tert- butoxycarbonyl)piperidin-4-yl](ethyl)amino}-2-methylindazole -7-carboxylate (120 mg, 92%) as a solid. LCMS (ES, m/z):417 [M+H] ⁺ Synthesis of Intermediate C439

To a stirred mixture of methyl 4-{[l-(tert-butoxycarbonyl)piperidin-4-yl](ethyl)amino}-2- methylindazole-7-carboxylate (120 mg, 0.288 mmol, 1 equiv) in THF (1.5 mL) and H ₂ O (1.5 mL) was added lithiumol hydrate (96.71 mg, 2.304 mmol, 8 equiv) at room temperature. The resulting mixture was stirred for 2 h at 50 °C. The mixture was acidified to pH 5 with HCl (2M). The resulting mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with water (3 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-{[l-(tert-butoxycarbonyl)piperidin-4- yl](ethyl)amino}-2-methylindazole-7-carboxylic acid (120 mg, 99%) as a solid. LCMS (ES, m/z): 403 [M+H] ⁺

Synthesis of Intermediate C440

To a stirred mixture of 4-{[l-(tert-butoxycarbonyl)piperidin-4-yl](ethyl)amino}-2- methylindazole-7-carboxylic acid (100 mg, 0.248 mmol, 1 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine (49.24 mg, 0.298 mmol, 1.2 equiv) in DMF (1 mL) were added NMI (81.60 mg, 0.992 mmol, 4 equiv) and TCFH (104.57 mg, 0.372 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 4 h at room temperature. The resulting mixture was diluted with water (6 mL). The resulting mixture was extracted with EtOAc (3x6 mL). The combined organic layers were washed with water (3 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with C^Cl ₂ /MeOH (10: 1) to afford tertbutyl 4-{ethyl[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}car bamoyl)-2-methylindazol-4- yl]amino}piperidine-l -carboxylate (50 mg, 37%) as a solid. LCMS (ES, m, z):550 [M+H] ⁺

Synthesis of Compound 527

To a stirred mixture of tert-butyl 4-{ethyl[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]amino}piperidine-l-carbox ylate (50 mg, 0.091 mmol, 1 equiv) in DCM (1 mL) was added HCl(gas)in 1,4-dioxane (0.2 mL, 4M) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4-[ethyl(piperidin-4-yl)amino]-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxa mide (9 mg, 22%) as a solid.

LCMS (ES, m, z):450 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.09 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.56 (s, 1H), 7.94 (d, J= 8.4 Hz, 1H), 7.89 (d, J= 3.1 Hz, 1H), 7.32 (dd, J= 12.4, 1.7 Hz, 1H), 6.37 (d, J= 8.5 Hz, 1H), 4.31 (s, 3H), 4.06 (d, J= 8.9 Hz, 1H), 3.57 (t, J= 7.0 Hz, 2H), 3.04 (d, J= 12.1 Hz, 2H), 2.76-2.60 (m, 2H), 2.35 (s, 3H), 1.72 (d, J= 18.6 Hz, 4H), 1.21 (t, J= 6.9 Hz, 3H).

Example 258: Synthesis of Compound 528

Synthesis of Intermediate C441 C ₄ 41

To a stirred mixture of tert-butyl 4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2 -methylindazol-4-yl]piperazine-l -carboxylate (85.0 mg, 0.167 mmol, 1.0 equiv) in DCE (2 mL) was added PCh (45.3 mg, 0.217 mmol, 1.3 equiv) in portions at room temperature. The resulting mixture was stirred for 5 h at 60 °C. The reaction was monitored by LCMS. The resulting mixture was concentrated under reduced pressure. The crude product mixture was used in the next step directly without further purification. LCMS (ES, m/z): 541 [M+H] ⁺

Synthesis of Compound 528 C ₄ 41 528

Into a 40 mL vial were added tert-butyl 4-[5-chloro-7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl} carbamoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (80.0 mg, 0.148 mmol, 1.0 equiv), DCM (2 mL) and HCl(gas)in 1,4-dioxane (0.5 mL, 4M) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The reaction was monitored by LCMS. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 5-chloro-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methyl- 4-(piperazin-l-yl)indazole-7-carboxamide (15 mg, 23%) as a solid. LCMS (ES, m/z): 441 [M+H] ⁺¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.00 (s, 1H), 9.22 (d, J= 1.7 Hz, 1H), 8.95 (s, 1H), 7.96-7.90 (m, 2H), 7.36 (dd, J= 12.3, 1.7 Hz, 1H), 4.32 (s, 3H), 3.39 (t, J= 4.7 Hz, 4H), 2.90 (t, J= 4.8 Hz, 4H), 2.36 (s, 3H). Example 259: Synthesis of Compound 529

Synthesis of Intermediate C442 C ₄ 42

To a stirred mixture of 6-bromo-2-methoxypyridin-3-amine (9 g, 44.326 mmol, 1 equiv) in DCM (90 mL) was added NCS (7.1 g, 53.191 mmol, 1.2 equiv) in portions at 0°C. The resulting mixture was stirred for overnight at room temperature. The resulting mixture was diluted with water (100 mL). The resulting mixture was extracted with CH ₂ CI ₂ (2 x 100 mL). The combined organic layers were washed with brine (2 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (10: 1) to afford 6-bromo-4- chloro-2-methoxypyri din-3 -amine (6 g, 57%) as a solid. LCMS (ES, m z): 237 [M+H] ⁺

Synthesis of Intermediate C443

A solution of 6-bromo-4-chloro-2-methoxypyridin-3-amine (2 g, 8.422 mmol, 1 equiv) in AC2O (20 mL) was stirred for 2 h at 80 °C. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 1) to afford N-acetyl-N-(6-bromo-4-chl oro-2-methoxypyri din-3 -yl) acetamide (1.5 g, 55%) as a solid. LCMS (ES, m/z): 280 [M+H] ⁺

Synthesis of Intermediate C444 C ₄ 43 C ₄ 44

To a solution of N-(6-bromo-4-chl oro-2-methoxypyri din-3 -yl)acetamide (1 g, 3.578 mmol, 1 equiv) in DMF (3 mL) was added Cs ₂ CO ₃ (2.33 g, 7.156 mmol, 2.0 equiv), (1S,2S)-N1,N2- dimethylcyclohexane-1,2-diamine (0.1 g, 0.716 mmol, 0.2 equiv) and Cui (0.07 g, 0.358 mmol, 0.1 equiv). After stirring for 3 h at 80°C under a nitrogen atmosphere, the mixture was allowed to cool down to rt. The resulting mixture was purified by reverse flash chromatography (Condition 5, Gradient 3) to afford 6-bromo-4-methoxy-2-methyl-[l,3]oxazolo[4,5-c]pyridine (100 mg, 12%) as a solid. LCMS (ES, m/z): 243 [M+H] ⁺

Synthesis of Intermediate C445

To a solution of tert-butyl 4-(7-carbamoyl-2-methylindazol-4-yl)piperazine-l-carboxylate (150 mg, 0.417 mmol, 1 equiv) and 6-bromo-4-methoxy-2-methyl-[l,3]oxazolo[4,5-c]pyridine (101.4 mg, 0.417 mmol, 1.0 equiv) in dioxane (4 mL) were added Cs ₂ CO ₃ (407.9 mg, 1.251 mmol, 3.0 equiv), Xantphos (48.3 mg, 0.083 mmol, 0.2 equiv) and Pd2(dba)3.CHCl3 (43.2 mg, 0.042 mmol, 0.1 equiv). After stirring for 2 h at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford tert-butyl 4-[7-({4-methoxy-2-methyl- [ 1 ,3 ]oxazolo[4,5-c]pyridin-6-yl } carbarnoyl)-2-methylindazol-4-yl]piperazine- 1 -carboxylate (163 mg, 75%) as a solid. LCMS (ES, m/z): 522 [M+H] ⁺

Synthesis of Compound 529 C ₄ 45

529

A solution of tert-butyl 4-[7-({4-methoxy-2-methyl-[l,3]oxazolo[4,5-c]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (150 mg, 0.288 mmol, 1 equiv) and TFA (0.3 mL) in DCM (3 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 3) to afford N-{4-methoxy-2-methyl-[l,3]oxazolo[4,5-c]pyridin-6-yl}-2-met hyl-4-(piperazin-l- yl)indazole-7-carboxamide (26 mg, 21%) as a solid. LCMS (ES, m/z): 422 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.69 (s, 1H), 8.81 (s, 1H), 8.20 (s, 1H), 8.03 (d, J= 8.1 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 4.26 (s, 3H), 4.09 (s, 3H), 3.37-3.32 (m, 4H), 2.92 (t, J= 5.0 Hz, 4H), 2.60 (s, 3H).

Example 260: Synthesis of Compound 531

To a stirred mixture of (3S)-l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl 4-nitrobenzenesulfonate (150 mg, 0.253 mmol, 1 equiv) in DMSO (0.75 mL) was added oxetan-3 -amine (92.36 mg, 1.265 mmol, 5 equiv) dropwise at room temperature. The resulting mixture was stirred for 24 h at 60 °C. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with EtOAc (2 x 10 mL). The combined organic layers were washed with water (1 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (10: 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[ (3R)-3-(oxetan- 3-ylamino)pyrrolidin-l-yl]indazole-7-carboxamide (50 mg) and then prep-chiral -HPLC (Condition 9, Gradient 1) to afford the target compound (12.2 mg, 10%) as a solid. LCMS (ES, m/z): 464 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.20 (d, J= 1.7 Hz, 1H), 8.82 (s, 1H), 7.97-7.85 (m, 2H), 7.31 (dd, J= 12.4, 1.6 Hz, 1H), 6.01 (d, J= 8.4 Hz, 1H), 4.68 (td, J= 6.6, 3.7 Hz, 2H), 4.36 (dt, J= 10.6, 6.1 Hz, 2H), 4.27 (s, 3H), 4.03 (p, J= 6.7 Hz, 1H), 3.79-3.71 (m, 2H), 3.67-3.61 (m, 1H), 3.41 (d, J= 8.8 Hz, 3H), 2.35 (s, 3H), 2.14-2.09 (m, 1H), 1.85 (dd, J= 12.3, 6.3 Hz, 1H).

Example 261: Synthesis of Compound 533

533

To a stirred mixture of (3S)-l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl 4-nitrobenzenesulfonate (150 mg, 0.253 mmol, 1 equiv) in DMSO (0.75 mL) was added cyclobutanamine (89.83 mg, 1.265 mmol, 5 equiv) dropwise at room temperature. The resulting mixture was stirred for 24 h at 60 °C. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with EtOAc (2 x 10 mL). The combined organic layers were washed with water (1 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with C^Cl ₂ /MeOH (10: 1) to afford (R)-4-(3-(cyclobutylamino)pyrrolidin-l-yl)-N-(8-fluoro-2-met hylimidazo[1,2- a]pyridin-6-yl)-2-methyl-2H-indazole-7-carboxamide (60 mg) and then prep-chiral-HPLC (Condition 9, Gradient 1) to afford the target compound (19.3 mg, 17%) as a solid. LCMS (ES, m/zy. 462 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.81 (s, 1H), 7.93 (d, J= 8.2 Hz, 1H), 7.88 (d, J= 3.0 Hz, 1H), 7.30 (dd, J= 12.4, 1.7 Hz, 1H), 6.01 (d, J= 8.4 Hz, 1H), 4.27 (s, 3H), 3.78-3.72 (m, 2H), 3.66-3.59 (m, 1H), 3.49-3.47 (m, 1H), 3.41-3.39 (m, 2H), 2.35 (s, 3H), 2.21-2.11 (m, 3H), 1.95-1.88 (m, 1H), 1.79-1.74 (m, 2H), 1.66- 1.55 (m, 2H).

Example 262: Synthesis of Compound 535

Synthesis of Intermediate C446

C446

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (150 mg, 0.36 mmol, 1 equiv) and tert-butyl (2S)-2- isopropylpiperazine-1 -carboxylate (124 mg, 0.54 mmol, 1.5 equiv) in dioxane (8 mL) were added Cs ₂ CO ₃ (235 mg, 0.72 mmol, 2 equiv), RuPhos (34 mg, 0.072 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (31 mg, 0.036 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 2 h at 100 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :5) to afford tert-butyl (2S)-4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6 -yl}carbamoyl)indazol- 4-yl]-2-isopropylpiperazine-l-carboxylate (100 mg, 49%) as a solid. LCMS (ES, m/z): 564 [M+H] ⁺

Synthesis of Compound 535 A solution of tert-butyl (2S)-4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6 - yl}carbamoyl)indazol-4-yl]-2-isopropylpiperazine-l-carboxyla te (100 mg, 0.177 mmol, 1 equiv) in TFA (1 mL) and DCM (3 mL) was stirred for 3 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7 M NHs(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 2-ethyl-N-{8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[(3S)-3-isoprop ylpiperazin-l-yl]indazole-7- carboxamide (35 mg, 43%) as a solid. LCMS (ES, m/z): 464 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.76 (s, 1H), 7.98 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.30 (d, J= 12.2 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 4.60 (q, J= 7.2 Hz, 2H), 3.84 (d, J= 8.4 Hz, 1H), 3.75 (d, J= 11.7 Hz, 1H), 3.05 (d, J= 8.0 Hz, 1H), 2.90 (d, J= 8.6 Hz, 2H), 2.67 (t, J= 11.0 Hz, 2H), 2.35 (s, 3H), 1.61 (t, J= 7.2 Hz, 4H), 0.97 (d, J= 6.7 Hz, 6H).

Example 263: Synthesis of Compounds 537 and 538

Synthesis of Compound 537

537

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (150 mg, 0.360 mmol, 1 equiv), Cs ₂ CO ₃ (352 mg, 1.080 mmol, 3 equiv) and (9aR)-octahydropyrazino[2,l-c][l,4]oxazine (76 mg, 0.540 mmol, 1.5 equiv) in 1,4- dioxane (5 mL) were added RuPhos (33 mg, 0.072 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 5 h at 100 °C. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 4-[(9aR)-hexahydro-lH-pyrazino[2,l-c] [l,4]oxazin-8-yl]-2-ethyl-N-{8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxa mide (11 mg, 6%) as a solid. LCMS (ES, m/zy. 478 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.12 (s, 1H), 9.22 (d, J= 1.6 Hz, 1H), 8.89 (s, 1H), 7.99 (d, J= 8.0 Hz, 1H), 7.92 (d, J= 3.1 Hz, 1H), 7.33 (d, J= 12.0 Hz, 1H), 6.52 (s, 1H), 4.60 (q, J= 13 Hz, 2H), 3.86 (s, 4H), 3.58 (s, 4H), 2.97 (s, 1H), 2.87 (s, 1H), 2.73 (s, 1H), 2.54 (s, 1H),2.36 (s, 3H), 1.63 (t, J= 13 Hz, 3H).

Synthesis of Compound 538

538

To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (100 mg, 0.24 mmol, 1 equiv) and (9aS)-octahydropyrazino[2,l- c][l,4]oxazine (69 mg, 0.48 mmol, 2 equiv) in dioxane (3 mL) were added Cs ₂ CO ₃ (470 mg, 1.440 mmol, 6 equiv), RuPhos (23 mg, 0.048 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (20 mg, 0.024 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 5 h at 100°C. The mixture was allowed to cool down to room temperature. The reaction was quenched with water (20 mL) at room temperature. The resulting mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with brine (1 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford 4-[(9aS)- hexahydro-lH-pyrazino[2,l-c][l,4]oxazin-8-yl]-2-ethyl-N-{8-f luoro-2-methylimidazo[1,2- a]pyridin-6-yl} indazole-7-carboxamide (55 mg, 48%) as a solid. LCMS (ES, m/z): 478 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.88 (s, 1H), 7.98 (d, J = 8.1 Hz, 1H), 7.91 (d, J= 3.1 Hz, 1H), 7.31 (dd, J= 12.4, 1.5 Hz, 1H), 6.51 (d, J= 8.1 Hz, 1H), 4.60 (q, J= 7.2 Hz, 2H), 3.81 (dq, J= 22.0, 12.0 Hz, 4H), 3.57 (t, J= 11.2 Hz, 1H), 3.19 (t, J= 10.4 Hz, 1H), 3.08 (t, J= 11.5 Hz, 1H), 2.88 (d, J= 11.5 Hz, 1H), 2.73 (d, J= 10.7 Hz, 1H), 2.61 (t, J= 11.2 Hz, 1H), 2.35 (s, 6H), 1.63 (t, J= 7.2 Hz, 3H). Example 264: Synthesis of Compound 539

Synthesis of Intermediate C447 C ₄ 47

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7- carboxamide (100.0 mg, 0.240 mmol, 1.0 equiv) and tert-butyl N-(3- methylpyrrolidin-3-yl)carbamate (72.1 mg, 0.360 mmol, 1.5 equiv) in dioxane (4 mL) were added Cs ₂ CO ₃ (156.5 mg, 0.480 mmol, 2.0 equiv) and Ruphos (22.4 mg, 0.048 mmol, 0.2 equiv) , RuPhos Palladacycle Gen.3 (20.0 mg, 0.024 mmol, 0.1 equiv) . After stirring for 2 h at 80 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :5) to afford tert-butyl N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}c arbamoyl)indazol-4- yl]-3- methylpyrrolidin-3-yl}carbamate (80 mg, 57.20%) as a solid. LCMS (ES, m/z): 536 [M+H] ⁺

Synthesis of Compound 539 C ₄ 47 539

To a stirred mixture of tert-butyl N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl} carbamoyl)indazol-4-yl]-3-methylpyrrolidin-3-yl}carbamate (80.0 mg, 0.149 mmol, 1.0 equiv) in DCM (2 mL) was added HCl(gas)in 1,4-dioxane (1 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient l) to afford 4-(3-amino-3-methylpyrrolidin-l-yl)-2-ethyl-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (15 mg, 23%) as a solid. LCMS (ES, m / 436 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.05 (s, 1H), 9.20 (d, J= 1.7 Hz, 1H), 8.83 (s, 1H), 7.93 (d, J= 8.3 Hz, 1H), 7.89 (d, J= 3.0 Hz, 1H), 7.27 (dd, J= 12.4, 1.7 Hz, 1H), 6.00 (d, J= 8.4 Hz, 1H), 4.57 (q, J= 13 Hz, 2H), 3.85 (d, J= 8.9 Hz, 1H), 3.72-3.71 (m, 1H), 3.51 (q, J= 10.1 Hz, 2H), 2.37-2.33 (m, 3H), 1.96 (t, J= 6.9 Hz, 2H), 1.61 (t, J= 13 Hz, 3H), 1.34 (s, 3H).

Example 265: Synthesis of Compounds 541 and 542

Synthesis of Intermediate C448 C ₄ 48

To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (150 mg, 0.360 mmol, 1.0 equiv) and tert-butyl 2- cyclopropylpiperazine-1 -carboxylate (97.8 mg, 0.432 mmol, 1.2 equiv) in dioxane (1.5 mL) were added Cs ₂ CO ₃ (352.2 mg, 1.080 mmol, 3.0 equiv), Ruphos (33.6 mg, 0.072 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.1 mg, 0.036 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 3 h at 90 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The reaction was concentrated off. The residue was purified by silica gel column chromatography, eluted with CH2Cl ₂ /MeOH (10: 1) to afford tert-butyl 2- cyclopropyl-4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]py ridin-6-yl}carbamoyl)indazol-4- yl]piperazine-l -carboxylate (116 mg, 57%) as a solid. LCMS (ES, m/z): 562 [M+H] ⁺

Synthesis of Compound 541 C ₄ 48 541

A solution of tert-butyl 2-cyclopropyl-4-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl (carbarnoyl)indazol-4-yl]piperazine-l -carboxylate (110 mg, 0.196 mmol, 1 equiv) in DCM (0.9 mL) was treated with HCl(gas)in 1,4-dioxane (0.3 mL). The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was neutralized to PH=7 with NaHCO, aqueous and extracted with DCM/MeOH (20/1). The organic layer was concentrated in vacuo. The residue was purified by chiral-HPLC (Condition 2, Gradient 2) to afford 4-[(3S)-3-cyclopropylpiperazin-l-yl]-2-ethyl-N- {8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl(indazole-7-carb oxamide (23 mg, 29%) as a solid. LCMS (ES, m/z): 462 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.77 (s, 1H), 7.99 (d, J= 8.1 Hz, 1H), 7.91 (d, J= 3.1 Hz, 1H), 7.30 (dd, J= 12.3, 1.7 Hz, 1H), 6.51 (d, J= 8.2 Hz, 1H), 4.61 (q, J= 7.3 Hz, 2H), 3.79 (dd, J= 19.6, 11.7 Hz, 2H), 3.08-2.72 (m, 4H), 2.35 (s, 3H), 2.16-2.03 (m, 1H), 1.62 (t, J= 7.3 Hz, 3H), 0.81 (qt, J= 8.4, 5.0 Hz, 1H), 0.44 (dd, J= 7.9, 3.9 Hz, 2H), 0.42-0.26 (m, 2H).

Synthesis of Compound 542 Cs ₂ CO ₃ , dioxane, 90 C,3 h

542

To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (100 mg, 0.240 mmol, 1.0 equiv) and (2R)-2-cyclopropylpiperazine (36.4 mg, 0.288 mmol, 1.2 equiv) in dioxane (1 mL) were added Cs ₂ CO ₃ (244.2 mg, 0.750 mmol, 3.0 equiv), Ruphos (23.3 mg, 0.050 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (20.9 mg, 0.025 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 3 h at 90°C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature and concentrated off. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4-[(3R)-3-cyclopropylpiperazin-l-yl]-2-ethyl-N-{8-fluoro-2-m ethylimidazo[1,2- a]pyridin-6-yl}indazole-7-carboxamide (32.3 mg, 29%) as a solid. LCMS (ES, m/z): 462 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.77 (s, 1H), 7.99 (d, J= 8.1 Hz, 1H), 7.91 (d, J= 3.0 Hz, 1H), 7.30 (dd, J= 12.3, 1.7 Hz, 1H), 6.51 (d, J= 8.2 Hz, 1H), 4.61 (q, J = 7.3 Hz, 2H), 3.79 (dd, J= 19.5, 11.6 Hz, 2H), 3.03 (d, J= 11.2 Hz, 1H), 2.99-2.90 (m, 1H), 2.87 (dd, J= 11.2, 2.5 Hz, 1H), 2.84-2.75 (m, 1H), 2.35 (s, 3H), 2.11 (t, J= 9.1 Hz, 1H), 1.62 (t, J= 7.3 Hz, 3H), 0.81 (td, J= 8.7, 8.1, 4.1 Hz, 1H), 0.43 (dd, J= 7.8, 3.7 Hz, 2H), 0.40-0.26 (m, 2H).

