TITLE

Cywiobactermm sp. for Production of Compounds

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0001] Thi invention was made in part with United States government support under the

Department of Energy grant number DE-EEQ002867. Tlie government has certain rights associated with this invention.

CROSS REFERENCE TO RELATED APPLICATION

[0002] This application claims priority to U.S. provisional application No. 61/741,000 filed on December 21, 2012, and U.S. provisional application No. 61/835,294 filed on June 14, 2013. which are each herein incorporated by reference in thei entirety and for all purposes.

REFERENCE TO SEQUENCE LISTING

[0003] This application contains a sequence listing submitted by EFS-Web, thereby satisfying the requirements of 37 C.F.R. §1.821-1.825.

FIELD OF INVENTION

[0004 j T e present disclosure relates to the genetic enhancement of cyanobacteria to produce compounds of interest

BACKGROUND

[0005| Cyanobacteria are prokaryotes capable of photoautotrophy. Cy anobacteria can be

genetically enhanced to use light and CO2 to produce compounds of interest such as biofuels, industrial chemicals, pharmaceuticals, nutrients, earotenoids, and food supplements. Various cyanobacterial strai s have been genetically enhanced to produce compounds of interest Carbon dioxide that, is used by cyanobacteria can be derived from any source, such as a waste byproduct of industrial production. In this way, cyanobacteria can be used to recycle CO2 to compounds of interes

[0006] The fransformation of the cyanobacterial genus S nechococcms with genes that enc ode enzymes thai can produce ethano! for biofuel production has been described (U.S. Patent Nos, 6,699,69 and 6,306,639, both to Woods et L). The transformation of the cyanobacfeiiai genus Sy chocystis has been described, for example, in PCT EP2009/0008 2 and in

PCT/EP2009/060526.

[0007] The cyanobaeterial geaus Cyatiobacteriwn was first established in Ϊ983 (see Rippka et al. (2001). Sergey's Manual of Systematic Bacteriology, Vol. 1, p. 497-498). In general, the genus differs from the genus Syneckococcus by differences in DNA base composition and by differences in sensitivity to cyanophages (Mora, et al,. 2007, Algological Studies, 123:1-15). Members of the Cyanobacteriimi genus are often found in thermal mats.

SUMMARY

[0008] This disclosure provides non-naturally occurring Cyanobacterium sp. ABICyanol organisms containing ethanologenic pathways with at least one exogenous nucleic acid encoding an ethanologenie pathway enzyme expressed in a sufficient amount to produce ethane!. This disclo sure additionally provides, methods of using such Cyanobacterium sp.

ABICyanolorganisms to produce ethanol by cinturing the non-na raliy occurring, genetically enhanced Cyanobacterium sp. ABICyano 1 organisms containing ethanotogeiiic pathways as described herein under conditions and for a sufficient period of time to produce ethanol.

[0009] In an aspect a non-naturally occumng emanologenic Cyanobacterium sp. organism derived from Cyanobacterium sp. ABICyano l is disclosed, wherein said organism comprises a genetically enhanced plaseiki derived from a plasmid that is endogenous to Cyanobacterium sp. ABICyanol, and wherein said organism produces etlianol from about 0.002% (vol/vol) per day up to about 0.07% (vol/vol) per day. In an embodiment, the non-naturally occumng

ethanotogenic Cyanobacterhmi sp, organism is capabl e of producing ethanol at a rate of 0.07% (vol/vol) per day. In another embodiment, the non-naturally occumng emanologenic

Cyaiiobacterium sp. organism is capable of producing ethanol at a rate of ,047% (vol/vol) per twelve hours. In another enibodiment, the non-naturally occurring emanologenic Cyanobactetium sp. organism is capable of producing ethanol a.t a rate of about 0.0201% (vol/vol) per day at about 114 days of growth. In another enibodiment the non-naturally occurring emanologenic

Cyartobactetiimi sp. organism produces ethane! at about 135 days of growth. In another embodiment, me non-natural!y occurring ethanotogenic Cyanobacterium sp. organism comprises Cyanobacterium sp. ABICyanol deposited in the American Type Culture Collection (ATCC) under ATC accession number PTA-13 11. and further comprises an ethanologenic pathway comprising at least one exogenous nucleic acid encoding an ethanologenic pathway enzyme expressed in a sufficient amount for the organism to produce sthanoL said ethanologenic pathway comprising a pyruvate decarboxylase, and an alcohol dehydrogenase. Is yet another eiiibodmient, the non-naturally occurring ethanologenic Cyanobacterium sp. organism, of has a genetically enhanced plasmid that is derived from a 6.8 kb plasmid endogenous to Cymiobacterium sp.

ABICyanol consisting of SEQ ID NO: 1. In another embodiment the non-naturally occurring ethanologenic Cyanobacterium sp. organism contains a genetically enhanced plasmid having at least 50% of a 6.8 kb plasmid endogenous to Cyanobacterium sp. ABICyanol consisting of SEQ ID NO; 1. In another embodiment, the non-naturally occurring ethanologenic Cymiobacterium sp. organism comprises one. two, or three exogenous nucleic acids each encoding an

ethanologenic pathway enzyme. In an embodimentthe non-naturally occurring ethanologenic Cyaiiobacterium sp. organism comprises a heterologous adh gene and a heterologous pdc gene, and the adh gene is operably linked to a promoter, and the pdc gene is operably linked to a promoter. In an embodiment, the non-namraMy occuiiing eiiianologenic Cyanobacterium sp, organism lias a heterologous adh gene that encodes for an alcohol dehydrogenase thai has an amino acid sequence identity of at least 60% to the amino acid sequence identity of the enzyme encoded for by nucleotides 117 to 1127 of SEQ ID NO: 48, In another embodiment, the non- naturally occurring ettianologenk Cyanobacterium sp. organism has a heterologous pdc gene that encodes for a pyruvate decarb oxylase that has an amino acid sequence identity of at least 60% to the annuo acid sequence identity of the enzyme encoded for by nucleotides 379 to 2085 of SEQ ∑D NO: 43. hi yet another embodiment, fee non-naturally occurring ethanologenic

Cymiobacterium sp. organism contains a plasmid selected from plasmids comprising

polynucleotide sequences that are 90% or more identical to the polynucleotide sequence of any of SEQ ID O'S 43 _: . 61, 62, 66, 72, 73, 74, 82, S3 _: . 84, 85, and 106, hi an embodiment, the non- naturally occurring ethanologenic Cyatiobacterivm sp. organism has a promoter operably linked to the adh gene that is constitutive, and the promoter that is oper ably linked to the pdc gene is inducible, hi another embodiment, the non-naturally occurring ethanologenic Cyanobactmium sp. organism has a promoter operably linked to the ad gene that is selected from th group consisting ©f Prbc, Prbc*„ PcpcB, PrpsL*4 and PipsL, hi another embodiment the non-naturally occurring ethanologenic Cyanobacterium sp. organism lias a promoter operably linked to the pdc gen that is selected km promoters inducible by ihe presence or absence of nitrate and/or copper. In another embodiment, the non-namrally occurring ethanologenic Cyanobactmium sp, organism has a promoter or promoters operably linked to a pdc gene that is selected from the group consisting of endogenous Pair A, Pair A, PnirA*!, PnirA*2. PnirA *3, PnirA*4, Porf0221. PorfD223, and Porf0316. in an enibodmieiit, e non-naturaily occuning etlianoiogenic

Cyatiobactenmn sp. organism has a promoter thai is operabiy linked to said adli gene is endogenous to Cyanob cierium sp., and wherein said promoter operabiy linked to me pdc gene and is endogenous to Cyanabacieriim sp. in another embodiment, the non-naturaily occurring ethanologenic Cyanobacierium sp. organism of contains a promoter that is operabiy linked to me adh gene and a promoter operabiy linked to the pdc gene and the promoters are selected from promoters comprising polynucleotide sequences that are 90% or more identical to the polynucleotide sequence of any of SEQ ID NOs 9 -41. In another embodiment, the non-naturaily occurring emanologenic Cyanobacteri n sp. organism contains genetically enhanced plasmids that are selected from plasmids comprising polynucleotide sequences that are 90% or more identical to the polynucleotide sequence of any of SEQ ID NOs: 62, 66, 82, 83, 84, 85, and 106.

[0910] In another aspect a non-naturaily occurring emanologenic Cyanobacierium sp. organism comprising Cyanobacterimn sp. ABICyanol deposited in the American Type Culture Collection (ATCC) under ATCC accession number PTA-13311, and the organisms further comprises an ethanologenic pathway comprising one, two, or three exogenous nucleic acids each encoding an etlianoiogenic pathway enzyme expressed in a sufficient amount to produce ethanoL and wherein the emanologenic pathway has bees introduced into the cliromosomal DNA of the

Cfyanobacteriwn sp. ABICyanol , and wherein the emanologenic pathway comprises at least one pyruvate decarboxylase gene operabiy linked to a promoter and an alcohol dehydrogenase- gene operabiy linked to a promoter. In an embodiment, the non-natnrally occurring etlianoiogenic Cyanobacterium sp. organism further comprises a chromosomal knockout of one or more red homologs from Cyemob cferium sp, ABICyanol selected from the group consisting of SEQ ID NOs: 127 and 128. In another embodiment, the non-naturaily occurring etlianoiogenic

Cyanobactetitim sp. organism contains an emanologenic pathway that has been introduced into the cliromosomal DN A of the Cyanobacierium sp. ABICyano l by transforming the non-naturaily occurring emanologenic Cymiobacterium sp. organism with one or more integrative piasmid. In another embodiment the non-naturaily occurring ethanologenic Cymiobacterium sp. organism has an integrative plasmid mat is selected from plasmids comprising polynucleotide sequences that are 90% or more identical to the polynucleotide sequence of any of SEQ ID NOs: 107, 108, 109 and 110. [0911] In another aspect, a method for producing ethanoi is disclosed comprising growing a non- naturaliy occurring etimnologenic Cyanob eleiium sp. organism comprisin Cymobacfer m sp. ABICyanol deposited in tlie Americas Type Culture Coilection (ATCC) under ATCC accession number PTA-1331 L and fer&er comprising an ethanologenie a hwa comprising at least one exogenous nucleic acid encoding as etiianologenic pathway enzyme expressed in a sufficient amount for the organism to produce ethanoi, and the ethanologenie pathway comprises a

pyruvate decarboxylase, and an alcohol dehydrogenase. In an embodiment, the method produces ethanoi from about 0,002% vol vol ethanoi per day up to about 0.07% vol/vol ethanoi per day. In another embodiment, the organism is capable of producing ethanoi at a ra te of 0 ,07% (vol/vol) per day. In yet another ein odinieiii, the organism is capable of producing ethanoi at a rate of 0.047% (vol/vol) per twelve hours, in another embodiment, ethanoi is produced at a rate of about 0.0201% (vol/vol) per day at about 114 days of growth. In an embodiment, a method for producing ethanoi is disclosed wherein the non-naturaily occurring ethanologenie

Cyanob cieriimi sp. organism comprises a plasmid selected from piasmids comprising polynucleotide sequences that are 90% or more identical to the polynucleotide sequence of any of SEQ ID NQs 43, 61, 62, 66. 72, 73, 74. 82, 83, 84, 85, and 106.

[0012] In an aspect, a genetically enhanced Cyanobacterium sp. host cell comprising at least one recombinant gene, wherein the recombinant gene encode one protein selected from a group consisting of a protein that is invol ved in a biosyntheiic pathway for the production of a chemical compound or a marker protein. la an embodiment, the host cell is Cyonobacter mi sp.

ABICyanol or a Cyatiobacterium sp. host ceil derived from the host cell Cyanobacterium sp. ABICyanol by the introduction of further genetic enhancements. In an embodiment, the host ceil can withstand at least one of the following cu uring conditions: at least 1%. 2%, 3% or 4% (v/v) ethanoi in t e medium for at least 6, 12 or 16 weeks, at least 48 ^C C, preferably at least 50 or at least 53 to 55 °C for at least 2 hour peaks over at least 7 days, and purging with 60% (v/v) to 80% oxygen, in another embodiment, die host cell has recombinant genes that are located on an extrachromosomal plasmid. In another embodiment, the host cell of the previous claim, wherein the extrachromosomal plasmid contains eyanobacterial nucleic ac sequences. la another embodiment, the extrachromosomal plasmid is derived from a plasmid that is endogenous to the Cyanobacterium sp. host cell. In another embodiment the recombinant gene is integrated into an endogenou extrachromosomal 6.8 kb plasmid from C cmobacterhan sp. ABICyanol comprising a polynucleotide sequence of SEQ ID NO; 1. In another embodiment the extrachromosomal plasmid comprises the recombinant gene, and an origin of replication suitable for replication in the C anobacterhmt sp. ABlCyanol . In another embodiment, tiie host cell further comprises oae gene coding for a replication initiation fa ctor binding to the origin of replication. In an

embodiment, the host ceil of the previous claim, wherein the gene coding for a replication initiation facto is included on the extrachromosomai plasmid. In another embodiment, the sequence of the origin of replication has at least 90%, preferably 95% identity or is identical to the nucleotides 3375 to 3408 of fee sequence of the endogenous 6,8 kb plasmid having a polynucleotide sequence comprising SEQ ID NO: 1. In another embodiment, the host cell has a gene for the replication initiatio factor feat codes for a protein having at least 90%, preferably 95% sequence identity or is identical to the protein coded by nucleotides 594 to 3779 of the sequence of the endogenous 6.8 kb plasmid having a polynucleotide sequence comprising SEQ ∑D NO: 1. hi another embodiment, the extrachromosonial plasmid comprises a sequence with a sequence identity of at least 90%, preferably 95% to the sequence of the endogenous 6.8 kb plasmid having a. polynucleotide sequence comprising SEQ ID NO; ! . In yet another

embodiment the extrachromosomal plasmid comprises a recombinant origin of transfer for conjugation. In an embodiment, the exfrachromosomal plasmid is a shuttle vector feat is able to replicate in two different host species. la an embodiment, fee shuttle vector comprises a cyanobacterial origin of replication and an origin of replication for Enterobactwiaceae _* is particular E. coii. hi another embodiment, the the at least one recombinant gene is codon.

impro ved for enhancing translation by adapting fee codon usage of the at least one recombinant gene to the codon usage of Cyanobacterium sp., in particular Cyanobacterium ABlCyanol . In an embodimen the G and/or C wobble bases in the codons have been replaced by A a d? or T. In an embodiment, the recombinant, gene is integrated into a chromosome of the host cell In another embodiment, the recombinan gene is integrated into an endogenous gene of the host cell thereby leading to a gene raactivation of the endogenous gene, hi an embodiment, the protein is involved in a biosynfeetic pathway for the production of a chemical compound. In another embodiment, the chemical compound, is a biofuel or another organic compound, hi yet another embodiment the hiofiiel or the othe organic compound is selected from a group consisting of alcohols, alkanes, polyhydroxyalkanoates, fatty acids, ferry acid esters, carboxylic acids, amino acids, hydrogen, terpenes, terpenoids, peptides, peiyketides, alkaloids, lactams, pyrrolidone, alkenes, ethers, tetrahydrofuran and combinations thereof. In anofeer embodiment the chemical compound is an alcohol. In another embodiment, the chemical compound is efeanol. In another embodiment, tiie genes for ethanol production are selected from a group of genes consisting of pdc coding for PDC enzyme catalyzing the mtereonversion between pyruvate and aeetaldehyde, adh coding for ADH enzyme catalyzing the interconversion between acetaldehyde and ethanoL and adliE, coding for AdhE enzyme catalyzing the interconversion between ace†yJ-CoA and ethanoL In yet another embodiment, the at least one recombinant gene is under the control of either a constitutive or inducible promoter. In an embodiment, the promoter is a cyanobacterial promoter. In an embodiment, the promoter is endogenous to the genetically enhanced

