CONTROL OF CARDIAC GROWTH, DIFFERENTIATION AND HYPERTROPHY

INTRODUCTION

[01] Heart failure is the leading cause of morbidity in western cultures. Congestive heart failure (CHF) develops when plasma volume increases and fluid accumulates in the lungs, abdominal organs (especially the liver), and peripheral tissues. Cardiac hypertrophy is recognized as one of the independent risk factors leading to severe heart diseases such as ischemic heart diseases and heart failure. When cardiac hypertrophy is present, there is a 2.5 to 3 fold increase in the percentage of onset of heart failure, ischemic heart diseases such as angina pectoris and myocardial infarction, and cardiovascular diseases such as arrhythmia.

[02] Cardiac hypertrophy is a maladaptive mechanism made in response to an increased workload imposed on the heart. It is a specialized process reflecting a quantitative increase in cell size and mass rather than cell number, and may be the result of one or a combination of stimuli. It can be caused either by an increase of the width of myofibrils or by an increase of the length of myofibrils. These contrasting hypertrophic forms are derived respectively by parallel assembly and serial assembly of the sarcomeres, and termed concentric and eccentric hypertrophy, respectively.

[03] Cardiac hypertrophy can be induced by response to normal post-natal physiological adaptation or by movement, resulting in increased cardiac pump capacity corresponding to the increase in demand. However, a pathologically generated load on the heart may also induce cardiac hypertrophy that leads to heart disease. When the load on the ventricles is increased by hypertension or valvular disease of the heart, or when damage to the cardiomyocytes themselves is produced by myocardial infarction or myocarditis, pathological cardiac hypertrophy can occur. Cardiac hypertrophy is a compensatory mechanism of the heart to adapt to the increased mechanical load. However, prolonged cardiac hypertrophy results in systolic and diastolic dysfunctions of the heart, and eventually heart failure. Also, hypertrophic hearts become susceptible to ischemic heart disease and prone to fatal arrhythmia.

[04] The performance of a failing heart depends critically on the residual amount of a-MHC.

A normal human left ventricle contains -10% a-MHC and -90% β-MHC; however, in the failing human heart, a-MHC is virtually eliminated from the left ventricle, causing contractile dysfunction. In large animal models, increasing the expression of a-MHC by even a small amount can augment cardiac contraction by as much as 90%. In smaller mammals, a-MHC is also reduced in the stressed hearts, and an increase of a-MHC enhances cardiac contractility and resistance to pathological stress. Therefore, regardless of the size of mammals, a-MHC reduction in the stressed heart is a critical step toward myopathy and heart failure. [05] Conventional pharmacologic methods to treat chronic heart failure relied on inotropic drugs, with the objective of improving systolic capacity of the heart and to increase the cardiac output. Although inotropic drugs improved subjective symptoms and exercise tolerance, they failed to prolong life. In fact, these inotropic agents increase mortality. Newer therapies include inhibitors of angiotensin conversion enzyme (ACE), which suppresses the onset and development of cardiac hypertrophy in animal models, endothelin antagonists and vasopressin antagonists. Non-pharmacological treatment is primarily used as an adjunct to pharmacological treatment. One means of non-pharmacological treatment involves reducing the sodium in the diet. In addition, non-pharmacological treatment may include the elimination of precipitating drugs, including negative inotropic agents, cardiotoxins and plasma volume expanders.

[06] The treatment of heart disease is of great interest. As evidenced by the present invention, underlying mechanisms relate to fundamental control of gene expression, which is directly relevant to the clinical outcome of heart disease.

SUMMARY OF THE INVENTION

[07] Compositions and methods are provided for prevention and treatment of heart disease, including cardiac hypertrophy, myocardial infarction, and heart failure. The present invention is based on the finding that G9a/Glp histone methyltransferase and DNA methyltransferase (DNMT) cooperate to assemble repressive chromatin on the key molecular motor gene a-myosin heavy chain (a-MHC) to promote heart disease, including cardiac hypertrophy and failure. G9a/GLP and DNMT3 are activated in human hypertrophic hearts and in stressed human iPS-derived cardiomyocytes. Their activation is shown to be essential for H3K9/CpG methylation, which results in aberrant gene expression and hypertrophy. Identification of these pathogenic factors, and the availability of agent that inhibit G9a/GLP and DNMT activity, provide methods for the treatment and prevention of heart disease.

[08] In the methods of the invention, an effective dose of an inhibitor of H3K9/CpG methylation at a genetic locus that contributes to heart disease, including specifically the a-MHC locus, is administered to an individual suffering from cardiac hypertrophy or myocardial infarction; or diagnosed as being at risk of cardiac hypertrophy or myocardial infarction. In some embodiment, the inhibitor is an inhibitor of one or both of G9a/GLP and DNMT activity, and in some such embodiments, the inhibitor is a direct inhibitor of the enzyme, i.e. it directly acts to inhibit the activity of the targeted enzyme. In some embodiments the inhibitor selectively inhibits a DNMT3 enzyme, i.e. DNMT3A, DNMT3B or DNMT3L. In some embodiments the inhibitor selectively inhibits G9a/GLP.

[09] Embodiments of the present invention provide methods of reducing injury following myocardial infarction in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an inhibitor of H3K9/CpG methylation at a genetic locus that contributes to heart disease. Further embodiments of the present invention provide administering the inhibitor of H3K9/CpG methylation at a genetic locus that contributes to heart disease at the time of myocardial infarction, after myocardial infarction and/or before myocardial infarction. Embodiments of the present invention also provide methods of promoting myocardial repair following myocardial injury in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an an inhibitor of H3K9/CpG methylation at a genetic locus that contributes to heart disease. According to particular embodiments, the an inhibitor of H3K9/CpG methylation at a genetic locus that contributes to heart disease can be administered at the time of myocardial infarction, after myocardial infarction and/or before myocardial infarction. Embodiments of the present invention further provide methods of reducing myocardial injury and/or promoting mycocardial repair in reperfused or nonreperfused myocardial tissue.

[10] The dose of inhibitor may be effective for increasing the expression of oc-MHC, e.g. increasing expression, relative to a control in the absence of therapy, by 10%, 20%, 50%, 100% or more. The therapy may be continued for a period of time sufficient to provide such an effect, and may further be continued on a maintenance dose. The therapy may be combined with conventional agents for treatment of cardiac hypertrophy, including without limitation inhibitors of angiotensin conversion enzyme (ACE); endothelin antagonists; vasopressin antagonists; and the like.

[1 1 ] Individuals in need of treatment may be identified by various clinical indicia, and relevant biomarkers. In addition to human patients, various non-human mammals may be treated for veterinary or research purposes.

[12] In other embodiments, a pharmaceutical formulation is provided comprising a unit dose of an inhibitor of H3K9/CpG methylation, e.g. at the oc-MHC locus, including an inhibitor of one or both of G9a/GLP and DNMT, to administered to an individual in need thereof. In some embodiments the inhibitor is a direct inhibitor of the enzyme, i.e. it directly acts to inhibit the activity of the targeted enzyme. In some embodiments the inhibitor selectively inhibits a DNMT3 enzyme, i.e. DNMT3A, DNMT3B or DNMT3L. In some embodiments the inhibitor selectively inhibits G9a/GLP. The dose of inhibitor may be effective for increasing the expression of oc-MHC, e.g. increasing expression relative to a control in the absence of therapy by 10%, 20%, 50%, 100% or more. Formulations may provide for systemic administration, or may provide for a localized administration to cardiac tissue. Small molecule inhibitors of G9a/GLP and DNMT are known in the art and may be used in the methods of the invention, or may be modified for use by conventional medicinal chemistry modifications. BRIEF DESCRI PTION OF THE DRAWINGS

[13] Figure 1 . H3K9 methylation by G9a/Glp underlies cardiac hypertrophy and failure a, b,

Quantitation of H3K9me2 ChIP of the proximal promoters of a-MHC (a) and β-MHC (b) in fetal hearts (E12.5), sham-operated adult hearts, and TAC-treated adult hearts. Data are presented as H3K9me2 enrichment relative to IgG control. P-value: Student's t-test. Error bar: SEM, standard error of the mean, c, mRNA expression of H3K9 methyltransferases in adult hearts after 7 days of TAC. P-value: Student's t-test. Error bar: SEM, standard error of the mean, d- g, Immunostaining of G9a and Glp in adult hearts 7 days after sham or TAC procedure. Green: wheat germ agglutinin staining (WGA) outlining cell borders. Red: G9a or Glp immunostaining. Blue: DAPI nuclear staining. Arrows point to nuclei of cardiomyocytes. h, i, Quantitation of ventricle-body weight ratio (h) and cardiomyocyte size (i) in littermate control and mutant mice lacking myocardial G9a 14 days after sham or TAC operation. Ctrhcontrol mice. G9a null: Tnnt2-rtTA;Tre-Cre;G9af/f mice, j, k, Trichrome staining of cardiac fibrosis in littermate control and mutant mice lacking myocardial G9a 2 weeks after sham or TAC operation. Ctrl: control. G9a null: Tnnt2-rtTA;Tre-Cre;G9af/f mice. Red: cardiomyocytes. Blue: fibrosis. I, Echocardiographic measurement of fractional shortening of the left ventricle after 14 days of TAC. Ctrl: control. G9a null: Tnnt2-rtTA;Tre-Cre;G9at/f m\ce. P-value: Student's t-test. Error bar: SEM, standard error of the mean, m, n, Quantitation of ventricle-body weight ratio (m) and cardiomyocyte size (n) of PBS- and BlX-treated mice 14 days after the sham or TAC operation. PBS: phosphate buffered saline. P value:Student's t-test. Error bar: SEM, standard error of the mean, o, p, Trichrome staining of cardiac fibrosis 14 days after TAC operation. Red: cardiomyocytes. Blue: fibrosis, q, Echocardiographic measurement of fractional shortening of the left ventricle after 2 weeks of TAC. P-value: Student's t-test. Error bar: SEM, standard error of the mean, r, Quantitation of H3K9me2 ChIP on the a-MHC proximal promoter 2 days after sham or TAC operation. Ctrl: control heart. G9a null: Tnnt2-rtTA;Tre- Cre;G9at/f heart. BIX: BlX-treated heart. Data are presented as the enrichment relative to the sham-operated hearts. P-value: Student's t test. Error bar: SEM, standard error of the mean, s, Quantitation of a-MHC mRNA 2 days after sham or TAC operation. Ctrl: control heart. G9a null: Tnnt2-rtTA;Tre-Cre;G9af/f hearl PBS: PBS-treated heart. BIX: BlX-treated heart. P-value: Student's t-test. Error bar: SEM, standard error of the mean, t, Quantitation of H3K9me2 ChIP on the β- -ZC proximal promoter 2 days after sham or TAC operation. Ctrl: control heart. G9a null: Tnnt2-rtTA;Tre-Cre;G9af/f heart. BIX: BlX-treated heart. Data are presented as the enrichment relative to the sham-operated hearts. P-value: Student's t test. Error bar: SEM, standard error of the mean, u, Quantitation of -ΜΗΟ mRNA 2 days after sham or TAC operation. Ctrl: control heart. G9a null: Tnnt2-rtTA;Tre-Cre;G9af/f heart. PBS: PBS-treated heart. BIX: BlX-treated heart. P-value: Student's t-test. Error bar: SEM, standard error of the mean.