Example 266: Synthesis of Compound 543

Synthesis of Intermediate C449 C ₄ 49

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (130 mg, 0.312 mmol, 1 equiv) and tert-butyl N-cyclobutyl-N- (piperidin-4-yl)carbamate (159 mg, 0.624 mmol, 2 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (204 mg, 0.624 mmol, 2 equiv), RuPhos (29 mg, 0.062 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (26 mg, 0.031 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :10) to afford tert-butyl N-cyclobutyl-N-{ l-[2-ethyl-7-({8-fluoro-2- methylimidazof 1 ,2-a]pyridin-6-yl } carbarnoyl)indazol-4-yl]piperidin-4-yl } carbamate (100 mg, 54%) as a solid. LCMS (ES, m/z): 590 [M+H] ⁺ Synthesis of Compound 543 C ₄ 49 543

A solution of tert-butyl N-cyclobutyl-N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl} carbarnoyl)indazol-4-yl]piperidin-4-yl} carbamate (90 mg, 0.153 mmol, 1 equiv) in TFA (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The residue was basified to pH 8 with 7M NHs(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 4-[4- (cyclobutylamino)piperidin- 1 -yl]-2-ethyl-N-{ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6- yl}indazole-7-carboxamide (40 mg, 54%) as a solid. LCMS (ES, m/z): 490 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.20 (s, 1H), 8.78 (s, 1H), 7.96 (d, J= 8.0 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.29 (d, J= 12.2 Hz, 1H), 6.47 (d, J= 8.2 Hz, 1H), 4.59 (q, J= 13 Hz, 2H), 3.86 (d, J= 12.5 Hz, 2H), 3.27 (d, J= 1A Hz, 1H), 3.03 (t, J= 11.9 Hz, 2H), 2.65 (dq, J= 9.7, 4.6, 4.1 Hz, 1H), 2.35 (s, 3H), 2.12 (t, J= 8.2 Hz, 2H), 1.96-1.76 (m, 3H), 1.76-1.50 (m, 7H), 1.43 (q, J= 11.5, 9.7 Hz, 2H).

Example 267: Synthesis of Compounds 544, 547, and 548

Synthesis of Intermediate C450 C ₄ 50

To a stirred solution of tert-butyl N-(3-methylpyrrolidin-3-yl)carbamate (2.0 g, 9.986 mmol, 1.0 equiv) and DIEA (2.5 g, 19.972 mmol, 2.0 equiv) in DCM (30 mL) was added benzyl chloroformate (2.0 g, 11.983 mmol, 1.2 equiv) dropwise at 0 °C under nitrogen atmosphere. The resulting mixture was stirred for 5 h at room temperature. The reaction was monitored by LCMS. The resulting mixture was diluted with deionized water (50 mL). The resulting mixture was extracted with CH ₂ Cl ₂ (2 x 50 mL). The combined organic layers were washed with brine (1 x 50 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (5: 1) to afford benzyl 3 -[(tert- butoxy carbonyl)amino] -3 -methylpyrrolidine-1 -carboxylate (3.4 g, 92%) as a solid. LCMS (ES, m/z): 335 [M+H] ⁺

Synthesis of Intermediate C451

Cbz

NaH, CH ₃ I

DMF, rt, 1 h

450 451

To a stirred solution of benzyl 3-[(tert-butoxycarbonyl)amino]-3-methylpyrrolidine-l- carboxylate (750.0 mg, 2.243 mmol, 1.0 equiv) and NaH (107.6 mg, 4.486 mmol, 2.0 equiv) in dimethylformamide (15 mL) was added methyl iodide (636.6 mg, 4.486 mmol, 2.0 equiv) dropwise at 0 °C. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with Water at 0 °C. The resulting mixture was extracted with EtOAc (2 x 50 mL). The combined organic layers were washed with brine (1 x 50 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. LCMS (ES, m/z): 349 [M+H] ⁺

Synthesis of Intermediate C452 oc

451 452

To a solution of benzyl 3-[(tert-butoxycarbonyl)(methyl)amino]-3-methylpyrrolidine-l - carboxylate (650.0 mg, 1.865 mmol, 1.0 equiv) in 15 mL MeOH was added Pd/C (10%, 59.5 mg) under nitrogen atmosphere in a 100 mL round-bottom flask. The mixture was hydrogenated at room temperature for overnight under hydrogen atmosphere using a hydrogen balloon, filtered through a C ₆ lite pad and concentrated under reduced pressure. This resulted in tert-butyl N- methyl-N-(3-methylpyrrolidin-3-yl) carbamate (350 mg, 79%) as an oil. LCMS (ES, m/z): 215 [M+H] ⁺

Synthesis of Intermediate C453 C ₄ 53

To a solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7- carboxamide (100.0 mg, 0.240 mmol, 1.0 equiv) and tert-butyl N-methyl-N-(3- methylpyrrolidin-3-yl) carbamate (77.2 mg, 0.360 mmol, 1.5 equiv) in dioxane (3 mL) were added Cs ₂ CO ₃ (157.0 mg, 0.480 mmol, 2.0 equiv) and Ruphos (22.4 mg, 0.048 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (20.0 mg, 0.024 mmol, 0.1 equiv). After stirring for 2 h at 85°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :5) to afford tert-butyl N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}c arbamoyl)indazol-4- yl]-3-methylpyrrolidin-3-yl}-N-methylcarbamate (130 mg, 89%) as a solid. LCMS (ES, m/z): 550 [M+H] ⁺

Synthesis of Compound 544 C ₄ 53 544 To a stirred solution of tert-butyl N-{ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl} carbamoyl)indazol-4-yl]-3-methylpyrrolidin-3-yl}-N-m ethylcarbamate (100.0 mg, 0.182 mmol, 1.0 equiv) in DCM (2 mL) was added HCl (gas) in 1,4-dioxane (1 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The reaction was monitored by LCMS. The crude product was purified by Prep-HPLC (Condition 13, Gradient l) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl} -4- [3 -methyl-3 -(methylamino) pyrrolidin-l-yl]indazole-7-carboxamide (23 mg, 28%) as a solid. LCMS (ES, m/zp. 450 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.05 (s, 1H), 9.20 (d, J= 1.6 Hz, 1H), 8.84 (s, 1H), 7.96-7.86 (m, 2H), 7.31-7.23 (m, 1H), 6.00 (d, J= 8.4 Hz, 1H), 4.57 (q, J = 13 Hz, 2H), 3.78 (d, J= 8.4 Hz, 1H), 3.68 (m, 1H), 3.57 (d, J= 10.3 Hz, 1H), 3.45 (d, J= 10.2 Hz, 1H), 2.35 (s, 3H), 2.28 (s, 3H), 2.06 (dt, J= 12.3, 6.4 Hz, 1H), 1.93-1.84 (m, 1H), 1.82 (m, 1H), 1.61 (t, J = 7.2 Hz, 3H), 1.27 (s, 3H).

Synthesis of Compound 547

17 mg of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[3 -methyl-3- (methylamino) pyrrolidin-l-yl]indazole-7-carboxamide was purified by chiral-prep-HPLC (Condition 10, Gradient l) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}- 4-[(3R)-3-methyl-3-(methylamino)pyrrolidin-l-yl]indazole-7-c arboxamide (6 mg, 33%) as a solid. LCMS (ES, m/zp. 450 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.05 (s, 1H), 9.20 (d, J = 1.6 Hz, 1H), 8.84 (s, 1H), 7.96-7.86 (m, 2H), 7.31-7.23 (m, 1H), 6.00 (d, J= 8.4 Hz, 1H), 4.57 (q, J= 13 Hz, 2H), 3.78 (d, J= 8.4 Hz, 1H), 3.68-3.67 (m, 1H), 3.57 (d, J= 10.3 Hz, 1H), 3.45 (d, J= 10.2 Hz, 1H), 2.35 (s, 3H), 2.28 (s, 3H), 2.06 (dt, J= 12.3, 6.4 Hz, 1H), 1.93-1.84 (m, 1H), 1.82-1.81 (m, 1H), 1.61 (t, J= 7.2 Hz, 3H), 1.27 (s, 3H). Synthesis of Compound 548

548

17 mg of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[3 -methyl-3- (methylamino) pyrrolidin-l-yl]indazole-7-carboxamide was purified by prep-chiral HPLC (Condition 10, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo [1 ,2-a]pyridin-6-yl }- 4-[(3S)-3-methyl-3-(methylamino) pyrrolidin-l-yl]indazole-7-carboxamide (6 mg, 33%) as a solid.

LCMS (ES, m/zy. 450 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.05 (s, 1H), 9.20 (d, J= 1.6 Hz, 1H), 8.84 (s, 1H), 7.96-7.86 (m, 2H), 7.31-7.23 (m, 1H), 6.00 (d, J= 8.4 Hz, 1H), 4.57 (q, J = 13 Hz, 2H), 3.78 (d, J= 8.4 Hz, 1H), 3.68-3.67 (m, 1H), 3.57 (d, J= 10.3 Hz, 1H), 3.45 (d, J= 10.2 Hz, 1H), 2.35 (s, 3H), 2.28 (s, 3H), 2.06 (dt, J= 12.3, 6.4 Hz, 1H), 1.93-1.84 (m, 1H), 1.82- 1.81 (m, 1H), 1.61 (t, J= 7.2 Hz, 3H), 1.27 (s, 3H).

Example 268: Synthesis of Compound 545

Synthesis of Intermediate C454

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (150 mg, 0.36 mmol, 1 equiv), Cs ₂ CO ₃ (235 mg, 0.72 mmol, 2 equiv) and tert-butyl 4-(methylamino)piperidine-l -carboxylate (116 mg, 0.54 mmol, 1.5 equiv) in dioxane (5 mL) were added RuPhos (34 mg, 0.072 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :5) to afford tert-butyl 4-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl](methyl)amino}piperidine-l-carboxy late (60 mg, 30%) as a solid.

LCMS (ES, m/z): 550 [M+H] ⁺

Synthesis of Compound 545

A solution of tert-butyl 4-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl](methyl)amino}piperidine-l-carboxy late (60 mg, 0.109 mmol, 1 equiv) in TFA (2 mL) and DCM (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The residue was basified to pH 8 with 7M NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 2-ethyl-N-(8- fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-4-(methyl(piperid in-4-yl)amino)-2H-indazole-7- carboxamide (16 mg, 33%) as a solid. LCMS (ES, m/z): 450 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.70 (s, 1H), 7.99-7.86 (m, 2H), 7.33-7.23 (m, 1H), 6.34 (d, J= 8.5 Hz, 1H), 4.60 (q, J= 7.2 Hz, 2H), 3.99 (s, 1H), 3.06 (d, J= 15.7 Hz, 5H), 2.67 (s, 2H), 2.35 (s, 3H), 1.72 (s, 4H), 1.62 (t, J= 7.2 Hz, 3H).

Example 269: Synthesis of Compound 550

Synthesis of Intermediate C455 C ₄ 55

To a solution of methyl 4-bromo-2-ethylindazole-7-carboxylate (1 g, 3.532 mmol, 1 equiv) and tert-butyl (lR,5S)-3-amino-8-azabicyclo[3.2.1]octane-8-carboxylate (0.96 g, 4.238 mmol, 1.2 equiv) in dioxane (18 mL) were added RuPhos (0.33 g, 0.706 mmol, 0.2 equiv), Cs ₂ CO ₃ (3.45 g, 10.596 mmol, 3.0 equiv) and RuPhos Palladacycle Gen.3 (0.3 g, 0.353 mmol, 0.1 equiv). After stirring for 3 h at 80°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography w(Condition 5, Gradient 2) to afford methyl 4-{[(lR,5S)-8-(tert-butoxycarbonyl)-8- azabicyclo[3.2.1]octan-3-yl]amino}-2-ethylindazole-7-carboxy late (1.4 g, 93%) as a solid. LCMS (ES, m/z): 429 [M+H] ⁺

Synthesis of Intermediate C456 C ₄ 56

To a stirred solution of methyl 4-{[(lR,5S)-8-(tert-butoxycarbonyl)-8- azabicyclo[3.2.1]octan-3-yl]amino}-2-ethylindazole-7-carboxy late (500 mg, 1.167 mmol, 1 equiv) in DMF (6 mL) was added NaH (93.33 mg, 2.334 mmol, 2.0 equiv, 60%) in portions at 0°C. The resulting mixture was stirred for 0.5 h at 0 °C. To the above mixture was added CH ₃ I (165.6 mg, 1.167 mmol, 1.0 equiv) dropwise at 0 °C. The resulting mixture was stirred for additional 2 h at room temperature. The reaction mixture was quenched by the addition of MeOH (5 mL) at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford methyl 4-{[(lR,5S)-8-(tert- butoxy carbonyl)-8-azabicyclo[3.2. l]octan-3-yl](methyl)amino}-2-ethylindazole-7- carboxylate (500 mg, 97%) as a solid. LCMS (ES, m/z): 443 [M+H] ⁺

Synthesis of Intermediate C457 C ₄ 56 C ₄ 57

A solution of methyl 4-{[(lR,5S)-8-(tert-butoxycarbonyl)-8-azabicyclo[3.2.1]octan - 3-yl](methyl)amino}-2-ethylindazole-7-carboxylate (500 mg, 1.130 mmol, 1 equiv) and LiOH.H ₂ O (162.3 mg, 6.780 mmol, 6.0 equiv) in MeOH (2 mL), H ₂ O (2 mL) and THF (2 mL) was stirred for 12 h at room temperature. The mixture was acidified to pH 2 with 2 mol/L aq.HCl. The precipitated solids were collected by filtration and washed with H ₂ O (3 x 5 mL) to afford 4-(((lR,5S)-8-(tert-butoxycarbonyl)-8-azabicyclo[3.2.1]octan -3- yl)(methyl)amino)-2-ethyl-2H-indazole-7-carboxylic acid (400 mg, 83% ) as a solid. LCMS (ES, m/z): 429 [M+H] ⁺

Synthesis of Intermediate C458

To a solution of 4-{[(lR,5S)-8-(tert-butoxycarbonyl)-8-azabicyclo[3.2.1]octan -3- yl](methyl)amino}-2-ethylindazole-7-carboxylic acid (100 mg, 0.233 mmol, 1 equiv) and TCFH (85.1 mg, 0.303 mmol, 1.3 equiv) in CH ₃ CN (2 mL) were added NMI (67 mg, 0.816 mmol, 3.5 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (46.2 mg, 0.28 mmol, 1.2 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 1) to afford tert-butyl (lR,5S)-3-{[2-ethyl-7-({8-fluoro- 2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl](m ethyl)amino}-8- azabicyclo[3.2.1]octane-8-carboxylate (55 mg, 41%) as a solid.

LCMS (ES, m/z): 576 [M+H] ⁺

Synthesis of Compound 550 C ₄ 58

550

A solution of tert-butyl (lR,5S)-3-{[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyrid in-6- yl}carbamoyl)indazol-4-yl](methyl)amino}-8-azabicyclo[3.2.1] octane-8-carboxylate (50 mg, 0.087 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 2) to afford 4-[(lR,5S)-8-azabicyclo[3.2.1]octan-3-yl(methyl)amino]-2- ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}indazol e-7-carboxamide (20 mg, 48%) as a solid. LCMS (ES, m/z): 476 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.09 (s, 1H), 9.22 (d, J= 1.7 Hz, 1H), 8.69 (s, 1H), 7.99-7.86 (m, 2H), 7.28 (dd, J= 12.4, 1.7 Hz, 1H), 6.37 (d, J= 8.5 Hz, 1H), 4.60 (q, J= 13 Hz, 2H), 4.38-4.18 (m, 1H), 3.52 (s, 2H), 3.07 (s, 3H), 2.35 (s, 3H), 1.87 (t, J= 11.5 Hz, 2H), 1.74 (s, 3H), 1.63 (q, J= 9.2, 7.3 Hz, 6H).

Example 270: Synthesis of Compound 552

Synthesis of Intermediate C459 C ₄ 59

A solution of benzyl (3S)-3-[(4-methylbenzenesulfonyl)oxy]pyrrolidine-l-carboxyla te (500 mg, 1.332 mmol, 1.0 equiv) in DMSO (5 mL) was treated with morpholine (580.1 mg, 6.66 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for overnight at 70 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was extracted with EtOAc (3 x 30 mL). The combined organic layers were washed with brine (1 x 30 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 1) to afford benzyl (3R)-3-(morpholin-4-yl)pyrrolidine- 1-carboxylate (395 mg, 98%) as a solid. LCMS (ES, m/z): 291 [M+H] ⁺

Synthesis of Intermediate C460 C ₄ 59 C ₄ 60

To a solution of benzyl (3R)-3-(morpholin-4-yl)pyrrolidine-l -carboxylate (395 mg, 1.360 mmol, 1.0 equiv) in 10 mL MeOH was added Pd/C (10%, 40 mg) in a pressure tank. The mixture was hydrogenated at room temperature under 5 psi of hydrogen pressure for overnight, filtered through a C ₆ lite pad and concentrated under reduced pressure to afford 4-[(3R)-pyrrolidin-3- yl]morpholine (170 mg, 80%) as a oil. ¹ H NMR (400 MHz, Chloroform-d) δ 3.73 (t, J= 4.8 Hz, 4H), 3.19-3.01 (m, 2H), 2.95 (dt, J= 11.0, 7.5 Hz, 1H), 2.83-2.62 (m, 2H), 2.49 (ddt, J= 27.6, 10.7, 4.0 Hz, 4H), 1.95 (dtd, J= 12.3, 7.4, 4.7 Hz, 1H), 1.64 (dq, J= 12.4, 7.7 Hz, 1H).

Synthesis of Compound 552 C ₄ 60 552

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (70 mg, 0.174 mmol, 1.0 equiv) and 4-[(3R)-pyrrolidin-3- yl]morpholine (32.6 mg, 0.209 mmol, 1.2 equiv) in dioxane (1 mL) were added Cs ₂ CO ₃ (170.1 mg, 0.522 mmol, 3.0 equiv), Ruphos (8.1 mg, 0.017 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (14.5 mg, 0.017 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 3 h at 90°C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The crude product was purified by Prep-HPLC (Condition 10, Gradient 5) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[ (3R)-3-(morpholin-4- yl)pyrrolidin-l-yl]indazole-7-carboxamide (40 mg, 48%) as a solid. LCMS (ES, m/z): 478 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.86 (s, 1H), 7.93 (d, J= 8.3 Hz, 1H), 7.90-7.86 (m, 1H), 7.30 (dd, J= 12.5, 1.7 Hz, 1H), 6.04 (d, J= 8.4 Hz, 1H), 4.27 (s, 3H), 3.96-3.84 (m, 1H), 3.75 (t, J= 9.3 Hz, 1H), 3.64-3.61 (m, 5H), 3.49 (t, J= 9.0 Hz, 1H), 3.00 (t, J= 8.2 Hz, 1H), 2.53-2.52 (m, 4H), 2.34 (s, 3H), 2.33-2.18 (m, 1H), 1.90-1.88 (m, 1H).

Example 271: Synthesis of Compound 554

Synthesis of Intermediate C461

461 To a stirred solution of allylamine (2.0 g, 35.029 mmol, 1.0 equiv) and DIEA (9.0 g, 70.058 mmol, 2.0 equiv) in DCM (30 mL) was added 4-nitrobenzenesulfonyl chloride (7.7 g, 35.029 mmol, 1.0 equiv) dropwise at room temperature. The resulting mixture was stirred for 5 h at room temperature. The resulting mixture was extracted with CH ₂ Cl ₂ (2 x 50 mL). The combined organic layers were washed with brine (1 x 50 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (5: 1) to afford 4-nitro-N-(prop-2-en-l- yl)benzenesulfonamide (5 g, 53%) as a solid. LCMS (ES, m/z): 243 [M+H] ⁺

Synthesis of Intermediate C462 C461 C ₄ 62

To a stirred solution of 4-nitro-N-(prop-2-en-l-yl)benzenesulfonamide (1.5 g, 6.192 mmol, 1.0 equiv), triphenylphosphine (2.7 g, 10.526 mmol, 1.7 equiv) and tert-butyl (3S)-3- hydroxypyrrolidine-1 -carboxylate (1.7 g, 9.288 mmol, 1.5 equiv) in tetrahydrofuran (20 mL) was added DEAD (2.1 g, 12.384 mmol, 2.0 equiv) dropwise at 0°C under nitrogen atmosphere. The resulting mixture was stirred for 3 h at room temperature under nitrogen atmosphere. The reaction was monitored by LCMS. The resulting mixture was diluted with deionized water (50 mL). The resulting mixture was extracted with EtOAc (2 x 50 mL). The combined organic layers were washed with brine (1 x 50 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (5: 1) to afford tert-butyl (3R)-3-[N-(prop-2-en-l-yl)4- nitrobenzenesulfonamido]pyrrolidine-l -carboxylate (1.6 g, 56%) as an oil. LCMS (ES, m/z): 412 [M+H] ⁺

Synthesis of Intermediate C463 C ₄ 62 C ₄ 63

To a stirred solution of tert-butyl (3R)-3-[N-(prop-2-en-l-yl)4-nitrobenzenesulfonamido] pyrrolidine- 1- carboxylate (800.0 mg, 1.944 mmol, 1.0 equiv) in DCM (3 mL) was added HCI (gas)in 1,4-dioxane (1 mL, 4 M) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was neutralized to PH=7 with NaHCO3 aqueous and extracted with DCM (3 x 5 mL). The combined organic layers were dried by anhydrous Na ₂ SO ₄ and filtered. The filtrate was concentrated in vacuo. This resulted in 4-nitro-N-(prop-2-en-l-yl)-N-[(3R)- pyrrolidin-3-yl] benzenesulfonamide (450 mg, 68%) as a solid. LCMS (ES, m/z): 312 [M+H] ⁺

Synthesis of Intermediate C464 C ₄ 64

Into a 20 mL vial were added 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (200.0 mg, 0.497 mmol, 1.0 equiv), Cs ₂ CO ₃ (325. Omg, 0.994 mmol, 2.0 equiv), 4-nitro-N-(prop-2-en-l-yl)-N-[(3R)-pyrrolidin-3-yl]benzenesu lfonamide (309.6 mg, 0.994 mmol, 2.0 equiv), Pd-PEPPSI-IP entCl (20.9 mg, 0.025 mmol, 0.05 equiv) and dimethylformamide (5 mL) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 70 °C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :2) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin- 6-yl}-2-methyl-4-[(3R)-3-[N-(prop-2-en-l-yl)4-nitrobenzenesu lfonamido]pyrrolidin-l- yl]indazole-7-carboxamide (220 mg, 35%) as a solid. LCMS (ES, m z): 633 [M+H] ⁺ Synthesis of Compound 554 C ₄ 64 554

Into a 8 mL vial were added N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4- [(3R)-3- [N-(prop-2-en-l-yl)4-nitrobenzenesulfonamido]pyrrolidin-l-yl ]indazole-7-carboxamide (100.0 mg, 0.158 mmol, 1.0 equiv), K ₂ CO ₃ (43.6 mg, 0.316 mmol, 2.0 equiv) and C ₆ H ₅ SK (35.0 mg, 0.237 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (10: 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4- [(3R)-3-(prop-2-en-l-ylamino)pyrrolidin-l-yl]indazole-7-carb oxamide (70 mg) as a solid. The crude product (70 mg) was purified by Prep-HPLC (Condition 13, Gradient 1) to afford N-{8- fluoro-2-methylimidazo [1,2-a]pyridin-6-yl}-2-methyl-4-[(3R)-3-(prop-2-en-l- ylamino)pyrrolidin-l-yl]indazole-7-carboxamide (15 mg, 21%) as a solid. LCMS (ES, m/z): 448 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.20 (d, J= 1.6 Hz, 1H), 8.83 (s, 1H), 7.96-7.86 (m, 2H), 7.31 (dd, J= 12.4, 1.6 Hz, 1H), 6.02 (d, J= 8.4 Hz, 1H), 5.89 (ddt, J= 16.3, 11.3, 5.8 Hz, 1H), 5.21 (dq, J= 17.3, 1.7 Hz, 1H), 5.07 (dt, J= 10.3, 1.7 Hz, 1H), 4.27 (s, 3H), 3.78 (dd, J= 19.9, 6.9 Hz, 2H), 3.64 (d, J= 8.1 Hz, 1H), 3.51-3.40 (m, 2H), 3.26 (dt, J= 5.8, 1.6 Hz, 2H), 2.37-2.33 (m, 3H), 2.17 (dd, J= 11.9, 5.7 Hz, 1H), 1.93 (dd, J= 12.2, 6.2 Hz, 1H).