Cyanohacierium sp. In another embodiment, the promoter has at least 90%· sequence identity to an endogenous promoter of t e genetically enhanced Cytmobacteri m sp. In an embodiment, the promoter is an inducible promoter selected from a group consisting of PnirA, PziaA. PsratA, PeorT, PnrsB, PnriA, PpetJ, PnarB and other metal-ion inducible promoters and variations thereof. In another embodiment, the promoter is an inducible promoter and has at least 90%, prefexabiy 95% sequence identity or is identical to tlie promoters having SEQ ID HOs 9-41. hi an embodiment, the promoter is an inducible promoter having the following general nucleotide sequences of SEQ ID NOs: 112 to 124. hi another embodiment, the promoter is a constitutive promoter selected from a group consisting of; PrpsL, PcpcB, Prbe, FpetE and variations thereof. I an embodiment, the promoter includes nucleotide changes in either one of the ribosomal binding site, the TATA box, the operator or the 5' -UTR (untranslated region). la another

embodiment, the promoter is selected from PnirA, PcorT and PsmtA . In another embodiment, the host cell comprises at least a first and a second recombinant gene. In an embodiment, the first and second recombinant genes are under the transcriptional control of different first and second promoters and the first recombinant gene encodes pyruvate decarboxylase and the second recombinant gene encodes alcohol dehydrogenase. In another embodiment a transcription terminator is present between tlie first and second recombinant gene. In an embodiment, the first recombinant gene encodes pyruvate decarboxylase and the second recombinant gene encodes alcohol dehydrogenase and wherem the first recombinant gene is under tlie transcriptional control of a first inducible promoter and wherem the second recombinant gene is under the

transcriptional control of a second constitutive promoter. In an embodiment the second

constitutive promoter is selected from a group consisting of the following from PrpsL*4:

GAGCTCTAGAAAAACTATTGACAAACCCATAAAAAATGTGATATAATTATAGAT GT CACTGGTATTTTATACTAGAGGCAAATTATATTTATATATACAAAAATGCTGTAGGA GGATCAGCCATATG, Prbc*{optRBS) with th sequence: ACT AG TTGACATAAG TAAAGGCATC CCCTGCGTGA TATAATTACCTTCAGTTTAA GGAGGTATACACAT, at id PcpcB wish sequence:

TGAGAAAAAGTGTAAACAAATATTAAGAAAAA

AATAAAAAAATGCGTCACTACGGGTTATAAATTTACATGAAAGGTT^

CTGAGACGATTTTGATAAAAAAGTTGTCAAAAAATTAAGTTTCTTTA ACAAAAACTTGGTITTAAGG\4CAAAATAAGAGAGACTAATTTGCAGAAG1 I ACAA GGAAATCT GAAGAAAAAGATCTAAGTAAAACGACTCTGTTTAACCAAAATTTAACA AATTTAACAAAACAAACTAAATCTATTAGGAGATTAACTAAGC . IK another

etnbodiment. the host ceil is able to produce ethanol in quantifies of at least 0,025%(v/v) per lay, preferably at least 0.03 % (v/v) pes" day. most preferred at least 0.0493 % (v/v) per day. In another embodiment, the host c ell of any of the previous claims for ethanol production, wherein the first recombinant gene encodes AdliE enzyme directly converting acetyi-CoA to ethanoL

[0013] In an aspect a transformable Cyanobactwium sp, cell is disclosed that comprises an extracellular polymer layer (EPS) pretreated with couipounds selected from a group consisting of: N-acefylcystemej lysozyme, β-gala.c osidase and combinations thereof,

[0014] Ih another aspect, a method for producing a chemical compound is disclosed comprising the method steps of: a) cdturing the genetically enhanced cyanobacterial host cells according to any of the preceding claims in a culture medium, the host cells thereby producing the chemical compound, and b) retrieving the chemical compound from either one of; the host cells, the medium or the headspace above the medium, and wherein during method step A) the host ceils are subjected to light and C02.

[0015] In another aspect, disclosed is a method for producing a genetically enhanced

Gy mb eterium sp. host cell comprising introducing the recombinant gen into the genome of the host ceil comprising the method step of:

[0016] A) subjecting the host cell to compounds increasing the permeability of the

extracellular polymeric layer (EPS) and cell wall, respectively of the host cell, and

[0017] B) hitroducing the recombinant nucleic acid sequence into the host ceil. In an embodinieiit, the recombinant nucleic acid sequence comprises an extrachromosomal piasmid. In another embodiment, the extraehiOmosoniai piasmid is derived from an endogenous piasmid of the host cell by at least the introduction of the recombinant gene, hi another embodiment the method comprises protecting the recombinant nucleic acid sequence against endogenous restriction endonucleases of the host cell by for example methylafing at least a part of the recombinant nucleic acid sequence or modifying and/or eliiiiinating the recognition sequences of the endogenous restriction endonucleases and wherein the recombinant nucleic acid sequence is subjected to me&yitransferases, for example MAval a d MAcyl. Iii another embodiment, the m the method step A) the compoun s are selected from a grou consisting of; N-acetyfcysteine, iysozynie. and β-galactosidase and combinations thereof and a combination comprising N- aceiyl.cyst.eine and lysozyme is used. In an embodiment, the host cell is first subjected to N- acetylcysteine followed by treatment of lysozyme. and wherein the host cell is subjected to N- acefylcysteine for 0.5 to 3 days, preferably to I to 2 days and is further treated with lysozyme for 3 min. to 1 hour, preferably for 10 ruin to 30 niiii, most preferred for 10 to 15 lain, hi another embodiment, the N-aceiylcysieine treatment is carried out at a temperature of 12 °C to 37 °C and the lysozyme treatment is conducted in a temperature range from 20 ^C C to 37 °C, preferably at a temperature range from 20 °C to 30 °C„ In an embodiment, the concentration ofN-acetyicysteine is kept between 0.05 mg mL and i mg/niL and the concentration of lysozyme is between 10 to 60 ^ig mL. in another embodiment in method step B) the recombinant nucleic acid sequence is introduced into the host cell via conjugation or eiectioporation, In another embodiment, in method step A) the cells are subjected to positively charged polyarninoacids such as poly-L- lysine hydrobromide or poiy-L-omi thine hydrochloride or combinations thereof.

[0018] In another aspect, a method for transforming cyanobacteriai cells having an extracellular polymeric layer (BPS) comprising treating the ceils with compounds selected from a group consisting of: N -acetylcysteine, iysozyiue, and p-galaetosidase and combinaiioiis thereof, before and/or during transformatio with a recombinant DNA wherein the cyanobacteriai cell in addition includes restriction endonuc leases and wherein the method further comprises

methylating the restriction sites of the recombinant DNA before or during transformation, hi an embodiment, the piasmid vector has first recombinant gene codes for a first enzyme catalyzing a metabolic reaction, which is not present in the wild type host cell and die first recombinant genes is pyruvate decarboxylase gene coding for PDC enzyme as a first enzyme and the second recombinant gene is adh coding for ADH enzyme. In an embodiment, the plasmid vector of an has a transcription terminator is present between the first and second recombinant gene.

[0019] hi another aspect, a method for introducing a recombinant nucleic acid sequence into a cyanobacteriai cell with an extracellular polymeric layer (EPS) comprising the method steps of:

[0020] A) subjecting the cyanobacteriai cell to compounds increasing the permeability of the extracellular polymeric layer (EPS) and cell wall, respectively of the cyanobacteriai cell, and [0021] B) mtroducing the recombinant nucleic acid sequence into the eyanobacterial cell. In ail embodiment, the eyanobacterial ceil is subjected to compounds: selected from a group consisting of: N-ace†yleysteine, lysozyine, and β-galactosidase aad com inations thereof.

[0022] In an aspect a kit for producing a chemical coxnpound via photosynthesis, comprising host including the recombinant gene encoding one protein that is involved in a biosynthetic pathway for the production of the chemical compound, a vessel for collaring the host cells, and means for illumination of the host cells and wherein the host cells are in a transportable form, wherein the host cells are at least in one of the following transportable forms, suspende d in a liquid growth medium, in a frozen form, on an agar plate, hi another embodiment, the vessel comprises a plioiobiereactor which is at least partly transparent for the radiation emitted by the means for illuininatioii of the host cells wherein the means for iui iination of the host ceils comprises lamps or light emitting diodes or a combination thereof

[0023] In an aspect, a genetically enhanced eihaaologenic copper inducible ABICyaiiol host cell is disclosed wherein the host ceil exhibits ethane! production up to 135 days.

[0024] hi another aspect, a genetically enhanced ethanologenic ABICyaiio l host cell is disclosed comprising adli genes that encode for alcohol dehydrogenase enzymes with catalytic properties that result in increased ethanol production relative to the ethanol production of alcohol dehydrogenase from Synee ocy&tis sp. PCC 6803.. In an embodiment, the genetically enhanced plasmids are derived from endogenous plasmids of the host cell wherein the genetically enhanced plasmids are selected from the group consisting of #1792, # 743, #1744,. #1749, #1751 , # 817, #1818, #1728, and #1578 and can also comprise multiple copies of dc genes. In an embodiment, the multiple copies are integrated into the chromosome or into a plasmid within the host cell and can comprise plasmids. selected from the group consisting of #1792, #1743, #1744, #1749,

#1751, #1817, #1818, #1728, and #1578. In an embodiment, a method for generating knockouts in the genome of ABICyaiiol comprking introducing a heterologous polynucleotide construct into a . ABICyanoI host cell wher ein the heterologous polynucleotide construct, comprises flankin regions of about 2 kbp or greater- thai are homologous to a gene or gene portion in the genome of ABICyanoI. In another embodiment, the homologous recombin tion efficiency is increased through the deletio of a gene homologue in ABICyanoI mat encodes for a RecJ honiolog selected from the group consistin of orf0488, and orf2384. in yet another embodiment, the knockouts are selected from the group consisting of narB, argH, ieuB, a homologue of a

Rad54 encoding aene. and vcf37. [0025] In an aspect the ethanologenic cassette is selected from an eihaiiologenic cassette selected from a piasfflid selected from the group consisting of #1495. #1578, #1580. #1581, #1601, #1606, 1X412 and TK41 1.

[0026] In an aspect a genetically enhanced ethanologenic ABICyanoi host ceil is disclosed comprising an ethanologenic cassette compr si g adh and pdc genes that are under the control of endogenous metal inducible promoters selected from the group consisting of Pori0l28 (SEQ ID NO: 19), Porfl486 (SEQ ID NO; 20). PorB164 (SEQ ID NO; 21). Porf3293 (SEQ ID NO: 22), Porf362l (SEQ ID NO: 23), Porf3635 (SEQ ID NO: 24), PorSSSS (SEQ ID NO: 25), Porfl 071 (SEQ ID NO: 26), Porfl 72 (SEQ ID NO; 27). Porf 1074 (SEQ ID NO: 28), Porfl 075 (SEQ ID NO: 29), Porfl542 (SEQ ID NO: 30). Porf! 823 (SEQ ID NO: 31), Porfl 824 (SEQ ID NO: 32), Porf3126 (SEQ ID NO: 33), Por£3389 (SEQ ID NO; 34), Porf0221 (SEQ ID NO: 35), PoriD222 (SEQ ID NO: 36), Porf0223 (SEQ ID NO: 37), Pori03 6 (SEQ ID NO: 38), Porf3232 (SEQ ID NO; 39), Porf3461 (SEQ ID NO: 40), and Porf3749 (SEQ ID NO; 41), Porfl 071 and PorfB 126.

[0027] In another aspect, disclosed is a genetically enhanced ethanologenic ABI yano Ϊ host cell comprising a genomic knockout of the flv3 gene wherein tlie host cell produces more ethanoi that the eoirespoiidmg host cell having an intact flv3 gene. In an embodiment, the production of ethanot is about 10% to about 20%· greater than the host ceil av ng an intact ilv3 gene. In an embodiment, the piasm d comprises piasmid #1 72,

[0028] In another aspect, a method for making ethanot is disclosed comprising growing the host cell comprising a genomic knockout of a yc£37 gene and forther comprising knocking out a genomic yc©7 gene in an ethanologenic ABICyanoi host cell.

[0029] In an aspect, a non-naturall occurring ethanologenic Cpanobacteriimi sp. ABICyano i orgamsm is disclosed wherein the promoter operably linked to an adh gene and the promoter operably linked to pdc gene are selected from the group consisting of PrbcLS, PiitcA, PnbtA, PfeiA. PpetJ, PpetE, PeorT, PsmtA, PziaA, PsigB, PlrtA, PhfpG, PhspA, PclpBl, PhliB, PggpS, PpsbA2, PpsaA, PnirA. PnarB, PnrtA, PislB, PnrsB, PlrtA, PmrgA, PpstS. and PcrhC, PpetJ, PpsbD, PhbiA, P poA, PistB. PnblA, PisiA, PpetJ, PpetE, PcorT, PsmtA, PziaA, PsigB, PlrtA, PhtpG, PhspA, PclpBl , PhliB, PggpS, PpsbA2, PpsaA. PnirA, PnarB, PnrtA, PcrhC, PrbcL, PmpA, PrpsL. PrpoA, PpsaA, PpsbA2, PpsbD. PcpcB, PhspA, PclpBl, PhliB, PairA*2, PnfcA*3, PnirA*4, PiiaitC, PrpsL*4, Prbc*, PcpcB, PipsL*4, PcpcB (SEQ ID NO: 9), PnirA (SEQ ID NO: 10), PlrtA (SEQ ID NO: 1 1), PmrgA (SEQ ID NO: 12), PnblA (SEQ ID NO; 13), PggpS (SEQ ID NO: 14), PpetJ (SEQ∑D NO: 15), PppsA (SEQ ID NO: 16), PmpA (SEQ ID NO: 17), PpstS

I I. (SEQ ID NO: IS), Porfl>128 (SEQ ID NO; 19), PotfI4S6 (SEQ ID NO: 20), Porf3l64 (SEQ ID NO: 21). Por£32 3 (SEQ iD NO; 22), PorS62I :(SEQ ID NO; 23), Porf3633 (SEQ ID NO: 24). PorS858 (SEQ ID NO; 25). Peril 071 (SEQ ID NO: 26), Port! 072 (SEQ ID NO: 27), Porfl.074 (SEQ ID NO: 28), PorflSTS (SEQ ID NO; 29). Porfi542 (SEQ ID NO: 30), Porfl823 (SEQ ID NO: 31), Porfl824 (SEQ ID NO: 32), PorSl.26 (SEQ ID NO: 33), Por£33S9 (SEQ ID NO: 34), Porfi>221 (SEQ ID NO; 35), Poif0222 (SEQ ID NO: 36), Porf0223 (SEQ ID NO: 37),. Porfi>316 (SEQ ID NO: 38), Porf3232 (SEQ ID NO; 39), PorS461 (SEQ ID NO: 40), Porf3749. and (SEQ ID NO; 41). In an embodiment, the promoter operably linked to an. adit gene and the promoter operably linked to a pdc gene are selected from the group consisting of PorfO.128, Porfl4S6, Porf3164, Porf32 3, Porf362I , Por£3635, Porfi07L Porfl072, Porfl074, Porfi075, Porfl542, Porfl 823, Porf3126, Porf022t , Porfi>222, Pojffi>223, Pori¾316, Porf3126, PorS232, Porf3461, and Porf3749. In another embodiment, the non-naturally occurring efl aiioio enie

Cyanobacteriimi sp. ABICyaaol organism contains a promoter operably linked to an ad gene and the promoter operably linked to a pdc gene are selected from a. polynucleotide sequence having at least 90% identity to a polynucleotide sequence selected from the group consisting of PrfecLS. PnicA, PnbiA, PisiA, PpeiJ, PpetE, PcorT, PsmtA, PziaA, PsigB, PlrtA, PhtpG. PhspA. PclpBl, PhliB, PggpS, PpshA2, PpsaA, PairA, PaarB, PnrtA, PisiB, PnrsB, PlrtA, PmrgA, PpstS, and PcxhC, PpetJ, PpsbD, PnblA, PrpoA, PisiB, PnblA, PisiA, PpetJ, PpetE, PcorT, PsmtA, PziaA, PsigB, PlrtA, PhtpG, PhspA. PclpBl, PhliB. PggpS, PpsbAZ, PpsaA, PairA, PaarB, PnrtA. PcrhC, PrbeL, PmpA, PrpsL, PrpoA, PpsaA, Ppsl>A2, PpsbD, PcpcB, PhspA, PclpBl, PhliB, PakA*2, PiarA*3, PiiirA*4, PaiatC, PrpsL*4, Prbc* PcpcB, PipsL*4, PcpcB (SEQ ID NO; 9), PnirA (SEQ ID NO: 10). PlrtA (SEQ ID NO: 1 1), PrnrgA (SEQ ID NO: 12), riMA (SEQ ID NO: 13), PggpS (SEQ ID NO: 14), PpetJ (SEQ ID NO: 15), PppsA (SEQ ID NO: 16), PmpA (SEQ ID NO: 17), PpstS (SEQ' ID NO: 18), PorfO 128 (SEQ ID NO: 19), Porfl486 (SEQ ID NO: 20), Porf3164 (SEQ ID NO: 21), PorS293 (SEQ ID NO: 22), Porf3621 (SEQ ID NO: 23), Porf3635 (SEQ ID NO: 24), Porf3858 (SEQ ID NO: 25), Porfl0 I (SEQ ID NO: 26),

Porfl072 (SEQ ID NO: 27), Porfi074 (SEQ ID NO; 28), Porfl075 (SEQ ID NO: 29), Porfl542 (SEQ ID NO: 30), Porfl823 (SEQ ID NO; 31). PorfI824 (SEQ ID NO: 32). Porf3126 (SEQ ID NO: 33), Porf3389 (SEQ ID NO; 34), Porf0221 (SEQ ID NO; 35). Poif9222 (SEQ ID NO: 36), Porf0223 (SEQ ID NO: 37), Porf0316 (SEQ ID NO: 38), Por£3232 (SEQ ID NO: 39), PorB461 (SEQ ID NO: 40), Porf3749, and (SEQ ID NO: 41). In another embodiment, the non-naturally occurring et aaologenic Cyanobact-erium sp. ABICyaaol organism contains a genetically

3.2 enhanced piasmid that is selected from the group consisting of TK293, TK441, TK48©, TK4S1. TK482. TK483, T 4S4 _; i .4H . TK4S6, TK487, TK488. TK4S9, TK490, TK491, TK4V2.

