Background of the invention

The clustered regularly interspersed palindromic repeats (CRISPR) system is responsible for the acquired immunity of bacteria (1), which is shared among 40% of eubacteria and 90% of archaea (2). When bacteria are attacked by infectious agents, such as phages or plasmids, a subpopulation of the bacteria incorporates segments of the infectious DNA into a CRISPR locus as a memory of the bacterial adaptive immune system (1). If the bacteria are infected with the same pathogen, short R A transcribed from the CRISPR locus is integrated into CRISPR-associated protein 9 (Cas 9), which acts as a sequence-specific endonuclease and eliminates the infectious pathogen (3).

CRISPR Cas9 is available as a sequence-specific endonuclease (4, 5) that can cleave any locus of the genome if a guide RNA (gRNA) is provided. Indels on the genomic loci generated by nonhomologous end joining (NHEJ) can knock out the corresponding gene (4, 5). By designing gRNA for the gene of interest, individual genes can be knocked out one -by-one (reverse genetics); however, this strategy is not helpful when the gene responsible for the phenomenon of interest is not identified. If a proper read out and selection method is available, phenotype screening (forward genetics) is an attractive alternative.

Recently, genome-scale pooled gRNA libraries have been applied for forward genetics screening in mammals (6-9). While phenotypic screening depends on the experimental set-up, the most straightforward method is screening based on the viability of mutant cell lines that are combined with either positive or negative selection. Negative selection screens for human gRNA libraries have identified essential gene sets involved in fundamental processes (6-8). Screens for resistance to nucleotide analogs or anti-cancer drugs successfully identified previously validated genes as well as novel targets (6-8). Thus, Cas9/gRNA screening has been shown to be a powerful tool for systematic genetic analysis in mammalian cells.

The gRNA for Streptococcus pyogenes (Sp) Cas9 can be designed as a 20-bp sequence that is adjacent to the protospacer adjacent motif (PAM) NGG (4, 5). Such a sequence can usually be identified from the coding sequence or locus of interest by bioinformatics techniques, but this approach is difficult for species with poorly annotated genetic information. Despite current advances in genome bioinformatics, annotation of the genetic information is incomplete in most species, except for well-established model organisms such as human, mouse, or yeast. While the diversity of species represents a diversity of special biological abilities, according to the organism, many of the genes encoding special abilities in a variety of species are left untouched, leaving an untapped gold mine of genetic information. Nevertheless, species-specific abilities are certainly beneficial due to possible transplantation in humans or applications for medical research.

If one wants to convert the mRNA into gRNA without prior knowledge of the target DNA sequences, the major challenges are to find the sequences flanking the PAM and to cut out the 20-bp fragment.

Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelsen, T.S., Heckl, D., Ebert, B.L., Root, D.E., Doench, J.G. & Zhang, F. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84-87 (2014) show that lentiviral delivery of a genome-scale CRISPR- Cas9 knockout (GeCKO) library targeting 18,080 genes with 64,751 unique guide sequences enables both negative and positive selection screening in human cells. The disclosed sgRNA library was constructed using chemically synthesized oligonucleotides. Although the genome-scale sgRNA library is powerful, construction of an sgRNA in this way requires sufficient genetic information of the species in order to design guide sequences as well as enormous cost to synthesize a huge number of oligos. This makes difficult to create sgRNA library de novo in different biological model species. Wang, T., Wei, J.J., Sabatini, D.M. & Lander, E.S. Genetic screens in human cells using the CRISPR-Cas9 system. Science 343, 80-84 (2014) refers to a pooled, loss-of- function genetic screening approach suitable for both positive and negative selection that uses a genome-scale lentiviral single-guide RNA (sgRNA) library. sgRNA expression cassettes were stably integrated into the genome, which enabled a complex mutant pool to be tracked by massively parallel sequencing. A library containing 73,000 sgRNAs was used to generate knockout collections and performed screens in two human cell lines. A screen for resistance to the nucleotide analog 6- thioguanine identified all expected members of the DNA mismatch repair pathway, whereas another for the DNA topoisomerase II (TOP2A) poison etoposide identified TOP2A, as expected, and also cyclin-dependent kinase 6, CDK6. A negative selection screen for essential genes identified numerous gene sets corresponding to fundamental processes. Last, it was shown that sgRNA efficiency is associated with specific sequence motifs, enabling the prediction of more effective sgRNAs. Collectively, these results establish Cas9/sgRNA screens as a powerful tool for systematic genetic analysis in mammalian cells. The sgRNA library was constructed also using a huge number of chemically synthesized oligonucleotides. Lane et al. developed an elegant approach using PAM-like restriction enzymes to generate guide libraries, which can label chromosomal loci in Xenopus egg extracts or can target the E. coli genome at high frequency (18).

The patent Application WO2015065964 relates to libraries, kits, methods, applications and screens used in functional genomics that focus on gene function in a cell and that may use vector systems and other aspects related to Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)- Cas systems and components thereof. The patent application also relates to rules for making potent single guide RNAs (sgRNAs) for use in CRISPR-Cas systems. Provided are genomic libraries and genome wide libraries, kits, methods of knocking out in parallel every gene in the genome, methods of selecting individual cell knock outs that survive under a selective pressure, methods of identifying the genetic basis of one or more medical symptoms exhibited by a patient, and methods for designing a genome-scale sgRNA library. The obtained sgR A library is based on bioinformatics and cloning of a huge number of oligonucleotides.

The patent application US2014357523 refers to a method for fragmenting a genome. In certain embodiments, the method comprises: (a) combining a genomic sample containing genomic DNA with a plurality of Cas9-gRNA complexes, wherein the Cas9-gR A complexes comprise a Cas9 protein and a set of at least 10 Cas9-associated guide RNAs that are complementary to different, pre-defined, sites in a genome, to produce a reaction mixture; and (b) incubating the reaction mixture to produce at least 5 fragments of the genomic DNA. Also provided is a composition comprising at least 100 Cas9-associated guide RNAs that are each complementary to a different, pre-defined, site in a genome. Kits for performing the method are also provided. In addition, other methods, compositions and kits for manipulating nucleic acids are also provided. This approach aims fragmentation of the target of initially identified genes (reverse genetics), and is not related to a construction of a genome-scale sgRNA library. The clustered regularly interspersed palindromic repeats (CRISPR)/Cas9 system is a powerful tool for genome editing ⁴ ' ⁵ that can be used to construct a guide RNA (gRNA) library for genetic screening ⁶ ' ⁷ . For gRNA design, one must know the sequence of the 20-mer flanking the protospacer adjacent motif (PAM) ⁴ ' ⁵ , which seriously impedes making gRNA experimentally. Therefore, it is still felt the need of a method for obtaining a sgRNA library by molecular biological techniques without relying on bioinformatics and without requiring prior knowledge about the target DNA sequences, making the method applicable to any species.

Summary of the invention

Inventor herein describes a method to construct a gRNA library by molecular biological techniques, without relying on bioinformatics, and which allows forward genetics screening of any species, independent of their genetic characterization. Since the present method is not based on bioinformatics, it is possible to create guide sequences even from unknown genetic information. Briefly, one synthesizes cDNA from the mRNA sequence using a semi-random primer containing a complementary sequence to the PAM and then cuts out the 20-mer adjacent to the PAM using type IIS and type III restriction enzymes to create a gRNA library.

The described approach does not require prior knowledge about the target DNA sequences, making it applicable to any species, whereas gRNA libraries generated this way are at least 100-fold cheaper than oligo cloning-based libraries.

It is therefore an object of the invention the use of a semi-random primer comprising a protospacer adjacent motif (PAM)-complementary sequence to produce a clustered regularly interspersed short palindromic repeats (CRISPR)-Cas single-guide RNA (sgRNA) library or a sgRNA or a guide sequence.

Preferably, said semi-random primer is used as cDNA synthesis primer to produce a clustered regularly interspersed short palindromic repeats (CRISPR)-Cas single-guide RNA (sgRNA) library or a sgRNA or a guide sequence.

Said semi-random primer is preferably 4 to 10 nucleotides long.

The PAM-complementary sequence is preferably complementary to a PAM sequence specific for S. progenies (Sp) Cas9, Neisseria meningitidis (NM) Cas9, Streptococcus thermophilus (ST) Cas9 or Treponema denticola (TD) Cas9, orthologues, homologues or variants thereof.

Said PAM-complementary sequence is a sequence which is preferably substantially complementary or more preferably perfectly complementary to a PAM sequence.

In a preferred embodiment of the invention the PAM sequence is selected from the group consisting of: 5 '-NGG-3 ', 5 '-NNNNGATT-3 ', 5 ' -NN AG AAW-3 ' and 5'-NAAAAC-3', orthologues, homologues or variants thereof, wherein N is a nucleotide selected from C, G, A and T. Said PAM-complementary sequence preferably comprises the sequence 5- CCN-3 ', wherein N is a nucleotide selected from C, G, A and T, said primer being preferably phosphorylated at the 5 ' terminus.

Preferably, the semi-random primer comprises or has essentially the sequence of SEQ ID NO: 1 (5'- NNNCCN-3').

A further object of the invention is a method for obtaining a guide sequence comprising the following steps:

a) DNA synthesis from a RNA or a DNA using a semi-random primer as defined in any one of previous claims,

b) generation of guide sequences by molecular biological methods.

The guide sequence is preferably generated from mass RNA or DNA by molecular biological methods including cDNA synthesis and/or restriction digest and/or DNA ligation and/or PCR.

Said guide sequence is preferably generated cutting the synthetized DNA to obtain a guide sequence.

The obtained guide sequence preferably consists of 20 base pairs.

The cutting is preferably carried out with at least one type III restriction enzyme and/or a type IIS restriction enzyme.

Preferably the cutting is carried out with enzymes that cleave 25/27 and/or 14/16 base pairs away from their recognition site.

The method of the invention preferably further comprises, before cutting the synthetized DNA, a step wherein the synthetized DNA is modified by addition of restriction sites for said restriction enzymes.

In the a preferred embodiment of the method of the invention, step b) comprises the following steps: i) modification of synthetized DNA by addition:

- to the 5' end of the synthetized DNA of a linker sequence comprising a type III first restriction site and/or a type IIS second restriction site

and/or

- to the 3' end of the synthetized DNA of a linker sequence comprising a type IIS third restriction site and/or a type III fourth restriction sites

ii) cutting of the modified DNA as above defined .

In a preferred embodiment of the invention, the synthetized DNA is modified by the addition : - to the 5' end of the synthetized DNA of a linker sequence comprising a type III first restriction site and/or a type IIS second restriction site

and

- to the 3' end of the synthetized DNA of a linker sequence comprising a type IIS third restriction site and/or a type III fourth restriction sites.

More preferably, the synthetized DNA is modified by the addition :

- to the 5' end of the synthetized DNA of a linker sequence comprising a type III first restriction site and

- to the 3' end of the synthetized DNA of a linker sequence comprising a type IIS third restriction site and a type III fourth restriction sites.

Preferably, the synthetized DNA is a dsDNA.

Preferably, the RNA is a mRNA, more preferably a purified poly(A)RNA.

The type III restriction site is preferably selected from the group consisting of: EcoP15I or EcoPlI restriction site, more preferably the type III restriction site is EcoP15I.

The type IIS restriction sites is preferably selected from the group consisting of: Acul, Bbvl, Bpml, Fokl, Gsul, Bsgl, Eco57I, Eco57MI, BpuEI or Mmel restriction site, more preferably the type IIS restriction site is Acul.

In a preferred embodiment of the invention, the linker sequence at the 5 ' end of the synthetized DNA preferably comprises an EcoP15I restriction site.

Preferably, the linker sequence at the 3' end of the synthetized DNA comprises an EcoP15I restriction site and an Acul restriction site.

In a preferred embodiment, the linker sequence at the 5' end of the synthetized DNA further comprises a fifth restriction site, preferably Bglll restriction site, and/or the linker sequence at the 3' end of the synthetized DNA further comprises a sixth restriction site, preferably a Xbal restriction site.

Other suitable restriction sites may be used instead of Bglll or Xbal.

In a preferred embodiment the linker at the 3' end of the synthetized DNA is:

EcoP15l Acul Xbai

5' CTG CTG A CTTC AGTG GTTC T AG AGGTGTC C A AC 3 ' (SEQ ID NO : 284)

3' p TG ACG ACTG AAGTC AC C AAG AT CTC C AC AG GTTG 5' (SEQ ID NO : 3)

or Eco P15l Acu i Xba I

5 : C ⁼ G C ^' ϋ Λ C L ] GG l I C 1 AG <\G G I G l Ί C ΛΛ 3 ^* (SEQ ID NO : 2)

3 TG A C G AC TG A AG TC AC A AG ATCTCCACAGGTTG-5' (SEQ ID NO : 3)

Preferably, the above method further comprises a step i') wherein the modified DNA is digested with the specific type III restriction enzyme.

More preferably, the method further comprising a step i") wherein the to the 5' end of the digested DNA is added a further linker sequence comprising a seventh restriction site which is a cloning site for the gRNA expression vector and a eight restriction site, preferably a Aatll restriction site, and the DNA is then optionally digested with the specific restriction enzyme for the fifth restriction site at the 5', preferably Bglll restriction enzyme.

Other suitable restriction sites may be used instead of Aatll or Bglll.

Preferably the restriction site which is a cloning site is a BsmBI site.

The above defined method preferably further comprises a step i'") wherein the DNA is amplified, preferably by PCR, and digested with the specific type IIS restriction enzyme for the third restriction site at the 3' and optionally with the specific restriction enzyme for the sixth restriction site, preferably with Xbal.

The above defined method preferably further comprises a step i"") wherein the guide sequence fragment is purified from the digested DNA and ligated with a further linker sequence at the 3 ' end comprising a restriction site which is a cloning site for the gRNA expression vector and optionally a ninth restriction site, preferably Aatll restriction site.

The above defined method preferably further comprises a step i'"") wherein the DNA is amplified, preferably by PCR, and digested with the specific restriction enzyme for the cloning site and optionally with the specific restriction enzyme for the ninth restriction site, preferably with Aatll. In a preferred embodiment, 25-bp fragments are then purified.

Another object of the invention is an isolated guide sequence obtainable by the method of the invention.

A further object of the invention is an isolated sgRNA comprising the RNA corresponding to the isolated guide sequence as above defined. Another object of the invention is a method for obtaining a CRISPR-Cas system sgRNA library comprising cloning the guide sequences as above defined into a sgRNA expression vector and transforming said vector into a competent cell to obtain a CRISP-Cas system sgRNA library.

Preferably, the expression vector is a lentivirus, and/or the vector comprises a species specific functional promoter, preferably a pol III promoter, more preferably U6 promoter and/or a gRNA scaffold sequence.

A further object of the invention is a CRISPR-Cas system sgRNA library obtainable by above defined method.

Another object of the invention is a library comprising a plurality of CRISPR-Cas system guide sequences that target a plurality of target sequences in genomic loci of a plurality of genes, wherein said targeting results in a knockout of gene function,

wherein the unique CRISPR-Cas system guide sequences are obtained by using a semi-random primer as above defined in.

Said plurality of genes are preferably Gallus gallus genes.

Another object of the invention is an isolated sgRNA or an isolated guide sequence selected from the library of the invention.

A further object of the invention is the use of the guide sequence as above defined or of the CRISPR-Cas system sgRNA library as above defined or of the sgRNA as above defined, for functional genomic studies, preferably to select individual cell knock outs that survive under a selective pressure and/or to identify the genetic basis of one or more biological or medical symptoms exhibited by a subject and/or to knocking out in parallel every gene in the genome.

Other objects of the invention are a kit comprising the semi-random primer as above defined for carrying out the above defined method, a kit comprising the guide sequence as above defined or the CRISPR-Cas system sgRNA library as above defined or the sgRNA as above defined; a kit comprising one or more vectors, each vector comprising at least one guide sequence according to the invention, wherein the vector comprises a first regulatory element operably linked to a tracr mate sequence and a guide sequence upstream of the tracr mate sequence, wherein when expressed, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, wherein the CRISPR complex comprises a Cas9 enzyme complexed with (1) the guide sequence and (2) the tracr mate sequence that is hybridized to a tracr sequence; an isolated DNA molecule encoding the guide sequence as above defined or the sgRNA as above defined; a vector comprising a DNA molecule as above defined; an isolated host cell comprising the DNA molecule as above defined or the vector as above defined, the isolated host cell as above defined which has been transduced with the library as above defined.

The primer used in the present invention is a semi-random primer, which is composed of mixture of fixed and random sequence.

In one aspect, the invention provides a library comprising a plurality of CRISPR-Cas sytem guide sequence that are capable of targeting a plurality of target sequences in genomic loci, wherein said targeting results in a knockout of gene function.

The invention also comprehends kit comprising the library of the invention. In certain aspects, wherein the kit comprises a single container comprising vectors comprising the library of the invention. In other aspects, the kit comprises a single container comprising plasmids comprising the library of the invention. The invention also comprehends kits comprising a panel comprising a selection of unique CRISPR-Cas system guide sequences from the library of the invention, wherein the selection is indicative of a particular physiological condition. The kit may also comprise a panel comprising a selection of unique CRISPR-Cas system guide R As comprising guide sequences from the library of the invention, wherein the selection is indicative of a particular physiological condition. In preferred embodiments, the targeting is of about 100 or more sequences, about 1000 or more sequences or about 20,000 or more sequences or the entire genome; in other embodiments a panel of target sequences is focused on a relevant or desirable pathway, such as an immune pathway or cell division. In one aspect, the invention provides a genome wide library comprising a plurality of unique CRISPR-Cas system guide sequences that are capable of targeting a plurality of target sequences in genomic loci of a plurality of genes, wherein said targeting results in a knockout of gene function.

In certain embodiments of the invention, the guide sequences are capable of targeting a plurality of target sequences in genomic loci of a plurality of genes selected from the entire genome, in embodiments, the genes may represent a subset of the entire genome; for example, genes relating to a particular pathway (for example, an enzymatic pathway) or a particular disease or group of diseases or disorders may be selected. One or more of the genes may include a plurality of target sequences; that is, one gene may be targeted by a plurality of guide sequences. In certain embodiments, a knockout of gene function is not essential, and for certain applications, the invention may be practiced where said targeting results only in a knockdown of gene function. However, this is not preferred.

