COMPOUNDS AND THEIR USE AS ANTAGONISTS OF JASMONATE

PERCEPTION

Technical field The present invention relates generally to methods and materials for use in antagonising responses mediated by the jasmonate-family of plant hormones.

Background art Jasmonates are fatty acid-derived hormones ubiquitous in the plant kingdom (Creelman and Mullet, 1997). These plant hormones are involved in many developmental processes such as gamete development, trichome formation, root growth, fruit ripening, senescence and cell cycle regulation (Blechert et al., 1999; Pauwels et al., 2008; Zhang and Turner, 2008; Reinbothe et al., 2009; Yoshida et al., 2009). Jasmonates also act as regulators of responses to abiotic and biotic stress, including drought, ozone exposure, wounding, herbivory and pathogens (Farmer et al., 2003; Browse and Howe, 2008; Chico et al., 2008; Wasternack, 2007). Thus, jasmonates are important regulators of the allocation of plant resources towards growth or defense. Jasmonates are synthesized by the octadecanoid pathway and originate from fatty acid precursors of the chloroplasts membranes by the concerted action of lipoxygenases, allene oxide synthase and allene oxide cyclase, which give rise to OPDA (12-oxo- 10, 15(Z)-phytodienoic acid; Wasternack, 2007). This molecule moves to the peroxisome where is converted to jasmonic acid (JA) by the action of OPR3 and three cycles of β- oxidation (Wasternack, 2007). In the cytoplasm, conjugation of JA with lie by the enzyme JAR1 leads to the production of the bioactive hormone, (+)7-iso-JA-lle (Staswick et al., 2002; Staswick and Tiryaki, 2004; Thines et al., 2007; Katsir et al., 2008; Fonseca et al., 2009; Suza et al., 2010). Responses to JA-lle are regulated by transcription factors (TFs) that belong to the bHLH (MYC and GL3/EGL3/TT8), MYB and EIN3/EIL families (Pauwels and Goossens, 201 1 ). In the absence of the hormone, the activity of these TFs is repressed by interaction with the JAZ repressors (Chini et al., 2007; Thines et al., 2007; Yan et al., 2007), which recruit the general co-repressors TOPLESS (TPL) and TPR (TOPLESS Related Proteins) through the adaptor protein NINJA (Novel Interactor of JAZ; Pauwels et al., 2010).

NINJA-TPL interaction is mediated by its EAR motif, which is also present in several JAZ proteins, enabling the direct interaction between these JAZs and TOPLESS (Kagale et al., 2010; Consortium, 201 1 ; Causier et al., 2012). Once released upon a specific stimulus, JA-lle is perceived by its co-receptor integrated by COM , the F-box component of the SCF ^COM (Skip-Cullin-F-box) E3 ubiquitin- ligase, and the JAZ repressors (Xie et al., 1998; Thines et al., 2007; Katsir et al., 2008; Fonseca et al., 2009; Sheard et al., 2010). Similar to the case of auxins (Tan et al., 2007), JA-lle acts as a molecular glue that induces the interaction between the SCF ^COM complex and its substrates, the JAZ repressors, which are ubiquitinated and targeted to the 26S proteasome for degradation (Chini et al., 2007; Maor et al., 2007; Thines et al., 2007; Yan et al., 2007; Saracco et al., 2009). As a consequence, the TFs targeted by JAZs are de- repressed and activate transcriptional reprogramming in response to JA-lle (Boter et al., 2004; Lorenzo et al., 2004; Dombrecht et al., 2007; Cheng et al., 201 1 ; Fernandez-Calvo et al., 201 1 ; Niu et al., 201 1 ). In Arabidopsis thaliana, the JAZ family, which belongs to the TIFY superfamily, encompasses 12 members (Chini et al., 2007; Thines et al., 2007). JAZ proteins share two conserved regions: the Jas motif in the C-terminus, and the ZIM domain containing the TIFY motif (Chini et al., 2007; Thines et al., 2007; Vanholme et al., 2007; Yan et al., 2007). The Jas motif is necessary for the interaction with both COM and MYC TFs (Chini et al., 2007; Katsir et al., 2008). Interestingly, the lack of the Jas motif in JAZ10.4, a splice variant of JAZ10, and the lack of some residues of this motif in JAZ8 prevent their interaction with COM and their subsequent degradation, thus behaving as constitutive repressors (Yan et al., 2007; Chung and Howe 2009; Chung et al., 2010; Shyu et al., 2012; Moreno et al., 2013). The ZIM domain mediates homo and heterodimerization of JAZ (Chini et al., 2009; Chung and Howe, 2009; Chung et al., 2009), and is also responsible for the interaction with NINJA.

Coronatine (COR) is a virulence factor produced by different strains of the hemibiotrophic plant pathogen Pseudomonas syringae (Bender et al., 1999). Indeed, COR is a mimic of the bioactive hormone JA-lle and can bind to the co-receptor COI1 -JAZ, induce JAZ degradation via the ubiquitin-proteasome system, release TFs and activate the expression of JA-responsive genes (Chini et al., 2007; Thines et al., 2007; Fonseca et al., 2009; Sheard et al., 2010). P. syringae has evolved this compound to suppress host defenses by activating the JA pathway, which has an inhibitory effect on Salicylic Acid (SA)-mediated defences against the bacteria (Feys et al., 1994; Zhao et al., 2003;

Uppalapati et al., 2005; Laurie-Berry et al., 2006; Thilmony et al., 2006). As a result, production of COR allows P. syringae to manipulate the interactions between these hormonal pathways to open stomata, grow in the apoplast and induce disease symptoms in plants (Kloek et al., 2001 ; Brooks et al., 2004; Melotto et al., 2006; Uppalapati et al., 2007; Melotto et al., 2008). So far, COR is the compound that has been demonstrated to show the strongest JA-lle agonistic activity (Brooks et al., 2004; Fonseca et al., 2009) although other JA-amino acid conjugates containing small hydrophobic amino acids have been shown to stimulate COI 1-JAZ1 binding to varying degrees, for example JA-Val 3, JA-Leu , and JA-Ala (Katsir et al., 2008). Both coronatine and JA-lle are perceived by the co-receptor complex consisting of COM , JAZ and the cofactor inositol

pentakisphosphate (Sheard et al., 2010).

Analyses of the roles of JA during development and in response to stress have been so far achieved by genetic analysis or exogenous treatments of the hormone or precursors. However, loss-of-function mutants are limited tools for the analysis of JA-dependent responses in particular tissues or developmental times. Temporal and spatial analyses of the roles of JA have been so far been made difficult by the lack of JA-lle antagonist molecules that could be used to manipulate/repress the pathway in particular tissues or developmental stages without compromising the whole JA response of the plant in other tissues or stages. Moreover, such JA-pathway antagonist molecules would be useful to prevent infection by biotrophic or hemibiotrophic pathogens since reduction of JA- responses would potentiate SA-dependent defenses. WO02055480 relates to the application of coronalon and related compounds in inducing resistance to pathogens including insects. Coronalon is an artificial (chemically synthesised) analogue of COR. This is intended to mimic COR.

COR has been proposed for use as an abscission agent (see WO2003001910). That publication also discusses the use of COR derivatives and COR analogues which share the activity of COR, although no detailed description of COR derivatives and COR analogues is given.

WO2003086076 concerns tobacco having reduced nicotine and nitrosamines wherein it is suggested that an auxin, an auxin analog, or a jasmonate antagonist is applied to said tobacco to reduce nicotine and nitrosamines. Examples of a "jasmonate antagonist" are defined as including any which have an inhibitory effect on the activity of lipoxygenase or the octadecanoid pathway, such that jasmonic acid levels are reduced. Other examples are reported as compounds which block the jasmonic acid pathway such as NSAIDS or Benzo[l,2,3]thiadiazole-7-carbothioic acid containing compounds.

Thus it can be seen that novel materials and methods which can antagonise JA-lle mediated responses in an organism would provide a contribution to the art.

Disclosure of the invention

The present inventors have designed, synthesised and characterized novel, potent and highly specific antagonist of JA-lle perception. These antagonist compounds

competitively inhibit binding of JA-lle to its co-receptor.

Preferred antagonist compounds are analogs of JA-lle or Cor, wherein the keto group which would normally be exposed outside of the binding pocket of COM is modified.

The modification of the residue results in the steric interference with JAZ proteins which would otherwise bind to COM , and can therefore attenuate the JA responsiveness of the plant. Preferred analog compounds are described in detail hereinafter. A most preferred compound is COR-methoxime, wherein the keto group is modified to a methoxime.

Although an auxin antagonist ("auxinole") has previously been reported (Hayashi et al., 2012) there is no previous report of rationally designed JA-lle or COR based specific antagonists.

The inventors show that COR-methoxime reverts the effects of JA-lle or COR treatments on Arabidopsis plants. Remarkably, it prevents the effect of naturally produced COR during infections by Pseudomonas syringae.

After the presently claimed priority date, some of the work disclosed herein was published as Monte et al. (2014) "Rational design of a ligand-based antagonist of jasmonate perception" in Nature Chemical Biology, Volume: 10, Pages: 671-676, the disclosure of which is herein incorporated by reference.

In various aspects, the invention relates to methods or processes for inhibiting a JA- related agonist mediated response in an organism (generally a plant or seed) which process comprises applying or administering to the organism an analog of the JA-related agonist which competitively inhibits the binding of the agonist to the COIVJAZ co-receptor.

"Agonists" in this context are JA-lle or COR, of which typically the most physiologically relevant will be JA-lle.

As discussed in more detail hereinafter, preferably binding of the analog compound to the COIVJAZ co-receptor spatially impedes the COIVJAZ co-receptor interaction, with the result that the normal biological activity of the agonist\COI\JAZ co-receptor interaction is inhibited. For example whereas wherein binding of the agonist to the COIVJAZ co- receptor normally leads to ubiquitination and degradation of JAZ repressors, and derepression of JA mediated genes, the presence of the analog compound inhibits this process thereby inhibiting ubiquitination and degradation of the JAZ repressors. This in turn inhibits derepression of JA mediated genes, which would otherwise arise from the degradation of the JAZ repressors, with the result that the properties of the treated organism is modified.

Preferred analog compounds (or antagonist compounds, the terms are used

interchangeably) are described below. Methods for assessing the relevant biological activities are also described below.

In other aspects the invention provides the analog compounds, processes of synthesising them, compositions comprising the compounds, treated plants and seeds, and uses of all these.

Some of these aspects and embodiments will now be described in more detail.

***** The analog or antagonist compounds of the present invention are related to jasmonic acid (JA):

Jasmonic acid More specifically, the compounds are related to the following JA-related agonist compounds: coronatine (COR) and /V-jasmonyl amino acid conjugates, such as N- jasmonoyl isoleucine (JA-lle), /V-jasmonyl alanine (JA-Ala), /V-jasmonoyl valine (JA-Val), and /V-jasmonyl leucine (JA-Leu):

Coronatine

/V-jasmonoyl

isoleucine

/V-jasmonoyl valine

/V-jasmonyl leucine

/V-jasmonyl alanine In general terms analog compounds may be those which are, or are related to, JA-amino acid (e.g., JA-lle, JA-Val, JA-Leu or JA-Ala) and COR derivatives where the "oxo" group (C=0) of the cyclopentanone ring (which is normally exposed outside of the binding pocket of COM ) is covalently modified to a stable group which sterically interferes with JAZ proteins which would otherwise interact with the agonist\COI1 , with the result that the analog compound attenuates the JA-related agonist responsiveness of the plant.

In preferred embodiments it is replaced by a C=N functional group (C=NX). Example blocking groups include imines, oximes, and hydrazones.

In a first aspect, the present invention relates to a compound having the following formula, or a tautomer thereof, or a pharmaceutically acceptable salt, hydrate, or solvate of the foregoing, wherein X, R ¹ , R ² , R ³ , R ⁴ and R ^E are as defined herein.

Some embodiments of the invention include the following: (1 ) A compound of the following formula:

or a tautomer thereof;

or a pharmaceutically acceptable salt, hydrate, or solvate of the foregoing; wherein:

-X is -R ^c , -OH, -OR°, -NH ₂ , -NHR ^NA , -NR ^NA R ^NB , or -NR ^NC R ^ND ; -R ^c is -R ^CS1 , -R ^CS2 , or -|_ ^CS -R ^CS2 ;

-R ^CS1 is Ci-i ₀ alkyl,

optionally substituted with one or more groups R ^M1 ;

-R ^CS2 is C3- ₈ cycloalkyl,

optionally substituted with one or more groups R ^M3 ;

-L ^cs - is Ci-4alkylene; -R° is -R ^os1 , -R ^OS2 , -R ^OS3 , R ^OS4 , -L ^os -R ^OS2 , -L ^os -R ^OS3 , or -L ^os -R ^OS4 ;

-R ^os1 is Ci-i ₀ alkyl,

optionally substituted with one or more groups R ^M1 ;

-R ^OS2 is Cs-scycloalkyl,

optionally substituted with one or more groups R ^M3 ;

-R ^OS3 is Ce-ioaryl,

optionally substituted with one or more groups R ^M3 ;

-R ^OS4 is Cs-ioheteroaryl,

optionally substituted on carbon with one or more groups -R ^M3 , and optionally substituted on secondary nitrogen, if present, with

-L ^os - is Ci-4alkylene; -R ^NA and R ^NB are independently -R ^NS1 , -R ^NS2 , -R ^NS3 , -R ^NS4 , -L ^NS -R ^NS2 , -L ^NS -R ^NS3 , or

-L ^NS -R ^NS4 '

-R ^NS1 is Ci-i ₀ alkyl,

optionally substituted with one or more groups R ^M1 ;

-R ^NS2 is Cs-scycloalkyl,

optionally substituted with one or more groups R ^M3 ;

-R ^NS3 is Ce-ioaryl,

optionally substituted with one or more groups R ^M3 ;

-R ^NS4 is Cs-ioheteroaryl,

optionally substituted on carbon with one or more groups -R ^M3 , and optionally substituted on secondary nitrogen, if present, with -R ^M2 ; -L ^NS - is Ci-4alkylene;

-NR ^NC R ^ND is azetidino, pyrrolidino, piperidino, piperizino, (N-Ci-4alkyl)-piperizino, (N-Ci-4alkyl-C(=0))-piperizino, morpholino, thiomorpholino, azepino, diazepino,

(N-Ci-4alkyl)-diazepino, or (N-Ci- ₄ alkyl-C(=0))-diazepino;

optionally substituted with one or more groups selected from linear or branched saturated -R ^E is -H, -R ^ES1 , -R ^ES2 , R ^ES3 , -L ^ES -R ^ES2 , or -L ^ES -R ^ES3 ;

-R ^ES1 is Ci-i ₀ alkyl,

optionally substituted with one or more groups R ^M1 ;

-R ^ES2 is Cs-ecycloalkyl,

optionally substituted with one or more groups R ^M3 ;

-R ^ES3 is Ce-ioaryl,

optionally substituted with one or more groups R ^M3 ;

-L ^ES - is Ci-4alkylene;

-R ^M1 is halo (e.g., -F, -CI, -Br, -I), -OH, -OR' -CF ₃ , -OCF ₃ , -NH ₂ , -NHR' or -NR' ₂ ; -R ^M2 is Ci-4alkyl, -CF ₃ , -L ^MS -OH, -L ^MS -OR', -L ^MS -CF ₃ , L ^MS -OCF ₃ , -L ^MS -NH ₂ , - L ^MS NHR', -L ^MS NR' ₂ ; _ _R M3 _is _ _R M1 _or _ _R M2.

-L ^MS - is Ci-4alkylene;

-R' is C1-4 alkyl;

-R ¹ and -R ² taken together form a group *-CH2-CH(CH ₂ CH3)-CH=#, where

^* indicates the carbon to which -R ¹ is attached and

# indicates the carbon to which -R ² is attached;

-R ³ and -R ⁴ taken together with the carbon atom to which they are bonded, form an ethyl-substituted cyclopropyl group (i.e., 2-ethylcyclopropyl);

-R ¹ is (Z)-pent-2-enyl;

-R ² is -H;

-R ³ is -H; and

-R ⁴ is -H or Ci-C ₆ alkyl.

Differently stated, the present invention relates to a compound having one of the following formulae:

With regards to the R ³ and R ⁴ groups in (1 )(a) above, it can be seen that R ³ and R ⁴ form a group ^** -CH-CH(CH2CH3)-##, where ^** indicates the carbon to which -R ³ is attached and ## indicates the carbon to which -R ⁴ is attached.

(2) A compound of (1 ), wherein either:

(a) -R ¹ and -R ² taken together form a group ^* -CH ₂ -CH(CH ₂ CH ₃ )-CH=#, where * indicates the carbon to which -R ¹ is attached and

# indicates the carbon to which -R ² is attached;

-R ³ and -R ⁴ taken together with the carbon atom to which they are bonded, form an ethyl-substituted cyclopropyl group (i.e., 2-ethylcyclopropyl);

or

(b) -R ¹ is (Z)-pent-2-enyl;

-R ² is -H;

-R ³ is -H; and

-R ⁴ is methyl, ethyl, /-propyl, n-propyl, /-butyl, s-butyl, n-butyl, or /-butyl.

(3) A compound of (1 ), wherein either: (a) -R ¹ and -R ² taken together form a group *-CH2-CH(CH ₂ CH3)-CH=#, where

^* indicates the carbon to which -R ¹ is attached and

# indicates the carbon to which -R ² is attached;

-R ³ and -R ⁴ taken together with the carbon atom to which they are bonded, form an ethyl-substituted cyclopropyl group (i.e., 2-ethylcyclopropyl);

(b) -R ¹ is (Z)-pent-2-enyl;

-R ² is -H;

-R ³ is -H; and

-R ⁴ is methyl, /-propyl, /-butyl or s-butyl.