TK493, TK500, TK501. T 502, TK503, T 504, 1X527, TK528, TK529. #1581, #1578, TK36S, #1495, #1606, #1629, #1636, #1631, #1632, #1580, #1601, #1606, TK41 L and TK412.

BRIEF DESCRIPTION OF THE DRAWINGS

[0030] FIG. I depi cts two panels of microscopic images that demonstrate ihe presence of the extracellular polymer (EPS) layer that is present in a sheath surrounding the Cy no&aeTeriwn sp. ABICyanol cell. The left panel is without stain and the right, panel is with a stain specific for EPS.

[0031] FIGs. 2 A and 2B depict the thermotoloerance growth characteristics of Cym bacrer sp. ABICyaool (panel A) and S echoc ccm PCC 7002 (panel B).

[0032] FIG, 3 depicts a piasmid map with sequence annotation of the 6S28 bp endogenous piasmid ol ^" Cy nob cterium ABICyanol cell.

[0033] FIG. 4 depicts a pliy!ogenetsc tree showing the relationship between Cy b cterium sp. ABICyanol and other eyanobacterial genera and species.

[0034] FIG. 5 depicts a sequence comparison of 16S rDNA of ABICyanol with 16S rDNA from other Cy nobacteii m species.

[0035] FIG. 6 depicts an image of an agarose gel having undergone electrophoresis to show how methylation of a piasmid only containing antibiotic resistance genes may at least partially protect it from digestion by a crude extract of ABICyanol .

[0036] FIG. 7 depicts a map of the piasmid construct and sequence annotation of piasmid TK225 (pABICyano 1-6.8

[0037] FIG. § depicts a map of the piasmid construct and sequence annotation of piasmid T 293

(pABIC¼:attol-6.8

PrbcABICyano 1 -Km**-eriVT).

[0038] FIG. 9 is a map of the piasmid construct and sequenc annotation of piasmid TK295 (pABICyano I -6.8 PnirAABICyano 1 -PDC(opti>PpsbAABICyaao i-synADH(optl)- PAcABICyano I -Km* *-©riVT).

[0039] FIG. 10 is a map of the piasmid construct and sequence annotation of piasmid TK229 (pABICyanol -6.8 PpeffiABICyanof-PDC(optl)-synADH(optl)-PifecABICymo l-Km**-oriVT). [0040] FIG, 11 depicts a map of the piasmid construct "ΓΚ368 (pABICyano 1-6.8

PpeiEABICyaaiol-PDC<opU)- PipsLABICyano! -syiL J3H(opil)-PAcABiCyanol-Kai**- oriVT).

[0041] FIG, 12 depicts a map of the plasmid construct and sequence annotation of plasmid #1495 (pABICyanol -6,8: :PmrAABICyano 1-zmPDCABICyano I (opi3)-PipsLABICyanoi - ADHABICyano 1 (opt3) !er-Prbc ABICyano 1 -Km** ) ,

[0042] FIG. 13 depicts a map of the plasmid construct and sequence annotation of plasmid #1578 (pABIeyano I -¾h A-zmPDC(opt3 )-dsr A-Pr c(opf RB S)-synADHoop) .

[0043] FIG, 14 depicts a map of the plasmid construct and sequence annotation of plasmid #1581 (pABICyano 1 -6.8: :PnirAABICyano 1 -zmPDCABICyano 1 (opt3)-dsrA^sLABICyasol- ADHABI€^anol(opt3)ter-PrbeABICyanol-Kni**).

[0044] FIG. 15 depicts a map of piasmid construct and sequence annotation of plasmid TK441 ( ABICyano :Ppet JABICyano 1 -PDC(opt 1 )-PrpsL ABICy ano-syiiADH(opt 1 }-PrbcABICy ano- Kni**).

[0045] FIG. 16 depicts a map of plasmid construct and sequence annotation of plasmid #1629 (pABICyano Ϊ -6.8::I^A(opt2)-zniPDe<optI)_d^

[0046] FIG, 17 depicts a map of piasmid construct and sequence annotation of plasmid # 1636

[0047] FIG. IS depicts a map of plasmid construct and sequence annotation of plasmid 1630 (pABICyano! -6..8: reorR-PeoiT^

[0048] FIG. 19 depict a map of piasmid construct and sequence annotation of plasmid #1631 (pABICyaaol -6,8::corR-PcorT*2-z!iu ^

[0049] FIG. 20 depicts a map of plasmid construct and sequence annotation of plasmid #1632. (pABICyano! .-6.8: :corR-PeoiT*3-zmPDCABICyaiiol (optl)_ds.A-Prl c*(optRBS)- synADH(optl)_ter).

[0050] FIG. 21 depicts a ma of plasmid construct and sequence annotation of plasmid #1635 (pABICyano! -6.8: :smtB~PsintA-zinPDC(optl)_dsi -¾½c*{optRBS)-synADH(opti)_tei-).

[0051] FIG. 22 depicts a map of plasmid construct and sequence annotation of plasmid #1639 (pABICyano I -6.. S : : smtB-PsmtA* 1 -zmPDC(opt 1 )_dsrA-Pi'bc * (o tRBS)-synADH(opf 1 )_f εΐ') .

[0052] FIG. 23 depicts a map of piasmid construct and sequence annotation of plasmid #164(3 (pABICyanol -6..S: :smiB-PsmtA*2-m^ [0053] FIG, 24 depicts a sequence comparison between the native promoter iiii A from

ABICyanoI and different variants of the promoter harboring nucleotide changes; in the libosotnal binding site, the binding sites for the regulators NtcA and NtcB and fee TATA bos,

[0054] FIG. 25 depicts a map of the plasniid construct and sequence annotation of piasmid #1606

(pABICyanol : :PiiaA-zmPDC(opti)_dsiA-Prbc*(optRBS)-s¾iADH(opt

[0055 j FIG. 26 depicts a nucleotide sequence comparison between different corT promoters.

[0056] FIG. 27 depicts a nucleotide sequence comparison between fee native smfA promoter from Synechococc s PCC 7002 and two different variants of the promoter containing mutations in the ribosomal binding site.

[0057] FIG. 28 depicts ethanol production normalized to the growth (QE so _a m} f° ^r ABICyanoI strams transformed "with plasmids #1606, #1629 and #1636.

[0058] FIG. 29 depicts the specific activity of PDC for ABICyanoI strains transformed with plasmids #1606, #1629 and #1636.

[0059] FIG. 30 depicts fee specific activity of ADH for ABICyanoI strains transformed with plasmids #1606, #1629 and #1636,

[0060] FIG. 31 depicts ethanol production normalized to the growth (ODrstaia) for ABICyanoI strains transformed with plasmids #1606, #1631 and #1632.

[0061] FIG, 32 depicts the specific activity of PDC for ABICyanoI strains transformed with plasmids #1606, #1631 and #1632.

[0062] FIG. 33 depicts the spec ific activity of ADH. for ABICyanoI strains transformed with plasmids #1606, #1631 and #1632.

[0063] FIG, 34 Figure 34 depicts the production of ethanol and acetaldehyde from.

Cy nob cterii i sp. ABICyanoI strains containing either one of ethanologenic plasmids TK293 and TK225.

[0064] FIGs 35 A to 35D depict the ethanol production rate, acetaldehyde accumulation and ADH and PDC activities of about a 15 day cultivation of Cyanobacterium sp. ABICy anoI containing fee etlianofogenic piasmid T 225,

[0065] FIGs 36A to 36C depict ethanol production rate, cell growth and maximum ethanol production ra e for 7 days from a 14 day cultivation of Cyanobactetium sp. ABICyanoI

containing the e anologenic plasmid TK293.

[0066] FIG, 37 depicts the ethanol production rates and the acetaldehyde accumulation for Cyanobacteriimi sp. ABICyanoI strains TK293, # 1495, # 1578 and # 1581.

3.5 [0067] FIG, 38 depicts and compares (in the left panel) fee FDC enzyme activity and (in the right panel) tlie ADH enzyme activity between ABICyaiiol host cells each containing one of the plasmids TK293, #1495, #1578. and #1581.

[0068] FIG. 39A and 39B depict ethanol production in. an ABICyaiiol Τ 44Ϊ strain having the endogenous PJ»*J upstream of as etliaiiol gemc gene cassette producing the same amount of ethanol (percent v/v) under copper depletion (FIG. 39 A) conditions as compared to an

ABICyaiiol TK293 strain grown in marine BG11 in FIG. 39B.

[0069] FIG. 40 depicts the ethanol production rate of the ABICyaiio l transformed with plasmid

#1635.

[0070] FIG. 41 depiets the ethanol production rate of the ABICyaiiol transformed with plasmid

#1639..

[0071] FIG. 42 depicts the ethanes! production rate of the ABICyaiio l transformed with plasniid

#1640.

[0072] FIG. 43 depicts different variations of the components of the ethanologenic gene cassettes.

[0073] FIG. 44 depicts ceil growth, ethanol production and OD?so normalized ethanol production of ABICyaiio l with TK293 or #1578.

[0074] FIG. 45 depicts PDC and ADH activity in ABICyaiiol with T 293 or #1578.

[0075 j FIG. 46 depiets overlays of the curve progression in reg ard to cell growth, overlays of the curve progression, in regard to ethanol production, overlays of the curve progression in regard to the ethanol production rate and a comparison of the FDC and ADH activity between ABXCyanoi #1578 and ABICyaiiol TK293.

[0076] FIG. 47 depicts improved ethanol production and reduced acetaldehyde accumulation for ABICyaiiol #1578 in relation to ABICyaiiol TK293. The alterations in activity of PDC and synADH observed for ABXCyanoi #1578 enhanced ethanol productivity is ABICyanol by about 20-25%.

[0077] FIG. 48 depicts the higher ethanol production rate and lower growth for ABICyanol #1578 as compared to T 2 and shows that PDC regulates the partitionin of carbon fixed by photosynthesis into biomass and ethanol.

[0078] FIG. 49 depicts ethanol production in several ABICyano 1 strains including copper- inducible promoters controlling the pdc expression.

3.6 [0079] FIG. 50 depicts die ethanol production of ABICyanol TK293 < ABICyanol-6.8::PiiirA- PDC(optl )-PipsL-syiL4DH(optl)_ter) compared to ABICyanol TK4S3 (jpABICyanol- 6.8::PorS)221-zmPDC_(optl)dsrA-¾ c*(optRBS)-ADHI 1 i(ppt)_ter) in the presence and absence of 3 uM Cu ^2÷ ,

[0080 j FIG, 51 depicts sequenc reformation and annotation of endogenous copper indiicibie promoters Pori0316, Porf34 i 6, and zinc inducible promoters Porf31.26, Porfl07i (also

repressible by manganese),

[0081] FIG. 52 depicts a plasmid map with sequence annotation of T 480 (pABIeyano 1 -PmntC- zmPiX;(opti)dsrA-Prbc*{optRBS)-ADHi ί l(opt)_ter).

[0082| FIG, 53 depicts a plasmid map with sequence annotation for TK483 (pABIcyanol-

Pori¾221-zniPDC(optI)dsfA-Prbc*(optRBS)-ADHI 1 1(opt)_ier).

[0083] FIG. 54 depicts a plasmid map with sequence annotation for TK487 (pABIcyanol- Pori¾316-zmPDC( ptl)dsrA-Prbc*(optRBS)-ADHi i l(opt)_ter).

[0084] FIG, 55 depicts a plasmid map wim sequence annotation for TK4SS (pABIeyanol-PsigH- zmPDC(opt 1 )dsrA-Pi-bc*{optRBS)-ADH ! ! 1 (opf )_ier).

[0085] FIG. 56 depicts a plasmid map with sequence annotation for TK4S9 {pABIcyanol- Porfl 542-2mPDC{opt )dsrA-Prbc*( ptRBS)-ADHl 11 (opt)_ter).

[0QS6j FIG, 57 depicts a plasmid ma with sequence annotation for TK49G {jjABIcyanol- Porfi l26-zmPlX:{optl)dsrA-Prbc*(optRBS ADHl 1 l(opt)_rer).

[0087] FIG. SB depicts a plasmid map for T 504 (pABIcyanoi-Poi'fi)223-zmPDC(optl)dsrA- Prbc*(opfRBS)-ADHl 1 l(opf)_ter).

[0088] FIG. 59 depicts the ethanol production of TK4SG and #1770,

[0089| FIG, 60 depicts the ethanol production of TK488.

[0090] FIG, 1 depicts the ethanol production of TK4S9.

[0091] FIG. 62 depicts the ethanol production of TK490 and #1773.

[0092] FIG. 63 depict the ethanol production of TK4S7 and #1772.

[0093] FIG, 64 depicts the ethanol production of TK483 and #1771.

[0094] FIG, 65 depicts the ethanol production of T 504 and #1774.

[0095] FIG. 66 depicts PDC activity for TK483, TK4S7, TK504, #1771, #1772, and #1774 induced with diff erent amounts of copper. [09961 FIG. 67 depicts eopper-inducible strains such as #1771 (Psrsmi #1772 (P^mis) and #1774 (Pod!B223) as ¾¾ i as a zinc-inducible strain #1770 (Pm _B tc) exhibit a higher ethanol productivity than a nitrate inducible strain T 293 uses the sirA promoter.

[0097] FIG. 68 depicts that the PDC activity of stems #1770. #1771, #1772 and #1774 ware greater than TK293.

[0998] FIG. 69 depicts initial in uction with 1.6 M Cuf* (which, is about, five times the Cn ^2÷ concentration of BGI 1) followed by further copper additions different in all four treatments of T 4S7 for etkanol production,

[0099] FIG. 70 depict depicts initial induction with 1.6 μΜ u ^{" '} (which is about five times the Cu ^2" concentration of BGI 1) followed by fortlier copper additions different i all four treatments of TK487 for cell growth.

[0100] FIG. 1 depicts PDC activity in TK487 for the cultivation depicted in FIGs 70 and 1.

[0101] FIG. 72 depicts ethanol per cell density of induced TK487 for the cultivation depicted in FIGs 70 and 71.

[0102] FIG. 73 depicts the effect on ceii growth of releasing copper into solution over a prolonged period of time and at various concentrations of copper to a T 4S7 strain.

[0103] FIG. 74 depicts the effec o PDC activity of releasing copper into solution over a prolonged period of time and at various concentrations of copper to a T 487 strain.

[0194] FIG. 75 depicts the effect on ethanol production of releasing copper into solution over a prolonged period of t ime and at various concentrations of copper to a T 487 strain.

[0105] FIG. 76 depict the effect on ethanol production per OD _?¾ ) of releasing copper into solution over a prolonged period of time and at various concentrations of copper to a TK487 strain.

[01O6J FIG. 77 depicts the ethanol production over tirne of an ABICyanoi strain #17 1 incubated wit different bivalent metal-ions to test the specificity for copper- .