[14] Figure 2. DNA methylation and Dnmt activity is essential for cardiac hypertrophy a, b,

Distribution of CpG sites across the proximal promoters or 5'-untranslated regions of murine a-MHC (a) and β-MHC (b), as well as the methylation of those CpG sites in fetal heart ventricles (E12.5) and adult heart ventricles after 2 days, 7 days and 14 days of sham or TAC operation. The numbers denote the position of CpG sites relative to the transcriptional start site (+1 ). The CpG sites are color coded. Open and closed circles represent unmethylated and methylated CpG sites, respectively. Each column of circles refers to the sequencing results (at a given CpG site) of 12 randomly selected clones of PCR products amplified from sodium bisulfite-modified genomic DNA. %: percentage of CpG methylation (closed circles) relative to total number of sites sequenced (closed and open circles), c, Quantitation of mRNA of Dnmts in adult hearts after 7 days of sham or TAC operation. P value: Student's t-test. Error bar: SEM, standard error of the mean, d, e, Immunostaining of Dnmt3a in adult hearts 7 days after sham or TAC procedure. Green:wheat germ agglutinin staining (WGA) outlining cell borders. Red: Dnmt3a immunostaining. Blue: DAPI nuclear staining. Arrows point to nuclei of cardiomyocytes. f, g, Quantitation of ventricle-body weight ratio (f) and cardiomyocyte size (g) of PBS- and AZA-treated mice 14 days after the sham or TAC operation. P-value: Student's t- test. Error bar: SEM, standard error of the mean, h, i, Trichrome staining of cardiac fibrosis 14 days after TAC operation. Red: cardiomyocytes. Blue: fibrosis. PBS: PBS-treated heart. AZA: AZA-treated heart, j, Echocardiographic measurement of fractional shortening of the left ventricle after 14 days of sham or TAC operation. PBS: PBS-treated heart. AZA: AZA-treated heart, k, Methylation of CpG sites on the proximal promoter of a-MHC in hearts with PBS or AZA treatment 2 days after sham or TAC operation. Representative sequencing results and quantitation analysis of CpG methylation of individual hearts are shown. N represents the number of different hearts used for analysis, with each heart having 12 randomly selected clones sequenced. P-value: Student's t-test. Error bar: SEM, standard error of the mean. I, m, Quantitation of a-MHC (I) and β-MHC (m) mRNA in hearts treated with PBS or AZA 2 days after sham or TAC operation. P-value: Student's t-test. Error bar: SEM.

[15] Figure 3. Sequential recruitment of chromatin regulators to build repressive chromatins a, Quantitation of G9a ChIP on the proximal promoter of a-MHC 2 days after sham or TAC operation. Data are presented as G9a enrichment relative to IgG control. P-value: Student's t- test Error bar: SEM, standard error of the mean, b, Quantitation of Dnmt3a ChIP on the proximal promoter of a-MHC 2 days after sham or TAC operation. Data are presented as Dnmt3a enrichment relative to IgG control. P-value: Student's t test. Error bar: SEM, standard error of the mean, c, Co-immunoprecipitation of G9a and Dnmt3a in the left ventricles 2 days after TAC. d, Quantitation of G9a and H3K9me2 ChIP on the proximal promoter of a-MHC 2 days after sham or TAC operation. Data are presented as G9a or H3K9me2 enrichment relative to sham control. P-value: Student's t-test. Error bar: SEM, standard error of the mean, e, Quantitation of Dnmt3a ChIP on the proximal promoter of a-MHC 2 days in G9a-null hearts 2 days after sham or TAC operation. G9a null: Tnnt2-rtTA;Tre-Cre;G9af/f heart. Data are presented as Dnmt3a enrichment relative to sham control. P-value: Student's t-test. Error bar: SEM, standard error of the mean, f, Quantitation of CpG methylation of a-MHC in G9a-null hearts. Representative sequencing results and quantitation analysis of CpG methylation of individual hearts are shown. G9a null: Tnnt2-rtTA;Tre-Cre;G9af/f heart. N represents the number of different hearts used for analysis, with each heart having 12 randomly selected clones sequenced. P-value: Student's t-test. Error bar: SEM, standard error of the mean, g, Co-immunoprecipitation of Brg1 with G9a and Dnmt3a in the left ventricles 2 days after TAC. h, Quantitation of Brg1 ChIP on the proximal promoter of a-MHC in G9a-null and AZA-treated hearts 2 days after sham or TAC operation. G9a null: Tnnt2-rtTA;Tre-Cre;G9af/f heart. P- value: Student's t-test. Error bar: SEM, standard error of the mean, i, Quantitation of G9a and H3K9me2 ChIP on the proximal promoter of a-MHC in Brg1-ru\\ hearts 2 days after sham or TAC operation. Brg1 null: Tnnt2-rtTA;Tre-Cre;Brg1f/f heart P-value: Student's t-test. Error bar: SEM, standard error of the mean, j, Quantitation of Dnmt3a ChIP on the proximal promoter of a-MHC in Brg1-ru\\ hearts 2 days after sham or TAC operation. Brg1 null: Tnnt2-rtTA;Tre- Cre;Brg1f/f heart. P-value: Student's t test. Error bar: SEM, standard error of the mean, k, Quantitation of CpG methylation of a-MHC in Brg1-ru\\ hearts. Representative sequencing results and quantitation analysis of CpG methylation of individual hearts are shown. Brg1 null: Tnnt2-rtTA;Tre-Cre;Brg1 f/f heart. N represents the number of different hearts used for analysis, with each heart having 12 randomly selected clones sequenced. P-value: Student's t-test. Error bar: SEM, standard error of the mean.

[16] Figure 4. Activation of G9a/GLP, DNMT3, and chromatin methylation in human hypertrophic hearts and iPS-derived cardiomyocytes a, Quantitation of a-MHC and β-MHC mRNA in normal and hypertrophic left ventricles of human hearts. Ctrl: control. LVH: left ventricular hypertrophy. P-value: Student's t-test. Error bar: SEM, standard error of the mean, b, Quantitation of H3K9me2 ChIP on the proximal promoters of human a-MHC and β-MHC in normal and hypertrophic left ventricles of human hearts. Ctrl: control. LVH: left ventricular hypertrophy. P-value: Student's t-test. Error bar: SEM, standard error of the mean, c, d, Distribution of the CpG sites across the proximal promoter of human a-MHC (c) and quantitation of CpG methylation on a-MHC (d). The numbers denote the position of CpG sites relative to the transcriptional start site (+1 ). The CpG sites are color coded. Open and closed circles represent unmethylated and methylated CpG sites, respectively. Each column of circles (c) refers to the sequencing results (at a given CpG site) of 12 randomly selected clones of PCR products amplified from sodium bisulfite-modified genomic DNA. Ctrl: control. LVH: left ventricular hypertrophy. N represents the number of different hearts used for analysis, with each heart having 12 randomly selected clones sequenced. P-value: Student's t-test. Error bar: SEM, standard error of the mean, e, f, Distribution of the CpG sites across the proximal promoter of human β- -ZC (e) and quantitation of CpG methylation on β-ΜΗΟ (f). Ctrl: control. LVH: left ventricular hypertrophy. N represents the number of different hearts used for analysis, with each heart having 12 randomly selected clones sequenced. P-value: Student's t-test. Error bar: SEM, standard error of the mean, g, Quantitation of human G9a and GLP. Ctrl: control. LVH: left ventricular hypertrophy. P value: Student's t-test. Error bar: SEM, standard error of the mean, h, Quantitation of human DNMT3a and DNMT3b. Ctrl: control. LVH: left ventricular hypertrophy. P-value: Student's t-test. Error bar: SEM, standard error of the mean, i, j, Correlation of G9a and GLP mRNA level (x axis) with -/a-MHC mRNA ratio (y axis) (i) and with H3K9 methylation of a-MHC (y axis) (j). Red: regression curve, e, the base of natural logarithm (-2.718). Arrow and dashed line, the inflection point, k, I, Correlation of DNMT3a and DNMT3b mRNA level (x axis) with -/a-MHC mRNA ratio (y axis) (k) and with CpG methylation of a-MHC (y axis) (I). Red: regression curve, e, the base of natural logarithm (-2.718). m, Quantitation of G9a, GLP, DNMT3a and DNMT3b mRNA in control and endothelin-1 treated human iPS-derived cardiomyocytes (iCMs). Ctrl: control. ET-1 : endothelin-1 . P-value: Student's t-test. Error bar: SEM, standard error of the mean, n-r, Quantitation of cell size, -MHC, β-MHC, ANF and BNP mRNA in control and drug treated iCMs. Ctrl: control. ET-1 : endothelin-1 . PBS: PBS-treated cells. BIX: BlX-treated cells. AZA: AZA-treated cells. P-value: Student's t-test. Error bar: SEM, standard error of the mean, s, Working model showing that cardiac stress triggers sequential recruitment of chromatin regulators on the a-MHC locus to establish a repressive chromatin scaffold. H: histone. K9: the ninth lysine residue of histone H3 N-terminal tail. C: cytosine at the CpG site. Me: methyl group on H3K9 or CpG sites.

[17] Figure 5. G9a and GIp immunostaining and cardiomyocyte size a, b, Immunostaining of G9a and GIp in E12.5 left ventricle. Red: G9a or GIp immunostaining. Blue: DAPI nuclear staining. Arrows point to nuclei of cardiomyocytes. c, d, Immunostaining of G9a in doxycycline (DOX)-treated littermate control {Tnnt2-rtTA;Tre-Cre;G9af/+) and G9a-null { Tnnt2-rtTA;Tre- Cre;G9at/f) hearts after TAC. The staining shows the absence of G9a proteins in cardiomyocytes (arrows) but not endothelial cells (arrowheads) in the heart of DOX-treated Tnnt2-rtTA;Tre-Cre;G9af/f mice. Green: wheat germ agglutinin staining (WGA) outlining cell borders. Red: G9a immunostaining. Blue: DAPI nuclear staining, e-h, Wheat germ agglutinin (WGA) immunostaining of control and G¾-null mice lacking myocardial G9a 14 days after sham or TAC operation. Ctrl: control mice. G9a null: Tnnt2-rtTA;Tre-Cre;G9af/f mice, i-l, Wheat germ agglutinin (WGA) immunostaining of PBS- and BlX-treated mice 14 days after the sham or TAC operation, m-n, Ventricle-body weight ratio of mice 2 days after TAC. P- value: Student's t-test. Error bar: SEM, standard error of the mean.

[18] Figure 6. Echocardiographic assessment of the left ventricular function

Echocardiographic assessment of fractional shortening of the left ventricle of G9a null, BIX- or AZA- treated hearts 14 days after sham or TAC operation. Representative M-mode images of the short axis of transthoracic left ventricle echocardiography. The image was taken at the mid-papillary muscle level, and measurement of left ventricular fractional shortening was performed over five heart beats. Vertical scale bar, 2 mm; Horizontal scale bar, 200 milliseconds, a-d, Control and G9a null ( Tnnt2-rtTA;Tre-Cre;G9af/f) mice, e-h, PBS- and BlX- treated mice, i-l, PBS- and AZA-treated mice.

[19] Figure 7. DNMT3 immunostaining, cardiomyocyte size, and Dnmt3 ChlP-qPCR a-d,

Immunostaining of Dnmt3a and Dnmt3b in the left ventricle of E12.5 embryos (a, b) and adult mice 7 days after sham or TAC operation (c, d). Red: Dnmt3a or Dnmt3b. Blue: DAPI nuclear staining. Arrowheads point to nuclei of cardiomyocytes. e-h, Wheat germ agglutinin (WGA) immunostaining of PBS- and AZA-treated mice 14 days after the sham or TAC operation, i, ChlP-qPCR of Dnmt3b on the proximal promoters of MHC genes 2 days after sham or TAC operation. Data are presented as Dnmt3b enrichment relative to IgG control. P-value: Student's t-test. Error bar: SEM, standard error of the mean, j, Co-immunoprecipitation of Dnmt3b with G9a and Brg1 in the left ventricle of mice 2 days after TAC operation, k, I, ChlP- qPCR of Dnmt3b on the proximal promoters of MHC genes 2 days after sham or TAC operation in G9a-null (K) and Brg1 -null (L) mice. Data are presented as Dnmt3b enrichment in TAC hearts relative to Sham control. P-value: Student's t-test. Error bar: SEM, standard error of the mean.