Differently stated, the compound has one of the following formulae:

u)

(4) A compound of (3), wherein the compound is of formula (lll-a), (lll-b-lle), (I I l-b-Val) or(lll-b-Leu). (5) A compound of (3), wherein the compound is of formula (lll-a), (lll-b-lle) or (lll-b-Val).

(6) A compound of (3), wherein the compound is of formula (lll-a) or (lll-b-lle). Stereochemistry

Note that compounds of the above formulae have a number of chiral centres, specifically, at least the carbon atoms marked with an asterisk (*) in the following formulae. The carbon atoms at each of these positions may be in either an (R) or (S) configuration. Unless otherwise stated, a reference to one enantiomer/diastereomer is intended to be a reference to both enantiomers/all diastereomers.

(IV-b)

(7) A compound of (1 ), which is a compound having one of the following formulae:

Compounds of formula (V-a-1 ) have the same stereoconfiguration about the two stereocentres of the cyclopentane ring as naturally occurring coronatine.

Note that the cis arrangement of groups attached to the two stereocentres of the cyclopentane ring in formula (V-b-3) is the same as the cis arrangement of groups at the two stereocentres of the cyclopentane ring in naturally occurring coronatine. (8) A compound of (7), which is a compound of formula (V-a-1 ), formula (V-b-2) or formula (V-b-3).

(9) A compound of (7), which is a compound of formula (V-a-1 ) or formula (V-b-2).

(10) A compound of (7), which is a compound of formula (V-a-1 ) or formula (V-b-3). (1 1 ) A compound of (1 ), which is a compound of any one of the following formulae:

Compounds of formula (V-b-lle-1 ) may be referred to as "(+)-JA-lle derivatives".

Compounds of formula (V-b-lle-2) may be referred to as "(-)-JA-lle derivatives".

Compounds of formula (V-b-lle-3) may be referred to as "(+)-7-/so-JA-lle derivatives". Note that the cis arrangement of groups attached to the two stereocentres of the cyclopentane ring in formula (V-b-lle-3) is the same as the cis arrangement of groups at the two stereocentres of the cyclopentane ring in naturally occurring coronatine.

Compounds of formula (V-b-lle-4) may be referred to as "(-)-7-/so-JA-lle derivatives".

Similar naming conventions apply to JA-Val, JA-Leu and JA-Ala derivatives. (12) A compound of (1 1 ), which is a compound of formula (V-a-1 ), formula (V-b-lle-2), formula (V-b-Val-2), formula (V-b-Leu-2), formula (V-b-Ala-2), formula (V-b-lle-3), formula (V-b-Val-3), formula (V-b-Leu-3) or formula (V-b-Ala-3).

(13) A compound of (1 1 ), which is a compound of formula (V-a-1 ), formula (V-b-lle-2), formula (V-b-Val-2), formula (V-b-Leu-2), formula (V-b-lle-3), formula (V-b-Val-3) or formula (V-b-Leu-3).

(14) A compound of (1 1 ), which is a compound of formula (V-a-1 ), formula (V-b-lle-2), formula (V-b-Val-2), formula (V-b-lle-3) or formula (V-b-Val-3). (15) A compound of (1 1 ), which is a compound of formula (V-a-1 ), formula (V-b-lle-2) or formula (V-b-lle-3).

(16) A compound of (1 1 ), which is a compound of formula (V-a-1 ) or formula (V-b-lle-2).

(17) A compound of (1 1 ), which is a compound of formula (V-a-1 ) or formula (V-b-lle-3).

(18) A compound of (1 ), which is a compound of any one of the following formulae:

Compounds of formula (VI-a-1 ) have the same stereoconfiguration as naturally occurring coronatine. Compounds of formula (VI-b-lle-1 ) may be referred to as "(+)-JA-L-lle derivatives".

Compounds of formula (VI-b-lle-2) may be referred to as "(-)-JA-L-lle derivatives".

Compounds of formula (VI-b-lle-3) may be referred to as "(+)-7-/so-JA-L-lle derivatives". Note that the cis arrangement of groups attached to the two stereocentres of the cyclopentane ring in formula (VI-b-3) is the same as the cis arrangement of groups at the two stereocentres of the cyclopentane ring in naturally occurring coronatine.

Compounds of formula (VI-b-lle-4) may be referred to as "(-)-7-/so JA-L-lle derivatives".

Similar naming conventions apply to JA-L-Val, JA- L-Leu and JA-L-Ala derivatives. (19) A compound of (18), which is a compound of formula (VI-a-1 ), formula (VI-b-lle-2), formula (VI-b-Val-2), formula (VI-b-Leu-2), formula (VI-b-Ala-2), formula (VI-b-lle-3), formula (VI-b-Val-3), formula (VI-b-Leu-3) or formula (V-b-Ala-3).

(20) A compound of (18), which is a compound of formula (VI-a-1 ), formula (VI-b-lle-2), formula (VI-b-Val-2), formula (VI-b-Leu-2), formula (VI-b-lle-3), formula (VI-b-Val-3) or formula (VI-b-Leu-3).

(21 ) A compound of (18), which is a compound of formula (VI-a-1 ), formula (VI-b-lle-2), formula (VI-b-Val-2), formula (VI-b-lle-3) or formula (VI-b-Val-3).

(22) A compound of (18), which is a compound of formula (VI-a-1 ), formula (VI-b-lle-2) or formula (VI-b-lle-3).

(23) A compound of (18), which is a compound of formula (Vl-a) or formula (VI-b-lle-2).

(24) A compound of (18), which is a compound of formula (Vl-a) or formula (VI-b-lle-3). Enolisation

Note that naturally occurring JA and JA-amino acid derivatives may undergo enolisation,

However, replacement of the oxo (C=0) group with C=NX in the present invention means that such enolisation can no longer take place. Thus, for example, the methoxime of (+)- 7-iso- JA-L-lle is more stable chemically compared to (+)-7-iso-JA-L-lle and cannot undergo spontaneous isomerization to the (-)-JA derivative)

Geometrical isomers

Also note that the C=NX group can exist in two configurations, leading to Z (syn) and E (anti) isomers, as shown in the following formulae:

(Z) isomer (Vll-Z)

(E) isomer (Vll-E)

where the wavy line (- -) indicates the point of attachment to the rest of the molecule.

Note that the wavy bond between the nitrogen atom and -X in the group C=NX in formulae (l)-(VI) above indicates that both Zand E isomers are possible.

In some embodiments, the Zand E isomers are isolable. For example, in some embodiments a mixture of the isomers may be separated into Zand E isomers using conventional separation techniques.

(25) A compound according to any one of (1 ) to (24), wherein the compound is the Z (syn) isomer, as shown in formula (Vll-Z).

(26) A compound according to any one of (1 ) to (24), wherein the compound is the E (anti) isomer, as shown in formula (Vll-E).

The Group -X

(27) A compound according to any one of (1 ) to (26), wherein -X is -OH, -OR°, -NH2, -NHR ^NA , -NHR ^NA R ^NB .

(28) A compound according to any one of (1 ) to (26), wherein -X is -OR°, -NHR ^NA , -NHR ^NA R ^NB .

(29) A compound according to any one of (1 ) to (26), wherein -X is -OH or -OR°.

(30) A compound according to any one of (1 ) to (26), wherein -X is -R ^c . Such compounds may be referred to as "substituted imines", or alternatively "Schiff bases".

(31 ) A compound according to any one of (1 ) to (26), wherein -X is -OH. Such compounds may be referred to as "unsubstituted oximes". (32) A compound according to any one of (1 ) to (26), wherein -X is -OR°. Such compounds may be referred to as "O-substituted oximes".

(33) A compound according to any one of (1 ) to (26), wherein -X is -Nhb. Such compounds may be referred to as "unsubstituted hydrazones".

(34) A compound according to any one of (1 ) to (26), wherein -X is -NHR ^NA . Such compounds may be referred to as ' -monosubstituted hydrazones". An example of an N- monosubstituted hydrazone is, for example, >C=N-NHMe.

(35) A compound according to any one of (1 ) to (26), wherein -X is -NR ^NA R ^NB . Such compounds may be referred to as "/V,/V-disubstituted hydrazones". An example of an A/JV-disubstituted hydrazone is, for example, >C=N-N(Me)2. (36) A compound according to any one of (1 ) to (26), wherein -X is -NR ^NC R ^ND . The Group -R ^c (37) A compound according to any one of (1 ) to (36), wherein -R ^c , if present, is -R ^CS1 .

(38) A compound according to any one of (1 ) to (36), wherein -R ^c , if present, is -R ^CS2 .

(39) A compound according to any one of (1 ) to (36), wherein -R ^c , if present, is -|_ ^CS -R ^CS2 ;

The Group -R ^CS1

(40) A compound according to any one of (1 ) to (39), wherein -R ^CS1 , if present, is methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl, or /-butyl and is optionally substituted with one or more groups -R ^M1 .

(41 ) A compound according to any one of (1 ) to (39), wherein -R ^CS1 , if present, is methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl, or /-butyl. (42) A compound according to any one of (1 ) to (39), wherein -R ^CS1 , if present, is methyl or ethyl.

(43) A compound according to any one of (1 ) to (39), wherein -R ^CS1 , if present, is methyl.

The Group -R ^CS2

(44) A compound according to any one of (1 ) to (43), wherein R ^CS2 , if present, is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl, and is optionally substituted with one or more groups -R ^M3 . (45) A compound according to any one of (1 ) to (43), wherein R ^CS2 , if present, is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.

The Group -L ^cs -

(46) A compound according to any one of (1 ) to (45), wherein -L ^cs , if present, is -CH2-, -CH(CH ₃ )-, -C(CH ₃ ) ₂ -, -CH2CH2-, -CH(CH ₃ )CH ₂ -, -CH ₂ CH(CH ₃ )-, or -CH ₂ CH ₂ CH ₂ -.

(47) A compound according to any one of (1 ) to (45), wherein -L ^cs , if present, is -CH ₂ -, -CH(CH ₃ )-, -C(CH ₃ ) ₂ -, or -CH ₂ CH ₂ -.

(48) A compound according to any one of (1 ) to (45), wherein -L ^cs , if present, is -CH ₂ -, -CH(CH ₃ )-, or -C(CH ₃ ) ₂ -.

(49) A compound according to any one of (1 ) to (45), wherein -L ^cs , if present, is -CH ₂ - or -CH ₂ CH ₂ -.

(50) A compound according to any one of (1 ) to (45), wherein -L ^cs , if present, is -CH ₂ -.

The Group -R°

(51 ) A compound according to any one of (1 ) to (50), wherein -R° if present, is -R ^os1 , -

ROS2 _pOS3 _|_OS_pOS2 _Q |- _|_OS_pOS3

(52) A compound according to any one of (1 ) to (50), wherein -R° if present, is -R ^os1 , or -R ^OS2 or -L ^os -R ^OS2 .

(53) A compound according to any one of (1 ) to (50), wherein -R°, if present, is -R ^os1 .

(54) A compound according to any one of (1 ) to (50), wherein -R°, if present, is -R ^OS2 .

(55) A compound according to any one of (1 ) to (50), wherein -R°, if present, is -R ^OS3 .

(56) A compound according to any one of (1 ) to (50), wherein -R°, if present, is -R ^OS4 .

(57) A compound according to any one of (1 ) to (50), wherein -R°, if present, is -|_ ^os -R ^OS2

(58) A compound according to any one of (1 ) to (50), wherein -R°, if present, is -|_ ^os -R ^OS3

(59) A compound according to any one of (1 ) to (50), wherein -R°, if present, is -|_ ^os -R ^OS4 The Group -R° ^S1

(60) A compound according to any one of (1 ) to (59), wherein -R ^os1 , if present, is methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl, or /-butyl and is optionally substituted with one or more groups -R ^M1 .

(61 ) A compound according to any one of (1 ) to (59), wherein -R ^os1 , if present, is methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl, or /-butyl.

(62) A compound according to any one of (1 ) to (59), wherein -R ^os1 , if present, is methyl, ethyl, / ^' -propyl, or n-propyl.

(63) A compound according to any one of (1 ) to (59), wherein -R ^os1 , if present, is methyl, ethyl.

(64) A compound according to any one of (1 ) to (59), wherein -R ^os1 , if present, is methyl.

The Group -R ^OS2

(65) A compound according to any one of (1 ) to (64), wherein -R ^OS2 , if present, is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl, and is optionally substituted with one or more groups -R ^M3 .

(66) A compound according to any one of (1 ) to (64), wherein -R ^OS2 , if present, is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.

The Group -R ^OS3

(67) A compound according to any one of (1 ) to (66), wherein -R ^OS3 , if present, is phenyl, and is optionally substituted with one or more groups -R ^M3 .

(68) A compound according to any one of (1 ) to (66), wherein -R ^OS3 , if present, is phenyl.

(69) A compound according to any one of (1 ) to (66), wherein -|_ ^os -R ^OS3 , if present, is - Chb-phenyl optionally substituted with one or more groups -R ^M3 .

(70) A compound according to any one of (1 ) to (66), wherein -|_ ^os -R ^OS3 , if present, is - Chb-phenyl (i.e., benzyl). The Group -R ^OS4

(71 ) A compound according to any one of (1 ) to (70), wherein -R ^OS4 , if present, is furanyl, thienyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl, pyrazolyl, isoxazolyl, isothiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolyl, benzoimidazolyl, indazolyl, benzofuranyl, benzothienyl, benzooxazolyl, benzothiazolyl, benzoisoxazolyl, benzoisothiazolyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, quinazolinyl, or phthalazinyl,

and is optionally substituted on carbon with one or more groups -R ^M3 ,

and is optionally substituted on secondary nitrogen, if present, with a group -R ^M2 .

(72) A compound according to any one of (1 ) to (70), wherein -R ^OS4 , if present, is furanyl, thienyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl, pyrazolyl, isoxazolyl, or isothiazolyl,

and is optionally substituted on carbon with one or more groups -R ^M3 ,

and is optionally substituted on secondary nitrogen, if present, with a group -R ^M2 .

(73) A compound according to any one of (1 ) to (70), wherein -R ^OS4 , if present, is pyridyl, pyridazinyl, pyrimidinyl, or pyrazinyl,

and is optionally substituted on carbon with one or more groups -R ^M3 .

The Group - L ^os -

(74) A compound according to any one of (1 ) to (73), wherein -L ^os , if present, is -CH2-, -CH(CH ₃ )-, -C(CH ₃ ) ₂ -, -CH ₂ CH ₂ -, -CH(CH ₃ )CH ₂ -, -CH ₂ CH(CH ₃ )-, or -CH ₂ CH ₂ CH ₂ -.

(75) A compound according to any one of (1 ) to (73), wherein -L ^os , if present, is -CH ₂ -, -CH(CH ₃ )-, -C(CH ₃ ) ₂ -, or -CH ₂ CH ₂ -. (76) A compound according to any one of (1 ) to (73), wherein -L ^os , if present, is -CH ₂ -, -CH(CH ₃ )-, or -C(CH ₃ ) ₂ -.

(77) A compound according to any one of (1 ) to (73), wherein -L ^os , if present, is -CH ₂ - or -CH ₂ CH ₂ -.

(78) A compound according to any one of (1 ) to (73), wherein -L ^os , if present, is -CH ₂ -.

The Group -R ^NA

(79) A compound according to any one of (1 ) to (78), wherein -R ^NA , if present, is -R'

RNS ₂ _RNS ₃ _|_NS_RNS _{2 0} Γ -|_ ^NS -R ^NS3

(80) A compound according to any one of (1 ) to (78), wherein -R ^NA , if present, is -R' R ^NS2 , or -L ^NS -R ^NS2 .

(81 ) A compound according to any one of (1 ) to (78), wherein -R ^NA , if present, is -R' (82) A compound according to any one of (1 ) to (78), wherein _RNA if present, is -RNS2

(83) A compound according to any one of (1 ) to (78), wherein _RNA if present, is -RNS3

(84) A compound according to any one of (1 ) to (78), wherein _RNA if present, is -RNS4

(85) A compound according to any one of (1 ) to (78), wherein _RNA if present, is _|_NS_

(86) A compound according to any one of (1 ) to (78), wherein _RNA if present, is _|_NS_

(87) A compound according to any one of (1 ) to (78), wherein _RNA if present, is _|_NS_

The Group -R ^NS1

(88) A compound according to any one of (1 ) to (87), wherein -R ^NS1 , if present, is methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl, or /-butyl and is optionally substituted with one or more groups -R ^M1 .

(89) A compound according to any one of (1 ) to (87), wherein -R ^NS1 , if present, is methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl, or /-butyl.

(90) A compound according to any one of (1 ) to (87), wherein -R ^NS1 , if present, is methyl or ethyl.

(91 ) A compound according to any one of (1 ) to (87), wherein -R ^NS1 , if present, is methyl.

The Group -R ^NS2

(92) A compound according to any one of (1 ) to (91 ), wherein -R ^NS2< if present, is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl, and is optionally substituted with one or more groups -R ^M3 .

(93) A compound according to any one of (1 ) to (91 ), wherein -R ^NS2 < if present, is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.

The Group -R ^NS3

(94) A compound according to any one of (1 ) to (93), wherein -R ^NS3 , if present, is phenyl, and is optionally substituted with one or more groups -R ^M3 . (95) A compound according to any one of (1 ) to (93), wherein -R ^NS3 , if present, is phenyl.