[0107] FIG. 78 depicts, the etliaiiol production over time of an ABICyanoi strain #1772

incubated with different bivalent metal-ions to test the specificity for copper.

[0108] FIG. 79 depicts the ethanol production over tirne of an ABICyano I strain #1774 incubated with, different bivalent metal-ions to test the specificity for copper .

[0109] FIG. 80 depicts both ethanologenic ABICyanoi strains T 441 and #1769 producing ethanol in growth media substantially lacking copper son while producing less ethanol in the presence of 3 μΜ copper ion. [0110] FIG, 81 depicts die activity of PDC in the iuiiajduced state and after 72 hours of induction for ABICyaiioi strains tensformed with the pksmids #1578. #1701. # 1658, #1697 and #1663,

[0111] FIG. 82 depicts the activity of PDC daring the course of a 30 day cultivation for

ABICyaaol steins transformed with the plasinids #1578, # 1658, #1697 and #1663.

[0112] FIG, 83 depicts OD7so»sr n rmalized ethanol production (% EtOH per ODTS&U _B ) during the course of a 29 day cultivation for ABICyanol strains transformed with the plasinids #1578, # 1658, #1697 and #1663.

[0113] FIG. 84 depicts the OD _755smi of a 30 day cultivation grown at 125|iE*in ^"2 *s ^"1 hi a 12h 12 day/night cycle.

[0114] FIG. 85 depicts the ethanol production in %(v/v) of an about 30 day cultivation grown at 125μΕ*ηι ^¾ *δ ^"1 in a 12h 12 day/night cycle.

[0115] FIG. 86 depicts depicts ADH and PDC activity in K293, 1578 and 1792,

[0116] FIG, 87 depicts total ethanoi production in TK293, 1578 and 1 92.

[0117] FIG, 88 depicts emanol production per OD?so in TK293, 1578 and 1792.

[0118] FIG. 89 depicts aeetaldehyde accumulation of TK293, #1578, #1749, and #1792.

[0119] FIG. 90 depicts ADH activity in TK293, #1578, # 49, and #1792,

[0120] FIG. 91 depicts specific PDC activity in varying amounts of aeetaldehyde added to the cells. Aeetaldehyde is completely coverted to ethanol within 1-2 hours.

[0121] FIG. 92 depicts ADH activity with or without the addition of acetaidehye (3 mM for 5 hours) for steins TK293. #1 78, #1749, and #1751 each having different ADH activity levels.

[0122] FIG. 93 depicts PDC activity wi th or without the addition of acetaidehye (3 mM for 5 hours) for strains TK293. #1578, #1749, and #1751 each having different ADH activity levels,

[01231 FIG. 94 depicts ADH activity of various expressed adh genes, some of which were codon improved for expression in ABICyanol .

[0124] FIG. 95 depicts the effect of ethanol productivity of various ethanologenic ABICyanol strains in growth media containing 1 % vol/vol ethanol.

[0125] FIG, 96 depicts that the ethanol production of ABICyanol strains 1790, 1791 , 1792, 1793, 1794, and 1795 was greater than that of TK293 after about day 10 to about day 31 of growth.

[0126] FIG. 97 depicts the PDC activity in dual PDC strain #1743 with and without induction of a second pdc gene by addition of 6 «M copper at about day 16 and the additional duction with 5 μΜ copper at about day 30. [0127] FIG, 98 depicts die total ethanoi production of strain #1743 with and without the induction of copper.

[0128] FIG. 99 depicts total ethanoi per OD750 of strain #1 43.

[0129] FIG. i00 depicts growth over 135 days and the addition of copper at days 48, 78 and 106 which caused a slight decrease in the rate of growth of ABICyanoi strain #1743 when compared to the control lacking copper in the growth media,

[0130] FIG. 101 depicts th production of ethanoi from strain #1743 over a period of 135 days.

[0131] FIG. 102 depicts the PDC activity in ABICyanoi strain #1743 cells ove the course of about 135 days.

[0132] FIG. 103 depicts ethanoi per OD750 of strain #1743 that was grown for about 135 days and was diluted at about days 48. 78 and 106. As depicted in FIG. 103 the induction of the pdc gene by introduction of copper into the growth media results in an incr ease in the amount of ethanoi produced per OD ₇₅₀ of ABICyan i strain #1743 when compared to the ABICyan i strain #1743 grown in media lacking copper.

[0133] FIG. 104 depicts the results of various transformation experiments via homologous recombination (HR) events in ABICyanoi.

[0134] FIG. 105 depicts a piasmid map of T 471 (pABICyano ί ::pilT- PrbcLABICyanol_Km* *pilC-sacB-oriVT)

[0135] FIG. 106 depicts the piasmid map of TK541 (oriW_f e-up_PrbcL-Gm**_fl.v3-dows).

[0136] FIG. 107 depicts a DNA agarose gel of a PCR reaction using two PCR primers including one primer specific for the geniamycin resistance gene and the other primer binding within the genome of ABICyanoi.

[0137] FIG. 108 depicts a piasmid map of TK554 (4oriVTfiv3-«pPorS>223ABICyano 1 - zmPDCABICyano 1 (opt)dsrA-Prbc*(opiRBS>ADH of figure 66B(ABIC^anol)Prbd_Gm**fiv3- down).

[0138] FIG. 109 depicts a piasmid map of 1X552 (oriVT_flv3-iip_PcpcBABICyano - Gffl* *_fiv3 - down) .

[0139] FIG. 110 depicts an agarose gel with lane "1" and "2" being a PCR reaction performed with primers specific for the gene frv3.

[0140] FIG. I l l depicts a piasmid map of TK540 (oriVT_|:iilT-iip_PrbcL-Gni* *_piiC-down). [0141] FIG, 112 is an image of a 0.8% DNA agarose gel that depicts single and double cross over integration of the TK540 plasmid into the genome of ABI yanol as detected by PCR with primer specific for regions outside the pilT pilC region,

[0142] FIG. 113 depicts data for various raiisforniatioji experiments via homologous

recombination.

[0143] FiG, 114 depicts PCR-based segregation analysis shows that an ABICyanol organism transformed with construct TK552 (pQii\^_iIv3-up_PcpcB-Gm* *_i]v3-dowii) successfully integrated an antibiotic resistance marker gene (Gm**) into to the fiv3 gene in me chromosome of ABICyano l and confirms complete segregation of TK552, 5 for all chromosome copies.

[01441 FIG, 115 depicts PCR-based segregation analysis shows that an ABICyanol organism transformed with construct 1X616 C Qi r ^* cS7-i^_F T-Pc cB-Gni**- ei-FRTj¾i37-do m) successfully integrated an antibiotic resistance marker gene (Gm**) into to fee yc£3? gene in the chi'OiBosonie of ABICyanol and confirins complete segregation of TK616.5 for ail chromosome copies.

[0145] FIG. 116 depicts PCR-based segregation analysis show s that an ABICyanol organism transformed with construct 1X597 (pOriVT_argH-up_FRT-PcpcB-Gm* *-ter-FRT_argH-down) successfully integrated an antibiotic resistance marker gene (Gm**) into to the argH gene in the chromosome of ABICyanol. FIG, 116 also depicts auxotrophy for argi ine of the ABICyanol

1X597 strains tested by growing o a BG11 agarose plate lacking arginine.

[0146] FIG. 117 depicts ethanol production of ABICyanol strains whose ethanologenic capacit was created by homologous recombination using constructs #1817. #1818, #1819 and #1820.

[0147] FIG. 118 depicts a plasmid map of and sequence annotation of plasmid #1658

(pABIcyanol-PiarA2-ziiiPDCCapt3)-dsrA-Ps¾c(optRBS)-synADHoo p),

[0148] FIG, 119 depicts a plasmid map of and sequence annotation ofp!asmid #1663

(pABIeyanoi-P rA*4-zinPlX^

[0149] FiG. 120 depicts a plasmid map of #1697 ^ABIcyanoI-PnirA*3-zmPDC(opf3)-dsrA- Prbc*(optRBS)-synADHoop).

[0150] FIG, 121 depicts copper-promoter variants with improved RBS.

[0151] FIG. 122 depicts copper-promoter' valiants with improved -10 region.

[0152] FIG. 123 depicts, optimized. Porf3126* (PsmtA) promoter valiant derived from

ABICyanol Porf312 used to control PDC activity in construct 1X490,

[0153] FIG, 124 depicts PDC activity in Z ² * induced ABICyanol strains T 490 and #1762, [0154] FIG, 125 depicts a plasmid map with sequence annotation of plasmid #1646 (pABIcyanol -l¾kA-zn^DC(opf 1 )dsrA-Prbc*(optRBS)-ADHl 11 (opi)_fer

[0155] FIG. 126 depicts a plasmid map with sequence annotation of plasmid #1762 (pABIcyaaol-Pori3126*-zmPDC(opti)dsrA-Pfbc*(optRBS)-ADHi 1 l(opi)\ter.

[&156| FIG, 127 depicts a plasmid map with sequence annotation of plasmid #1753 (pABIcyaiiol -PiarA-zii*IX;(optl)_dsrA-Prbc*{optRBS)-Adlii 1 1 _fer).

[0157] FIG. 128 depicts a plasmid iiiap with sequence annotation of plasmid #1754 (pABIeyanoI-Pnh A-zo^

[0158] FIG, 129 depicts a plasmid map with sequence annotation of plasmid #1735

(pABIcyanol -PtnrA-zmP DC(opt 1 )_d¾rA-Pr c*(opfRBS)-Adhl694_ter).

[0159] FIG. 130 depicts a plasmid map with sequence annotation of plasmid #1749

(pABIeyano 1 -Pnii -ζηιΡΙ ( ρί3)^ΓΑ-ΡφΛ*4-8>ιιΑΟΗ ο ).

[0160] FIG, 131 depicts a plasmid map with sequence antiotation of plasmid #1790

[0161] FIG. 132 depicts a plasmid iiiap wit sequence annotation of plasmid #1791

(pABIc aiiol-PmrA-zniPDC(of>f3)ysrA-PcpcB-ADHi 1 i(opt)JrbcS).

[0162] FIG, 133 depicts a plasmid map with sequence annotation of plasmid #1792

[0163] FIG. 134 depicts a plasmid map witli sequence annotation of plasmid #1793 (pABIcyanol-ftnrA-zii^^

[0164] FIG. 135 depicts a plasmid map with sequence annotation of plasmid #1794 (pABIcyaael -¾fiA-zi«PDC(^^^

[0165] FIG. 136 depicts a plasmid map with sequence annotation of plasmid #1795 (pABIcyanol -PimA-ziii_PD£¾o t^

[0166] FIG. 137 depicts a plasmid map with sequence annotation of plasmid #1803 (pABIeyano 1 -Pnh A-zinPDC(opi i) dsrA-PepcB-Ad¾ 1520_ter).

[0167] FIG, 138 depicts a plasmid map with sequence annotation of plasmid T 539 (oiiVT_flv3_up_Pr cL-Kin* *_fl v3_down) .

[0168] FIG. 139 depicts a plasmid map with sequence annotation of plasmid ΤΚ54Ϊ (oriVT_flv3_ jp_Pi-bcL-Gi i**_flv3_down},

[0169] FIG, 140 depicts a plasmid map with sequence annotation of plasmid TK552 (oii\T_tlv3_up_PcpcB- Gm* * _fiv3 _down) . [0170] FIG, 141 depicts a plasmid map witli sequence amiotadoa of plasmid TK 17

(oriVT_fl v3_ap_ 1 kb_FRT-PcpcB-Gni* *-tB001 -F T-flv3_down_ 1 fcb) ,

[0171] FIG. 142 depicts a plasmid map with sequence annotation of plasmid TK6I8

[0172] FIG, 143 depicts a plasmid map witli sequence annotation of plasmid TK61

[0173] FIG. 144 depicts plasmid map wit sequence annotation of plasmid TK.572

(ooVT_recJ_iip_FRT-PcpeB-Giii**-tB001 -FRT_recJ_down).

[0174] FIG, 145 depicts a plasmid map with sequence annotation of plasmid T 567

(OTi\ _recJ2_^J^RT-PcpcB jm**-tB0014-FRT_i^2_dowii).

[0175] FIG. 146 depicts a plasmid map wit sequence annotation of plasmid T 596

(oiiW_narB_up_FRT-PcpcB-Gm**-tBiH>14-FRT_narB_dow¾^

[0176] FIG, 147 depicts a plasmid map with sequence annotation of pksmid TK597

(oriW_argH_t¾3_FRT-PcpcB-Gm* *-ΐΒ00 ϊ 4-FRT_argH_down).

[0177] FIG. 148 depicts a plasmid map wit sequence annotation of plasmid TK598

(oriVTJe«B jp_FRT-PcpcB-Gm**-iB0014-FRTJeuB_down).

[0178] FIG, 149 depicts a plasmid map with sequence annotation of plasmid T 16

(ori\¾/cB7_iip_FRT-PcpcB-Gni**-iB0014-FRT_yct¾7_down).

[0179] FIG. 150 depicts a plasmid map with sequence annotation of plasmid #1932

(pABIc anolPairA*2-2raPDC(opt3)\dsi-A-PcpcB-ADHl 1 l(opt)_tt¾cS).

[0180] FIG. 151 depicts a plasmid map with sequence annotation of plasmid #1933

[0181] FIG. 152 depicts a plasmid map with sequence annotation of pksmid #1934

(pABIcyanol -PmrA*2-zmPDC(optl ) dsrA-PcpcB-ADHi.520(opt)_trbcS).

[0182] FIG. 153 depicts a pksmid map with sequence annotation of plasmid #1935

(pABIeyanoI-Porf&S 16-zmPEiC(opt3)\dsrA-PepcB-ADHl 1 l(opt)_trbcS).

[0183] FIG. 154 depicts a plasmid map with sequence annotation of pksmid # 1936

(pABIcyanol-PorflB 16-zmPDCXopt3) dsrA-PcpcB-Adli9 i6(opt)_trbcS).

[0184] FIG. 155 depicts a plasmid map with sequence annotation of plasmid #1937

(p ABIeyaiio: I -Poif 0316-ZHiPD^ [0185] FIG, 156 depicts a p sniid map witli sequence annotation of piasmid #1 43

zrnPDC(opi Ϊ >dsrA) .

[0186] FIG. 157 depicts a piasmid map with sequence ann.otati m of piasmid #1817

(pfiv3 : :PmrA-zmPDC(optl )_dsrA-Pi½*(opt BS)-syiiADil\oop-PrbcL-Gm**)- [0187] FIG. 158 depicts a piasmid ma wiih sequence annotation of piasmid #1818

(pf '3::Porf0316-zmPDC(opt 1 )^iA-PAc*(optlffiS)-syiiADH\oop-PrbcL-GiH**).

[0188] FIG. 159 depicts a piasmid map with sequence annotation of piasmid #1819

[0189] FIG. 160 depicts a piasmid map with sequence annotation of piasmid #1820

(pilv : :Pori¾316-miPDC(opt l)_dsiA-ft^

[0190] FIG. 161 depicts a piasmid map with sequence annotation ofplasmid #1744

(pABIcyMM) 1 -PiikA-z^^

zmPDC(optl)\dsrA).

[0191] FIG. 162 depicts the ethanologenic acttivily of ABICyanol comprising #! 772 with the endogenous copper-mducible promoter Porf0316 tested with 20xC¾ (6μΜ Cxi ¹ *} at a start OD of 2 either grown with, aii-monia urea (2mM each) or nitrate (BGl 1 recipe) as the sole nitrogen soarce.

[0192] FIG. 163 depicts PDC activity of strains #1578, #1743 and #1744 tested with and withou induction by nitrate and copper (#1578 and #1743) and with and thout induction by nitrate and zinc pi 744).

[0193] FIG. 164 depicts the growth of TK293 (OD at 750nm) over about 120 days.

[0194] FIG. 165 depicts ethanol production of T 2 3 and PDC activity of 1X293 over about 120 days of cultivation.

DETAILED DESCRIPTION

[0195] Disclosed herein is an isolated strain of the Cyem&bacteriam genus, Cycmobacterhim sp. ABICyanol (referred to herein as ABICyanol) as well as genetically enhanced, non-naturally occurring ABICyanol organisms. Genetically enhanced non-namrally occurring ABICyanol organisms disclosed herein are useful for the production of compounds of interest such as ethanot, for example, ABICyano 1 has been analyzed by DNA sequencing and is a member of the genus C anabacterium. Cyanob cter i sp. include several species and strains and have been found in a variety of environments including thermal mats in Italy (Moro. ef al, 2007. Algological Studies. 123: 1-15 ) .