[20] Figure 8. Brg1, G9a, and Dnmt3 are not downstream targets of each other a,

Quantitation of G9a and Glp mRNA 2 days after TAC operation in PBS- and AZA-treated hearts.. Ctrl: control heart. G9a null: Tnnt2-rtTA;Tre-Cre;G9af/f heart. PBS: PBS-treated heart. AZA: AZA-treated heart. P-value: Student's t-test. Error bar: SEM, standard error of the mean, b, c, Immunostaining of G9a in PBS- and AZA-treated hearts 2 days after TAC. Green: wheat germ agglutinin staining (WGA) outlining cell borders. Red: G9a immunostaining. Blue: DAPI nuclear staining. Arrows point to nuclei of cardiomyocytes. d, Quantitation of Dnmt3a and Dnmt3b mRNA 2 days after TAC in control and G9a null hearts. Ctrl: control heart. G9a null: Tnnt2-rtTA;Tre-Cre; G9at/f heart. P-value: Student's t-test. Error bar: SEM, standard error of the mean, e-h, Immunostaining of Dnmt3a or Dnmt3b in control, G9a null heart 2 days after TAC. Green :wheat germ agglutinin staining (WGA) outlining cell borders. Red: Dnmt3a or Dnmt3b immunostaining. Blue: DAPI nuclear staining. Arrows point to nuclei of cardiomyocytes. i, Quantitation of G9a, Dnmt3a, and Dnmt3b mRNA 2 days after TAC operation in control and Brg1 null hearts.. Ctrl: control heart. Brg1 null: dox-treated Tnnt2- rtTA;Tre-Cre;Brg1f/f heart. P-value: Student's t-test. Error bar: SEM, standard error of the mean, j-o Immunostaining of G9a (j, k), Dnmt3a (I, m), and Dnmt3b (n, o) in control and Brg1 null (dox-treated Tnnt2-rtTA;Tre-Cre;Brg1 f/f ) hearts 2 days after TAC. Green: wheat germ agglutinin staining (WGA) outlining cell borders. Red: G9a, Dnmt3a, or Dnmt3b. Blue: DAPI nuclear staining. Arrows point to nuclei of cardiomyocytes.

[21 ] Figure 9. Demography of heart transplantation donors. The left ventricular wall thickness and function was assessed by echocardiography or cardiac magnetic resonance imaging. Tissue assays performed include DNA methylation (D), RT-qPCR (q), and/or ChlP- qPCR (C). Not all assays could be performed in a given tissue sample due to the quality and amount of tissue materials available. LV: left ventricle. EF: ejection fraction (normal value is 55-65%). IHC: intracranial hemorrhage. BMI: body mass index (normal value is less than 25). LVH: left ventricular hypertrophy. HTN: hypertension.

[22] Figure 10. Beating cardiomyocytes derived from human iPS cells and their hypertrophic response to ET-1 a, iPS-derived human cardiomyocytes (iCMs) form monolayer. Images were taken from bright field microscope. Lower panel shows zoom-in image of the cells, b, Homogeneous beating activity of the iCMs was recorded, c, Immunostaining of oc- Actinin and Troponin-T in iCMs. Blue: DAPI nuclear staining. Green: oc-Actinin or Troponin-T staining, d, Quantitation of cell size, -MHC, β-MHC, ANF and BNP mRNA in control and endothelin-1 treated iCMs. Ctrl: control. ET-1 : endothelin-1 . P-value: Student's t-test. Error bar: SEM, standard error of the mean.

[23] Figure 1 1 . Expression of Class I HDACs and PARP1 in TAC-stressed mouse hearts or human myopathic hearts a, mRNA expression of Class I Hdac genes (Hdad, 2, 3) and Parpl in adult mouse hearts after sham, 2 or 7 days of TAC procedure. P-value: Student's t-test. Error bar: SEM, standard error of the mean, b, mRNA expression of Class-I HDAC genes (HDAC1, 2, 3) and PARP1 in normal and hypertrophic left ventricles of human hearts. Ctrl: control. LVH: left ventricular hypertrophy. P-value: Student's t-test. Error bar: SEM, standard error of the mean.

[24] Figure 12. G9a inhibition reduces myocardial infarction. Representative hearts after 9 days of acute occlusion of the LAD coronary artery with PBS (infusion pump N=4; IP injection, N=5) or BIX treatment (infusion pump N=5; IP injection, N=6). The areas of myocardial infarction are delineated from back view (a) , side view (b) or front view (c) of the hearts, d, Myocardial sections from those hearts were also stained with TTC: white staining indicates infarction. DETAILED DESCRI PTION OF THE EMBODIMENTS

[25] Methods and compositions for the treatment of heart diseases including but not limited to cardiomyopathies; heart failure; and the like, are provided. The invention is based, in part, on the evaluation of the expression and role of enzymes that are differentially expressed in the heart, including cardiomyocytes and endothelial cells, in response to pressure overload. Enzymes involved in H3K9/CpG methylation are activated in stressed cardiomyocytes, resulting in the assembly of repressive chromatin on the key molecular motor gene a-myosin heavy chain (a-MHC), which promotes cardiac hypertrophy and failure. Enzymes of interest include G9a/Glp histone methyltransferase and DNA methyltransferase (DNMT). Methods of treatment are provided, where these enzymes are inhibited in individuals in need thereof. The findings also provides for diagnostic methods, in determining the presence of modified chromatin at the a-MHC locus, and activity of histone methyltransferase and DNA methyltransferase in cardiomyocytes. The invention also provides methods for the identification of compounds that modulate cardiac hypertrophy and myopathy, e.g. through specific inhibition of G9a/Glp histone methyltransferase and/or DNA methyltransferase (DNMT) activity and/or expression, including the optimization and formulation of known inhibitors for therapeutic purposes.

[26] Functional inhibition of enzymes involved in H3K9/CpG methylation in cardiomyocytes provides a point of intervention to block the pathophysiologic processes of hypertrophy and enlargement, and also provides therapeutic intervention in other cardiovascular system diseases with similar pathophysiologies, to prevent, attenuate or reduce damage in prophylactic strategies in patients at high-risk of heart failure. The agent that acts to decrease such gene product activity can be an anti-sense or RNAi nucleic acid, neutralizing antibodies or any agent that acts as an inhibitor of the enzyme, e.g. a direct pharmacological inhibitor.

[27] Various techniques and reagents find use in the diagnostic and screening methods. In one embodiment of the invention, clinical samples are assayed for the presence of repressive chromatin at the a-MHC locus; or for the presence of enzymes associated with H3K9/CpG methylation. In some embodiments a cell sample of heart tissue is analyzed for the presence of such chromatin or enzymes.

Histone/CpG methylation and inhibitors thereof.

[28] H3K9 methylation. The lysine at position 9 along the histone 3 tail can be modified to a mono- (H3K9me1 ), di-(H3K9me2) or tri-methylated state (H3K9me3). Although both di-, and tri-methylation of Histone H3 lysine 9 (H3K9) are essential repressive chromatin modification, H3K9Me2 is of particular interest because it is critical for silencing euchromatin within gene rich areas across the genome. H3K9me3, on the contrary, marks heterochromatin and mainly locates to gene-poor regions of repetitive DNA. Furthermore, H3K9me2 is demonstrated to be associated directly with gene repression. Given the myosin heavy chain genes are actively transcribed in cardiac tissue, H3K9Me2 is likely to be enriched and perform the transcriptional control.

[29] H3K9 methyltransferase. In mammals, the methylation of H3K9 depends on members of the histone lysine methyltransferase (HKMT) family, consisting of Ehmt1 /Glp, Ehmt2/G9a, Suv39h1 , Suv39h2, Setdbl and Setdb2, as well as the non-Suv39 enzymes Prdm2 and Ashl L. Among all known HKMTs, G9a and GLP, which form a heterodimeric enzyme complex, are the major HKMTs for H3K9 methylation on the euchromatin. Setdbl and 2 are also HKMTs which catalyze H3K9 methylation on the euchromatin. In contrast, Suv39h1 and 2 are primary HKMTs that target the pericentric heterochromatin. Prdm2 functions as a tumor suppressor. Ashl L, on the other hand, is not specific for H3K9; it also methylates H3K4, H4K20, and H3K36.

[30] G9a is a SET domain containing lysine-specific histone methyltransferase. The human gene sequence may be referenced at Genbank accession number NM 006709.3, and is located on chromosome 6, 31 .85-31 .87 Mb.

[31 ] A number of small molecule inhibitors of G9a are known in the art, including quinazolines, of which the class of 7-aminoalkoxy-quinazolines have been shown to be specific direct inhibitors of G9a, (see Chang et al. (2009) Nat. Struct. Bio. 16(3):312-317; Kubicek et al. (2007) Mol. Cell. 25(3):473-481 ). It has been shown that BIX-01294 (diazepin- quinazolin-amine derivative), does not compete with the cofactor S-adenosyl-methionine, and selectively impairs the G9a HMTase and the generation of H3K9me2 in vitro.

[32] Analogs and derivatives of BIX are also known in the art. For example, Malmquist et al. (2012) PNAS 109(41 ):16708-13 synthesized a compound library based upon the known specific inhibitor (BIX-01294) of the human G9a histone methyltransferase to generate the derivative TM2-1 15. Liu et al. (201 1 ) J. Med. Chem. 54(17):6139-50; describes optimization of cellular activity of G9a inhibitors 7-aminoalkoxy-quinazolines. The derivative UNC0321 was generated via structure-based design and structure-activity relationship (SAR) exploration of the quinazoline scaffold represented by BIX01294. Design and synthesis of several generations of new analogues aimed at improving cell membrane permeability while maintaining high in vitro potency resulted in the discovery of a number of novel G9a inhibitors such as UNC0646 and UNC0631 with excellent potency in a variety of cell lines and excellent separation of functional potency versus cell toxicity. Alternatively, Chang et al. (2010) J. Mol. Biol. 400(1 ):1 -7, applied the concept of adding a lysine mimic to BIX-01294 by including a 5- aminopentyloxy moiety, which is inserted into the target lysine-binding channel and becomes methylated by G9a-like protein. The compound enhances its potency in vitro and reduces cell toxicity in vivo. Each of the references cited above are specifically incorporated by reference for the teaching of compounds that inhibit G9a. [33] High throughput screening assays are also known in the art for screening candidate compounds for G9a inhibition, including screening of analogs and variants of known inhibitors. For example, see Dhayalan et al. (2009) J. Biomol. Screen. 14(9):1 129-1 133, herein incorporated by reference, for a continuous protein methylation assay using the G9a protein lysine methyltransferase and its substrate protein WIZ (widely interspaced zinc finger motifs). The assay is based on the coupling of the biotinylated substrate protein to streptavidin-coated FlashPlates and the transfer of radioactive methyl groups from the S-adenosyl-L-methionine to the substrate. The reaction progress is monitored continuously by proximity scintillation counting.

[34] DNMT. DNA cytosine-5 methyltransferases (DNMTs) catalyze the transfer of a methyl group to the CpG sites of DNA. In mammals, three active DNMTs have been identified— Dnmtl , Dnmt3a, and Dnmt3b. Dnmtl methylates the hemimethylated CpG di-nucleotides in the mammalian genome during DNA replication to maintain DNA methylation during cell proliferation. In contrast, Dnmt3a and Dnmt3b are the methyltransferases that catalyze de novo DNA methylation. Consistent with cardiomyocytes being post-mitotic, only the de novo Dnmt3a and 3b, but not the maintenance Dnmtl , methyltransferases are induced in the cardiomyocytes after pressure overload.