Example 272: Synthesis of Compound 556

Synthesis of Intermediate C465

To a stirred mixture of methyl 4-bromo-2-ethylindazole-7-carboxylate (1.5 g, 5.298 mmol, 1 equiv) and tert-butyl N-methyl-N-[(3R)-pyrrolidin-3-yl]carbamate (1.27 g, 6.358 mmol, 1.2 equiv) in Dioxane (30 mL) were added Cs ₂ CO ₃ (5.18 g, 15.894 mmol, 3 equiv) and RuPhos (0.49 g, 1.060 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (443.1 mg, 0.530 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 80 °C under nitrogen atmosphere. The resulting mixture was diluted with water (30 mL). The resulting mixture was extracted with EtOAc (3 x 30 mL). The combined organic layers were washed with water (3 x 30 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford methyl 4-[(3R)-3-[(tert- butoxycarbonyl)(methyl)amino]pyrrolidin-l-yl]-2-ethylindazol e-7-carboxylate (1.9 g, 89%) as a solid. LCMS (ES, m/z): 403 [M+H] ⁺

Synthesis of Intermediate C466 C ₄ 66

To a stirred mixture of methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l- yl]-2-ethylindazole-7-carboxylate (1.9 g, 4.721 mmol, 1 equiv) in THF (20 mL) and H ₂ O (20 mL) was added LiOH.H ₂ O (0.99 g, 23.605 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 2 h at 50°C. The mixture was acidified to pH 4 with HCl (2M). The resulting mixture was extracted with EtOAc (3 x 40 mL). The combined organic layers were washed with water (3 x 40 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-[(3R)-3-[(tert- butoxycarbonyl)(methyl)amino]pyrrolidin-l-yl]-2-ethylindazol e-7-carboxylic acid (1.4 g, 76%) as a solid. LCMS (ES, m/z): 389 [M+H] ⁺

Synthesis of Intermediate C467

To a stirred mixture of 4-[(3R)-3-[(tert-butoxycarbonyl)(methyl)amino]pyrrolidin-l-y l]-2- ethylindazole-7-carboxylic acid (1.2 g, 3.089 mmol, 1 equiv) and NH4CI (0.83 g, 15.445 mmol, 5 equiv) in DMF (24 mL) were added NMI (1.01 g, 12.356 mmol, 4 equiv) and TCFH (1.73 g, 6.178 mmol, 2 equiv) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was filtered and the filter cake was washed with EtOAc (3 x 10 mL). The filtrate was concentrated under reduced pressure to afford tert-butyl N-[(3R)-l-(7- carbamoyl-2-ethylindazol-4-yl)pyrrolidin-3-yl]-N-methylcarba mate (900 mg, 75%) as a solid.

LCMS (ES, m/z): 388 [M+H] ⁺

Synthesis of Intermediate C468 To a stirred solution of tert-butyl N-[(3R)-l-(7-carbamoyl-2-ethylindazol-4-yl)pyrrolidin-3- yl]-N-methylcarbamate (400 mg, 1.032 mmol, 1 equiv) and 6-bromo-8-chloro-2- methylimidazo[1,2-a]pyridine (380.1 mg, 1.548 mmol, 1.5 equiv) in Dioxane (8 mL) were added Cs ₂ CO ₃ (672.7 mg, 2.064 mmol, 2 equiv) and BrettPhos (110.8 mg, 0.206 mmol, 0.2 equiv) and Pd2(dba)3 (94.5 mg, 0.103 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 16 h at 100 °C under nitrogen atmosphere. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with EtOAc (3 x 10 mL). The combined organic layers were washed with water (3 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with C^Cl ₂ /MeOH (10: 1) to afford tert-butyl N-[(3R)-l-[7-({8-chloro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-ethylindazol-4-yl]pyrrolidin-3-yl]-N-m ethylcarbamate (80 mg, 14%) as a solid. LCMS (ES, m/z): 552 [M+H] ⁺

Synthesis of Compound 556

To a stirred mixture of tert-butyl N-[(3R)-l-[7-({8-chloro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-ethylindazol-4-yl]pyrrolidin-3-yl]-N-m ethylcarbamate (80 mg, 0.145 mmol, 1 equiv) in DCM (1.5 mL) was added HCl(gas)in 1,4-dioxane (0.5 mL, 4M) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-chloro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-ethyl-4-[( 3R)-3- (methylamino)pyrrolidin-l-yl]indazole-7-carboxamide (12.8 mg, 20%) as a solid. LCMS (ES, m/z): 452 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.03 (s, 1H), 9.30 (d, J= 1.8 Hz, 1H), 8.84 (s, 1H), 7.93 (d, J= 8.2 Hz, 1H), 7.88 (s, 1H), 7.50 (d, J= 1.7 Hz, 1H), 6.02 (d, J= 8.3 Hz, 1H), 4.58 (q, J= 7.2 Hz, 2H), 3.77 (dd, J= 13.5, 7.1 Hz, 2H), 3.66 (s, 1H), 3.43 (dd, J= 11.1, 3.9 Hz, 1H), 2.35 (d, J= 3.5 Hz, 6H), 2.15 (dd, J= 12.7, 6.1 Hz, 1H), 1.92 (dd, J= 12.5, 6.7 Hz, 2H), 1.61 (t, J = 7.2 Hz, 3H).

Example 273: Synthesis of Compound 557

Synthesis of Intermediate C469 C ₄ 69

To a stirred solution of methyl 4-bromo-6-fluoro-2H-indazole-7-carboxylate (2 g, 7.324 mmol, 1 equiv) in EA (20 mL) was added tetrafluoroboranuide; tri ethyl oxi danium (2.8 g, 14.648 mmol, 2 equiv) in portions at room temperature. The resulting mixture was stirred for 3 h at room temperature. The reaction was quenched by the addition of saturated aqueous NaHCO3 (100 mL) at room temperature. The resulting mixture was extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine (1 x 50 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford methyl 4- bromo-2-ethyl-6-fluoroindazole-7-carboxylate (2.1 g, 95%) as a solid. LCMS (ES, m/z): 301 [M+H] ⁺

Synthesis of Intermediate C470

To a stirred solution of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (300 mg, 0.996 mmol, 1 equiv) and tert-butyl N-(4-ethylpiperidin-4-yl)carbamate (455 mg, 1.992 mmol, 2 equiv) in dioxane (10 mL) were added Cs ₂ CO ₃ (649 mg, 1.992 mmol, 2 equiv), RuPhos (93 mg, 0.199 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (83 mg, 0.1 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 5 h at 100 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 1) to afford methyl 4-{4-[(tert-butoxycarbonyl)amino]-4- ethylpiperidin-l-yl}-2-ethyl-6-fluoroindazole-7-carboxylate (150 mg, 34%) as a solid. LCMS (ES, m/z): 449 [M+H] ⁺

Synthesis of Intermediate C471 C ₄ 70 C ₄ 71

A mixture of methyl 4-{4-[(tert-butoxycarbonyl)amino]-4-ethylpiperidin-l-yl}-2-e thyl-6- fluoroindazole-7-carboxylate (376 mg, 0.838 mmol, 1 equiv) and LiOH (201 mg, 8.38 mmol, 10 equiv) in H ₂ O (4 mL), THF (4 mL) and MeOH (4 mL) was stirred for overnight at room temperature. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with water (20 mL). The mixture was acidified to pH 2 with 1 M HCl (aq.). The resulting mixture was extracted with CH ₂ CI ₂ (3 x 5 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-{4-[(tert-butoxycarbonyl)amino]-4-ethylpiperidin-l-yl}-2- ethyl-6-fluoroindazole-7-carboxylic acid (136 mg, 37%) as a solid. LCMS (ES, m/z): 435 [M+H] ⁺

Synthesis of Intermediate C472 C ₄ 71 C ₄ 72

To a stirred solution of 4-{4-[(tert-butoxycarbonyl)amino]-4-ethylpiperidin-l-yl}-2-e thyl-6- fluoroindazole-7-carboxylic acid (136 mg, 0.313 mmol, 1 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine (57 mg, 0.344 mmol, 1.1 equiv) in DMF (5 mL) were added HATU (143 mg, 0.376 mmol, 1.2 equiv) and DIEA (202 mg, 1.565 mmol, 5 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 24 h at room temperature. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting solids were collected by filtration and washed with water (3 x 5 mL) to afford tertbutyl N-{4-ethyl-l-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[ 1,2-a]pyridin-6- yl} carbarnoyl)indazol-4-yl]piperidin-4-yl} carbamate (130 mg, 71%) as a solid. LCMS (ES, m/z): 582 [M+H] ⁺

Synthesis of Compound 557 C ₄ 72 557

A mixture of tert-butyl N-{4-ethyl-l-[2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[ 1,2- a]pyridin-6-yl} carbarnoyl)indazol-4-yl]piperidin-4-yl} carbamate (150 mg, 0.258 mmol, 1 equiv) in TFA (1 mL) and DCM (3 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7M NH3(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography(Condition 3, Gradient 2) to afford 4-(4-amino-4-ethylpiperidin-l- yl)-2-ethyl-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyrid in-6-yl}indazole-7-carboxamide (40 mg, 32%) as a solid. LCMS (ES, m z): 482 [M+H] ⁺¹ H NMR (400 MHz, DMSO-d ₆ ) δ 10.97 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.78 (s, 1H), 7.89 (d, J= 3.1 Hz, 1H), 7.21 (dd, J= 12.4, 1.7 Hz, 1H), 6.22 (d, J= 15.5 Hz, 1H), 4.50 (q, J= 7.3 Hz, 2H), 3.63 (dt, J= 13.1, 4.3 Hz, 2H), 3.51-3.40 (m, 2H), 2.35 (s, 3H), 1.66-1.58 (m, 1H), 1.57 (q, J= 7.3, 6.2 Hz, 4H), 1.52-1.45 (m, 2H), 1.40 (q, J= 7.4 Hz, 2H), 0.88 (t, J= 7.4 Hz, 3H).

Example 274: Synthesis of Compounds 559 and 560

Synthesis of Intermediate C473

C473

To a stirred solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (500 mg, 1.201 mmol, 1.0 equiv) and l,4-dioxa-8- azaspiro[4.5]decane (206.4 mg, 1.441 mmol, 1.2 equiv) in dioxane (5 mL) were added Cs ₂ CO ₃ (1.27 g, 3.90 mmol, 3.0 equiv), Ruphos (112.1 mg, 0.240 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (100.4 mg, 0.120 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 100°C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl ₂ /MeOH (10: 1) to afford 4-{ l,4-dioxa-8- azaspiro[4.5]decan-8-yl}-2-ethyl-N-{8-fluoro-2-methylimidazo [1,2-a]pyridin-6-yl}indazole-7- carboxamide (510 mg, 89%) as a solid. LCMS (ES, m/z): 479 [M+H] ⁺

Synthesis of Intermediate C474 C ₄ 73 C ₄ 74 A solution of 4-{ l,4-dioxa-8-azaspiro[4.5]decan-8-yl}-2-ethyl-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (370 mg, 0.773 mmol, 1 equiv) in Acetone (4 mL) and H ₂ O (2 mL) was treated with PPTS (3.89 g, 15.460 mmol, 20 equiv) at room temperature. The resulting mixture was stirred for 48 h at 70°C. The mixture was allowed to cool down to room temperature. The mixture was neutralized to pH 7 with saturated NaHCOs (aq.). The resulting mixture was extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2- a]pyridin-6-yl}-4-(4-oxopiperidin-l-yl)indazole-7-carboxamid e (230 mg, 68.47%) as a yellow solid. LCMS (ES, m/z): 435 [M+H] ⁺

Synthesis of Compound 559

To a stirred mixture of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4 - oxopiperidin-l-yl)indazole-7-carboxamide (100 mg, 0.230 mmol, 1 equiv) and 3- aminocyclobutan-l-ol (24.06 mg, 0.276 mmol, 1.2 equiv) in DCM (1 mL) was added NaBH(AcO)3 (97.56 mg, 0.460 mmol, 2 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with Water at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 14) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4 -{[(ls,3s)-3- hydroxycyclobutyl]amino}piperidin-l-yl)indazole-7-carboxamid e (4.1 mg, 4%) as a solid. LCMS (ES, m/z): 506 [M+H] ^{+ 1} H NMR (300 MHz, Methanol-d ₄ ) δ 9.04 (d, J= 1.6 Hz, 1H),

8.47 (s, 1H), 8.03 (d, J= 8.1 Hz, 1H), 7.68 (d, J = 3.0 Hz, 1H), 7.16 (dd, J= 11.7, 1.7 Hz, 1H),

6.48 (d, J= 8.2 Hz, 1H), 4.59 (q, J= 13 Hz, 2H), 4.40 (s, 1H), 3.97 (d, J= 12.8 Hz, 2H), 3.68 (p, J = 7.2 Hz, 1H), 3.00 (t, J= 12.3 Hz, 2H), 2.73 (t, J= 11.2 Hz, 1H), 2.41 (s, 3H), 2.18 (q, J= 6.8 Hz, 4H), 2.01 (d, J= 12.5 Hz, 2H), 1.69 (t, J= 13 Hz, 3H), 1.57 (q, J= 10.1 Hz, 2H). Synthesis of Compound 560 C ₄ 74 560

To a stirred mixture of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4 - oxopiperidin-l-yl)indazole-7-carboxamide (100 mg, 0.230 mmol, 1 equiv) and 3- aminocyclobutan-l-ol (24.06 mg, 0.276 mmol, 1.2 equiv) in DCM (1 mL) was added NaBH(AcO)3 (97.56 mg, 0.460 mmol, 2 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with water at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 14) to afford 2- ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-{ [(lr,3r)-3- hydroxycyclobutyl]amino}piperidin-l-yl)indazole-7-carboxamid e (3.6 mg, 3%) as a solid. LCMS (ES, m/z): 506 [M+H] ^{+ 1} H NMR (300 MHz, Methanol-d ₄ ) δ 9.07 (d, J= 1.7 Hz, 1H), 8.50 (s, 1H), 8.06 (d, J= 8.1 Hz, 1H), 7.71 (dd, J= 3.0, 1.0 Hz, 1H), 7.19 (dd, J= 11.8, 1.6 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 4.61 (q, J= 13 Hz, 2H), 4.06-3.90 (m, 3H), 3.12-2.88 (m, 3H), 2.86-2.57 (m, 3H), 2.43 (d, J= 0.8 Hz, 3H), 2.04 (d, J= 12.6 Hz, 2H), 1.87-1.67 (m, 5H), 1.59 (q, J= 12.1, 11.1 Hz, 2H).

Example 275: Synthesis of Compound 562

Synthesis of Intermediate C475 C ₄ 75

A solution of benzyl (3S)-3-[(4-methylbenzenesulfonyl)oxy]pyrrolidine-l-carboxyla te (500 mg, 1.332 mmol, 1.0 equiv) in DMSO (5 mL) was treated with tert-butyl piperazine-1- carboxylate (1.24 g, 6.660 mmol, 5.0 equiv) at room temperature. The resulting mixture was stirred for overnight at 70°C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was extracted with EtOAc (3 x 30 mL). The combined organic layers were washed with brine (1 x 30 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (2:1) to afford tert-butyl 4-[(3R)-l- [(benzyloxy)carbonyl]pyrrolidin-3-yl]piperazine-l -carboxylate (510 mg, 98%) as an oil. LCMS (ES, m/z): 390 [M+H] ⁺

Synthesis of Intermediate C476 C ₄ 75 C ₄ 76

To a solution of tert-butyl 4-[(3R)-l-[(benzyloxy)carbonyl]pyrrolidin-3-yl]piperazine-l- carboxylate (510 mg, 1.309 mmol, 1.0 equiv) in 10 mL MeOH was added Pd/C (10%, 50 mg) in a pressure tank. The mixture was hydrogenated at room temperature under 5 psi of hydrogen pressure for overnight, filtered through a C ₆ lite pad and concentrated under reduced pressure to afford tert-butyl 4-[(3R)-pyrrolidin-3-yl]piperazine-l-carboxylate (350 mg, 105%) as an oil.

Synthesis of Intermediate C477

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (70 mg, 0.174 mmol, 1.0 equiv) and tert-butyl 4-[(3R)- pyrrolidin-3-yl]piperazine-l -carboxylate (53.3 mg, 0.209 mmol, 1.2 equiv) in dioxane (1 mL) were added Cs ₂ CO ₃ (170.1 mg, 0.522 mmol, 3.0 equiv), Ruphos (8.1 mg, 0.017 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (14.6 mg, 0.017 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 3 h at 90 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The residue was purified by silica gel column chromatography, eluted with C^Cl ₂ /MeOH (10: 1) to afford tert-butyl 4-[(3R)-l-[7-({8-fluoro- 2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazo l-4-yl]pyrrolidin-3- yl]piperazine-l -carboxylate (94 mg, 94%) as a solid. LCMS (ES, m/z): 577 [M+H] ⁺

Synthesis of Compound 562

A solution of tert-butyl 4-[(3R)-l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]piperazine- l -carboxylate (93 mg, 0.161 mmol, 1.0 equiv) in DCM (0.9 mL) was treated with HCl (gas) in 1,4-dioxane (0.3 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 18, Gradient l) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl- 4-[(3R)-3-(piperazin-l-yl)pyrrolidin-l-yl]indazole-7-carboxa mide hydrochloride (39 mg, 47%) as a solid. LCMS (ES, m/z): 477 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.33 (s, 1H), 10.01 (s, 2H), 9.60 (s, 1H), 9.04 (s, 1H), 8.30 (s, 1H), 8.13 (d, J= 11.7 Hz, 1H), 7.98 (d, J= 8.2 Hz, 1H), 6.12 (d, J= 8.4 Hz, 1H), 4.32 (s, 3H), 4.17 (d, J= 5.7 Hz, 1H), 4.05-4.04 (m, 4H), 3.92- 3.91 (m, 2H), 3.64-3.63 (m, 2H), 3.61-3.49 (m, 4H), 2.64-2.63 (m, 1H), 2.51 (s, 3H), 2.44-2.43 (m, 1H). Example 276: Synthesis of Compound 563

Synthesis of Intermediate C448 C ₄ 48

To a solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7- carboxamide (100.0 mg, 0.249 mmol, 1.0 equiv) and tert-butyl 3,6- diazabicyclo[3.1.0]hexane-6-carboxylate (68.7 mg, 0.373 mmol, 1.5 equiv) in DMF (4 mL) were added Cs ₂ CO ₃ (162.0 mg, 0.498 mmol, 2.0 equiv) and Ruphos (11.6 mg, 0.025 mmol, 0.1 equiv), RuPhos Palladacycle Gen.3 (20.7 mg, 0.025 mmol, 0.1 equiv). After stirring for overnight at 90 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :3) to afford tert-butyl 3-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]-3,6-diazabicyclo[3.1.0]h exane-6-carboxylate (100 mg, 72%) as a solid. LCMS (ES, m/z): 506 [M+H] ⁺

Synthesis of Compound 563

A solution of tert-butyl 3-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2- methylindazol-4-yl]-3,6-diazabicyclo[3.1.0]hexane-6-carboxyl ate (100.0 mg, 0.198 mmol, 1.0 equiv) in DCM (2 mL) was treated with DIEA (76.7 mg, 0.594 mmol, 3.0 equiv), TMSOTf (131.8 mg, 0.594 mmol, 3.0 equiv) for 1 h at room temperature. The reaction was monitored by LCMS. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-{3,6-diazabicyclo[3.1.0]hexan-3- yl}-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl indazole- 7-carboxamide (10 mg, 11%) as a solid. LCMS (ES, m/z): 406 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 10.97 (s, 1H), 9.21 (d, J = 1.7 Hz, 1H), 8.77 (s, 1H), 7.97 (d, J= 7.7 Hz, 1H), 7.92 (d, J= 3.1 Hz, 1H), 7.35 (dd, J= 12.2, 1.7 Hz, 1H), 6.68 (d, J= 7.8 Hz, 1H), 4.33 (s, 3H), 3.28 -3.19 (m, 4H), 2.65 (d, J= 12.8 Hz, 2H), 2.36 (s, 3H).

Example 277: Synthesis of Compound 564

Synthesis of Intermediate C449

To a solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-me thylindazole-7- carboxamide (100.0 mg, 0.249 mmol, 1.0 equiv) and tert-butyl 3,6-diazabicyclo[3.1.0]hexane-3- carboxylate (68.7 mg, 0.373 mmol, 1.5 equiv) in DMF (4 mL) were added Cs ₂ CO ₃ (162.0 mg, 0.498 mmol, 2.0 equiv) and Ruphos (11.60 mg, 0.025 mmol, 0.1 equiv) ,RuPhos Palladacycle Gen.3 (20.7 mg, 0.025 mmol, 0.1 equiv). After stirring for overnight at 90°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :3) to afford tert-butyl6-[7- ({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-m ethylindazol-4-yl]-3,6- diazabicyclo[3.1.0]hexane-3-carboxylate (80 mg, 57%) as a solid. LCMS (ES, m/z): 506 [M+H] +

Synthesis of Compound 564 Into a 40 mL vial were added tert-butyl 6-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]-3,6-diazabicyclo[3.1.0]h exane-3-carboxylate (80.0 mg, 0.158 mmol, 1.0 equiv), DCM (2 mL), DIEA (61.3 mg, 0.474 mmol, 3.0 equiv) and TMSOTf (105.5 mg, 0.474 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4-{3,6- diazabicyclo[3. L0]hexan-6-yl}-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-y l}-2- methylindazole-7-carboxamide (10 mg, 15%) as a solid. LCMS (ES, m z): 406 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 10.97 (s, 1H), 9.20 (s, 1H), 8.77 (s, 1H), 8.01-7.85 (m, 2H), 7.34 (d, J= 12.3 Hz, 1H), 6.68 (d, J= 7.8 Hz, 1H), 4.33 (s, 3H), 3.28-3.19 (m, 4H), 2.65 (d, J= 12.7 Hz, 2H), 2.35 (s, 3H).