(96) A compound according to any one of (1 ) to (93), wherein -|_ ^NS -R ^NS3 , if present, is - Chb-phenyl optionally substituted with one or more groups -R ^M3 .

(97) A compound according to any one of (1 ) to (93), wherein -|_ ^NS -R ^NS3 , if present, is - Chb-phenyl (i.e., benzyl).

The Group -R ^NS4

(98) A compound according to any one of (1 ) to (97), wherein -R ^NS4 , if present, is furanyl, thienyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl, pyrazolyl, isoxazolyl, isothiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolyl, benzoimidazolyl, indazolyl, benzofuranyl, benzothienyl, benzooxazolyl, benzothiazolyl, benzoisoxazolyl, benzoisothiazolyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, quinazolinyl, or phthalazinyl,

and is optionally substituted on carbon with one or more groups -R ^M3 ,

and is optionally substituted on secondary nitrogen, if present, with a group -R ^M2 .

(99) A compound according to any one of (1 ) to (97), wherein -R ^NS4 , if present, is furanyl, thienyl, pyrrolyl, imidazolyl, oxazolyl, thiazolyl, pyrazolyl, isoxazolyl, or isothiazolyl,

and is optionally substituted on carbon with one or more groups -R ^M3 ,

and is optionally substituted on secondary nitrogen, if present, with a group -R ^M2 .

(100) A compound according to any one of (1 ) to (97), wherein -R ^NS4 , if present, is pyridyl, pyridazinyl, pyrimidinyl, or pyrazinyl,

and is optionally substituted on carbon with one or more groups -R ^M3 . The Group -NR ^NC R ^ND

(101 ) A compound according to any one of (1 ) to (100), wherein -NR ^NC R ^ND , if present, is azetidino, pyrrolidino, piperidino, piperizino, (N-Ci-4alkyl)-piperizino,

(N-Ci-4alkyl-C(=0))-piperizino, or morpholino; and is optionally substituted with one or more groups selected from linear or branched saturated Ci-4alkyl.

(102) A compound according to any one of (1 ) to (100), wherein -NR ^NC R ^ND , if present, is pyrrolidino, piperidino, piperizino, (N-Ci-4alkyl)-piperizino, (N-Ci-4alkyl-C(=0))-piperizino, or morpholino.

The Group -L ^NS -

(103) A compound according to any one of (1 ) to (102), wherein -L ^NS , if present, is -CH ₂ -, -CH(CH ₃ )-, -C(CH ₃ ) ₂ -, -CH ₂ CH ₂ -, -CH(CH ₃ )CH ₂ -, -CH ₂ CH(CH ₃ )-, or -CH ₂ CH ₂ CH ₂ -. (104) A compound according to any one of (1 ) to (102), wherein -L ^NS , if present, is -CH ₂ -CH(CH ₃ )-, -C(CH ₃ ) ₂ -, or -CH ₂ CH ₂ -.

(105) A compound according to any one of (1 ) to (102), wherein -L ^NS , if present, is -CH ₂ -CH(CH ₃ )-, or -C(CH ₃ ) ₂ -.

(106) A compound according to any one of (1 ) to (102), wherein -L ^NS , if present, is -CH ₂ or -CH ₂ CH ₂ -.

(107) A compound according to any one of (1 ) to (102), wherein -L ^NS , if present, is -CH ₂

The Group -R ^E

(108) A compound according to any one of (1 ) to (107), wherein R ^E is H, R ^ES1 , R ^ES2 , or -L ^ES -R ^ES2

(109) A compound according to any one of (1 ) to (107), wherein R ^E is H, or R ^ES1 .

(1 10) A compound according to any one of (1 ) to (107), wherein R ^E is H.

(1 1 1 ) A compound according to any one of (1 ) to (107), wherein R ^E is R ^ES1 .

(1 12) A compound according to any one of (1 ) to (107), wherein R ^E is R ^ES2 .

(1 13) A compound according to any one of (1 ) to (107), wherein R ^E is R ^ES3 .

(1 14) A compound according to any one of (1 ) to (107), wherein R ^E is -L ^ES -R ^ES2 .

(1 15) A compound according to any one of (1 ) to (107), wherein R ^E is -L ^ES -R ^ES3 .

The Group -R ^ES1

(1 16) A compound according to any one of (1 ) to (1 15), wherein -R ^ES1 , if present, is methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl, or /-butyl and is optionally substituted with one or more groups -R ^M1 .

(1 17) A compound according to any one of (1 ) to (1 15), wherein -R ^ES1 , if present, is methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl, or /-butyl.

(1 18) A compound according to any one of (1 ) to (1 15), wherein -R ^ES1 , if present, is methyl or ethyl.

(1 19) A compound according to any one of (1 ) to (1 15), wherein -R ^ES1 , if present, is methyl. The Group -R ^ES2

(120) A compound according to any one of (1 ) to (1 19), wherein -R ^ES2 , if present, is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl, and is optionally substituted with one or more groups -R ^M3 .

(121 ) A compound according to any one of (1 ) to (1 19), wherein -R ^ES2 , if present, is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.

The Group -R ^ES3

(122) A compound according to any one of (1 ) to (121 ), wherein -R ^ES3 , if present, is phenyl, and is optionally substituted with one or more groups -R ^M3 .

(123) A compound according to any one of (1 ) to (121 ), wherein -R ^ES3 , if present, is phenyl. (124) A compound according to any one of (1 ) to (121 ), wherein -L ^ES -R ^ES3 , if present, is - CH ₂ -phenyl optionally substituted with one or more groups -R ^M3 .

(125) A compound according to any one of (1 ) to (121 ), wherein -L ^ES -R ^ES3 , if present, is - Chb-phenyl (i.e., benzyl).

The Group -L ^ES

(126) A compound according to any one of (1 ) to (125), wherein -L ^ES , if present, is -CH2-, -CH(CH ₃ )-, -C(CH ₃ ) ₂ -, -CH2CH2-, -CH(CH ₃ )CH ₂ -, -CH ₂ CH(CH ₃ )-, or -CH ₂ CH ₂ CH ₂ -.

(127) A compound according to any one of (1 ) to (125), wherein -L ^ES , if present, is -CH ₂ -, -CH(CH ₃ )-, -C(CH ₃ ) ₂ -, or -CH ₂ CH ₂ -. (128) A compound according to any one of (1 ) to (125), wherein -L ^ES , if present, is -CH ₂ -, -CH(CH ₃ )-, or -C(CH ₃ ) ₂ -.

(129) A compound according to any one of (1 ) to (125), wherein -L ^ES , if present, is -CH ₂ - or -CH ₂ CH ₂ -.

(130) A compound according to any one of (1 ) to (125), wherein -L ^ES , if present, is -CH ₂ -. The Group -R ^M1

(131 ) A compound according to any one of (1 ) to (130), wherein -R ^M1 , if present, is -F, -CI, -Br, -I, -OH, OR', -NH ₂ , -NHR' or -NR' ₂ .

(132) A compound according to any one of (1 ) to (130), wherein -R ^M1 , if present, is -F, -CI, -Br, -I, -OH or OR'.

(133) A compound according to any one of (1 ) to (130), wherein -R ^M1 , if present, is -F, -CI, -Br, -I or -OH.

(134) A compound according to any one of (1 ) to (130), wherein -R ^M1 , if present, is -F, -CI, -Br or -I.

The Group -R' M2

(135) A compound according to any one of (1 ) to (134), wherein -R ^M2 , if present, is methyl, ethyl, /-propyl, n-propyl, /-butyl, s-butyl, n-butyl, i-butyl, -L ^MS -OH, -L ^MS -OR', -L ^MS -NH ₂ , -L ^MS -NHR' or -L ^MS -NR' ₂ .

(136) A compound according to any one of (1 ) to (134), wherein -R ^M2 , if present, is methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl or i-butyl. (137) A compound according to any one of (1 ) to (134), wherein -R ^M2 , if present, is methyl, ethyl, / ^' -propyl or n-propyl.

(138) A compound according to any one of (1 ) to (134), wherein -R ^M2 , if present, is methyl or ethyl.

(139) A compound according to any one of (1 ) to (134), wherein -R ^M2 , if present, is methyl. The Group -R ^M3

(140) A compound according to any one of (1 ) to (139), wherein -R ^M3 , if present, is -F, -CI, -Br, -I, methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl, i-butyl, -OH, -OR', -NH ₂ , -NHR', -NR' ₂ , -L ^MS -OH, -L ^MS -OR', -L ^MS -NH ₂ , -L ^MS -NHR' or -L ^MS -NR' ₂ .

(141 ) A compound according to any one of (1 ) to (139), wherein -R ^M3 , if present, is -F, -CI, -Br, -I, methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl, i-butyl, -OH or -OR'.

(142) A compound according to any one of (1 ) to (139), wherein -R ^M3 , if present, is -F, -CI, -Br, -I, methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl or i-butyl. (143) A compound according to any one of (1 ) to (139), wherein -R ^M3 , if present, is -F, -CI, -Br, -I, methyl or ethyl.

(144) A compound according to any one of (1 ) to (139), wherein -R ^M3 , if present, is -F, -CI, -Br, -I or methyl.

The Group -L ^MS (145) A compound according to any one of (1 ) to (144), wherein -L ^MS , if present, is -CH2-, -CH(CH ₃ )-, -C(CH ₃ ) ₂ -, -CH2CH2-, -CH(CH ₃ )CH ₂ -, -CH ₂ CH(CH ₃ )- or -CH ₂ CH ₂ CH ₂ -.

(146) A compound according to any one of (1 ) to (144), wherein -L ^MS , if present, is -CH ₂ -, -CH(CH ₃ )-, -C(CH ₃ ) ₂ - or -CH ₂ CH ₂ -.

(147) A compound according to any one of (1 ) to (144), wherein -L ^MS , if present, is -CH ₂ -, -CH(CH ₃ )- or -C(CH ₃ ) ₂ -.

(148) A compound according to any one of (1 ) to (144), wherein -L ^MS , if present, is -CH ₂ - or -CH ₂ CH ₂ -.

(149) A compound according to any one of (1 ) to (144), wherein -L ^MS , if present, is -CH ₂ -.

The Group -R'

(150) A compound according to any one of (1 ) to (149), wherein R', if present, is methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl, or /-butyl. (151 ) A compound according to any one of (1 ) to (149), wherein R', if present, is methyl, ethyl, / ^' -propyl or n-propyl.

(152) A compound according to any one of (1 ) to (149), wherein R', if present, is methyl or ethyl.

(153) A compound according to any one of (1 ) to (149), wherein R', if present, is methyl. Certain preferred compounds (154) A compound according to (1 ), wherein either:

(a) -R ¹ and -R ² taken together form a group ^* -CH ₂ -CH(CH ₂ CH ₃ )-CH=#, where

^* indicates the carbon to which -R ¹ is attached and

# indicates the carbon to which -R ² is attached;

-R ³ and -R ⁴ taken together with the carbon atom to which they are bonded, form an ethyl-substituted cyclopropyl group (i.e., 2-ethylcyclopropyl);

or (b) -R ¹ is (Z)-pent-2-enyl;

-R ² is -H;

-R ³ is -H; and

-R ⁴ is methyl, ethyl, / ^' -propyl, n-propyl, /-butyl, s-butyl, n-butyl, or /-butyl. (155) A compound according to (1 ), having one of the following formulae:

(156) A compound of (155), wherein the compound is of formula (lll-a), (lll-b-lle), (lll-b- Val) or (lll-b-Leu). (157) A compound of (155), wherein the compound is of formula (lll-a), (lll-b-lle) or (lll-b-Val).

(158) A compound of (155), wherein the compound is of formula (lll-a) or (lll-b-lle). (159) A compound according to any one of (154) to (158), wherein -X is -OH, or -OR°.

(160) A compound according to any one of (154) to (158), wherein X is OR°.

(161 ) A compound according to any one of (154) to (160) , wherein R° is R ^os1 , -R ^OS2 , - R ^OS3 , -L ^os -R ^OS2 , or -|_ ^os -R ^OS3 . (162) A compound according to any one of (154) to (160), wherein R° is R ^os1 , -R ^OS2 , or -

(163) A compound according to any one of (154) to (160), wherein R° is R ^os1 .

(164) A compound according to any one of (154) to (160), wherein R ^os1 is methyl, ethyl, / ^' - propyl, n-propyl, /-butyl, s-butyl, n-butyl, or i-butyl.

(165) A compound according to any one of (154) to (160), wherein R ^os1 is methyl, ethyl, / ^' - propyl, or n-propyl.

(166) A compound according to any one of (154) to (160), wherein R ^os1 is methyl, or ethyl. (167) A compound according to any one of ( 54) to (160), wherein R ^os1 is methyl.

(168) A compound according to any one of (154) to (167), wherein R ^E is H.

(169) A compound according to any one of (154) to (168), which is a compound of any one of the following formulae:

(169) A compound according to any one of (154) to (168), which is a compound of any one of the following formulae:

(170) A compound according to (169), wherein the compound is of formula (V-a-1 ) or (V-b-2). (171 ) A compound according to (169), wherein the compound is of formula (V-a-1 ) or (V-b-3).

(172) A compound according to any one of (169) to (171 ), which is a compound of one of the following formulae:

(173) A compound according to (1 ), which is a compound of the following formula:

(174) A compound according to (1 ), which is a compound of the following formula:

Such a compound can be referred to as "coronatine-methoxime".

(176) A compound according to (1 ), which is a compound of the following formula:

(177) A compound according to (1 ), which is a compound of the following formula:

Synthesis and processes for production

Processes or methods of making analog compounds of the present invention form a further aspect of the invention. These and/or other well-known methods may be modified and/or adapted in known ways in order to facilitate the synthesis of additional compounds within the scope of the present invention.

Thus in a further aspect, the present invention relates to a method of making analog compounds described herein e.g. in relation to the first aspect of the invention.

Some embodiments of the invention include:

(178) A method of making a compound, the compound being according to any one of (1 ) to (177), comprising converting the oxo (C=0) group of the pentanone ring of JA or COR, or a derivative of either (e.g., JA-lle), to a C=NX group, wherein X is as defined above.

(179) A method of making a compound according to (178), wherein the converting step comprises reacting the JA derivative (JA-lle) or COR derivative with Nh X, or a salt thereof.

(180) A method of making a compound, the compound being according to any one of (1 ) to (177), comprising taking a precursor of the following formula:

or a tautomer thereof;

or a pharmaceutically acceptable salt, hydrate, or solvate of the foregoing;

and converting the oxo (C=0) group of the cyclopentanone ring to a C=NX group;

wherein X, R ¹ , R ² , R ³ , R ⁴ and R ^E are as defined above.

(181 ) A method of making a compound according to (180), wherein the precursor has the following formula:

(182) A method of making a compound according to (180), wherein the precursor has the following formula:

(183) A method of making a compound according to any one of (180) to (182), wherein the converting step comprises reacting the precursor with Nh X, or a salt thereof.

COR and JA precursors are available from commercial sources, or can be produced using methods known in the art. Methods for obtaining separate stereoisomers of JA-lle can be found in the published literature (e.g., Fonseca et al., 2009a; Ogawa, 2008; Suza ef a/. 2010).

The C=0 group of COR and JA derivatives/precursors (e.g., JA-lle) can be converted to the functional groups C=NX described herein using methods as described herein and known in the art.

The skilled person will be able to identify suitable solvents for the methods of (178) to (183). In some embodiments, the solvent is an aqueous solvent (e.g., a methanol water mix, e.g., 95:5 v/v). In some embodiments, the solvent is a non-aqueous solvent (e.g., dry pyridine).

In some embodiments, the compounds produced by the methods of (178) to (183) are separated into different isomers (e.g., different diastereomers). For example, the compounds produced by the methods of (178) to (183) may be separated into separate stereoisomers using methods known in the art (e.g., HPLC: see Fonseca et al 2009a).

_*****

In a further aspect of the invention there is provided a method for inhibiting a JA-related agonist mediated biological response in a plant or seed, which process comprises applying to the plant or seed a compound which is an analog of the agonist which competitively inhibits the binding of the agonist to the COIVJAZ co-receptor, and thereby modulating the biological response.

The agonist may be JA-lle (for example (+)7-iso-JA-lle) or COR, or other JA-related agonist of the COIVJAZ co-receptor.

The ability of the analog to modulate the relevant biological response can be readily confirmed by those skilled in the art for example based on the common general knowledge , or assays described herein.

Where the JA-related agonist mediated biological response is itself an inhibition compared to the control, then the use of the analog will counteract that inhibition, and thereby 'enhance' or 'restore' the response towards control levels. For example root growth assays can be performed by treating multiple (e.g. 40) seedlings after treatment with an appropriate medium (e.g. Johnson medium) in the presence or absence of the analog and agonist mix (e.g. in a ratio of between 2:1 to 100:1 , or 1 :5 to 100:1 , with analog:agonist) between and then comparing root length after a period of time (e.g. 10 days) e.g. using suitable image processing software.

In certain embodiments of the invention the inhibition by the analog of the agonist's effect vs. control may be up to, equal to, or more than, 10, 20, 30, 40, 50, 60, 70, 80, 90, 95%, 99% or 100%. For example whereas the presence of COR 0.15 μΜ may reduce average root length in control medium from 30mm to 10mm, the presence of COR-MO 10 μΜ may entirely restore this to control levels (virtually 100% inhibition of the agonist, within experimental error). In certain embodiments of the invention, the concentration of analog required to inhibit the effect of 10 μΜ JA-lle or JA by 50% in the assay may be between 0.1 and 100 e.g. 1 to 1000 μΜ. An example of the inhibition of a response which is otherwise enhanced by the JA-related agonist is anthocyanin accumulation, which can be quantified by known methods e.g. as in Swain and Hillis (1959).