[0196] A deposit of Cvanobacteritm sp. strain ABICyaaol {ABICyanoi), disclosed herein and recited in the appended claims, has been made with t e Americas Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, Va, 201 10. The date of deposit was November 7, 2012. The ATCC accession number is PTA-13311. The deposited Cyanob cierium sp. strain ABICyanoi is not genetically enhanced. The deposit includes 25 2-niL vials, each containing about 1 ,5 ml, of cryopreserved cyanobacterial cells at a concentration of about 2.39 xlO" cells per iiiL. To satisfy the enablement requirements of 35 U.S.C. 112. and to certify thai the deposit of the present invention meets the criteria set forth in 3 CFR 1.801-1.809, Applicants hereby make the following statements regarding he deposited Cyanobacierium sp. strain ABICyanoi

(deposited as ATCC Accession No. FTA-13311);

[0197] I, During the pendency of this application, access to the invention will be afforded to the Commissioner upon request:

[0198] 2. Upon granting of the patent the deposit will be available to the public under conditions specified in 37 CFR 1.808;

[0199] 3. The deposit will be maintained in a public repository for a period of 30 years or 5 years after the last request or for the effective life of the patent, whichever is longer;

[0200} 4. The viability of the biological material at the time of deposit was tested (see 37 CFR

1,807); and

[0201] 5. The deposit will be replaced if it should ever become unavailable.

[0202] Access to this deposit will he available during the pendency of this application to persons detemiiiied by the Consnissioner of Patents and Trademarks to be entitled thereto under

37 C.F.R. § 1.14 and 35 U.S.C. § 122. Upon granting of any claims in this application, all restrictions on the availability' to the public of the variety will be irrevocably removed by affording access to a deposit of a sufficient amount of eryopreserved cyanobacterial cells of the same variety with the ATCC.

Definitions

[0203] Aspects of the disclosiiie encompass techniques and methods well known in molecular biology, microbiology arid cell culture. Laboratory references for tiiese types of methodologies are readily available to those skilled in the art. see, for example. Molecular Cloning: A Laboratory Manual (Third Edition), Sambreok. J., et at (2001) Cold Spring Harbor Laboratory Press: Qjrrent Protocols n Microbiology (2007) Edited by Coico, R, et al. _s John Wiley and Sons. Inc.; The Molecular Biology of Cyanobacteria (1994) Donald Bryant (Ed ), Springer

Netherlands; Handbook Of Mieroalgal Culture Biotechnology And Applied Phycology (2003) Richmond, A.; (ed,), Blackwell Publishing; and "The Cyanobacteria, Molecular Biology, Genomics and Evolution". Edited by Aatouia Herrero and Enrique Mores, Caister Academic Press, Norfolk, UK, 2008.

[0204] It is well known to a person of ordinary skill in the art that large plasxnids can be produced using techniques sacli as the ones described in th US patents US 6,472,184 B l titled "Method for Producing Nucleic Acid Polymers" and US 5,750,380 titled "DNA Polymerase Mediated Synthesis of Double Stranded Nucleic Acid Molecules", which are hereby incorporated by reference in their entirety,

[0205] Genes are disclosed as a thre letter lower case name followed by a capitalized letter if more than one related gene exists, for example nirA. The respective protein encoded by that gene is denominated by the same name with the first letter capitalized, suc as NirA, or all letters are capitalized.

[0206] Promoter sequences, which control the transcription of a gene, are given by capitalized letter "F" followed by the subscripted gene name according to the above described nomenclature, for example "Ρ _ΒΪ ,-Α" for the promoter controlling the transcription of the nirA gene. Promoter sequences may also be referred to without the gene name being subscripted, for example

"PnirA".

[0207] Enzyme names can be given in a two or three letter code indicating the origin of the enzyme, followed by the above mentioned three letter code for the enzyme itself, such as SynAdh (Ζ ^η2τ dependent Alcohol dehydrogenase from S nechocystis PCC 6803), ZmPdc (pyruvate decarboxylase from Zymomem s mobtiis).

[0208] Ail publications and patent applications mentioned in this specification are herein incorporated by reference to the sam extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0209] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood b a person skilled in the art to which this disclosure belongs. As used herein, the following terms have the meanings ascribed to them unless specified otherwise. [0210] The tens "about" is used herein to meat} approximately, in the region, of, roughly, or around. When tiie term "about' ^* is used in conjunction with a numerical value/range, it modifies that value/range by exte ding the boundaries above and below the numerical value(s) set forth. In general, the term " out" is used herein to modify a numerical vahte(s) above and below the stated vaiue(s) by a variance of 20%.

[0211 j The term "Cyanobacteria" refers to a member from the group of photoautotrophic prokaryotic microorganisms which can utilize solar energy and fix carbon dioxide. Cyanobaeteria are also referred to as bhie-greeii algae.

[0212] The ^' term " enniijator" refers to a nucleic acid sequence, at which the transcription of a rnRNA stops. Non- nitiiig examples are dsrA from Escherichi call (E. call), the oop terminator or the rho teniiiiiator.

[0213] The term "Cyanob cierium sp, ^' "" refers to a. member of the genus Cyanobaet&ium, as, for example, characterized by Rippka et al. ₅ 1983. Ann. Microbiol. (Inst. Pasteur) 134B: 32.

[0214] The term "BG-1 1" or "BGi Γ" refers fo a growth media used for growing cyanobacterial species as disclosed in Rippka, R., et ai. "Generic Assignments. Strain Histories and Propeities of Pure Cultures of Cyanobaderia. ^* ' (1979) J. Gen, Microbiol. I l l; 1-61.

[02Ϊ5] The term "aiBG-l Γ' or 'iiiBGl 1" refers to marine BGI 1 and in may alternatively be referred to as marine medium. mBGl 1 has from about 30 to abou 38 psu {practical salinity units).

[0216] The terms "'host cell" and "recombinant host ceil" include a cell suitable for metabolic manipulation including, but not limited to, incorporating heterologous polynucleotide sequences and can be transformed. Host cell and recombinant host cell includes progeny of the cell originally transformed. In particular embodiments, the cell is a. prokaryotic cell, such as a cyanobacterial ceil. The term recombinant host cell is intended to include cell that has already engineered to aw desirable propeities and is suitable for further enhancement usin the

compositions and methods disclosed herein.

[0217] The term "shuttle vector' refers to a vector, such as a plasmid, which can propagate in different host species. For example, a shuttle vector with a cyanobacterial origin of replication can be replicated and propagated in different cyanobacterial genera such as Cycmob cterhtm, Symchococcus, and Synechocysiis, Alternatively, or additionally, a shuttle vector may also contain an origin of replication for different phyla of bacteria such as Enf robacteri ceae and Cyanobacteria, so that cioning genefic enhancements can performed in E, co!i and the recombinant plasrnid can be expressed½iaintaiiied in cyanobacterial hosts. For example, in the latter case, in certain embodiments, the shuttle vector is either a broad host range vector whose origin of replication is recognized by E, coli and cyanobacteria. or a plasmid which contains at least two different origins of replication for the appropriate organism,

[0218] The term "genome" refers to th chromosomal genome as well as to extraehromosonial plasm ds ^' which are nonnally present in wild type cyanobacteria without having performed recombinant DNA technology..

[0219] "Competent to express" refers to a host cell thai provides a sufficient cellular environmeiit for expression of endogenous and/or exogenous polynucleotides.

[0220] As used herein, the term "genetically enhanced" refers to any change in the endogenous genome (chromosomal and plasmidial) of a wild type cell or to the addition of non-endogenous genetic code to a wild type cell, e.g., the uitrodection of a heterologous gene. Changes to the genome of various organisms disclosed herein are made by the hand of man through the use of various recombinant polynucleotide technologies and other techniques such as mu genes s* for example. Included in changes to the genomes are changes in protein coding sequences or nonprotein coding sequences, including regulatory sequences such as promoters, enhancers or other regulators of transcription.

[0221] The nucleic acids disclosed herein may be modified and/or contain non-natural nucleotide bases,

[0222] As used herein, '"substantially similar" refers to nucleic acid fragments wherein changes in one or more nucleotide bases results in substitution of one or more amino acids, but do not affect the functional properties of the protein encoded by the DNA sequences. In certain embodiments, changes in one or more nucleotide bases do not change the encoded amino acid. Substantially similar also refers to modifications of the nucleic acid fragments such as

substitution, deletion or insertion of one or more ucleotide bases that do not substantially affect the functional properties of the resulting transcript.

[0223] As used herein, in certain embodiments, homologous nucleic acid sequences are about 60%. 65%, 68%, 70%, 75%,S©%, 85%. 90%, 91%. 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99,5%, 99,9%, 99.95% or even higher' identical to nucleic acids disclosed herein.

[0224] The percentage of identity of two nucleic acid sequences or two amino acid sequences can be determined using the algorithm of Thompson et al, (CLUSTAL , 1994 Nucleic Acid

Research 22 : 4673-4, 680). A nucleotide sequence or an amino acid .sequence can also be used as a so-caJled "quer sequence" to perform a search against public nucleic acid or protein sequence databases in order, for example, to identify further unknown homologous sequences, which can also be used in embodiments of this disclosure. Such searches can be performed using the algorithm of Kariiii aad Alisehul (1999 Proceedings of the National Academy of Sciences U.S.A. 87: 2.264 to 2,268), modified as in Kariiii and Aitschui (1993 Proceedings of the National Academy of Sciences U.S.A. 90: 5,873 to 5,877). Such an algorithm is incorporafed in the NBLAST and XBLAST programs of Aiischul et al. (1999 Journal of Molecular Biology 215: 403 to 410). Where gaps exist between two sequences, gapped BLAST can be utilized as described in A!tsckil et at (1997 Nucleic Acid Research, 25: 3,389 to 3,402)...

[0225] "Recombinant" refers to polynucleotides synthesized or otherwise manipulated m vitro or in vivo ("recombinant polynucleotides") and to methods of using recombinant polynucleotides to produce gene products encoded by those polynucleotides in cells or other biological systems. For example, a cloned polynucleotide may be inserted into a suitable expression vector, such as a bacieiial plasiiiid. and th plasmid can be used to transform a. suitable host ceil. A host cell that comprises the recombinant polynucleotide is referred to as a "recombinant host cell" or a

"recombinant bacterium" or a. ^' "recombinant cyanobacteiia." The gene is then expressed in the recombinant host cell to produce, e.g., a 'Recombinant protein." A recombinant polynucleotide may serve a non-coding function (e g,, promoter, origin of replication, ribosonie-bindiiig site, etc.) as well.

[0226] The term ^s, n©n-naturally occurring", when used in reference to a microbial organism or microorganism herein is intended to mea that the microbial organism has at least one genetic alteration not normally found in a naturally occ ring strain of th referenced species, including mild-type strains of the referenced species. Genetic alterations include, for example,

modifications introducing expressible nucleic acids encoding metabolic polypeptides, other nucleic acid additions, nucleic acid deletions and or other functional disruption of the microbial organism's genetic material. Such modifications include, for example, coding regions and functional fragments thereof, for heterologous, homologous or both heterologous and

homologous polypeptides for the referenced species. Additional modifications include, for example, non-coding regulatory regions in which the modifications alter expression of a. gene or operon such as regions associated with promoters, for example. Exemplary metabolic

polypeptides include enzymes or proteins within an ethanologenic biosyntlietic pathway resulting in the production of emanol by a non-naturally occurring organism. [0227] The term "recombinant nucleic acid molecule" includes a nucleic acid molecule (e.g., a DNA molecule) thai has been altered, modified or engineered such that it differs in nucleotide sequence from the native or natural nucleic acid molecule from which the recombinant nucleic acid molecule was derived (e.g., by addition, deletion or substitution of one or more nucleotides-).

[0228] The term '¾ansfomiation' ^' is used herein to m an the insertion of heterologous genetic material into the host cell Typically, the genetic material is DNA on a piasmid vector, but other means can also be employed. General transformation methods and selectable markers for bacteiia and cyanobacteria are known in fee art (Wirrh, Mol Gen Genet. 216: 175-177 (1989);

oksharova. Appi Microbiol Biotechnol 58:123-137 (2002). Additionally, transformation methods and selectable markers for use in bacteria are well known (see. e.g., Samfarook et al, supra).

[0229] The term "homologous reeonife ation'' refers to the process of recombination between two nucleic acid molecules based on nucleic acid sequence similarity. The term embraces both reciprocal and noiireeiprocal recombination (also referred to as gene conversion), hi addition, the recombination can be the result of equivalent or non- equivalent cross-over events. Equivalent crossing over occurs between two equivalent sequences or chromosome regions, whereas nonequivaient crossing over occurs between identical (or substantially identical) segments of nonequivalent sequences or chromosome regions. Unequal crossing over typically results in gene duplications and deletions. For a description of the enzymes and mechanisms involved in

homologous recombination see Court et al, "Genetic engineering using homologous

recombination," Annual Review of Genetics 36:361-388; 2002.

[0230] The 'term "non-homologous or random int gration" refers to any process by which DNA is integrated into the genome that does not involve homologous recombination. It appears to be a random process in which incorporation can occur at any of a large number of genomic locations.

[0231] The term "vector" as used herein is intended to refer to a nucleic acid molecule

(polynucleotides and oligonucleotides) capable of transporting another nucleic acid to which it has been linked. One type of vector is a. ^£< plasiind." which generally refers to a circular double stranded DNA molecule into which additional DNA segments may be ligated, but also includes linear double-stranded molecules such as those resulting from, amplification by the polymerase chain reaction (PGR) or from treatment of a circular p!asmid with a restriction enzyme.

[0232] Some vectors are capable of autonomous replication in a hos cell into which they are introduced (e.g., vectors having an origin of replication wh h iimcfioiis i the host cell). Other vectors can be integrated into the genome of a host cell upon introduction into the host cell, and are thereby replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which fluey are operatively linked. Sach vectors are referred to herein as "recombinant expression vectors" (or simply "expression vectors").

[0233] The term "'promoter' ^" is intended to include a polynucleotide segment that can transcriptionally control a gene of interest, e.g.. a pyruvate decarboxylase gene that it does or does not transcriptionally control m nature. In one embodiment, the transcriptional control of a promoter results in an increase in expression of the gene of interest. In an embodiment, a promoter is placed 5 ^! to the gene of interest, A heterologous promoter can be used to replace the natural promoter, or can be used in addition to the natural promoter. A promoter can be endogenous with regard to the host cell in which it is used or ft can be a heterologous polynucleotide sequence introduced into the host cell, e.g. , exogenous with regard to the host eel i which it is used. Promoters may also be inducible, meaning that certain exogenous stimuli (e.g., nutrient starvation, heat shock, mechanical stress, light exposure, etc..) will induce the promoter leading to the transcription of an operably linked gene.

[0234] The phrase "operably linked" means thai the nucleotide sequence of the nucleic acid molecule or gene of interest is linked to the regulatory sequencers), e.g., a promoter, in. a manner which allows tor regulation of expression (e.g., enhanced, increased, constitutive, basal, attenuated, decreased or repressed expression) of the nucleotide sequence and expression of a gene product encoded by the nucleotide sequence (e.g., when the recombinant nucleic acid molecule is included in a recombinant vector, as defined herein, and is introduced into a iiiicrocfrgaiiism) .

[0235! The term "gene" refers to an assembly of nucleotides mat encode for a polypeptide, and includes cDNA and genomic DNA nucleic acids. "Gene" also refers to a nucleic acid fragment that expresses a. specific protein or polypeptide, including regulatory sequences preceding (5 ^! non-coding sequences) and following (3 ^! non-coding sequences) the coding sequence.