Example 278: Synthesis of Compound 565

Synthesis of Intermediate C450

100°C, o/n C ₄ 50

To a stirred mixture of methyl 4-bromo-2-ethylindazole-7-carboxylate (1 g, 3.532 mmol, 1 equiv), tert-butyl piperazine- 1 -carboxylate (0.79 g, 4.238 mmol, 1.2 equiv) and Cs ₂ CO ₃ (3.45 g, 10.596 mmol, 3 equiv) in 1,4-dioxane (20 mL) were added RuPhos (0.33 g, 0.706 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (0.30 g, 0.353 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 100°C under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :1) to afford methyl 4-[4-(tert- butoxycarbonyl)piperazin-l-yl]-2-ethylindazole-7-carboxylate (1.1 g, 80%) as a solid. LCMS (ES, m/z): 389[M+H] ⁺

Synthesis of Intermediate C451 C ₄ 50 C ₄ 51

To a stirred solution of methyl 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-ethylindazole-7- carboxylate (1.1 g, 2.832 mmol, 1 equiv) in THF/H ₂ O (9 mL/3 mL) was added lithiumol hydrate (0.36 g, 8.496 mmol, 3 equiv) at room temperature. The resulting mixture was stirred overnight at 40°C. The resulting mixture was concentrated under vacuum. The resulting mixture was diluted with H ₂ O (10 mL). The mixture was acidified to pH 4 with citric acid. The precipitated solids were collected by filtration and dried under infrared light to afford 4-[4-(tert- butoxycarbonyl)piperazin-l-yl]-2-ethylindazole-7-carboxylic acid (850 mg, 80%) as a solid. LCMS (ES, m/z): 375 [M+H] ⁺

Synthesis of Intermediate C452 C ₄ 51 C ₄ 52

To a stirred solution of 4-[4-(tert-butoxycarbonyl)piperazin-l-yl]-2-ethylindazole-7- carboxylic acid (850 mg, 2.270 mmol, 1 equiv) and HATU (1035.78 mg, 2.724 mmol, 1.2 equiv) in DCM (20 mL) was added DIEA (1466.99 mg, 11.350 mmol, 5 equiv) and NH4CI (485.70 mg, 9.080 mmol, 4 equiv) at room temperature. The resulting mixture was stirred overnight at room temperature. The resulting mixture was diluted with DCM (100 mL), washed with 2 x 50 mL of H ₂ O and 1 x 50 mL of brine. The organic layer was dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with C^Cl ₂ /MeOH (10: 1) to afford tert-butyl 4-(7- carbamoyl-2-ethylindazol-4-yl)piperazine-l -carboxylate (700 mg, 83%) as a solid. LCMS (ES, m/z): 374 [M+H] ⁺ Synthesis of Intermediate C453

To a stirred solution of 6-bromo-8-fluoro-2-methylimidazo[1,2-a]pyridine (1.0 g, 4.366 mmol, 1 equiv) in THF (20 mL) was added NaH (0.16 g, 6.549 mmol, 1.5 equiv) at 0 °C. The resulting mixture was stirred for 0.5 h at 0 °C under nitrogen atmosphere. To the above mixture was added F-TEDA-BF4 (2.32 g, 6.549 mmol, 1.5 equiv) in portions at 0 °C. The resulting mixture was stirred for additional 16 h at 60 °C. The reaction was quenched with MeOH at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with C^Cl ₂ /MeOH (10: 1) to afford 6-bromo-3,8- difluoro-2-methylimidazo[1,2-a]pyridine (400 mg, 37.09%) as a solid. LCMS (ES, m z): 247 [M+H] ⁺

Synthesis of Intermediate C454 100 C, o/n C ₄ 52 C ₄ 54

To a stirred mixture of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-l- carboxylate (160 mg, 0.428 mmol, 1 equiv), Cs ₂ CO ₃ (418.77 mg, 1.284 mmol, 3 equiv) and 6- bromo-3,8-difluoro-2-methylimidazo[1,2-a]pyridine (127.01 mg, 0.514 mmol, 1.2 equiv) in 1,4- dioxane (3 mL) were added XantPhos (49.58 mg, 0.086 mmol, 0.2 equiv) and Pd2(dba)3 (39.23 mg, 0.043 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 100 °C under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with C^Cl ₂ /MeOH (10: 1) to afford tert-butyl 4-[7-({3,8-difluoro-2-methylimidazo[1,2- a]pyridin-6-yl} carbarnoyl)-2-ethylindazol-4-yl]piperazine-l -carboxylate (100 mg, 43%) as a solid. LCMS (ES, m/z): 540 [M+H] ⁺

Synthesis of Compound 565 C ₄ 54 565

To a stirred solution of tert-butyl 4-[7-({3,8-difluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-ethylindazol-4-yl]piperazine-l -carboxylate (100 mg, 0.185 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 15, Gradient 1) to afford N-{3,8-difluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-ethyl-4-(piperazin-l-yl) indazole-7-carboxamide; trifluoroacetic acid (19 mg, 19%) as solid. LCMS (ES, m/z): 440 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.21 (s, 1H), 8.99 - 8.90 (m, 2H), 8.82 (s, 2H), 8.03 (d, J= 8.0 Hz, 1H), 7.37 (d, J = 12.6 Hz, 1H), 6.62 (d, J= 8.1 Hz, 1H), 4.63 (q, J= 7.2 Hz, 2H), 3.60 (t, J= 5.1 Hz, 4H), 3.36 (s, 4H), 2.35 (d, J= 1.3 Hz, 3H), 1.64 (t, J= 13 Hz, 3H).

Example 279: Synthesis of Compound 566

Synthesis of Intermediate C455 C ₄ 55

To a solution of phenol (4.30 g, 45.671 mmol, 1.1 equiv) in THF (55 mL) was added sodium hydride (60% in oil, 1.83 g, 1.1 equiv) at 0 °C. The mixture was stirred for 30 min. The solution of 3,5-dibromopyrazin-2-amine (10.5 g, 41.519 mmol, 1 equiv) in THF (50 mL) was added and the mixture was allowed to warm to 70 °C and stirred overnight. The mixture was allowed to cool down to room temperature. The reaction was quenched with water/ice. The resulting mixture was extracted with EtOAc (3 x 100 mL). The combined organic layers were washed with brine (1 x 100 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 : 1) to afford 5-bromo-3-phenoxypyrazin-2-amine (2.3 g, 21%) as a solid. LCMS (ES, m/z): 266 [M+H] ⁺

Synthesis of Intermediate C456

To a stirred solution of 5-bromo-3-phenoxypyrazin-2-amine (2.3 g, 8.643 mmol, 1 equiv) in isopropanol (23 mL) were added l-bromo-2,2-dimethoxypropane (1.90 g, 10.372 mmol, 1.2 equiv) and PPTS (0.22 g, 0.864 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred overnight at 80°C. The mixture was allowed to cool down to room temperature. The precipitated solids were collected by filtration and the solids was dried under vacuum to afford 6- bromo-2-methyl-8-phenoxyimidazo[1,2-a]pyrazine (800 mg, 30%) as a solid. LCMS (ES, m/ z): 304 [M+H] ⁺

Synthesis of Intermediate C457

C456 C457 To a stirred mixture of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-l- carboxylate (160 mg, 0.428 mmol, 1 equiv), 6-bromo-2-methyl-8-phenoxyimidazo[1,2- a]pyrazine (156.37 mg, 0.514 mmol, 1.2 equiv) and Cs ₂ CO ₃ (418.77 mg, 1.284 mmol, 3 equiv) in 1,4-dioxane (3.2 mL) was added XantPhos (49.58 mg, 0.086 mmol, 0.2 equiv) and Pd2(dba)3 (39.23 mg, 0.043 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 100 °C under nitrogen atmosphere. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with CH2l ₂ /MeOH (10: 1) to afford tert-butyl 4-[2-ethyl-7-({2-methyl- 8-phenoxyimidazo[1,2-a]pyrazin-6-yl}carbamoyl)indazol-4-yl]p iperazine-l -carboxylate (110 mg, 43%) as a solid. LCMS (ES, m/z): 597 [M+H] ⁺

Synthesis of Compound 566 C ₄ 57 566

To a stirred solution of tert-butyl 4-[2-ethyl-7-({2-methyl-8-phenoxyimidazo[1,2-a]pyrazin- 6-yl}carbamoyl)indazol-4-yl]piperazine-l-carboxylate (110 mg, 0.184 mmol, 1 equiv) in DCM (1 mL) was added TFA (1 mL) at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 15) to afford 2-ethyl-N-{2-methyl-8- phenoxyimidazo[1,2-a]pyrazin-6-yl}-4-(piperazin-l-yl)indazol e-7-carboxamide (17.1 mg, 19%) as a solid. LCMS (ES, m/z): 497 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.23 (s, 1H), 9.09 (s, 1H), 8.75 (s, 1H), 8.04 (s, 1H), 7.96 (d, J= 8.1 Hz, 1H), 7.53 (t, J= 7.8 Hz, 2H), 7.37 (dd, J= 13.8, 7.4 Hz, 3H), 6.46 (d, J= 8.1 Hz, 1H), 4.30 (q, J= 7.3 Hz, 2H), 3.34 (d, J= 4.9 Hz, 4H) 2.90 (dd, J= 6.1, 3.6 Hz, 4H), 2.41 (s, 4H), 1.34 (t, J= 7.3 Hz, 3H), 1.24 (s, 1H).

Example 280: Synthesis of Compound 568

Synthesis of Intermediate C458 C ₄ 58

To a stirred mixture of bicyclo[ 1.1.1 ]pentan-l -amine hydrochloride (550 mg, 4.599 mmol, 1 equiv) in DCM (10 mL) were added EtsN (1.40 g, 13.797 mmol, 3 equiv) and 4-nitrobenzene- 1-sulfonyl chloride (1.12 g, 5.059 mmol, 1.1 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 5 h at room temperature under nitrogen atmosphere. The resulting mixture was washed with 3 x 10 mL of water, dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford N-{bicyclo[l. l.l]pentan-l-yl}-4-nitrobenzenesulfonamide (780 mg, 63%) as a solid. LCMS (ES, m/z):267 [M-H] ’

Synthesis of Intermediate C459

Boc C ₄ 58 C ₄ 59

To a stirred mixture of N-{bicyclo[l.l. l]pentan-l-yl}-4-nitrobenzenesulfonamide (750 mg, 2.795 mmol, 1.0 equiv) and tert-butyl (3 S)-3 -hydroxypyrrolidine- 1 -carboxylate (785.1 mg, 4.192 mmol, 1.5 equiv) in THF (15 mL) were added PPh3 (1.4 g, 5.590 mmol, 2.0 equiv) and DEAD (973.7 mg, 5.590 mmol, 2.0 equiv) dropwise at 0°C under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 50 °C under nitrogen atmosphere. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with EtOAc (3x10 mL). The combined organic layers were washed with water (3 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :1) to afford tert-butyl (3R)-3-(N- {bicyclo[ 1.1.1 ]pentan- 1 -yl }4-nitrobenzenesulfonamido)pyrrolidine- 1 -carboxylate (760 mg, 62%) as a solid. LCMS (ES, m/z):438 [M+H] ⁺

Synthesis of Intermediate C460 C ₄ 60

To a stirred mixture of tert-butyl (3R)-3-(N-{bicyclo[l. l.l]pentan-l-yl}4- nitrobenzenesulfonamido)pyrrolidine-l -carboxylate (320 mg, 0.731 mmol, 1 equiv) in DCM (2 mL) was added HCl(gas)in 1,4-dioxane (0.5 mL, 4M) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under vacuum. The mixture basified to pH 8 with saturated NaHCO3 (aq.). The resulting mixture was extracted with EtOAc (3 x 2 mL). The combined organic layers were washed with water (3 x 2 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford N-{bicyclo[l .1. l]pentan-l-yl}-4-nitro-N-[(3R)- pyrrolidin-3-yl]benzenesulfonamide (230 mg, 93%) as a solid. LCMS (ES, m/z): 338 [M+H] ⁺

Synthesis of Intermediate C461 C ₄ 60 C ₄ 61

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (110 mg, 0.273 mmol, 1.0 equiv) and N-{bicyclo[l. l.l]pentan-l- yl}-4-nitro-N-[(3R)-pyrrolidin-3-yl]benzenesulfonamide (119.95 mg, 0.355 mmol, 1.3 equiv) in DMF (2 mL) were added Cs ₂ CO ₃ (222.7 mg, 0.683 mmol, 2.5 equiv) and RuPhos (25.5 mg, 0.055 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (22.9 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 90°C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with EtOAc (3x5 mL). The combined organic layers were washed with water (3 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford 4-[(3R)-3- (N-{bicyclo[ 1.1.1 ]pentan- 1 -yl }4-nitrobenzenesulfonamido)pyrrolidin- 1 -yl]-N- { 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxa mide (60 mg, 33%) as a solid. LCMS (ES, m/z): 658 [M+H] ⁺

Synthesis of Compound 568 C ₄ 61

568

To a stirred mixture of 4-[(3R)-3-(N-{bicyclo[l.l. l]pentan-l-yl}4- nitrobenzenesulfonamido)pyrrolidin-l-yl]-N-{8-fluoro-2-methy limidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (40 mg, 0.061 mmol, 1 equiv) in DMF (1 mL) were added K ₂ CO ₃ (16.8 mg, 0.122 mmol, 2 equiv) and PhSK (13.4 mg, 0.092 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with EtOAc (3x5 mL). The combined organic layers were washed with water (3 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4-[(3R)-3-{bicyclo[l.l. l]pentan-l- ylamino}pyrrolidin-l-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]p yridin-6-yl}-2-methylindazole-7- carboxamide (11 mg, 38%) as a solid. LCMS (ES, m/z): 558 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.19 (s, 1H), 8.79 (s, 1H), 7.91 (dd, J= 12.8, 5.7 Hz, 2H), 7.30 (d, J = 12.2 Hz, 1H), 6.00 (d, J= 8.4 Hz, 1H), 4.27 (s, 3H), 3.93-3.44 (m, 4H), 2.36 (d, J= 7.6 Hz, 5H), 2.28-2.27 (m, 1H), 1.79-1.78 (m, 7H).

Example 281: Synthesis of Compound 569

Synthesis of Intermediate C462 C ₄ 62

To a stirred solution of methyl 4-bromo-2-ethyl-6-fluoroindazole-7-carboxylate (500 mg, 1.66 mmol, 1 equiv), Cs ₂ CO ₃ (1082 mg, 3.32 mmol, 2 equiv) and tert-butyl N-cyclopropyl-N- (pyrrolidin-3-yl)carbamate (752 mg, 3.32 mmol, 2 equiv) in dioxane (10 mL) were added RuPhos (775 mg, 1.66 mmol, 1 equiv) and RuPhos Palladacycle Gen.3 (278 mg, 0.332 mmol, 0.2 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for overnight at 100°C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The reaction was quenched by the addition of water (30 mL) at room temperature. The resulting mixture was extracted with EtOAc (3 x 10 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography(Condition 3, Gradient 1) to afford methyl 4-{3-[(tert- butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-l-yl}-2-ethyl-6 -fluoroindazole-7-carboxylate (150 mg, 20%) as a solid. LCMS (ES, m/z): 447 [M+H] ⁺

Synthesis of Intermediate C463 C ₄ 62 C ₄ 63

A mixture of methyl 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-l-y l}-2- ethyl-6-fluoroindazole-7-carboxylate (150 mg, 0.336 mmol, 1 equiv) and LiOEEELO (282 mg, 6.720 mmol, 20 equiv) in H ₂ O (2 mL) and THF (4 mL) was stirred for 24 h at room temperature. The resulting mixture was concentrated under vacuum. The residue was diluted with water (5.0 mL), then adjusted to pH 5 with 1 mol/L aq.HCl. The resulting mixture was extracted with CH ₂ Q2 (3 x 5 mL). The combined organic layers were washed with brine (1 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-l-y l}-2-ethyl-6-fluoroindazole-7- carboxylic acid (130 mg, 89%) as an oil. LCMS (ES, m/z): 433 [M+H] ⁺

Synthesis of Intermediate C464

To a stirred solution of 4-{3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-l-y l}-2- ethyl-6-fluoroindazole-7-carboxylic acid (130 mg, 0.301 mmol, 1 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine (55 mg, 0.331 mmol, 1.1 equiv) in DMF (5 mL) were added HATU (137 mg, 0.361 mmol, 1.2 equiv) and DIEA (117 mg, 0.903 mmol, 3 equiv) at room temperature. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting mixture was extracted with EtOAc (3 x 10 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :3) to afford tert-butyl N-cyclopropyl-N-{ l- [2-ethyl-6-fluoro-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin -6-yl}carbamoyl)indazol-4- yl]pyrrolidin-3-yl} carbamate (130 mg, 75%) as a solid. LCMS (ES, m z): 580 [M+H] ⁺

Synthesis of Compound 569

569

A solution of tert-butyl N-cyclopropyl-N-{ l-[2-ethyl-6-fluoro-7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)indazol-4-yl]pyrrolidin-3-yl} carbamate (130 mg, 0.224 mmol, 1 equiv) in TFA (1 mL) and DCM (3 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was basified to pH 8 with 7M NH(g) in MeOH. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 4-[3-(cyclopropylamino)pyrrolidin-l-yl]-2-ethyl-6-fluoro-N-{ 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (27 mg, 25%) as a solid. LCMS (ES, m/z): 480 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.17 (d, J= 1.7 Hz, 1H), 8.80 (s, 1H), 7.87 (d, J= 3.1 Hz, 1H), 7.18 (dd, J= 12.4, 1.7 Hz, 1H), 5.74 (d, J= 16.1 Hz, 1H), 4.52 (q, J= 13 Hz, 2H), 3.85-3.48 (m, 4H), 3.44 (d, J= 10.1 Hz, 1H), 2.35 (s, 3H), 2.15 (tt, J= 7.0, 3.5 Hz, 2H), 1.98 (p, J= 6.1 Hz, 1H), 1.58 (t, J = 7.2 Hz, 3H), 0.42 (d, J= 6.6 Hz, 2H), 0.26 (dq, J = 7.2, 4.8, 3.3 Hz, 2H).

Example 282: Synthesis of Compound 571

Synthesis of Intermediate C465 C ₄ 65 To a solution of methyl 4-bromo-6-fluoro-2-methylindazole-7-carboxylate (200 mg, 0.697 mmol, 1 equiv) and tert-butyl N-cyclopropyl-N-[(3R)-pyrrolidin-3-yl]carbamate (173 mg, 0.767 mmol, 1.1 equiv) in dioxane (6 mL) were added Cs ₂ CO ₃ (680 mg, 2.091 mmol, 3.0 equiv), RuPhos (32.5 mg, 0.07 mmol, 0.1 equiv) and RuPhos Palladacycle Gen.3 (58.2 mg, 0.070 mmol, 0.1 equiv). After stirring for 2 h at 80 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford methyl 4-[(3R)-3-[(tert- butoxycarbonyl)(cyclopropyl)amino]pyrrolidin-l-yl]-6-fluoro- 2-methylindazole-7-carboxylate (210 mg, 70%) as a solid. LCMS (ES, m/z): 433 [M+H] ⁺

Synthesis of Intermediate C466

A mixture of methyl 4-[(3R)-3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidi n-l-yl]- 6-fluoro-2-methylindazole-7-carboxylate (200 mg, 0.462 mmol, 1 equiv) and LiOH’HiO (66 mg, 2.772 mmol, 6.0 equiv) in H ₂ O (2 mL), THF (2 mL) and MeOH (2 mL) was stirred for 12 h at 60°C. The mixture was acidified to pH 3 with aq.HCl (2 M). The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford 4-[(3R)-3 -[(tertbutoxy carbonyl)(cy cl opropyl)amino]pyrrolidin-l-yl]-6-fluoro-2-methylindazole-7-c arboxylic acid (100 mg, 52%) as a solid. LCMS (ES, m/z): 419 [M+H] ⁺

Synthesis of Intermediate C467 C ₄ 66 C ₄ 67

To a stirred solution of 4-[(3R)-3-[(tert-butoxycarbonyl)(cyclopropyl)amino]pyrrolidi n-l- yl]-6-fluoro-2-methylindazole-7-carboxylic acid (100 mg, 0.239 mmol, 1 equiv) and TCFH (109 mg, 0.287 mmol, 1.2 equiv) in CH ₃ CN (2 mL) were added NMI (123.5 mg, 0.956 mmol, 4.0 equiv) and 8-fluoro-2-methylimidazo[1,2-a]pyridin-6-amine (47.3 mg, 0.287 mmol, 1.2 equiv) in portions at room temperature. The resulting mixture was stirred for 12 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 3) tert-butyl N-cyclopropyl-N- [(3R)- 1 -[6-fluoro-7-({ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } carbarnoyl)-2- methylindazol-4-yl]pyrrolidin-3-yl]carbamate (20 mg, 15%) as a solid. LCMS (ES, m/z): 566 [M+H] ⁺

Synthesis of Compound 571 C ₄ 67 571

To a stirred solution of tert-butyl N-cyclopropyl-N-[(3R)-l-[6-fluoro-7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)-2-methylindazol- 4-yl]pyrrolidin-3-yl]carbamate (15 mg, 0.027 mmol, 1 equiv) in DCM (2 mL) was added TFA (0.05 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3(g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford 4- [(3R)-3-(cyclopropylamino)pyrrolidin-l-yl]-6-fluoro-N-{8-flu oro-2-methylimidazo[1,2- a]pyridin-6-yl}-2-methylindazole-7-carboxamide (4 mg, 32%) as a solid. LCMS (ES, m z): 466 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.03 (s, 1H), 9.18 (d, J= 1.6 Hz, 1H), 8.80 (s, 1H), 7.91-7.83 (m, 1H), 7.25 (dd, J= 12.5, 1.7 Hz, 1H), 5.76 (d, J= 16.1 Hz, 1H), 4.22 (s, 3H), 3.72 (d, J= 14.9 Hz, 3H), 3.65-3.51 (m, 2H), 2.38-2.31 (m, 3H), 2.16 (dd, J= 8.3, 4.5 Hz, 2H), 1.98 (dd, J= 12.2, 6.1 Hz, 1H), 0.42 (dd, J= 6.6, 1.5 Hz, 2H), 0.25 (s, 2H).

Example 283: Synthesis of Compound 573

Synthesis of Intermediate C468 Boc C ₄ 68

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (220 mg, 0.547 mmol, 1 equiv) and tert-butyl N-[(3R)- pyrrolidin-3-yl]carbamate (122.3 mg, 0.656 mmol, 1.2 equiv) in DMF (5.5 mL) were added Cs ₂ CO ₃ (534.6 mg, 1.641 mmol, 3 equiv) and Ruphos (51.1 mg, 0.109 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (45.8 mg, 0.055 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 16 h at 90 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (15 mL). The resulting mixture was extracted with EtOAc (3 x 15 mL). The combined organic layers were washed with water (3 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ Cl ₂ /MeOH (10: 1) to afford tertbutyl N-[(3R)-l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}c arbamoyl)-2-methylindazol- 4-yl]pyrrolidin-3-yl]carbamate (200 mg, 72%) as a solid. LCMS (ES, m/z): 508 [M+H] ⁺

Synthesis of Intermediate C469 C ₄ 68 C ₄ 69

To a stirred mixture of tert-butyl N-[(3R)-l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]carbamate (170 mg, 0.335 mmol, 1 equiv) in DCM (2.5 mL) was added HCl(gas)in 1,4-dioxane (1 mL) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure to afford 4-[(3R)-3-aminopyrrolidin-l-yl]-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxa mide hydrochloride (140 mg, 103%) as a solid. LCMS (ES, m/z): 408 [M+H] ⁺

Synthesis of Compound 573

To a stirred mixture of 4-[(3R)-3-aminopyrrolidin-l-yl]-N-{8-fluoro-2-methylimidazo[ 1,2- a]pyridin-6-yl}-2-methylindazole-7-carboxamide (76.2 mg, 0.172 mmol, 1.0 equiv) and DIEA (24.4 mg, 0.189 mmol, 1.1 equiv) in DCE (1.75 mL) were added 2-chloropyrimidine-5- carbaldehyde (24.49 mg, 0.172 mmol, 1.0 equiv) and NaBH(OAc)3 (54.6 mg, 0.258 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 1.5 h at room temperature. The reaction was quenched with water at 0 °C. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4- [(3R)-3-{[(2-chloropyrimidin-5-yl)methyl]amino}pyrrolidin-l- yl]-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxa mide (13.5 mg, 15%) as a solid. LCMS (ES, m/z): 534 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.20 (s, 1H), 8.80 (d, J= 16.3 Hz, 3H), 7.97-7.80 (m, 2H), 7.31 (d, J= 12.3 Hz, 1H), 6.02 (d, J= 8.4 Hz, 1H), 4.28 (s, 3H), 3.92-3.59 (m, 5H), 3.47 (s, 2H), 2.75-2.72 (m, 1H), 2.35 (s, 3H), 2.23 (d, J= 31.4 Hz, 1H), 1.98-1.97 (m, 1H).

