BAE, Hyun-ae (#1105-204, Deokcheon 1-dongBuk-gu, Busan 616-100, KR)
KIM, Hyo-jin (303 Richvill, #1075-11 Hwagok 7-dong,Gangseo-gu, Seoul 157-010, KR)
CHANG, Jin-sook (2 Dongil highvill Apt, Sinjeong 3-dong Yangcheon-gu, Seoul 158-070, 01-1102, KR)
JU, Jae-yeong (104-401 Mujigaemaeul Daelim Apt, Gumi-dong Bundang-gu, Seongnam-si, Gyeonggi-do 463-703, KR)
BAE, Hyun-ae (#1105-204, Deokcheon 1-dongBuk-gu, Busan 616-100, KR)
KIM, Hyo-jin (303 Richvill, #1075-11 Hwagok 7-dong,Gangseo-gu, Seoul 157-010, KR)
CHANG, Jin-sook (2 Dongil highvill Apt, Sinjeong 3-dong Yangcheon-gu, Seoul 158-070, 01-1102, KR)
Claims
[1] A glpDFK operon having the nucleotide sequence represented by SEQ. ID. NO:
3 originated from Brevibacterium Linens BL2, which facilitates the use of glycerol.
[2] A vector containing the glpDFK operon according to claim 1.
[3] The vector according to claim 2, wherein the vector is pECCGl 17-Bli glpDFK, a shuttle vector shown in FIG. 1.
[4] Corynebacteria transformed with the vector according to claim 2.
[5] The Corynebacteria according to claim 4, wherein the Corynebacteria is selected from the group consisting of Corynebacterium glutamicum and Corynebacterium glutamicum CgGB 3.
[6] The Corynebacteria according to claim 4, wherein the Corynebacteria is
Corynebacterium glutamicum C003-0011 (KCCM10886P).
[7] A method for producing fermentation product from a carbon source containing glycerol using Corynebacteria, comprising the following steps of: transforming Corynebacteria with the vector containing glpDFK operon having the nucleotide sequence represented by SEQ. ID. NO: 3 originated from Brevibacterium Linens BL2; culturing the transformed Corynebacteria by inoculating in the culture medium containing glycerol aldone or glycerol together with other carbon source as a carbon source; and separating fermentation product from the culture.
[8] The method according to claim 7, wherein Corynebacteria is selected from the group consisting of Corynebacterium glutamicum and Corynebacterium glutamicum CgGB 3.
[9] The method according to claim 7, wherein the Corynebacteria is
Corynebacterium glutamicum C003-0011 (KCCM10886P).
[10] The method according to claim 7, wherein the fermentation product is lysine. |
Description
CORYNEBACTERIA USING CARBON SOURCES CONTAINING GLYCEROL AND PROCESS FOR PRODUCING FERMENTATION PRODUCT USING THE
SAME Technical Field
[1] The present invention relates to Corynebacteria introduced with a foreign gene glpDFK operon involved in the utilization of glycerol. Also, the present invention relates to a method for producing fermentation product from various carbon sources containing glycerol using the Corynebacteria.
[2]
Background Art
[3] In order to solve the problem of high oil price due to increase in the use of natural resources such as petroleum and pollution resulted from the use thereof, it has been tried to develop an alternative energy using recyclable materials in nature. Among many candidates for alternative energy source, BioDiesel obtained from plant oil and Bioethanol produced by fermentation are the most attractive candidates. BioDiesel indicates fatty acid methyl ester or fatty acid ethyl ester synthesized by esterification of methanol produced using plant oil as a substrate in the presence of a catalyst. During the synthesis, the byproduct, glycerol, is necessarily generated by 10% of the total weight.