In another aspect, the invention provides for a method of knocking out in parallel every gene in the genome, the method comprising contacting a population of cells with a composition comprising a vector system comprising one or more packaged vectors comprising

a) a first regulatory element operably linked to a CRISPR-Cas system chimeric R A (chiR A) polynucleotide sequence that targets a DNA molecule encoding a gene product, wherein the polynucleotide sequence comprises

(a) a guide sequence capable of hybridizing to a target sequence,

(b) a tracr mate sequence, and

(c) a tracr sequence, and

b) a second regulatory element operably linked to a Cas protein and a selection marker, wherein components (a) and (b) are located on same or different vectors of the system, wherein each cell is transduced or transfected with a single packaged vector,

selecting for successfully transduced cells,

wherein when transcribed, the tracr mate sequence hybridizes to the tracr sequence and the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in the genomic loci of the DNA molecule encoding the gene product,

wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence,

wherein the guide sequence is selected from the library of the invention,

wherein the guide sequence targets the genomic loci of the DNA molecule encoding the gene product and the CRISPR enzyme cleaves the genomic loci of the DNA molecule encoding the gene product and whereby each cell in the population of cells has a unique gene knocked out in parallel. The present methods and uses may be carried out in any kind of cells or organisms. In preferred embodiments, the cell is a eukaryotic cell. The eukaryotic cell may be a plant or animal cell; for example, algae or microalgae; invertebrates, such as planaria; vertebrate, preferably mammalian, including murine, ungulate, primate, human; insect. In further embodiments the vector is a lenti virus, an adenovirus or an AAV and/or the first regulatory element is a U6 promoter and/or the second regulatory element is an EPS promoter or a doxycycline inducible promoter, and/or the vector system comprises one vector and/or the CRISPR enzyme is Cas9. In aspects of the invention the cell is a eukaryotic cell, preferably a human cell. In a further embodiment, the cell is transduced with a multiplicity of infection (MOT) of 0.3-0.75, preferably, the MOI has a value close to 0.4, more preferably the MOI is 0.3 or 0.4.

The invention also encompasses methods of selecting individual cell knock outs that survive under a selective pressure, the method comprising

contacting a population of cells with a composition comprising a vector system comprising one or more packaged vectors comprising

a) a first regulatory element operably linked to a CRISPR-Cas system chimeric R A (chiR A) polynucleotide sequence that targets a DNA molecule encoding a gene product,

wherein the polynucleotide sequence comprises

(a) a guide sequence capable of hybridizing to a target sequence,

(b) a tracr mate sequence, and

(c) a tracr sequence, and

b) a second regulatory element operably linked to a Cas protein and a selection marker, wherein components (a) and (b) are located on same or different vectors of the system, wherein each cell is transduced or transfected with a single packaged vector,

selecting for successfully transduced cells,

wherein when transcribed, the tracr mate sequence hybridizes to the tracr sequence and the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in the genomic loci of the DNA molecule encoding the gene product,

wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence,

wherein the guide sequence is selected from the library of the invention,

wherein the guide sequence targets the genomic loci of the DNA molecule encoding the gene product and the CRISPR enzyme cleaves the genomic loci of the DNA molecule encoding the gene product, whereby each cell in the population of cells has a unique gene knocked out in parallel, applying the selective pressure,

and selecting the cells that survive under the selective pressure. In preferred embodiments, the selective pressure is application of a drug, FACS sorting of cell markers or aging and/or the vector is a lentivirus, a adenovirus or a AAV and/or the first regulatory element is a U6 promoter and/or the second regulatory element is an EFS promoter or a doxycycline inducible promoter, and/or the vector system comprises one vector and/or the CRISPR enzyme is Cas9. In a further embodiment the cell is transduced with a multiplicity of infection (MOI) of 0.3- 0.75, preferably, the MOI has a value close to 0.4, more preferably the MOI is 0.3 or 0,4. In aspects of the invention the cell is a eukaryotic cell. The eukaryotic cell may be a plant or animal cell; for example, algae or microalgae; invertebrate; vertebrate, preferably mammalian, including murine, ungulate, primate, human; insect. Preferably the cell is a human cell. In preferred embodiments of the invention, the method further comprises extracting DNA and determining the depletion or enrichment of the guide sequences by deep sequencing.

In other aspects, the invention encompasses methods of identifying the genetic basis of one or more medical symptoms exhibited by a subject, the method comprising

obtaining a biological sample from the subject and isolating a population of cells having a first phenotype from the biological sample;

contacting the cells having the first phenotype with a composition comprising a vector system comprising one or more packaged vectors comprising

a) a first regulatory element operably linked to a CRISPR-Cas system chimeric R A (chiR A) polynucleotide sequence that targets a DN A molecule encoding a gene product,

wherein the polynucleotide sequence comprises

(a) a guide sequence capable of hybridizing to a target sequence,

(b) a tracr mate sequence, and

(c) a tracr sequence, and

b) a second regulatory element operably linked to a Cas protein and a selection marker, wherein components (a) and (b) are located on same or different vectors of the system, wherein each cell is transduced or transfected with a single packaged vector,

selecting for successfully transduced cells,

wherein when transcribed, the tracr mate sequence hybridizes to the tracr sequence and the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in the genomic loci of the DNA molecule encoding the gene product, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence that is hybridized to the target sequence, and (2) the tracr mate sequence that is hybridized to the tracr sequence,

wherein the guide sequence is selected from the library of the invention,

wherein the guide sequence targets the genomic loci of the DN A molecule encoding the gene product and the CRISPR enzyme cleaves the genomic loci of the DNA molecule encoding the gene product, whereby each cell in the population of cells has a unique gene knocked out in parallel, applying a selective pressure, selecting the cells that survive under the selective pressure, determining the genomic loci of the DNA molecule that interacts with the first phenotype and identifying the genetic basis of the one or more medical symptoms exhibited by the subject.

In preferred embodiments, the selective pressure is application of a drug, FACS sorting of cell markers or aging and/or the vector is a lenti virus, an adenovirus or an AAV and/or the first regulatory element is a U6 promoter and/or the second regulatory element is an EFS promoter or a doxycycline inducible promoter, and/or the vector system comprises one vector and/or the CRISPR enzyme is Cas9. In a further embodiment the cell is transduced with a multiplicity of infection (MOI) of 0.3-0.75, preferably, the MO I has a value close to 0.4, more preferably the MOI is 0.3 or 0.4. in aspects of the invention the cell is a eukaryotic cell, preferably a human cell.

In an aspect, the invention provides a non-human eukaryotic organism; preferably a multicellular eukaryotic organism, comprising a eukaryotic host cell according to any of the described embodiments in which a candidate gene is knocked down or knocked out. Preferably the gene is knocked out. In other aspects, the invention provides a eukaryotic organism; preferably a multicellular eukaryotic organism, comprising a eukaryotic host cell which has been altered according to any of the described embodiments. The organism in some embodiments of these aspects may be an animal; for example a mammal. Also, the organism may be an arthropod such as an insect. The organism also may be a plant. Further, the organism may be a fungus. In some embodiments, the invention provides a set of non-human eukaryotic organisms, each of which comprises a eukaryotic host cell according to any of the described embodiments in which a candidate gene is knocked down or knocked out. In preferred embodiments, the set comprises a plurality of organisms, in each of which a different gene is knocked down or knocked out.

In some embodiments, the CRISPR enzyme comprises one or more nuclear localization sequences of sufficient strength to drive accumulation of said CRISPR enzyme in a detectable amount in the nucleus of a eukaryotic cell. In some embodiments, the CRISPR enzyme is a type II CRISPR system enzyme. In some embodiments, the CRISPR enzyme is a Cas9 enzyme. In some embodiments, the Cas9 enzyme is S. pneumoniae, S. pyogenes or S. thermophilus Cas9, and may include mutated Cas9 derived from these organisms. The enzyme may be a Cas9 homolog or ortholog. In some embodiments, the CRISPR enzyme is codon - optimized for expression in a eukaryotic cell. In some embodiments, the CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence, in some embodiments, the CRISPR enzyme lacks DNA strand cleavage activity. In some embodiments, the first regulatory element is a polymerase III promoter. In some embodiments, the second regulatory element is a polymerase II promoter. In some embodiments, the guide sequence is at least 15, 16, 17, 18, 19, 20, 25 nucleotides, or between 10-30, or between 15-25, or between 15- 20 nucleotides in length. In an advantageous embodiment the guide sequence is 20 nucleotides in length.

In a preferred embodiment, the invention has advantageous pharmaceutical application, e.g., the invention may be harnessed to test how robust any new drug designed to kill cells (eg. chemotherapeutic) is to mutations that KO genes. Cancers mutate at an exceedingly fast pace and the libraries and methods of the invention may be used in functional genomic screens to predict the ability of a chemotherapy to be robust to "escape mutations".

According to one aspect of the invention, a method of altering a eukaryotic cell is providing including transfecting the eukaryotic cell with a nucleic acid encoding RNA complementary to genomic DNA of the eukaryotic cell, transfecting the eukaryotic cell with a nucleic acid encoding an enzyme that interacts with the RNA and cleaves the genomic DNA in a site specific manner, wherein the cell expresses the RNA and the enzyme, the RNA binds to complementary genomic DNA and the enzyme cleaves the genomic DNA in a site specific manner. Said nucleic acid encoding RNA complementary to genomic DNA is preferably the guide sequence of the present invention. Preferably, the enzyme is Cas9 or modified Cas9 or a homolog of Cas9. More preferably, the eukaryotic cell is a yeast cell, a plant cell or a mammalian cell. According to one aspect, the RNA includes between about 20 to about 100 nucleotides.

According to one aspect of the invention, to direct Cas9 to cleave sequences of interest, crRNA- tracrRNA fusion transcripts are expressed, herein also referred to as "guide RNAs" (gRNAs), from the human U6 polymerase III promoter. gRNAs may be directly transcribed by the cell. The invention also provides a method of generating a gene knockout cell library comprising introducing into each cell in a population of cells a vector system of one or more vectors that may comprise an engineered, non-naturally occurring CRISPR-Cas system comprising I. a Cas protein, and II. one or more guide RNAs of the library of the invention, wherein components I and II may be on the same or on different vectors of the system, integrating components I and II into each cell, wherein the guide sequence targets a unique gene in each cell, wherein the Cas protein is operably linked to a regulatory element, wherein when transcribed, the guide RNA comprising the guide sequence directs sequence-specific binding of a CRISPR-Cas system to a target sequence in the genomic loci of the unique gene, inducing cleavage of the genomic loci by the Cas protein, and confirming different knockout mutations in a plurality of unique genes in each cell of the population of cells thereby generating a gene knockout cell library. In an embodiment of the invention, the Cas protein is a Cas9 protein. In another embodiment, the one or more vectors are plasmid vectors. In a further embodiment, the regulatory element operably linked to the Cas protein is an inducible promoter, e.g. a doxycycline inducible promoter. The invention comprehends that the population of cells is a population of eukaryotic cells, and in a preferred embodiment, the population of cells is a population of embryonic stem (ES) cells, preferably non human. In another aspect the invention provides for use of genome wide libraries for functional genomic studies. Such studies focus on the dynamic aspects such as gene transcription, translation, and protein-protein interactions, as opposed to the static aspects of the genomic information such as DNA sequence or structures, though these static aspects are very important and supplement one's understanding of cellular and molecular mechanisms. Functional genomics attempts to answer questions about the function of DNA at the levels of genes, RNA transcripts, and protein products. A key characteristic of functional genomics studies is a genome -wide approach to these questions, generally involving high-throughput methods rather than a more traditional "gene-by-gene" approach. Given the vast inventory of genes and genetic information it is advantageous to use genetic screens to provide information of what these genes do, what cellular pathways they are involved in and how any alteration in gene expression can result in particular biological process.

Preferably, delivery is in the form of a vector which may be a viral vector, such as a lenti- or baculo- or preferably adeno-viral/adeno-associated viral vectors, but other means of delivery are known (such as yeast systems, microvesicles, gene guns/means of attaching vectors to gold nanoparticles) and are provided. A vector may mean not only a viral or yeast system (for instance, where the nucleic acids of interest may be operably linked to and under the control of (in terms of expression, such as to ultimately provide a processed RNA) a promoter), but also direct delivery of nucleic acids into a host cell. While in herein methods the vector may be a viral vector and this is advantageously an AAV, other viral vectors as herein discussed can be employed, such as lentivirus. For example, baculoviruses may be used for expression in insect cells. These insect cells may, in turn be useful for producing large quantities of further vectors, such as AAV or lentivirus vectors adapted for delivery of the present invention. Also envisaged is a method of delivering the present CRISP enzyme comprising delivering to a cell mRNA encoding the CRISPR enzyme. It will be appreciated that in certain embodiments the CRISPR enzyme is truncated, and/or comprised of less than one thousand amino acids or less than four thousand amino acids, and/or is a nuclease or nickase, and/or is codon- optimized, and/or comprises one or more mutations, and/or comprises a chimeric CRISPR enzyme, and/or the other options as herein discussed. AAV and lentiviral vectors are preferred.

Viral delivery: The CRISPR enzyme, for instance a Cas9, and/or any of the present R As, for instance a guide RNA, can be delivered using adeno associated virus (AAV), lentivirus, adenovirus or other viral vector types, or combinations thereof. Cas9 and one or more guide RNAs can be packaged into one or more viral vectors. In some embodiments, the viral vector is delivered to the tissue of interest by, for example, an intramuscular injection, while other times the viral delivery is via intravenous, transdermal, intranasal, oral, mucosal, or other delivery methods. Such delivery may be either via a single dose, or multiple doses. One skilled in the art understands that the actual dosage to be delivered herein may vary greatly depending upon a variety of factors, such as the vector chose, the target cell, organism, or tissue, the general condition of the subject to be treated, the degree of transformation/modification sought, the administration route, the administration mode, the type of transformation/modification sought, etc.

One aspect of the invention comprehends a genome wide library that may comprise a plurality of CRISPR-Cas system guide RNAs that may comprise guide sequences that are capable of targeting a plurality of target sequences in a plurality of genomic loci, wherein said targeting results in a knockout of gene function. This library may potentially comprise guide RNAs that target each gene in the genome of an organism. In some embodiments of the invention the organism or subject is a eukaryote (including mammal including human) or a non-human eukaryote or a non-human animal or a non-human mammal. In some embodiments, the organism or subject is a non-human animal, and may be an arthropod, for example, an insect, or may be a nematode. In some methods of the invention the organism or subject is a plant. In some methods of the invention the organism or subject is a mammal or a non-human mammal. A non-human mammal may be for example a rodent (preferably a mouse or a rat), an ungulate, or a primate. In some methods of the invention the organism or subject is algae, including microalgae, or is a fungus.

The length and sequence of the semi-random primer may be modified according to guide sequence generation strategy. EcoP15I is currently the most suitable type III restriction enzyme for the method of the invention. This enzyme cleaves 27 bp separated position from its recognition sequence, and a guide sequence will need the minimum length of 17 bp. Since a semi-random primer bridges the restriction site and the guide sequence, maximum length of a semi-random primer can be 10 mer. The minimum length of a cDNA synthesis primer can be 4 mer. Thus a semi -random primer containing PAM can have variation between 4 and 10 mer of N (0-7) CC N (l-8).While this sequence is optimized for Sp Cas9, the sequence of a semi -random primer can be further customized depending on PAM sequence of Cas9 from different species.

In order to recognize the target sequence, Cas9 requires a protospacer adjacent motif (PAM) neighboring the target sequence. The PAM sequence is required in the target DNA but not in the gRNA sequence. The PAM sequences vary depending on Cas9 derived from different bacterial species. For example, NGG is the PAM sequence for S. progenies (Sp) Cas9, which is the endonuclease for the most widely used type II CRISPR system. PAM sequences of Cas9 from other species are, for example, GATT for Neisseria meningitidis (NM), NNAGAAW for Streptococcus thermophilus (ST) and NAAAAC for Treponema denticola (TD).

The sequence of the semi-random primer can be changed depending on experimental design. In an alternative preferred embodiment the sequence of the semi-random primer is 5' NNCCNN 3'. PAMs are different among deferent species-derived Cas9, and the semi-random primer may be modified accordingly.

To use the CRISPR system, gRNA needs to be expressed and to be recruited into Cas9. In a gRNA expression vector, gRNA expression may be driven by a promoter which functions in a specific species or cell type. Since pol III promoter is suitable for expression of defined length of short RNA, typically pol III promoter like U6 promoter is used for gRNA expression. In a gRNA expression vector, the guide sequence cloning site will be followed by the gRNA scaffold sequence (e.g. the sequence as mentioned in figure 2b or its proper variants). The gRNA scaffold is folded and integrated into Cas9, thus allowing recruitment and proper positioning of the gRNA into Cas9 endonuclease. In this case, another vector coding for Cas9 will be used.

With respect to general information on CRISPR-Cas Systems, components thereof and delivery of such components, including methods, materials, delivery vehicles, vectors, particles, AAV, and making and using thereof, including as to amounts and formulations, all useful in the practice of the instant invention, reference is made to: US Patents Nos. 8,697,359, 8,771,945, 8,795,965, 8,865,406 and 8,871 ,445; US Patent Publications US 2014-0287938 Al (U.S. App. Ser. No. 14/213,991 ), US 2014-0273234 Al (U.S. App. Ser. No. 14/293,674), US2014-0273232 Al (U.S. App. Ser. No. 14/290,575), US 2014-0273231 (U.S. App. Ser. No. 14/259,420), US 2014-0256046 Al (U.S. App. Ser. No. 14/226,274), US 2014-0248702 Al (U.S. App. Ser. No. 14/258,458), US 2014-0242700 Al (U.S. App. Ser. No. 14/222,930), US 2014-0242699 Al (U.S. App. Ser. No. 14/183,512), US 2014- 0242664 Al (U.S. App. Ser. No. 14/104,990), US 2014-0234972 Al (U.S. App. Ser. No. 14/183,471), US 2014-0227787 Al (U.S. App. Ser. No. 14/256,912), US 2014-0189896 Al (U.S. App. Ser. No. 14/105,035), US 2014-0186958 (U.S. App. Ser. No. 14/105,01 7), US 2014-0186919 Al (U.S. App. Ser. No. 14/104,977), US 2014-0186843 Al (U.S. App. Ser. No. 14/104,900), US 2014-0179770 Al (U.S. App. Ser. No. 14/104,837) and US 2014-0179006 Al (U.S. App. Ser. No. 14/183,486); PCT Patent Publications WO 2014/093661 (PCT/US2013/074743), WO 2014/093694 (PCT/US2013/074790), WO 2014/093595 (PCT/US2013/07461 1), WO 2014/09371 8 (PCT/US2013/074825), WO 2014/093709 (PCT/US2013/074812), WO 2014/093622 (PCT/US2013/074667), WO 2014/093635 (PCT/US2013/074691), WO 2014/093655 (PCT/US2013/074736), WO 2014/093712 (PCT/US2013/074819), WO2014/093701 (PCT/US2013/074800), and WO2014/018423 (PCT/US2013/051418); US provisional patent applications 61/961,980 and 61/963,643 each entitled FUNCTIONAL GENOMICS USING CRISPR-CAS SYSTEMS, COMPOSITIONS, METHODS, SCREENS AND APPLICATIONS THEREOF, filed October 28 and December 9, 2013 respectively; PCT/US2014/041806, filed June 10, 2014, US provisional patent applications 61/836, 123, 61/960,777 and 61/995,636, filed on June 17, 2013, September 25, 2013 and April 15, 2014, and PCT/US 13/74800, filed December 12, 2013. : Reference is also made to US provisional patent applications 61 /736,527, 61/748,427, 61/791 ,409 and 61/835,931 , filed on December 12, 2012, January 2, 2013, March 15, 2013 and June 17, 2013, respectively. Reference is also made to US provisional applications 61/757,972 and 61/768,959, filed on January 29, 2013 and February 25, 2013, respectively. Reference is also made to US provisional patent applications 61/835,931, 61/835,936, 61/836,127, 61/836,101 , 61/836,080 and 61/835,973, each filed June 17, 2013. Each of these applications, and all documents cited therein or during their prosecution ("appln cited documents") and all documents cited or referenced in the appln cited documents, together with any instructions, descriptions, product specifications, and product sheets for any products mentioned therein or in any document therein and incorporated by reference herein, are hereby incorporated herein by reference, and may be employed in the practice of the invention. All documents (e.g., these applications and the appln cited documents) are incorporated herein by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference. Citations for documents cited herein may also be found in the foregoing herein-cited documents, as well as those herein below cited.