[35] DNMT3 is a family of DNA methyltransferases that could methylate hemimethylated and unmethylated CpG at the same rate. The architecture of DNMT3 enzymes is similar to that of DNMT1 , with a regulatory region attached to a catalytic domain. There are three known members of the DNMT3 family: DNMT3a, 3b, and 3L. DNMT3a and DNMT3b can mediate methylation-independent gene repression, DNMT3L can recruit DNMT3 to target sites on the chromatin. DNMT3a can co-localize HP1 and methyl-CpG-binding protein (MeCBP).

[36] The reference sequence for human DNMT3A may be found in Genbank at accession number NG_029465.1 ; and the reference sequence for human DNMT3B may be found at accession number NG_007290.1 .

[37] Small molecule inhibitors of DNMT are known in the art, including direct inhibitors. 5- azacytidine and decitabine (5-aza-2'-deoxycytidine) are well-known inhibitors. Also known in the art as inhibitors are RG108 (Savickiene et al. (2012) Cell Biol. Int. 36(1 1 ):1067-78); zebularine (You et al. (2012) Mol. Biol. Rep. 39(10):9723-9731 ); procainamide and analogs and derivatives thereof (Halby et al. (2012) Chembiochem. 13(1 ) :157-165); etc.

[38] In addition to the known small molecule inhibitors, inhibitors of interest for G9a/GLP and DNMT, particularly DNMT3a/b/l, include agents that directly inhibit expression, e.g. RNAi, antisense specific for the targeted gene; and agents that act on the protein, e.g. specific antibodies and analogs thereof, small organic molecules that block activity, etc. [39] Antisense molecules can be used to down-regulate expression in cells. The antisense reagent may be antisense oligonucleotides (ODN), particularly synthetic ODN having chemical modifications from native nucleic acids, or nucleic acid constructs that express such antisense molecules as RNA. The antisense sequence is complementary to the mRNA of the targeted gene, and inhibits expression of the targeted gene products. Antisense molecules inhibit gene expression through various mechanisms, e.g. by reducing the amount of mRNA available for translation, through activation of RNAse H, or steric hindrance. One or a combination of antisense molecules may be administered, where a combination may comprise multiple different sequences.

[40] RNAi technology refers to a process in which double-stranded RNA is introduced into cells expressing a candidate gene to inhibit expression of the candidate gene, i.e., to "silence" its expression. The dsRNA is selected to have substantial identity with the candidate gene. In general such methods initially involve transcribing a nucleic acids containing all or part of a candidate gene into single- or double-stranded RNA. Sense and anti-sense RNA strands are allowed to anneal under appropriate conditions to form dsRNA. The resulting dsRNA is introduced into cells via various methods. Usually the dsRNA consists of two separate complementary RNA strands. However, in some instances, the dsRNA may be formed by a single strand of RNA that is self-complementary, such that the strand loops back upon itself to form a hairpin loop. Regardless of form, RNA duplex formation can occur inside or outside of a cell.

[41 ] A number of options can be utilized to deliver the dsRNA into a cell or population of cells, e.g. cardiac endothelial cells and/or cardiomyocytes. For instance, RNA can be directly introduced intracellular^. Various physical methods are generally utilized in such instances, such as administration by microinjection (see, e.g., Zernicka-Goetz, et al. (1997) Development 124:1 133-1 137; and Wianny, et al. (1998) Chromosoma 107: 430-439). Other options for cellular delivery include permeabilizing the cell membrane and electroporation in the presence of the dsRNA, liposome-mediated transfection, or transfection using chemicals such as calcium phosphate. A number of established gene therapy techniques can also be utilized to introduce the dsRNA into a cell. By introducing a viral construct within a viral particle, for instance, one can achieve efficient introduction of an expression construct into the cell and transcription of the RNA encoded by the construct.

Disease Conditions

[42] Heart failure is a general term that describes the final common pathway of many disease processes. Heart failure is usually caused by a reduction in the efficiency of cardiac muscle contraction. However, mechanical overload with normal or elevated cardiac contraction can also cause heart failure. This mechanical overload may be due to arterial hypertension, or stenosis or leakage of the aortic, mitral, or pulmonary valves, or other causes. The initial response to overload is usually hypertrophy (cellular enlargement) of the myocardium to increase force production, returning cardiac output (CO) to normal levels. Typically, a hypertrophic heart has impaired relaxation, a syndrome referred to as diastolic dysfunction. In the natural history of the disease, compensatory hypertrophy in the face of ongoing overload is followed by thinning, dilation, and enlargement, resulting in systolic dysfunction, also commonly known as heart failure. This natural progression typically occurs over the course of months to many years in humans, depending on the severity of the overload stimulus. Intervention at the hypertrophy stage can slow or prevent the progression to the clinically significant systolic dysfunction stage. Thus, diagnosis in the early hypertrophy stage provides unique therapeutic opportunities. The most common cause of congestive heart failure is coronary artery disease, which can cause a myocardial infarction (heart attack), which forces the heart to carry out the same work with fewer heart cells. The result is a pathophysiological state where the heart is unable to pump out enough blood to meet the nutrient and oxygen requirements of metabolizing tissues or cells.

[43] In LV failure, CO declines and pulmonary venous pressure increases. Elevated pulmonary capillary pressure to levels that exceed the oncotic pressure of the plasma proteins (about 24 mm Hg) leads to increased lung water, reduced pulmonary compliance, and a rise in the 0 ₂ cost of the work of breathing. Pulmonary venous hypertension and edema resulting from LV failure significantly alter pulmonary mechanics and, thereby, ventilation/perfusion relationships. When pulmonary venous hydrostatic pressure exceeds plasma protein oncotic pressure, fluid extravasates into the capillaries, the interstitial space, and the alveoli.

[44] Increased heart rate and myocardial contractility, arteriolar constriction in selected vascular beds, venoconstriction, and Na and water retention compensate in the early stages for reduced ventricular performance. Adverse effects of these compensatory efforts include increased cardiac work, reduced coronary perfusion, increased cardiac preload and afterload, fluid retention resulting in congestion, myocyte loss, increased K excretion, and cardiac arrhythmia.

[45] The mechanism by which an asymptomatic patient with cardiac dysfunction develops overt CHF is unknown, but it begins with renal retention of Na and water, secondary to decreased renal perfusion. Thus, as cardiac function deteriorates, renal blood flow decreases in proportion to the reduced CO, the GFR falls, and blood flow within the kidney is redistributed. The filtration fraction and filtered Na decrease, but tubular resorption increases.

[46] Although symptoms and signs, for example exertional dyspnea, orthopnea, edema, tachycardia, pulmonary rales, a third heart sound, jugular venous distention, etc. have a diagnostic specificity of 70 to 90%, the sensitivity and predictive accuracy of conventional tests are low. Elevated levels of B-type natriuretic peptide may be diagnostic. Adjunctive tests include CBC, blood creatinine, BUN, electrolytes (eg, Mg, Ca), glucose, albumin, and liver function tests. ECG may be performed in all patients with HF, although findings are not specific.

Patients diagnosed as being at risk for heart failure may be appropriately treated with the methods of the invention to reduce the risk of heart failure. In addition to treatment with inhibitors of H3K9/CpG methylation at the oc-MHC locus, the individual may be treated with conventional therapy, including diuretics, ACE inhibitors, digitalis, and β-blockers.

Arterial hypertension, or the elevation of systolic and/or diastolic BP, either primary or secondary, is frequently associated with pressure overload of the heart, and is an important risk factor for heart failure. Hypertensive patients may be analyzed by the diagnostic methods of the invention, in order to determine whether there is a concurrent development of hypertrophy, diastolic dysfunction, and a tendency to heart failure. Criteria for hypertension is typically over about 140 mm Hg systolic blood pressure, and/or diastolic blood pressure of greater than about 90 mm Hg.

Primary (essential) hypertension is of unknown etiology; its diverse hemodynamic and pathophysiologic derangements are unlikely to result from a single cause. Heredity is a predisposing factor, but the exact mechanism is unclear. The pathogenic mechanisms can lead to increased total peripheral vascular resistance by inducing vasoconstriction and to increased cardiac output.

While no early pathologic changes occur in primary hypertension, ultimately, generalized arteriolar sclerosis develops. Left ventricular hypertrophy and, eventually, dilation develop gradually. Coronary, cerebral, aortic, renal, and peripheral atherosclerosis are more common and more severe in hypertensives because hypertension accelerates atherogenesis.

Valvular disease, including stenosis or insufficiency of the aortic, mitral, pulmonary, or tricuspid valves, is also frequently associated with overload of the heart, and is another important risk factor for heart failure. Patients with valvular disease may be analyzed by the diagnostic methods of the invention, in order to determine whether ther is a concurrent development of hypertrophy, diastolic dysfunction, and a tendency to heart failure. Valvular disease is typically diagnosed by echocardiographic measurement of significant valvular stenoses or insufficiencies. Valvular heart disease has many etiologies, including but not limited to rheumatic heart disease, congenital valve defects, endocarditis, aging, etc. The pathogenic mechanism whereby valvular disease leads to heart failure is the obstruction of blood outflow from various chambers of the heart, thus increasing load.

Cardiomyopathy refers to a structural or functional abnormality of the ventricular myocardium. Cardiomyopathy has many causes. Pathophysiologic classification (dilated congestive, hypertrophic, or restrictive cardiomyopathy) by means of history, physical examination, and invasive or noninvasive testing may be performed. If no cause can be found, cardiomyopathy is considered primary or idiopathic.

[53] Hypertrophic cardiomyopathies are congenital or acquired disorders characterized by marked ventricular hypertrophy with diastolic dysfunction that may develop in the absence of increased afterload. The cardiac muscle is abnormal with cellular and myofibrillar disarray, although this finding is not specific to hypertrophic cardiomyopathy. The interventricular septum may be hypertrophied more than the left ventricular posterior wall (asymmetric septal hypertrophy). In the most common asymmetric form of hypertrophic cardiomyopathy, there is marked hypertrophy and thickening of the upper interventricular septum below the aortic valve. During systole, the septum thickens and the anterior leaflet of the mitral valve, already abnormally oriented due to the abnormal shape of the ventricle, is sucked toward the septum, producing outflow tract obstruction. Clinical manifestations may occur alone or in any combination: Chest pain is usually typical angina related to exertion. Syncope is usually exertional and due to a combination of cardiomyopathy, arrhythmia, outflow tract obstruction, and poor diastolic filling of the ventricle. Dyspnea on exertion results from poor diastolic compliance of the left ventricle, which leads to a rapid rise in left ventricular end-diastolic pressure as flow increases. Outflow tract obstruction, by lowering cardiac output, may contribute to the dyspnea.

[54] As used herein, "myocardial infarction" or "Ml" refers to a rapid development of myocardial necrosis, which may be caused by the interruption of blood supply to the heart resulting in a critical imbalance between oxygen supply and demand of the myocardium This may result from plaque rupture with thrombus formation in a coronary vessel leading to an acute reduction of blood supply to a portion of the myocardium; that is, an occlusion or blockage of a coronary artery following the rupture of a susceptible atherosclerotic plaque. If untreated for a sufficient period of time, the resulting ischemia or restriction in blood supply and oxygen shortage can cause damage or death, i.e., infarction of the heart. In general, this damage is largely irreversible, and clinical therapies thus far mainly aim at delaying the progression of heart failure to prolong survival. Myocardial infarction can be assessed using clinical parameters and/or assessments known to those skilled in the art of diagnosing and/or treating the same, for example, physical examinations, detection of signs and symptoms of myocardial infarction, electrocardiogram, echocardiogram, chest X-ray, blood tests to detect cardiac biomarkers including troponins, CK, and CK-MB, etc.