Example 284: Synthesis of Compound 575

Synthesis of Intermediate C470 , C ₄ 70

To a stirred mixture of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-l- carboxylate (100 mg, 0.268 mmol, 1 equiv) and 6-bromo-8-fluoroquinoline (78.7 mg, 0.348 mmol, 1.3 equiv) in dioxane (2 mL) were added Cs ₂ CO ₃ (261.7 mg, 0.804 mmol, 3 equiv) and XantPhos (31 mg, 0.054 mmol, 0.2 equiv) and Pd2(dba)3 (24.5 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 100 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with water (3 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 1) to afford tert-butyl 4-{2-ethyl-7-[(8-fluoroquinolin-6-yl)carbamoyl]indazol-4-yl} piperazine-l-carboxylate (100 mg, 72%) as a solid. LCMS (ES, m/z): 519 [M+H] ⁺

Synthesis of Compound 575 C ₄ 70 575

To a stirred mixture of tert-butyl 4-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6- yl} carbarnoyl)-2-ethylindazol-4-yl]piperazine-l -carboxylate (60 mg, 0.111 mmol, 1 equiv) in DCM (1 mL) was added HCl(gas)in 1,4-dioxane (0.25 mL) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-ethyl-4-(p iperazin-l- yl)indazole-7-carboxamide (15.8 mg, 32%) as a solid. LCMS (ES, m/z): 419 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.56 (s, 1H), 8.85 (s, 2H), 8.43 (d, J= 8.4 Hz, 1H), 8.28 (d, J= 2.2 Hz, 1H), 8.10-8.01 (m, 2H), 7.61 (dd, J= 8.4, 4.2 Hz, 1H), 6.51 (d, J= 8.1 Hz, 1H), 4.63 (q, J= 13 Hz, 2H), 3.37 (t, J= 4.9 Hz, 4H), 2.92 (t, J= 4.9 Hz, 4H), 1.66 (t, J= 13 Hz, 3H).

Example 285: Synthesis of Compound 576

576

To a stirred mixture of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4 - oxopiperidin-l-yl)indazole-7-carboxamide (100.0 mg, 0.230 mmol, 1.0 equiv) and 1- (aminomethyl)cyclopropan-l-ol (30.0 mg, 0.345 mmol, 1.5 equiv) in DCM (1 mL) was added NaBH(AcO)3 (97.6 mg, 0.460 mmol, 2.0 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with water at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 2- ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-{ [(l- hydroxycyclopropyl)methyl]amino}piperidin-l-yl)indazole-7-ca rboxamide (41 mg, 35%) as a solid. LCMS (ES, m/z): 506 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.80 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.1 Hz, 1H), 7.29 (dd, J = 12.3, 1.7 Hz, 1H), 6.49 (d, J= 8.1 Hz, 1H), 5.12 (s, 1H), 4.60 (q, J= 7.3 Hz, 2H), 3.94-3.83 (m, 2H), 3.13-2.97 (m, 2H), 2.75 (dq, J= 9.1, 4.7, 3.8 Hz, 1H), 2.67 (s, 2H), 2.35 (s, 3H), 1.97 (dd, J = 13.3, 4.0 Hz, 2H), 1.62 (t, J= 7.2 Hz, 4H), 1.54-1.37 (m, 2H), 0.54 (q, J= 4.5, 4.0 Hz, 2H), 0.44 (q, J = 4.9, 4.5 Hz, 2H).

Example 286: Synthesis of Compound 577

577

To a stirred mixture of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4 - oxopiperidin-l-yl)indazole-7-carboxamide (100 mg, 0.230 mmol, 1 equiv) and l-amino-2- methylpropan-2-ol (30.7 mg, 0.345 mmol, 1.5 equiv) in DCM (1 mL) was added NaBH(AcO)3 (97.5 mg, 0.460 mmol, 2 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with water at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 3) to afford 2-ethyl-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-4-{4-[(2-hydroxy-2-methylp ropyl)amino]piperidin-l- yl}indazole-7-carboxamide (50.1 mg, 47%) as a solid. LCMS (ES, m/z): 506 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.80 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.91 (d, J= 3.1 Hz, 1H), 7.30 (dd, J= 12.3, 1.6 Hz, 1H), 6.49 (d, J= 8.2 Hz, 1H), 4.60 (q, J = 13 Hz, 2H), 4.17 (s, 1H), 3.88 (dd, J= 10.7, 6.6 Hz, 2H), 3.07 (t, J= 11.8 Hz, 2H), 2.66 (d, J = 11.6 Hz, 1H), 2.47 (s, 2H), 2.35 (s, 3H), 1.97 (d, J= 12.3 Hz, 2H), 1.63 (d, J= 13 Hz, 3H), 1.57-1.40 (m, 3H), 1.11 (s, 6H). Example 287: Synthesis of Compound 579

Synthesis of Intermediate C471 C ₄ 71

A solution of benzyl (3S)-3-[(4-methyl benzenesulfonyl)oxy] pyrrolidine- 1 -carboxylate (1 g, 2.664 mmol, 1 equiv) in DMSO (5 mL) was added DIEA (1.72 g, 13.320 mmol, 5 equiv) and aniline (1.24 g, 13.320 mmol, 5 equiv). The mixture was stirred for 24 h at 70 °C. The resulting mixture was washed with 3 x 10 mL of water and extracted with EtOAc (2 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (15%) to afford benzyl (3 R)-3 -(phenylamino) pyrrolidine- 1 -carboxylate (530 mg, 67%) as an oil. LCMS (ES, m/z): 297 [M+H] ⁺

Synthesis of Intermediate C472 C ₄ 71 C ₄ 72

A solution of benzyl (3R)-3 -(phenylamino) pyrrolidine- 1 -carboxylate (120 mg, 0.405 mmol, 1 equiv) in MeOH (10 mL) was added Pd/C (20 mg, 10%). The mixture was stirred for overnight at 50°C under hydrogen atmosphere. The resulting mixture was filtered and the filtrate was concentrated under reduced pressure to afford (3R)-N-phenylpyrrolidin-3 -amine (60 mg, 91.34%) as an oil. LCMS (ES, m/z): 163 [M+H] ⁺

Synthesis of Compound 579 C ₄ 72 579

A solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl}-2- methylindazole-7-carboxamide (60 mg, 0.149 mmol, 1.0 equiv) in 1,4-dioxane (0.5 mL) was added (3R)-N-phenylpyrrolidin-3-amine (36.30 mg, 0.223 mmol, 1.5 equiv), RuPhos (13.92 mg, 0.030 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (12.48 mg, 0.015 mmol, 0.1 equiv) under nitrogen atmosphere. The reaction was stirred for 2 h at 90 °C. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE / EA (60%) to afford the crude product. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl}-2-methyl-4-[(3R)-3 -(phenylamino) pyrrolidin-l-yl] indazole-7-carboxamide (5 mg, 7%) as a solid. LCMS (ES, m/z): 460 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.02 (s, 1H), 9.20 (d, J= 1.6 Hz, 1H), 8.85 (s, 1H), 7.94 (d, J= 8.2 Hz, 1H), 7.91- 7.86 (m, 1H), 7.32 (dd, J= 12.3, 1.6 Hz, 1H), 7.11 (t, J= 7.7 Hz, 2H), 6.67 (d, J= 7.9 Hz, 2H), 6.57 (t, 7.3 Hz, 1H), 6.07

(d, J= 8.4 Hz, 1H), 5.96 (d, J= 6.6 Hz, 1H), 4.27 (s, 3H), 4.22 (s, 1H), 4.01 (d, J= 7.1 Hz, 1H), 3.84 (d, J= 9.0 Hz, 1H), 3.75 (s, 1H), 3.53 (d, J= 11.6 Hz, 1H), 2.35 (s, 3H), 2.14-1.92 (m, 2H), 1.30-1.24 (m, 5H), 0.85 (d, J= 1A Hz, 1H).

Example 288: Synthesis of Compound 580

Synthesis of Intermediate C473 C ₄ 73

To a stirred mixture of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4 - oxopiperidin-l-yl)indazole-7-carboxamide (100.0 mg, 0.230 mmol, 1.0 equiv) and tert-butyl 6- amino-3-azabicyclo[3.1.0]hexane-3 -carboxylate (68.4 mg, 0.345 mmol, 1.5 equiv) in DCM (1 mL) was added NaBH(AcO)3 (97.6 mg, 0.460 mmol, 2.0 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with water at room temperature. The resulting mixture was extracted with CH ₂ Q2 (3 x 10 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford tert-butyl 6-({ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]piperidin-4-yl}amino)-3-azabicyclo [3.1.0]hexane-3-carboxylate (113.8 mg, 80%) as a solid. LCMS (ES, m/z): 617 [M+H] ⁺

Synthesis of Compound 580

A solution of tert-butyl 6-({ l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}carbamoyl)indazol-4-yl]piperidin-4-yl}amino)-3-azabicyclo [3.1.0]hexane-3-carboxylate (113 mg, 0.183 mmol, 1.0 equiv) in DCM (0.9 mL) was treated with HCl(gas) in 1,4-dioxane (0.3 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 4-(4-{3-azabicyclo[3.1.0]hexan-6- ylamino}piperidin-l-yl)-2-ethyl-N-{8-fluoro-2-methylimidazo[ 1,2-a]pyridin-6-yl}indazole-7- carboxamide; bis(trifluoroacetic acid) (60 mg, 44%) as a solid. LCMS (ES, m/z): 517 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.23 (s, 1H), 9.45-9.30 (m, 4H), 8.88 (s, 1H), 8.72 (s, 1H), 8.08 (s, 1H), 8.02 (d, J= 8.0 Hz, 1H), 7.65 (d, J= 11.9 Hz, 1H), 6.58 (d, J= 8.2 Hz, 1H), 4.62 (q, J= 13 Hz, 2H), 4.08 (d, J= 12.8 Hz, 2H), 3.46 (d, J= 5.9 Hz, 5H), 3.06 (t, J= 12.4 Hz, 2H), 2.81 (s, 1H), 2.42 (s, 3H), 2.33 (s, 2H), 2.22-2.09 (m, 2H), 1.76 (td, J= 13.7, 9.9 Hz, 2H), 1.64 (t, J = 7.2 Hz, 3H). Example 289: Synthesis of Compound 581

To a stirred mixture of 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4 - oxopiperidin-l-yl)indazole-7-carboxamide (100.0 mg, 0.230 mmol, 1.0 equiv) and 1- (aminomethyl)cyclopropan-l-ol (30.0 mg, 0.345 mmol, 1.5 equiv) in DCM (1 mL) was added NaBH(AcO)3 (97.6 mg, 0.460 mmol, 2.0 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with water at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 2- ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-(4-{ 3-oxabicyclo[3.1.0]hexan-6- ylamino}piperidin-l-yl)indazole-7-carboxamide (16.6 mg, 14%) as a solid. LCMS (ES, m/z): 518 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.10 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.79 (s, 1H), 7.97 (d, J= 8.1 Hz, 1H), 7.90 (d, J= 3.0 Hz, 1H), 7.29 (dd, J= 12.3, 1.7 Hz, 1H), 6.48 (d, J = 8.2 Hz, 1H), 4.59 (q, J= 13 Hz, 2H), 3.96-3.82 (m, 2H), 3.75 (d, J= 8.2 Hz, 2H), 3.59 (d, J= 8.2 Hz, 2H), 3.12-2.98 (m, 2H), 2.75 (tt, J= 9.5, 4.0 Hz, 1H), 2.35 (s, 3H), 2.26 (s, 1H), 2.04- 1.93 (m, 2H), 1.91 (d, J = 23 Hz, 1H), 1.66-1.54 (m, 5H), 1.55-1.36 (m, 2H).

Example 290: Synthesis of Compound 582

Synthesis of Intermediate C474 C ₄ 74 To a solution of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-l -carboxylate (100 mg, 0.268 mmol, 1 equiv) and (6-bromo-4-fluoro-l,3-benzoxazol-2-yl)methyl acetate (92.5 mg, 0.322 mmol, 1.2 equiv) in dioxane (2 mL) were added Cs ₂ CO ₃ (261.7 mg, 0.804 mmol, 3.0 equiv), XantPhos (30.9 mg, 0.054 mmol, 0.2 equiv) and Pd2(dba)3.CHCh (27.7 mg, 0.027 mmol, 0.1 equiv). After stirring for 1 h at 80°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (2: 1) to afford tert-butyl 4-[7-({2-[(acetyloxy)methyl]-4- fluoro- 1 ,3 -benzoxazol-6-yl } carbarnoyl)-2-ethylindazol-4-yl]piperazine- 1 -carboxylate (120 mg, 77%) as a solid. LCMS (ES, m/z): 581 [M+H] ⁺

Synthesis of Intermediate C475 C ₄ 74 C ₄ 75

To a stirred solution of tert-butyl 4-[7-({2-[(acetyloxy)methyl]-4-fluoro-l,3-benzoxazol-6- yl} carbarnoyl)-2-ethylindazol-4-yl]piperazine-l -carboxylate (120 mg, 0.207 mmol, 1 equiv) in MeOH (2 mL) was added K ₂ CO ₃ (171 mg, 1.242 mmol, 6.0 equiv) at room temperature. The resulting mixture was stirred for 1 h at 60°C. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 3) to afford tert-butyl 4-(2-ethyl-7-{[4-fluoro-2-(hydroxymethyl)-l,3- benzoxazol-6-yl]carbamoyl}indazol-4-yl)piperazine-l-carboxyl ate (100 mg, 90%) as a solid. LCMS (ES, m/z): 539 [M+H] ⁺

Synthesis of Compound 582 C ₄ 75 582

A solution of tert-butyl 4-(2-ethyl-7-{[4-fluoro-2-(hydroxymethyl)-l,3-benzoxazol-6- yl]carbamoyl}indazol-4-yl)piperazine-l-carboxylate (50 mg, 0.093 mmol, 1 equiv) and TFA (0.2 mL) in DCM (2 mL) was stirred for 1 h at room temperature. The mixture was basified to pH 8 with NH3 (g) in MeOH. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford 2- ethyl-N-[4-fluoro-2-(hydroxymethyl)- 1 ,3 -benzoxazol-6-yl]-4-(piperazin- 1 -yl)indazole-7- carboxamide (20 mg, 49%) as a solid. LCMS (ES, m/z): 439 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.53 (s, 1H), 8.84 (s, 1H), 8.18 (d, J= 1.7 Hz, 1H), 8.01 (d, J= 8.1 Hz, 1H), 7.65 (dd, J= 12.0, 1.7 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 5.94 (s, 1H), 4.71 (d, J= 4.4 Hz, 2H), 4.61 (q, J= 13 Hz, 2H), 3.37-3.32 (m, 4H), 2.92 (t, J= 5.0 Hz, 4H), 1.63 (t, J= 13 Hz,

Example 291: Synthesis of Compound 584

Synthesis of Intermediate C476 C ₄ 76

To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv), trans-tert-butyl N-[(3R,4R)-4- fluoropyrrolidin-3-yl]-N-methylcarbamate (126 mg, 0.576 mmol, 1.2 equiv) and Cs ₂ CO ₃ (313 mg, 0.960 mmol, 2 equiv) in 1,4-dioxane (2 mL) were added RuPhos Palladacycle Gen.3 (40 mg, 0.048 mmol, 0.1 equiv) and Ruphos (22 mg, 0.048 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 90 °C under nitrogen atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by silical gel column chromatography, eluted with PE:EA (1 : 1) to afford trans-tert-butyl N-[(3R,4R)-l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyr idin-6-yl}carbamoyl)indazol-4- yl]-4-fluoropyrrolidin-3-yl]-N-methylcarbamate (108 mg, 41%) as a solid. LCMS (ES, m/z): 554 [M+H] ⁺

Synthesis of Compound 584 C ₄ 76 584

To a stirred solution of trans-tert-butyl N-[(3R,4R)-l-[2-ethyl-7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]-4-f luoropyrrolidin-3-yl]-N- methylcarbamate (100 mg, 0.181 mmol, 1 equiv) in DCM (2 mL) was added 4M HCl(gas)in 1,4- dioxane (0.2 mL) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 30 min at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford 2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[( 3R,4R)-3-fluoro-4- (methylamino)pyrrolidin-l-yl]indazole-7-carboxamide (6.7 mg, 8%) as a solid. LCMS (ES, m z 454 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.06 (s, 1H), 9.20 (d, J= 1.6 Hz, 1H), 8.89 (s, 1H), 7.95 (d, J= 8.2 Hz, 1H), 7.91-7.87 (m, 1H), 7.29 (dd, J= 12.4, 1.7 Hz, 1H), 6.08 (d, J= 8.4 Hz, 1H), 5.27 (d, J= 50.8 Hz, 1H), 4.58 (q, J= 7.3 Hz, 2H), 4.20-3.78 (m, 3H), 3.62 (d, J = 10.9 Hz, 1H), 2.40-2.32 (m, 6H), 1.62 (t, J= 7.3 Hz, 3H).

Example 292: Synthesis of Compound 585

Synthesis of Intermediate C477

To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (200 mg, 0.480 mmol, 1 equiv), cis -tert-butyl N-[(3R,4S)-4- fluoropyrrolidin-3-yl]-N-methylcarbamate (125.85 mg, 0.576 mmol, 1.2 equiv) and Cs ₂ CO ₃ (313.10 mg, 0.960 mmol, 2 equiv) in 1,4-di oxane (5 mL) were added RuPhos Palladacycle Gen.3 (40.19 mg, 0.048 mmol, 0.1 equiv) and Ruphos (22.42 mg, 0.048 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 90°C under nitrogen atmosphere. The reaction mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE:EA (1 : 1) to afford cis- tertbutyl N-[(3R,4S)-l-[2-ethyl-7-({8-fluoro-2-methylimidazo[1,2-a]pyr idin-6- yl}carbamoyl)indazol-4-yl]-4-fluoropyrrolidin-3-yl]-N-methyl carbamate (110 mg, 41%) as a solid. LCMS (ES, m/z): 554 [M+H] ⁺

Synthesis of Compound 585

To a stirred solution of cis -tert-butyl N-[(3R,4S)-l-[2-ethyl-7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}carbamoyl)indazol-4-yl]-4-f luoropyrrolidin-3-yl]-N- methylcarbamate (100 mg, 0.181 mmol, 1 equiv) in DCM (2 mL) was added 4M HCl(gas)in 1,4- dioxane (0.2 mL) at room temperature. The resulting mixture was stirred for 30 min at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 6, Gradient 3) to afford cis- 2-ethyl-N-(8- fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl)-4-((3 S,4R)-3 -fluoro-4-(methylamino)pyrrolidin- 1 - yl)-2H-indazole-7-carboxamide bis(2,2,2-trifluoroacetate) (55 mg, 39%) as a solid. LCMS (ES, m/z): 454 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.27 (d, J= 2.8 Hz, 1H), 10.02 (s, 1H), 9.44 (d, J= 6.8 Hz, 1H), 8.86-8.73 (m, 1H), 8.06-7.95 (m, 2H), 7.57 (dd, J = 23.2, 13.1 Hz, 1H), 6.04 (q, J= 8.7, 6.9 Hz, 1H), 5.66 (d, J= 53.9 Hz, 1H), 4.58 (q, J = 7.8 Hz, 2H), 4.28-3.97 (m, 4H), 3.93-3.80 (m, 1H), 2.82 (s, 3H), 1.66 (td, J = 7.3, 2.3 Hz, 3H).

Example 293: Synthesis of Compound 587

Synthesis of Intermediate C478 C ₄ 78

To a solution of 4-bromo-6-fluoro-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6 -yl}-2- methylindazole-7-carboxamide (150 mg, 0.357 mmol, 1 equiv) and N-(l-cyanocyclopropyl)-4- nitro-N-[(3R)-pyrrolidin-3-yl]benzenesulfonamide (144.0 mg, 0.428 mmol, 1.2 equiv) in dioxane (3 mL) were added RuPhos (33.3 mg, 0.071 mmol, 0.2 equiv), Cs ₂ CO ₃ (348.9 mg, 1.071 mmol, 3.0 equiv) and RuPhos Palladacycle Gen.3 (29.8 mg, 0.036 mmol, 0.1 equiv). After stirring for 3 h at 80°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford 4-[(3R)-3-[N-(l-cyanocyclopropyl)4-nitrobenzenesulfonamido]p yrrolidin-l-yl]-6-fluoro- N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methylinda zole-7-carboxamide (120 mg, 50%) as a solid. LCMS (ES, m/z): 676 [M+H] ⁺

Synthesis of Compound 587 C ₄ 87 587

To a stirred solution of 4-[(3R)-3-[N-(l-cyanocyclopropyl)4- nitrobenzenesulfonamido]pyrrolidin- 1 -yl]-6-fluoro-N-{ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin- 6-yl}-2-methylindazole-7-carboxamide (70 mg, 0.104 mmol, 1 equiv) and (phenylsulfanyl)potassium (23.0 mg, 0.156 mmol, 1.5 equiv) in DMF (2 mL) was added K ₂ CO ₃ (28.6 mg, 0.208 mmol, 2.0 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was diluted with H ₂ O (5 mL). The resulting mixture was extracted with EA (3 x 5 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 5) to afford 4-[(3R)-3-[(l-cyanocyclopropyl)amino]pyrrolidin-l-yl]-6-fluo ro-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxa mide (20 mg, 39%) as a solid. LCMS (ES, m/z): 491 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.02 (s, 1H), 9.19 (d, J= 1.6 Hz, 1H), 8.78 (s, 1H), 7.88 (d, J= 3.2 Hz, 1H), 7.25 (dd, J= 12.6, 1.7 Hz, 1H), 5.76 (d, J= 15.9 Hz, 1H), 4.22 (s, 3H), 3.77 (s, 2H), 3.70 (s, 3H), 3.44 (d, J= 9.8 Hz, 1H), 2.37-2.31 (m, 3H), 2.28- 2.18 (m, 1H), 2.04 (s, 1H), 1.26 (s, 2H), 1.08-0.95 (m, 2H).

Example 294: Synthesis of Compound 589

Synthesis of Intermediate C488 C ₄ 88 To a solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7- carboxamide (80.0 mg, 0.199 mmol, 1.0 equiv) and tert-butyl (2S)-2- isopropylpiperazine-1 -carboxylate (68.1 mg, 0.298 mmol, 1.5 equiv) in DMF (2 mL) were added Cs ₂ CO ₃ (129.6 mg, 0.398 mmol, 2.0 equiv) and Ruphos (18.5 mg, 0.040 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (16.6 mg, 0.020 mmol, 0.1 equiv) . After stirring for 2 days at 100 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :2) to afford tert-butyl (2S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carb amoyl)-2- methylindazol-4-yl]-2-isopropylpiperazine-l -carboxylate (100 mg, 82%) as a solid. LCMS (ES, m/z): 550 [M+H] ⁺

Synthesis of Compound 589

Into a 8 mL vial were added tert-butyl (2S)-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin- 6-yl} carbamoyl)-2-methylindazol-4-yl]-2-isopropylpiperazine-l-car boxylate (80.0 mg, 0.146 mmol, 1 equiv), DCM (1 mL) and HCl (gas) in 1,4-dioxane (0.5 mL, 4M) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient l) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-4-[(3S)-3- isopropylpiperazin-l-yl]-2-methylindazole-7-carboxamide (8 mg, 12%) as a solid. LCMS (ES, m/z): 450 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.22 (s, 1H), 8.74 (s, 1H), 7.98 (d, J= 8.1 Hz, 1H), 7.91 (d, J= 3.1 Hz, 1H), 7.35 (d, J= 12.2 Hz, 1H), 6.51 (d, J= 8.1 Hz, 1H), 4.31 (s, 3H), 3.80 (dd, J= 27.2, 10.4 Hz, 2H), 3.05 (d, J= 8.8 Hz, 1H), 2.94-2.87 (m, 2H), 2.67 (d, J= 10.3 Hz, 1H), 2.36 (s, 3H), 1.67 (dt, J= 13.1, 6.7 Hz, 1H), 0.98 (dd, J= 6.8, 2.0 Hz, 6H). Example 295: Synthesis of Compound 594

To a stirred mixture of (R)-4-(3-aminopyrrolidin-l-yl)-N-(8-fluoro-2-methylimidazo[1 ,2- a]pyridin-6-yl)-2-methyl-2H-indazole-7-carboxamide hydrochloride (40 mg, 0.090 mmol, 1 equiv) and DIEA (12 mg, 0.099 mmol, 1.1 equiv) in DCE (2 mL) were added pyrimidine-2- carbaldehyde (10 mg, 0.090 mmol, 1 equiv) and NaBH(OAc)3 (66 mg, 0.315 mmol, 3.5 equiv) at room temperature. The resulting mixture was stirred for 1.5 h at room temperature. The reaction was quenched with water (2 mL) at 0°C. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 10, Gradient 1) to afford N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2-methyl-4-[ (3R)-3-[(pyrimidin-2- ylmethyl)amino]pyrrolidin-l-yl]indazole-7-carboxamide (6 mg, 13.33%) as a solid. LCMS (ES, m/z): 500 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.02 (s, 1H), 9.20 (d, J= 1.6 Hz, 1H), 8.87-8.76 (m, 3H), 7.97-7.85 (m, 2H), 7.41 (t, J= 4.9 Hz, 1H), 7.36-7.25 (m, 1H), 6.02 (d, J= 8.4 Hz, 1H), 4.27 (s, 3H), 4.03 (s, 2H), 3.76 (d, J= 8.8 Hz, 1H), 3.65 (s, 2H), 3.56 (s, 2H), 2.55 (s, 2H), 2.35 (s, 3H), 2.22-2.12 (m, 1H), 2.03 (s, 1H).