Also with respect to general information on CRISPR-Cas Systems, mention is made of:

> Multiplex genome engineering using CRISPR/Cas systems. Cong, L., Ran, F.A., Cox, D,, Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., & Zhang, F. Science Feb 15;339(6121 ):819-23 (2013);

> RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Jiang W., Bikard D., Cox D., Zhang F, Marraffini LA. Nat Biotechnol Mar;31(3):233-9 (2013);

> One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas- Mediated Genome Engineering. Wang H., Yang H., Shivalila CS., Dawlaty MM, Cheng AW., Zhang F., Jaenisch R. Cell May 9;153(4):910-8 (2013);

> Optical control of mammalian endogenous transcription and epi genetic states, onermann S, Brigham MD, Trevino AE, Hsu PD, Heidenreich M, Cong L, Piatt RJ, Scott DA, Church GM, Zhang F. Nature. 2013 Aug 22;500(7463):472-6. doi: 10.1038/Naturel 2466. Epub 2013 Aug 23;

> Double Niching by RNA-Guided CRISPR Cas for Enhanced Genome Editing Specificity.

Ran, FA., Hsu, PD., Lin, CY., Gootenberg, JS., Konermann, S., Trevino, AE., Scott, DA., Inoue, A., Matoba, S., Zhang, Y., & Zhang, F. Cell Aug 28. pii: 80092-8674(13)01015-5. (2013/;

> DNA targeting specificity of RNA-guided Cas9 nucleases. Hsu, P., Scott, D., Weinstein, J., Ran, FA., Konermann, S., Agarwala, V., Li, Y., Fine, E., Wu, X., Shalem, O., Cradick, TJ., Marraffini, LA., Bao, G., & Zhang, F. Nat Biotechnol 2013 Sep;31(9):827-32. doi: 10.1038/nbt2647. Epub 2013 Jul 21;

> Genome engineering using the CRISPR-Cas9 system. Ran, FA., Hsu, PD., Wright, J., Agarwala, V., Scott, DA., Zhang, F. Nature Protocols Nov;8(l l):2281-308. (2013); > Genome-Scale CRISPR- Cas9 Knockout Screening in Human Cells. Shalem, O., Sanjana, NE., Hartenian, E., Shi, X., Scott, DA., Mikkelson, T., Heckl, D., Ebert, BL., Root, DE., Doench, JG., Zhang, F. Science Dec 12, (2013). [Epub ahead of print]; Crystal structure of cas9 in complex with guide R A and target DNA. Nishimasu, FL, Ran, FA„ Hsu, PD., Konermann, S., Shehata, SI, Dohmae,„ Ishitatii, R., Zhang, F., Nureki, O. Cell Feb 27. (2014). 156(5):935-49;

> Genome -wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Wu X., Scott DA., Kriz AJ., Chiu AC, Hsu PD., Dadon DB., Cheng AW., Trevino AE., Konermann S., Chen S., Jaenisch R., Zhang F., Sharp PA. Nat Biotechnol. (2014) Apr 20. doi: 10.1038/nbt.2889,

> Development and Applications of CRISPR- Cas 9 for Genome Engineering, Hsu et al, Cell 157, 1262-1278 (June 5, 2014) (Hsu 2014),

> Genetic screens in human cells using the CRISPR/Cas9 system, Wang et al., Science.

2014 January 3; 343(6166): 80-84. doi: 10.1 126/science.1246981 , and

> Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation, Doench et al, Nature Biotechnology published online 3 September 2014; doi: 10.1038/nbt.3026.

each of which is incorporated herein by reference.

Detailed description of the invention

The terms "polynucleotide", "nucleotide", "nucleotide sequence", "nucleic acid" and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide may comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. In aspects of the invention the terms "chimeric RNA", "chimeric guide RNA", "guide RNA", "single guide RNA" and "synthetic guide RNA" are used interchangeably and refer to the polynucleotide sequence comprising the guide sequence, the tracr sequence and the tracr mate sequence.

The term "guide sequence" refers to the about 20bp sequence within the guide RNA that specifies the target site and may be used interchangeably with the terms "guide" or "spacer". The term "guide sequence" herein also includes the corresponding DNA or DNA encoding the RNA guide sequence. The expression "RNA corresponding to the isolated guide sequence" includes RNA encoded by DNA guide sequences. The term "tracr mate sequence" may also be used interchangeably with the term "direct repeat(s)".

The term " sgRNA library" and "gRNA" library may be used interchangeably. They can comprise single guide RNAs or guide sequences. "Complementarity" refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick base pairing or other non- traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100%) complementary). "Perfectly complementary" means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. "Substantially complementary" as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 1 8, 19, 20, 21 , 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.

As used herein, "stringent conditions" for hybridization refers to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non- limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology- Hybridization With Nucleic Acid Probes Part I, Second Chapter "Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, N.Y.

A sequence capable of hybridizing with a given sequence is referred to as the "complement" of the given sequence.

As used herein, "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and/or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as "gene product." If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. Several aspects of the invention relate to vector systems comprising one or more vectors, or vectors as such. Vectors can be designed for expression of CRISPR transcripts (e.g. nucleic acid transcripts, proteins, or enzymes) in prokaryotic or eukaryotic cells. Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example the lentiviral vectors encompassed in aspects of the invention may comprise a U6 RNA pol III promoter.

Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double- stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g. circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. One type of vector is a "plasmid," which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, wherein virally- derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g. retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses). Viral vectors also include polynucleotides earned by a virus for transfection into a host cell. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g. bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as "expression vectors." Common expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.

Recombinant expression vectors can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory elements, which may be selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory element(s) in a manner that allows for expression of the nucleotide sequence (e.g. in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).

The term "regulatory element" is intended to include promoters, enhancers, internal ribosomal entry sites (IRES), and other expression control elements (e.g. transcription termination signals, such as polyadenylation signals and poly-U sequences). Such regulatory elements are described, for example, in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, Calif. (1990). Regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Regulatory elements may also direct expression in a temporal-dependent manner, such as in a cell-cycle dependent or developmental stage-dependent manner, which may or may not also be tissue or cell-type specific. In some embodiments, a vector comprises one or more pol III promoter (e.g. 1 , 2, 3, 4, 5, or more pol III promoters), one or more pol II promoters (e.g. 1 , 2, 3, 4, 5, or more pol II promoters), one or more pol I promoters (e.g. 1, 2, 3, 4, 5, or more pol I promoters), or combinations thereof. Examples of pol III promoters include, but are not limited to, U6 and HI promoters. Examples of pol II promoters include, but are not limited to, the retroviral Rous sarcoma virus (R.SV) LTR. promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV ) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al, Cell, 41 :521 -530 (1985)], the SV4G promoter, the dihydro folate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter. Also encompassed by the term "regulatory element" are enhancer elements, such as WPRE; CMV enhancers; the R-U5' segment in LTR of HTLV-I (Mol. Cell. Biol, Vol. 8(1), p. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), p. 1527-31 , 1981). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression desired, etc. A vector can be introduced into host cells to thereby produce transcripts, proteins, or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., clustered regularly interspersed short palindromic repeats (CRISPR) transcripts, proteins, enzymes, mutant forms thereof, fusion proteins thereof, etc.).

Advantageous vectors include lentiviruses, adenoviruses and adeno-associated viruses, and types of such vectors can also be selected for targeting particular types of cells. In aspects on the invention the vectors may include but are not limited to packaged vectors. In other aspects of the invention a population of cells or host cells may be transduced with a vector with a low multiplicity of infection (MOI). As used herein the MOI is the ratio of infectious agents (e.g. phage or virus) to infection targets (e.g. cell). For example, when referring to a group of cells inoculated with infectious virus particles, the multiplicity of infection or MOI is the ratio of the number of infectious virus particles to the number of target cells present in a defined space (e.g. a well in a plate). In embodiments of the invention the cells are transduced with an MOI of 0.3- 0.75 or 0.3-0.5; in preferred embodiments, the MOI has a value close to 0.4 and in more preferred embodiments the MOI is 0.3. In aspects of the invention the vector library of the invention may be applied to a well of a plate to attain a transduction efficiency of at least 20%, 30%, 40%, 50%, 60%, 70%, or 80%. In a preferred embodiment the transduction efficiency is approximately 30% wherein it may be approximately 370-400 cells per lentiCRISPR construct. In a more preferred embodiment, it may be 400 cells per lentiCRISPR construct.

In some embodiments, a regulatory element is operably linked to one or more elements of a CRISPR system so as to drive expression of the one or more elements of the CRISPR system. In general, CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats), also known as SPIDRs (SPacer Interspersed Direct Repeats), constitute a family of DNA loci that are usually specific to a particular bacterial species. The CRISPR locus comprises a distinct class of interspersed short sequence repeats (SSRs) that were recognized in E. coli (Ishino et al, J. Bacterid., 169:5429-5433 [1987]; and Nakata et al, J. Bacterid., 171 :3553- 3556 [1989]), and associated genes. Similar interspersed SSRs have been identified in Haloferax mediterranei, Streptococcus pyogenes, Anabaena, and Mycobacterium, tuberculosis (See, Groenen et al., Mol. Microbiol, 10: 1057-1065 [1993]; Hoe et al, Emerg. Infect. Dis., 5:254-263 [1999]; Masepohl et al, Biochim. Biophys. Acta 1307:26-30 [1996]; and Mojica et al, Mol. Microbiol, 17:85-93 [1995]). The CRISPR loci typically differ from other SSRs by the structure of the repeats, which have been termed short regularly spaced repeats (SRSRs) (Janssen et al, OMICS J. Integ. Biol, 6:23-33 [2002]; and Mojica et al, Mol. Microbiol, 36:244-246 [2000]). In general, the repeats are short elements that occur in clusters that are regularly spaced by unique intervening sequences with a substantially constant length (Mojica et al, [2000], supra). Although the repeat sequences are highly conserved between strains, the number of interspersed repeats and the sequences of the spacer regions typically differ from strain to strain (van Embden et al, J, Bacteriol, 182:2393-2401 [2000]). CRISPR loci have been identified in more than 40 prokaryotes (See e.g., Jansen et al, Mol. Microbiol, 43 ; 1565-1575 [2002]; and Mojica et al, [2005]) including, but not limited to Aeropyrum, Pyrobaculum, Sulfolobus, Archaeoglobus, Halocarcula, Methanol) acterium, Methanococcus, Methanosarcina, Methanopyrus, Pyrococcus, Picrophilus, Thermoplasma, Corynebacterium, Mycobacterium, Streptomyces, Aquifex, Porphyromonas, Chlorobium, Thermus, Bacillus, Listeria, Staphylococcus, Clostridium., Therrnoanaerobacter, Mycoplasma, Fusob acterium, Azarcus, Chromobacterium, Neisseria, Nitrosomonas, Desulfovibrio, Geobacter, Myxococcus, Campylobacter, Wolinella, Acinetobacter, Erwinia, Escherichia, Legionella, Methylococcus, Pasteurella, Photobacterium, Salmonella, Xanthomonas, Yersinia, Treponema, and Thermotoga.

In aspects of the invention functional genomics screens allow for discovery of novel human and mammalian therapeutic applications, including the discovery of novel drugs, for, e.g., treatment of genetic diseases, cancer, fungal, protozoal, bacterial, and viral infection, ischemia, vascular disease, arthritis, immunological disorders, etc. As used herein assay systems may be used for a readout of cell state or changes in phenotype include, e.g., transformation assays, e.g., changes in proliferation, anchorage dependence, growth factor dependence, foci formation, growth in soft agar, tumor proliferation in nude mice, and tumor vascularization in nude mice; apoptosis assays, e.g., DNA laddering and cell death, expression of genes involved in apoptosis; signal transduction assays, e.g., changes in intracellular calcium, cAMP, cGMP changes in hormone and neurotransmitter release; receptor assays, e.g., estrogen receptor and cell growth; growth factor assays, e.g., EPO, hypoxia and erythrocyte colony forming units assays; enzyme product assays, e.g., FAD-2 induced oil desaturation; transcription assays, e.g., reporter gene assays; and protein production assays, e.g., VEGF ELISAs.

Aspects of the invention relate to modulation of gene expression and modulation can be assayed by determining any parameter that is indirectly or directly affected by the expression of the target candidate gene. Such parameters include, e.g., changes in RNA or protein levels, changes in protein activity, changes in product levels, changes in downstream gene expression, changes in reporter gene transcription (luciferase, CAT, bet. -galactosidase, beta- glucuronidase, GFP (see, e.g., Mistili & Spector, Nature Biotechnology 15:961 -964 (1997)); changes in signal transduction, phosphorylation and dephosphorylation, receptor-ligand interactions, second messenger concentrations (e.g., cGMP, cAMP, IP3), cell growth, and neovascularization, etc., as described herein. These assays can be in vitro, in vivo, and ex vivo. Such functional effects can be measured by any means known to those skilled in the art, e.g., measurement of RNA or protein levels, measurement of RNA stability, identification of downstream or reporter gene expression, e.g., via chemiluminescence, fluorescence, calorimetric reactions, antibody binding, inducible markers, ligand binding assays; changes in intracellular second messengers such as cGMP and inositol triphosphate (IP3); changes in intracellular calcium levels; cytokine release, and the like, as described herein. To determine the level of gene expression modulated by the CRISPR-Cas system, cells contacted with the CRISPR-Cas system are compared to control cells, e.g., without the CRISPR-Cas system or with a non-specific CRISPR-Cas system, to examine the extent of inhibition or activation. Control samples may be assigned a relative gene expression activity value of 100%. Modulation/inhibition of gene expression is achieved when the gene expression activity value relative to the control is about 80%, preferably 50% (i.e., 0.5 times the activity of the control), more preferably 25%, more preferably 5-0%. Modulation/activation of gene expression is achieved when the gene expression activity value relative to the control is 1 10% , more preferably 150%) (i.e., 1.5 times the activity of the control), more preferably 200-500%, more preferably 1000-2000% or more.

In general, "CRISPR system", "CRISPR-Cas" or the "CRISPR-Cas system" may refer collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR- associated ("Cas") genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a "direct repeat" and a tracrRNA -processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a "spacer" in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus. In some embodiments, one or more elements of a CRISPR system is derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of a CRISPR system is derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRJSPR system). In the context of formation of a CRISPR complex, "target sequence" refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. In some embodiments, a target sequence is located in the nucleus or cytoplasm of a cell. In some embodiments, the target sequence may be within an organelle of a eukaryotic cell, for example, mitochondrion or chloroplast. A sequence or template that may be used for recombination into the targeted locus comprising the target sequences is referred to as an "editing template" or "editing polynucleotide" or "editing sequence". In aspects of the invention, an exogenous template polynucleotide may be referred to as an editing template, in an aspect of the invention the recombination is homologous recombination.

Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g. within 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence. Without wishing to be bound by theory, the tracr sequence, which may comprise or consist of all or a portion of a wild- type tracr sequence (e.g. about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tracr sequence), may also form part of a CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence that is operably linked to the guide sequence. In some embodiments, the tracr sequence has sufficient complementarity to a tracr mate sequence to hybridize and participate in formation of a CRISPR complex. As with the target sequence, it is believed that complete complementarity is not needed, provided there is sufficient to be functional. In some embodiments, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of sequence complementarity along the length of the tracr mate sequence when optimally aligned. In some embodiments, one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a host cell such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements, may be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector, CRISPR system elements that are combined in a single vector may be arranged in any suitable orientation, such as one element located 5' with respect to ("upstream" of) or 3 ' with respect to ("downstream" of) a second element. The coding sequence of one element may be located on the same or opposite strand of the coding sequence of a second element, and oriented in the same or opposite direction. In some embodiments, a single promoter drives expression of a transcript encoding a CRISPR enzyme and one or more of the guide sequence, tracr mate sequence (optionally operably linked to the guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g. each in a different intron, two or more in at least one intron, or all in a single intron). In some embodiments, the CRISPR enzyme, guide sequence, tracr mate sequence, and tracr sequence are operably linked to and expressed from the same promoter.

In some embodiments, a vector comprises one or more insertion sites, such as a restriction endonuclease recognition sequence (also referred to as a "cloning site"), in some embodiments, one or more insertion sites (e.g. about or more than about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites) are located upstream and/or downstream of one or more sequence elements of one or more vectors. In some embodiments, a vector comprises an insertion site upstream of a tracr mate sequence, and optionally downstream of a regulatory element operably linked to the tracr mate sequence, such that following insertion of a guide sequence into the insertion site and upon expression the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell. In some embodiments, a vector comprises two or more insertion sites, each insertion site being located between two tracr mate sequences so as to allow insertion of a guide sequence at each site. In such an arrangement, the two or more guide sequences may comprise two or more copies of a single guide sequence, two or more different guide sequences, or combinations of these. When multiple different guide sequences are used, a single expression construct may be used to target CRISPR activity to multiple different, corresponding target sequences within a cell. For example, a single vector may comprise about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more guide sequences. In some embodiments, about or more than about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or more such guide-sequence-containing vectors may be provided, and optionally delivered to a cell.