Preferably binding of the analog compound to the COIVJAZ co-receptor spatially

(sterically) impedes the COIVJAZ co-receptor interaction, with the result that the normal biological activity of the agonist\COI\JAZ co-receptor interaction is inhibited.

For example whereas wherein binding of the agonist to the COIVJAZ co-receptor normally leads to ubiquitination and degradation of JAZ repressors, and de-repression of JA mediated genes, the presence of the analog compound inhibits this process thereby inhibiting ubiquitination and degradation of the JAZ repressors.

This in turn inhibits de-repression of JA mediated genes, which would otherwise arise from the degradation of the JAZ repressors, with the result that the properties of the treated organism is modified. The methods of the invention may be used to modify the characteristics in the plant, seed, or plant grown from the seed.

In particular the methods may be used to modify characteristics governed or affected (or effected) by JA mediated gene expression, and more specifically to inhibit said gene expression and the resulting phenotype.

For example the methods may be used to modify one or more of the following

characteristics of the plant: anthocyanin accumulation; gamete development; trichome formation; root growth; fruit ripening; senescence and\or cell cycle regulation; lateral root and root-hair density; adventitious root formation; flower filament elongation; anther dehiscence; tendril coiling; nicotine biosynthesis; terpenoid indole alkaloid (TIA) synthesis such as Vinblastine; biosynthesis of the antimalarial sesquiterpene lactone artemisinin; production of defence related secondary metabolites such as glucosinolates and camalexin;

One JA mediated response is modulation of pollen fertility. The methods of the invention can be used to counteract this modulation. As noted above one JA mediated response is anthocyanin accumulation. The methods of the invention can be used to modulate anthocyanin levels in plant.

More specifically, any of the methods, processes or uses of the present invention may have as their purpose one or more of the following:

• Inhibition or reduction of gamete development and pollen germination; trichome formation; fruit ripening; senescence, Lateral root and root-hair density, adventitious root development, anthocyanin accumulation and production of secondary metabolites.

• Promotion (or counteraction of inhibition of) plant growth (root and rosette); cell cycle progression.

One preferred function is to improve or enhance root growth.

As discussed above, one well established JA mediated response is inhibition of certain pathogen-defence pathways in the plant host, for example the SA-mediated defences against bacteria. Thus the methods may be used to improve disease resistance against biotrophic or hemibiotrophic pathogens, where such resistance is governed by such defences.

Examples of biotrophic or hemibiotrophic pathogens include Pseudomonas sp,

Xanthomonas sp, Hyaloperonospora sp, Erisyphe sp, Magnaporthe sp. Many other such examples are well known in the art.

To the extent that a JA mediated response in a plant is a desirable one, it will be appreciated that the use of the present invention may disadvantage the plant in one or more respects of phenotypes relating to that response. Nevertheless those skilled in the art will be able to select situations where the benefits (for example increased resistance to biotrophic or hemibiotrophic pathogens from which the plant is at risk) will outweigh any possible negative consequence for the plant (e.g. compromised resistance to

necrotrophs). Thus the present invention provides a novel tool for these purposes, and is therefore a useful contribution to the art.

Combination treatments As noted above, JA-pathway antagonist molecules such as those provided herein can be useful to reduce or prevent infection by biotrophic or hemibiotrophic pathogens, since reduction of JA-responses can potentiate SA-dependent defences.

In one embodiment, the analog compounds are used in combination with SA or SA- analogs e.g. BTH (Gorlach et al., 1996; Vallad and Goodman, 2004). This combinatorial can be expected to have an additive effect since it will simultaneously potentiate SA activity and prevent any repression of this pathway by blocking the JA response. Other SA analogs include INA (2,6-dichloroisonicotinic acid) and β-aminobutyric acid (BABA), which is a functional analog of salicylic acid

Use of the compounds

In one embodiment the analog compound is applied to only one or more tissues or parts of the plant. This permits inhibition of the JA mediated response in these tissues or parts only.

For instance, treated plants may become susceptible to soil-borne microorganisms, which in many cases are not even pathogenic for WT plants (Adie et al., 2007). If desired, the compound may therefore be applied only to crop leaves or stems, thereby not affecting the affect JA-sensitivity of the roots, while still enhancing resistance against foliar pathogens such as P.syringae.

In one embodiment the analog compound is applied only during one or more

developmental stages of the plant or seed. This permits inhibition of the JA mediated response during these stages only, without compromising the whole JA response of the plant in other tissues or stages.

Preferred analog compounds of the invention are stable in the environment and on the plant or seed, with the result that their inhibitory effect persists for a period of time which will depend on the rate they are lost from the plant (e.g. through washing out or other elimination).

Preferably the inhibition persists for at least about 1 , 2, 3, 4, 5, 6, 7 days, or at least (or up to) about 2, 3, 4, 5, 6, 7, 8, 9, or 10 weeks. Thus treatments of the present invention can be tissue-specific and transient (tissue- controlled and\or time-controlled). This has the advantage of reducing any time- and\or tissue- window of weakness or exposition to antagonist pathogens. ^*****

The analog or antagonist compounds employed in the methods of the invention, or discussed in relation to any other aspect of claim, are preferably "specific" inhibitors of the COIVJAZ co-receptor-agonist interaction. In particular they will not affect the interaction between auxin and its receptor. This can be verified by those skilled in the art e.g. by assessing the effect of the compound on the TIR1 and IAA7 interaction. A suitable example assay is described below, in which the effect of the compound on the interaction between Myc-tagged TIR1 and IAA7-GST is assessed using e.g. a 'pull-down' reaction. Another method for verifying specificity is by confirming the compound does not induce or decrease auxin-induced gene expression e.g. by assessing auxin-induced expression from a DR5:GUS construct in the roots transgenic plants.

_*****

In general terms analog compounds may be those which are, or are related to, JA-lle and COR derivatives where the "oxo" group (C=0) of the cyclopentanone ring (which is normally exposed outside of the binding pocket of COM ) is covalently modified to a stable group which sterically interferes with JAZ proteins which would otherwise interact with the agonist\COI 1 , with the result that the analog compound attenuates the JA-related agonist responsiveness of the plant.

It will be appreciated by those skilled in the art, that further additional modifications to the COR or JA structures, for example to increase its affinity to the COM protein, will also therefore enhance the compounds antagonistic activity, and such further modifications are expressly included in the present invention.

As noted above, preferably binding of the analog compound to the COIVJAZ co-receptor spatially (sterically) impedes the COIVJAZ co-receptor interaction, with the result that the normal biological activity of the agonist\COI\JAZ co-receptor interaction is inhibited.

Confirmation that the analog inhibits the COIVJAZ co-receptor interaction can be established by those skilled in the art in the light of the present disclosure. For example the analog can be shown to inhibit the COR or JA-lle dependent COI 1/JAZ9 interaction by use of 'pull down' reaction in which recombinant JAZ9-MBP and COR are used to pull down FLAG-tagged COM , which interaction can be detected immunologically. The presence of the analog can be shown to competitively inhibit this interaction.

As noted above, binding of the agonist to the COIVJAZ co-receptor normally leads to ubiquitination and degradation of JAZ repressors, and de-repression of JA mediated genes, the presence of the analog compound inhibits this process thereby inhibiting ubiquitination and degradation of the JAZ repressors. This in turn inhibits de-repression of JA mediated genes, which would otherwise arise from the degradation of the JAZ repressors, with the result that the properties of the treated organism is modified.

Confirmation that the analog inhibits the ubiquitination and degradation of the JAZ repressors can be established by those skilled in the art in the light of the present disclosure. For example the analog can be shown to inhibit degradation of JAZ1-GUS, JAZ9-GUS and JAZ10-GUS expressed in transgenic plants.

Confirmation that the analog inhibits the derepression of JA mediated genes otherwise arising from the degradation of the JAZ repressors can be established by those skilled in the art in the light of the present disclosure, for example by microarray analysis of the type exemplified in Figure 13B. Specific genes can also be assessed using reporter systems. For example the expression of the JA hormone-induced gene pJAZ2 can be assessed using a pJAZ2-GUS reporter construct expressed in a transgenic plant line carrying this construct and staining for GUS.

Preferred analog compounds for use in the methods of the invention are any of those of the first aspect. A most preferred analog compound is coronatine-methoxime.

Compositions of the invention

In one aspect the invention provides a plant or seed treatment composition comprising as an active ingredient (treatment agent) one of the analog compounds described herein.

Plant (including tree) or seed treatment compositions made be formulated and utilised using methods well known in the art. For example, as described in WO2003001910, the active compound or agent may be formulated for use in a mixture with one or more plant- compatible surfactants, to provide solid or liquid (including a suspension of a solid in a liquid phase) formulations. A plant-compatible surfactant causes little or no damage to plants. Surfactants of the invention can be nonionic, anionic, cationic, or zwitterionic surfactants. A surfactant can be present in a composition of the invention as formulated or, alternatively, a surfactant can be introduced to the compositions of the invention during application to the plant or tree. Preferably, a surfactant is Kinetic® (Setre Chemical Co., Memphis, TN), Silwet L-77® (polyalkylene oxide modified heptamethyl trisiloxane) (OSi Specialties, Danbury CT), or Tween® 20 (Sigma- Aldrich, St. Louis MO). Preferably, a surfactant used at a final concentration of about 1 .0 to 0.01 % (volume by volume). More preferably, a surfactant is used at a final concentration of about 0.5 to 0.05 %. Even more preferably, a surfactant is used at a final concentration of about 0.125%.

The compositions can be applied in a mixture with a carrier, or optionally, other auxiliary agents from any one of the standard types of preparations commonly used in agriculture, for example, a dry blend, granules, a wettable powder, an emulsion, and an aqueous solution. Suitable carriers for solid formulations include clay, talc, kaolin, bentonite, terra alba, calcium carbonate, diatomaceous earth, silica, synthetic calcium silicate, eselguhr, dolomite, powdered magnesia, Fuller's earth, gypsum and the like. Solid compositions can be in the form of dispersible powders or grains, comprising, in addition to the active agent, a surfactant to facilitate the dispersion of the powder or grains in liquid. Granular compositions can be prepared by, for example, impregnating the agent onto or into granulated carriers such as attapulgites or vermiculites, or granulated solid fertilizers.

Liquid forms of the compositions of the invention, which are used for example, for spraying on plants as aerosols or mists, are prepared for application by admixing the agent, surfactant, if used, and a liquid carrier, such as water or other liquid (e.g. a nonaqueous solvent, suitably an alcohol, for example ethanol) to form a stable emulsion or suspension. Liquid compositions of the invention include solutions, dispersions, or emulsions containing the agent and optionally, one or more surface-active agents such as wetting agents, dispersing agents, emulsifying agents, or suspending agents.

The compositions of the invention can also be used in plant-substantive formulations. Plant substantive formulations mechanically or chemically adhere to a plant and resist removal. Preferred plant substantive agents include various waxes and paraffins, polymers, and sulfur. Wax coated compositions can be prepared by dispersing the agent in molten wax, forming the dispersion into small particles, and cooling the composition below the melting point of the wax. The water resistance of the particles can be controlled by increasing or decreasing the amount of wax employed so as to provide proper release for climatic conditions, i.e., wet areas or dry areas. Additionally, various additives can be dissolved in the wax phase in order to improve the water resistance of the composition or effect other benefits such as slow-release additives or anticaking agents. Other plant- substantive agents include casein, salts of alginic acids, cellulose gums and their derivatives, polyvinyl pyrrolidone, vegetable gums, propylene glycol, invert syrup, corn syrup, and the like.

As used herein the term "seed treatment composition" includes seed coating and seed soak compositions. Suitably, the seed treatment composition comprises a seed soak. If applied as a powder the treatment composition may comprise a sticking agent. If applied; as a slurry the slurry may comprise either a wettable powder, water dispersible powder or a micro encapsulation/ capsule suspensions. If applied as a liquid then a concentrate may require dilution before application to the seed.

Suitably, the treatment composition comprises treatment agent at a concentration of at least 1 , 5, or 10μΜ, for example of 1 to 50 μΜ or 1 to 100 μΜ. However compositions of 1 mM or more may be used or prepared for dilution. Thus the treatment composition may comprise treatment agent at a concentration of between 1 μΜ, and 50mM, suitably of between 0.01 mM and 15mM, for example of between 1 mM and 5mM. The treatment composition may comprise treatment agent in an amount of up to 10mM. The treatment composition may comprise treatment agent in an amount of at least 1 , 5, or 10μΜ , for example at least: 0.1 mM; 0.5mM; 1.0mM; 1 .5mM; 2.0mM; 2.5mM; 3.0mM; 3.5mM; 4.0mM; 4.5mM; 5.0mM; 6.0mM; 7.0mM; 8.0mM; 9.0mM; or 10mM. The treatment composition may comprise treatment agent in an amount of no greater than 15mM, for example no greater than: 14mM, 13mM, 12.5mM, 12.0mM, 1 1.5mM, 1 1 .0mM, 10.5mM, "l O.OmM, 9.5mM, 9.0mM, 8.0mM, 7.0mM or 6.0mM. The treatment composition may comprise a non-aqueous solvent, suitably an alcohol, in a concentration of at least 1 mM. The treatment composition may comprise a non- aqueous solvent, suitably an alcohol, in a concentration of between 1 mM and 100mM, suitably between 10mM and 100mM, for example between 30mM and 50mM. The treatment composition may be applied as a dust, powder, slurry or vapour.

Treated plants

In another aspect of the present invention there is provided a seed or plant obtained by treating the seed or plant with an analog compound of the invention, or composition of the invention, or using a method of the invention. Preferably the treated seed or plant is the direct product of a process, which process is a method of the invention described above.

Such a treated seed or plant will have - at least transiently - at least one modified characteristic as described above in relation to the methods of the invention e.g. in relation to gamete development; trichome formation; root growth; fruit ripening;

senescence and\or cell cycle regulation.

Uses of compounds and compositions (in methods)

In another aspect of the present invention there is provided use of analog compound as described herein to inhibit a JA-mediated response in an organism.

The use may be in a method of the invention as described above.

The use may have the purpose of spatially (sterically) impeding the COIVJAZ co-receptor interaction, with the result that the normal biological activity of the agonist\COI\JAZ co- receptor interaction is inhibited, as described above. The use may have the purpose of inhibiting ubiquitination and degradation of JAZ repressors, as described above.

The use may have the purpose of inhibiting de-repression of JA mediated genes which would otherwise arise from the degradation of the JAZ repressors, with the result that the properties of the treated organism is modified, as described above.

The use may have the purpose of modifying at least one characteristic as described above in relation to the methods of the invention e.g. in relation to gamete development; trichome formation; root growth; fruit ripening; senescence and\or cell cycle regulation; or response or resistance to an abiotic (e.g. drought, salt, ozone exposure etc.) and wounding or biotic stress etc. The use may have the purpose of modifying this characteristic in a tissue-specific or transient manner as explained above. Definitions

The term "C _x-y alkyl", as used herein pertains to a monovalent moiety obtained by removing a hydrogen atom from a carbon atom of an unsaturated hydrocarbon compound having from x to y carbon atoms. Unless specified otherwise, the term covers both linear and branched hydrocarbon chains.

The term "C _x-y alkylene", as used herein, pertains to a bidentate moiety obtained by removing two hydrogen atoms, either both from the same carbon atom, or one from each of two different carbon atoms, or a saturated hydrocarbon compound having from to y carbon atoms. Unless specified otherwise, the term covers both linear and branched hydrocarbon chains. The term "C _x - _y cycloalkyl" as used herein pertains to an alkyl group which is also a cyclyl group; that is, a monovalent moiety obtained by removing a hydrogen atom from an alicyclic ring atom of a cyclic hydrocarbon (carbocyclic) compound, which moiety has from x to y carbon atoms, including from x to y ring atoms. The term "C _x - _y heterocyclyl" as used herein pertains to a monovalent moiety obtained by removing a hydrogen atom from a ring atom of a heterocylic compound, which moiety has from x to y ring atoms.

The term "C _x-y aryl" as used herein pertains to a monovalent moiety obtained by removing a hydrogen atom from an aromatic ring atom of an aromatic compound, which moiety has from x to y ring atoms.

The term "C _x-y heteroaryl" as used herein pertains to a monovalent moiety obtained by removing a hydrogen atom from an aromatic ring atom of an heteroaromatic compound, which moiety has from x to y ring atoms.

For the avoidance of doubt, the index "C _x-y " in terms such as "Cs-ioheteroaryl",

"C3-7heterocyclyl", and the like, refers to the number of ring atoms, which may be carbon atoms or heteroatoms {e.g., N, O, S). For example, pyridyl is an example of a

Ceheteroaryl group, and piperidino is an example of a Ceheterocyclyl group.

The term "heteroaryl" refers to a group that is attached to the rest of the molecule by an atom that is part of an aromatic ring, wherein the aromatic ring is part of an aromatic ring system, and the aromatic ring system has one or more heteroatoms {e.g., N, O, S). For example, pyridyl is an example of a Ceheteroaryl group, and quinolyl is an example of a Cioheteroaryl group.