[55] As used herein, "reperfusion" refers to the restoration of blood flow or supply to the myocardium or myocardial tissue that has become ischemic or hypoxic. Modalities for reperfusion include, but are not limited to, chemical dissolution of the occluding thrombus, i.e., thrombolysis, administration of vasodilators, angioplasty, percutaneous coronary intervention (PCI), catheterization and coronary artery bypass graft (CABG) surgery.

[56] As used herein, "therapeutically effective amount" refers to an amount of an agent, i.e., an inhibitor of H3K9/CpG methylation at a genetic locus that contributes to heart disease, or composition that is sufficient to produce the desired therapeutic effect. The therapeutically effective amount will vary with the age and physical condition of the subject, the severity of the disorder, the duration of the treatment, the nature of any concurrent treatment, the pharmaceutically acceptable carrier used, and like factors within the knowledge and expertise of those skilled in the art. An appropriate "therapeutically effective amount" in any individual case can be determined by one of ordinary skill in the art by reference to the pertinent texts and literature and/or by using routine experimentation. (See, for example, Remington, The Science and Practice of Pharmacy 20th Edition, Lippincott Williams & White, Baltimore, Md. (2000).

[57] As used herein, "administered at the time of" means that the inhibitor of H3K9/CpG methylation at a genetic locus that contributes to heart disease according to embodiments of the present invention is administered at a time sufficiently close to the onset of an impetus causing injury, a time sufficiently close to the onset of the actual injury or a time sufficiently close to the manifestation of physical symptoms characteristic of the injury. If administered at the time of injury, the inhibitor may reduce injury or prevent further injury. "Administered after" means that the inhibitor is administered after the onset of an impetus causing injury, after the onset of the actual injury or after the manifestation of physical symptoms characteristic of the injury. If administered after injury, the inhibitor may reduce injury or prevent further injury. "Administered before" means that the inhibitor is administered before the onset of an impetus causing injury, before the onset of the actual injury or before the manifestation of physical symptoms characteristic of the injury. If administered before, the inhibitor may be used as a preventive treatment.

[58] The term "treatment" or grammatical equivalents encompasses the improvement and/or reversal of the symptoms of heart failure (i.e., the ability of the heart to pump blood). "Improvement in the physiologic function" of the heart may be assessed using, for example, measurement of ejection fraction, fractional shortening, left ventricular internal dimension, heart rate, etc., as well as any effect upon the individual's survival. In use of animal models, the response of treated transgenic animals and untreated transgenic animals may be compared. Humans and other mammals may be targeted for the methods of the invention. The mammals in question are not particularly limited, and, concretely, may include rats, mice, hamsters, guinea pigs, dogs, monkeys, cows, horses, sheep, goats, and pigs, etc. The term "compound" refers to any chemical entity, pharmaceutical, drug, and the like that can be used to treat or prevent a disease, illness, sickness, or disorder of bodily function. Compounds comprise both known and potential therapeutic compounds. A compound can be determined to be therapeutic by screening using the screening methods of the present invention. A "known therapeutic compound" refers to a therapeutic compound that has been shown (e.g., through animal trials or prior experience with administration to humans) to be effective in such treatment.

As used herein, the term "agonist" refers to molecules or compounds that mimic or enhance the action of a "native" or "natural" molecule. Agonists may include proteins, nucleic acids, carbohydrates, or any other molecules that interact with a molecule, receptor, and/or pathway of interest.

As used herein, the terms "antagonist" and "inhibitor" refer to molecules or compounds that inhibit the action of a cellular factor involved in cardiac hypertrophy, usually H3K9/CpG methylation at the a-MHC locus. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecules which bind or interact with a receptor, molecule, and/or pathway of interest.

As used herein, the term "modulate" refers to a change or an alteration in the biological activity. Modulation may be an increase or a decrease in protein activity, a change in binding characteristics, or any other change in the biological, functional, or immunological properties associated with the activity of a protein or other structure of interest. The term "modulator" refers to any molecule or compound which is capable of changing or altering biological activity as described above.

THERAPEUTIC/PROPHYLACTIC TREATMENT METHODS

Pharmaceutical compositions for treating heart disease according to the methods of the present invention, comprise as active ingredients substances that inhibit H3K9/CpG methylation at the a-MHC locus in cardiomyocytes. Inhibition may be evaluated by a direct effect on histone or CpG methylation at the a-MHC locus, may be evaluated by an increase in expression of a-MHC as a result of the inhibition; or may be evaluated by determining the effect on one or more of the enzymes involved in the process, particularly G9a, and DNMT3a/b. Inhibition may reduce methylation, relative to a control in the absence of treatment, by 100%, 90%, 80%, 70%, 50%, 25%, etc. Inhibition may increase a-MHC expression relative to a control in the absence of therapy by 10%, 20%, 50%, 100% or more. Inhibition my inhibit activity of a targeted enzyme in cardiomyocytes by 100%, 90%, 80%, 70%, 50%, 25%, etc.

An inhibitor of H3K9/CpG methylation at the a-MHC locus in cardiomyocytes may be used in the form of pharmaceutical compositions at a dose effective to prevent or remedy heart diseases caused by cardiac hypertrophy together with pharmaceutically acceptable carriers and other additives. The method to prevent or remedy heart disease caused by cardiac hypertrophy of the present invention may be carried out by administering to test subjects with heart diseases caused by cardiac hypertrophy or the preconditions thereof the effective amount of a substance that inhibits the functional activity or expression. The method may be effectively used to prevent cardiac hypertrophy from developing into heart disease for a test subject with cardiac hypertrophy.

[65] A determination of effective dose, and effective combination of agents may be determined empirically, for example using animal models as provided herein. In vitro models are also useful for the assessment of dose and selection of agent. For example, cultures are described herein where the effect on cardiomyocytes is evaluated. Such cultures may be used to assay for the effectiveness of agents alone, or in combinations.

[66] Determining a therapeutically or prophylactically effective amount of an agent composition can be done based on animal data using routine computational methods. The effective dose may be measured in terms of parameters described above, in terms of hemodynamic parameters as known in the art, etc., in the individual over a suitable period of time, e.g. over 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, 12 weeks, or more. In one embodiment, the unit dose of a therapeutically or prophylactically effective amount contains between about 0.1 μg to about 100 mg/kg weight of the individual, as applicable. Typically the administration is performed over a period of time, e.g. semi-daily, daily, semi- weekly, weekly, for a period of days, weeks, months, etc.

[67] In this invention, administering the instant compositions can be effected or performed using any of the various methods and delivery systems known to those skilled in the art. The administering can be performed, for example, intravenously, orally, via implant, transmucosally, transdermal^, intramuscularly, intrathecal^, and subcutaneously. The following delivery systems, which employ a number of routinely used pharmaceutical carriers, are only representative of the many embodiments envisioned for administering the instant compositions.

[68] Injectable drug delivery systems include solutions, suspensions, gels, microspheres and polymeric injectables, and can comprise excipients such as solubility-altering agents (e.g., ethanol, propylene glycol and sucrose) and polymers (e.g., polycaprylactones and PLGA's). Implantable systems include rods and discs, and can contain excipients such as PLGA and polycaprylactone. Protein or nucleic acids of the invention can also be administered attached to particles using a gene gun.

[69] Oral delivery systems include tablets and capsules. These can contain excipients such as binders (e.g., hydroxypropylmethylcellulose, polyvinyl pyrilodone, other cellulosic materials and starch), diluents (e.g., lactose and other sugars, starch, dicalcium phosphate and cellulosic materials), disintegrating agents (e.g., starch polymers and cellulosic materials) and lubricating agents (e.g., stearates and talc).

Solutions, suspensions and powders for reconstitutable delivery systems include vehicles such as suspending agents (e.g., gums, xanthans, cellulosics and sugars), humectants (e.g., sorbitol), solubilizers (e.g., ethanol, water, PEG and propylene glycol), surfactants (e.g., sodium lauryl sulfate, Spans, Tweens, and cetyl pyridine), preservatives and antioxidants (e.g., parabens, vitamins E and C, and ascorbic acid), anti-caking agents, coating agents, and chelating agents (e.g., EDTA).

Formulations may be provided in a unit dosage form, where the term "unit dosage form," refers to physically discrete units suitable as unitary dosages for human subjects, each unit containing a predetermined quantity of active agent in an amount calculated sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier or vehicle. The specifications for the unit dosage forms of the present invention depend on the particular complex employed and the effect to be achieved, and the pharmacodynamics associated with each complex in the host.

Those of skill will readily appreciate that dose levels can vary as a function of the specific agent, the severity of the symptoms and the susceptibility of the subject to side effects. Some of the agents will be more potent than others. Preferred dosages for a given agent are readily determinable by those of skill in the art by a variety of means. A preferred means is to measure the physiological potency of a given compound.

For the treatment of disorders in which there is cardiac hypertrophy, the agent is administered at a dose that is effective to cause an improvement in hemodynamic paramaters, but which maintains the overall health of the individual. Treatment regimens may utilize a short-term administration of the active agent; although typically the treatment is administered for prolonged periods, for example as a daily, semi-weekly, weekly, semimonthly, monthly dose monthly, etc. The size of the dose administered must be determined by a physician and will depend on a number of factors, such as the nature and gravity of the disease, the age and state of health of the patient and the patient's tolerance to the agent itself.

In some embodiments, myocardial repair can be an improvement or a decrease in infarct size, necrosis, apoptosis, autophagy, angiogenesis, remodeling, chamber dilation, wall thinning, inflammation, reduction in serum cardiac troponin I and/or other markers of cardiomyocyte degradation or a combination thereof.

The pharmaceutical composition of the present invention may further contain well- known therapeutic drugs for heart disease as necessary. The therapeutic drugs for heart disease are not particularly limited, but β-blockers, anti-hypertensive agents, cardiotonic agents, anti-thrombosis agents, vasodilators, endothelial receptor blockers, calcium channel blockers, phosphodiesterase inhibitors, Angll receptor blockers, cytokine receptor blockers, gp130 receptor inhibitors, and the like.

DIAGNOSTIC AND PROGNOSTIC METHODS

[76] The change of H3K9/CpG methylation at the oc-MHC locus in cardiomyocytes in hypertrophic cardiomyocytes provides for its use as a marker for diagnosis, and in prognostic evaluations to detect individuals at risk for cardiac pathologies, including atrial enlargement, ventricular hypertrophy, heart failure, etc. Prognostic methods can also be utilized to monitor an individual's health status prior to and after an episode, as well as in the assessment of the severity of the episode and the likelihood and extent of recovery.

[77] In general, such diagnostic and prognostic methods involve detecting an altered level of repressive chromatin structures at the oc-MHC locus in the cells or tissue of an individual or a sample therefrom. Usually this determined value or test value is compared against some type of reference or baseline value.

[78] Samples can be obtained from the tissues or fluids of an individual, as well as from cell cultures or tissue homogenates. For example, samples can be obtained from heart tissue biopsy of cardiomyocytes, etc. Also included in the term are derivatives and fractions of such cells and fluids. Where cells are analyzed, the number of cells in a sample will often be at least about 10 ² , usually at least 10 ³ , and may be about 10 ⁴ or more. The cells may be dissociated, in the case of solid tissues, or tissue sections may be analyzed. Alternatively a lysate of the cells may be prepared.

[79] Diagnostic samples are collected any time after an individual is suspected to have cardiomyopathy, atrial enlargement, ventricular hypertrophy, etc. or has exhibited symptoms that predict such pathologies. In prophylactic testing, samples can be obtained from an individual who present with risk factors that indicate a susceptibility to heart failure, which risk factors include high blood pressure, obesity, diabetes, etc. as part of a routine assessment of the individual's health status.