[4] Glycerol (C H O ) is converted from glucose (C H O ) by 1 step reduction, which
3 8 3 6 12 6 can provide improved reducing power during the metabolism of a microorganism. Many products produced by fermentation require reducing power in their metabolic pathways. Therefore, if the glycerol could be effectively used as a substrate, the yield and productivity would be improved. Despite the expectation, the studies on glycerol have been limited to reuterin (Talarico et. al., Antimicrob. Agents Chemother., 32:1854-1858 (1988)), 2,3-butanediol (Biebl, et al., Appl Microbiol. Biotechnol. 50:24-29 (1998)), 1,3-propanediol (Menzel, et. al., Enzyme Microb. Technol., 20:82-86 (1997)), succinic acid (Korean Patent No. 10-0313134), itaconic acid (US Patent No. 5,457,040), 3-hydroxypropanaldehyde (Doleyres et al. Appl. Micribiol. Biotechnol. 68(4):467-474 (2005)) and propionic acid (Himmi et al., Appl. Microbiol. Biotechnol., 53: 435-440 (2000)). That is because the price of glycerol is higher than
that of any other carbon sources used for the fermentation in this industry. Now, studes to produce glycerol by fermentation are undergoing (Wang et al., Biotechnol. Adv., 19(3):201-223 (2001)).
[5] However, with the increase of BioDiesel production, glycerol production is also increasing, resulting in the rapid reduction of the price. Accordingly, there has been a report that 1,3-propandiol (Gonzalez-Pajuelo et al., J. Ind. Microbiol. Biotechnol. 31: 442-446, (2004)), hydrogen and ethanol (Ito et al., J. Biosci. Bioeng., 100(3): 260-265 (2005)) have been produced by using the byproduct of BioDiesel comprising glycerol. However, no reports have been made to produce the most representative fermentation product, amino acids, and other major metabolites by using glycerol.
[6] Glycerol has been produced so far in the industry of soap, fatty acid, wax and surfactants. However, as mentioned above, it has been a new problem to solve how to treat glycerol, the byproduct, produced during the production of BioDiesel that is dramatically increasing. In the meantime, the price of the purified glycerol is also expected to be dropped. Therefore, the production of useful fermentation products using glycerol might bring effects more than expected.
[7] The cases of using glycerol in microorganisms have been reported in E. coli and
Klebsiella pneumoniae . In E. coli, extracellular glycerol infiltrates in cells by using GIpF, one of aquaglyceroporin having permeability for water, glycerol and urea, without energy consumption (Heller et al., J. Bacteriol. 144:274-278, (1980)). The glycerol is converted into glycerol- 3 -phosphate by glycerol kinase, which is converted again into dihydroxyacetonephosphate (DHAP) by glycerol- 3 -phosphate dehydrogenase and then converted into glyceroaldehyde- 3 -phosphate (G-3-P) by triosephosphate isomerase (TpiA), followed by final metabolism. (Lin EC, Annu. Rev. Microbiol. 30:535-578, (1976)). In the case that glycerol kinase activity has no activity, glycerol is converted into dihydroxyacetone (DHA) by glycerol dehydrogenase (Gdh), which is converted again into dihydroxyacetone phosphate (DHAP) by glycerol kinase or dihydroxyacetone kianse (DHA kinase), followed by conversion again into glyceraldehydes-3-phosphate (G-3-P) before final metabolism (Paulsen et al., Microbiology, 146:2343-2344, (2000)). Such glycerol metabolic pathway is regulated by various factors. Particularly, when glycerol and glucose are together, the wild type E. coli reportedly shows diauxic growth in which the wild type E. coli uses glucose first, exclusively, and then uses glycerol (Lin, Annu. Rev. Microbiol. 30:535-578, (1976)).
[8] Microorganisms of Corynebacterium genus are the ones that have been widely used
in industrial fields. For example, Corynebacterium glutamicum has been used for the production of such amino acids as lysine and monosodium glutamate, and C. am- moniagenes has been used for the production of nucleic acid by fermentation industrially. It has reported that Corynebacteria can use various carbon sources such as glucose and raw sugar for fermentation. It has also been reported that Corynebacteria can use xylose by the introduction of a gene such as xylAB (Kawaguchi et al., Appl. Envion. Microbiol. 72(5): 3418-3428 (2006)).