The term "heterocyclyl" refers to a group that is attached to the rest of the molecule by a ring atom that is not part of an aromatic ring {i.e., the ring is partially or fully saturated), and the ring contains one or more heteroatoms {e.g., N, O, S). For example, piperidino is an example of a Ceheterocyclyl group. Combinations

It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the chemical groups represented by the variables {e.g., -X, -R ^c , -R°, -R ^NA , -R ^NB , -NR ^NC R ^ND , - R ^CS1 , -R ^CS2 , -L ^cs -, -R ^os1 , -R ^OS2 , -R ^OS3 , -R ^OS4 , -L ^os -, -R ^NS1 , -R ^NS2 , -R ^NS3 , -R ^NS4 , -L ^NS -, -R ^E , -R ^ES1 , -R ^ES2 , -R ^ES3 , -L ^ES -, -R ^M1 , -R ^M2 , -R ^M3 , -L ^ES -, -R' etc.) are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed, to the extent that such combinations embrace compounds that are stable compounds (i.e., compounds that can be isolated,

characterised, and tested for biological activity).

In addition, all sub-combinations of the chemical groups listed in the embodiments describing such variables are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination of chemical groups was individually and explicitly disclosed herein.

Substantially Purified Forms

One aspect of the present invention pertains to compounds, as described herein, in substantially purified form and/or in a form substantially free from contaminants.

In one embodiment, the substantially purified form is at least 50% by weight, e.g., at least 60% by weight, e.g., at least 70% by weight, e.g., at least 80% by weight, e.g., at least 90% by weight, e.g., at least 95% by weight, e.g., at least 97% by weight, e.g., at least 98% by weight, e.g., at least 99% by weight.

Unless specified, the substantially purified form refers to the compound in any

stereoisomeric or enantiomeric form. For example, in one embodiment, the substantially purified form refers to a mixture of stereoisomers, i.e., purified with respect to other compounds. In one embodiment, the substantially purified form refers to one

stereoisomer, e.g., optically pure stereoisomer. In one embodiment, the substantially purified form refers to a mixture of enantiomers. In one embodiment, the substantially purified form refers to an equimolar mixture of enantiomers (i.e., a racemic mixture, a racemate). In one embodiment, the substantially purified form refers to one enantiomer, e.g., optically pure enantiomer.

In one embodiment, the contaminants represent no more than 50% by weight, e.g., no more than 40% by weight, e.g., no more than 30% by weight, e.g., no more than 20% by weight, e.g., no more than 10% by weight, e.g., no more than 5% by weight, e.g., no more than 3% by weight, e.g., no more than 2% by weight, e.g., no more than 1 % by weight.

Unless specified, the contaminants refer to other compounds, that is, other than stereoisomers or enantiomers. In one embodiment, the contaminants refer to other compounds and other stereoisomers. In one embodiment, the contaminants refer to other compounds and the other enantiomer.

In one embodiment, the substantially purified form is at least 60% optically pure (i.e., 60% of the compound, on a molar basis, is the desired stereoisomer or enantiomer, and 40% is the undesired stereoisomer(s) or enantiomer), e.g., at least 70% optically pure, e.g., at least 80% optically pure, e.g., at least 90% optically pure, e.g., at least 95% optically pure, e.g., at least 97% optically pure, e.g., at least 98% optically pure, e.g., at least 99% optically pure.

Isomers

Certain compounds may exist in one or more particular geometric, optical, enantiomeric, diastereoisomeric, epimeric, atropic, stereoisomeric, tautomeric, conformational, or anomeric forms, including but not limited to, cis- and trans-forms; E- and Z-forms; c-, t-, and r- forms; endo- and exo-forms; R-, S-, and meso-forms; D- and L-forms; d- and l-forms; (+) and (-) forms; keto-, enol-, and enolate-forms; syn- and anti-forms; synclinal- and anticlinal-forms; a- and β-forms; axial and equatorial forms; boat-, chair-, twist-, envelope-, and halfchair-forms; and combinations thereof, hereinafter collectively referred to as "isomers" (or "isomeric forms").

A reference to a class of structures may well include structurally isomeric forms falling within that class (e.g., Ci-ioalkyl includes n-propyl and iso-propyl; butyl includes n-, iso-, sec-, and tert-butyl; methoxyphenyl includes ortho-, meta-, and para-methoxyphenyl).

However, reference to a specific group or substitution pattern is not intended to include other structural (or constitutional isomers) which differ with respect to the connections between atoms rather than by positions in space. For example, a reference to a methoxy group, -OCH3, is not to be construed as a reference to its structural isomer, a

hydroxymethyl group, -CH2OH. Similarly, a reference to ortho-chlorophenyl is not to be construed as a reference to its structural isomer, meta-chlorophenyl.

The above exclusion does not pertain to tautomeric forms, for example, keto-, enol-, and enolate-forms, as in, for example, the following tautomeric pairs: keto/enol (illustrated below), imine/enamine, amide/imino alcohol, amidine/amidine, nitroso/oxime, thioketone/enethiol, N-nitroso/hydroxyazo, and nitro/aci-nitro. ,0 \ OH - H ⁺ o-

— c-c — C=C — ^C=C

I \ / \ _H+ / \

keto enol enolate Note that specifically included in the term "isomer" are compounds with one or more isotopic substitutions. For example, H may be in any isotopic form, including ¹ H, ² H (D), and ³ H (T); C may be in any isotopic form, including ¹² C, ¹³ C, and ¹⁴ C; O may be in any isotopic form, including ¹⁶ 0 and ¹⁸ 0; and the like. Unless otherwise specified, a reference to a particular compound includes all such isomeric forms, including mixtures {e.g., racemic mixtures) thereof. Methods for the preparation (e.g., asymmetric synthesis) and separation (e.g., fractional crystallisation and chromatographic means) of such isomeric forms are either known in the art or are readily obtained by adapting the methods taught herein, or known methods, in a known manner.

Salts

It may be convenient or desirable to prepare, purify, and/or handle a corresponding salt of the compound. For example, if the compound is anionic, or has a functional group which may be anionic (e.g., -COOH may be -COO ^" ), then a salt may be formed with a suitable cation. Examples of suitable inorganic cations include, but are not limited to, alkali metal ions such as Na ⁺ and K ⁺ , alkaline earth cations such as Ca ²⁺ and Mg ²⁺ , and other cations such as Al ³⁺ . Examples of suitable organic cations include, but are not limited to, ammonium ion (i.e., NhV) and substituted ammonium ions (e.g., Nh F , NhbF , NHFV, NFV). Examples of some suitable substituted ammonium ions are those derived from: ethylamine, diethylamine, dicyclohexylamine, triethylamine, butylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, benzylamine, phenylbenzylamine, choline, meglumine, and tromethamine, as well as amino acids, such as lysine and arginine. An example of a common quaternary ammonium ion is N(CH3)4 ⁺ .

If the compound is cationic, or has a functional group which may be cationic (e.g., -Nhb may be -Nh ), then a salt may be formed with a suitable anion. Examples of suitable inorganic anions include, but are not limited to, those derived from the following inorganic acids: hydrochloric, hydrobromic, hydroiodic, sulfuric, sulfurous, nitric, nitrous,

phosphoric, and phosphorous. Examples of suitable organic anions include, but are not limited to, those derived from the following organic acids: 2-acetyoxybenzoic, acetic, ascorbic, aspartic, benzoic, camphorsulfonic, cinnamic, citric, edetic, ethanedisulfonic, ethanesulfonic, fumaric, glucheptonic, gluconic, glutamic, glycolic, hydroxymaleic, hydroxynaphthalene carboxylic, isethionic, lactic, lactobionic, lauric, maleic, malic, methanesulfonic, mucic, oleic, oxalic, palmitic, pamoic, pantothenic, phenylacetic, phenylsulfonic, propionic, pyruvic, salicylic, stearic, succinic, sulfanilic, tartaric, toluenesulfonic, and valeric. Examples of suitable polymeric organic anions include, but are not limited to, those derived from the following polymeric acids: tannic acid, carboxymethyl cellulose.

Unless otherwise specified, a reference to a particular compound also includes salt forms thereof.

Solvates and Hydrates

It may be convenient or desirable to prepare, purify, and/or handle a corresponding solvate of the compound. The term "solvate" is used herein in the conventional sense to refer to a complex of solute (e.g., compound, salt of compound) and solvent. If the solvent is water, the solvate may be conveniently referred to as a hydrate, for example, a mono-hydrate, a di-hydrate, a tri-hydrate, etc.

Unless otherwise specified, a reference to a particular compound also includes solvate and hydrate forms thereof.

Chemically Protected Forms

It may be convenient or desirable to prepare, purify, and/or handle the compound in a chemically protected form. The term "chemically protected form" is used herein in the conventional chemical sense and pertains to a compound in which one or more reactive functional groups are protected from undesirable chemical reactions under specified conditions {e.g., pH, temperature, radiation, solvent, and the like). In practice, well known chemical methods are employed to reversibly render unreactive a functional group, which otherwise would be reactive, under specified conditions. In a chemically protected form, one or more reactive functional groups are in the form of a protected or protecting group (also known as a masked or masking group or a blocked or blocking group). By protecting a reactive functional group, reactions involving other unprotected reactive functional groups can be performed, without affecting the protected group; the protecting group may be removed, usually in a subsequent step, without substantially affecting the remainder of the molecule. See, for example, Protective Groups in Organic Synthesis (T. Green and P. Wuts; 4th Edition; John Wiley and Sons, 2006).

A wide variety of such "protecting," "blocking," or "masking" methods are widely used and well known in organic synthesis. For example, a compound which has two nonequivalent reactive functional groups, both of which would be reactive under specified conditions, may be derivatized to render one of the functional groups "protected," and therefore unreactive, under the specified conditions; so protected, the compound may be used as a reactant which has effectively only one reactive functional group. After the desired reaction (involving the other functional group) is complete, the protected group may be "deprotected" to return it to its original functionality.

For example, a hydroxy group may be protected as an ether (-OR) or an ester

(-OC(=0)R), for example, as: a t-butyl ether; a benzyl, benzhydryl (diphenylmethyl), or trityl (triphenylmethyl) ether; a trimethylsilyl or t-butyldimethylsilyl ether; or an acetyl ester (-OC(=0)CH ₃ , -OAc).

For example, an aldehyde or ketone group may be protected as an acetal (R-CH(OR)2) or ketal (R2C(OR)2), respectively, in which the carbonyl group (>C=0) is converted to a diether (>C(OR)2), by reaction with, for example, a primary alcohol. The aldehyde or ketone group is readily regenerated by hydrolysis using a large excess of water in the presence of acid.

For example, an amine group may be protected, for example, as an amide (-NRCO-R) or a urethane (-NRCO-OR), for example, as: a methyl amide (-NHCO-CH3); a

benzyloxycarbonyl amide (-NHCO-OCH2C6H5, -NH-Cbz); as a t-butoxycarbonyl amine (-NHCO-OC(CH ₃ ) ₃ , -NH-Boc); a 2-biphenyl-2-propoxycarbonyl amine (-NHCO-OC(CH ₃ )2C6H4C6H ₅ , -NH-Bpoc), as a 9-fluorenylmethoxycarbonyl amine

(-NH-Fmoc), as a 6-nitroveratryloxycarbonyl amine (-NH-Nvoc), as a

2-trimethylsilylethyloxycarbonyl amine (-NH-Teoc), as a 2,2,2-trichloroethyloxycarbonyl amine (-NH-Troc), as an allyloxycarbonyl amine (-NH-Alloc), as a

2(-phenylsulfonyl)ethyloxycarbonyl amine (-NH-Psec); or, in suitable cases {e.g., cyclic amines), as a nitroxide radical (>Ν-0·).

For example, a carboxylic acid group may be protected as an ester for example, as: a Ci-7alkyl ester {e.g., a methyl ester; a t-butyl ester); a Ci-7haloalkyl ester {e.g., a

Ci-7trihaloalkyl ester); a triCi-7alkylsilyl-Ci-7alkyl ester; or a C5-2oaryl-Ci-7alkyl ester {e.g., a benzyl ester; a nitrobenzyl ester); or as an amide, for example, as a methyl amide.

For example, a thiol group may be protected as a thioether (-SR), for example, as: a benzyl thioether; an acetamidomethyl ether (-S-CH2NHC(=0)CH3).

_*****

Throughout this specification, including the claims which follow, unless the context requires otherwise, the word "comprise," and variations such as "comprises" and

"comprising," will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

It must be noted that, as used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a pharmaceutical carrier" includes mixtures of two or more such carriers, and the like.

Ranges are often expressed herein as from "about" one particular value, and/or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent "about," it will be understood that the particular value forms another embodiment. This disclosure includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art. Any sub-titles herein are included for convenience only, and are not to be construed as limiting the disclosure in any way.

The invention will now be further described with reference to the following non-limiting Figures and Examples. Other embodiments of the invention will occur to those skilled in the art in the light of these. The disclosure of all references cited herein, inasmuch as it may be used by those skilled in the art to carry out the invention, is hereby specifically incorporated herein by cross- reference. Figures

Figure 1 : COR-MO and JAIIe-MO prevent JA and COR-dependent JAZ1 GUS degradation

Figure 2: COR-MO and JAIIe-MO prevents JA and COR-dependent pJAZ2:GUS gene expression.

Figure 3: COR-MO reduces root growth inhibition and anthocyanin accumulation in the presence of COR. Figure 4: COR-MO reduces COI 1-FLAG/JAZ9-MBP interaction in pull-down assays.

Figure 5: A) COR-MO does not interfere with TIR1 -myc/IAA7-GST interaction in pulldown assays. B) COR-MO does not induce DR5GUS nor prevents IAA-dependent DR5GUS induction.

Figure 6: A) & C) COR-MO reduces bacterial growth upon Pst DC3000 spray infection in Arabidopsis and tomato, but does not affect Pst DC31 18 growth. B) COR-MO reduces the symptoms induced after infiltration with Pst DC3000. Figure 7: A) Molecular model of the perception of COR by the co-receptor COM (pink) and JAZ degron (yellow, red and blue) after Sheard et al., 2010. B) Molecular model for the action of COR-MO by docking calculation. COR-MO prevents JAZ binding for sterical reasons. Figure 8: Low concentrations of COR-MO reduce root growth inhibition and anthocyanin accumulation in the presence of JA or COR

Figure 9: A) JAIIe-MO partially reduces root growth inhibition and anthocyanin

accumulation in the presence of JA. B) Low concentrations of JA-lle-MO fail to reduce anthocyanin accumulation induced after 48h treatment with JA 50 μΜ.

Figure 10: Effect of COR-MO on COR-dependent root growth inhibition and anthocyanin accumulation. (A) Quantification of anthocyanin accumulation of 10-day-old WT seedlings grown on different combinations of coronatine (0, 0.5 and 1 μΜ) and COR-MO (0, 0.2, 0.4, 0.8, 1 .5 and 3 μΜ). Anthocyanin of four pools of 10 seedlings were measured for every point. (B) Representation of root growth inhibition of 10-day-old WT seedlings grown on COR 1 μΜ plus different concentrations of COR-MO, as in (A). (n=40-45). Results shown are the mean ± s.d. (see methods). This experiment was repeated 4 times with similar results. (C) Quantification of anthocyanin accumulation of 10-day-old A.Thaliana WT seedlings grown in different concentrations of COR with or without COR- MO. Four pools of 10 seedlings were measured for every point. Results shown are the mean ± s.d. This experiment was repeated 4 times with similar results. IC50 values are described below

Figure 1 1 : Effect of COR-MO on COI 1/JAZ interaction in pull-down assays.

Quantification using ImageJ of protein bands from immunoblot (anti-FLAG antibody) of recovered COM -FLAG (from 35S:COI 1-FLAG plant extracts) after pull-down reactions using recombinant JAZ9-MBP protein alone, or with different combinations of COR and COR-MO. This experiment was repeated 5 times with similar results. Results shown are the mean ± s.d. of three independent measurements. IC50 values are described below.

Figure 12: COR-MO prevents the COR-mediated degradation of JAZ1 , JAZ9 and JAZ10 in planta. Quantification of GUS activity in roots of 7-day-old transgenic A. thaliana 35S:JAZ1-GUS, 35S:JAZ9-GUS and 35S:JAZ10-GUS. Seedlings were pretreated with the indicated concentrations of COR-MO for 1 h and then treated with COR 50 nM for another hour. (n=15). Results shown are the mean ± s.d. of seven replicates (see methods).

Figure 13: COR-MO and JA-lle-MO prevent JA- and COR-dependent gene expression in planta. (A) Percentage of JA-regulated genes (Induced or Repressed) among those differentially expressed in the transcriptomic comparison of COR vs COR+COR-MO. Expected: genes expected to be induced or repressed by JA considering the whole genome data of JA treatments (0.5, 1 and 3h) in BAR (http://bar.utoronto.ca). Down by COR-MO: % of genes induced or repressed by JA within the list of genes downregulated by the COR-MO treatment (COR vs COR+COR-MO). Up by COR-MO: % of genes induced or repressed by JA within the list of genes upregulated by the COR-MO treatment (COR vs COR+COR-MO). (B) Regulation by JA of genes down-regulated (left) and up-regulated (right) by COR-MO in the transcriptomic profiling of seedlings treated with COR vs seedlings treated with COR+COR-MO. Right panel shows the JA regulation (BAR data; http://bar.utoronto.ca) of the 57 genes up-regulated by COR-MO using the criteria of FoldChange>=2 or <= -2 and FDR<0.05. Left panel shows the JA regulation (BAR data) of 1 15 genes down-regulated by COR-MO using a more stringent criteria to reduce the total number (FoldChange>=3 or <= -3 and FDR<0.05).