[0236! The term "exogenous ^** as used herein is intended to mean mat the referenced molecule or the referenced activity is introduced into the host microbial organism. The molecule can be introduced, for example, by introduction of an encoding nucleic acid info the host cell genetic material such as by integration into a host chromosome or as non-chromosomal genetic material such as a plasmkl. Therefore, the term as it is used m reference to expression of an encoding nucleic acid refers to introductioti of the encoding nucleic acid in an expressible form into the microbial organism. When used in reference to a bimyntiietic activity, the terrn refers to an activity that is introduced into the host reference organism. The source can be, for example, a homologous or heterologous encoding nucleic acid that expresses fee referenced activity following introduction into the host microbial organism. Therefore, the term "endogenous" refers to a referenced molecule or acti vity that is present in the host. Similarly, the temi w en used in reference to expression of an encoding nucleic acid refers to expressi on of an encoding nucleic acid contained within the microbial organism. The term "heterologous" refers to a molecule or activity derived from a source other than the referenced species whereas "homologous" refers to a molecule or activity derived from the host microbial organism. Accordingly, exogenous expression of an encoding nucleic acid of the invention can utilize either or both a heterologous or homologous encoding nucleic acid,

[0237] The term "fragment" refers to a nucleotide sequence of reduced length relative to the reference nucleic acid and comprising, over th common portion, a nucleotide sequence

substantially identical to the reference nucleic acid. Such a nucleic acid fragment according to the disclosure may be included in a larger polynucleotide of which it is a constituent. Such fragments comprise, or alternatively consist of, oligonucleotides ranging in length from at least about 6 to about 1500 or more consecutive nucleotides of a polynucleotide according to th disclosure.

[0238] The term "'open reading fr ame" abbreviated as "OEi," refers to a length of nucleic aci d sequence, either DNA, cDNA. or RNA that contains a translation start signal or initiation codon, such as an A.TG or AUG. and a tenumation codon and can be potentially translated into a polypeptide sequence.

[0239] The ^' term "upstream" refers to a nucleotide sequence that is located 5* to a reference nucleotide sequence. In particular, upstream nucleotide sequences generally relate to sequences that are located on the 5 ^* side of a codi g sequence or starting point of transcription. For example, most promoters are located upstream of the start site of transcription.

[0240] The team "downstream" refer s to a nucleotide sequence that is located 3' to a reference nucleotide sequence. In particular, downstream nucleotide sequences generally relate to s equences that follow th stalling point of transcription. For example, the translation initiation codon of gene is located downstream of the start site of transcription.

[0241] The terms "restriction endonuciease" and. "restriction enzyme" refer to an enzyme that binds and cuts within a specific nucleotide sequence within double stranded DNA. [0242] Tlie tens "expression" as used herein, refers to the transcription and stable accumulation mRNA derived from a nucleic acid or polynucleotide. Expression may also refer to translation of RNA into a protein or polypeptide. Expression may also be used to refer to the process by which a gene's coded herniati n is converted into the structures and functions of a cell, such as a protein, transfer RNA, or libosonial RNA.

[0243] Ail "expression cassette" or "construct" ^' refers to a series of polynucleotide elements that permit transcription of a gene in a host cell. Typically, the expression cassette includes a

promoter and a heterologous or native polynucleotide sequence that is transcribed. Expression cassettes or constructs may also include, e.g.. transcription tenninat ion signals, polyadenylatios signals, and enhancer elements.

[0244] The term "codon bias" refers to the fact that different organisms use different codon frequencies.

[0245] The term "codon improwment" refers to the modification of at least some of the codons present in a. heterologous gene sequence from a triplet code that is not generally used in tlie host organism to a triplet code thai is more common in the particular host organism. This can result in a higher expression level of the gene of interest. The term "codon improvement ^'5 can also he used synonymously with codon opt imization.

[0246] Tlie term "'reporter gene" refers to a nucleic acid encoding an identifying factor that can be identified based upon the reporter gene's effec in order to determine or confirm that a cell or organism contains the nucleic acid of interest, and/or to measure gene expression induct on or transcription.

[0247] The 'term "selectable marker" means an identifying factor, usually an antibiotic or chemical resistance gene, that is abl to be selected for based upon the marker gene's effect, such as resistance to an antibiotic, resistance to a herbicide, colorimetiic markers, enzymes, fluorescent markers, and the like, wherein the effect is used to tr ack the inheritance of a nucleic acid of interest and/or to identify' a cell or organism that, lias inherited tlie nucleic acid of interest.

[0248] A "heterologous protein"' refers to a protein not naturally produced in the cell.

[0249] An 'I lated polypeptide" or "isolated protein" is polypeptide or protein that is substantially free of those compounds that are nonnaliy associated therewith in its natural state (e.g., other proteins or polypeptides, nucleic acids, carbohydrates, lipids).

[0250] An "'isola ted organism" is an organism that i substantially See of other organisms that are normally associated therewith in it natural state. [0251] The term "tolerate ¹ ' refers to the ability of an organism to continue to gr ow after exposure to a condition. In one embodiment , "tolerate" ^' is defined as the ability of an organism to grow after being exposed to an environmental condition after being exposed to me co dition for at least 2 hours per day over a time period of at least 7 days. In another embodiment, "tolerate" is synonymous with withstand. In an embodiment ability of an organism to tolerate environmental conditions is refereed to as "hardiness".

[0252] A "variant" of a polypeptide or protein is any analogue, fragment, derivative, or mutant which is derived from a polypeptide or protein and which retams at least one biological property of the polypeptide or protein. Different variants of the polypeptide or protein may exist in nature. These variants may be allelic variations characterized by differences in the nucleotide sequences of the structural gene coding for the protein, or may involve differential splicing or posf- translationai modification. The skilled artisan can produce variants having single or multiple amino acid substitutions, deletions, additions, or replacements.

[0253] As used herein, the term "VLE' ^* stands for vapor-liquid equilibrium. VIE is a method of determin ig ethaiiol concentration in a medium by measuring the ethanoi concentration in a vapor over the medium. VLE relies upon the vapor pressure of eihanol in a medium and other variables such as temperature and exchange of other gasses in the vapor. In one embodiment, ethanot concentration of the vapor phase over the mediom is measured by gas chromotagraphy. hi another embodiment, Raman spectroscopy, infrared spectroscopy and other spectrographs analyses may be performed in order to detemime the concentration of a compound of in terest i the vapor phase over a medium.

[0254] As used herein, the phrase "increased activity'" ^' refers to any genetic modification resulting in increased levels of enzyme function in a host cell. As known to one of ordinary skill in the art, in certain embodiments, enzyme activity may be increased by increasing the level of

transcription, either by modifying promoter function or by increasing gene copy number, increasing transJationai efficiency of an enzyme messenger RNA, e.g., by modifying ribosomal binding, or by increasing the stability of an enzyme, which increases the half-life of the protein, leading to the presence of more enzyme molecules in the ceil. All of these represent non-limiting examples of increasing the activity of an enzyme, see for example. mRNA Processing and

Metabolism: Methods and Protocols, Edited fay Daniel R. Schoenberg, Humana Press Inc., Toiowa, N.J.: 2004: ISBN 1-59259-750-5; Prokaryotic Gene Expression (1999) Baumberg, S... Oxford University Press, ISBN 01 9636036; The Biomedical Engineering Handbook (2000) Bronznio, J. D., Springer, ISBN 354O66808X, all of which are incorporated by reference.

[0255] T e terms "pyruvate decarboxylase", "Pdc" and "PDC" refer to an enzyme that catalyzes the decarboxylation of pyruvic acid to acetaideliyde and carbon dioxide. A "pdc gene" refers to the gene encoding an enzyme that catalyzes the decarboxylation of pyruvic acid to acetaideliyde and carbon dioxide.

[0256] The terms "'alcohol dehydrogenase", "Adh" and "ADH" refer to an enzyme that catalyzes the mterconversion between alcohols and aldehydes or ketones. An "adh gene" refers to the gene encoding an enzyme that, catalyzes the iiitei conversion between alcohols and aldehydes or ketones.

[0257] The term "pdc adli" refers to the pdc and adh genes collectively. A "pdc/adli cassette" refers to a nucleic acid sequence encoding a PDC enzyme and an ADH enzyme.

[0258] The term "ethanologeiiic cassette" refers to any polynucleotide sequence thai encodes for enzymes capable of producing ethanol alone or hi combination with other exogenous or endogenous enzymes. In a certain embodiment, an ethanologeuic cassette comprises genes encoding for an akohoi dehydrogenase and a pyruvate decarboxylase. In another embodiment, an ethanotogenic cassette comprises genes encoding for a biftme&aaal alcohol/aldehyde

dehydrogenase. In certain embodiments, an emanologenic cassette comprises genes encoding for enzymes that are pari of a biochemical pathway to generate precursors for alcohol

dehydrogenases and pyruvate decarboxylases of an ethanoiogenic cassette.

[0259] The term "prioier" is an oligonucleotide that hybridize to a target nucleic acid sequence to create a double stranded nucleic acid region that can serve as an initiation point for DNA synthesis under suitable conditions. Such primers may be used in a polymerase chain reaction.

[0260] The term "polymerase chain reaction," also termed "PCR," refers to an in vitro method for erizymatically amplifying specific nucleic acid sequences, PGR involves a repetitive series of temperature cycles with each cycle comprising three stages: denaturation of the template nucleic acid to separate the stands of the target molecule, annealing a single stranded PCR

oligonucleotide primer to the template nucleic acid, and extension of the annealed primer(s) by DNA polymerase. PCR provides a means to detect the presence of the target molecule and, under quantitative or semi-quantitative conditions, to determine the relative amount of that target molecule withi the starting pool of nucleic acids. [0261] Database entry numbers as used herein may be from the NCBI database (National Center for Biotechnology Information; http: /www .ncbi.iiJmjiiii.gov) or from tiie CyanoBase, the genome database for cyanobacteria (( ¾>; >¾a€teria.kaz Jsa.oi'.jp/ cyanobase/ ^' iadex. tmi)

Yazukazu et al. "CyanoBase, the genome database for Syaechocystis sp. Strain PCC6803: status for the year 2000", Nucleic Acid Research, 2000, Vol. 1 S, page 72),

[0262] Tiie enzyme commission numbers (EC numbers) cited throughout, this patent application are numbers which are a numeiical classification scheme for enzymes based on the chemical reactions which are catalyzed by the enzymes.

Growth of ABICyanol ia adverse eflviroaraeatal conditions

[0263] In comparison to other cyanobacterial species, ABICyanol grows quickly and can tolerate and grow over a large range of various envkomnenial stresses related to temperature, salinity, light intensity, oxygen levels, pH and the presence of contaminants iiicludmg chemical and microbial contaminants. ABICyanol 's ability to tolerate wide-ranging environmental parameters makes it ideally suited to growth in cyanobacterial culture systems. ABICyanol can be genetically enhanced to express endogenous and exogenous genes used for the production of compounds of interest, such as bio&els, and still tolerates and grows over a large range of various environmental stresses related to temperature, salinity, light intensity, oxygen levels, pH and the presence of various contaminants.

[0264] Methods for cultivation of cyanobacteria in liquid media and on agarosercontaining plates are well known to those skilled in the art (see, e.g.. websites associated with ATCC). Any of these methods or media maybe used to culture ABICyanol or derivatives thereof. A number of known recipes for cyanobacterial growth medium can be used. In an embodiment. BGl 1 medium is used for growing ABICyanol, see Stanier, R.Y., et al., Bacteriol. Rev. 1971, 35: 171-205, which is hereby incorporated by reference.

[0265] In an embodiment the cyanobacterial strain is a fresh water strain, and BGl 1 is used. In another embodiment, the cyanobacteria culture grows best in a marine (salt water) medium, by adding an amount of salt to the BGl 1 medium, ia an embodiment, marine BGl 1 (mBGl 1) contains about 35 practical salinity units (psu). .see Uaesco, The Practical Salinity Scale 1978 and the International Equation of State of Seawater 19S0. Tech. Pap. Mar.. Sc , 19SL 36: 25 which is hereby incorporated by reference. [0266 j In an embodiment the cells are grown airtotrophieaily, and the only carbon source is <¾. Is another embodiment the cells aie grown tnixotrophicaily, for example with the addition of another carbon source such as glycerol.

[0267] The cultures can be grown indoors or outdoors. The light cycle can be set as for continuous; light, or for periodic exposure to light, e.g.. 16 hours: on and S hours off, or 14 hours on and 10 hours oil. or 12 horn s on and 2 hours off. or any al ternative variation of on and off hours of li ght eonipris ig about a day .

[0268] The cultures can be axenic. or the cultures can also contain other contaminating species.

[0269] In an embodiment,, the cyanobacteria are grown in enclosed bioreaciors in quantities of at least about I L. 20L, SOL, 100 L, 500 L, 1000 L, 2600 L, 5000 L, or more, In a preferred embodiment the bioreaciors are about 20 L to about 100 L. In an embodiment, the cyanobacterial cell cultures are grown in disposable, flexible, and tubular photobioreactors made of a clear plastic material.

[0270] In another embodimen cultures are grown indoors or outdoors with continuous ligh in a sterile environment, in another embodiment the cultures are grown outdoors in an open pond type of photobioreactor.

[0271] ABICyanol cells are generally coccoid in appearance. ABICyaaol cells are sheathed with copious amounts of mucilaginous extracellular material (extracellular polymeric substances- also referred to as exopolysaceharides (referred to herein generall as EPS)), as shown in FIG. 1. This material may help the cells survive i adverse environmental conditions. This mucilage can participate in the formation of cellular aggregates or ''clumps". Figure 1 depicts a panel of microscopic images that demonstrate the presence of the EPS layer thai is present in a sheath surrounding the Cyanobacterium sp. ABICyanol cell wherein the bar depicted in the figure is equal to 50 μπι. The left panel depict unstained ABICyanol cells. The right panel depicts

ABICyanol cells thai are stained with scrihtol black which cannot penetrate the EPS layer and thus depicts the thick EPS layer of ABICyano 1.

[0272] ABICyano grows over broad range of temperatures. In a particular embodiment, ABICyanol can grow from about 1 °C to about 55 °C, from about 5 "C to about 55 °C, from about 10 °C to about 55 °C, from about 15 *C to about 55 °C. from about 20 °C to about 55 *C, from about 25 °C to about 55 °C, from about 30 °C to about 55 °C. from about 35 °C to about 55 °C, &om about 40 ' ³ ϋ to about 55 °C, from about 45 °C to about 55 °C. or from about 50 ^>3 to about 55 °C. In an embodiment, as depicted in FIG. 2 A ABICyanol can grow up to about 5 "C, e.g. at temperatures greater than 45 °C or greater than 50 °C including 48 °C, 50· *C, 53 °C, and 55 °C. Hie broad temperature range at which ABICyanoI can grow is larger than many other cyanobacteria. For example, as depicted i FIG. IB, Synechococcus sp. PCC 7002 exhibits growth only « to 45 °C whereas ABICyanoI (FIG. 2A) exhibits robust growth at 50 °C. As depicted in FIG. 2, to the test for temperature tolerance. ABICyanoI and Synechococcus sp. PCC 7002 were caltored in a medium, e.g. a marine aiediion.. under conditions of light ilhiniiimtion and omitting light illumination (day ghf cycle) at maximum temperatures between 45 to 55 °C for a certain period of time, for example I to 2 hours, during illumination. Cyanobacierial cells were deemed to have passed the test, if the cultures were still growing after having been subjected to 7 days of day/night cycles as described above. Growth could be detected, for example, by an increase in the chlorophyll content of the eyanobaeterial cultures.

Cyanobactetitim sp. ABICyanoI was found to withstand cultivation at 48 °C, 50 °C and 53 to 55 °C for at least 2 hours per day over a. time period of at least 7 days. As depicted in FIG. 2 A, Cyanobacieriimi sp. ABICyanoI grows well even when daytime temperatures get up to bout 45 °C to 50 ^C C for about 2 hours. Growth was measured by chlorophyll content (diamonds: pg rnL) and absorbance at OD750 (squares).

[0273] I» another embodiment, ABICyanoI growth was determined at 45 °C, 48 °C 50 °C, 53 ^C' C, and 55 °C for I week and compared to the growth of S ech&cysfis sp. PCC 6803 and

Synechococcus sp. PCC 7002 under the same conditions. Table I depicts that. ABICyanoI is capable of growth even alter being exposed daily to 53 °C, and 55 ^C 'C for two hours over the course of a week .

Table 1

Tliemiotolerance Test

Genus, species 2 hours at 2 hours at 2 hours 2 hours at 2 hours a t

5 °C ^' for 48 °C for 50 ^S C for 53 ^: C for 55 °C for 1 week ! week 1 week 1 week 1 week

Smeeh ^' ocystis sp. pos. pos. neg.

PCC 6803

Synechococcus sp . pos. pos. pos. neg.