[80] The various test values determined for a sample from an individual believed to suffer pressure overload, cardiac hypertrophy, diastolic dysfunction, and/or a tendency to heart failure typically are compared against a baseline value to assess the extent of increased or decreased expression, if any. This baseline value can be any of a number of different values. In some instances, the baseline value is a value established in a trial using a healthy cell or tissue sample that is run in parallel with the test sample. Alternatively, the baseline value can be a statistical value (e.g., a mean or average) established from a population of control cells or individuals. For example, the baseline value can be a value or range that is characteristic of a control individual or control population. For instance, the baseline value can be a statistical value or range that is reflective of expression levels for the general population, or more specifically, healthy individuals not susceptible to stroke. Individuals not susceptible to stroke generally refer to those having no apparent risk factors correlated with heart failure, such as high blood pressure, high cholesterol levels, diabetes, smoking and high salt diet, for example.

EXPERIMENTAL

[81 ] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.

[82] All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference.

[83] The present invention has been described in terms of particular embodiments found or proposed by the present inventor to comprise preferred modes for the practice of the invention. It will be appreciated by those of skill in the art that, in light of the present disclosure, numerous modifications and changes can be made in the particular embodiments exemplified without departing from the intended scope of the invention. For example, due to codon redundancy, changes can be made in the underlying DNA sequence without affecting the protein sequence. Moreover, due to biological functional equivalency considerations, changes can be made in protein structure without affecting the biological action in kind or amount. All such modifications are intended to be included within the scope of the appended claims.

Example 1

Cardiac stress activates G9a and Dnmt3 to trigger myopathy and heart failure

[84] Given the sensitivity of cardiac function to -MHC expression, we used the -MHC promoter as a molecular tool to search for new therapeutic targets for heart failure. By examining the chromatin scaffold of -MHC, we found two new cardiac chromatin modifiers, G9a/Glp histone methyltransferase and DNA methyltransferase (DNMT), that are activated by pressure overload to trigger cardiac hypertrophy and failure. [85] -MHC dynamically changes its expression: it has low expression in fetal hearts, is upregulated in adult hearts, but repressed in hypertrophic and failing hearts. To test how histones associated with -MHC are regulated during such developmental and pathophysiological changes, we surveyed the methylation pattern of histone 3 lysine 9 (H3K9)— an epigenetic marker for gene repression— on the a-MHC promoter in fetal, adult, and hypertrophic mouse hearts. Because dimethylated H3K9 (H3K9me2) is critical for silencing euchromatin within gene rich areas, we focused on H3K9me2. By chromatin immunoprecipitation with quantitative polymerase chain reaction (ChlP-qPCR) using the left ventricles, we found that the proximal promoter of a-MHC (approximately -673 to -73) was highly enriched with H3K9 dimethylation (H3K9me2) in fetal heart ventricles at embryonic day 12.5 (E12.5), whereas such H3K9me2 decreased 4.4-fold in healthy adult hearts (Fig. 1 a).

[86] However, when the adult heart was stressed by pressure overload through surgical constriction of the transverse aorta (transverse aortic constriction, TAC), H3K9me2 on the oc- MHC promoter was reactivated and increased 3.6-fold on the a-MHC promoter, comparable to the fetal level of H3K9 methylation (Fig. 1 a). In contrast, very low H3K9me2 was found on the proximal -MHC promoter (approximately -322 to +278) relative to the IgG control, and H3K9me2 showed no significant changes on the -MHC promoter during heart development and hypertrophy (Fig. 1 b), indicating a specific chromatin mechanism underlies a-MHC repression. We next searched for the histone methyltransferase that controlled such dynamic H3K9 methylation. By RT-qPCR, we examined the expression of known histone H3K9 methyltransferases (H3K9MTs)22— G9a/Ehmt2, Glp/Ehmtl , Suv39h1 , Suv39h2, Setdbl , and Setdb2— in mouse heart ventricles with or without TAC. Among these enzymes, only G9a and Glp, which encode proteins to form a heteromeric H3K9MT complex, were induced 1 .9-2.2- fold by TAC; the other enzymes had no significant changes (Fig. 1 c). Immunostaining showed abundant G9a and Glp proteins in the fetal myocardium (Fig. 5a, b), minimal G9a/Glp in healthy adult myocardium (Fig. 1 d, f), and induction of G9a/Glp in the TAC-stressed adult myocardium (Fig. 1 e, g). Such G9a/Glp dynamics in the myocardium corresponded to H3K9me2 dynamics on the a-MHC promoter (Fig. 1 a), suggesting an essential role of G9a/Glp in H3K9 methylation, a-MHC repression, and cardiac hypertrophy.

[87] To test the necessity of G9a/Glp for a-MHC silencing and cardiac hypertrophy, we used the doxycycline-inducible Tnnt2-rtTA;Tre-Cre mouse line to effect deletion of G9a floxed alleles (G9at/t) and abolish the formation of G9a/Glp heterodimeric methyltransferase in the adult myocardium. After a 7-day doxycycline treatment to activate myocardial G9a deletion (Fig. 5c, d), we performed TAC to pressure overload the hearts of littermate control (G9at/f, Tnnt2-rtta;Tre-Cre, or Tnnt2-rtta;Tre-Cre;G9af/+) and mutant ( Tnnt2-rtta;Tre-Cre;G9af/f) mice to induce cardiac hypertrophy. Within 2 weeks after TAC, the control mice fed with normal or doxycycline diet developed severe cardiac hypertrophy with increased ventricle/body-weight ratio (Fig. 1 h), enlarged cardiomyocytes (Fig. 1 i and Fig. 5e, f), cardiac fibrosis (Fig. 1j), and heart failure with reduction of left ventricular fractional shortening (Fig. 11 and Fig. 6a, b). In contrast, the doxycycline-treated mutant mice ( Tnnt2-rtTA;Tre-Cre;G9af/f) exhibited mild cardiac hypertrophy (Fig. 1 h and 1 i; Fig. 5g, h), minimal/no fibrosis (Fig. 1 k), and a lesser degree of cardiac dysfunction (Fig. 11 and Fig. 6c, d). Furthermore, mice treated with BIX- 01294 (BIX), a potent and direct specific inhibitor of the G9a/Glp methyltransferase activity, exhibited cardiac resistance to TAC-induced hypertrophy, fibrosis, and failure (Fig. 1 m-q and Fig. 5i-l, 2e-h). Overall, without myocardial G9a/Glp activity, there was a 60-68% reduction of hypertrophy and 33^17% reduction of cardiac dysfunction. Also, within 2 days of TAC before substantial cardiac hypertrophy (Fig. 5m, n), G9a disruption— by myocardial gene deletion or BIX treatment— had abolished TAC-induced H3K9me2 of -MHC (Fig. 1 r) and reversed TAC-induced -MHC repression (Fig. 1 s), whereas G9a/Glp disruption had minimal effect on -MHC (Fig. 1 t, u). Collectively, the data indicate that the stress-activated G9a/Glp activation is essential for H3K9 methylation, -MHC repression, hypertrophy, and heart failure.

[88] Another potent marker for gene repression is DNA methylation at the CpG dinucleotides. To examine the role of DNA methylation in heart failure, we identified five CpG sites on the a- MHC proximal promoter and eight CpG sites on the proximal promoter/5'- untranslated region of -MHC (Fig. 2a, b). Bisulfite genomic sequencing showed that the oc- MHC CpG sites were highly methylated in E12.5 fetal heart ventricles, and the methylation decreased by 44% in healthy adult heart ventricles (from 50% to 28%, Fig. 2a). Interestingly, in adult heart ventricles stressed by TAC for 2, 7 and 14 days, the degree of a-MHC CpG methylation increased by 2.1 -2.7 folds (from 28% to 60%, 58% and 75%, respectively, Fig. 2a). Therefore, the TAC-induced methylation of a-MHC CpG sites was a rapid process with near saturation of CpG methylation within 2 days of TAC before apparent cardiac hypertrophy developed. Conversely, on the β- -ZC locus, the methylation of CpG sites was absent in fetal hearts, modest in healthy adult hearts, and sparse in TAC-stressed hearts (Fig. 2b). This differential CpG methylation pattern correlates inversely with MHC expression at various pathophysiological conditions.

[89] To identify enzymes responsible for TAC-induced DNA methylation of a-MHC, we examined the expression of two DNA methyltransferases (Dnmt 3a and 3b) known to be active in mammals for de novo methylation. Immunostaining and RT-qPCR of heart ventricles showed that Dnmt3a and Dnmt3b were abundant in the fetal hearts (Fig. 7a, b) and that their expression in the healthy adult hearts was low but activated 3-4-fold by TAC (Fig. 2c-e; Fig. 7c, d). To test whether Dnmt activity is required for cardiac hypertrophy, we used 5- Azacytidine (AZA), an inhibitor of Dnmt, to inhibit DNA methylation in TAC-stressed hearts. AZA treatment was sufficient to abolish TAC induced cardiac hypertrophy, fibrosis, and failure (Fig. 2f-j; Fig. 6i-l, 7e-h). Also, within 2 days of TAC, AZA abolished the TAC-induced CpG methylation and -MHC repression (Fig. 2k, I); however, AZA had no significant influence on -MHC activation by TAC (Fig. 2m). Therefore, activation of Dnmts by cardiac stress is essential for DNA methylation, a-MHC repression, hypertrophy, and heart failure.

[90] We next used MHC promoters to investigate how G9a/Glp and Dnmts reacted to pressure stress to control MHC and cardiomyopathy. ChlP-qPCR of mouse left ventricles showed that TAC triggered the targeting of G9a/Glp and Dnmt3a/3b proteins to a-MHC, but not β-MHC, promoter (Fig. 3a, b; Fig. 7i). These observations, combined with the in vivo necessity of these proteins for chromatin methylation and a-MHC repression (Figs 1 and 2), indicate that G9a/Glp and Dnmt3 are the primary in vivo stress-induced enzymes that catalyze H3K9 and CpG methylation of a-MHC.

[91 ] We asked if the stress-activated H3K9 and CpG methylation processes were mutually dependent. Co-immunoprecipitation (co-IP) showed that G9a and Dnmt3a/3b formed a physical complex in TAC-stressed left ventricles (Fig. 3c and Fig. 7j). To test whether G9a and Dnmt3 required each other to bind to a-MHC promoter, we examined the binding of G9a to oc- MHC in the absence of Dnmt activity. ChlP-qPCR revealed that G9a bound equally well to the a-MHC promoter to catalyze H3K9 methylation in TAC-stressed left ventricles with/without AZA (Fig. 3d). Because AZA did not change G9a RNA/protein level (Fig. 8a-c), these results indicate that G9a's function on a-MHC does not require Dnmt. Conversely, in TAC-stressed hearts without G9a/Glp (dox-treated Tnnt2-rtTA;Tre- Cre;G9at/f mice), Dnmt3's binding to oc- MHC was eliminated (Fig. 3e and Fig. 7k), accompanied by a loss of TAC-induced DNA/CpG methylation (Fig. 3f). Because G9a had no effects on the Dnmt3a RNA/protein level (Fig. 8d- h), the results suggest that Dnmts require G9a to bind to and methylate CpG sites of a-MHC in the stressed heart. Brg1 is an essential ATPase of the BAF chromatin-remodeling complex essential for MHC regulation and cardiac hypertrophy. We asked how Brg1 may integrate with G9a/Glp and Dnmts to regulate gene expression. Co-IP studies showed that Brg1 formed physical complexes with G9a/Glp in TAC-stressed ventricles (Fig. 3g), indicating the presence of Brg1-G9a-Dnmt3 complex in stressed hearts. Brg1 , however, did not require G9a/Glp or Dnmt activities to target to the a-MHC site (Fig. 3h). In contrast, G9a required Brg1 to bind to the a-MHC promoter. In TAC-stressed mice that lacked myocardial Brg1 (dox-treated Tnnt2- rtTA;Tre-Cre;Brg1f/f mice), G9a was absent from the a-MHC promoter with a consequent loss of H3K9me2 (Fig. 3i). Also, Dnmt3 required Brg1 to bind to the a-MHC promoter. Without myocardial Brg1, Dnmt3a/3b bound poorly to a-MHC (Fig. 3j and Fig. 7I), accompanied by a 70.4 % loss of CpG methylation (p=0.0024)(Fig. 3k). Such requirement of Brg1 for G9a and Dnmt to function on the -MHC promoter occurred within 2 days of TAC before there was apparent hypertrophy (Fig. 5m); therefore, the results were not the consequence of reduced hypertrophy of Brg1-ru\\ hearts. Furthermore, the absence of G9a/Dnmt3 on -MHC was not the consequence of reduced G9a or Dnmt3 expression because Brg1 mutation had no effect on the RNA/protein level of G9a or Dnmt3 (Fig. 7i-o). Therefore, Brg1 is necessary for recruiting G9a and Dnmt3 to a-MHC. Because G9a was also essential for recruiting Dnmt3 to -MHC, these studies suggest a TAC-activated sequence of recruitment from Brg1 , G9a to Dnmt3 to methylate the chromatin of a-MHC.