Figure 14: Effect of COR-MO on the infection by the necrotrophic pathogen Botrytis cinerea. (A) Quantification of symptoms 4 days after inoculation of A. thaliana WT plants with Botrytis cinerea (5x10 ⁵ spores/ml). COR-MO (10 μΜ) was included in the spores suspension when indicated. Symptoms were divided in three stages depending on the size of the necrotic lesion (1 :<10 mm ² , 2:10-20 mm ² or 3:>20 mm ² ). (n=42-47 leaves; this experiment was repeated twice with similar results) (B) Determination of B. cinerea spore number 4 days after inoculation of A. thaliana WT plants. 15 leaves from 5 different plants were pooled; 3 pools per treatment were measured. This experiment was repeated twice with similar results.

Figure 15: Bacterial growth on Nicotiana benthamiana leaves (infiltrated with COR-MO 24 h before inoculation) 2 and 3 days after spray inoculation with Pst DC3000 at 10 ⁸ colony-forming units per ml (OD6oo=0.2). (n=8 samples, each from 2 different plants; this experiment was repeated twice with similar results). Bacterial counts are expressed as log (colony-forming units/cm ² ). Error bars indicate SE.

Figure 16: COR-MO reduces fungal infection in rice. Rice variety was cv C039 (indica variety); pathogen was Magnaporthe Oryzae isolate Guy1 1 .

Examples Materials and methods

Plant material and growth conditions

Arabidopsis thaliana Columbia (Col-0) is the genetic background of wildtype and transgenic lines used throughout the work. Seeds were surface-sterilized by chlorine gas method (50 ml bleach and 3 ml HCI 37% for 3 hours) and stratified for 2-3 days at 4°C. All seedlings were grown under a 16-h light/8-h dark cycle at 21°C.

Wildtype and 35S:COI1 -FLAG seedlings were grown in Johnson media (Johnson et al., 1957), supplemented with coronatine (COR; Sigma-Aldrich), (±)-Jasmonic acid (JA; Sigma-Aldrich), JAIIe-MO or COR-MO when indicated. 35S:JAZ1 -GUS seedlings (Thines et al., 2007) were grown vertically on MS plates (Murashige and Skoog, 1962), while DR5GUS (Ulmasov et al., 1997), Dexp:TIR1-myc/tir1 -1 (Gray et al., 1999) and

pJAZ2:GUS were grown in liquid MS. 2 kb promoter region of JAZ2 was PCR amplified with Expand High Fidelity polymerase (Roche) and primers pJAZ2 Fwd: CACCGACTAAGAATTTGTTATGAAG and pJAZ2 Rev: CATCGTTGAAACCGAAATTGAAATCG. PCR product was cloned into pENTR/D-TOPO. The resulting plasmid and the destination vector pGWB3 were subjected to a

recombination reaction using Gateway LR II Clonase kit (Invitrogen). This construct carrying pJAZ2:GUS sequence was transferred to the Agrobacterium tumefaciens strain GV3101 and then transformed in Col-0 plants by floral dipping (Clough and Bent, 1998). Kanamycin- and hygromycin-resistant plants were selected and their T2 progenies propagated for subsequent analysis. Root length measurements

For root growth inhibition assays, root length of 35 to 45 seedlings was measured 10 days after germination in Johnson medium in presence or absence of JA (Sigma-Aldrich) or coronatine (Sigma-Aldrich) plus COR-MO or JAIIe-MO when indicated. Pictures were taken with a NIKON D1 -x digital camera and root length was measured using ImageJ software.

Anthocvanin quantification

Seedlings were grown for 10 days in Johnson media, in the presence of the indicated compounds. In the case of JAIIe-MO, seedlings were also germinated in Johnson media and 8 days after germination, seedlings were treated for 48 hours with different combinations of JA and JAIIe-MO. Eight seedlings were pooled for each replicate.

Anthocyanin quantification was performed as described (Swain and Hillis, 1959). Four independent replicates (seedling pools) were measured for each sample. Values represent mean ± s.d.

GUS staining

Fifteen 7-day-old JAZ1-GUS, JAZ9-GUS and JAZ10-GUS seedlings grown vertically were transferred to each cell of a 12-well plate containing 2 ml liquid MS in the presence of COR-MO (from 50 nM to 10 μΜ) or JAIIe-MO 100 μΜ for 1 hour in the growth chamber and then JA 1 μΜ or COR 50 nM was added and the plate was incubated for another hour. Then, the different solutions were removed and 1 ml GUS staining buffer was added (50mM NaP0 ₄ ; 0.5 mM K ₄ Fe(CN) ₆ ; 0.5 mM K ₃ Fe(CN) ₆ ; 0.2% Triton X-100; 0.7 mg/ml 5-bromo-4-chloro-3-indolyl b-D glucuronic acid [X-Gluc, Glycosynth]) and the seedlings were incubated 37°C overnight.

In the case of pJAZ2:GUS assay, seedlings were treated with JA 5 μΜ, COR 100 nM and COR-MO 10 μΜ or JAIIe-MO 100 μΜ when indicated and incubated for 1 hour prior GUS staining.

For DR5GUS assay, 6-day-old seedlings were treated with or without COR-MO 10 μΜ for 1 hour. Then, IAA 5 μΜ (3-indole-acetic acid, Duchefa) was added when indicated for 80 min prior GUS staining.

Protein extraction and pull-down assays

MBP-JAZ9 fusion protein was generated as previously described (Chini et al., 2009). Ten day-old Arabidopsis 35S:COI 1-FLAG seedlings were ground in liquid nitrogen and homogenized in extraction buffer containing 50 mM TrisHCI pH 7.4, 80 mM NaCI, 10% glycerol, 0.1 % Tween-20, 1 mM phenylmethylsulphonyl fluoride (PMSF), Complete protease inhibitor (Roche) and 50 μΜ MG132 (Sigma). After two rounds of 15 min centrifugation at 13000 rpm at 4°C, supernatant was collected and total protein quantified by the Bradford method. For in vivo pull-down experiments, 6 mg of resin-bound MBP- fusion protein was added to 1 mg of total protein extract and when indicated,

supplemented with COR and COR-MO and incubated for 1 h at 4°C under rotation.

Samples were washed twice with 500 μΙ of extraction buffer for 3 min. Samples were resuspended in 35 μΙ extraction buffer containing 2 mM CaC and 1 μΙ factor Xa (New England Biolabs), to digest MBP-fused proteins, for 2 h at RT. Samples were boiled with loading buffer and run on 8 % SDS-PAGE gels. Proteins were transferred onto nitrocellulose membranes and incubated with monoclonal anti-FLAG antibody (Sigma) and anti-mouse-HRP (GE Healthcare). A 7 μΙ aliquot was taken from each sample after factor Xa cleavage. These samples were loaded into SDS-PAGE gels and stained with Coomassie Brilliant Blue to confirm equal protein loading in each PD sample.

Pull-down assays with TIR1 -myc, obtained from transgenic Arabidopsis plants, and IAA7- GST, expressed in BL21 E. coli cells, were performed as previously described (Kepinski, 2009). The extraction buffer contained 200 mM NaCI, 100 mM Tris-HCI pH7.4, 5 mM MgCI ₂ , 0.5% NP-40, 10% glycerol, 1 mM PMSF, 10 μΜ MG132, 10 μΜ DTT and protease inhibitor cocktail (Roche). Samples were incubated with IAA 0.5 μΜ with or without COR- MO 30 μΜ for 30 min at 4°C under rotation. Samples were washed three times with 500 μΙ of extraction buffer for 3 min. TIR1-myc protein was immunodetected with anti-myc- HRP antibody (Santa Cruz).

Bacterial Assays on plants

Pseudomonas syringae pv tomato (Pto) DC3000 and DC31 18 (COR ^" ) growth assays in Arabidopsis were performed by infiltration and spray inoculation. Nicotiana benthamiana leaves were infected by spray inoculation. Briefly, bacterial cultures were incubated at 28°C for 3-4 hours until OD ₆ oo=0,6. Then cells were pelleted and resuspended in sterile 10 mM MgC . Four week-old plants, grown directly in soil under short-day conditions and 21 °C, were infiltrated with COR-MO diluted in 10 mM MgC to a final concentration of 10 μΜ and 24 hours after infiltration, plants were sprayed with a bacterial suspension containing 10 ⁸ CFU (colony-forming units)/ml_ bacteria (Οϋβοο = 0.2) with 0.04% Silwet L- 77. Leaf discs were harvested 2 or 3 days post infection and grounded in 10 mM MgC^. Serial dilutions of leaf extracts were plated on LB agar with appropriate antibiotics. Each data point represents the average of eight replicates, each containing two leaf discs from different plants. Error bars indicate SE.

For the infiltration assay, COR-MO was infiltrated together with a bacterial suspension containing 5 x 10 ⁵ CFU/ml bacteria (OD = 0.001 ). Symptoms were recorded 5 days post infection.

The bacterial assay on tomato was performed on four-week-old Solanum lycopersicum Moneymaker leaves. Tomato leaves were infiltrated with COR-MO diluted in 10 mM MgC to a final concentration of 10 μΜ and 24 hours after infiltration, plants were inoculated by vacuum infiltration with a bacterial suspension containing 5 x 10 ⁵ CFU (colony-forming units)/mL bacteria (OD ₆ oo = 0.001 ) with 0.02% Silwet L-77. Leaf discs were harvested 3 or 6 days post infection and treated as indicated above to make the bacterial growth curves. Molecular models

The structural data of COI 1/JAZ/COR complex was obtained from PDB (ID 30GM). Edition and docking of COR-MO was performed with PyMOL software.

Example 1 - Ligand-based rational design of JA-lle antagonists

We aimed to design a direct antagonist that could compete with JA-lle for binding to its co-receptor (COI 1-JAZ) and prevent the hormone-triggered interaction between COM and the JAZ repressors. Such antagonists would provide extremely useful chemical tools which could be used to manipulate the JA-pathway at particular tissues or developmental stages and would also have an important biotechnological potential.

It was known that the keto and carboxyl residues of the hormone are exposed to the solvent when JA-lle binds to COM (Sheard et al., 2010) We proposed that a stable modification on either group of the hormone would result in a compound that could still specifically bind to COM , but would prevent the interaction with JAZ proteins for sterical reasons (Figure 7). A methoxime group was selected to modify the keto with the aim of reducing the likelihood that natural enzymes could eliminate it within the plant. For the carboxyl group, a methyl esterification was selected.

We synthesized the methoxime derivatives of JA, JA-lle and COR and the methyl esters of JA-lle and COR and analyzed their effects in vivo and in vitro.

Example 2 - Synthesis of compounds

Coronatine O-methyloxime (COR-MO)

Coronatine (about 10 mg, purchased from Sigma-Aldrich Co.) was dissolved in dry pyridine (3 ml.) and treated at 23°C for 18 h with O-methylhydroxylamine hydrochloride (81 mg, purchased from Sigma-Aldrich Co.). Water was added and the product extracted with redistilled ethyl acetate. The organic phase was washed with water and taken to dryness. An aliquot was methyl-esterified (cf. below) and analyzed by GC-MS using a Hewlett-Packard model 5970B mass selective detector connected to a Hewlett-Packard model 5890 gas chromatograph equipped with a 12-m phenylmethylsilicone capillary column. The chromatogram demonstrated a complete conversion of COR into COR-MO, which appeared as two peaks (ratio, 7:1 ) because of syn-anti isomerism of the

methoxime functional group. By selected monitoring of mass-spectral ions typical for COR methyl ester (m/z 333, 301 and 191 ), the absence of unreacted COR could be further verified. The mass spectrum of COR-MO methyl ester showed the following prominent ions: m/z 362 (35%; M ⁺ ), 331 (8; M ⁺ - OCH ₃ ), 299 (4; M ⁺ - (OCH ₃ + CH ₃ OH)), 271 (3), 220 (100; cleavage of the amide bond and charge retention on the coronafacic moiety), 192 (7; 220 - 28, loss of CO from the coronafacic fragment), 188 (7), 145 (14),

142 (19; cleavage of the amide bond and charge retention on the coronamic moiety), and 91 (13). COR-MO prepared as described above was stored under a high vacuum for 2 h and obtained as a colorless viscous oil, weight 10 mg. (±)-Jasmonic acid O-methyloxime (JA-MO)

(±)-Jasmonic acid methyl ester (100 mg, purchased from Sigma-Aldrich Co.) was dissolved in dry pyridine and treated with O-methylhydroxylamine hydrochloride as described above. The extracted product was saponified by treatment with 0.4 M NaOH in 80% aqueous ethanol at 23°C for 18 h. Purification by normal-phase HPLC using a mobile phase of 2-propanol-hexane-acetic acid (1 :99:0.01 , v/v/v) afforded pure JA-MO (84 mg) as a colorless oil. An aliquot was methyl-esterified and analyzed by GC-MS, which showed two peaks (ratio, 6:1 ) due to syn-anti isomerism of the methoxime group. The mass spectrum recorded on the major isomer showed the following prominent ions: m/z 253 (8%; M ⁺ ), 224 (15; M ⁺ - C ₂ H ₅ ), 222 (39; M ⁺ - OCH ₃ ), 180 (100; M ⁺ - CH ₂ - COOCHs), 148 (40; 180 - 32, loss of CH ₃ OH), and 1 12 (68). N-((-)-Jasmonoyl)-L-isoleucine O-methyloxime (JA-lle-MO)

A/-((-)-jasmonoyl)-L-isoleucine (95 mg, prepared as described by Fonseca et al (2009) was treated with 200 mL of a 30 mM solution of O-methylhydroxylamine hydrochloride in methanol-water (95:5, v/v) at 23°C for 18 h. The product obtained by extraction with ethyl acetate was subjected to reversed-phase HPLC using methanol-water-acetic acid (60:40:0.01 , v/v/v) as the mobile phase. This afforded pure JA-lle-MO (75 mg) as a white solid. Analysis of the methyl-esterified compound by GC-MS showed two peaks (ratio 6:1 ) due to the methoxime syn-anti isomers. The mass spectrum recorded on the major peak showed the following ions: m/z 366 (0.1 %; M ⁺ ), 335 (100; M ⁺ - OCH ₃ ), 305 (53; tentatively M ⁺ - (C ₂ H ₅ + CH3OH)), 267 (12; 335 - 68, loss of pentenyl side chain - 1 H), 190 (16), 180 (23; cleavage at C-2/C-3 with charge retention at the five-membered ring fragment), 148 (64; 180 - 32, loss of CH ₃ OH), and 86 (23). A small amount of (+)-7-iso-JA-lle-MO was present in the /V-((-)-Jasmonoyl)-L-isoleucine O-methyloxime preparation (the maximum amount measured by GC-MS analysis being 0.8%).

Preparation of methyl esters

Methyl esters of the above-mentioned compounds and other jasmonates were prepared in connection with analyses by GC-MS and to generate compounds for biological testing. Samples in amounts ranging from a few μg to several milligrams were dissolved in methanol (0.1 - 1 mL) and treated for 1 min with an excess of ethereal diazomethane. The solvents and the diazomethane reagent (a gas) were removed in vacuo. Example 3 - Molecular characterization and properties of derivatives

Both methyl esters (methyl-COR and methyl-JAIIe) did not show any antagonistic effect on our tests (Data not shown). This may be due to the existence of plant esterases that could cleave the ester to produce coronatine or JAIIe.

JA-methoxime did not show any effect in the tests, suggesting the modification could interfere with the enzymatic JAR1 conjugating activity.

Therefore we focused on the analysis of the JAIIe- and COR-methoxime derivatives.

Effect of COR-methoxime and JAIIe-methoxime on JAZ degradation.

Hormone-triggered JAZ binding to SCF ^COM complex is followed by the polyubiquitination and subsequent proteasome degradation of the JAZ repressors. To analyze the antagonistic activity of the methoxime derivatives, we studied their effect on the hormone- triggered degradation of JAZ1 on roots of Arabidopsis 35S:JAZ1-GUS, 35S:JAZ9-GUS and 35S:JAZ10-GUS transgenic plants. As shown in Figures 1 and 12, treatment of transgenic seedlings with either COR or JA promoted a quick degradation of JAZ1-GUS, JAZ9-GUS and JAZ10-GUS as observed by the reduced GUS activity. In contrast, pretreatment with COR-methoxime fully prevented the degradation of this protein. JAIIe- methoxime treatment also prevented the degradation of JAZ1 , but required a

concentration much higher (20-fold higher) than COR-methoxime (Figure 1 ). The effect was stronger in the cases of JAZ9 and JAZ10 (Figure 12). These results indicate that the effect of COR-MO is not restricted to a particular COI 1/JAZ co-receptor complex, that both methoxime derivatives block this hormone-regulated process, and that COR- methoxime is a much potent antagonist than JAIIe-methoxime.