In some embodiments, a vector comprises a regulatory element operably linked to an enzyme- coding sequence encoding a CRISPR enzyme, such as a Cas protein. Non-limiting examples of Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Cs 12), CaslO, Csyl , Csy2, Csy3, Csel , Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl , Csxl5, Csfl, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. These enzymes are known; for example, the amino acid sequence of S. pyogenes Cas9 protein may be found in the SwissProt database under accession number Q99ZW2. In some embodiments, the unmodified CRISPR enzyme has UNA cleavage activity, such as Cas9. In some embodiments the CRISPR enzyme is Cas9, and may be Cas9 from S. pyogenes or S. pneumoniae. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands at the location of a target sequence, such as within the target sequence and/or within the complement of the target sequence. In some embodiments, the CRISPR enzyme directs cleavage of one or both strands within about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of a target sequence. In some embodiments, a vector encodes a CRISPR enzyme that is mutated to with respect to a corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence. In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith- Waterman algorithm, the Needieman-Wimsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), ClustaiW, Ciustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, CA), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net). In some embodiments, a guide sequence is about or more than about 5, 10, 1 1 , 12, 13, 14, 15, 16, 17, 1 8, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length. The ability of a guide sequence to direct sequence- specific binding of a CRISPR complex to a target sequence may be assessed by any suitable assay. For example, the components of a CRISPR system sufficient to form a CRISPR complex, including the guide sequence to be tested, may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of the CRISPR sequence, followed by an assessment of preferential cleavage within the target sequence. Similarly, cleavage of a target polynucleotide sequence may be evaluated in a test tube by providing the target sequence, components of a CRISPR complex, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions. Other assays are possible, and will occur to those skilled in the art. The term "variant" as used herein refers to a sequence, polypeptide or protein having substantial or significant sequence identity or similarity to a parent sequence, polypeptide or protein. Said variant are functional, i.e. retain the biological activity of the sequence, polypeptide or protein of which it is a variant. In reference to the parent sequence, polypeptide or protein, the functional variant can, for instance, be at least about 30%, 50%, 75%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or more identical in amino acid sequence to the parent sequence, polypeptide, or protein.

The functional variant can, for example, comprise the amino acid sequence of the parent sequence, polypeptide, or protein with at least one conservative amino acid substitution. Conservative amino acid substitutions are known in the art, and include amino acid substitutions in which one amino acid having certain physical and/or chemical properties is exchanged for another amino acid that has the same chemical or physical properties.

Alternatively or additionally, the functional variants can comprise the amino acid sequence of the parent sequence, polypeptide, or protein with at least one non-conservative amino acid substitution. In this case, it is preferable for the non-conservative amino acid substitution to not interfere with or inhibit the biological activity of the functional variant. Preferably, the non-conservative amino acid substitution enhances the biological activity of the functional variant, such that the biological activity of the functional variant is increased as compared to the parent sequence, polypeptide, or protein.

Variants also comprises functional fragment of the parent sequence, polypeptide, or protein and can comprise, for instance, about 10%, 25%, 30%, 50%, 68%, 80%, 90%, 95%, or more, of the parent sequence, polypeptide, or protein.

As used herein, the term "orthologues" refers to proteins or corresponding sequences in different species.

The invention will be illustrated by means of non-limiting examples in reference to the following figures.

Figure 1 gRNA library construction using a semi-random primer. A. Semi-random primer. B. Type III and IIS restriction sites to cut out the 20-bp guide sequence. Ec, EcoP15I; Ac, Acul. C. Scheme of gRNA library construction. Bg, Bglll; Xb, Xbal; Bs, BsmBI; Aa, Aatll. D. Short-range PCR for PCR cycle optimization and size fractionation of the guide sequence. PCR products were run on 20% polyacrylamide gels. A 10-bp ladder was used as the size marker. Bands of the expected sizes are marked by triangles. Figure 2 Guide sequences in the gRNA library. (A) Mass sequencing of the gRNA library. (B) An example of sequencing for 12 random clones. (C) An example of the BLAST search analysis of a guide sequence. The first guide sequence clone in Fig. 2A is shown as an example. A 20-bp guide sequence (first frame) is accompanied by a protospacer adjacent motif (PAM; second frame). (D) Three different guide sequences derived from the same gene, the immunoglobulin (Ig) heavy chain Ομ gene. (E) Features of the gRNA library. Percentages in the PAM graph were calculated among the guide sequences where their origins were identified. "Others" in the gRNA-candidates graph indicates the sum of guide sequences of rRNA and PAM (-) mRNA.

Figure 3 Functional validation of guide sequences. Three lentivirus clones specific to Ομ (Ομ guides 1 , 2, and 3 in Fig. 2d) were transduced into the AID ^7" cell surface IgM (slgM) (+) DT40 cell line. FACS profiles two weeks after transduction are shown with the slgM (-) gatings, which were used for FACS sorting (upper panels). The cDNA of the IgM gene from the sorted slgM (-) cells is mapped together with the position of guide sequences, insertions, deletions, and mutations (lower panels). Detailed cDNA sequences around the guide sequences are shown below.

Figure 4 Characterization and functional validation of the gRNA library. (A) Distribution of guide sequences on a chromosome. (B) Diversity of the gRNA library. Sequence reads per gene reflecting the transcriptomic landscape of the guide sequences (heat map; shown with a scale bar). Guide sequence species per gene (circle graph). (C) Lentiviral transduction of gRNA library. A FACS profile two weeks after transduction is shown with the slgM (-) gating, which was used for FACS sorting (left panel). The graph shows the total sequence reads in the library versus those in the sorted slgM (-) (right panel). Each dot represents a different gene. (D) IgM-specific guide sequences. Sequence reads specific to IgM (graph). Guide sequences mapped on IgM cDNA (map). (E) Deletions in the IgM cDNA in sorted slgM (-). The cDNA of the IgM gene from sorted slgM (-) cells is shown with the position of guide sequences, deletions, mutations, and exon borders (left panel). The detailed sequences around breakpoints are shown in the right panel. Micro-homologies in the reference sequences are underlined.

Example

METHODS

Preparation of RNA

Total RNA was prepared from DT40 ^Crel cells ^{(11 12)} using TRIzol reagent (Invitrogen). Poly(A) RNA was prepared from DT40 ^Crel total RNA using an Oligotex mRNA Mini Kit (Qiagen). To enrich mRNA, hybridization of poly(A)+ RNA and washing with buffer OBB (from the Oligotex kit) were repeated twice, according to the stringent wash protocol from the manufacturer's recommendations. Oligonucleotides

The following oligonucleotides were used:

Semi-random primer p NNNCCN (SEQ ID NO: 1)

5 ' SMART (switching mechanism at RNA transcript) tag

TGGTCAAGCTTCAGCAGATCTACACGGACGTCGCrGrGrG (SEQ ID NO: 29 ) 5 ^* SMART PCR primer TGGTCAAGCTTCAGCAGATCTACACG (SEQ ID NO: 30) 3 ' linker I forward p CTGCTGACTTCAGTGGTTCTAGAGGTGTCCAA (SEQ ID NO: 31 )

3 ' linker I reverse GTTGGACACCTCTAGAACCACTGAAGTCAGCAGT (SEQ ID NO: 32)

5 ' linker I forward GCATATAAGCTTGACGTCTCTCACCG (SEQ ID NO: 33 )

5 ' linker I reverse p NNCGGTGAGAGACGTCAAGCTTATATGC (SEQ ID NO: 34) 3' linker II forward p GTTTGGAGACGTCTTCTAGATCAGCG (SEQ ID NO: 35)

3' linker II reverse CGCTGATCTAGAAGACGTCTCCAAACNN (SEQ ID NO: 36)

3 ' linker I PCR primer

GTTGGACACCTCTAGAACCACTGAAGTCAGCAGTNNNCC (SEQ ID NO: 37) 3' linker II PCR primer CGCTGATCTAGAAGACGTCTCCAAAC (SEQ ID NO:38 ) Sequencing primer TTTTCGGGTTTATTACAGGGACAGCAG (SEQ ID NO: 39)

lentiCRISPR forward CTTGGCTTTATATATCTTGTGGAAAGGACG (SEQ ID NO: 40) lentiCRISPR reverse CGGACTAGCCTTATTTTAACTTGCTATTTCTAG (SEQ ID NO: 41) universal forward AGCGGATAACAATTTCACACAGGA (SEQ ID NO: 42)

universal reverse CGCCAGGGTTTTCCCAGTCACGAC (SEQ ID NO:43 )

Ig heavy chain 1 CCGCAACCAAGCTTATGAGCCCACTCGTCTCCTCCCTCC (SEQ ID NO: 44)

Ig heavy chain 2 CGTCCATCTAGAATGGACATCTGCTCTTTAATCCCAATCGAG (SEQ ID NO: 45)

Ig heavy chain 3 GCTGAACAACCTCAGGGCTGAGGACACC (SEQ ID NO: 46)

Ig heavy chain 4 AGCAACGCCCGCCCCCCATCCGTCTACGTCTT (SEQ ID NO: 47) Linker preparation The following reagents were combined in a 1.5 ml microcentrifuge tube: 10 μΐ of 100 μΜ linker forward oligo, 10 μΐ of 100 μΜ linker reverse oligo, and 2.2 μΐ of lOx T4 DNA ligase buffer (NEB). The tubes were placed in a water bath containing 2 1 of boiled water and were incubated as the water cooled naturally. The annealed oligos were diluted with 77.8 μΐ of TE buffer (pH 8.0) and used as 10 μΜ linkers.

gRNA library construction

(1) First-strand cDNA synthesis

The following reagents were combined in a 0.2 ml PCR tube: 200 ng of DT40 ^Crel poly(A) RNA, 0.6 μΐ of 25 μΜ semi-random primer, and RNase-free water in a 4.75 μΐ volume. The tube was incubated at 72°C in a hot-lid thermal cycler for 3 min, cooled on ice for 2 min, and further incubated at 25°C for 10 min. The temperature was then increased to 42°C and a 5.25 μΐ mixture containing the following reagents was added: 0.5 μΐ of 25 μΜ 5' SMART tag, 2 μΐ of 5x SMART Scribe buffer, 0.25 μΐ of 100 mM DTT, 1 μΐ of 10 mM dNTP Mix, 0.5 μΐ of RNaseOUT (Invitrogen), and 1 μΐ SMART Scribe Reverse Transcriptase (100 U) (Clontech). The first-strand cDNA reaction mixture was incubated at 42°C for 90 min and then at 68°C for 10 min. To degrade RNA, 1 μΐ of RNase H (Invitrogen) was added to the mixture and the mixture was incubated at 37°C for 20 min.

(2) Double-stranded (ds) cDNA synthesis by primer extension

Eleven μΐ of prepared first-strand poly(A) cDNA was mixed with 74 μΐ of milliQ water, 10 μΐ of lOx Advantage 2 PCR Buffer, 2 μΐ of 10 mM dNTP mix, 1 μΐ of 25 μΜ 5' SMART PCR primer, and 2 μΐ of 50x Advantage 2 polymerase mix (Clontech). A 100 μΐ volume of the reaction mixture for primer extension was incubated at 95°C for 1 min, 68°C for 20 min, and then 70°C for 10 min. The prepared ds cDNA was purified using a QIAquick PCR Purification Kit (Qiagen) and was eluted with 40 μΐ of TE buffer (pH 8.0).

(3) 3' linker I ligation

DT40 ^Crel ds poly(A) cDNA was mixed with 0.5 μΐ of 10 μΜ 3' linker I and 1 μΐ of Quick T4 DNA ligase (New England Biolabs; NEB) in lx Quick ligation buffer. The ligation reaction mixture was incubated at room temperature for 15 min, then purified using a QIAquick PCR Purification Kit, and eluted with 80 μΐ of TE buffer.

(4) EcoP15I digestion The 3' linker I-ligated DNA was digested with 1 μ1 ΕοοΡ15Ι (10 U/μΙ, NEB) in lx NEBuffer 3.1 containing lx ATP in a 100 μΐ volume at 37°C overnight. The EcoP15I-digested DNA was purified using a QIAquick PCR Purification Kit and eluted with 40 μΐ of TE buffer.

(5) 5' linker I ligation and Bglll digestion

The digested DNA was mixed with 0.5 μΐ of 10 μΜ 5' linker I and 1 μΐ of Quick T4 DNA ligase (NEB) in 1 x Quick ligation buffer. The ligation reaction mixture was incubated at room temperature for 15 min, purified using a QIAquick PCR Purification Kit, and eluted with 80 μΐ of TE buffer. The DNA was further digested with 1 μΐ ofBglll (l O U/μΙ, ΝΕΒ) in lx NEBuffer 3.1 in a 100 μΐ volume at 37°C for 3 h. The EcoP15I/BglII-digested DNA was purified using a QIAquick PCR Purification Kit and eluted with 50 μΐ of TE buffer.

(6) First PCR optimization

To determine the optimal number of PCR cycles, a 0.2 ml PCR tube was prepared containing 5 μΐ of the ds cDNA ligated with 5' linker 1/3' linker I, 0.5 μΐ of 25 μΜ 5' linker I forward primer, 0.5 μΐ of 25 μΜ 3' linker I PCR primer, 5 μΐ of lx Advantage 2 PCR buffer, 1 μΐ of 10 mM dNTP mix, 1 μΐ of 50x Advantage 2 Polymerase mix, and milliQ water in a 50 μΐ volume. PCR was carried out with the following cycling parameters: 6 cycles of 98°C for 10 s and 68°C for 10 s. After the 6 cycles, 5 μΐ of the reaction were transferred to a clean microcentrifuge tube. The rest of the PCR reaction mixture underwent 3 additional cycles of98°C for 10 s and 68°C for 10 s. After these additional 3 cycles, 5 μΐ were transferred to a clean microcentrifuge tube. In the same way, additional PCR was repeated until reaching 30 total cycles. Thus, a series of PCR reactions of 6, 9, 12, 15, 18, 21 , 24, 27, and 30 cycles was prepared and analyzed by 20% polyacrylamide gel electrophoresis to compare the band patterns. The optimal number of PCR cycles was determined as the minimal number of PCR cycles yielding the greatest quantity of the 84-bp product (typically around 17 cycles). Two 50-μ1 PCR reactions were repeated with the optimal number of PCR cycles. The PCR product was purified using a QIAquick PCR Purification Kit and eluted with 50 μΐ of TE buffer.

(7) Acul/Xbal digestion

The PCR product was digested with 2 μΐ of Acul (5 U/μΙ, NEB) and 2 μΐ of Xbal (20 U/μΙ, NEB) in lx CutSmart Buffer containing 40 μΜ S-adenosylmethionine (SAM) in a 60 μΐ volume at 37 °C overnight. The AcuI/Xbal-digested DNA was run on a 20% polyacrylamide gel. The 45-bp fragment was cut out of the gel, purified by the crush and soak procedure, and dissolved into 20 μΐ of TE buffer.

(8) 3' linker II ligation

The digested DNA was mixed with 2 μΐ of 10 μΜ 3' linker II and 1 μΐ of Quick T4 DNA ligase (NEB) in lx Quick ligation buffer. The ligation reaction mixture was incubated at room temperature for 15 min, purified using a QIAquick PCR Purification Kit, and eluted with 100 μΐ of TE buffer.

(9) Second PCR optimization

To determine the optimal number of PCR cycles, a 0.2 ml PCR tube was prepared, containing 5 μΐ of the ds cDNA ligated with 5' linker 1/3' linker II, 0.5 μΐ of 25 μΜ 5' linker I forward primer, 0.5 μΐ of 25 μΜ 3' linker II PCR primer, 5 μΐ of lx Advantage 2 PCR buffer, 1 μΐ of 10 mM dNTP mix, 1 μΐ of 50x Advantage 2 Polymerase mix, and milliQ water in a 50 μΐ volume. PCR was carried out with the following cycling parameters: 6 cycles of 98°C for 10 s and 68°C for 10 s. After the 6 cycles, 5 μΐ of the reaction were transferred to a clean microcentrifuge tube. The rest of the PCR reaction mixture underwent an additional 3 cycles of 98 °C for 10 s and 68°C for 10 s. After these additional 3 cycles, 5 μΐ of the reaction were transferred to a clean microcentrifuge tube. In the same way, additional PCR cycles were repeated until 18 total cycles were reached. Thus, a series of PCR reactions of 6, 9, 12, 15, and 18 cycles was prepared and analyzed by 20% polyacrylamide gel electrophoresis to compare the band patterns. The optimal number of PCR cycles was determined as the minimal number of PCR cycles yielding the greatest quantity of the 72-bp product (typically around 9 cycles). Five PCR reactions, each containing 50 μΐ, were repeated with the optimal number of PCR cycles. The PCR product was purified using a QIAquick PCR Purification Kit and eluted with 100 μΐ of TE buffer.

(10) BsmBI / Aatll digestion

The PCR product was digested with 10 μΐ of BsmBI (10 U/μΙ, NEB) in lx NEBuffer 3.1 in a 100 μΐ volume at 55°C for 6 h, and then 5 μΐ of Aatll (20 U/μΙ, NEB) were added to the solution, which was left at 37°C overnight. The BsmBI / Aatll digested DNA was run on a 20% polyacrylamide gel.

Typically, 3 bands, corresponding to 25, 24, and 23 bp, were visible. The 25-bp fragment was cut out of the gel, purified by the crush and soak procedure, and dissolved into 50 μΐ of TE buffer.

The concentration of the purified DNA was measured by a Qubit dsDNA HS Assay Kit (Life Technologies).

(11) Cloning The lenti CRISPR ver. 2 (lentiCRISPR v2) ⁽¹⁵⁾ (Addgene) was digested with BsmBI, treated with calf intestine phosphatase, extracted with phenol/chloroform, and purified by ethanol precipitation. Five ng of the purified 25-bp guide sequence fragment was mixed with 3 μg of lentiCRISPR v2 and 1 μΐ of Quick T4 DNA ligase (NEB) in lx Quick ligation buffer in a 40 μΐ volume. The ligation reaction mixture was incubated at room temperature for 15 min and then purified by ethanol precipitation. The prepared gRNA library was electroporated into STBL4 electro-competent cells (Invitrogen) using the following electroporator conditions: 1200 V, 25 μΡ, and 200 Ω.

Sequencing and sequence analysis

Plasmid DNA was purified using a Wizard Plus SV Minipreps DNA Purification System (Promega) from 236 of the randomly-selected clones from the gRNA library, in accordance with the manufacturer's protocol. The guide sequence clones were sequenced with the sequencing primer using a model 373 automated DNA sequencer (Applied Biosystems). The cloned guide sequences were compared with the GenBank database using BLAST.