[9] Among the microorganisms of Corynebacterium genus, only 4 microorganisms were analyzed to identify their total genome sequences. And, a complete gene using glycerol was found only in Corynebacterium diphtheriae and such genes involved in glycerol consumption as GIpF was deficient in other three microorganisms, Corynebacterium glutamicum, Corynebacterium efficiens, and Corynebacterium jeikeium. The deficiency of the gene is the major obstacle for Corynebacteria to use glycerol efficiently.
[10] There have been reported a case of using glycerol as a carbon source by introducing the complete gene using glycerol of Corynebacterium diphtheriae into Corynebacterium glutamicum (Korean Patent Application No. 2006-057633), and a case of producing glutamic acid and lysine therefrom (Korean Patent Application No. 10-2007-007513).
[11] However, there are many restrictions to use the gene of Corynebacterium diphtheria in fermentation industry because Corynebacterium diphtheria is a pathogenic bacterium which is classified as Biosafety level 2. Thus, the present inventors continued studies to solve the above problem and found various strains containing a complete gene using glycerol other than Corynebacterium diphtheria. Among these strains, Brevibacterium genus inducing Brevibacterium linens was one containing a complete gene using glycerol. In particular, according to the result of genomic hybridization experiments, Corynebacterium and Brevibacterium are known to have similar gene specificities. Therefore, there has recently been reported a trend to classify Corynebacterium and Brevibacterium into a single species (Liebl, Ekaman et al., 1991).
[12]
Disclosure of Invention Technical Problem
[13] As explained hereinbefore, there is an added- value to using glycerol which is the
byproduct of BioHesel production as a carbon source. Thus, based on that, the present inventors focused our studies on the glycerol availability of Corynebacteria with industrially high effective value such as Corynebacterium glutamicum and Corynebacterium ammoniagenes. As a result, the present inventors completed this invention by confirming that the glycerol availability could be remarkably improved by introducing a foreign gene involved in the use of glycerol into those Corynebacteria.
[14] It is an object of the present invention to provide an operon involved in the use of glycerol, which is originated from Brevibacterium, a related species of Corynebacterium, to significantly improve glycerol assimilation of Corynebacteria.
[15] It is another object of the present invention to provide a mutant originated from
Corynebacteria using glycerol either alone as a carbon source or together with other carbon sources.
[16] It is further object of the present invention to provide a method for producing fermentation product by fermenting the mutant of Corynebacteria using glycerol either alone as a carbon soruce or together with other carbon sources.
[17]
Technical Solution
[18] The above objects and other objects of the present invention can be achieved by the following embodiments of the present invention.
[19] The present invention is described in detail hereinafter.
[20] To achieve the object of the invention, the present invention provides an operon involved in the use of glycerol to improve glycerol assimilation of Corynebacteria significantly. Preferably, the present invention provides a mutant of the operon involved in the use of glycerol.
[21] The gene involved in the use of glycerol herein indicates a gene encoding glycerol uptake facilitator protein originated from Brevibacterium linens (referred as glpF hereinafter), a gene encoding glycerol kinase which is the enzyme producing glycerol- 3-phosphate by phosphorylation using ATP (referred as glpK hereinafter), and a gene encoding glycerol- 3 -phospho dihydrogenase which is the enzyme producing dihy- droxyacetone-3-phosphate by oxidizing glycerol- 3 -phosphate (referred as glpD hereinafter).
[22] The gene includes any gene encoding a polypeptide in Corynebacteria that plays a role in uptake of extracellular glycerol and converting the glycerol into glycerol- 3-phosphate by phosphorylation, and converting glycerol-3-phosphate into dihy-
droxyacetone-3-phosphate, and then finally converting dihydroxyacetone- 3 -phosphate into glyceraldehyde-3-phosphate, the intermediate of glycolysis, to metabolize.
[23] The gene can be originated from animals, plants, and microorganisms. It is more preferred to select a gene originated from a microorganism, particularly from Brevibacterium linens BL2 (Gene Bank Accession No: NZ_AAGP00000000; SEQ. ID. NO: 7). It is most preferred to select a gene corresponding to SEQ. ID. NO: 3, having a mutation in the nucleotide sequence of glpDFK of Brevibacterium linens BL2
[24] The present invention also provides a mutant originated from Corynebacteria using glycerol either alone as a carbon source or together with other carbon sources.