[92] To test the relevance of mouse studies to human cardiac hypertrophy, we examined

G9a/GLP and DNMT3 expression, as well as H3K9me2 and CpG methylation of MHC loci in the human hearts. Human left ventricular tissues were sampled from donor hearts deemed clinically unsuitable for heart transplantation, and these donors did not have known family history of inheritable heart disease (Fig. 9). The left ventricular hypertrophy, diagnosed by echocardiography, was linked to chronic hypertension and/or morbid obesity. We validated the normal/disease status of the donor hearts by analysis of MHC expression. RT-qPCR showed that the hypertrophic left ventricle had down-regulated a-MHC (by 82.4%) and upregulated β- MHC (by 4-5 folds) (Fig. 4a), consistent with the clinical diagnosis. Also, ChlP-qPCR revealed that H3K9me2 was enriched 6.7-fold on the a-MHC promoter without significant enrichment on the β-MHC promoter of hypertrophic left ventricles (Fig. 4b). Bisulfite sequencing of hypertrophic tissues showed a 1 .9-fold increase of CpG methylation on the a-MHC locus (Fig. 4c, d) and a converse 55% decrease of CpG methylation on the β-MHC locus (Fig. 4e, f). These changes of H3K9me2 and CpG methylation of MHC promoters correlated inversely with MHC mRNA in hypertrophic left ventricles (Fig. 4a) and resembled those changes observed in the mouse hearts (Fig. 1 a, b and 2a, b). The results show that H3K9 and DNA methylation provides an evolutionarily conserved mechanism for a-MHC repression in myopathic hearts.

[93] We next examined the expression of G9a/GLP and DNMT3 of human hypertrophic left ventricles. RT-qPCR showed that G9a and GLP were activated in the hypertrophic hearts by 2.7-3.4 folds (Fig. 4g), whereas DNMT3a and DNMT3b were activated by 5.3-7.8 folds (Fig. 4h). The results resemble the activation of G9a/Glp and Dnmt3 in the TAC-stressed mouse hearts and suggest that G9a and DNMT3 play a causal role in human cardiomyopathy. By non-linear regression analysis, we found a strong correlation between G9alGLP expression and the disease severity as defined by β-ία-MHC ratio-12,35-37 (regression r ² = 0.91 and 0.95, Fig. 4i).

[94] Also, G9a and GLP activation correlated strongly with H3K9me2 of human a-MHC promoter (regression r ² = 0.99 and 0.96, Fig. 4j), consistent with the necessity of G9a for hypertrophy and -MHC H3K9 methylation in mice. Furthermore, DNMT3a and 3b activation correlated strongly with the disease severity (regression r ² = 0.98 and 0.96, Fig. 4k) and with the CpG methylation of -MHC (regression r ² = 0.86 and 0.92, Fig. 41), consistent with the necessity of Dnmt for hypertrophy and -MHC CpG methylation in mice. In combination, the human and mouse studies show that the activation of G9a/GLP, DNMT3, and H3K9/CpG methylation is causal to human cardiac hypertrophy.

[95] To further test the causal role of G9a/GLP and DNMT in human cardiac hypertrophy, we used the iPS technology and endothelin-1 to induce hypertrophy of human iPS-derived cardiomyocytes (iCMs)(Cellular Dynamics). iCMs exhibited spontaneous contraction (Fig. 10a, b) and contained cardiac-specific proteins a-Actinin and Troponin-T (Fig. 10c). iCMs were treated with endothelin-1 (ET-1 ) to induce cell hypertrophy and gene reprogramming. Within 2 days of treatment, ET-1 induced a 12.3 % increase of cell size (p=0.018), accompanied by a 37.8 % reduction of a-MHC and 10.8-fold increase of β-MHC, as well as 1 .8-2.2-fold increase of ANF and BNP mRNAs (Fig. 10d), consistent with a hypertrophic response. Also activated were G9a and GLP (1 .93-1 .98 folds) and DNMT3a and DNMT3b (2.64-2.89 folds) (Fig. 4m). However, BIX or AZA- treatment of iCMs greatly reduced or abolished ET-1 -induced cell hypertrophy, MHC and ANF/BNP changes (Fig. 4n-r), demonstrating that G9a/GLP and DNMT3 are essential for stress-induced hypertrophy and gene changes in human cardiomyocytes. Combined with the mouse and human heart tissue studies, the iPS-cardiomyocyte studies support a causal role of G9a/GLP and DNMT3 activation in human hypertrophic heart disease.

[96] These results demonstrate new roles of G9a/GLP and DNMT in the pathogenesis of heart failure, as well as a new mechanistic link from chromatin-remodeling factor to H3K9 and CpG methylation— how the pathological stress triggers a successive assembly of repressive chromatin, leading to DNA methylation and repression of a key molecular motor gene (Fig. 4s), essential for cardiac myopathy and failure. Our studies show that five classes of chromatin regulators converge on a-MHC to create a repressive chromatin: Brg1 , G9a/GLP, Dnmt3, Hdac, and Parp. Among these chromatin factors, however, only Brg1 , G9a/Glp, and Dnmt3— but not Hdac (Hdad , 2, 3) or Parpl - are induced by pathological stress in the mouse and human hearts (Fig. 1 1 ).

[97] Because the gene-silencing DNA methylation marks are chemically stable, the relentless clinical deterioration of the failing heart may be partly explained by the presence of such stable methylation marks, which are difficult to erase without altering key factors involved in their formation. The availability of small molecules, such as BIX-01294 and 5-Azacytidine, to inhibit G9a/GLP and DNMT provides a means to deactivate chromatin methylation and augment a-MHC to improve ventricular function of the failing heart. Our studies show that directly boosting a-MHC is pharmacologically possible and useful in our armamentarium against heart failure.

METHODS

[98] Mice. Brg1f/f, G9at/f and Tnnt2-rtTA;Tre-Cre mice have been described previously. The mouse embryonic date was determined by the conventional method, in which the date of observing a vaginal plug was set as embryonic day E0.5. The use of mice for studies is in compliance with the regulations of Stanford University and National Institute of Health.

[99] Histology, immunostaining, and trichrome Staining. Histology, immunostaining, and trichrome staining were performed as described. The following primary antibodies were used for immunostaining: anti-G9a (Cat* PP-A8620A-00, R&D Systems), anti-GLP (Cat* PP- B0422-00, R&D Systems), anti-DNMT3a (H-295, Cat* sc20703, Santa Cruz Biotechnology), anti-DNMT3b (Cat* ab16049, Abeam), anti-oc-Actinin (EA-53, Cat* A781 1 , Sigma) and Troponin-T (CT-3, DSHB).

[100] Transaortic constriction (TAC). Mice were fed with doxycycline food seven days prior to TAC operation to induce deletion of G9a or Brg1 . Surgeries were performed on adult mice of 8-10 weeks of age and between 20 and 25 grams of weight. Mice were fed with doxycycline food pellets (6 mg doxycycline/kg of food, Bioserv, Frenchtown, NJ) seven days prior to the TAC operation. Mice were anesthetized with isoflurane (2-3%, inhalation) in an induction chamber and then intubated with a 20-gauge intravenous catheter and ventilated with a mouse ventilator (Minivent, Harvard Apparatus, Inc). Anesthesia was maintained with inhaled isoflurane (1 -2%). A longitudinal 5-mm incision of the skin was made with scissors at midline of sternum. The chest cavity was opened by a small incision at the level of the second intercostal space 2-3 mm from the left sternal border. While opening the chest wall, the chest retractor was gently inserted to spread the wound 4-5 mm in width. The transverse portion of the aorta was bluntly dissected with curved forceps. Then, 6-0 silk was brought underneath the transverse aorta between the left common carotid artery and the brachiocephalic trunk. One 27-gauge needle was placed directly above and parallel to the aorta. The loop was then tied around the aorta and needle, and secured with a second knot. The needle was immediately removed to create a lumen with a fixed stenotic diameter. The chest cavity was closed by 6-0 silk suture. Sham-operated mice underwent similar surgical procedures, including isolation of the aorta, looping of aorta, but without tying of the suture. The pressure load caused by TAC was verified by the pressure gradient across the aortic constriction measured by echocardiography. Only mice with a pressure gradient >30 mmHg were analyzed for cardiac hypertrophy and gene expression.

[101 ] Echocardiography. The echocardiographer was blinded to the genotypes, surgical, or pharmacological treatment of the mice tested. Transthoracic ultrasonography with a GE Vivid 7 ultrasound platform (GE Health Care, Milwaukee, Wl) and a 1 3 MHz transducer was used to measure aortic pressure gradient and left ventricular function. Echocardiography was performed on control and Tnnt2-rtTA;Tre-Cre;G9af/f mice, as well as on mice treated with PBS (phosphate buffered saline), BIX, and AZA at 8 to 1 2 weeks of age. To minimize the confounding influence of different heart rates on aortic pressure gradient and left ventricular function, the flow of isoflurane (inhalational) was adjusted to anesthetize the mice while maintaining their heart rates at 450-550 beats per minute. The peak aortic pressure gradient was measured by continuous wave Doppler across the aortic constriction. The left ventricular function was assessed by the M-mode scanning of the left ventricular chamber, standardized by two-dimensional, short-axis views of the left ventricle at the mid papillary muscle level. The fractional shortening (FS) of the left ventricle was defined as 100% x (1 - end systolic/end diastolic diameter), representing the relative change of left ventricular diameters during the cardiac cycle. The mean FS of the left ventricle was determined by the average of FS measurement of the left ventricular contraction over 5 beats. P-values were calculated by the Student-t test. Error bars indicate standard error of mean.

[102] Morphometric analysis of cardiomyocytes. Paraffin sections of the heart were immunostained with a fluoresecin isothiocyanate-conjugated Wheat Germ Agglutinin (WGA) antibody (F49, Biomeda, Foster City, CA) that highlighted the cell membrane of cardiomyocytes. Cellular areas outlined by WGA were determined by the number of pixels enclosed using the NIS element software (Nikon). Approximately 250 cardiomyocytes of the papillary muscle at the mid left ventricular cavity were measured to determine the size distribution. P-values were calculated by the Student-t test. Error bars indicate standard error of mean.

[103] Reverse transcription-quantitative PCR analysis (RT-qPCR). RT-qPCR analyses were performed as described previously. The following primer sequences (listed below) were used. RT-qPCR reactions were performed using SYBR green master mix (BioRad, Hercules, CA) with an Eppendorf realplex, and the primer sets were tested to be quantitative. Threshold cycles and melting curve measurements were performed with software. P-values were calculated by the Student-t test. Error bars indicate standard error of mean.