Effect of COR-methoxime and JAIIe-methoxime on JA-dependent gene expression. We next analyzed the effect of both derivatives on JA-dependent gene expression. Hormone- triggered degradation of JAZ repressors liberates the TFs that activate JA-responsive genes (Fonseca et al., 2009b). JAZ genes can be found among the early responsive genes. Thus, to monitor the expression of JAZ genes, we fused the promoter region of JAZ2 to the GUS reporter and generated A. thaliana transgenic lines carrying this construct. GUS staining showed that JAZ2:GUS expression was induced in roots after treatment with JA or coronatine, as is the case of WT JAZ2 (Figure 2). Consistent with the inhibition of JAZ1 degradation, the concomitant treatment with COR-methoxime or JAIIe- methoxime prevents hormone-induced gene expression of pJAZ2:GUS. We concluded that both COR-methoxime and JAIIe-methoxime prevent JA- and coronatine-dependent gene expression. Similar to previous results, COR-methoxime showed a 20-fold higher activity than JAIIe-methoxime. To address the specificity and magnitude of COR-MO inhibitory effect, we next obtained whole-genome transcriptomic profiles of WT seedlings untreated or treated with COR, COR-MO or both simultaneously, using two-color microarrays (Agilent). Differentially expressed genes were selected as those showing a foldchange >2 or <-2 and a FDR < 0.05. Profiles obtained comparing COR vs COR+COR-MO treated plants rendered a total of 62 genes with increased expression by the COR-MO treatment and 386 genes with reduced expression. Remarkably, analysis of JA-regulation data of those genes from public databases (BAR; http://bar.utoronto.ca) revealed that a strong percentage of the genes with reduced expression by COR-MO treatment (in the COR vs COR-COR-MO comparison) are genes induced by JA (55.44% observed vs 1 .97% expected; Figures 13A and 13B). None of them, however, were repressed by the hormone (Figure 13A). Similarly, a high percentage of the genes with increased expression by COR-MO correspond to genes repressed by JA and none of them to genes induced by the hormone (21 % observed vs 0.49% expected. COR-MO alone did not promote any significant change in gene expression after 2 h of treatment compared to untreated plants, indicating that in the absence of the agonist COR-MO does not have off target effects. Altogether, these results indicate that COR-MO has a strong effect inhibiting the modulation of gene expression by COR at the whole-genome scale and support a strong specificity of COR-MO activity. Effect of COR-methoxime and JAIIe-methoxime on JA-mediated phenotypes.

Anthocyanin accumulation and inhibition of root-growth are two of the best-characterized plant responses to the phytohormone JAIIe. Treatment with JA or COR promotes the accumulation of anthocyanins and the inhibition of root growth (Figures 3, 8 and 9). In contrast, Arabidopsis plants germinated and grown in plates containing different combinations of JA or COR and COR-methoxime showed a dose-dependent strong reduction (complete in some cases) of both hormone-induced phenotypic effects (Figures 3 and 8). Moreover, ratios as low as 0.1 (COR-m vs JA) to 2-fold (COR-m vs COR) were sufficient to strongly reduce the effect of JA or COR, respectively (Figure 8).

The half maximal inhibitory concentration (IC50) of COR-MO was 0.43 μΜ for a concentration of 0.5 μΜ COR and 0.7 μΜ for a concentration of 1 μΜ COR, underscoring the potency of COR-MO (Figures 10A and 10C). Noteworthy, COR-MO treatment alone did not have any noticeable effect on anthocyanins accumulation even at concentrations of 30 μΜ, supporting its specificity and lack of toxicity (Figures 10A-10C). Similar to the effect on anthocyanins, COR-MO reduced the inhibition of root-growth by COR in a dose-dependent manner, with an IC50 of 0.8 μΜ for a concentration of COR of 1 μΜ (Figure 10B). Similar to the case of anthocyanins, even high concentrations (30 μΜ) of COR-MO alone did not altered root growth.

Although JAIIe-methoxime had a clear effect reverting root-growth inhibition by JA (Figure 9), its effect was very poor preventing anthocyanin accumulation and not comparable to that of COR-methoxime, at the concentrations tested (2-2.5 fold JAIIe-methoxime vs JA)

Effect of COR-methoxime on COI1-JAZ interaction. To further test if the rationally designed antagonist could effectively interfere with the COR-mediated formation of the co-receptor complex, we performed pull-down assays using recombinant JAZ9-MBP protein expressed and purified from E. coli, and extracts of Arabidopsis thaliana transgenic plants expressing FLAG-tagged COM . In the presence of coronatine, COM binds to JAZ9 and the COM -FLAG protein can be detected by immunoblot after the pulldown reaction (Figure 4). However, when COR-methoxime was added to the pull-down reaction, it prevented (or strongly reduced) the coronatine-dependent COI1/JAZ9 interaction (IC ₅ o= 1 .53 μΜ for a concentration of 0.5 μΜ COR; Figure 1 1 ). COR-MO was unable to induce COI1/JAZ9 interaction in the absence of COR. These results suggest that COR-MO competitively inhibits binding of COR to the COI 1/JAZ co-receptor. Example 4 - Specificity of COR-methoxime

The ligand-based rational design using the coronatine structure as template, suggests that the designed compound would bind to the same target as the original molecule, and therefore, should be highly specific. Due to the similarity between the receptors of JAIIe and auxin, we decided to analyze several auxin responses to discard any unspecific side effect of the methoxime modification of COR. In fact, TIR1 , the auxin receptor is the phylogenetically closest protein to COM , and auxin and JAIIe act in a similar way as molecular glues between their co-receptor proteins (TIR1 and the Aux/IAA repressors; and COM and the JAZ repressors). First, we analyzed the interaction between TIR1 and IAA7 mediated by auxins by pull-down assays. Myc-tagged TIR1 protein was obtained from plant extracts of A. thaliana transgenic plants and recombinant IAA7-GST was expressed in E. coli. IAA induced the interaction between TIR1 -myc and IAA7-GST and the addition of COR-methoxime to the pull-down reaction did not affect the interaction between these two proteins, supporting its specificity (Figure 5A,).

Next, we also studied the effect of coronatine-methoxime on auxin-induced gene expression, using the auxin-induced marker DR5 (from DR5:GUS transgenic plants). DR5:GUS seedlings treated with coronatine-methoxime show DR5:GUS expression levels in roots similar to non-treated seedlings (Figure 5B,). Moreover, the auxin induction of DR5:GUS expression in seedlings was not altered by treatment with COR-methoxime. These results indicate that COR-methoxime can neither induce nor decrease DR5:GUS expression and do not affect the interaction between TIR1 and IAA7, therefore indicating that the effect of COR-methoxime is restricted to the COI 1 -JAZ system.

Example 5 - COR-methoxime effect upon pathogen infection Activation of jasmonate signalling pathway plays a dual role upon pathogen infection. In the case of necrotrophic pathogens, such as Botrytis cinerea, JAIIe induces resistance, whereas in the case of biotrophic or hemibiotrophic pathogens, such as Pseudomonas synngae, this signaling pathway promotes susceptibility due to its well-documented antagonistic effect on the SA pathway (Feys et al., 1994; Zhao et al., 2003; Uppalapati et al., 2005; Laurie-Berry et al., 2006). Thus, as described hereinabove, the production of COR by P. synngae strains is an evolutionary advantage acquired by these strains as a mechanism of pathogenicity that induces the JAIIe pathway to supress SA-dependent defences. To analyze the effect of COR-MO treatment on JA-dependent defenses against Botrytis cinerea four-week-old WT A. thaliana plants were challenged with 5x10 ⁵ spores of the fungus and infection symptoms scored 4 days after inoculation. As shown in Figure 14A, simultaneous application of the spores and COR-MO promoted a shift of symptoms from mild to severe, indicating that the antagonist reduces the activation of JA-dependent defenses, therefore increasing the susceptibility to the necrotrophic fungus. Similarly, quantification of spores produced after 4 days of infection revealed that COR-MO treatment increase plant susceptibility enhancing spore production by approximately twofold (Figure 14B). To test the biotechnological potential of COR-methoxime we analyzed if its antagonistic activity could be sufficient to overcome the effect of COR produced by P. syringae strains during infection. In our bioassays, we used two different strains of P. syringae pv. tomato: DC3000, which produces COR, and DC31 18, commonly known as COR-, because it is impaired in coronatine synthesis. We infiltrated COR-methoxime together with the bacterial strains DC3000 and DC31 18 into Arabidopsis leaves. After 5 days of infection COR-methoxime reduced the symptoms produced by DC3000, but did not show any effect upon infection with DC31 18 (Figure 6A, 6B, 6C). We also checked if COR- methoxime could reduce the symptoms produced by DC31 18 supplemented with coronatine. As expected, COR-methoxime strongly reduced the coronatine-dependent symptoms caused by DC31 18 supplemented with the phytotoxin COR.

We also performed the infection assays by infiltration of coronatine-methoxime 24h prior spray application of either Pst DC3000 or DC31 18. The results of this assay agreed with those of the infiltration assay. The use of coronatine-methoxime reduced bacterial growth in one logaritmic unit. Interestingly, pretreatment with coronatine-methoxime and subsequent spray infection with Pst DC31 18, did not affect bacterial growth of this strain. This suggests that COR-methoxime directly targets JA signaling pathway, which is activated by coronatine produced by DC3000.

To further explore the biotechnological potential of COR-MO, we analyzed its effect on two solanaceous species {Nicotiana benthamiana and Solanum lycopersicum). As shown in Figure 6C and 15, COR-MO reduced bacterial growth by over one logarithmic unit, confirming that the antagonist is effective in different plant-pathogen interactions.

To further investigate the biotechnological potential of COR-MO, we tested its effect on fungal infection in rice. Rice variety (cv C039, indica variety) was infected with the fungal pathogen Magnaporthe Oryzae (isolate Guy1 1 ) and Figure 16 shows that COR-MO can also reduce fungal infection in rice.

Example 6 - COR-methoxime effect upon abiotic stresses

As well as biotic stresses, Jasmonates also act as regulators of responses to abiotic stress, including drought, salt, ozone exposure, and wounding in different plant species, including Arabidopsis, soybean and rice (Farmer et al., 2003; Browse and Howe, 2008; Chico et al., 2008; Ye et al., 2009; Zhu et al., 2012; Wasternack, 2007, updated in Ann Bot (2013) 1 1 1 (6): 1021-1058). As demonstrated above, COR-MO can effectively antagonise the effects of jasmonates, and can therefore be used to combat the effects of abiotic stresses. Specifically, two examples have been reported showing that repression of the JA pathway by over-expression of JAZ genes leads to increased tolerance to salt, alkali and dehydration stresses (Ye et al., 2009; Zhu et al., 2012). Therefore, COR-MO can be used to enhance plants tolerance to these abiotic stresses, by its capacity to block the JA-pathway

Example 7 - Discussion The regulation of gene expression by the hormone JAIIe is a crucial mechanism in plant responses to stress and development. Most of the information available so far about how JAIIe regulate these processes comes from genetic analyses or exogenous treatments in the model plant Arabidopsis thaliana. Conservation of the JAIIe pathway components in land plants for which genome information is available suggests the importance of the JA pathway in all land plants (Chico et al., 2008). However, the physiological role of JAIIe among plant species has been so far difficult to assess due to the lack of genetic tools. Moreover, even in Arabidopsis, available loss-of-function or gain-of-function mutants are limited tools for the analysis of JA-dependent responses in particular tissues or developmental times.

The identification of antagonists by Chemical Biology approaches is, therefore, of great interest to manipulate pathways in particular tissues, developmental stages or different species. However, the key issue of these approaches is the specificity of the compounds identified, which in most cases have undesired side effects (Oostendorp et al., 2001 ; Raihkel and Pirrung, 2005,; Norambuena et al., 2009; Duran-Frigola and Aloy, 2013)..

This unspecificity could compromise the application of these chemicals on crops (Marcos et al., 2008). On the other hand, and taking advantage of structural data about receptor- ligand interactions, a ligand-based rational design approach could be followed (Mandal et al., 2009). This strategy has been widely used in the biomedical field, but its application to agrochemical design lags behind (Walter, 2002; Speck-Planche et al., 201 1 ). Ligand- based rational design of antagonist molecules allows to improve their properties in terms of specificity, reduced toxicity against plant cells, greater stability or modulation of the spectrum of action (Marcos et al., 2008).

Structural studies of the COI1 -ligand-JAZdegron complex showed that the keto and carboxyl residues of the hormone are exposed to the solvent when JA-lle (or its bacterial mimic COR) binds to COM (Sheard et al., 2010). We hypothesized that stable

modifications of the keto group would still allow binding of the ligand to COM but will prevent binding of the JAZ degron peptide, thus blocking COM function. We have designed and synthesized specific COM antagonists that inhibit all tested COM -mediated responses to JAIIe (or COR) in Arabidopsis, from the molecular to the whole-plant level. Thus, using PD assays we have demonstrated that COR-MO competes with the hormone (or its mimic COR) for the formation of the co-receptor complexes. This competitive binding prevents the degradation of the JAZ repressor, and therefore blocks responses to the hormone. This is supported by the COR-MO reversion of the JA or COR effects on gene expression and JA-regulated phenotypes (i.e. anthocyanin accumulation and root- growth inhibition). Remarkably, this reversion occurs at very low ratios of the antagonist vs agonist concentrations, indicating the efficiency and strength of the molecule.

Therefore, we have generated a powerful dissection tool for JA biology.

In addition to its use in Plant Biology research, there is a clear agronomical utility for COR-MO to potentiate crop defenses against biotrophic and hemi-biotrophic pathogens. In a simplified view jasmonates are key hormones regulating plant immunity and essential to mount defenses against necrotrophs, whereas the SA pathway orchestrates defenses against biotrophs (Grant and Lamb, 2006; Robert-Seilaniantz et al., 201 1 ). The antagonism between these two pathways is well documented and, thus, modifications that enhance resistance to biotrophic pathogens tend to reduce resistance to necrotrophs and viceversa (Grant and Lamb, 2006; Robert-Seilaniantz et al., 201 1 ). In fact, COR is a paradigmatic example of how evolution has provided P.syringae strains with the ability to manipulate the host hormonal network to enhance susceptibility (Cui et al., 2005;

Uppalapati et al., 2007; Bender et al., 1999; O'Brien et al., 201 1 ). So far, efforts to develop plants with broad-spectrum resistance by genetic manipulation of defense pathway genes have had a limited success due to the antagonism between defense pathways (Glazebrook, 2005; Robert-Seilaniantz et al., 201 1 ; Pieterse et al., 2012; Gimenez-lbanez and Solano, 2013). Besides, public resistance to the production of genetically modified plants is still an important factor to take into account. The use of agrochemicals instead of genetic strategies to improve plant resistance has the advantage that chemical treatments can be tissue-specific and transient (tissue-controlled and time-controlled), therefore, reducing the time- and tissue- window of

weakness/exposition to antagonist pathogens. For instance, JA-insensitive plants become susceptible to soil-borne microorganisms, which in many cases are not even pathogenic for WT plants (Adie et al., 2007). Therefore, the use of JA-insensitive plants to enhance resistance to foliar pathogens such as P.syringae, would face the threat of susceptibility to soil-borne pathogens. However, this problem could be overcome by the use of specific JA-pathway antagonists (ie COR-MO) on crop leaves, which should not affect JA-sensitivity of the roots.

COR-MO could be applied to plants alone or in combination with SA-analogs e.g. BTH (Gorlach et al., 1996; Vallad and Goodman, 2004). This combinatorial application should have an additive effect since it will simultaneously potentiate SA activity and prevent any repression of this pathway by blocking JA responses with COR-MO.

COR-MO showed to be a much more efficient antagonist than (-)-JA-lle-MO. This is in line with studies of auxin antagonists and consistent with the tenfold higher affinity of COR than JAIIe for COM binding (Hayashi et al., 2008; 2012; Fonseca et al., 2009a; Sheard et al., 2012). In the case of auxin, the TIR1-IAA complex is stabilized by interaction with the AUX/IAA degron peptide (Tan et al., 2007). IAA derivatives (eg. BH- IAA) that prevent the interaction of TIR1-ligand with the AUX/IAA peptide are unable to stabilize the receptor complex and have a lower overall affinity for TIR1 , therefore behaving as weak antagonists (Hayashi et al., 2008). However, modifications of the IAA moiety that increase the affinity for TIR1 , such as in the case of auxinole, dramatically enhance the antagonistic activity of the derivative (Hayashi et al., 2012). In the case of the COM /JAZ co-receptor, structural analyses showed that, similar to the case of TIR1- auxin, the COM-JAIIe complex is stabilized by binding to the JAZ degron peptide (Sheard et al., 2010; Tan et al., 2007). These analyses also demonstrated that the

cyclopentanone ring shared by COR and JAIIe establish similar interactions with Phe 89 and Tyr 444 of COM . However, the cyclohexene ring of COR provides a stronger interaction surface than the corresponding pentenyl side chain of JAIIe, explaining the higher affinity of COR than JAIIe for COM (Sheard et al., 2010). This higher affinity also explains why COR-MO is a more efficient antagonist of the hormone than JAIIe-MO, in line with the higher activity of auxinole that BH-IAA. Remarkably, COR-MO is also an efficient antagonist of COR, having both molecules the same COM -interacting moiety. These results indicate that, in contrast to JAIIe, COR binding to COM does not need to be stabilized by binding to the JAZ peptide. In fact, ligand binding to COM in the absence of JAZ has been detected previously for COR, but not for JAIIe (Sheard et al., 2010).

REFERENCES Adie BA, Perez-Perez J, Perez-Perez MM, Godoy M, Sanchez-Serrano JJ, Schmelz EA, Solano R (2007) ABA is an essential signal for plant resistance to pathogens affecting JA biosynthesis and the activation of plant defenses in Arabidopsis. Plant Cell 19:1665-81 .

Bender CL, Alarcon-Chaidez F, Gross DC (1999). Pseudomonas syringae phytotoxins: mode of action, regulation, and biosynthesis by peptide and polyketide synthetases. Microbiol Mol Biol Rev 63, 266-292.

Blechert S, Bockelmann C, Fusslein M, von Schrader T, Stelmach BA, Niesel U, Weiler EW (1999) Structure activity analyses reveal the existence of two separate groups of active octadecanoids in elicitation of the tendril coiling response of Bryonia dioica Jacq. Planta 207: 470-479. Boter M, Ruiz-Rivero O, Abdeen A, Prat S (2004) Conserved MYC transcription factors play a key role in jasmonate signaling both in tomato and Arabidopsis. Genes Dev 18, 1577-1591. Brooks DM, Hernandez-Guzman G, Kloek AP, Alarcon-Chaidez F, Sreedharan A,

Rangaswamy V, Penaloza-Vazquez A, Bender CL, Kunkel BN (2004) Identification and characterization of a well-defined series of coronatine biosynthetic mutants of

Pseudomonas syringae pv. tomato DC3000. Mol Plant Microbe Interact 17, 162-174. Browse J and Howe GA (2008) New weapons and a rapid response against insect attack. Plant Physiol 146, 832-838.