[25] The strain used in this invention can be growth consuming glycerol and glucose simultaneously to use glycerol effectively. When glucose and glycerol are given simultaneously as a carbon source, the wild type E. coli uses glucose exclusively, and after consuming all the glucose the wild type E. coli uses glycerol, which is so called 'diauxy' Thus, when a complex carbon source containing glycerol is supplied, fermentation efficiency is reduced.
[26] To overcome the above problem, the present inventors investigated the possibility of simultaneous using of glucose and glycerol in the strain. And as a result, the inventors confirmed that glycerol and other carbon sources could be effectively used by the insertion of a foreign gene involved in the use of glycerol originated from Brevibacterium.
[27] In a preferred embodiment of the present invention, the present inventors provide a microorganism containing the gene encoding GIpD (Gene Bank Accession No: NP_00380226.1; SEQ. ID. NO: 4), GIpF (Gene bank Accession No: NP_00380225.1; SEQ ID NO: 5) or GIpK (Gene Bank Accession No: NP_00380224.1; SEQ. ID. NO: 6), the protein involved in the use of glycerol, originated from Brevibacterium linens. The transformation of Corynebacteria with the gene can be performed by the conventional method known to those in the art, and a mutant of Corynebacterium transformed with a vector containing glpDFK operon (SEQ. ID. NO: 3), producing amino acids using glycerol either alone as a carbon source or together with other carbon sources can be provided.
[28] The vector for the present invention is not limited to a specific one and any informed expression vector can be used. Particularly, E. coli-Corynebacterium shuttle vector pECCG117 (Biotechnology letters vol 13, No.10, p.721-726 (1991)) is preferred.
[29] In this description, 'transformation' indicates the process of introducing a gene into a host cell and expressing the gene therein. The gene used for the transformation is
either inserted into chromosome of the host cell or presented in the outside of chromosome as long as it can be expressed in the cell. The gene is a polynucleotide capable of encoding a polypeptide and containing DNA and RNA. The gene is not limited in its form for introduction, as long as it can be expressed in the host cell. For example, the gene can be introduced into the host cell as an expression cassette, the polynucleotide construct that contains every necessary element for auto-expression. The expression cassette comprising a promoter operably linked to the gene, a transcription terminator, a ribosome binding site, and a translation terminator. The expression cassette can be the expression vector capable of auto-replication. Also, the gene can be operably linked to the sequence necessary for the expression in the host cell by introducing into a host cell as in itself or the form of a polynucleotide construct.
[30] In this invention, the microorganism transformed with a gene involved in the use of glycerol to produce amino acids effectively using glycerol can be one of Corynebac- teriaceae, more preferably a microorganism of Corynebacterium genus, and most preferably a microorganism selected from the group consisting of Corynebacterium glutamicum (ex. ATCC 13032), Corynebacterium ammoniagenes (ex. ATCC 6872), Brevibacterium lactofermentum (ex. ATCC13869), Brevibacterium flavum (ex. ATCC14067), Corynebacterium thermoamino genes (ex. FERM-BP 1539) and Corynebacterium efficiens (ex. C. efficiens str. YS-314), but not always limited thereto. And also, the microorganism producing useful materials such as amino acids or nucleic acids, for example Corynebacterium glutamicum SM5 producing glutamic acid and Corynebacterium glutamicum CF 905 (KFCC- 10881) and Corynebacterium glutamicum CgGB 3 producing lysine, can be included, but not always limited thereto.