PCR primers for RT-qPCR of mRNA:

Mouse G9a-F (CAGCCGAGCACAAGCACATC),

Mouse G9a-R (CTCCACG AG ACAGG AAC AACA) ,

Mouse Glp-F (GTCTGGTCACGCTCCTGTAT),

Mouse Glp-R (AAGCAAACCCACATTTCATC),

Mouse Dnmt3a-F (C AC ACCTG AG CTGTACTG C AG AG ) ,

Mouse Dnmt3a-R (CTCTTCC AC AG C ATTC ATTACTG C) ,

Mouse Dnmt3b-F ( ACC AAATCC AG GG CCTTCTTT) , Mouse Dnmt3b-R (GATAATGCACTCCTCATACCCGC), Mouse Suv39hl-F (CTGTGCCGACTAGCCAAGC), Mouse Suv39hl-R ( ATACCC ACG CC ACTTAACC AG ) , Mouse Suv39h2-F (GCTGTGGTTGGGGTGTAAAA), Mouse Suv39h2-F\ (GCTGCATCCACTGTG AACTC) , Mouse Setdbl-F (GATTCTGGGCAAGAAGAGGA), Mouse Setdbl-R (GTACTTGGCCACCACTCGAC), Mouse Setdb2-F (TCAGTCGCGTTTCCCCCACC), Mouse Setdb2-F\ (CAAGGCCAGGTTGAAAGCCGGA), Mouse Hdacl-F (GCGAGACGGCATTGACGACGA), Mouse Hdacl-H (GTCCAGGGCCACCGCTGTTT), Mouse Hdac2-F (GCCAGGGTCATCCCATGAAGCC), Mouse Hdac2-R (CCCCAGCAACTGAACCACCCG), Mouse Hdac3-F (GACTGACGAGGCCGACGCTG), Mouse Hdac3-R (ACACCCTGGGGGTACCCAGTT), Mouse Parpl-F (CCCCACCTGAAGCGCCTGTG), Mouse Parpl- (CCAGGGTGATGCTGGCCGA), Mouse oMHC-F (GCAGGCCCTGGCTCTTCAGC), Mouse aMHC-R (GCCTGCCTCCTCCAGCCTCT), Mouse βΜΗΟ-F (GCCCTTTG ACCTCAAG AAAG) , Mouse βΜΗΟ-R (CTTCACAGTCACCGTCTTGC), Mouse TFIIb-F (CTCTGTGGCGGCAGCAGCTATTT), Mouse TFIIb-R (CGAGGGTAGATCAGTCTGTAGGA), Human G9a-F (GCGAAAAGACAGCCCATGGGTG), Human G9a-R (GCCTGAGGAGCCCACACCATTC), Human GLP-F (GGCGGGCGCTAATATTGACACCT), Human GLP-R (TTG GC AGCC AG GTG C AAAC ACG ) , Human DNMT3a-F (TATTGATGAGCGCACAAGAGAGC), Human DNMT3a-R (GGGTGTTCCAGGGTAACATTGAG), Human DNMT3b-F (GACTTGGTGATTGGCGGAA), Human DNMT3b-R (GGCCCTGTGAGCAGCAGA), Human HDAC1-F (GGCGAGCAAGATGGCGCAGA), Human HDAC1-R (TCTGGACGGATGGAGCGCAAGA), Human HDAC2-F (CGGGGAGCCCATGGCGTACA), Human HDAC2-R (TTCGGCAGTGGCTTTATGGGGC), Human HDAC3-F (ACCGGGTCATGACGGTGTCCT), Human HDAC3-R (ACGCATTCCCCATGCCCTCG), Human PARP1-F (AGGTCCAGCAGGCGGTGTCT), Human PARP1-R (TTCCGCCTTGGCCTGCACAC), Human aMHC-F (GGCCACTCTCTTCTCCTCCTACGC), Human aMHC-R (GGTGG AG AGCCG ACACCGTC) ,

Human βΜΗΟ-F (CTGCGGCTGCAGGACCTGG),

Human βΜΗΟ-R (CTCATTCAAGCCCTTCGTGCCA),

Human ANF-F (GCGGAGATCCAGCTGCTTCGG),

Human ANF-R (GGGAGAGGCGAGGAAGTCACCA),

Human BNP-F (TTCCTGGGAGGTCGTTCCCAC),

Human BNP-R (CATCTTCCTCCCAAAGCAGCC),

Human H3F3A-F (AAAACAGATCTGCGCTTCCA),

Human H3F3A-R (TTGTT AC ACG TTTG G C ATG G ) .

[104] Chromatin immunoprecipitation-quantitative PCR (ChlP-qPCR). Hearts from

E12.5 mouse embryos, adult mice, and human subjects were used for ChIP assay as described previously. Chromatin was sonicated to generate average fragment sizes of 200- 600 bp, and immunoprecipitated using anti-BRG1 J1 antibody, anti-G9a antibody (Cat# G6919, Sigma), anti-H3K9Me2 antibody (Cat* 17-648, Millipore), anti-DNMT3a antibody (H- 295, Cat# sc20703, Santa Cruz Biotechnology), anti-DNMT3b (Cat* ab16049, Abeam), or normal control IgG. Isolation and purification of immunoprecipitated and input DNA were done according to the manufacturer's protocol (Magna ChIP Protein G Magnetic Beads, Cat* 16- 662, Millipore), and RT-qPCR analysis of immunoprecipitated DNA was performed. ChlP- qPCR signals of individual ChIP reaction was standardized to its own input RT-qPCR signals and normalized to IgG ChIP signals. PCR primers (listed below) were designed to amplify the proximal promoter regions of mouse -MHC (-426, -320), mouse β- HC (-102, +58), human -MHC (-169, -5) and human β- HC (-343, -189). The DNA positions are denoted relative to the transcriptional start site (+1 ).

[105] PCR primers for ChlP-qPCR:

Mouse ChIP-aMHC-F (GCAGATAGCCAGGGTTGAAA),

Mouse ChlP-aMHC-R (TGGGTAAGGGTCACCTTCTC),

Mouse ChIP-aMHC-F (GTGACAACAGCCCTTTCTAAAT),

Mouse ChlP-aMHC-R (CTCCAGCTCCCACTCCTACC),

Human ChIP-aMHC-F (AAATCAGGGGGCCCTGCTG),

Human ChlP-aMHC-R (GTCCTCAAAGCTCCAGTTCCT),

Human ChIP-aMHC-F (GGACATTGGCTGCCTGTGGT),

Human ChlP-aMHC-R (TC ATTGTT ATG G C ATG G ACTG T) .

[106] Bisulfite genomic sequencing. For each reaction, genomic DNA was extracted from 25 mg of the left ventricular tissues of mouse or human hearts by ZR Tissue & Insect DNA MiniPrep kit (Cat* D6016, Zymo Research). Bisulfite treatment of 2 μg DNA per reaction was performed using the EZ DNA Methylation-Gold Kit (Cat* D5005, Zymo Research). PCR primers are listed above. Amplified products by ZymoTaq PreMix (Cat* E2003, Zymo Research) were cloned into pDrive Cloning Vector (Qiagen). For each gene promoter, twelve randomly selected clones were sequenced with the T7 primer. N number in the figures represents the number of different hearts used for analysis, with each heart having 12 randomly selected clones sequenced.

[107] Western blot analysis. The blots were reacted with antibodies of anti-G9a (Cat# PP- A8620A-00, R&D Systems), anti-DNMT3a antibody (H-295, Cat# sc20703, Santa Cruz Biotechnology), and anti-DNMT3b (Cat* ab16049, Abeam), followed by HRP-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA). Chemiluminescence was detected with ECL Western blot detection kits (GE).

[108] Co-immunoprecipitation. Adult mouse heart ventricles were minced and homogenized by cell extraction buffer (25 mM Hepes pH 7.5, 25 mM KCI, 0.1 % NP-40, 1 mM DTT, protease inhibitor) to enrich nuclei. The nuclei were then washed and lysed using nuclear lysis buffer (50 mM Tris-HCI pH 8.0, 150 mM NaCI, 0.1 % NP-40, 1 mM DTT, protease inhibitor). The lysates were pre-cleared with PureProteome Protein G Magnetic Beads (Cat# LSKMAGG02, Millipore). Immuunoprecipitation with antibody and following western blotting were performed as described above and previously. 2 μg primary antibodies of anti-BRG1 (G-7, Cat# sc17796, Santa Cruz Biotechnology), anti-G9a (Cat* PP-A8620A-00, R&D Systems), anti- DNMT3a antibody (H-295, Cat* sc20703, Santa Cruz Biotechnology) or normal control IgG, were used.

[109] Drug treatment. For BIX studies, mice were implanted with subcutaneous micro- osmotic pumps (Alzet Model 1002, DURECT, Cupertino, CA) to infuse BIX01294 (BIX, 25 mg/ml, Cat* 3364, Tocris Bioscience). Micro-pumps were activated prior to implantation to initiate continuous delivery (0.25 μΙ/hr. of vehicle, PBS) or BIX. Sham or TAC procedures were performed 12 hours post implantation of pumps. After 14 days of sham or TAC operation, mice were evaluated by echocardiography for heart function and harvested for cardiac hypertrophy and fibrosis studies.

[1 10] For AZA studies, mice were injected intraperitoneally and daily with vehicle (PBS) or 5- Azacytidine (AZA, 2.5 mg/kg/day) (Cat* A2385, Sigma). Sham or TAC procedures were performed 12 hours after the first injection. After 14 days of the sham or TAC operation, mice were evaluated by echocardiography for heart function and harvested for cardiac hypertrophy and fibrosis studies.

[1 1 1 ] For studies of heart tissues harvested 2 days after the sham or TAC operation, mice were injected intraperitoneally and daily with vehicle (PBS), BIX (1 mg/kg/day), or AZA (2.5 mg/kg/day). Sham or TAC operation was performed 12 hours after the first injection. Two days after the operation, hearts were harvested for bisulfate genomic sequencing, RT-qPCR, immunostaining, or ChIP analysis.

[1 12] iPS-derived human cardiomyocytes culture, stress and analysis. The iPS-derived human cardiomyocytes (Cellular Dynamics, Madison, Wl) were cultured according to the manufacture's recommendations. Briefly, cells were cultured in the Plating Medium (Cellular Dynamics, Madison, Wl) for 48 hours and then cultured in William's E Medium with Cocktail B (Life Technology). After another 48 hours, the cells were stressed with 10 nM of endothelin-1 (Sigma) freshly reconstituted in William's E Medium. For BIX and AZA treatment, 100 nM of each chemical was applied together with the vehicle (William's E Medium) or endothelin-1 . Within 48 hours of treatment, the total cell RNA was extracted using the Quick-RNA Microprep kit (Zymo Research) for gene expression analysis. For cell size measurement, cells were plated on the coverslip and processed after 48 hours of culture. Cell borders were outlined by WGA staining, and the areas were determined by the ImageJ (NCBI) software. The examiner was blinded to the information of drug treatment. 100 to 300 cells were measured for each control or experimental group.

[1 13] Human heart tissue analysis. The human tissues were processed for RT-qPCR, ChlP-qPCR, and bisulfite genomic sequencing analysis as described in above sections. The use of human tissues is in compliance with the regulation of Sanford/Burnham Medical Research Institute, Intermountain Medical Center, and Stanford University.

[1 14] Construction of regression curves and derivation of equations. The regression curve, equation and r-square (re) for Figure 4i to 4I are derived using the Levenburg-Marquardt nonlinear regression method and a statistics/curve modeling software (XLfit, 2005). Different curve models ranging from linear, polynomial, exponential/log, power series, hyperbolic and sigmoidal curves were tested. Curves that fitted best with the data points based on re are shown in Figure 4.