Optional steps to avoid background noise in the gRNA library

During setup of the methodology for gRNA library construction, rRNA contamination was observed in poly(A) RNA purified using an oligOdT column, and rRNA-originated guide sequences sometimes occupied 40-50% of the total original library. Since rRNA occupies more than 90% of intracellular RNA, generally speaking, it is hard to avoid having some rRNA contamination. The stringent wash protocol for poly(A) RNA purification successfully reduced the rRNA-derived guide sequences to around 10%. PCR artifacts amplifying the linker sequences were also observed during setup of the methodology. For this reason, the linker sequence was designed with additional restriction sites, namely Bglll for the 5 ' SMART tag, Xbal for the 3' linker I, and Aatll for the 5' linker I and 3 ' linker II. By cutting with these additional restriction enzymes, it was possible to remove most of the PCR artifacts amplifying the linker sequences. The BsmBI restriction digest of the final PCR reaction generated the right size of DNA fragment (25 bp) in addition to one- or two-bp shorter, unexpected DNA fragments. These shorter DNA fragments were probably due to the inaccuracy of the cleavage position of the type III and type IIS restriction enzymes. After BsmBI cleavage, it was possible to minimize shorter DNA artifacts by carefully purifying the 25-bp fragment with a 20% polyacrylamide gel.

Lentiviral vectors lentiCRISPR v2 (15) was provided by from Feng Zhang (Addgene plasmid # 52961). pCMV-VSV- G (25) was provided by Bob Weinberg (Addgene plasmid # 8454). psPAX2 was provided by Didier Trono (Addgene plasmid # 12260).

Lentiviral packaging

To produce lentivirus, a T-225 flask of HEK293T cells was seeded at -40 % confluence the day before transfection in D10 medium (DMEM supplemented with 10 % fetal bovine serum). One hour prior to transfection, the medium was removed and 13 mL of pre -warmed reduced serum OptiMEM medium (Life Technologies) was added to the flask. Transfection was performed using Lipofectamine 2000 (Life Technologies). Twenty μg of gRNA plasmid library, 10 μg of pCMV- VSV-G (25) (Addgene), and 15 μg of psPAX2 (Addgene) was mixed with 4 ml of OptiMEM (Life Technologies). One hundred μΐ of Lipofectamine 2000 was diluted in 4 ml of OptiMEM and this solution was, after 5 min, added to the mixture of DNA. The complete mixture was incubated for 20 min before being added to cells. After overnight incubation, the medium was changed to 30 ml of D10. After two days, the medium was removed and centrifuged at 3000 rpm at 4 °C for 10 min to pellet cell debris. The supernatant was filtered through a 0.45 μιη low-protein-binding membrane (Millipore Sterifiip HV/PVDF). The gRNA library virus was further enriched 100-fold by PEG precipitation.

Lentiviral vectors containing Ομ guide sequences were packaged as described above except for the following modifications. Five μg of Ομ guide-lentiviral vectors was used instead of 20 μg of the gRNA library. The experiment was done in a quarter-scale concerning solutions or culture medium without changing incubation times. 100-mm plates were used for lentiviral packaging instead of a T- 225 flask. Ομ gRNA virus was directly used for transduction without enrichment by PEG precipitation.

Lentiviral transduction

Cells were transduced with the gRNA library via spinfection. Briefly, 2 x 10 ⁶ cells per well were plated into a 12-well plate in DT40 culture medium supplemented with 8 μg/ml polybrene (Sigma). Each well received either 1 ml of Ομ gRNA virus or 100 μΐ of 100-fold enriched gRNA library virus along with a no-transduction control. The 12-well plate was centrifuged at 2,000 rpm for 2 h at 37°C. Cells were incubated overnight, transferred to culture flasks containing DT40 culture medium, and then selected with 1 μg/ml puromycin.

Sorting of slgM (-) population The AID slgM (+) cell line with or without lentiviral transduction was first stained with a monoclonal antibody to chicken Ομ (Ml) (Southern Biotech) and then with polyclonal fluorescein isothiocyanate-conjugated goat antibodies to mouse IgG (Fab) ₂ (Sigma). The slgM (-) population was sorted using the FACSAria (BD Biosciences).

Cloning and sequencing of the Ig heavy chain gene

The sorted slgM (-) cells were further expanded and used for total RNA and genomic DNA preparation. Total RNA was purified using TRIzol reagent (Invitrogen). Total RNA was reverse- transcribed using Superscript III Reverse Transcriptase (Invitrogen) with oligOdT primer according to the manufacturer's instructions. The IgM heavy chain gene was amplified from the total cDNA of the sorted slgM (-) population with Ig heavy chain 1 and 2 primers. PCR was performed using Q5 Hot Start High-Fidelity DNA Polymerase (NEB) with the following cycling parameters: 30 s of initial incubation at 98°C, 35 cycles consisting of 10 s at 98°C and 2 min at 72°C, and a final elongation step of 2 min at 72°C. The PCR product was purified by a QIAquick Gel Extraction Kit (Qiagen), digested with Hindlll (NEB) and Xbal (NEB), and cloned into the pUC119 plasmid vector. Approximately 30 plasmid clones for each sorted slgM (-) population were sequenced using universal forward, reverse, and Ig heavy chain 3 and 4 primers.

Deep sequencing

Genomic DNA of the transduced cell library or sorted slgM (-) cells was purified using an Easy- DNA Kit (Invitrogen). Either 100 ng of lentiviral plasmid library or 1 μg of genomic DNA were used as the PCR template. The guide sequences were amplified with lentiCRISPR forward and reverse primers using Advantage 2 Polymerase (Clontech). PCR was carried out with the following cycling parameters: 15 cycles of 98°C for 10 s and 68°C for 10 s for plasmid DNA, or 27 cycles of 98°C for 10 s and 68°C for 10 s for genomic DNA. The 100-bp PCR fragment containing the guide sequence was purified using a QIAquick Gel Extraction Kit (Qiagen). The deep sequencing library was prepared using a TruSeq Nano DNA Library Preparation Kit (Illumina), and deep sequenced using Miseq (Illumina).

Bioinformatics

FASTQ files demultiplexed by Illumina Miseq were analyzed using the CLC Genomics Workbench (Qiagen). Briefly, the sequence reads were trimmed to exclude vector backbone sequences and added with the PAM-sequence NGG. The sequence reads before or after adding NGG were aligned with the Ensemble chicken genome database (16) using the RNA seq analysis toolbox with the read mapping parameters optimized for comprehensive analysis. After alignment, duplicates were removed from the mapped sequence reads in order to identify different guide sequence species. Afterwards, the guide sequence reads and species per gene were calculated from the numbers of sequence reads mapped on the annotated genes. Since Ig genes were not annotated in the Ensemble database, the cDNA sequence of the IgM gene of the AID knockout DT40 cell line was used as a reference for the mapping of guide sequences specific to IgM.

Results

Strategy to convert niRNA to guide sequences

A random primer is commonly used for cD A synthesis. The present inventor found out that a semi -random primer containing a PAM-complementary sequence could be used as the cDNA synthesis primer instead of a random primer (Fig. la).

Type IIS or type III restriction enzymes cleave sequences separated from their recognition sequences. The type III restriction enzyme, EcoP15I, cleaves 25/27 bp away from its recognition site but requires a pair of inversely-oriented recognition sites for efficient cleavage^ ¹⁰ . The type IIS restriction enzyme, Acul, cleaves 13/15 bp away from its recognition site. The present inventor now developed an approach that allows to cut out a 20-mer by carefully arranging the positions of these restriction sites (Fig. lb).

gRNA library construction via molecular biology techniques

Using a semi-random primer (NCC ) that contained the PAM-complementary CCN, cDNA was reverse-transcribed from poly(A) RNA of the chicken B cell line DT40 ^{Crel 12)} (Fig. lc). At that time, the 5' SMART tag sequence containing the EcoP15I site was added onto the 5' side by the switching mechanism at RNA transcript (SMART) method ¹³ . The second strand of cDNA was synthesized by primer extension using a primer that annealed at the 5 ' SMART tag sequence with Advantage 2 PCR polymerase, which generated A-overhang at the 3' terminus. This A-overhang was ligated with 3' linker I, which contains EcoP15I and Acul sites for cutting out the guide sequence afterwards. The ds cDNA was digested with EcoP15I to remove the 5' SMART tag sequence and was ligated with 5' linker I that included a BsmBI site, a cloning site for the gRNA expression vector. The DNA was then digested with Bglll to destroy the 5 ' SMART tag backbone. The gRNA library at this stage was amplified by PCR. To determine the optimal number of PCR cycles, a titration between 6 and 30 cycles was performed (Fig. Id; PCR optimization 1). The expected PCR product, approximately 80 bp, was visible after 12 cycles; however, as the number of cycles increased, a larger, non-specific appeared. In addition, unnecessary cycle number increases may reduce the complexity of the library. Thus, PCR amplification was repeated on a large scale using the optimal PCR cycle number of around 17 cycles. The PCR product was subsequently digested with Acul and Xbal and examined using 20% polyacrylamide gel electrophoresis. The 45- bp fragment was purified (Fig. Id; size fractionation 1), ligated with the 3' linker II that included a BsmBI cloning site, and used for the next PCR.

To determine the optimal PCR cycle number, a titration between 6 and 18 PCR cycles was additionally performed (Fig. Id; PCR optimization 2). PCR amplification was repeated on a large scale with the optimal number of 9 PCR cycles. The PCR product was then digested with BsmBI and Aatll. The restriction digest generated the 25-bp fragment, as well as 24- and 23-bp fragments (Fig. Id; size fractionation 2), which were likely generated due to the inaccurate breakpoints of the type IIS and type III restriction enzymes ¹⁴ ; careful purification of the 25-bp fragment minimized the possible problems with those artifacts. The guide sequence insert library, generated as described above, was finally cloned into a BsmBI-digested lentiCRISPR v2 ¹⁵ vector and then electroporated into STBL4 electro-competent cells.

Guide sequences in the gRNA library

Plasmid DNA was purified from the generated gRNA library by maxiprep. Initially, the DNA was sequenced as a mixed plasmid population. A highly complexed and heterogeneous sequence was observed in the lentiCRISPR v2 cloning site between the U6 promoter and gRNA scaffold (Fig. 2a), indicating that: 1) no-insert clones are rare, 2) cloned guide sequences are highly complexed, and 3) the majority of guide sequences are 20 bp long. After re -transformation of the library in bacteria, a total of 236 bacterial clones were randomly picked and used for plasmid miniprep and sequencing. As shown in the example of sequencing for 12 random clones (Fig. 2b), the cloned guide sequences were heterogeneous. These guide sequences were subsequently analyzed using NCBI's BLAST search. As shown in Fig. 2c, typically one gene was hit by each guide sequence. Importantly, a PAM was identified adjacent to the guide sequence. For more than three quarters of the guide sequences, the original genes from which those guides were generated were identified in the BLAST search. Most such guide sequences were derived from single genes.

Notably, three of the guide sequences among the 236 plasmid clones were derived from different positions adjacent to the PAMs on the immunoglobulin (Ig) heavy chain Cμ gene (Fig. 2d). Thus, multiple guide sequences were generated from the same gene. Unexpectedly, the reversed- orientation guide sequences, like Ομ guide 3 (Fig. 2D), were also observed at a relatively low frequency (-10%) (Table I). Most of these were, however, accompanied by a PAM (Table I). PAM -priming might have worked even from the first strand cDNA and not only from mRNA. These reversed guide sequences are expected to work in genome cleavage, contributing to the knockout library.

The cloning of the guide sequences was efficient (100%), and most guide sequences (89%) were 20 bp long (Fig. 2e, Table I).). While 66% of the insert sequences were derived from mRNA, 1 1% of the insert sequences were derived from rRNA and 23% were from unknown origins, possibly derived from unannotated genes (Fig. 2e). Importantly, 91% of the guide sequences with identified origins were accompanied by PAMs, which confirms that PAM-priming using the semi-random primer functioned as intended. In addition, PAMs were also found near of most of the remaining guide sequences (7%), but separated by 1 bp (Fig. 2e). This is most likely due to the inaccurate breakpoints of Acul, since the length of those guide sequences was often 19 bp.

Functional validation of guide sequences

Three guide sequences specific to Ομ (Fig. 2D) were further tested to functionally validate the guide sequences in the library. These lentiviral clones were transduced into the AID ^7" DT40 cell line, which constitutively expresses cell surface IgM (slgM) due to the absence of immunoglobulin gene conversion (12). The Ομ guides 1 , 2, and 3 generated 5.9%, 1 1.7%, and 9.2% slgM (-) populations two weeks after transduction, as estimated by flow cytometry analysis (Fig. 3, upper panels), and these slgM (-) populations were further isolated by FACS sorting. Since the Ig heavy chain genomic locus is poorly characterized and only the rearranged VDJ allele is transcribed, its cDNA, rather than its genomic locus, was analyzed by Sanger sequencing. Sequencing analysis of about 30 IgM cDNA-containing plasmid clones for each sorted slgM (-) population clarified the insertions, deletions, and mutations on the locus (Fig. 3, lower panels). Most of the indels were focused around the guide sequences. Relatively large deletions observed on the cDNA sequence indicate that the clones in the library can sometimes cause even large functional deletions in the corresponding transcripts.

Deep characterization of the gRNA library

To characterize the complexity of the gRNA library, the library was deep-sequenced using Illumina Miseq and analyzed by a RNA seq protocol using the Ensemble chicken genome database (16) as a reference. For example, approximately 500,000 of the guide sequences were mapped to chromosome 1 , suggesting robust generation of guide sequences from various loci in the genome. Although the Ensemble database includes 15,916 chicken genes, the number of annotated chicken genes appears to be at least 4,000 less than those in other established genetic model vertebrates such as humans, mice, and zebrafish (16). Among the 5,209,083 sequence reads, 4,052,174 reads (77.8%) were mapped to chicken genes, and most of those sequences were accompanied by PAM (Fig. 4B). Nevertheless, one quarter of the unmapped reads could be due to the relatively poor genetic annotation of the chicken genome, which again emphasizes the limitations of bioinformatics approaches for specific species. The average length of guide sequence reads was 19.9 bp. Although 2.0% of the guide sequences that mapped to exon/exon junctions appeared non-functional, 3,936,069 (75.6%) of the guide sequences, including 2,626,362 different guide sequences, were considered as functional. Guide sequences were generated even from genes with low expression levels, covering 91.8% of annotated genes (14,617/15,916) (Fig. 4B, heatmap). While two or more unique guide sequences were identified for 97.8% of those genes, more than 100 different guide sequence species were identified for 46.0% of genes (Fig. 4B, circle graph). Thus, the gRNA library appeared to have sufficient diversity for genetic screening.

Functional validation of the gRNA library

The transduction of the library into the AID ^7" DT40 cell line induced a significant sIgM (-) population (0.3%) (Fig. 4C, left) compared to the mother cell line (Fig. 3, left). This sIgM (-) population was further enriched 100-fold by FACS sorting, and their guide sequences were analyzed by deep sequencing. Unexpectedly, contaminated sIgM (+) cells appeared to expand more rapidly than sIgM (-) cells, possibly due to B-cell receptor signaling, leading to incomplete enrichment of sIgM (-) cells. Nevertheless, as IgM-specific guide sequences achieved the second-highest score of sequence reads in the sorted sIgM (-) population (Fig. 4C, right), IgM-specific guide sequences were obviously enriched after sIgM (-) sorting (Fig. 4D, left). While 224 of the unique guide sequences specific to IgM were identified in the plasmid library, a few such guide sequences were highly increased in the sorted sIgM (-) population (Fig. 4D, right). Sanger sequencing of 29 plasmid clones of the IgM cDNA from the sorted sIgM (-) population independently identified 4 deletions and 1 mutation (Fig. 4E). Three large deletions were likely generated by alternative non-homologous end joining via micro-homology, and one appeared to be generated by mis-splicing, possibly due to indels around splicing signals. Therefore, the library can be used to screen knockout clones when the proper screening method is available.

Taken together, a diverse and functional gR A library was successfully generated using the described method. The generated gRNA library is a specialized short cDNA library and is, therefore, also useful as a customized gRNA library specific to organs or cell lines.

The present inventor generated a gRNA library for a higher eukaryotic transcriptome using molecular biology techniques. This is the first gRNA library created from mRNA and the first library created from a rather poorly genetically characterized species. The semi-random primer can potentially target any NGG on mRNA, generating a highly complex gRNA library that covers more than 90% of the annotated genes (Fig. 4B). Furthermore, the method described here could be applied to CRISPR systems in organisms other than S. pyogenes by customizing the semi-random primer. Multiple guide sequences were efficiently generated from the same gene (Fig. 2D, 4B, and 4D), like the native CRISPR system in bacteria (1); this is an important advantage of the developed method. Although each guide sequence may differ in genome cleavage efficiency for each target gene, relatively more efficient guide sequences for each gene are included in the library (Fig. 4D).

Because the gRNA library created here is on a B-cell transcriptomic scale rather than a genome scale, guide sequences will not be generated from non-transcribed genes. Guide sequences were more frequently generated from abundantly-transcribed mRNAs but less frequently generated from rare mRNAs (Fig. 4B). By combining the techniques of a normalized library, in which one normalizes the amount of mRNA for each gene, it is possible to increase the frequency of guide sequences generated from rare mRNA (19). If the promoters in the lentiCRISPR v2 for Cas9 or gRNA expression are replaced with optimal promoters for each cell type or species, this will further improve the transduction or knockout efficiency of the gRNA library.

Guide sequences can be generated not only from the coding sequence but also from the 5' and 3 ' untranslated regions (UTRs). Since gRNA from UTRs will not cause indels within the coding sequence, gRNAs are not usually designed on UTRs in order to knock out genes; however, because several key features, such as mRNA stability or translation control, are determined by regulatory sequences located in the UTRs, indels occurring in these areas can lead to the unexpected elucidation of the gene's function. In this regard, this method can be also usefully applied for species like human, whose large-scale gRNA libraries are already constructed (6-8). Indeed, it can be also useful to make personalized human gRNA libraries, which represent collections of single nucleotide polymorphisms from different exons. Such personalized human gRNA libraries could be used to study allelic variations and their phenotypes, leading to better characterisations of rare diseases.

Approximately 23% of the guide sequences were derived from unknown origins (Fig. 2E, 4B). These sequences may be, at least partly, derived from mR A with insufficient genetic annotation. This is the greatest advantage of the developed method: the sum of these "unknown" sequences and PAM (+) mRNA cover 83% of the library and are expected guide sequence candidates available for genetic screening (Fig. 2E). Since this method is not based on bioinformatics, it is possible to create guide sequences even from unknown genetic information. Such a bioinformatics-independent approach is obviously advantageous for species with insufficient genetic analysis.