Example 296: Synthesis of Compound 596

Synthesis of Intermediate C489 C ₄ 89

To a stirred solution of 1 -aminocyclopropane- 1 -carbonitrile hydrochloride (2.0 g, 16.869 mmol, 1.0 equiv) and DIEA (4.3 g, 33.738 mmol, 2.0 equiv) in DCM (30 mL) was added 4- nitrobenzene- 1 -sulfonyl chloride (3.4 g, 15.182 mmol, 0.9 equiv) at room temperature. The resulting mixture was stirred for 5 h at room temperature. The resulting mixture was diluted with deionized water (50 mL). The resulting mixture was extracted with CH ₂ CI ₂ (2 x 50 mL). The combined organic layers were washed with brine (1 x 50 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (5:1) to afford N-(l-cyanocyclopropyl)-4- nitrobenzenesulfonamide (2.5 g, 50%) as a solid. LCMS (ES, m z): 268 [M+H] ⁺

Synthesis of Intermediate C490 C ₄ 89 C ₄ 90

To a stirred solution of N-(l-cyanocyclopropyl)-4-nitrobenzenesulfonamide (1.5 g, 5.613 mmol, 1.0 equiv) and tert-butyl (3 S)-3 -hydroxypyrrolidine- 1 -carboxylate (1.4 g, 7.297 mmol, 1.3 equiv) in THF (30 mL) were added DEAD (1.7 g, 10.103 mmol, 1.8 equiv) dropwise at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at room temperature under nitrogen atmosphere. The resulting mixture was diluted with water (50mL). The resulting mixture was extracted with EtOAc (2 x 50 mL). The combined organic layers were washed with brine (1 x 50 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 1) to afford tert-butyl (3R)-3-[N-(l-cyanocyclopropyl)4- nitrobenzenesulfonamido]pyrrolidine-l -carboxylate (1 g, 38%) as a solid. LCMS (ES, m/z): 437 [M+H] ⁺

Synthesis of Intermediate C491 C ₄ 90 C ₄ 91

To a stirred solution of tert-butyl (3R)-3-[N-(l-cyanocyclopropyl)4- nitrobenzenesulfonamido] pyrrolidine- 1 -carboxylate (1.0 g, 2.291 mmol, 1.0 equiv) in DCM (10 mL) was added TFA (5 mL) dropwise at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The mixture was basified to pH 8 with saturated NaHCO3 (aq.). The resulting mixture was extracted with EtOAc (2 x 30 mL). The combined organic layers were washed with brine (1 x 50 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. This resulted in N-(l-cyanocyclopropyl)-4-nitro-N-[(3R)- pyrrolidin-3- yl]benzenesulfonamide (0.7 g, 84%) as a solid. LCMS (ES, m z): 337 [M+H] ⁺

Synthesis of Intermediate C492

0492

To a solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7- carboxamide (100.0 mg, 0.249 mmol, 1.0 equiv) and N-(l-cyanocyclopropyl)- 4-nitro-N-[(3R)-pyrrolidin-3- yl]benzenesulfonamide (125.4 mg, 0.373 mmol, 1.5 equiv) in DMF (4 mL) were added Cs ₂ CO ₃ (162.01 mg, 0.498 mmol, 2.0 equiv) and Ruphos (23.2 mg, 0.050 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (20.8 mg, 0.025 mmol, 0.1 equiv). After stirring for 16 h at 90 °C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :3) to afford 4-[(3R)-3-[N-(l-cyanocyclopropyl)4- nitrobenzenesulfonamido]pyrrolidin-l-yl]-N-{8-fluoro-2-methy limidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (75 mg, 41%) as a solid. LCMS (ES, m/z): 658 [M+H] ⁺

Synthesis of Compound 596 C ₄ 92 596

To a stirred solution of 4-[(3R)-3-[N-(l-cyanocyclopropyl)4- nitrobenzenesulfonamido]pyrrolidin- 1 -y 1 ] - N-{ 8-fluoro-2-methylimidazo[ 1 ,2-a]pyridin-6-yl } -2- methylindazole-7-carboxamide (60.0 mg, 0.091 mmol, 1.0 equiv) and BGCCL (25.2 mg, 0.182 mmol, 2.0 equiv) in DMF (2 mL) was added PhSK (20.3 mg, 0.137 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was extracted with EtOAc (2 x 5 mL). The combined organic layers were washed with brine (1 x 3 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 13, Gradient 1) to afford 4- [(3R)-3 -[( 1 -cyanocyclopropyl)amino]pyrrolidin- 1 -yl]-N-{ 8-fluoro-2-methylimidazo[ 1 ,2- a]pyridin-6-yl}-2-methylindazole-7-carboxamide (35 mg, 81%) as a solid. LCMS (ES, m/z): 473 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.20 (d, J= 1.6 Hz, 1H), 8.81 (s, 1H), 7.93 (d, J= 8.2 Hz, 1H), 7.89 (d, J= 3.1 Hz, 1H), 7.31 (d, J= 12.4 Hz, 1H), 6.02 (d, J= 8.3 Hz, 1H), 4.28 (s, 3H), 3.84-3.82 (m, 1H), 3.76-3.70 (m, 4H), 3.48 (d, J= 10.0 Hz, 1H), 2.35 (s, 3H), 2.24-2.23 (m, 1H), 2.11-2.03 (m, 1H), 1.33-1.16 (m, 2H), 1.04 (d, J= 12.4 Hz, 1H), 0.98 (d, J= 4.3 Hz, 1H). Example 297: Synthesis of Compound 600

600

A solution of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a] pyridin-6-yl} indazole- 7-carboxamide (120 mg, 0.288 mmol, 1 equiv) in 1,4-dioxane (1.5 mL) was added (2S,6R)-2- isopropyl-6-methylpiperazine (61.51 mg, 0.432 mmol, 1.5 equiv), Cs ₂ CO ₃ (234.82 mg, 0.720 mmol, 2.5 equiv), RuPhos (26.91 mg, 0.058 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (24.11 mg, 0.029 mmol, 0.1 equiv) under nitrogen atmosphere. The reaction was stirred for 2 h at 90°C. The resulting mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluted with PE/EA (90%) to afford the crude product. The crude product was purified by Prep-HPLC (Condition 10, Gradient 16) to afford 2-ethyl-N-{8-fluoro- 2-methylimidazo[1,2-a] pyridin-6-yl}-4-[(3S,5R)-3-isopropyl-5-methylpiperazin-l-yl] indazole- 7-carboxamide (40 mg, 29%) as a solid. LCMS (ES, m/z): 478 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.21 (d, J= 1.6 Hz, 1H), 8.76 (s, 1H), 7.98 (d, J= 8.1 Hz, 1H), 7.91 (d, J= 3.0 Hz, 1H), 7.30 (dd, J= 12.3, 1.7 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 4.61 (q, J= 7.2 Hz, 2H), 3.80 (dd, J= 20.3, 10.2 Hz, 2H), 2.95-2.94 (m, 1H), 2.67-2.55 (m, 2H), 2.50-2.49 (m, 1H), 2.35 (s, 3H), 2.05 (s, 1H), 1.62 (t, J = 7.3 Hz, 4H), 1.10 (d, J= 6.2 Hz, 3H), 0.99 (dd, J= 6.8, 1.5 Hz, 6H).

Example 298: Synthesis of Compound 604

Synthesis of Intermediate C493 C ₄ 93 To a stirred solution of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-l- carboxylate (120 mg, 0.321 mmol, 1 equiv) and 6-bromo-8-chloro-2-methylimidazo[1,2- a]pyrazine (95 mg, 0.385 mmol, 1.2 equiv) in dioxane (2.4 mL) were added Cs ₂ CO ₃ (314.1 mg, 0.963 mmol, 3 equiv) and XantPhos (37.2 mg, 0.064 mmol, 0.2 equiv) and Pd2(dba)3 (29.4 mg, 0.032 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 2 h at 90 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (3 mL). The resulting mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with water (3 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4- [7-({ 8-chloro-2-methylimidazo[ 1 ,2-a]pyrazin-6-yl } carbarnoyl)-2-ethylindazol-4-yl]piperazine- 1 - carboxylate (150 mg, 87%) as a solid. LCMS (ES, m z): 539 [M+H] ⁺

Synthesis of Compound 604 C ₄ 93 604

To a stirred mixture of tert-butyl 4-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6- yl} carbarnoyl)-2-ethylindazol-4-yl]piperazine-l -carboxylate (100 mg, 0.186 mmol, 1 equiv) in DCM (1 mL) was added HCl(gas)in 1,4-dioxane (0.3 mL) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-ethyl-4-(p iperazin-l- yl)indazole-7-carboxamide (24 mg, 29%) as a solid. LCMS (ES, m/z): 439 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.45 (s, 1H), 9.45 (s, 1H), 8.84 (s, 1H), 8.17 (s, 1H), 8.03 (d, J= 8.1 Hz, 1H), 6.51 (d, J= 8.2 Hz, 1H), 4.57 (q, J= 13 Hz, 2H), 3.38 (t, J= 4.9 Hz, 4H), 2.92 (dd, J= 6.0, 3.5 Hz, 4H), 2.42 (s, 3H), 1.64 (t, J= 13 Hz, 3H). Example 299: Synthesis of Compounds 605, 606, and 607

Synthesis of Intermediate C494

To a solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (110.0 mg, 0.273 mmol, 1.0 equiv) and tert-butyl 2- cyclopropylpiperazine-1 -carboxylate (92.8 mg, 0.410 mmol, 1.5 equiv) in DMF (3 mL) were added Cs ₂ CO ₃ (178.2 mg, 0.546 mmol, 2.0 equiv) and Ruphos (25.5 mg, 0.055 mmol, 0.2 equiv), RuPhos Palladacycle Gen.3 (22.8 mg, 0.027 mmol, 0.1 equiv). After stirring for 2 days at 100°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE / EA (1 :2) to afford tert-butyl 2-cyclopropyl-4-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin- 6- yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (150 mg, 85%) as a solid. LCMS (ES, m/z): 548 [M+H] ⁺

Synthesis of Compound 605 C ₄ 94 605

Into a 8 mL round-bottom flask were added tert-butyl 2-cyclopropyl-4-[7-({8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} carbarnoyl)-2-methylindazol-4-yl]piperazine-l -carboxylate (140.0 mg, 0.256 mmol, 1.0 equiv), DCM (2 mL) and HCl (gas) in 1,4-dioxane (1 mL, 4M) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep- HPLC (Condition 13, Gradient 1) to afford 4-(3-cyclopropylpiperazin-l-yl)-N-{8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl} -2-methylindazole-7-carboxamide (18 mg, 16%) as a solid. LCMS (ES, m/z): 448 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.21 (s, 1H), 8.74 (s, 1H), 7.98 (d, J= 8.0 Hz, 1H), 7.91 (d, J= 3.0 Hz, 1H), 7.35 (d, J= 12.3 Hz, 1H), 6.50 (d, J= 8.1 Hz, 1H), 4.31 (s, 3H), 3.78 (t, J= 10.1 Hz, 2H), 3.17 (d, J = 4.9 Hz, 1H), 3.02 (d, J= 11.2 Hz, 1H), 2.94 (t, J= 11.6 Hz, 1H), 2.81 (dt, J= 22.0, 11.0 Hz, 2H), 2.35 (s, 3H), 2.08 (t, J= 9.3 Hz, 1H), 0.84-0.76 (m, 1H), 0.43 (d, J= 8.2 Hz, 2H), 0.36 (s, 1H), 0.33-0.26 (m, 1H).

Synthesis of Compound 606

18 mg of 4-(3-cyclopropylpiperazin-l-yl)-N-{8-fluoro-2-methylimidazo[ 1,2-a]pyridin-6- yl}-2- methylindazole-7-carboxamide was purified by chiral-prep-HPLC (Condition 11, Gradient 1) to afford 4-[(3S)-3-cyclopropylpiperazin-l-yl]-N-{8-fluoro-2-methylimi dazo[1,2- a]pyridin-6- yl}-2-methylindazole-7-carboxamide (4.6 mg, 26%) as a solid. LCMS (ES, m/z): 448 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.21 (s, 1H), 8.74 (s, 1H), 7.98 (d, J= 8.0 Hz, 1H), 7.91 (d, J= 3.0 Hz, 1H), 7.35 (d, J= 12.3 Hz, 1H), 6.50 (d, J= 8.1 Hz, 1H), 4.31 (s, 3H), 3.78 (t, J= 10.1 Hz, 2H), 3.17 (d, J = 4.9 Hz, 1H), 3.02 (d, J= 11.2 Hz, 1H), 2.94 (t, J= 11.6 Hz, 1H), 2.81 (dt, J= 22.0, 11.0 Hz, 2H), 2.35 (s, 3H), 2.08 (t, J= 9.3 Hz, 1H), 0.84-0.76 (m, 1H), 0.43 (d, J= 8.2 Hz, 2H), 0.36-0.35 (m, 1H), 0.33-0.26 (m, 1H).

Synthesis of Compound 607

605 607

18 mg of 4-(3-cyclopropylpiperazin-l-yl)-N-{8-fluoro-2-methylimidazo[ 1,2-a]pyridin-6- yl}-2- methylindazole-7-carboxamide was purified by chiral-prep-HPLC (Condition 11, Gradient 1) to afford 4-[(3R)-3-cyclopropylpiperazin-l-yl]-N-{8-fluoro-2-methylimi dazo[1,2- a]pyridin- 6-yl}-2-methylindazole-7-carboxamide (6 mg, 33%) as a solid. LCMS (ES, m, z):448 [M+H] ⁺¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.07 (s, 1H), 9.21 (s, 1H), 8.74 (s, 1H), 7.98 (d, J= 8.0 Hz, 1H), 7.91 (d, J= 3.0 Hz, 1H), 7.35 (d, J= 12.3 Hz, 1H), 6.50 (d, J= 8.1 Hz, 1H), 4.31 (s, 3H), 3.78 (t, J = 10.1 Hz, 2H), 3.17 (d, J = 4.9 Hz, 1H), 3.02 (d, J= 11.2 Hz, 1H), 2.94 (t, J= 11.6 Hz, 1H), 2.81 (dt, J= 22.0, 11.0 Hz, 2H), 2.35 (s, 3H), 2.08 (t, J = 9.3 Hz, 1H), 0.84-0.76 (m, 1H), 0.43 (d, J = 8.2 Hz, 2H), 0.36-0.35 (m, 1H), 0.33-0.26 (m, 1H).

Example 300: Synthesis of Compound 610

Synthesis of Intermediate C495 C ₄ 95

A solution of tert-butyl N-[(3R)-l-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin-3-yl] -N- methylcarbamate (100 mg, 0.268 mmol, 1 equiv), 6-bromo-2-methyl-8-phenoxyimidazo[1,2- a]pyrazine (122 mg, 0.402 mmol, 1.5 equiv), Cs ₂ CO ₃ (261 mg, 0.804 mmol, 3 equiv) and Pd PEPPSI IPentCl (23 mg, 0.027 mmol, 0.1 equiv) in 1,4-dioxane was stirred for 3 h at 110°C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (0: 1) to afford tert-butyl N-methyl-N-[(3R)-l- [2-methyl-7-({2-methyl-8-phenoxyimidazo[1,2-a]pyrazin-6-yl}c arbamoyl)indazol-4- yl]pyrrolidin-3-yl]carbamate (96 mg, 60%) as a solid. LCMS (ES, m/z): 597 [M+H] ⁺

Synthesis of Compound 610 C ₄ 95 610

A solution of ert-butylN-methyl-N-[(3R)-l-[2-methyl-7-({2-methyl-8-phenoxy imidazo[1,2- a]pyrazin-6-yl}carbamoyl)indazol-4-yl]pyrrolidin-3-yl]carbam ate (96 mg, 0.161 mmol, 1 equiv) in HCl(gas)in 1,4-di oxane (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The residue was purified by reverse flash chromatography (Condition 3, Gradient 9) to afford 2-methyl-N-{2-methyl-8-phenoxyimidazo[1,2-a]pyrazin-6- yl}-4-[(3R)-3-(methylamino)pyrrolidin-l-yl]indazole-7-carbox amide (10 mg, 13%) as a solid. LCMS (ES, m/z): 497 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.12 (s, 1H), 9.05 (s, 1H), 8.78 (s, 1H), 8.03 (s, 1H), 7.90 (d, J= 8.3 Hz, 1H), 7.56 (t, J= 7.8 Hz, 2H), 7.41 (d, J= 7.9 Hz, 2H), 7.36 (t, J= 7.3 Hz, 1H), 5.99 (d, J= 8.4 Hz, 1H), 4.01 (s, 3H), 3.75 (s, 2H), 3.70 (s, 1H), 3.62 (s, 1H), 3.26 (s, 1H), 2.40 (s, 3H), 2.33 (s, 3H), 2.14 (dd, J= 12.4, 6.2 Hz, 1H), 1.95 - 1.87 (m, 1H).

Example 301: Synthesis of Compound 612

Synthesis of Intermediate C496 C ₄ 96

To a stirred solution of tert-butyl N-[(3R)-l-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin- 3 -yl]-N-m ethylcarbamate (100 mg, 0.268 mmol, 1 equiv), 4-{6-bromo-2-methylimidazo[1,2- a]pyrazin-8-yl (morpholine (90 mg, 0.322 mmol, 1.2 equiv) and Cs ₂ CO ₃ (175 mg, 0.536 mmol, 2.0 equiv) in 1,4-dioxane (5 mL) were added XantPhos (31 mg, 0.0536 mmol, 0.2 equiv) and Pd2(dba)3 (25 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 90 °C. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 1) to afford tert-butyl N- methyl-N-[(3R)-l-(2-methyl-7-{[2-methyl-8-(morpholin-4-yl)im idazo[1,2-a]pyrazin-6- yl]carbamoyl}indazol-4-yl)pyrrolidin-3-yl]carbamate (96 mg, 61%) as a solid. LCMS (ES, m/z): 590 [M+H] ⁺

Synthesis of Compound 612

A solution of tert-butyl N-methyl-N-[(3R)-l-(2-methyl-7-{[2-methyl-8-(morpholin-4- yl)imidazo[1,2-a]pyrazin-6-yl]carbamoyl(indazol-4-yl)pyrroli din-3-yl]carbamate (100 mg, 0.170 mmol, 1 equiv) and TFA (0.25 mL) in DCM (0.75 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 9) to afford 2-methyl-N-[2-methyl-8- (morpholin-4-yl)imidazo[ 1 ,2-a]pyrazin-6-yl]-4-[(3R)-3 -(methylamino)pyrrolidin- 1 -yl]indazole- 7-carboxamide (30 mg, 36%) as a solid. LCMS (ES, m/z): 490 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.08 (s, 1H), 8.81 (s, 1H), 8.72 (s, 1H), 7.92 (d, J= 8.3 Hz, 1H), 7.78 (s, 1H), 6.00 (d, J= 8.4 Hz, 1H), 4.23 (d, J= 6.0 Hz, 7H), 3.78 (t, J = 4.8 Hz, 6H), 3.74 (s, 1H), 3.64 (s, 1H), 3.42 (dd, J = 10.3, 4.1 Hz, 1H), 2.33 (d, J= 9.0 Hz, 6H), 2.15 (dq, J= 13.2, 7.2 Hz, 1H), 2.08 (s, 1H), 1.92 (dt, J= 11.5, 6.0 Hz, 1H)

Example 302: Synthesis of Compound 614

Synthesis of Intermediate C497

To a stirred solution of tert-butyl N-[(3R)-l-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin- 3 -yl]-N-m ethylcarbamate (65 mg, 0.174 mmol, 1 equiv), Cs ₂ CO ₃ (170 mg, 0.522 mmol, 3 equiv) and 6-bromo-8-chloro-2-methylimidazo[1,2-a]pyrazine (64 mg, 0.261 mmol, 1.5 equiv) in 1,4- dioxane (3. 0 mL) were added XantPhos (20 mg, 0.035 mmol, 0.2 equiv) and Pd2(dba)3 (15 mg, 0.017 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 90 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (0:1) to afford tert-butyl N-[(3R)-l-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}c arbamoyl)-2-methylindazol-4- yl]pyrrolidin-3-yl]-N-methylcarbamate (66 mg, 70%) as a solid. LCMS (ES, m/z): 539 [M+H]

Synthesis of Compound 614 C ₄ 97 614

A solution of tert-butyl N-[(3R)-l-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6- yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methyl carbamate (66 mg, 0.122 mmol, 1 equiv) and TFA (0.25 mL) in DCM (0.75mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford N-{8-chloro-2-methylimidazo[1,2- a]pyrazin-6-yl}-2-methyl-4-[(3R)-3-(methylamino)pyrrolidin-l -yl]indazole-7-carboxamide (10 mg, 19%) as a solid. LCMS (ES, m/z): 439 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.25 (s, 1H), 9.44 (s, 1H), 8.85 (s, 1H), 8.16 (s, 1H), 7.97 (d, J= 8.4 Hz, 1H), 6.04 (d, J= 8.4 Hz, 1H), 4.26 (s, 3H), 3.66 (s, 1H), 3.36-.32 (m, 4H), 2.42 (s, 3H), 2.35 (s, 3H), 2.17 (dt, J= 12.9, 6.5 Hz, -1H), 1.97-1.89 (m, 1H).