[31] In a preferred embodiment of the present invention, glpDFK gene of Brevibacterium linens was cloned into pECCG117, E. coli- Corynebacterium shuttle vector, followed by transfection of Corynebacterium glutamicum CgGB 3. Corynebacterium glutamicum CgGB 3 was transformed with the vector. The transformed strain was named Corynebacterium glutamicum C003-0011 (KCCM 10886P)
[32] The present invention further provides a method for producing fermentation product by fermenting Corynebacteria using glycerol either alone as a carbon source or together with other carbon sources. Particularly, the present invention provides a method for producing fermentation product using glycerol as a carbon source comprising the steps of : transforming Corynebacteria with the vector containing glpDFK operon represented by SEQ. ID. NO: 3 which is a gene combination facilitating the use of glycerol; culturing the transformed Corynebacteria by inoculating
in the culture medium containing glycerol either alone as a carbon source or together with other carbon sources; and separating fermentation product from the culture medium.
[33] In the method for producing fermentation product of the present invention, culture of the microorganism can be performed in a proper medium and under proper culture conditions known to those in the art. These conditions can be regulated according to the selected strain. The cultivation methods are exemplified by batch, continuous and fed-batch cultures, but not always limited thereto. Various culture methods are described in "Biochemical Engineering" by James M. Lee, Prentice-Hall International Editions, pp 138-176.
[34] The medium has to meet the requirements for the culture of a specific strain. The medium used in this invention contains glycerol alone or glycerol together with other carbon sources, as a carbon source. In addition to glycerol, other carbon sources can be properly added, and at this time glucose is preferred as a carbon source. As a nitrogen source, such organic nitrogen source as peptone, yeast extract, gravy, malt extract, corn steep liquor and soybean flour, and such inorganic nitrogen source as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be included in the medium. As a phosphate source, potassium dihydrogen phosphate, dipotassium hydrogen phosphate and their corresponding sodium-containing salts can be included in the medium. Besides, a metal salt such as magnesium sulfate or iron sulfate can also be included. Amino acids, vitamins and proper precursors can be included as well. These medium or precursors can be added to the culture by batch-type or continuously.
[35] PH of the culture can be adjusted during the cultivation by adding such a compound as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid. The generation of air bubbles can be inhibited during the cultivation by using an antifoaming agent such as fatty acid polyglycol ester. To maintain aerobic condition of the culture, oxygen or oxygen-containing gas can be injected into the culture. The temperature of the culture is preferably 20-45 0 C, more preferably 25-4O 0 C. The cultivation can be continued until the production of useful materials reachs a desired level, and the preferable culture time is 10-160 hours.
[36]
Brief Description of Drawings
[37] The application of the preferred embodiments of the present invention is best understood with reference to the accompanying drawings, wherein:
[38]
[39] Fig. 1 illustrates a construction of a recombinant plasmϋ pECCGl 17-bli glpDFK containing glpDFK operon.
[40]
Best Mode for Carrying out the Invention
[41] Practical and presently preferred embodiments of the present invention are illustrative as shown in the following Examples.
[42] However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.
[43]
[44] [Examples]
[45] Example 1: Screening and cloning of a gene involved in to the use of glycerol which is operable in Corvnebacteria
[46] The nucleotide sequence of the gene involved in the use of glycerol of Bre- vibacterium linens has already been identified and officially released. Information about genes encoding GIpF, GIpK and GIpD which are genes of Brevibacterium linens involved in the use of glycerol and adjacent nucleotide sequences was obtained from GeneBank, NIH, USA. Gene Bank Accession No. of GIpF of Brevibacterium linens was ZP_00380225.1, Gene Bank Accession No. of GIpK was ZP_00380224.1, and the Gene Bank Accession No. of GIpD was ZP_00380226.1. The genes were confirmed to be arranged in a series on a genome. So, one time PCR could amplify all of the three genes as a single polynucleotide. Primers represented by SEQ. ID. NO: 1 and NO: 2 were used for PCR to amplify the genes involved in the use of glycerol of Brevibacterium linens. The primer represented by SEQ. ID. NO: 1 includes a Xbal restriction enzyme site and the primer represented by SEQ. ID. NO: 2 includes a Pstl site.