Some cell type-/species-specific biological properties may be driven by uncharacterized or unannotated genes. For example, the inventor suspects that such unknown genes may play a key role in Ig gene conversion (20) or hyper-targeted integration (21) in chicken B cells. Moreover, many "minor" organisms exist that have not been used as genetic models despite their unique biological characteristics, e.g., planaria with extraordinary regeneration ability (22), naked mole rats with cancer resistance (23), and red sea urchins with their 200-year lifespan (24). Knockout libraries can be important genetic tools to shed light on genetic backgrounds with unique biological properties. Using this technique, it is possible to create a gRNA library, even from species with poorly annotated genetic information; some "forgotten" species may be converted into attractive genetic models by this technology.

Typically, the cost to synthesize a huge number of oligos for construction of a gRNA library is enormous ⁶ ' ⁷ . Importantly, since only a limited number of oligos is required for the described approach, it is possible to reduce the cost of the library by more than 100-fold, compared to the method using the oligo library.

It is in fact difficult to bear the enormous technological or economic costs for such "forgotten" species. The described method is expected to overcome obstacles associated with the high cost of oligo-based gRNA library generation.

While the present inventor used poly(A) RNA as a starting material for this study, in principle it is also possible to start from DNA, if the method is modified properly. DNA polymerase, rather than a reverse transcriptase, is required for semi-random primer-primed DNA synthesis. Such a DNA synthesis will be performed by a non-thermostable DNA polymerase at low temperatures rather than PCR polymerase, since semi-random primers have low annealing temperatures. The 5' tag sequence will be added by linker ligation to single-stranded DNA instead of the SMART method. In this way, it is also attractive to create a gRNA library from ready-made cDNA or cDNA libraries. Table I Guide Sequences

size orienta accession

clone (bp) sequence PAM tion origin number gene

PREDICTED

: Gallus gallus

POM121 transmembran e nucleoporin

AACAGCACCCACCA (POM121),

L9.2.2. CCACTG (SEQ ID partial 100 20 NO: 48) egg normal mRNA XM_415711 mRNA.

Gallus gallus

CGTCGCCAAGACCT finished

L9.2.2. CGAGGA ( SEQ ID cDNA, clone 101 20 NO: 49) egg normal mRNA CR387434 ChEST26e5

Gallus gallus ribosomal

TCGACGATGGCACG protein L27

L9.2.2. TCTGAT (SEQ ID (RPL27), 102 20 NO: 50) egg normal mRNA NM 205337 mRNA

Gallus gallus enhancer of rudimentary homolog

GCGTTGTGGGGGAT (Drosophila)

L9.2.2. CGTCGG (SEQ ID NM 0010064 (ERH), 103 20 NO: 51) ggg normal mRNA 75 mRNA

Gallus gallus ribosomal

AAGGTGGTGCTGGT protein L27

L9.2.2. GCTCGC (SEQ ID (RPL27), 104 20 NO: 52) egg normal mRNA NM 205337 mRNA

PREDICTED

: Gallus gallus

CAGCACCGTGCTGA RAB39B,

L9.2.2. CATTTC (SEQ ID member RAS 105 20 NO: 53) ggg normal mRNA XM 420326 oncogene family

(RAB39B), mRNA

Gallus gallus

Ybox binding

GGCGCTGAGCAGCT protein 3

L9.2.2. GTTCCT (SEQ ID (YBX3), 106 20 NO: 54) egg reverse mRNA NM 205406 mRNA

L9.2.2. GATAGGCACAATCTTTTCAC (

107 20 SEQ ID NO: 55)

Gallus gallus mRNA for

ACCTCCAAGACCGG hypothetical

L9.2.2. CAAGCA (SEQ ID protein, clone 108 20 NO: 56) egg normal mRNA AJ719748 6al2

PREDICTED

: Gallus gallus tetratricopepti de repeat, ankyrin repeat and coiled-coil containing 1 (TANC1),

CAGTCGCTCTTGGC transcript

L9.2.2. ATTCTC (SEQ ID XM 0049430 variant XI 2, 109 20 NO: 57) agg normal mRNA 61 mRNA

Gallus gallus breed Rugao yellow chicken

GTCCGAGAAAGCAC mitochondrio

L9.2.2. CTTCCA (SEQ ID n, complete 110 20 NO: 58) ggg normal mRNA KP742951 genome

Gallus gallus

CCCTCTTATCCAGG annexin Al 1

L9.2.2. ACCTAC (SEQ ID NM 0010129 (ANXAll), Ill 20 NO: 59) agg normal mRNA 03 mRNA

Gallus gallus breed Rugao yellow

TGCTGGGGTTCGTG chicken

L9.2.2. TGTGTC (SEQ ID mi mnrc mitochondrio 112 20 NO: 60) normal mRNA KP742951 n, complete genome

Gallus gallus fused in

GGGGTCGTCGAAGG sarcoma

L9.2.2. ACACGG (SEQ ID NM 0010015 (FUS), 1 13 20 NO: 61) tgg reverse mRNA 31 mRNA

L9.2.2. TATTAAATTAAAGCTCGTCC

1 14 20 (SEQ ID NO: 62)

Gallus gallus DNA, CENP- A associated sequence, partial

CGAATACAGACCGT sequence,

L9.2.2. GAAAG (SEQ ID clone:

1 15 19 NO: 63) egg normal mRNA AB556518 CAIP#220

Gallus gallus

CCCGTGAAAATCCG 28S rRNA

L9.2.2. GGGGAG (SEQ ID gene, clone 1 16 20 NO: 64) agg normal rRNA FM165415 GgLSU-1

PREDICTED

: Gallus gallus ribosomal protein L23 (RPL23),

TGTATTTTGAAGAC transcript

L9.2.2. AACGC (SEQ ID variant X2, 1 17 19 NO: 65) ggg normal mRNA XM_418122 mRNA

Gallus gallus cysteine-rich protein 1

CCCTGCTACGCTGC (intestinal)

L9.2.2. CTTGTT ( SEQ ID NM 0012823 (CRIPl), 1 18 20 NO: 66) egg normal mRNA 03 mRNA

L9.2.2. CGCGATGAGGGAACTTCCGC

1 19 20 (SEQ ID NO: 67)

Gallus gallus

CAGTGCCTGCAGGA finished

L9.2.2. CCCTCC (SEQ ID cDNA, clone 120 20 NO: 68) tgg reverse mRNA BX935029 ChEST304113

CATGATTAAGAGGG Gallus gallus

L9.2.2. ACGGC (SEQ ID isolate ML48 121 19 NO: 69) egg normal rRNA HQ873432 18S ribosomal

RNA gene, partial sequence

PREDICTED

: Gallus gallus ribosomal

CCGCAGCGACCGCA protein, large,

L9.2.2. CGTCCC (SEQ ID P2 (RPLP2), 122 20 NO: 70) ggg normal mRNA XM 424134 mRNA

L9.2.2. CGCGGTTTTCGTCCAATAAA

123 20 (SEQ ID NO: 71)

Gallus gallus peptidylprolyl isomerase A

TCCTGTCCATGGCC (cyclophilin

L9.2.2. AACGC (SEQ ID NM 0011663 A) (PPIA), 124 19 NO: 72) egg normal mRNA 26 mRNA

Gallus gallus cancer susceptibility

GCCCGCAGCCGATC candidate 4

L9.2.2. CTCCGC (SEQ ID NM 0010305 (CASC4), 125 20 NO: 73) egg normal mRNA 56 mRNA

Gallus gallus breed Rugao yellow chicken

TCTGTATCTTCCTT mitochondrio

L9^ ? CACAT (SEQ ID n, complete 126 19 NO: 74) egg normal mRNA KP742951 genome

PREDICTED

: Gallus gallus ribosomal protein L10-

CGTCCACCTTTGCT like

L9.2.2. TTCTTC (SEQ ID XM 0036435 (RPLIOL), 127 20 NO: 75) egg reverse mRNA 39 partial mRNA

Gallus gallus isolate ML48 18S

CGAGGAATTCCCAG ribosomal

L9.2.2. TAAGTG (SEQ ID RNA gene,

128 20 NO: 76) egg normal rRNA HQ873432 partial sequence

Gallus gallus isolate ML48 18S ribosomal

TTTTGTTGGTTTTC RNA gene,

L9.2.2. GGAAA (SEQ ID partial 129 19 NO: 77) egg normal rRNA HQ873432 sequence

Gallus gallus ribosomal protein LI 2

(RPL12),

GGCCCCCAAGATCG transcript

L9.2.2. GACCGC (SEQ ID tecs (at NM 0012776 variant 1, 130 20 NO: 78) + t) normal mRNA 79 mRNA

Gallus gallus 28S ribosomal

CGGCTCCGGGACGG RNA gene,

L9.2.2. CTGGGA (SEQ ID partial 131 20 NO: 79) agg reverse rRNA DQ018756 sequence

L9.2.2. CGCAGCATTTATGGGCACAG

132 20 (SEQ ID NO: 80)

GGGATAAGGATTGG chrl: 1003489

L9.2.2. CTCTAA (SEQ ID 61- 133 20 NO: 81) ggg 100348980

Gallus gallus M-phase phosphoprotei

TCCTAGAGCAAGGC n6

L9.2.2. AAACGT (SEQ ID NM 0012771 (MPHOSPH6 134 20 NO: 82) tgg normal mRNA 39 ), mRNA

Gallus gallus 28S ribosomal

AACCCGACTCCGAG RNA gene,

L9.2.2. AAGCCC (SEQ ID partial 135 20 NO: 83) egg normal rRNA DQ018756 sequence

Gallus gallus

GCGCCGCCACCTTC survivin

L9.2.2. CGCAAC (SEQ ID mRNA, 136 20 NO: 84) tgg normal mRNA AF322051 complete cds

L9.2.2. GCGGGGAGCATGGCGGAGAG

137 20 (SEQ ID NO: 85)

L9.2.2. 20 GGGTGCGTTTGGGA agg normal mRNA L13234 Gallus gallus 138 AGCCGC (SEQ ID Jun-binding NO: 86) protein mRN,

3' end

L9.2.2. GGTTTTTTTCCTTAGCCAAG

139 20 (SEQ ID NO: 87)

L9.2.2. CGCTTCCGGCGTCTTGCGCC

140 20 (SEQ ID NO: 88)

L9.2.2. CCCCGCCTCCGCCTCCCCTC

141 20 (SEQ ID NO: 89)

L9.2.2. CAGCCACAGGGCACAGTGAG

142 20 (SEQ ID NO: 90)

L9.2.2. GCTGAAGAACATGAGCACGG

143 20 (SEQ ID NO: 91)

Gallus gallus

28S ribosomal

TCCCCGGCGCCGCT R A gene,

L9.2.2. CTCGGG (SEQ ID partial

144 20 NO: 92) ggg reverse rRNA DQ018756 sequence

Gallus gallus breed Rugao yellow chicken

AGCATACCAATCAG mitochondrio

L9.2.2. CTACGC (SEQ ID n, complete

145 20 NO: 93) egg normal mRNA KP742951 genome

Gallus gallus major vault

TCCTGTTGGCTGAG protein

L9.2.2. GCTCGT (SEQ ID NM 0010063 (MVP),

146 20 NO: 94) ggg normal mRNA 36 mRNA

PREDICTED

: Gallus gallus coiled- coil-helix- coiled-coil- helix domain- containing protein 2, mitochondrial

-like

(LOC416933)

GGGGACGTAGGAGC , transcript

L9.2.2. GTATCG (SEQ ID XM 0036422 variant XI,

147 20 NO: 95) egg normal mRNA 22 mRNA Gallus gallus paraspeckle

AACCCAGGGGGCAA component 1

L9.2.2. CTTTGA (SEQ ID NM 0010308 (PSPC1),

148 20 NO: 96) agg normal mRNA 31 mRNA

Gallus gallus breed Rugao yellow chicken

CTAACCCTCCTCTC mitochondrio

L9.2.2. CCTAGC (SEQ ID n, complete 149 20 NO: 97) tgg normal mRNA KP742951 genome

GGTCGGGCTGGGGC chrl : 1003489

L9.2.2. GCGAAG (SEQ ID 31 - 150 20 NO: 98) egg normal 7 100348950

PREDICTED

: Gallus gallus solute carrier family 43, member 3 (SLC43A3),

TGGCACTTGCGGAA transcript

L9.2.2. GCTTCCG (SEQ XM 0036413 variant XI , 151 21 ID NO: 99) ggg reverse mRNA 77 mRNA

L9.2.2. CCCACCCGTGTGACCCCGAA

152 20 (SEQ ID NO: 100)

Gallus gallus

PEST

proteolytic signal containing nuclear

GATTGAGATTTGGG protein

L9.2.2. TGT (SEQ ID NO: ctgg (at NM 0010062 (PCNP), 153 17 101) +1) normal mRNA 53 mRNA

PREDICTED

: Gallus gallus TBC1 domain family, member 22B (TBC1D22B)

GGCAAACTCATGAA , transcript

L9.2.2. AGCTGG ( SEQ ID XM 0049348 variant X3, 154 20 NO: 102) agg reverse mRNA 06 mRNA

L9.2.2. 20 GGGGCTGGACACAG tgg normal mRNA NM 0012822 Gallus gallus 155 GGACGC ( SEQ ID 77 ribosomal NO: 103) protein LI 7

(RPL17), mRNA

PREDICTED

: Gallus gallus uncharacteriz ed

LOCI 008572 66

AGAAATGAAAATCG (LOCI 00857

L9.2.2. TTGTAG (SEQ ID 266), 156 20 NO: 104) egg normal mRNA XR 214191 misc_RNA

Gallus gallus peptidyl rolyl isomerase B

CGGGGCGTGGGCAA (cyclophilin

L9.2.2. CCGCTG(SEQ ID B) (PPIB), 157 20 NO: 105) agg normal mRNA NM 205461 mRNA

Gallus gallus poly(A) binding protein,

TCCCGACGACCTCC cytoplasmic 1

L9.2.2. TGCAAC ( SEQ ID NM 0010315 (PABPC1),

158 20 NO: 106) egg normal mRNA 97 mRNA

Gallus gallus

NME/NM23 nucleoside diphosphate

GTTGTGGCCATGGT kinase 2

L9.2.2. GTGGGA ( SEQ ID (NME2), 159 20 NO: 107) agg normal mRNA NM 205047 mRNA

L9.2.2. CATGGCCCAGTTTTGCAAGT (

160 20 SEQ ID NO: 108)

Gallus gallus proteasome (pro some, macropain) 26 S subunit,

GACAGGCGGTGCGG non-ATPase,

L9.2.2. GCTGGG (SEQ ID NM 0010129 2 (PSMD2), 161 20 NO: 109) ggg normal mRNA 34 mRNA

L9.2.2. TGAAGCTGGCACAC NM 0010043 Gallus gallus 162 20 AAATAC (SEQ ID agg normal mRNA 79 ribosomal NO: 110) protein L7a

(RPL7A), mRNA

Gallus gallus ribosomal

TGCTTGTGCAGACC protein L3

L9.2.2. AAGCG ( SEQ ID NM 0010062 (RPL3),

163 20 NO: 111) egg normal mRNA 41 mRNA

Gallus gallus

TGAGGGGAGCAGCA finished

L9.2.2. A AAAA (SEQ ID cDNA, clone

164 20 NO: 112) agg normal mRNA BX935029 ChEST304113

Gallus gallus ribosomal

TGGAGCCACCCCAG protein S29

L9.2.2. GAAAT ( SEQ ID NM 0012778 (RPS29),

165 20 NO: 113) egg normal mRNA 80 mRNA

Gallus gallus succinate-

CoA ligase,

CGTCCCCTCGCCAA alpha subunit

L9.2.2. TGACAC ( SEQ ID NM 0010128 (SUCLG1),

166 20 NO: 114) egg reverse mRNA 92 mRNA

L9.2.2. CGCCGGCCCCCCCCCAAACC (

167 20 SEQ ID NO: 115)

Gallus gallus mRNA for female- associated

TGCCGATCCCTCCC factor FAF

L9.2.2. GTCAAA ( SEQ ID (faf gene),

168 20 NO: 116) tgg normal mRNA AJ606297 clone FAF5

L9.2.2. GCAGCAGCGCTCCGTGCTCC (

169 20 SEQ ID NO: 117)

Gallus gallus breed Rugao yellow chicken

TCCACCCACACATA mitochondrio

L9.2.2. AACCC(SEQ ID ctgg (at n, complete

170 19 NO: 118) +1) normal mRNA KP742951 genome

L9.2.2. TCCTCGGGACACACCCGCTC (

171 20 SEQ ID NO: 119)

TGCCAAATACGCAG Gallus gallus

L9.2.2. AAGAGA (SEQ ID myosin,

172 20 NO: 120) ggg normal mRNA NM 205477 heavy chain 9, non-muscle

(MYH9), mRNA

Gallus gallus

AACAAAATGCTGTC Jun-binding

L9.2.2. CTGCGCC(SEQ ID protein mRN,

173 21 NO: 121) ggg normal mRNA L13234 3' end

Gallus gallus ribosomal protein SI 7-

TCCGCGGCCGCCGC like

L9.2.2. AGCCAT ( SEQ ID (RPS17L), 174 20 NO: 122) ggg normal mRNA NM 204217 mRNA

PREDICTED

: Gallus gallus cob(I)yrinic acid a,c- diamide adenosyltrans ferase, mitochondrial -like

(LOCI 00859 013),

CAGGGGAGGCAGAT transcript

L9.2.2. CCAAA ( SEQ ID mismatc XM 0049501 variant XI 0, 175 19 NO: 123) h normal mRNA 05 mRNA

Gallus gallus protein phosphatase

1, catalytic subunit, gamma

TGGCACGGGGAAAG isozyme

L9.2.2. CACGAC(SEQ ID NM 0010061 (PPP1CC),

176 20 NO: 124) ggg normal mRNA 90 mRNA

Gallus gallus 28S

TTGAAGGCCGAAGT ribosomal

L9.2.2. GGAGCA ( SEQ ID RNA, partial

177 20 NO: 125) ggg normal rRNA JN639848 sequence

Gallus gallus

CAAACGTTTGAAGA ribosomal

L9.2.2. GGCTGT ( SEQ ID NM 0010063 protein L7

178 20 NO: 126) tgg normal mRNA 45 (RPL7), mRNA

L9.2.2. TGCGGAGCACCGCTCGTGG (

179 20 SEQ ID NO: 127)

PREDICTED

: Gallus gallus NMD 3 ho mo log (S.