PCC 7002

Cymobacterttmt pos. pos. pos. pos. pos.

sp. ABICyanoI [0274] ABICyano I was further tested for its ability to tolerate and grow in various environmental conditions. Some of the conditions tested would likely be present in large-scale culture systems, such as photobioreactors in outdoor conditions, for growing cyanobacteria including ranges of temperatures, oxygen levels, light levels, pH levels, and fee presence of contaminants. ABICyanoi gr ows in various media containing various concentrations of salts, hi a particular embodiment, ABICyanoi can grow hi fresh water media containing salts at less than about 0, 5 parts per thousand, brackish water containing salts at from about 0.5 parts per thousand to about 30 parts per thousand, and saline water containing salts from about 30 pails per thousand to about 50 parts per thousand. In some embodiments, ABICyanoi is grown in media including freshwater BG1 1 and marine (saline) BG11 (rnBGl 1) medium, which can, for example,, have a. salinity of between about 30 to 38 psu (practical salinity units also measured as water containing salts at.30 to 38 parts per thousand), hi particular 35 psu.

[0275] In an embodiment, ABICyanoi can grow in media containing from about zero percent ethanoi up to at least 1% ethanoi. ABICyanoi was shown to survive exposure to at least 1% (v/v) ethanoi in a BG11 medium, for example. This cufturing was done for at leas 6 weeks, at least 12 weeks, or at least 16 weeks. In a particular embodiment ABICyanoi cells were grown at 250 μ ιποΙΕ ni ^'i sec ^"! . a 12 hours of light, and 12 hours with no light cycle, at 37 C with ethanoi supplemented in the growth media. The test for ethanoi tolerance was performed by adding 1 % ethanoi to the growth medium of ABICyanoi. Cyanobacteriai cultures were examined, for example under the microscope after a predetermined period of time, for example 6, 12 or 16 weeks and cyanobacteriai cultures wer e deemed to have passed the ethanoi tolerance test if at least or more than 50 % of the cyanobacteriai cells were found to be intact, i.e. viable according to microscopic analysis meaning that the cell morphology did not change significantly, the cells were still green, and the cells were not lysed.

[0276] In an embodiment, ABICyanoi can grow hi the absence of oxygen all th wa up to media containing oxygen concentrations of about 1000 pmol L or more. Oxygen tolerance testing showed that ABICyanoi. can tolerate purging with 60% to 80% (v/v) oxygen (resulting in oxygen levels of up to 1000 urnol L in the culture during the day) when civlftu ed at temperatures between 28 *C to 37 °C and when being illimiinated with a light intensity of between 200 μΕ m ¹ s ^"1 to 400 μΕ i ^{^} s ^"1 in a medium such as marine BG11 or. in some embodiments. BG11 medium. I another embodiment ABICyanoi can tolerate oxygen levels of abou 100 μηιοΙ/L. 200 μηιοΙ L, 309 μηιοΙ/ ^' L. 400 μίηοΙ/L, 500 μηιοΙ/L. 600 μιΐΐοΙ/Ε, 700 μπιοΙ/L, S00 μιιιοΙ/L, and about 900 μιηοΙ L is the growth, medium.

[0277] ABICyaaol was also shown to tolerate a wide range of pH values and can be cultured at neutral or a slightly alkaline pH of 7.5, a pH between 6 to 7.5. and at a pH between 5,5 to 10, about 6 _S about 7, about 8, about 9 _S or about 10,

[0278] ABICyaaol cultures are resistant to the growth of contaiiiinamig microbial organisms. For example, contaminating strains in ABiCyanol cultures do not grow to as high density as compared to contaminant strains in oilier cultures of known cyanobacteriai strains. As an

example of the resistance of growth of microbial organisms in an ABiCyano l culture, about 10 ^J - 10* cfij/mL of contaminating strains were found in ABiCyanol cultures and about 10*-I ¹³ cjia mL of contaminating strains were found in Symc ccocc s sp. PCC 700.2 cultures.

[0279] In an embodiment, ABICyaaol host cells, can withstand at least one of the following eulturnig conditions: ϊ% (v/v) emanol in the medium for at least 6, 12 or 16 weeks; 48 °C, 50 *C, 53 to 55 °C for at least 2 hours per day over a time period of at least 7 days, and purging with 60% to 80% (v/v) oxygen (resulting in oxygen concentrations of up to 1000 urnol/L in the culture during the day). In an embodiment the Cptmabacterium sp., in particular ABICyaaol host cells, can tolerate at least two of the above mentioned culturing conditions. In an embodiment, the Cy nobacieri n sp., in particular ABiCyan l host cells, can tolerate all of the above mentioned culturing conditions.

[0280] The tolerance (also referred to as hardiness) to a wide range of growth temperatures, and tolerance to eaviroiiniental conditions in general, make Cycmobaeter m sp. ABiCyanol

amenable to industrial scale production of compounds of interest in potentially adverse environmental conditions such as those found in photobioreactors.

ABiCyanol endogenous plasmMs

[0281] ABiCyanol contains two endogenous plasiiiids. In combination with other genorypic and phenotypic attributes, these two endogenous plasmids differentiate ABICyano I from other Cyartobactetiimi species .

[0282] One plasmid is 6828 base pairs (SEQ ID NO: 1) and the other plasmid is 35,386 base pairs (SEQ ID NO: 2). The 6828 bp endogenous plasmid (SEQ ID NO: 1) is alternatively referred to herein as pABICyanol . p6,8 or 6,8. A plasmid map of the 6828 endogenous plasmid is depicted hi FIG , 3 [0283] The p6.8 endogenous p!asimd was isolated by an in vitro transposition reaction with an EZ-To5 R6K γ Ori Kan-2 transposition kit from Epicentre (Madison Wisconsin. USA) by following the manufacturer's protocol. The eyanohacterial plasmid was rescued in surrogate E. colt host cells. Hie sequence and size of the captured plasmid was confirmed and validated by PCR. as well as by comparison with available genome sequence data.

[0284} ABICyanol endogenous plasinid p6.8 contains sis open reading frames ORF i , GRF 2, ORF 3, ORF 4, ORF 5, and ORF 6 encoding for polypeptides having sequences as se forth hi SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7. and SEQ ID NO: 8, respectively. With respect to the nucleotide sequence of SEQ ID NO: 1 of p .8, ORF 1 consists of nucleotides 594 to 3779. ORF 2 consists of nucleotides 3815 to 4000, ORF 3 consists of nucleotides 4260 to 5024, ORF 4 consists of nucleotides 5350 to 6 36, ORF 5 consists of nucleotides 6078 to 6341, ORF 6 consists of ucleotides 6338 to 6586, and the origin of

replication consists of nucleotides 3375 to 3408.

[0285] As disclosed herein, plasmid 6.8 has been modified m vivo and in v iro for use as a plasmid vector containing genes of interest for the production of compounds of interest .

[0286] hi an embodiment a modified endogenous vector derived from p6.8 from ABICyanol was developed. The modified endogenous vector from ABICyanol can be used to transform

cyanobacieria from a. broad range of genera, including ABICyanol itself,

[0287} In certain embodiments, the present invention includes the p6.S plasmid and modified vectors comprising sequences of the p6.S plasmid. In an embodiment, the modified endogenous vector contains at least one of the following: a reconibisant gen that encodes at least one protein involved in a biosyiitiietic pathway for the productio of a compound or a marker protein; and an origin of replication suitable for replication in ABICyanol .

[0288} In certain embodiments, a gene coding for a. replication initiation factor that binds to tl e origin of replication can either be present on the modified endogenous vector or can be present in the cliromosonies or other extrachrcmosomal plasniids of ABICyanol. An origin of replication suitable for replication in ABICyano 1 and the gene coding for the replication initiation factor binding to tliat ori gin of replication ensure that the modified endogenous vector can be replicated in ABICyanol.

[0289] In an embo diment, the nucleotide se quence of an origin of replication of the modified endogenou plasmid vector can have at least 80%. 90% _s and 95% identity or can be identical to the nucleotides 3375 to 3408 of the sequence of the endogenous 6 8 kb plasmid (SEQ ID NO: I). [0290] In an embodiment the sequence of the gene coding for the replication initiation factor has at least 80%, 90%. and 95% identify or is identical to nucleotides 594 to 3779 of the sequence of the endogenous 6.8 kb plasniid (SEQ ID NO; I), in an embodiment, the gene coding for the replication initiation facto? codes for a protein having at least 80%, 90%, and 95% sequence identity or is identical to the protein coded by nucleotides 594 to 3779 of the sequence of the endogenous 6,8 kb piasmid (SEQ ID NO: 1) of ABICyanol. This putative initiation replication factor is thought to bi d to the putative origin of replication, thereby ensuring the implication of a piasmid containing the initiation factor in ABICyanol ,

[0291] In an embodiment,, a modified endogenous piasmid vector can contain a sequence having at least 50%. at least 55 %, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identity to the sequence of the endogenous 6,8 kb plasniid (SEQ ID NO: I), in another embodiment, the modified endogenous vector contains the entire p6,8 endogenou piasmid from ABICyanol.

[0292] In another embodiment gene delivery vehicles that are developed using the endogenous S. S kb plasniid (or a portion of the plasniid) containing characteristic portions of the endogenous 6.8 kb piasmid may be able to be efficiently transformed into a wide range of cyanobacteria. In an embodiment, characteristic portions of the 6.8 kb endogenous plasniid from ABICyanol include portions that enable it to replicate in a host c ell (origin of replication and replication initiation factor, for example) and can be referred to as the backbone of the endogenous 6.8 kb piasmid. Such vectors may also be able to efficiently produce heterologous proteins and other compounds of interest in cyanobacterial cultures,

[0293] In another embodiment, modifications starting with the backbone of the 6.8 kb endogenous piasmid from ABICyano I are performed individually or together to increase transformation efficiency, increase the replication rate within the ceil, and to increase the production of a desired product from, the cyanobacterial cell. Suitable modifications include, for example, insertion of selection markers (such as antibiotic resistance genes), recombinant genes or cassettes for the production ©f a desired compound, and other modifications to increase the expression or stability of the piasmid in the cyanobacterial cell. In an embodiment, the invention includes cyanobacteria, e.g. ABICyano , comprising a modified p6,S piasmid having any of these improved characteristics,

[0294] In yet another embodiment , codon improvement of the at leas one recombinant gene is performed for improved expression in the cyanobacterial host cell, Codon improvement can also be performed by adapting the codon usage of the ai least one recombinant gene to the codon usage in Cyanob cteti n sp. _t in particular ABICyanol. In an embodiment, the G and ο C wobble bases in the codons for the amino acids in the at least one recombinant gene can be replaced by A and/or T because me GC content of Hie genome of ABiCyaiiol is relatively low at. about 36%.

[0295] In an embodiment, only 2% to 6% or 1% to 10% of the codons of variants of recombinant genes are codon improved. In another embodiment, highly codon improved variants of

recombinant genes, at least 25%, to at least 50%, 65% or even at least 70% of the codons ha ve been changed. In another embodiment, recombinant genes are used which are not codon

improved.

Phylogenette classification of ABICvauoi

[029ts{ Figure 4 depicts a phylogenetie tree showing the relationship between ABICyanol and other cymrobacterial genera and species. As depicted in FIG. 4, ABICyanol is a member of the Cyanobacteri m genus. The tree was built with the 16S rR A gene sequences with the

Neighbor- Joining method using the Tainura-Nei nucleotide substitution model assuming uniform heterogeneity among sites. The scale bar indicates Hie number of substitutions per site.

[0297] ABICyanol differs in many ways from other species in the Cyanobactertimi genus, as well as from other cyanobacterial genera such as Synechococcm and Synechoeysfis. .Differences include, but are not limited to. endogenous plasmids. carotenoid and chlorophyll composition, and differences in its I 6S rDNA and internal transcribed spacer rDNA (ITS), for example.

[0298] Figure 5 depicts a sequence comparison of the 16S rDNA of ABICyanol with 168 rDNA from other Cyanobacterium species, The 16S rRNA gene sequences (16S rDNA) of ABICyanol were predicted from the genome sequence with RNAmmer program (Lagesen K, et ai (2007) Nucleic Acids Research 35(9}:3100-3 iOS). The predicted sequences were then used as a query to search against the NCBI database.16S rDNA sequences from four species belonging to the genus Cyanob cieriimi were retrieved as the top BLAST hits. Cyanol0216 is the 16S rDNA sequence of Cycmobacteriimi sp, MBIC10216, accession number AB058249. L CyanoETS-03 is the 16S rDNA sequence of Cyanob cier i apomnmn ETS-03, accession number AM23S427. i .

CyanoLLiS is the I6S rDNA sequence of Cyanobacterium sp. LLi.5, accession number

DQ7S6154.1. Cyano7202 is the 16S rDNA sequence for Cyanobacterium stanieri PCC 7202. accession number AM25898L1. According to this one comparative phylogenetie characteristic, and as depicted in FIG. 5. ABICyaaol is about 99% identical to the 16S rDNA of other species from the genus Cyanobacterium including Cy nobact ri n IHB-410, Cyanobacterium ponimtm ETS-03, and Cycm&bactemm sp. ΒΣΟ0216.

Transformation of ABICyaaol

[0299] Some strains of eyanobaeteria can be transformed through natural uptake of exogenous DNA. Other cyanobacterial strams can be transf ttm d, for example, by the us of conjugation or electroporation. Some eyanobaeteria! strains are difficult to transform by any known means. For many of these types of difficult to transform strains, specific methods of preparing the cells for transformation, as well as specific methods of allowing entry of the foreign DNA into the cells, need to be designed de novo,

[0300] ABICyaaol is very difficult to transform. The mucilaginous sheath may play a role in the transformation difficulties, as may the presence of restriction enzyme systems. Nevertheless, disclosed herein are compositions and methods for transforming ABICyaaol with endogenous and exogenous DNA,

[0301] Methods for producing a genetically enhanced, iion-narurally occur i g Cyanobacterium sp. and ABICyaaol host cells are disclosed herein. In an embodiment methods include introducing a recombinant nucleic acid sequence into a cyanobacterial host cell . At least one recombinant gene can b introduced into the host cells through the transformation of the host cell by an extrachromosomal plasmidL In an embodiment; the extrachromosomal plasmid can independently replicate in the host cell. In another embodiment, at least one recombinant gene can be introduced mto the genome of the host cell. In yet another embodiment, at least one recombinant gene is introduced into the genome of the host ceil by homologous recombination.

[0302] In an embodiment, a recombinant nucleic acid sequence can be provided as part of an extrachromosomal plasmid contahi ig cyanoba terial nucleic acid sequences in order to increase the likelihood of success for the trans formation.

[0303] In another embodiment, the method for producing a genetically enhanced

Cyartobactetiimi sp. host cell uses an extrachromosomal plasmid derived from an endogenous plasmid of the host cell to introduce a recombinant nucleic acid sequence into the host cell. This endogenous plasmid can be, for example, an extxachromosomal plasmid derived from the 6.8 kb endogenous plasmid of ABICyanol . [0304] In yet another embodiment, the method for producing a genetically enhanced Cyanobacteri m sp. host cell involves protecting the recombinant nucleic acid sequence, for exampl e a plasmid, agains t endogenous restriction endormdeases of the ho st cell by mefhyiating at least a part of the recombinant nucleic acid sequence or modifying and/or eliminating the recognition sequences of the endogenous restriction endonucl ases. By changing the nucleic a id sequence of potential recognition sites of restriction eiidomicleases, a digest of the recombinant nucleic acid sequence can. be avoided,. It was discovered that endogenous restriction,

endomicleases of ABICyanol can cut an extrachroinosonial plasmid carrying recombinant genes, thereby preventing a genet transformation event of this host ceil .

[0305] In an embodiment, meihyltransferases, for example Aval and Acyl. can be used to protect recombinant vector extraehroniosomal plasmids. The plasmids can either be incubated with the aiet yitransf erases in viiro or a helper plasmid can be present in a helper E. coii strain in order to methylate the extrachraniosoinal plasmids in vivo before conjugation takes place dining the transformation of ABICyanol . In another embodiment, recognition sequences for the restriction enzymes can be modified or deleted. As described by Elhai and Wolk, in Conjugal Transfer of DNA to Cyanobacteria in Methods in Enzyniology 02/1988; 167:747-54, herein incorporated by reference., plasmid pRL52S can be used as a helper plasmid for conjugal transfer. The indicated genes are M, Aval coding for the methyltransferase protecting against the restriction

endomiclease Aval and the respective gene coding for M. Avail. The latter is not required for transformation of ABICyanol , as it lacks any endonuciease activity of Avail.