[47] SEQ. ID. NO: 1 : 5' ACTCTAGACGCTGCGTGAAGGCATCA 3'
[48] SEQ. ID. NO: 2 : 5' AACTGCAGCGTTGGAAGACGAGCTGC 3'
[49] Chromosome of Brevibacterium linens was purchased from American Type Culture
Collection (ATCQ (ATCC ID. No: 9175D) to amplify the gene involved in the use of glycerol of Brevibacterium linens. PCR was performed using the chromosome of Brevibacterium linens as a template to amplify the gene involved in the use of glycerol. PCR was performed as follows; predenaturation at 94 0 C for 3 minutes, denaturation at 94 0 C for 30 seconds, annealing at 56 0 C for 30 seconds, polymerization at 72 0 C for 4
minutes 30 seconds, 25 cycles from denaturation to polymerization, and final extension at 72 0 C for 5 minutes. The PCR product was transferred on to agarose-gel for electrophoresis. As a result, 4574 bp sized polynucleotide was obtained. The polynucleotide was cloned into pCR2.1 by using TOPO TA cloning kit (Invitrogen).
[50] [51] Example 2: Determination of nucleotide sequence of the glpDFK gene [52] The plasmid obtained above was digested with Xbal and Pstl to obtain a DNA fragment containing the gene involved in the use of glycerol. The DNA fragment was cloned into pECCGl 17, E. coli- Corynebacterium shuttle vector, followed by transformation of E. coli TOPlO.
[53] The plasmid obtained by the conventional plasmid miniprep was named pECCGl 17-bli glpDFK. DNA nucleotide sequence of the pECCGl 17-bli glpDFK was determined and accordingly it was confirmed that the nucleotide sequence from 252 nd
,nd to 1972 encoded glpD gene (SEQ. ID. NO: 4), the nucleotide sequence from 2049 to
. th
2732 "' encoded glpF gene (SEQ. ID. NO: 5) and the nucleotide sequence from 2809 " * to 4341 st encoded glpK gene (SEQ. ID. NO: 6) and there were 21 nucleotide sequence changes (SEQ. ID. NO: 3), compared with the sequence obtained by the conventional genome sequencing. The changes in the nucleotide sequence are shown in Table 1. 9 changes in the nucleotide sequence were found in the promoter site, 11 changes in glpD site, and 1 change in glpK site. Particularly, the change of the 3844 th residue, the glpK site only induced mutation of the amino acid. The mutation of the amino acid was that the 346 cysteine of glpK was changed into glycine.
[54] Table 1 [Table 1]
[55] Example 3: Introduction of gene using glycerol into Corynebacterium slutamicum
ATCC 13032
[56] The prepared expression vector pECCGl 17-bli glpDFK was introduced into
Corynebacterium glutamicum ATCC 13032 (wild type) by electric pulse method. The cell was cultured on the plate medium containing bacto-peptone 10 g/L, yeast extract 10 g/L, beef extract 5 g/L, NaCl 2.5 g/L and kanamycin 25 μg/mL. The obtained colonies proceeded to PCR cloning to select the colonies containing the plasmid comprising the gene involved in the use of glycerol. The selected strain was named ATCC13032/pECCGl 17-bli glpDFK.
[57]
[58] Example 4: Glycerol availability of Corynebacterium slutamicum ATCC 13032
[59] To confirm glycerol availability of Corynebacterium glutamicum
ATCC13032/pECCGl 17-bli glpDFKusing glycerol, Corynebacterium glutamicum ATCC 13032 containing the above plasmid and Corynebacterium glutamicum ATCC 13032 not containing the plasmid were respectively cultured in solid LB medium. These were inoculated respectively in 250 ml corner-baffled flask containing 25 ml of the seed medium, followed by shaking-culture (200 rpm) at 3O 0 C for 48 hours. Residues of glycerol and glucose in the medium were measured by HLC analysis and the results are shown in Table 2. The growth of Corynebacterium glutamicum introduced with pECCGl 17-bli glpDFK was confirmed. But, the growth of the strain not introduced with the plasmid was insignificant.