GTGCCCATCCCGCC cerevisiae)

L9.2.2. CAAC(SEQ ID ccgg (at (NMD3), 180 18 NO: 128) +1) normal mRNA XM 422813 mRNA

PREDICTED

: Gallus gallus TM2 domain

CGGCCCTGCGTCAG containing 2

L9.2.2. GTACAC ( SEQ ID (TM2D2), 181 20 NO: 129) egg normal mRNA XM 424392 mRNA

PREDICTED

: Gallus gallus ribosomal

TCTGATGATGACAT protein, large,

L9.2.2. GGGATT ( SEQ ID P2 (RPLP2),

182 20 NO: 130) tgg normal mRNA XM 424134 mRNA

Gallus gallus nudix

(nucleoside diphosphate linked moiety

X)-type motif

GGGCTCTGAGCAGC 19

L9.2.2. CTGAGC ( SEQ ID NM 0010314 (NUDT19),

183 20 NO: 131) tgg normal mRNA 58 mRNA

Gallus gallus nascent polypeptide- associated complex

CATCGAGCTGGTCA alpha subunit

L9.2.2. TGTCCC(SEQ ID NM 0012763 (NACA),

184 20 NO: 132) agg normal mRNA 03 mRNA

Gallus gallus breed Rugao

AATGGTGCAACCGC yellow

L9.2.2. TATTAA ( SEQ ID chicken

185 20 NO: 133) ggg normal mRNA KP742951 mitochondrio n, complete genome

PREDICTED

: Gallus gallus ragulator complex protein

LAMTOR2- like

TCCGTGCTGCTGGG (LOCI 00859

L9.2.2. CGGCGA ( SEQ ID XM 0036426 842), partial

186 20 NO: 134) ggg normal mRNA 18 mRNA

L9 ^ -> GGCCGGGACTGCGCGCACAG (

187 20 SEQ ID NO: 135)

Gallus gallus

NME/NM23 nucleoside diphosphate

CTGGTGAAGTACAT kinase 2

L9.2.2. GAACTC ( SEQ ID (NME2),

188 20 NO: 136) egg normal mRNA NM 205047 mRNA

Gallus gallus breed Rugao yellow chicken

TGACTAGTCCCACT mitochondrio

L9.2.2. TATAAT ( SEQ ID n, complete

189 20 NO: 137) egg normal mRNA KP742951 genome

L9.2.2. CCGCCGCCTCCCGCCCCTAT (

190 20 SEQ ID NO: 138)

us

U2snRNP auxiliary factor small subunit class

TCCCTAGCATTCGA 3, (truncated),

L9.2.2. GACAAC ( SEQ ID (U2AF1 191 20 NO: 139) agg normal mRNA AJ291765 gene)

Gallus gallus RNA binding

CCACATGGAGCAGC motif protein

L9.2.2. CAGCCT(SEQ ID NM 0010063 7 (RBM7), 192 20 NO: 140) ggg normal mRNA 18 mRNA Gallus gallus solute carrier family 25 (mitochondria 1 folate carrier),

TTCTAAAACCTTTG member 32

L9.2.2. TGCAC ( SEQ ID NM 0010315 (SLC25A32), 193 19 NO: 141) agg normal mRNA 06 mRNA

Gallus gallus eukaryotic translation initiation

CCGCCACACACGCA factor 4A3

L9.2.2. GAGAAC (SEQ ID NM 0010306 (EIF4A3), 194 20 NO: 142) ggg reverse mRNA 49 mRNA

Gallus gallus isolate ML48 18S ribosomal

TTTAACGAGGATCC RNA gene,

L9.2.2. ATTGG ( SEQ ID partial 195 19 NO: 143) agg normal rRNA HQ873432 sequence

Gallus gallus gallus breed Sanhuang

CCTTCGGAGAGGTG broiler akirin

L9.2.2. TCCTCC(SEQ ID 2 mRNA, 201 20 NO: 144) egg normal mRNA KJ617062 complete cds

PREDICTED

: Gallus gallus WD repeat domain 1 1 (WDR11),

CCCTCAGCGCGCCC transcript

L9.2.2. AACCGG ( SEQ ID XM 0049423 variant XI 0, 202 20 NO: 145) ggg normal mRNA 31 mRNA

Gallus gallus ribosomal

CAGCCGCCATGCCT protein L32

L9.2.2. GCCCTC(SEQ ID NM 0012522 (RPL32),

203 20 NO: 146) egg normal mRNA 55 mRNA

Gallus gallus

AGAATAGTTTTATA WD repeat

L9.2.2. AACCAT ( SEQ ID NM 0010309 domain 77 204 20 NO: 147) tgg normal mRNA 16 (WDR77), mRNA

Gallus gallus clone

TTTTGTTGGTTTTC CDNA34A,

L9.2.2. GGAAAC ( SEQ ID mRNA 205 20 NO: 148) ggg reverse mRNA L48915 sequence

Gallus gallus guanine nucleotide binding protein (G protein), beta polypeptide

ACCCTCCGCGGTAC 2-like 1

L9.2.2. CCTGAA ( SEQ ID NM 0010043 (GNB2L1), 206 20 NO: 149) ggg normal mRNA 78 mRNA

PREDICTED

: Gallus gallus ubiquinol- cytochrome c reductase core protein I

(UQCRC1),

TGAGAATGAGAAGA transcript

L9.2.2. ACAAT ( SEQ ID XM 0049445 variant X3, 207 19 NO: 150) ggg normal mRNA 89 mRNA

PREDICTED

: Gallus gallus RNA- binding protein 39- like

(LOCI 00858 247), _

TGTAGACAAAAACT transcript

L9.2.2. CAGCTC(SEQ ID XM 0049469 variant XI 2,

208 20 NO: 151) agg normal mRNA 01 mRNA

Gallus gallus ribosomal

GGCCCGATCTGGAA protein S14

L9.2.2. TGAAGAT (SEQ ID NM 0010306 (RPS14), 209 21 NO: 152) tgg normal mRNA 19 mRNA

L9.2.2. GCGAGCGGTGCGGAGACCAC (

210 20 SEQ ID NO: 153) Gallus gallus ribosomal

AAGGGCACAGTGCT protein LI 8

L9.2.2. GCTGTC ( SEQ ID mRNA, 211 20 NO: 154) egg normal mRNA AY389963 partial cds

PREDICTED

: Gallus gallus

CGTGGTGGCCTACC RTN3w

L9.2.2. TGGTGC ( SEQ ID XM 0036435 (RTN3), 212 20 NO: 155) tgg normal mRNA 00 mRNA

PREDICTED

: Gallus gallus general transcription factor IIH, polypeptide 2, 44kDa (GTF2H2),

CAGCCTTACAACAT transcript

L9.2.2. GTGATC ( SEQ ID XM 0036430 variant XI, 213 20 NO: 156) egg normal mRNA 75 mRNA

CATTTCCAGCCCCA

L9.2.2. TCTGCCC(SEQ ID chr9: 1480579 214 21 NO: 157) tgg 2-14805812

Gallus gallus large-subunit

ACGGGCCGGTGGTG ribosomal

L9.2.2. CGCCCG(SEQ ID RNA D3 215 20 NO: 158) ggg reverse rRNA X51919 domain

Gallus gallus ribosomal

TCCAAGGCGGGGTT protein, large,

L9.2.2. GTTCTC ( SEQ ID cagg (at P0 (RPLP0), 216 20 NO: 159) +1) reverse mRNA NM 204987 mRNA

Gallus gallus phosphoglyce rate mutase 1

CGGCCTCAACAAGG (brain)

L9.2.2. CTGAGA ( SEQ ID NM 0010315 (PGAM1), 217 20 NO: 160) egg normal mRNA 56 mRNA

L9.2.2. ACGGGCTGCTGCTGTGAGCA (

218 20 SEQ ID NO: 161)

CGCCTCTCCCCCGC Gallus gallus

L9.2.2. GGGTGC ( SEQ ID NM 0012872 ribosomal 219 20 NO: 162) egg normal mRNA 05 protein S27a (RPS27A), mRNA

Gallus gallus breed Rugao yellow chicken

TAGCTACCCGGCGT mitochondrio

L9.2.2. AAAGAG ( SEQ ID n, complete 220 20 NO: 163) tgg normal mRNA KP742951 genome

L9.2.2. GGGACCGCCGTTCTACGTTC (

221 20 SEQ ID NO: 164)

Gallus gallus isolate ML48 18S ribosomal

CCATGATTAAGAGG RNA gene,

L9.2.2. GACGGC ( SEQ ID partial 222 20 NO: 165) egg normal rRNA HQ873432 sequence

PREDICTED

: Gallus gallus mitochondrial ribosomal protein 63

(MRP63),

CGGCACGATGTTTT transcript

L9.2.2. TAACGC ( SEQ ID XM 0049388 variant X2,

223 20 NO: 166) tgg normal mRNA 06 mRNA

PREDICTED

: Gallus gallus neurotrypsin- like

(LOC423740)

CTGAGGAGCAGGCT , transcript

L9.2.2. AACAA ( SEQ ID XM 0049420 variant X2,

224 20 NO: 167) tgg normal mRNA 78 mRNA

L9.2.2. CCGCCGCCAAGGGTAAGAAG (

225 20 SEQ ID NO: 168)

Gallus gallus cyclin- dependent

CACCTTGCCCAGAT kinase 2

L9.2.2. CCTGCC(SEQ ID NM 0011998 (CDK2),

226 20 NO: 169) ggg reverse mRNA 57 mRNA PREDICTED

: Gallus gallus nuclear calmodulin- binding

CGGGGGCACGGAGC protein

L9.2.2. ACACAT ( SEQ ID XM 0049502 (URP),

227 20 NO: 170) ggg normal m NA 06 mRNA

Gallus gallus ribosomal

AACATCTCTCCCTT protein, large,

L9.2.2. CTCCTT(SEQ ID P0 (RPLP0),

228 20 NO: 171) tgg normal mRNA NM 204987 mRNA

Gallus gallus GABA(A) receptor- associated

CGTCCCGGTTCGGC protein

L9.2.2. CCGGTC(SEQ ID mRNA,

229 20 NO: 172) egg normal mRNA KP064313 complete cds

Gallus gallus

NME/NM23 nucleoside diphosphate

CTGGTGAAGTACAT kinase 2

L9.2.2. GAACTC ( SEQ ID (NME2), 230 20 NO: 173) egg normal mRNA NM 205047 mRNA

Gallus gallus

SH3-domain binding protein 5

(BTK-

GCGCGGCCGTGCTG associated)

L9.2.2. CCGAGG ( SEQ ID NM 0010309 (SH3BP5), 231 20 NO: 174) agg normal mRNA 89 mRNA

Gallus gallus nudix (nucleoside diphosphate linked moiety X)-type motif

CCCAACCCGGGCAT 16-like 1

L9.2.2. GCTGTT ( SEQ ID (NUDT16L1)

232 20 NO: 175) egg normal mRNA NM_204780 , mRNA

L9.2.2. CGTCGCCAAGACCT Gallus gallus

233 20 CGAGGA ( SEQ ID egg normal mRNA CR387434 finished NO: 176) cDNA, clone

ChEST26e5

Gallus gallus

CTTTCAATGGGTAA 28S rRNA

L9.2.2. GACGC ( SEQ ID cctiti (at gene, clone

234 19 NO: 177) normal rRNA FM165415 GgLSU-1

L9.2.2. AAGTAGTGCTGCGACCAGAC (

235 20 SEQ ID NO: 178)

L9.2.2. GGGTTCTGCTCTGCGGCTTC (

236 20 SEQ ID NO: 179)

L9.2.2. GGCTCCCCTCTGTGCCCCGC (

237 20 SEQ ID NO: 180)

Gallus gallus translocase of inner mitochondrial membrane 13 homolog

CGGCTCCGGGGCCG (yeast)

L9.2.2. GCGGGG (SEQ ID NM 0013021 (TIMM13),

238 20 NO: 181) ggg normal mRNA 95 mRNA

L9.2.2. CATGGCGGGAACCGCGGCGA (

239 20 SEQ ID NO: 182)

L9.2.2. GAGTCCATTTTGGGGGGCGG (

240 20 SEQ ID NO: 183)

Gallus gallus

DNA, CENP-

A associated sequence, partial

CGCTCCGGGGACAG sequence,

L9.2.2. CGTCAG ( SEQ ID gtgg (at clone:

241 20 NO: 184) +1) normal mRNA AB556518 CAIP#220

Gallus gallus

28S

TATTCAAACGAGAG ribosomal

L9.2.2. CTTTGA (SEQ ID RNA, partial

242 20 NO: 185) agg normal rRNA JN639848 sequence

Gallus gallus small nuclear ribonucleopro tein 40kDa

ACCGGAGCTCTTCT (U5)

L9.2.2. GCAAT ( SEQ ID NM 0010063 (SNRNP40),

243 19 NO: 186) egg normal mRNA 08 mRNA Gallus gallus ribosomal

CACGGCCTCATCCG protein S29

L9.2.2. TAAGTA ( SEQ ID NM 0012778 (RPS29), 244 20 NO: 187) egg normal mRNA 80 mRNA

Gallus gallus phosphatidyli nositol-4,5- bisphosphate

3 -kinase, catalytic

CCTCACCTTCATTG subunit alpha

L9.2.2. CGCCGC(SEQ ID NM 0010044 (PHC3CA), 245 20 NO: 188) egg reverse mRNA 10 mRNA

PREDICTED

: Gallus gallus ribosomal protein L36a (RPL36A),

GAGGAAGCAGAGCG transcript

L9.2.2. GCTATG ( SEQ ID XM 0036410 variant X 1 , 246 20 NO: 189) normal mRNA 94 mRNA

Gallus gallus breed Rugao yellow chicken

TGTCATAGGTTAAC mitochondrio

L9.2.2. CTGCT ( SEQ ID n, complete

247 20 NO: 190) tgg normal mRNA KP742951 genome

L9.2.2. AAGTAGTGCTGCGACCAGAC (

248 20 SEQ ID NO: 191)

Gallus gallus

CCCGCCCCGCCGCG finished

L9.2.2. CATTCC(SEQ ID cDNA, clone

249 20 NO: 192) agg normal mRNA CR387434 ChEST26e5

AATGAAGCGCGGGT chrUn AAD

L9.2.2. AAACGG ( SEQ ID N03019346:8 250 20 NO: 193) egg 69-888

Gallus gallus retinoblastom a binding

CAACCTCTTGTGTA protein 4

L9.2.2. CAGAGC ( SEQ ID (RBBP4), 251 20 NO: 194) tgg normal mRNA NM 204852 mRNA

L9.2.2. 20 TGCCAGGAGGGCTC ggg chrl 9:844559 252 TGGAA ( SEQ ID 6-8445615 NO: 195)

Gallus gallus coiled-coil- helix-coiled- coil-helix domain

GAAGTGGCGCAGCG containing 2

L9.2.2. CGCGGC(SEQ ID NM 0010062 (CHCHD2),

253 20 NO: 196) ggg normal mRNA 18 mRNA

Gallus gallus endogenous

GCTCCCCTCTGTGA virus ALVE-

L9.2.2. ATAACC ( SEQ ID Bll genomic

254 20 NO: 197) agg normal mRNA KC610517 sequence

Gallus gallus breed Rugao yellow chicken

TTCGTCGCTACAGG mitochondrio

L9.2.2. GTTCCA ( SEQ ID n, complete

255 20 NO: 198) egg normal mRNA KP742951 genome

Gallus gallus translocase of inner mitochondrial membrane 8 homolog A

GAGAAGTGCATGGA (yeast)

L9.2.2. CAAGCC(SEQ ID NM 0013021 (TIMM8A), 256 20 NO: 199) egg normal mRNA 10 mRNA

Gallus gallus breed Rugao yellow chicken

TCCCCCACAATTAT mitochondrio

L9.2.2. CTTAA ( SEQ ID ce g (at n, complete

257 19 NO: 200) normal mRNA KP742951 genome

Gallus gallus finished

GGCCGCCTGGCACA cDNA, clone

L9.2.2. CGAGGT ( SEQ ID ChEST790c2

258 20 NO: 201) ggg normal mRNA BX931917 1

CACACCCCAACTGT Gallus gallus

L9.2.2. CCAAAA ( SEQ ID breed Rugao

259 20 NO: 202) ggg normal mRNA KP742951 yellow chicken

mitochondrio n, complete genome

Gallus gallus

TGTGATGCCCTTAG 18S rRNA

L9.2.2. ATGTCC ( SEQ ID gene, clone 260 20 NO: 203) ggg normal rRNA FM165414 GgSSU-1

CCGTGCGGGGCGGG

L9^ ? CAGGTA ( SEQ ID chr8: 1362229 261 20 NO: 204) egg 6-13622315

L9.2.2. CGCGGCCACGTCCAGCCCCA (

262 20 SEQ ID NO: 205)

Gallus gallus isolate ML48 18S ribosomal

TTTAACGAGGATCC RNA gene,

L9^ ? ATTGG ( SEQ ID partial 263 19 NO: 206) agg normal rR A HQ873432 sequence

Gallus gallus xeroderma pigmentosum, complementat

GCGGCCCCCGGCCC ion group A

L9.2.2. GGATGA ( SEQ ID (XPA), 264 20 NO: 207) agg normal mRNA NM_204853 mRNA

Gallus gallus eukaiyotic translation elongation factor 2

AAGTTCAGCAAATC (EEF2) gene,

L9.2.2. CGCTAC(SEQ ID exon 6 and

265 20 NO: 208) tgg normal mRNA FJ881855 partial cds

PREDICTED

: Gallus gallus methyltransfe rase like 6 (METTL6),

TGTGCGGTCCGACT transcript

L9^ ? GCTGTG ( SEQ ID XM 0049394 variant X5, 266 20 NO: 209) agg normal mRNA 36 mRNA

L9.2.2. TCGCCGGCGGTGCG Gallus gallus

267 20 GAGCCG ( SEQ ID egg normal rRNA FM165415 28S rRNA NO: 210) gene, clone

GgLSU-1

Gallus gallus

TCGTCCACCTTTGC Jun-binding

L9.2.2. TTTCT ( SEQ ID ccgu (as protein mRN,

268 20 NO: 211) 1- [ ) reverse mRNA L13234 3' end

Gallus gallus

TCGCCCGCTGCTTT finished

L9.2.2. AAGAAC (SEQ ID cDNA, clone

269 20 NO: 212) egg normal mRNA BX932373 ChEST98d21

Gallus gallus

ACAAAATGCTGTCC Jun-binding

L9.2.2. TGCGCC(SEQ ID protein mRN,

270 20 NO: 213) ggg normal mRNA L13234 3' end

Gallus gallus isoamyl acetate- hydrolyzing esterase 1 ho mo log (S.