Example 303: Synthesis of Compound 615, 616, and 617

Synthesis of Compound 615

615

To a stirred mixture of 4-bromo-2-ethyl-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl}indazole-7-carboxamide (150 mg, 0.360 mmol, 1 equiv) and 2-cyclopropyl-6- methylpiperazine (65.7 mg, 0.468 mmol, 1.3 equiv) in dioxane (3 mL) were added Cs ₂ CO ₃ (352.2 mg, 1.080 mmol, 3 equiv) and Ruphos (33.6 mg, 0.072 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (30.1 mg, 0.036 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 90 °C under nitrogen atmosphere. The resulting mixture was diluted with water (10 mL). The resulting mixture was extracted with EtOAc (3 x 10 mL). The combined organic layers were washed with water (3 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CLECl ₂ /MeOH (10: 1) to afford 4-(3-cyclopropyl-5-methylpiperazin-l-yl)-2-ethyl-N-{8-fluoro -2- methylimidazo[1,2-a]pyridin-6-yl}indazole-7-carboxamide (80 mg, 47%) as a solid. LCMS (ES, m/z): 476 [M+H] ⁺

Synthesis of Compound 616

615 616

80 mg of 4-(3-cyclopropyl-5-methylpiperazin-l-yl)-2-ethyl-N-(8-fluoro -2- methylimidazo[1,2-a]pyridin-6-yl)-2H-indazole-7-carboxamide was purified by chiral-prep- HPLC (Condition 12, Gradient 1) to afford 4-((3S,5R)-3-cyclopropyl-5-methylpiperazin-l-yl)-2- ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2H-ind azole-7-carboxamide (8.9 mg, 11.12%) as a yellow solid. LCMS (ES, m/z): 476 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.78 (s, 1H), 7.98 (d, J= 8.1 Hz, 1H), 7.91 (d, J= 3.1 Hz, 1H), 7.30 (dd, J= 12.3, 1.7 Hz, 1H), 6.50 (d, J = 8.2 Hz, 1H), 4.61 (q, J= 7.3 Hz, 2H), 3.84-3.76 (m, 2H), 2.92 (d, J= 8.7 Hz, 1H), 2.72 (d, J= 10.9 Hz, 1H), 2.50-2.49 (m, 1H), 2.35 (s, 3H), 2.18-2.09 (m, 1H), 1.62 (t, J= 7.2 Hz, 3H), 1.09 (d, J= 6.2 Hz, 3H), 0.77 (qt, J = 8.1, 4.8 Hz, 1H), 0.48-0.27 (m, 4H).

Synthesis of Compound 617

80 mg of 4-(3-cyclopropyl-5-methylpiperazin-l-yl)-2-ethyl-N-(8-fluoro -2- methylimidazo[1,2-a]pyridin-6-yl)-2H-indazole-7-carboxamide was purified by chiral-prep- HPLC (Condition 12, Gradient 1) to afford 4-((3R,5S)-3-cyclopropyl-5-methylpiperazin-l-yl)-2- ethyl-N-(8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl)-2H-ind azole-7-carboxamide (16.5 mg, 21%) as a solid. LCMS (ES, m, z):476 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.11 (s, 1H), 9.21 (d, J= 1.7 Hz, 1H), 8.78 (s, 1H), 7.98 (d, J= 8.1 Hz, 1H), 7.91 (d, J = 3.1 Hz, 1H), 7.30 (dd, J= 12.3, 1.7 Hz, 1H), 6.50 (d, J= 8.2 Hz, 1H), 4.61 (q, J= 7.3 Hz, 2H), 3.84-3.76 (m, 2H), 2.92 (d, J = 8.7 Hz, 1H), 2.72 (d, J= 10.9 Hz, 1H), 2.50-2.49 (m, 1H), 2.35 (s, 3H), 2.18-2.09 (m, 1H), 1.62 (t, J= 7.2 Hz, 3H), 1.09 (d, J= 6.2 Hz, 3H), 0.77 (qt, J= 8.1, 4.8 Hz, 1H), 0.48- 0.27 (m, 4H).

Example 304: Synthesis of Compound 619

Synthesis of Intermediate C498 C ₄ 98

To a solution of 4-bromo-6-chloro-2H-indazole (2.0 g, 8.651 mmol, 1 equiv) in EA (30 mL) was added tri ethyl oxonium tetrafluoroborate (1,98 g, 10. 389 mmol, 1.2 equiv) in portions at 0 degrees C. The resulting mixture was stirred for 5 h at room temperature. The reaction mixture was quenched with saturated aqueous NaHCOs (50 mL). The resulting mixture was extracted with EA (3 x 20 mL). The combined organics were washed with brine (2 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford 4-bromo-6-chloro-2-ethyl-2H-indazole (1.8 g, 80%) as a solid. LCMS (ES, m/z): 259 [M+H] ⁺

Synthesis of Intermediate C499 C ₄ 98 C ₄ 99

To a solution of 4-bromo-6-chloro-2-ethylindazole (600 mg, 2.312 mmol, 1.0 equiv) and (3R)-N,N-dimethylpyrrolidin-3-amine (316 mg, 2.774 mmol, 1.2 equiv) in dioxane (6.0 mL) were added Cs ₂ CO ₃ (1.5 g, 4.624 mmol, 2.0 equiv), RuPhos Palladacycle Gen.3 (193 mg, 0.231 mmol, 0.1 equiv) and RuPhos (107 mg, 0.231 mmol, 0.1 equiv) at room temperature. After stirring for 1 h at 90°C under a nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH ₂ CI ₂ / MeOH (20:1) to afford (3R)-l-(6-chloro-2-ethylindazol-4-yl)-N,N- dimethylpyrrolidin-3 -amine (600 mg, 89%) as a solid. LCMS (ES, m/z): 293 [M+H] ⁺

Synthesis of Intermediate C500

Pyridinium Tribromide

DMF, -5°C, 30 min C ₅₀ 0

To a stirred solution of (3R)-l-(6-chloro-2-ethylindazol-4-yl)-N,N-dimethylpyrrolidin -3- amine (600 mg, 2.049 mmol, 1.0 equiv) in DMF (12 mL) was added pyridinium tribromide (590 mg, 1.844 mmol, 0.9 equiv) in portions at -10 °C. The resulting mixture was stirred for 1 h at - 10°C. The reaction was quenched with water (2 mL) at 0 °C. The mixture was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford (3R)-l-(7-bromo-6-chloro-2- ethylindazol-4-yl)-N,N-dimethylpyrrolidin-3-amine (350 mg, 46%) as a solid. LCMS (ES, m/z):

371 [M+H] ⁺

Synthesis of Intermediate C501

To a solution of (3R)-l-(7-bromo-6-chloro-2-ethylindazol-4-yl)-N,N-dimethylpy rrolidin-3- amine (350 mg, 0.942 mmol, 1.0 equiv) in MeOH (4 mL) were added Pd(dppf)Cl ₂ (68 mg, 0.094 mmol, 0.1 equiv) and TEA (476 mg, 4.710 mmol, 5.0 equiv) in a pressure tank. The mixture was purged with nitrogen for 5 min and then was pressurized to 20 atm with carbon monoxide at 100°C for overnight. The reaction mixture was cooled to room temperature and filtered to remove insoluble solids. The filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 1) to afford methyl 6-chloro-4- [(3R)-3-(dimethylamino)pyrrolidin-l-yl]-2-ethylindazole-7-ca rboxylate (310 mg, 94%) as a solid. LCMS (ES, m/z): 351 [M+H] ⁺

Synthesis of Intermediate C502 C ₅₀ 1 C ₅₀ 2

A mixture of methyl 6-chloro-4-[(3R)-3-(dimethylamino)pyrrolidin-l-yl]-2-ethylin dazole- 7-carboxylate (310 mg, 0.884 mmol, 1.0 equiv) and LiOH (211 mg, 8.840 mmol, 10.0 equiv) in THF (1 mL), MeOH (1 mL) and H ₂ O (1 mL) was stirred for 2 h at 50°C. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 5, Gradient 2) to afford 6-chloro-4-[(3R)-3- (dimethylamino)pyrrolidin-l-yl]-2-ethylindazole-7-carboxylic acid (150 mg, 50%) as a solid.

LCMS (ES, m/z): 337 [M+H] ⁺

Synthesis of Compound 619 C ₅₀ 2

619

To a solution of 6-chloro-4-[(3R)-3-(dimethylamino)pyrrolidin-l-yl]-2-ethylin dazole-7- carboxylic acid (150 mg, 0.445 mmol, 1.0 equiv) and DIEA (201 mg, 1.558 mmol, 3.5 equiv) in DMF (4 mL) were added HATU (338 mg, 0.890 mmol, 2.0 equiv) and 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-amine (110 mg, 0.667 mmol, 1.5 equiv) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was quenched with water (10 mL). The resulting solids were collected by filtration and purified by reverse flash chromatography (Condition 3, Gradient 1) to afford 6-chloro-4-[(3R)-3- (dimethylamino)pyrrolidin-l-yl]-2-ethyl-N-{8-fluoro-2-methyl imidazo[1,2-a]pyri din-6- yl}indazole-7-carboxamide (62 mg, 29%) as a solid. LCMS (ES, m/z): 484 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 10.75 (s, 1H), 9.23 (s, 1H), 8.78 (s, 1H), 7.92 (d, J= 2.9 Hz, 1H), 7.16 (d, J= 12.5 Hz, 1H), 5.89 (s, 1H), 4.45 (q, J= 13 Hz, 2H), 3.82-3.68 (m, 2H), 3.61 (d, J= 9.5 Hz, 1H), 3.41 (d, J= 9.1 Hz, 2H), 2.87 (d, J= 9.3 Hz, 1H), 2.35 (s, 3H), 2.26 (s, 6H), 1.93-1.84 (m, 1H), 1.52 (t, J= 13 Hz, 3H).

Example 305: Synthesis of Compound 621

Synthesis of Intermediate C503 C ₅₀ 3

A solution of benzyl (3S)-3-[(4-methylbenzenesulfonyl)oxy]pyrrolidine-l-carboxyla te (2 g, 5.328 mmol, 1.0 equiv) in DMSO (5 mL) was treated with tert-butyl (2R,6S)-2,6- dimethylpiperazine-1 -carboxylate (3.42 g, 15.67 mmol, 3.0 equiv) at room temperature. The resulting mixture was stirred for 16 h at 70 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water. The resulting mixture was extracted with EtOAc (3 x 50 mL). The combined organic layers were washed with brine (1 x 100 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 :2) to afford tert-butyl (2R,6S)-4-[(3R)-l- [(benzyloxy)carbonyl]pyrrolidin-3-yl]-2,6-dimethylpiperazine -l-carboxylate (710 mg, 52%) as an oil. LCMS (ES, m/z): 418 [M+H] ⁺

Synthesis of Intermediate C504 C ₅₀ 3 C ₅₀ 4

A solution of tert-butyl (2R,6S)-4-[(3R)-l-[(benzyloxy)carbonyl]pyrrolidin-3-yl]-2,6- dimethylpiperazine-1 -carboxylate (710 mg, 0.431 mmol, 1 equiv) in MeOH (10 mL) was treated with Pd/C (71 mg) at room temperature. The resulting mixture was stirred for 16 h at room temperature under H2 atmosphere. The resulting mixture was filtered and the filter cake was washed with MeOH (20 mL). The filtrate was concentrated under reduced pressure to afford tertbutyl (2R,6S)-2,6-dimethyl-4-[(3R)-pyrrolidin-3-yl]piperazine-l-ca rboxylate (322 mg, 83%) as an oil. LCMS (ES, m/z): 284 [M+H] ⁺

Synthesis of Intermediate C505 C ₅₀ 5

To a stirred solution of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (300 mg, 0.746 mmol, 1.0 equiv) and tert-butyl (2R,6S)-2,6- dimethyl-4-[(3R)-pyrrolidin-3-yl]piperazine-l -carboxylate (253.6 mg, 0.895 mmol, 1.2 equiv) in dioxane (5 mL) were added Cs ₂ CO ₃ (729.0 mg, 2.238 mmol, 3.0 equiv), Ruphos (69.6 mg, 0.149 mmol, 0.2 equiv) and RuPhos Palladacycle Gen.3 (62.3 mg, 0.075 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 85°C under nitrogen atmosphere. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl ₂ /MeOH (10: 1) to afford tert-butyl (2R,6S)-4-[(3R)-l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridi n-6- yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-2,6-dime thylpiperazine-l-carboxylate (238 mg, 53%) as a solid. LCMS (ES, m/z): 605 [M+H] ⁺

Synthesis of Compound 621

A solution of tert-butyl (2R,6S)-4-[(3R)-l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridi n-6- yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-2,6-dime thylpiperazine-l-carboxylate (110 mg, 0.182 mmol, 1 equiv) in DCM (1 mL) was treated with HCl (gas) in 1,4-dioxane (0.2 mL) at room temperature. The resulting mixture was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep- HPLC (Condition 10, Gradient 11) to afford 4-[(3R)-3-[(3R,5S)-3,5-dimethylpiperazin-l- yl]pyrrolidin-l-yl]-N-{8-fluoro-2-methylimidazo[1,2-a]pyridi n-6-yl}-2-methylindazole-7- carboxamide (34 mg, 37%) as a solid. LCMS (ES, m/z): 505 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.02 (s, 1H), 9.19 (d, J= 1.7 Hz, 1H), 8.86 (s, 1H), 7.92 (d, J = 8.3 Hz, 1H), 7.89 (d, J= 3.1 Hz, 1H), 7.30 (dd, J= 12.5, 1.7 Hz, 1H), 6.05 (d, J= 8.4 Hz, 1H), 4.27 (s, 3H), 3.86 (t, J= 8.5 Hz, 1H), 3.74 (t, J= 9.4 Hz, 1H), 3.61 (d, J= 8.4 Hz, 1H), 3.46 (t, J= 9.0 Hz, 1H), 2.94 (p, J= 7.6 Hz, 1H), 2.89-2.70 (m, 4H), 2.35 (s, 3H), 2.27 (dd, J= 12.2, 6.2 Hz, 1H), 1.88 (d, J= 12.1 Hz, 2H), 1.60 (q, J= 10.2 Hz, 2H), 0.96 (t, J= 6.4 Hz, 6H).

Example 306: Synthesis of Compound 622

Synthesis of Intermediate C506 C ₅₀ 6

To a stirred mixture of benzyl 3 -oxopyrrolidine- 1 -carboxylate (550 mg, 2.509 mmol, 1.0 equiv) and tert-butyl (3R,4R)-3-amino-4-hydroxypyrrolidine-l -carboxylate (608.8 mg, 3.011 mmol, 1.2 equiv) in DCE (5.5 mL) was added NaBH(AcO)3 (797.5 mg, 3.763 mmol, 1.5 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature. The reaction was quenched with water at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (80%) to afford tert-butyl 3-({ l- [(benzyloxy)carbonyl]pyrrolidin-3-yl}amino)-4-hydroxypyrroli dine-l -carboxylate (802 mg, 79%) as a solid. LCMS (ES, m/z): 406 [M+H] ⁺

Synthesis of Intermediate C507 C ₅₀ 7 To a stirred mixture of tert-butyl 3-({ l-[(benzyloxy)carbonyl]pyrrolidin-3-yl}amino)-4- hydroxypyrrolidine-1 -carboxylate (800 mg, 1.973 mmol, 1.0 equiv) and TEA (399.2 mg, 3.946 mmol, 2.0 equiv) in DCM (8 mL) was added MsCl (271.1 mg, 2.368 mmol, 1.2 equiv) dropwise at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at room temperature under nitrogen atmosphere. The reaction was quenched with Water at room temperature. The resulting mixture was extracted with CH ₂ Cl ₂ (3 x 10 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure to afford tert-butyl 6-{ l- [(benzyloxy)carbonyl]pyrrolidin-3-yl}-3,6-diazabicyclo[3.1.0 ]hexane-3-carboxylate (623 mg, 82%) as a solid. LCMS (ES, m/z): 388 [M+H] ⁺

Synthesis of Intermediate C508

A solution of tert-butyl 6-{ l-[(benzyloxy)carbonyl]pyrrolidin-3-yl}-3,6- diazabicyclo[3.1.0]hexane-3-carboxylate (623 mg, 1.608 mmol, 1 equiv) in MeOH (20 mL) was treated with Pd/C (62 mg) at room temperature. The resulting mixture was stirred for 16 h at room temperature under H2 atmosphere. The resulting mixture was filtered and the filter cake was washed with MeOH (10 mL). The filtrate was concentrated under reduced pressure to afford tert-butyl 6-(pyrrolidin-3-yl)-3,6-diazabicyclo[3.1.0]hexane-3-carboxyl ate (280 mg, 69%) as an oil. LCMS (ES, m/z): 254 [M+H] ⁺

Synthesis of Intermediate C509

To a stirred mixture of 4-bromo-N-{8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}-2- methylindazole-7-carboxamide (220.0 mg, 0.547 mmol, 1.0 equiv) and tert-butyl 6-(pyrrolidin-3- yl)-3,6-diazabicyclo[3.1.0]hexane-3-carboxylate (207.8 mg, 0.821 mmol, 1.5 equiv) in 1,4- dioxane (4 mL) were added Ruphos (51.0 mg, 0.109 mmol, 0.2 equiv), Cs ₂ CO ₃ (534.6 mg, 1.641 mmol, 3.0 equiv) and RuPhos Palladacycle Gen.3 (56.2 mg, 0.11 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 90°C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water. The resulting mixture was extracted with EtOAc (3 x 20 mL). The combined organic layers were washed with brine (1 x 20 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with CH2Cl ₂ /MeOH (10: 1) to afford tertbutyl 6-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6-yl}carbamoyl )-2-methylindazol-4- yl]pyrrolidin-3-yl}-3,6-diazabicyclo[3.1.0]hexane-3-carboxyl ate (260 mg, 83%) as a solid. LCMS (ES, m/z): 575 [M+H] ⁺

Synthesis of Compound 622

To a stirred mixture of tert-butyl 6-{ l-[7-({8-fluoro-2-methylimidazo[1,2-a]pyridin-6- yl} carbarnoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl} -3, 6-diazabicyclo[3.1.0]hexane-3- carboxylate (60 mg, 0.104 mmol, 1 equiv) and DIEA (67.4 mg, 0.520 mmol, 5 equiv) in DCM (1 mL) was added TMSOTf (116.0 mg, 0.520 mmol, 5 equiv) at room temperature. The resulting mixture was stirred for 3 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 3) to afford 4-(3-{3,6-diazabicyclo[3.1.0]hexan-6-yl}pyrrolidin-l-yl)-N-{ 8-fluoro-2- methylimidazo[1,2-a]pyridin-6-yl}-2-methylindazole-7-carboxa mide (15 mg, 30%) as a solid.

LCMS (ES, m/z): 475 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.01 (s, 1H), 9.20 (d, J= 1.7 Hz, 1H), 8.84 (s, 1H), 7.93 (d, J = 8.3 Hz, 1H), 7.89 (d, J= 3.1 Hz, 1H), 7.31 (dd, J= 12.4, 1.7 Hz, 1H), 6.02 (d, J= 8.3 Hz, 1H), 4.27 (s, 3H), 3.81 (d, J= 9.5 Hz, 2H), 3.68 (s, 1H), 3.52 (d, J= 10.4 Hz, 1H), 2.82 (t, J= 11.8 Hz, 2H), 2.56-2.54 (m, 2H), 2.41 (dd, J= 14.8, 12.3 Hz, 1H), 2.34-2.32 (m, 5H), 2.14 (tt, J= 13.8, 7.0 Hz, 1H), 2.08-1.96 (m, 1H).

Example 307: Synthesis of Compound 624

Synthesis of Intermediate C510 C ₅ 10

A solution of methyl l-methyl-4-nitropyrazole-3 -carboxylate (2 g, 10.803 mmol, 1 equiv) in 7M NH3(g) in MeOH (32 mL) was stirred for overnight at 50°C. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure to afford l-methyl-4-nitropyrazole-3-carboxamide (1.8 g, 98%) as a solid. LCMS (ES, m/z): 171 [M+H] ⁺

Synthesis of Intermediate C511 C ₅ 10 C ₅ 11

To a solution of l-methyl-4-nitropyrazole-3 -carboxamide (1.9 g, 11.168 mmol, 1 equiv) in MeOH (20 mL) was added Pd/C (10%, 1.19 g) under nitrogen atmosphere in a 50 mL roundbottom flask. The mixture was hydrogenated at room temperature for overnight under hydrogen atmosphere using a hydrogen balloon, filtered through a C ₆ lite pad and concentrated under reduced pressure to afford 4-amino-l-methylpyrazole-3 -carboxamide (1.5 g, 96%) as a solid. LCMS (ES, m/z): 141 [M+H] ⁺

Synthesis of Intermediate C512

To a stirred solution of 4-amino-l-methylpyrazole-3 -carboxamide (1.5 g, 10.703 mmol, 1 equiv) in dimethylformamide (20 mL) was added NaH (1.54 g, 64.218 mmol, 6 equiv) in portions at 0°C under nitrogen atmosphere. The resulting mixture was stirred for 0.5 h at 0°C under nitrogen atmosphere. To the above mixture was added CDI (5.21 g, 32.109 mmol, 3 equiv) at 0°C. The resulting mixture was stirred for additional 3 h at 75 °C. The mixture was allowed to cool down to room temperature. The reaction was quenched by the addition of water (50 mL) at room temperature. The residue was purified by reverse flash chromatography (Condition 5, Graadient 7) to afford 2-methyl-4H,6H-pyrazolo[4,3-d]pyrimidine-5, 7-dione (300 mg, 17%) as a solid. LCMS (ES, m/z): 167 [M+H] ⁺

Synthesis of Intermediate C513

A solution of 2 -methyl-4H,6H-pyrazolo[4,3-d]pyrimidine-5, 7-dione (300 mg, 1.806 mmol, 1 equiv) in POOL (2.8 g, 18.060 mmol, 10 equiv) was stirred for 2 h at 50 °C. To the above mixture was added DBU (1.65 g, 10.836 mmol, 6 equiv) at 50 °C. The resulting mixture was stirred for additional 8 h at 80°C. The mixture was allowed to cool down to room temperature. The reaction was quenched by the addition of water (20 mL) at room temperature. The mixture was basified to pH 8 with saturated aqNaHCO3. The resulting mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 10) to afford 5,7-dichloro-2-methylpyrazolo[4,3-d]pyrimidine (250 mg, 68%) as a solid. LCMS (ES, m/z): 203 [M+H] ⁺

Synthesis of Intermediate C514

To a stirred solution of 5,7-dichloro-2-methylpyrazolo[4,3-d]pyrimidine (250 mg, 1.231 mmol, 1 equiv) in tetrahydrofuran (5 mL) was added sodium methoxide (63 mg, 1.169 mmol, 0.95 equiv) in portions at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 1 h at room temperature under nitrogen atmosphere. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with brine (1 x 10 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EA (1 : 1) to afford 5- chloro-7-methoxy-2-methylpyrazolo[4,3-d]pyrimidine (180 mg, 74%) as a solid. LCMS (ES, m/zy. 199 [M+H] ⁺

Synthesis of Intermediate C515

C514

C515

To a stirred solution of tert-butyl N-[(3R)-l-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin- 3 -yl]-N-m ethylcarbamate (100 mg, 0.268 mmol, 1 equiv) and 5-chloro-7-methoxy-2- methylpyrazolo[4,3-d]pyrimidine (53 mg, 0.268 mmol, 1 equiv) in dioxane (3 mL) were added Cs ₂ CO ₃ (175 mg, 0.536 mmol, 2 equiv), RuPhos (25 mg, 0.054 mmol, 0.2 equiv) and Pd2(dba)3 (25 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 100 °C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The reaction was quenched by the addition of water (20 mL) at room temperature. The resulting mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with brine (1 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 10, Gradient 3) to afford tert-butyl N-[(3R)-l-[7-({7-methoxy-2- methylpyrazolo[4,3-d]pyrimidin-5-yl}carbamoyl)-2-methylindaz ol-4-yl]pyrrolidin-3-yl]-N- methylcarbamate (90 mg, 63%) as a solid. LCMS (ES, m/z): 536 [M+H] ⁺

Synthesis of Compound 624 C ₅ 15 624 A solution of tert-butyl N-[(3R)-l-[7-({7-methoxy-2-methylpyrazolo[4,3-d]pyrimidin-5- yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methyl carbamate (90 mg, 0.168 mmol, 1 equiv) in 4 M HCl(gas) in 1,4-di oxane (3 mL) was stirred for 1 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford N-{7-methoxy-2-methylpyrazolo[4,3- d]pyrimidin-5-yl}-2-methyl-4-[(3R)-3-(methylamino)pyrrolidin -l-yl]indazole-7-carboxamide (16 mg, 19%) as a solid. LCMS (ES, m/z): 436 [M+H] ^{+ 1} H NMR (300 MHz, DMSO-d ₆ ) δ 11.50 (s, 1H), 8.83 (s, 1H), 8.40 (s, 1H), 7.95 (d, J= 8.3 Hz, 1H), 6.02 (d, J= 8.4 Hz, 1H), 4.24 (s, 3H), 4.17 (d, J= 3.6 Hz, 6H), 3.77 (q, J= 9.6 Hz, 2H), 3.66 (s, 2H), 2.35 (s, 3H), 2.21-2.09 (m, 1H), 1.95 (s, 2H).