Causier B, Ashworth M, Guo W, Davies B (2012) The TOPLESS interactome: a framework for gene repression in Arabidopsis. Plant Physiol 158:423-38.

Cheng Z, Sun L, Qi T, Zhang B, Peng W, Liu Y, Xie D (201 1 ) The bHLH transcription factor MYC3 interacts with the Jasmonate ZIM-domain proteins to mediate jasmonate response in Arabidopsis. Mol Plant 4(2), 279-288. Chico JM, Chini A, Fonseca S, Solano R (2008) JAZ repressors set the rhythm in jasmonate signaling. Curr Opin Plant Biol 1 1 :486-494.

Chini A, Fonseca S, Fernandez G, Adie B, Chico JM, Lorenzo O, Garcia-Casado G, Lopez-Vidriero I, Lozano FM, Ponce MR, Micol JL, Solano R (2007) The JAZ family of repressors is the missing link in jasmonate signalling. Nature 448, 666-671 .

Chini A, Fonseca S, Chico JM, Fernandez-Calvo P, Solano R (2009) The ZIM domain mediates homo and heteromeric interactions between Arabidopsis JAZ proteins. Plant J 59(1 ), 77-81 .

Chung HS and Howe GA (2009) A Critical Role for the TIFY Motif in Repression of Jasmonate Signaling by a Stabilized Splice Variant of the JASMONATE ZIM-Domain Protein JAZ 10 in Arabidopsis. Plant Cell 21 (1 ), 131-145. Chung HS, Niu Y, Browse J, Howe GA (2009) Top hits in contemporary JAZ: an update on jasmonate signaling. Phytochemistry 70, 1547-1559.

Chung HS, Cooke TF, Depew CL, Patel LC, Ogawa N, Kobayashi Y, Howe GA (2010) Alternative splicing expands the repertoire of dominant JAZ repressors of jasmonate signaling. Plant J 63, 613-622.

Clough SJ and Bent AF (1998) Floral dip: A simplified method for Agrobacterium- mediated transformation of Arabidopsis thaliana. Plant J 16: 735-743. Consortium AIM (201 1 ) Evidence for network evolution in an Arabidopsis interactome map. Science 333: 601 -607. Creelman RA and Mullet JE (1997) Biosynthesis and action of jasmonates in plants. Annu Rev Plant Physiol Plant Mol Biol 48: 355-381.

Cui J, Bahrami AK, Pringle EG, Hernandez-Guzman G, Bender CL, Pierce NE, Ausubel FM (2005) Pseudomonas syringae manipulates systemic plant defenses against pathogens and herbivores. Proc Natl Acad Sci U S A 102:1791-1796.

Dombrecht B, Xue GP, Sprague SJ, Kirkegaard JA, Ross JJ, Reid JB, Fitt GP, Sewelam N, Schenk PM, Manners JM, Kazan K (2007) MYC2 differentially modulates diverse jasmonate-dependent functions in Arabidopsis. Plant Cell 19: 2225-2245.

Duran-Frigola M and Aloy P (2013) Analysis of chemical and biological features yields mechanistic insights into drug side effects. Chem Biol 20:594-603. Farmer EE, Almeras E, Krishnamurthy V (2003) Jasmonates and related oxylipins in plant responses to pathogenesis and herbivory. Current Opinion in Plant Biology 6: 372-378.

Fernandez-Calvo P, Chini A, Fernandez-Barbero G, Chico JM, Gimenez-lbanez S, Geerinck J, Eeckhout D, Schweizer F, Godoy M, Franco-Zorrilla JM, Pauwels L, Witters E, Puga Ml, Paz-Ares J, Goossens A, Reymond P, De Jaeger G, Solano R (201 1 ) The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses. Plant Cell 23: 701-715. Feys B, Benedetti CE, Penfold CN, Turner JG (1994) Arabidopsis mutants selected for resistance to the phytotoxin coronatine are male sterile, insensitive to methyl jasmonate, and resistant to a bacterial pathogen. Plant Cell 6: 751 -759.

Fonseca S, Chini A, Hamberg M, Adie B, Kramell R, Miersch O, Wasternack C, Solano R (2009a) (+)-7-iso-Jasmonoyl-L-lsoleucine is the endogenous bioactive jasmonate. Nature Chemical Biology 5:344-50.

Fonseca S, Chico JM, Solano R (2009b) The jasmonate pathway: the ligand, the receptor and the core signalling module. Curr Opin Plant Biol 12:539-547.

Gimenez-lbanez S and Solano R (2013) Nuclear jasmonate and salicylate signaling and crosstalk in defense against pathogens. Front Plant Sci 4:72.

Glazebrook J (2005) Contrasting mechanism of defense against biotrophic and necrotrophic pathogens. Annu Rev Phytopathol 43: 205-27.

Gorlach J, Volrath S, Knauf-Beiter G, Hengy G, Beckhove U, Kogel KH, Oostendrop M, Staub T, Ward E, Kessmann H, Ryals J (1996) Benzothiadiazole, a novel class of inducers of systemic acquired resistance, activates gene expression and disease resistance in wheat. Plant Cell 8:629-43.

Grant M and Lamb C (2006) Systemic immunity. Curr Opin Plant Biol 9:414-420. Gray WM, del Pozo JC, Walker L, Hobbie L, Risseeuw E, Banks T, Crosby WL, Yang M, Ma H, Estelle M (1999) Identification of an SCF ubiquitin-ligase complex required for auxin response in Arabidopsis thaliana. Genes Dev 13:1678-1691.

Hayashi K, Tan X, Zheng N, Hatate T, Kimura Y, Kepinski S, Nozaki H (2008) Small- molecule agonists and antagonists of F-box protein-substrate interactions in auxin perception and signaling. Proc Natl Acad Sci U S A 105:5632-7. Hayashi K, Neve J, Hirose M, Kuboki A, Shimda Y, Kepinski S, Nozaki H (2012) Rational design of an auxin antagonist of the SCFTIR1 auxin receptor complex. ACS Chem Biol 7:590-598.

Johnson CM, Stout PR, Broyer TC, Carlton AB (1957) Comparative chlorine requirements for different plant species. Plant and Soil 8: 337-353.

Kagale S, Links MG, Rozwadowski K (2010) Genome-wide analysis of ethylene- responsive element binding factor-associated amphiphilic repression motif-containing transcriptional regulators in Arabidopsis. Plant Physiol 152: 1 109-1 134.

Katsir L, Schilmiller AL, Staswick PE, He SY, Howe GA (2008) COM is a critical component of a receptor for jasmonate and the bacterial virulence factor coronatine. Proc Natl Acad Sci U S A 105: 7100-7105. Kepinski S (2009) Pull-down assays for plant hormone research. Methods Mol Biol 495:61-80.

Kloek AP, Verbsky ML, Sharma SB, Schoelz JE, Vogel J, Klessig DF, Kunkel BN (2001 ) Resistance to Pseudomonas syringae conferred by an Arabidopsis thaliana coronatine- insensitive (coil ) mutation occurs through two distinct mechanisms. Plant J 26: 509-522.

Laurie-Berry N, Joardar V, Street IH, Kunkel BN (2006) The Arabidopsis thaliana

JASMONATE INSENSITIVE 1 gene is required for suppression of salicylic acid- dependent defenses during infection by Pseudomonas syringae. Mol Plant Microbe Interact 19: 789-800.

Lorenzo O, Chico JM, Sanchez-Serrano JJ, Solano R (2004) JASMONATE- INSENSITIVE1 encodes a MYC transcription factor essential to discriminate between different jasmonate-regulated defense responses in Arabidopsis. Plant Cell 16: 1938- 1950.

Mandal S, Moudgil M, Mandal SK (2009) Rational drug design. Eur J Pharmacol 625: 90- 100. Maor R, Jones A, Nuhse TS, Studholme DJ, Peck SC, Shirasu K (2007) Multidimensional protein identification technology (MudPIT) analysis of ubiquitinated proteins in plants. Mol Cell Proteomics 6: 601-610. Marcos JF, Mufioz A, Perez-Paya E, Misra S, Lopez-Garcia, B (2008) Identification and rational design of novel antimicrobial peptides for plant protection. Annu Rev Phytopathol 46:273-301 .

Melotto M, Underwood W, Koczan J, Nomura K, He SY (2006) Plant stomata function in innate immunity against bacterial invasion. Cell 126: 969-980.

Melotto M, Mecey C, Niu Y, Chung HS, Katsir L, Yao J, Zeng W, Thines B, Staswick P, Browse J, Howe GA, He SY (2008) A critical role of two positively charged amino acids in the Jas motif of Arabidopsis JAZ proteins in mediating coronatine- and jasmonoyl isoleucine-dependent interactions with the COM F-box protein. Plant J 55: 979-988.

Moreno JE, Shyu C, Campos ML, Patel LC, Chung HS, Yao J, He SY, Howe GA (2013) Negative feedback control of jasmonate signaling by an alternative splice variant of JAZ10. Plant Physiol 162:1006-17.

Murashige T and Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473-497.

Niu Y, Figueroa P, Browse J (201 1 ) Characterization of JAZ-interacting bHLH

transcription factors that regulate jasmonate responses in Arabidopsis. J Exp Bot 62: 2143-2154. O'Brien HE, Thakur S, Guttman DS (201 1 ) Evolution of plant pathogenesis in

Pseudomonas syringae: a genomics perspective. Annu Rev Phytopathol 49:269-89.

Ogawa, N. et al., 2008 - "Strategy for synthesis of the isoleucine conjugate of epi- jasmonic acid", Tetrahedron Lett. 49, pp. 7124-7127.

Oostendorp M, Kunz W, Dietrich B, Staub T (2001 ) Induced disease resistance in plants by chemicals. Eur J Plant Pathol 107:19-28.

Pauwels L, Morreel K, De Witte E, Lammertyn F, Van Montagu M, Boerjan W, Inze D, Goossens A (2008) Mapping methyl jasmonate-mediated transcriptional reprogramming of metabolism and cell cycle progression in cultured Arabidopsis cells. Proc Natl Acad Sci U S A 105: 1380-1385.

Pauwels L, Barbero G.F., Geerinck, J., Tilleman, S., Grunewald, W., Perez, A.C., Chico, J.M., Bossche, R.V., Sewell, J., Gil, E., Garcia-Casado, G., Witters, E., Inze, D., Long, J.A., De Jaeger, G., Solano, R., and Goossens, A. (2010). NINJA connects the co- repressor TOPLESS to jasmonate signalling. Nature 464: 788-791 .

Pauwels L and Goossens A (201 1 ) The JAZ proteins: a crucial interface in the jasmonate signalling cascade. Plant Cell 23: 3089-3100. Pieterse CM, Van der Does D, Zamioudis C, Leon-Reyes A, Van Wees SC (2012) Hormonal modulation of plant immunity. Annu Rev Cell Dev Biol 28: 489-521.

Raikhel N and Pirrung M (2005) Adding precision tools to the plant biologists' toolbox with chemical genomics. Plant Physiol 138:563-4.

Reinbothe, C, Springer, A., Samol, I., and Reinbothe, S. (2009). Plant oxylipins: role of jasmonic acid during programmed cell death, defence and leaf senescence. FEBS J 276: 4666-4681.

Robert-Seilaniantz A, Grant M, Jones JD (201 1 ) Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism. Annu Rev Phytopathol 49:317- 43. Saracco, S.A., Hansson, M., Scalf, M., Walker, J.M., Smith, L.M., and Vierstra, R.D. (2009). Tandem affinity purification and mass spectrometric analysis of ubiquitylated proteins in Arabidopsis. Plant J 59: 344-358.

Sheard LB, T.X., Mao H, Withers J, Ben-Nissan G, Hinds TR, Kobayashi Y, Hsu FF, Sharon M, Browse J, He SY, Rizo J, Howe GA, Zheng N. (2010) Jasmonate perception by inositol-phosphate-potentiated COI 1 -JAZ co-receptor. Nature 18: 400-405.

Shyu C, Figueroa P, DePew CL, Cooke TF, Sheard LB, Moreno JE, Katsir L, Zheng N, Browse J, Howe GA (2012) JAZ8 lacks a canonical degron and has an EAR motif that mediates transcriptional repression of jasmonate responses in Arabidopsis. Plant Cell 24: 536-550

Speck-Planche A, Kleandrova VV, Rojas-Vargas JA (201 1 ) QSAR model toward the rational design of new agrochemical fungicides with a defined resistance risk using substructural descriptors. Mol Divers 15: 901 -909.

Spoel SH, Koomneef A, Claessens SMC, Korzelius JP, Van Pelt JA, Mueller MJ, Buchala AJ, Metraux JP, Brown R, Kazan K, Van Loon LC, Dong X, Pieterse CM (2003) NPR1 modulates cross-talk between salicylate- and jasmonate-dependent defense pathways through a novel function in the cytosol. Plant Cell 15:760-770

Staswick PE, Tiryaki I, Rowe ML (2002) Jasmonate response locus JAR1 and several related Arabidopsis genes encode enzymes of the firefly luciferase superfamily that show activity on jasmonic, salicylic, and indole-3-acetic acids in an assay for adenylation. Plant Cell 14: 1405-1415.

Staswick PE and Tiryaki I (2004) The oxylipin signal jasmonic acid is activated by an enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell 16: 21 17-2127. Suza WP, Rowe ML, Hamberg M, Staswick PE (2010) A tomato enzyme synthesizes (+)- 7-/so-jasmonoyl L-isoleucine in wounded leaves. Planta 231 :717-728. Swain T and Hillis WE (1959) The pehnolic constituents of Prunus domestica. I.

Quantitative analysis of phenolic constituents. J Sci Food Agric 10:63-68.

Tan X, Calderon-Villalobos LI, Sharon M, Zheng C, Robinson CV, Estelle M, Zheng N (2007) Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature 446:640-5.

Thilmony R, Underwood W, He SY (2006) Genome-wide transcriptional analysis of the Arabidopsis thaliana interaction with the plant pathogen Pseudomonas syringae pv. tomato DC3000 and the human pathogen Escherichia coli 0157:1-17. Plant J 46:34-53.

Thines B, Katsir L, Melotto M, Niu Y, Mandaokar A, Liu G, Nomura K, He SY, Howe GA, Browse J (2007) JAZ repressor proteins are targets of the SCF(COM ) complex during jasmonate signalling. Nature 448: 661-665. Ulmasov T, Murfett J, Hagen G, Guilfoyle TJ (1997) Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 9:1963-1971.

Uppalapati SR, Ishiga Y, Wangdi T, Kunkel BN, Anand A, Mysore KS, Bender CL (2007) The phytotoxin coronatine contributes to pathogen fitness and is required for suppression of salicylic acid accumulation in tomato inoculated with Pseudomonas syringae pv.

tomato DC3000. Mol Plant Microbe Interact 20: 955-965.

Vallad GE and Goodman RM (2004) Systemic acquired resistance and induced systemic resistance in conventional agriculture. Crop Sci 6: 1920-1934.

Vanholme B, Grunewald W, Bateman A, Kohchi T, Gheysen G (2007) The tify family previously known as ZIM. Trends Plant Sci 12: 239-244. Walter MW (2002) Structure-based design of agrochemicals. Nat Prod Rep 19: 278-291.

Wasternack C (2007) Jasmonates: an update on biosynthesis, signal transduction and action in plant stress response, growth and development. Ann Bot (Lond) 100: 681-697. Wasternack C and Hause B (2013) Jasmonates: biosynthesis, perception, signal transduction and action in plant stress response, growth and development. An update to the 2007 review in Annals of Botany. Annals of Botany 1 1 1 : 1021-1058.

Xie DX, Feys BF, James S, Nieto-Rostro M, Turner JG (1998) COM : an Arabidopsis gene required for jasmonate-regulated defense and fertility. Science 280: 1091 -1094.

Yan Y, Stolz S, Chetelat A, Reymond P, Pagni M, Dubugnon L, Farmer EE (2007) A downstream mediator in the growth repression limb of the jasmonate pathway. Plant Cell 19: 2470-2483.

Ye H, Du H, Tang N, Li X, Xiong L. (2009) Identification and expression profiling analysis of TIFY family genes involved in stress and phytohormone responses in rice. Plant Mol Biol.71 (3):291-305.

Yoshida Y, Sano R, Wada T, Takabayashi J, Okada K (2009) Jasmonic acid control of GLABRA3 links inducible defense and trichome patterning in Arabidopsis. Development 136: 1039-1048.

Zhang Y and Turner JG (2008) Wound-induced endogenous jasmonates stunt plant growth by inhibiting mitosis. PLoS ONE 3: e3699. Zhao Y, Thilmony R, Bender CL, Schaller A, He SY, Howe GA (2003) Virulence systems of Pseudomonas syringae pv. tomato promote bacterial speck disease in tomato by targeting the jasmonate signaling pathway. Plant J 36: 485-499.

Zhu D, Cai H, Luo X, Bai X, Deyholos MK, Chen Q, Chen C, Ji W, Zhu Y (2012) Over- expression of a novel JAZ family gene from Glycine soja, increases salt and alkali stress tolerance. Biochem Biophys Res Commun. 426(2):273-9.