[60]
[61] Table 2
[Table 2]
[62] From the above results, it was confirmed that while no glucose and glycerol were remained in the medium in the case of Corynebacterium glutamicum ATCC 13032 introduced with pECCGl 17-bli glpDFK, glucose was not remained but glycerol was remained as it was in the case of wild type strain not introduced with the above plasmid. Also, it was confirmed that the strain introduced with the above plasmid showed superior growth as compared to the strain not introduced with the above plasmid and particularly showed OD of 57.5 which is markably different from 6.6 in
600 the case of the strain not introduced with the above plasmid even under a condition where glycerol alone is present as a carbon source.
[63] Therefore, it was confirmed that Corynebacterium glutamicum ATCC 13032 could not be growing by using glycerol, but Corynebacterium glutamicum ATCC13032/pECCGl 17-bli glpDFK containing glpDFK gene of Brevibacterium linens could be growing by using glycerol as a carbon source.
[64] [65] Example 5: Introduction of a gene involved in the use of glycerol into a lysine- producing strain
[66] To investigate whether it was possible not only to produce useful materials but also to stimulate the growth of Corynebacteria using glycerol, the expression vector pECCGl 17-bli glpDFK was introduced into Corynebacterium glutamicum CgGB3, a
lysine-producing strain, by electric pulse method through the same manner as described in Example 3. The obtained colonies proceeded to PCR cloning to select the colony containing the plasmid comprising the gene involved in the use of glycerol. The selected strain was named Corynebacterium glutamicum C003-0011, which was deposited at KCCM (Korean Culture Center of Microorganisms) of KFCC (Korean Federation of Culture Collection), the International Depository Authority located at 361-221, Hongje-1-Dong, Seodaemungu-Gu, Seoul, Korea, on October 19, 2007 (Accession No: KCCM10886P).
[67]
[68] Example 6: Lysine production of a lysine-producing strain Corynebacterium dutamicum C003-0011 (KCCM10886P) using glycerol
[69] Corynebacterium glutamicum mother strain CgGB3 and C003-0011 (KCCM10886P) containing pECCGl 17-bli glpDFK, the strain of the present invention, were inoculated respectively in 250 ml corner-baffled flask containing 25 ml of the seed medium, followed by shaking-culture (200 rpm) at 3O 0 C for 20 hours. 1 ml of the seed culture solution was inoculated in 250 ml corner-baffled flask containing 24 ml of the production medium, followed by shaking-culture (200 rpm) at 3O 0 C for 4 days. Upon completion of the culture, L-lysine production was measured with an amino acid analyzer. L-lysine levels in Corynebacterium glutamicum CgGB3 and C003-0011 (KCCM10886P) cultures were investigated and the results are shown in Table 3.
[70] Table 3
[Table 3]
[71] From the above results, when pECCGl 17-bli glpDFK, the gene involved in the use of glycerol, was introduced into the lysine-producing strain, the strain exhibited glycerol availability unlike the mother strain that cannot use glycerol at all, and lysine production was increased.
[72] Seed medium (pH 7.0 s ): [73] Glucose 40 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, K FPO 8 g, MgSO -7H O
2 4 4 2
0.5 g, Biotin 100 kits, Thiamine-HCl 1000 kits, Calcium-pantothenic acid 2000 kits, Nicotinamide 2000 kits (in 1 liter of process water).
[74] Production medium (pH 7.0 s ): [75] Glucose 100 g, (NH ) SO 40 g, Soy protein 2.5g, Corn Steep Solids 5 g, Urea 3 g,
4 2 4
KH PO 1 g, MgSO -7H O 0.5 g, Biotin 100 kit, Thiamine HCl 1000 kit, Calcium-
2 4 4 2 pantothenic acid 2000 kits, Nicotinamide 3000 kits, CaCO 30 g (in 1 liter of process water)
[76]
Industrial Applicability [77] As explained hereinbefore, the present invention provides a method for producing useful materials with high yield using glycerol effectively which is the byproduct of BioEXesel. The microorganism of the present invention can produce useful materials effectively in the medium containing a complex carbon source comprising glycerol
and in the medium containing glycerol alone as a carbon source. Therefore, the microorganism capable of producing useful materials, based on the microorganism of the present invention, can use glycerol as a carbon source effectively. [78] Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended claims.