Example 308: Synthesis of Compound 626

Synthesis of Intermediate C516

To a stirred solution of tert-butyl N-[(3R)-l-(7-carbamoyl-2-methylindazol-4-yl)pyrrolidin- 3 -yl]-N-m ethylcarbamate (100 mg, 0.268 mmol, 1 equiv) and 6-bromo-8-cyclopropoxy-2- methylimidazo[1,2-a]pyrazine (107. mg, 0.402 mmol, 1.5 equiv) in 1,4-dioxane (4.0 mL) were added Cs ₂ CO ₃ (261 mg, 0.804 mmol, 3 equiv), RuPhos (24 mg, 0.054 mmol, 0.2 equiv) and Pd2(dba)3 (24 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 3 h at 90 °C. The mixture was allowed to cool down to room temperature. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N-[(3R)-l-[7-({8-cyclopropoxy-2-methylimidazo[1,2-a]pyrazin- 6- yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methyl carbamate (90mg, 60%) as a solid. LCMS (ES, m/z): 561 [M+H] ⁺

Synthesis of Compound 626 C ₅ 16 626

A solution of tert-butyl N-[(3R)-l-[7-({8-cyclopropoxy-2-methylimidazo[1,2-a]pyrazin- 6- yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methyl carbamate (90 mg, 0.161 mmol, 1 equiv) in 4 M HCI (gas) in 1,4-di oxane (4 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford N-{8-cyclopropoxy-2- methylimidazo[1,2-a]pyrazin-6-yl} -2 -methyl -4-[(3R)-3 -(methylamino)pyrrolidin-l-yl]indazole- 7-carboxamide (22 mg, 30%) as a solid. LCMS (ES, m/z): 461 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.28 (s, 1H), 9.00 (s, 1H), 8.83 (s, 1H), 7.98-7.89 (m, 2H), 6.02 (d, J= 8.4 Hz, 1H), 4.53 (tt, J= 6.5, 3.3 Hz, 1H), 4.23 (s, 3H), 3.82-3.70 (m, 1H), 3.65 (d, J= 7.2 Hz, 1H), 3.42 (d, J = 9.5 Hz, 1H), 2.33 (d, J= 7.5 Hz, 6H), 2.14 (dt, J= 13.1, 6.5 Hz, 1H), 2.00 (s, 1H), 1.92 (dd, J = 12.0, 6.5 Hz, 1H), 0.98-0.82 (m, 4H).

Example 309: Synthesis of Compound 631

Synthesis of Intermediate C517 C ₅ 17

A solution of tert-butyl N-[(3R)-l-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6- yl}carbamoyl)-2-methylindazol-4-yl]pyrrolidin-3-yl]-N-methyl carbamate (200 mg, 0.371 mmol, 1 equiv) in 2 M methylamine in THF (2 mL) was stirred for overnight at 80 °C. The mixture was allowed to cool down to room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl N-methyl-N-[(3R)-l-(2-methyl-7-{[2-methyl-8-(methylamino)imi dazo[1,2- a]pyrazin-6-yl]carbamoyl}indazol-4-yl)pyrrolidin-3-yl]carbam ate (150 mg, 76%) as a solid.

LCMS (ES, m/z): 534 [M+H] ⁺

Synthesis of Compound 631 C ₅ 17 ₆₃₁

A solution of tert-butyl N-methyl-N-[(3R)-l-(2-methyl-7-{[2-methyl-8- (methylamino)imidazo[1,2-a]pyrazin-6-yl]carbamoyl}indazol-4- yl)pyrrolidin-3-yl]carbamate (90 mg, 0.169 mmol, 1 equiv) in 4 M HCl(gas)in 1,4-di oxane (2 mL) was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The residue was purified by reverse flash chromatography (Condition 3, Gradient 3) to afford 2-methyl-N-[2- methyl-8-(methylamino)imidazo[1,2-a]pyrazin-6-yl]-4-[(3R)-3- (methylamino)pyrrolidin-l- yl]indazole-7-carboxamide (35 mg, 48%) as a solid. LCMS (ES, m/z): 434 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.03 (s, 1H), 8.82 (s, 1H), 8.60 (s, 1H), 7.93 (d, J= 8.3 Hz, 1H), 7.67 (d, J= 1.0 Hz, 1H), 7.50 (d, J= 4.9 Hz, 1H), 6.02 (d, J= 8.4 Hz, 1H), 4.23 (s, 3H), 3.84-3.69 (m, 2H), 3.65 (d, J= 7.4 Hz, 1H), 3.45 (d, J= 9.9 Hz, 1H), 3.39 (s, 1H), 3.00 (d, J= 4.7 Hz, 3H), 2.38 (s, 3H), 2.32 (s, 3H), 2.18 (dd, J= 12.4, 5.9 Hz, 1H), 1.95 (dd, J= 12.0, 6.4 Hz, 1H).

Example 310: Synthesis of Compound 656

Synthesis of Intermediate C518

C ₅ 18

To a stirred solution of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-l- carboxylate (120 mg, 0.321 mmol, 1 equiv) and 6-bromo-8-chloro-2-methylimidazo[1,2- a]pyrazine (95 mg, 0.385 mmol, 1.2 equiv) in dioxane (2.4 mL) were added Cs ₂ CO ₃ (314.1 mg, 0.963 mmol, 3 equiv) and XantPhos (37.2 mg, 0.064 mmol, 0.2 equiv) and Pd2(dba)3 (29.4 mg, 0.032 mmol, 0.1 equiv) at room temperature. The resulting mixture was stirred for 2 h at 90°C under nitrogen atmosphere. The mixture was allowed to cool down to room temperature. The resulting mixture was diluted with water (3 mL). The resulting mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with water (3 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4- [7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}carbamoyl)- 2-ethylindazol-4-yl]piperazine-l- carboxylate (150 mg, 87%) as a solid. LCMS (ES, m/z): 539 [M+H] ⁺

Synthesis of Compound 656 C ₅ 18 656

To a stirred mixture of tert-butyl 4-[7-({8-chloro-2-methylimidazo[1,2-a]pyrazin-6- yl} carbarnoyl)-2-ethylindazol-4-yl]piperazine-l -carboxylate (100 mg, 0.186 mmol, 1 equiv) in DCM (1 mL) was added HCl(gas)in 1,4-dioxane (0.3 mL) dropwise at room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford N-{8-chloro-2-methylimidazo[1,2-a]pyrazin-6-yl}-2-ethyl-4-(p iperazin-l- yl)indazole-7-carboxamide (24 mg, 29%) as a solid. LCMS (ES, m/z): 439 [M+H] ^{+ 1} H NMR (400 MHz, DMSO-d ₆ ) δ 11.45 (s, 1H), 9.45 (s, 1H), 8.84 (s, 1H), 8.17 (s, 1H), 8.03 (d, J= 8.1 Hz, 1H), 6.51 (d, J= 8.2 Hz, 1H), 4.57 (q, J= 13 Hz, 2H), 3.38 (t, J= 4.9 Hz, 4H), 2.92 (dd, J= 6.0, 3.5 Hz, 4H), 2.42 (s, 3H), 1.64 (t, J= 13 Hz, 3H).

Example 311: Synthesis of Compound 658

Synthesis of Intermediate C519 C ₅ 19

To a stirred mixture of tert-butyl 4-(7-carbamoyl-2-ethylindazol-4-yl)piperazine-l- carboxylate (100 mg, 0.268 mmol, 1 equiv) and 6-bromo-8-fluoroisoquinoline (78.7 mg, 0.348 mmol, 1.3 equiv) in dioxane (2.5 mL) were added Cs ₂ CO ₃ (174.49 mg, 0.536 mmol, 2 equiv) and XantPhos (31 mg, 0.054 mmol, 0.2 equiv) and Pd2(dba)3 (24.5 mg, 0.027 mmol, 0.1 equiv) at room temperature under nitrogen atmosphere. The resulting mixture was stirred for 2 h at 90 °C under nitrogen atmosphere. The resulting mixture was diluted with water (5 mL). The resulting mixture was extracted with EtOAc (3 x 5 mL). The combined organic layers were washed with water (3 x 5 mL), dried over anhydrous Na ₂ SO ₄ . After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with EA to afford tert-butyl 4-{2-ethyl-7-[(8-fluoroisoquinolin-6- yl)carbamoyl]indazol-4-yl}piperazine-l-carboxylate (150 mg, 97%) as a solid. LCMS (ES, m/z): 519 [M+H] ⁺ Synthesis of Compound 658 C ₅ 19 658

To a stirred mixture of tert-butyl 4-{2-ethyl-7-[(8-fluoroisoquinolin-6- yl)carbamoyl]indazol-4-yl}piperazine-l-carboxylate (100 mg, 0.193 mmol, 1 equiv) in DCM (1 mL) was added HCl (gas) in 1,4-di oxane (0.3 mL) dropwise room temperature. The resulting mixture was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure. The crude product was purified by Prep-HPLC (Condition 10, Gradient 2) to afford 2-ethyl-N-(8-fluoroisoquinolin-6-yl)-4-(piperazin-l-yl)indaz ole-7-carboxamide (30 mg, 37%) as a solid. LCMS (ES, m/z): 419 [M+H] + ¹ H NMR (400 MHz, DMSO-d ₆ ) δ 11.66 (s, 1H), 9.35 (s, 1H), 8.86 (s, 1H), 8.54 (d, J= 5.8 Hz, 1H), 8.28 (d, J= 1.8 Hz, 1H), 8.04 (d, J= 8.1 Hz, 1H), 7.93 (dd, J= 12.5, 1.8 Hz, 1H), 7.87 (dd, J= 5.8, 1.8 Hz, 1H), 6.51 (d, J = 8.2 Hz, 1H), 4.63 (q, J= 13 Hz, 2H), 3.42-3.35 (m, 4H), 2.95-2.88 (m, 4H), 1.65 (t, J= 13 Hz, 3H).

Example 312: Exemplary splicing assay for monitoring expression levels of splice variants Compounds described herein were used to modulate RNA transcript abundance in cells. The expression of a target mRNA was measured by detecting the formation of an exon-exon junction in the canonical transcript (CJ). A compound mediated exon-inclusion event was detected by observing an increase in formation of a new junction with an alternative exon (AJ). Real-time qPCR assays were used to detect these splicing switches and interrogate the potency of various compounds towards different target genes. A high-throughput real time quantitative PCR (RT- qPCR) assay was developed to measure these two isoforms of the mRNA (CJ and AJ) for exemplary genes, such as HTT, SMN2, and MYB, together with a control housekeeping gene, GAPDH or GUSB or PPIA, used for normalization. Briefly, the A673 or K562 cell line was treated with various compounds described herein (e.g., compounds of Formula (I)). After treatment, the levels of the HTT, MYB, or SMN2 mRNA targets were determined from each sample of cell lysate by cDNA synthesis followed by qPCR.

Materials: cell s-to-CT 1-step kit: ThermoFisher A25602, cell s-to-CT lysis reagent: ThermoFisher 4391851C, TaqMan™ Fast Virus 1-Step Master Mix: ThermoFisher 4444436

GAPDH: VIC-PL, ThermoFisher 4326317E (Assay: Hs99999905_ml) - used for K562/suspension cell lines

GUSB: VIC-PL, ThermoFisher 4326320E (Assay: Hs99999908_ml) - used for K562/suspension cell lines

PPIA: VIC -PL, ThermoFisher 4326316E (Assay: Hs99999904_ml) - used for A673/adherent cell lines

Probe/primer sequences

Canonical junction (C J)

HTT Primer 1 : TCCTCCTGAGAAAGAGAAGGAC

HTT Primer 2: GCCTGGAGATCCAGACTCA

HTT CY5-Probe: /5Cy5/TGGCAACCCTTGAGGCCCTGTCCT/3IAbRQSp/

MYB Primer 1 : CCTCATTGGTCACAAATTGACTG

MYB Primer 2: TGGAGAGCTTTCTAAGATTGACC

MYB CY5-Probe: /5Cy5/AGGAAAATACTGTTTTTAGAACCCCAG/3IAbRQSp/ Alternative junction (A J)

HTT Primer 1 : TCCTGAGAAAGAGAAGGACATTG

HTT Primer 2: CTGTGGGCTCCTGTAGAAATC

HTT FAM-Probe: /56-FAM/TGGCAACCC/ZEN/TTGAGAGGCAAGCCCT/3IABkFQ/

MYB Primer 1 : CAACACCATTTCATAGAGACCAGAC

MYB Primer 2: GTTCTAAAATCATCCCTTGGCTTCTAAT

MYB FAM-Probe: /56-

FAM/AAATACTGT/ZEN/ATAGGACCTCTTCTGACATCC/3IABkFQ/

Description

The A673 cell line was cultured in DMEM with 10% FBS. cell s were diluted with full growth media and plated in a 96-well plate (15,000 cells in lOOul media per well). The plate was incubated at 37°C with 5% CO2 for 24 hours to allow cells to adhere. An 11 -point 3-fold serial dilution of the compounds was made in DMSO then diluted in media in an intermediate plate. Compounds were transferred from the intermediate plate to the cell plate with the top dose at a final concentration of lOuM in the well. Final DMSO concentration was kept at or below 0.25%. The cell plate was returned to the incubator at 37°C with 5% CO2 for an additional 24 hours.

The K562 cell line was cultured in IMDM with 10% FBS. For K562, cells were diluted with full growth media and plated in either a 96-well plate (50,000 cells in 50uL media per well) or a 384-well plate (8,000-40,000 cells in 45uL media per well). An 11-point 3-fold serial dilution of the compounds were made in DMSO then diluted in media in an intermediate plate. Compound was transferred from the intermediate plate to the cell plate with the top dose at a final concentration of lOuM in the well. Final DMSO concentration was kept at or below 0.25%. Final volume was lOOuL for 96-well plate and 50uL for 384-well plate. The cell plate was then placed in an incubator at 37°C with 5% CO2 for 24 hours.

The cells were then gently washed with 50uL - lOOuL cold PBS before proceeding to addition of lysis buffer. 30uL - 50uL of room temperature lysis buffer with DNAse I (and optionally RNAsin) was added to each well. cell s were shaken/mixed thoroughly at room temperature for 5-10 minutes for lysis to take place and then 3uL - 5uL of room temperature stop solution was added and wells were shaken/mixed again. After 2-5 minutes, the cell lysate plate was transferred to ice for RT-qPCR reaction setup. The lysates could also be frozen at - 80°C for later use.

In some cases, a direct lysis buffer was used. An appropriate volume of 3X lysis buffer (10 mM Tris, 150 mM NaCl, 1.5%-2.5% Igepal and 0.1-1 U/uL RNAsin, pH 7.4) was directly added to either K562 or A673 cells in media and mixed by pipetting 3 times. The plates were then incubated at room temperature with shaking/rocking for 20-50 minutes to allow for lysis to take place. After this time, the cell lysate plate was transferred to ice to set up for the RT-qPCR reactions. The lysates could also be frozen at -80°C for later use.

To set up 10 uL RT-qPCR reactions, cell lysates were transferred to 384-well qPCR plates containing the master mix according to the table below. The plates were sealed, gently vortexed, and spun down before the run. The volumes were adjusted accordingly in some instances where the reaction was carried in 20 uL. The table below summarizes the components of the RT-qPCR reactions:

The RT-qPCR reaction was performed using a QuantStudio (ThermoFisher) under the following fast cycling conditions. All samples and standards were analyzed at least in duplicate. In some instances, bulk room temperature (RT) step of 5-10 minutes was completed for all plates before proceeding with qPCR. The table below summarizes the PCR cycle:

The data analysis was performed by first determining the ACt vs the housekeeper gene. This ACt was then normalized against the DMSO control (AACt) and converted to RQ (relative quantification) using the 2 ^Λ (-AACt) equation. The RQ were then converted to a percentage response by arbitrarily setting an assay window of 3.5 and 4.0 ACt for HTT-CJ and MYB-CJ respectively and an assay window of 9 and 3 ACt for HTT-AJ and MYB-AJ in 96 well format (50,000 K562 cells/well and 15,000 A673 cells per well) and an assay window of 3 and 4 ACt for HTT-CJ and MYB-CJ respectively and an assay window of 5 and 3 ACt for HTT-AJ and MYB-AJ respectively in 384 well format (8,000 K562 cells/well example). These assay windows correspond to the maximal modulation observed at high concentration of the most active compounds. The percentage response was then fitted to the 4 parametric logistic equation to evaluate the concentration dependence of compound treatment. The increase in AJ mRNA is reported as AC ₅₀ (compound concentration having 50% response in AJ increase) while the decrease in CJ mRNA levels is reported as IC ₅₀ (compound concentration having 50% response in CJ decrease).

A summary of these results is illustrated in Tables 3A and 3B, wherein "A" represents an AC ₅₀ /IC ₅₀ of less than 100 Nm; "B" represents an AC ₅₀ /IC ₅₀ of between 100 Nm and 1 μM; and "C" represents an AC ₅₀ /IC ₅₀ of between 1 μM and 10 μM; and "D" represents an AC ₅₀ /IC ₅₀ of greater than 10 μM.

Table 3A: Modulation of RNA Splicing by Exemplary Compounds

Table 3B. Additional studies were carried out for a larger panel of genes using the protocol provided above. The junction between flanking upstream and downstream exons was used to design canonical junction qPCR assays. At least one of the forward primer, reverse primer or the CY5-labeled 5' nuclease probe (with 3' quencher such as ZEN / Iowa Black FQ) was designed to overlap with the exon junction to capture the CJ mRNA transcript. BLAST was used to confirm the specificity of the probeset and parameters such as melting temperature, GC content, amplicon size, and primer dimer formation are considered during their design. Data for the decrease in CJ mRNA levels for three exemplary genes (HTT, SMN2, and Target C) analyzed in this panel are reported as IC ₅₀ (compound concentration having 50% response in CJ decrease).

A summary of the results from the panel is illustrated in Tables 4A and 4B, wherein "A" represents an IC ₅₀ of less than 100 nM; "B" represents an IC ₅₀ of between 100 nM and 1 μM; and "C" represents an IC ₅₀ of between 1 μM and 10 μM; and "D" represents an IC ₅₀ of greater than 10 μM.

Table 4A: Modulation of RNA Splicing by Exemplary Compounds

Table 4B.

Example 313: Evaluating effect of exemplary compounds on protein abundance

Compounds described herein were used to screen for effects on quantitative protein abundance using a HiBit assay system (Promega). Quantitative protein abundance was determined by measuring the protein levels of HiBit-tagged protein targets expressed in cell culture via luminescence using the Nano-Gio HiBiT Lytic Detection System, which uses a split complementation assay format to reconstitute NanoBiT enzyme to generate a luminescent signal. A protein abundance assay was developed such that endogenous protein targets could be modified with the HiBiT peptide tag and their abundance could be assessed after compound treatment. Briefly, K562 cell lines containing a HiBiT-modification were treated with various compounds described herein (e.g., compounds of Formulas (I) or (II)). After treatment for 24 hours, the protein abundance of a specific target was determined by measuring luminescence.

Materials:

Promega Nano-Gio HiBiT Lytic Detection System (cat#N3030)

Coming 384-well TC-treated microplates (cat#3570)

Synthego Engineered cell s Knock-In Clones

Table 5: Design of genetically modified HiBiT cell lines

Description: cell s were maintained in IMDM with 10% FBS. Before the assay, cells were diluted with phenolphthalein-free growth media (IMDM + 1% FBS media) and were seeded in a 384-well plate at a density of 10000 cells/well (for each cell line listed in Table 5). Each compound was prepared as a 10-point 3 -fold serial dilution in DMSO with the top dose at a final concentration of 10 μM in the well. Unmodified K562 cells were added at the previously specified density with DMSO to serve as an assay baseline and positive control (PC) and DMSO only with the respective modified cell lines was added to the negative control (NC) columns. Final DMSO concentration was kept at or below 0.25%. Treated cell plates were placed in an incubator at 37°C with 5% CO2 for 24 hours. After 24 hours, 25 μL of Complete HiBit Lytic reagent was added to each well at room temperature (e.g. one plate requiring 10 mL Lytic Buffer, 100 μL LgBiT Protein, 200 μL Lytic Substrate), shaken for 5 minutes at 600 RPM, then left to sit for 10 minutes for signal to stabilize before reading on a Spark Cyto plate reader (Tecan) with a 500 ms measurement time.

To determine compound effects on protein abundance of each target in Table 6, the percent response for each respective cell line was calculated at each compound concentration as follows:

% response = 100 * (S - PC) / (NC - PC) For the normalized response at each concentration, a four-parameter logistical regression was fit to the data and the response was interpolated at the 50% value to determine a concentration for protein abundance at 50% (IC ₅₀ ) the untreated control.

A summary of the results for protein abundance is illustrated in Table 6, wherein A represents <100 nM; B represents 100-1000 nM; C represents 1000-9999 nM; and D represents greater than 10 μM.

Table 6.

Example 314: Investigating effect of exemplary compounds on cell viability

Compounds described herein were screened for toxicity in K562 (human chronic myelogenous leukemia) and SH-SY5Y (human neuroblastoma) cells using a cell Titer Gio 2.0 assay.

Materials:

Promega cell Titer-Glo® 2.0 cell Viability Assay (cat#G9241)

Coming 384-well TC-treated microplates (cat#3570)

Description: cell s were plated at 500 cells/well (K562 cells) in 45 μL of IMDM supplemented with 10% FBS in a 384-well opaque plate. Wells containing only medium were used as a blank control. Test compounds (e.g., compounds of Formula (I) or (II)) were first serially diluted in DMSO then diluted 1 : 100 with IMDM + 10% FBS. The final concentration of DMSO was 0.1% in each well. The cells were incubated for 72 hours at 37 °C and 5% CO2 before assaying with cell Titer Gio 2.0 reagent.

The compounds tested exhibited the following range as shown in Table 7, wherein A represents <100 nM; B represents 100-1000 nM; C represents 1000-9999 nM; and D represents greater than 10 μM in K562 cells. Table 7. EQUIVALENTS AND SCOPE

This application refers to various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. If there is a conflict between any of the incorporated references and the instant specification, the specification shall control. In addition, any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the invention can be excluded from any claim, for any reason, whether or not related to the existence of prior art.

Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above Description, Figures, or Examples but rather is as set forth in the appended claims. Those of ordinary skill in the art will appreciate that various changes and modifications to this description may be made without departing from the spirit or scope of the present invention, as defined in the following claims.