TGTTGCTGTTACTA cerevisiae)

L9.2.2. TTTTCTT ( SEQ ID NM 0012777 (IAH1),

271 21 NO: 214) tgg normal mRNA 29 mRNA

PREDICTED

: Gallus gallus G-rich

RNA

sequence binding factor

1 (GRSF1),

GATGGAGTCGTACT transcript

L9.2.2. ACTCAG ( SEQ ID variant X2,

272 20 NO: 215) agg normal mRNA XM 420600 mRNA

L9^ ? GACCGCCTGGCTGCGTTCTA (

273 20 SEQ ID NO: 216)

Gallus gallus isolate ML48

18S ribosomal

TCCCTGCCCTTTGT RNA gene,

L9.2.2. ACACAC(SEQ ID mismatc partial

274 20 NO: 217) h normal rRNA HQ873432 sequence

L9^ ? CGGAAAGACGAAGGTCCCGA (

275 20 SEQ ID NO: 218)

L9.2.2. CCTGTGCTAATCCT Gallus gallus

276 19 GCAAA ( SEQ ID egg normal mRNA NM 204985 phosphoglyce NO: 219) rate kinase 1

(PGK1), mRNA

Gallus gallus breed Rugao yellow chicken

AAACAACCAGCCTA mitochondrio

L9.2.2. CTTAT ( SEQ ID n, complete

277 20 NO: 220) egg normal mRNA KP742951 genome

Gallus gallus

ATGAACAGCGCCAG finished

L9.2.2. CAGCCA(SEQ ID cDNA, clone

278 20 NO: 221) ggg reverse mRNA CR387434 ChEST26e5

PREDICTED

: Gallus gallus cyclin I (CCNI),

TCCCAGCCAGTGAA transcript

L9.2.2. CACCTC(SEQ ID XM 0049411 variant X3,

279 20 NO: 222) egg normal mRNA 62 mRNA

L9.2.2. CGTCGCAGAGCATCGCCCAG (

280 20 SEQ ID NO: 223)

CGCGGCCTCGGGCC

L9.2.2. CGAACC(SEQ ID chr9:2308014

281 20 NO: 224) egg 6-23080165

L9.2.2. GAAGTCGCGCCCAGTAATGC (

282 20 SEQ ID NO:225)

Gallus gallus large-subunit

GAAGGCCCCGGGCG ribosomal

L9.2.2. CACCAC(SEQ ID RNA D3

283 20 NO: 226) egg normal mRNA X51919 domain

Gallus gallus

RuvB-like 1

CACACCTGCCTTGC (E. coli)

L9.2.2. CTCTTG ( SEQ ID aegg (at NM 0010061 (RUVBLl),

284 20 NO: 227) +1) reverse mRNA 38 mRNA

Gallus gallus

STT3B, subunit of the oligosacchary ltransferase

TTCCTAGCACCAGT complex

L9.2.2. TTTTAG ( SEQ ID NM 0010315 (catalytic)

285 20 NO: 228) egg normal mRNA 13 (STT3B), mRNA

Gallus gallus breed Rugao yellow chicken

AGCA ACCAATCAG mitochondrio

L9.2.2. CTACGC(SEQ ID n, complete

286 20 NO: 229) egg normal mRNA KP742951 genome

Gallus gallus ribosomal

TTTGGCAGCCCGTG protein SA

L9.2.2. CTATTG ( SEQ ID NM 0010078 (RPSA),

287 20 NO: 230) tgg normal mRNA 23 mRNA

L9.2.2. GCTCCATTGGAGGGCAAGTC (

288 20 SEQ ID NO: 231)

Gallus gallus ribosomal

TGGAGTGGGCTTCA protein L31

L9.2.2. AGAAGC ( SEQ ID NM 0012777 (RPL31),

289 20 NO: 232) ggg normal mRNA 55 mRNA

L9.2.2. GGGGTCCTTGGGGGTCTCAG (

290 20 SEQ ID NO: 233)

Gallus gallus breed Rugao yellow chicken

CACTGATTTCCCCT mitochondrio

L9.2.2. CTTCAC(SEQ ID n, complete 291 20 NO: 234) agg normal mRNA KP742951 genome

L9.2.2. TTCATCCTCACTGCCCCCCC (

292 20 SEQ ID NO: 235)

PREDICTED

: Gallus gallus prothymosin, alpha

(PTMA),

ACTTTACTTGTGGT transcript

L9.2.2. GTGACC ( SEQ ID XM 0049433 variant X4,

293 20 NO: 236) agg normal mRNA 73 mRNA

Gallus gallus

TTGTACTTCATTGC septin 6

L9.2.2. TCCGA ( SEQ ID cagg (at NM 0010311 (SEPT6),

294 19 NO: 237) +1) normal mRNA 25 mRNA L9.2.2. TATTAAATTAAAGCTCGTCC (

295 20 SEQ ID NO: 238)

Gallus gallus breed Rugao yellow chicken

AAGTGCTGTGCCGG mitochondrio

L9.2.2. CTATGC ( SEQ ID mismatc n, complete

301 20 NO: 239) h normal mRNA KP742951 genome

Gallus gallus isolate ML48

18S ribosomal

CATGATTAAGAGGG RNA gene,

L9.2.2. ACGGCC(SEQ ID partial

302 20 NO: 240) ggg normal rRNA HQ873432 sequence

L9.2.2. GAGGGGCAACTGAGGGGCAG (

303 20 SEQ ID NO: 241)

L9.2.2. AGTTACGGATCCGGCTTGCC (

304 20 SEQ ID NO: 242)

Gallus gallus finished

TCCATCCACGTGGG cDNA, clone

L9.2.2. CCAAGC(SEQ ID ChEST559bl

305 20 NO: 243) ggg normal mRNA BX934736 4

Gallus gallus zinc finger

TGTTGATCAGCAAA protein 706

L9.2.2. AATGAA ( SEQ ID NM 0010975 (ZNF706),

306 20 NO: 244) ggg normal mRNA 31 mRNA

PREDICTED

: Gallus gallus RNA binding motif

CTCAACAACTCTGA protein 34

L9.2.2. CCTGAT ( SEQ ID (RBM34),

307 20 NO: 245) ggg normal mRNA XM 423974 mRNA

Gallus gallus breed Rugao yellow chicken

ATCACCCCTCCCCG mitochondrio

L9.2.2. CACTGT ( SEQ ID n, complete

308 20 NO: 246) ggg normal mRNA KP742951 genome

L9.2.2. GGGGAATGCGAGCGCTCAGT (

309 20 SEQ ID NO: 247) Gallus gallus isolate ML48 18S ribosomal

CGGCACAATACGAA RNA gene,

L9.2.2. TGCCCC(SEQ ID partial 310 20 NO: 248) egg reverse rRNA HQ873432 sequence

Gallus gallus ribosomal

TATGGGCATCGGGA protein LI 9

L9.2.2. AGAGAA ( SEQ ID mRNA, 311 20 NO: 249) agg normal rRNA AY393838 partial cds

PREDICTED

: Gallus gallus LSM1 homolog, U6 small nuclear RNA

associated (S.

CACCTCGTCCTGCT cerevisiae)

L9.2.2. ACGGGA ( SEQ ID (LSM1), 312 20 NO: 250) egg normal mRNA XM_424387 mRNA

Gallus gallus ferritin, heavy

CAGGGGGACTTCTA polypeptide 1

L9.2.2. CTTCAC(SEQ ID (FTH1), 313 20 NO: 251) tgg normal mRNA NM 205086 mRNA

Gallus gallus calcium-

TGCGGGCACTACGG binding

L9.2.2. CTGAGA ( SEQ ID protein (P22), 314 20 NO: 252) ggg normal mRNA NM 205390 mRNA

L9.2.2. GGGGAGGGCGGGAGCGATAG (

315 20 SEQ ID NO: 253)

Gallus gallus ribosomal

CACGGCCTCATCCG protein S29

L9.2.2. TAAGTA ( SEQ ID NM 0012778 (RPS29), 316 20 NO: 254) egg normal mRNA 80 mRNA

Gallus gallus isolate ML48 18S ribosomal

ACCCGAGATTGAGC RNA gene,

L9.2.2. AATAAC ( SEQ ID partial 317 20 NO: 255) agg normal rRNA HQ873432 sequence Gallus gallus

CCTCTTCGGTACCT finished

L9.2.2. CCTCAG(SEQ ID cDNA, clone

318 20 NO: 256) egg reverse mRNA BX934562 ChEST28clO

L9.2.2. TCCCCTCGGGTCCATTATCG (

319 20 SEQ ID NO: 257)

Gallus gallus glucose- fructose oxidoreductas e domain

AGCTGTACTTGTGG containing 2

L9.2.2. CTGAGC ( SEQ ID NM 0010305 (GFOD2),

320 20 NO: 258) agg reverse mRNA 60 mRNA

Gallus gallus mRNA for

L9.2.2. mu

321 immunoglob

(Ομ TTCGGGGTTCTCCG ulin heavy guide CCATGG ( SEQ ID chain C

3) 20 NO: 259) ggg reverse mRNA X01613 region

Gallus gallus ribosomal

GCCTGCCGGGACTG protein L35a

L9.2.2. GGCTGC ( SEQ ID NM 0012774 (RPL35A),

322 20 NO: 260) agg normal mRNA 57 mRNA

Gallus gallus ribosomal

TGCAAAAAACCAGG protein L27a

L9.2.2. CTGGAC ( SEQ ID NM 0012776 (RPL27A),

323 20 NO: 261) tgg normal mRNA 63 mRNA

Gallus gallus isolate ML48

18S ribosomal

CATGATTAAGAGGG RNA gene,

L9.2.2. ACGGC ( SEQ ID partial

324 19 NO: 262) egg normal rRNA HQ873432 sequence

L9.2.2. GGGAGCGGCGGCCGTGGCGGC (SEQ

325 21 ID NO: 263)

L9.2.2. TCGGTGAAGTCCCCAAAAT (S

326 19 EQ ID NO: 264)

Gallus gallus

TCGACGATGGCACG ribosomal

L9.2.2. TCTGAT ( SEQ ID protein L27

327 20 NO: 265) egg normal mRNA NM 205337 (RPL27), mRNA

Gallus "alius mRNA for

L9.2.2. Mill

328 immunoglob (Ομ CCGTCCCGCGAGGA ulin heavy guide CTTCGA ( SEQ ID chain C 1) 20 NO: 266) agg normal mRNA X01613 region

Gallus gallus ribosomal

AACATCTCTCCCTT protein, large,

L9.2.2. CTCCTT(SEQ ID P0 (RPLPO),

329 20 NO: 267) tgg normal mRNA NM 204987 mRNA

Gallus gallus small nuclear ribonucleopro tein polypeptide

GAGGAAGACACCGT A'

L9.2.2. CCCCAC(SEQ ID NM 0010058 (SNRPA1 ),

330 20 NO: 268) egg normal mRNA 23 mRNA

Gallus gallus serine/arginin e-rich splicing

CCCGCCCGCGCTCC factor 1

L9.2.2. GCGCAC(SEQ ID NM 001 1 137 (SRSF1), 331 20 NO: 269) egg normal mRNA 41 mRNA

L9.2.2. CGCCTGTGTGATTACTCTAT (

332 20 SEQ ID NO: 270)

PREDICTED

: Gallus gallus ribosomal

GGCGCTCTTCCGGG protein L23a

L9.2.2. GGTATT ( SEQ ID (RPL23A),

333 20 NO: 271) tgg reverse mRNA XM 415820 mRNA

PREDICTED

: Gallus gallus SEC24 family, member A (S. cerevisiae)

GACTAACATTCCTC (SEC24A),

L9.2.2. AAACCC(SEQ ID transcript

334 20 NO: 272) agg normal mRNA XM 414630 variant X2, mRNA

Gallus gallus 28S

CGTTCCGAAGGGAC ribosomal

L9.2.2. GGGCGA ( SEQ ID RNA, partial

335 20 NO: 273) tgg normal rRNA JN639848 sequence

GGCGGAAGCAGCGA

L9.2.2. ACAGAG (SEQ ID

336 20 NO: 274) agg

Gallus gallus mRNA for

L9.2.2. mu

337 immunoglob (Ομ CCAAAGCCAATCGG ulin heavy guide TCACAT (SEQ ID chain C 2) 20 NO: 275) egg normal mRNA X01613 region

Gallus gallus 28S ribosomal

CCGTTAAGAGGTAA RNA gene,

L9.2.2. ACGGGT (SEQ ID partial

338 20 NO: 276) ggg reverse rRNA DQ018756 sequence

Gallus gallus isolate ML48 18S ribosomal

ATGCATGTCTAAGT RNA gene,

L9.2.2. ACACAC (SEQ ID partial

339 20 NO: 277) ggg normal rRNA HQ873432 sequence

Gallus gallus elongation

TCCGGCAAGTCCAC factor 1 alpha

L9.2.2. CACCAC (SEQ ID (EF1A) gene, 340 20 NO: 278) egg normal mRNA AY579777 partial cds

Gallus gallus

TCCGCACCGCCGGC 28S rRNA

L9.2.2. GACGGC (SEQ ID gene, clone 341 20 NO: 279) egg reverse rRNA FM165415 GgLSU-1

Gallus gallus

CGTTCCCTCCGCTT ubiquilin 4

L9.2.2. CGACCC (SEQ ID NM 0010313 (UBQLN4),

342 20 NO: 280) egg normal mRNA 73 mRNA

L9.2.2. TGGACCCCTACAGTATGTTC

343 20 (SEQ ID NO: 281 ) Gallus gallus

DNA, CENP- A associated sequence, partial

CGAATACAGACCGT sequence,

L9.2.2. GAAAGC ( SEQ I D clone:

344 20 NO : 2 82 ) ggg normal mRNA AB556518 CAIP#220

Gallus gallus ribosomal

CATCGGGAAGAGAA protein LI 9

L9.2.2. AGGGTA ( SEQ I D mRNA,

345 20 NO : 2 83 ) egg normal mRNA AY393838 partial cds

References

1. R. Barrangou, C. Fremaux, H. Deveau, M. Richards, P. Boyaval, S. Moineau, D.A. Romero, P. Horvath, CRISPR provides acquired resistance against viruses in prokaryotes. Science 315, 1709- 1712 (2007).

2. 1. Grissa, G. Vergnaud, C. Pourcel, The CRISPRdb database and tools to display CRISPRs and to generate dictionaries of spacers and repeats. BMC Bioinformatics 8, 172 (2007).

3. J.E. Garneau, M.E. Dupuis, M. Villion, D.A. Romero, R. Barrangou, P. Boyaval, C. Fremaux, P. Horvath, A.H. Magadan, S. Moineau, The CRISPR / Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468, 67-71 (2010).

4. L. Cong, F.A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib, P.D. Hsu, X. Wu, W. Jiang, L.A. Marraffini, F. Zhang, Multiplex genome engineering using CRISPR / Cas systems. Science 339, 819-823 (2013).

5. P. Mali, L. Yang, K.M. Esvelt, J. Aach, M. Guell, J.E. DiCarlo, J.E. Norville, G.M. Church, RNA-guided human genome engineering via Cas9. Science 339, 823-826 (2013).

6. O. Shalem, N.E. Sanjana, E. Hartenian, X. Shi, D.A. Scott, T.S. Mikkelsen, D. Heckl, B.L. Ebert, D.E. Root, J.G. Doench, F. Zhang, Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84-87 (2014).

7. T. Wang, J.J. Wei, D.M. Sabatini, E.S. Lander, Genetic screens in human cells using the CRISPR-Cas9 system. Science 343, 80-84 (2014).

8. Y. Zhou, S. Zhu, C. Cai, P. Yuan, C. Li, Y. Huang, W. Wei, High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature 509, 487-491 (2014). 9. H. Koike -Yusa, Y. Li, E.P. Tan, C. Velasco-Herrera Mdel, K. Yusa, Genome -wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide R A library. Nat. Biotechnol. 32, 267-273 (2014).

10. A. Meisel, TA. Bickle, D.H. Kriiger, C. Schroeder, Type III restriction enzymes need two inversely oriented recognition sites for DNA cleavage. Nature 355, 467-469 (1992).

11. H. Arakawa, D. Lodygin, J.M. Buerstedde, Mutant loxP vectors for selectable marker recycle and conditional knock-outs. BMC Biotechnol. 1, 7 (2001).

12. H. Arakawa, J. Hauschild, J.M. Buerstedde, Requirement of the activation-induced deaminase (AID) gene for immunoglobulin gene conversion. Science 295, 1301-1306 (2002).

13. Y.Y. Zhu, E.M. Machleder, A. Chenchik, R. Li, P.D. Siebert, Reverse Transcriptase template switching: A SMART approach for full-length cDNA Library Construction. BioTechniques 30, 892- 897 (2001).

14. S. Lundin, A. Jemt, F. Terje-Hegge, N. Foam, E. Pettersson, M. Kaller, V. Wirta, P. Lexow, J. Lundeberg, Endonuclease specificity and sequence dependence of type IIS restriction enzymes. PLoS One 10, eOl 17059 (2015).

15. N.E. Sanjana, O. Shalem, F. Zhang, Improved vectors and genome -wide libraries for CRISPR screening. Nat. Methods 11, 783-784 (2014).

16. International Chicken Genome Sequencing Consortium, Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432, 695-716 (2004).

17. J. Cheng et al., A Molecular Chipper technology for CRISPR sgR A library generation and functional mapping of noncoding regions. Nat. Commun. 7, 11178 (2016).

18. A. B. Lane et al., Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. ev. Cell. 34, 373-378 (2015).

19. S.R. Patanjali, S. Parimoo, S.M. Weissman, Construction of a uniform-abundance (normalized) cDNA library. Proc Natl Acad Sci USA. 88, 1943-1947 (1991).

20. C.A. Reynaud, V. Anquez, H. Grimal, J.C. Weill, A hyperconversion mechanism generates the chicken light chain preimmune repertoire. Ce// 48, 379-388 (1987).

21. J.M. Buerstedde, S. Takeda, Increased ratio of targeted to random integration after transfection of chicken B cell lines. Cell 67, 179-188 (1991). 22. Y. Umesono, J. Tasaki, Y. Nishimura, M. Hrouda, E. Kawaguchi, S. Yazawa, O. Nishimura, K. Hosoda, T. Inoue, K. Agata, The molecular logic for planarian regeneration along the anterior- posterior axis. Nature 500, 73-76 (2013).

23. X. Tian, J. Azpurua, C. Hine, A. Vaidya, M. Myakishev-Rempel, J. Ablaeva, Z. Mao, E. Nevo, V. Gorbunova, A. Seluanov, High -molecular-mass hyaluronan mediates the cancer resistance of the naked mole rat. Nature 499, 346-349 (2013).

24. T.A. Ebert, J.R. Southon, Red sea urchins (Strongylocentrotus franciscanus) can live over 100 years: confirmation with A-bomb 14Carbon. Fish. Bull. 101 , 915- 922 (2003).

25. S.A. Stewart, D.M. Dykxhoorn, D. Palliser, H. Mizuno, E.Y. Yu, D.S. An, D.M. Sabatini, I.S. Chen, W.C. Hahn, P.A. Sharp, R.A. Weinberg, CD. Novina, Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA 9. 493-501 (2003).