[0306] hi an embodiment, the vector to be transformed into Cyanobacterium sp. host cells can be modified to integrate into the cyanobacierial chromosome by adding an appropriate DNA sequence homologous to the target region of the host genome, hi another embodiment, the vector to be transformed can be modified to integrate into the cyanobacierial chromosome through in vivo transposition by introducing mosaic ends to the vector. Once the plasniid is established in the host cell, it can be present for example, at a range of from 1 to many copies per cell.

[0307] In an embodiment, an endogenous plasniid derived from ABICyanol can be modified, either in vivo or in viiro, to be a plasmid vector capable of introducing exogenous genes encoding enzymes for the production of a compound or compounds of interest into a. wide range of host cyanobacterial cells such as ABICyanol, Cyanobacterium sp., or other cyanobacteriai genera such as Synechocysiis and Syneehocaccifs. [0308] The transfer of exogenous genes into cyanobacteria often involves the construction of vectors having a backbone from a broad-host range bacterial plasniid, such as RSF1010. The RSFIOiO-based vector lias been widely used as a conjugation vector for transforming bacteria, including cyanobacteria (Meraiet-BoBvier et al. (1993) "Transfer and Replication ofRSFlOlO- derived Plasniids in Several Cyaiiobaeteria of ilie Genera Syneckocysiis and S iwchococcus" Current Microbiology 27:323-327), RSFIOIO lias mi E, coli origin of replication, but does not have a cyanobact erial origin of replica tion ,

[0309] As an example of additional tools used to transfer exogenous genes into cyaaobacteria, several endogenous piasniids from Sy chococcm sp, PCC 7002 were used as the backbone portions for plasrnids to prepare vectors for heterologous gene expression, see Xu ei ai.,

Photosynthesis Research. Protocols 684:273-293 (2011), Other vectors for fcansfonnation of cyaaobacteria include the pDUI-based vectors. The pDUl origin of replication is best suited for filamentous cyaaobacteria. Attempts to transform ABICyanol , with either RSFiOlO or pDUl- based shuttle vectors were unsuccessful using the techniques as described in the ait.

[0310] In an embodiment the ABICyanol 6.8 kb endogenous p!asmid is used as a backbone for a plasmid vector used for transformation of Cy nobacterium sp. Since this is the endogenous vector from me species, it is likely to be more stable when transformed into the cell than plasmids derived from completely different organisms, hi an embodiment, the entire p6.8 endogenous plasmid is inserted into a vector used for transformation. In another embodiment, a sequence of about 50%. 70%, 75%. 80% 85%, 90%, 95%, 98%, 99%. or 99.5% identity to the entire

endogenous plasmid sequence is inserted into the extrachroniosoma! plasmid vector.

[0311] In an embodiment,, a modified p6.8 vector is designed to have several modular units that can be swapped out using specific restriction enzymes. Promoters, genes of interest, selectable markers, and other desired sequences can be moved in and out of the vector as desired . This modular design makes genetic experiments faster and more efficient.

[0312] The modified p6,S vector, according to certain embodiments of the disclosure, can replicate in both cyanobacteria and in E. coli. The vector contains a replication unit that can function in a. broad range of cyanobacteria! genera. The vector also contains a replicon for propagation in E, coli for ease of cloning and genetic manipulation using E. coli.

[0313] hi an embodiment a plasmid shuttle vector is provided winch i characterized by being repiicable in both E, coli and cyanobacteria! species. The plasmid comprises 3 promoter capable of functioning in cyanobacteria and E. coli and a DNA sequence encoding a sequence capable of functioning as a selective marker for both E. coH a d cyanobaeteria. hi another embodiment, the shuttle vector includes two different promoter systems, one functioning in cyanobaeteria and the oilier one functional in E. colt In an embodiment, the plasrnid shuttle vector contains at least 50% of the p6.8 plasmid. The plasmid shuttle vector enables the efficient transformatio of cyanobaeteria and the expression of recombinant genes of interest

[0514] In another embodiment, the p6 , S deri ved plasmid vector also contains an origin of transfer (oriT) which is suitable for conjugation. In particular, the plasmid vector can contai a combined origin of replication and an origin of transfer (oriVT), which enables replication in

Enterobact ri cme. in particular E. coil, and which also enables conjugation with, for example,, an E. coli donor strain and Cy nohacierium sp., in particular ABICyanol as a recipient strain. Such an plasmid vector can be used for triparental mating wherein a eonjugative plasmid present in one bacterial strain assists the transfer of a niobilizahle plasmid, for example plasmid vector disclosed herein, present in a second bacterial strain into a third recipient bacterial strain, which can be ABICyano 1.

[0315] Also disclosed herein is a non-naturaUy occurring p6,S derived vector in which a gene of interest the recombinant gene, is operably linked to a shuttle vector, hi an embodiment, cyanobacterial cells are transformed with the recombinant shuttle vector. The recombinant shuttle vector is relatively small in size, relatively stable in a cyanobacterial host cell, and can replicate in a variety of cyanobacterial species. This recombinant vector is useful for expressing a variety of heterologous genes in cyanobacteria.

[0316] In an embodiment for transforming host cells with p6,8 derived vectors, a shuttle vector expresses a codon-optimized antibiotic resistance gene (A ^K } _? such as codon improved kanamycin or gentamycin resistance genes. In an embodiment, the shuttle vecto is constructed based on a modular basis so that all of the key elements (replication ori. Ab ^R gene and reporter gene) are exchangeable via unique restriction sites thus providing versatile cloning options and facilitating the delivery of genes of interest, to tar et organisms. Other antibiotic resistance genes can be used if desired. For example, genes conferring resistance to anip ci!lin, ddorarnphenieol, spectinomycin or other antibiotics can be inserted into the vector, under the control of a suitable promoter. In some embodiments, the vector contains more than one antibiotic resistance gene, [0317] hi yet another embodiment the p6.S derived vector is modified by several factors so that it is capable of efficient replicatio in multiple types of cyanobacterial species. The vector has also been organized so that various sequences can be easily replaced with other desired sequences as needed. Thus, a construct aving a different gene (or genes) of interest, a different antibiotic, a different promoter, etc. can be made with relative ease. The modified vector allows for rapid testing of various heterologous constructs in a cyanobacterial cell.

[0318] Any suitable promoter can be used to regulate the expression of the genes present in the vector. Exemplary promoter types include, for example, constitutive promoters, inducible promoters, endogenous promoters, heterologous promoters, and the like.

[0319] In an embodiment the modul ar design of the p6.8 derived vect or allows c omplex

sequence manipulation in cyanobacteria.

[0320] In an embodiment,, cyanobacteria disclosed herein can be transformed to add biochemical pathways to produce compounds of interest. Recombinant DNA sequences encoding genes can be amplified by PCR using specific primers. The amplified PCS, fragments can then be digested with t e appropriate restrictio enzymes and cloned into either a self-replicating plasmid or into an integrative plasmid. An antibiotic resistance cassette for selection of positive clones can be present on the appropriate p!asmid.

[0321] hi an embodiment, the recombinant nucleic acids of interest can be amplified from nucleic acid samples using known amplification techniques. PCR can be used to amplify the sequences of the genes directly from mRNA, from cDNA, from genomic libraries or cDNA libraries. PCR and other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes for detecting the presence of the desired mRNA in samples, and for nucleic acid

sequencing.

[0322] In an embodiment, recombinant DNA vectors suitable for transformation of cyanobacteria can be prepared. For example, a DNA sequence encoding one or more of the genes described herein can be combined wife transcriptional and other regulatory sequences which will direct the transcription of the sequence from the gene in the transformed cyanobacteria.

[0323] In an embodiment recombinant gene of interest are inserted into the cyanobacteria! chromosome. When the ceil is polyploid, the gene insertions can be present in all of the copies of the claOniosoine. or in some of the copies of the chromosome.

[0324] hi another embodiment, recombinant genes ar e present on an extrachromosonial plasmid. The exfraehromosonial plasmid can be derived from an outside source such as RSFlO-based plasmid vectors, for example, or can be derived from an endogenous plasmid from

Cyimoh cierium sp. host eels or from other cyanobacteria. [0325] In an embodiment, recombinant enes are present on an exirachroHiosoiiial plasmid having multiple copies per ceil. The plasmid can be present for example, at about 1, 3, 5, 8, 10, 15, 20, 30, 40, 50, 60, 70. SO, 90, or more copies per cyanobacterial host cell In an embodiment, the recombinant piasmids are fully segregated from the non- combmant plasinids,

[9326 In another embodiment; recombmant ge es are present on one cassette dri ven by one promoter. In another embodiment, the recombinant genes are present on separate piasmids, or on different cassettes.

[0327] In yet another embodiment, recombmant genes are modified for optimal expression by modifying the nucleic acid sequence to accommodate the cyanobacterial cell's protein translation system. Modifyin the nucleic acid sequences in tins manner can result in an increased

expression of the genes.

[0328] Methods of genetic engineering of piasmids us ing £. coii are generally known in th art. In some embodiments disclosed herein, the plasniid construct preparation is performed in E. coii to allow for ease of genetic manipulation. In order to be propagated in E. coii, an origin of replication suitable for Efiterobacteriace e, in particular E. colt is incorporated into the plasmid vector. Once the construct is prepared and changed in E. coli, the plasmid can then be transferred to the cyanobacterial cell where it can replicate as an independent plasmid. Alternatively- the plasmid vector can also be synthesized via solid pha se synthesis so that an origi of replication for Effterab cieri-aceae does not need to be present in the plasmid vector.

[0329] Exemplary methods suitable for transformation of cyaiiobaeteria include, as non-limiting examples, natural DMA uptake (Chung, et al. (1998) FEMS Microbiol. Lett. 164: 353-361 ;

Frigaard et al. (2004) Methods Mol Biol. 274: 325-40; Zang, et al (2007) J, Microbiol. 45: 241- 245), conjugation, transduction, glass head transformation (Kindle, et. al. (1989) I. Cell Biol. 109: 2589-601 ; Feng, et ai. (2009) Mol. Biol. Rep. 36: 1433-9: U.S.. Pat No. 5,661,017), silicon carbide whisker transformation (Di ahsy, et al. (1997) Methods Mol.. Biol. (1997) 62: 503-9), biolistics (Dawson, et al. (1997) Curr. Microbiol. 35: 356-62; Hallmann, et. al. (1997) Proc. Natl. Aead. USA 94: 7469-7474; Jakobiak, et al. (2004) Probst 155:381-93; Tan, et al. (2005) 1.

Microbiol 43: 361-365; Steinbrenner, et al. (2006) Appl Environ. Microbiol, 72: 7477-7484; roth (2007) Methods Mol Biol. 390: 257-267: U.S. Pat. No. 5,661,017) eleciroporaiion

(K emlff, et al. (1994) Photosynm. Res. 41 : 277-283: Iwai, et ai. (2004) Plant Cell Physiol. 45: 171-5; Ravkdraa, et al (2006) J. Microbiol. Methods 66; 174-6; Su , et al. (2006) Gene 377; 140- ϊ 49; Wang, et al. (2007) Appl. Microbiol. Biotechnol. 76: 65 -657: Chasrasia, et al. (2008) J. Microbiol.. Methods 73: 133-141 ; Ludwig, et al. (200S) Appl. Microbiol. Biotechnol. 78: 729- 35). laser-mediated transformation, or incubation with DNA hi the presence of or after pretreatment with any of poly(aaiidoaiitkie) dendiimers (Pasnpathy, et al. (2008) Biotechnol. J. 3: 1078-82),. polyethylene glycol (Otmuma, et al. (2008) Plant Cell Physiol 49: 1 1.7-120). cationk lipids (Muradawa, et al, (2668) J. Bios t. Bioeng, 105: 77-80} _s dextran, calcium phosphate, or calcium chloride {Meiidez-Alvarez, et. al. (1 94) J. Bacterid. 176: 7395-7397). optionally after treatment of the cells with ceil wall-degrading enzymes (Perrone, et al, (199S) Mol. Biol. Cell 9; 3351-3365). Biolistie methods (see, for example, Ramesli, et al. (2064) Methods Mol. Biol. 274 355-307: Doestch, et at. (2001) OUT. Genet. 39: 49-60; all of which are incorporated herein by reference m their entireties.

Extracellular polymer layer of ABICyanol

[0330] In an embodiment, a method of producing a genetically enhanced Cy nah cferium sp, host ceil including non-iiatural y occurring ABICyanol organisms, involves the steps of

subjecting the host cell to compounds thai increase the penneability of the extracellular polymer layer (also referred to as exopolysaeciiaride layer or EPS) and cell wall of the host cell and introducing an exogenous polymicleic acid into the host cell.

[03 1] In an embodiment, in order to introduce the at least one recombinant gene into an

ABICyanol host cell, the permeability of the EPS is increased beforehand so that the

recombinant nucleic acid sequence can pass through the EPS layer and reach the interior of the cyanobacterial cell.

[0332] In an embodiment, compounds that increase the permeability of the EPS and cell wait of the Cy nobacterhmi sp. host cell include N-acetylcysteine (NAC), lysozyme. β-galactosidase a d combinations thereof la an embodiment, a combination of NAC and lysozyme is used.

[0333] hi an embodiment the Cyanobacterium sp. host cell is first subjected to NAC followed by a treatment of lysozyme and then transformed. The inventors found out. that such a pretreatment drastically increased the number of trans&rmants in contrast to traiisfoiinatioii attempts lacking pretreatment.

[0334] hi one embodiment the present invention includes cyaiiobacteria having an EPS layer, wherein the organism lias been treated such that it has a 5-fold, 0-fold, 50-fold and about 100- fold increased rate of transformation as compared to the corresponding untreated cyaiiobacteria. In an embodiment, the ABICyanol host cell can be subjected to NAC for 0.5 to 3 days. In another embodiment, the host cell is subjected to NAC for ϊ to 2 days. In an embodiment after subjecting the host cell to MAC, the host ceil is further treated with tysozyrne for 3 mm. to 1 hour. In an embodiment after subjecting the host cell to NAC. the host cell is further treated with lysozyme for 10 to 30 mio. In an embodiment, after subjecting the host ceil to NAC, the host cell is further treated with lysozyme for 10 to 15 mill.

[0335 j In an embodiment, NAC treatment is carried oat at a temperature of 12 to 37 °C. In an embodiment, NAC treatment is earned out at a temperature of 16 C. In an embodiment, lysozyme treatment is conducted in a temperature range from 20 °C to 37 °C. In another embodiment, lysozyme treatment is conducted in a temperature range from 20 °C to 30 °C.

[0336] In an embodiment, a method of producing a genetically enhanced Cyanobacterhmi sp. uses a concentration of NAC between 0.05 and 1 mg mL and a concentration of lysozyme between 10 to 60 ^i mL to make Cyanobacteriiim sp. host ceils competent to transformation.

[0337] In an embodiment the techniques of pretreating the EPS of ABICyanol are also used as a step in introducing recombinant nucleic acid sequences, such as plasmids, into other

cyanobacterial ceils with an EPS. Non imiting examples of cyanobacteria with an EPS include several N s toe and .Anabaena strains such as Nostoc commune, Anabemma cylindrical, several Cyanothece sp. strains, such as Cyanothece PCC9224, Cyanothece CA.3, Cyanothece CE 4, Cyanothece ET 5, Cyanoiheee ET 2. a d Cyanospira capsidate ATCC 43193, Further eon- limiting examples of cyanobacteria with an EPS are Aph aocaps , Anacystis, Chroococcus, Qloeothece, Microcystis, Sfynechocystis, Lmgbya, Microcoleus, Osciilatoria, Phormiditm,

Sp ma, Cyanospira, Scytcmema, Tofypothrix, Ch mgloeopsi, Fischereila, Mastigocladm (see for example; "Exopolysaccharide-prodiicing cyanobacteria and their possible exploitation: A review" Roberto De Philippis et aL Journal of Applied Phycology 13: 293—299, 2001. and "Exocellular polysaccharides from cyanobacteria and t eir possible applications" Roberto De Philippis et aL, FEMS Microbiology Reviews 22 (1998) 151-175.

Transformation of ABICyanol by conjiigation

[0338] Attempts at transformation of ABICyanol by conjugation using methods well known in the art usually resulted in failure. Successful conjugation routinely occurred o ly after treating the EPS of ABICyanol according to the methods disclosed herein and then using conjugation techniques well known in the art. In an embodiment, transformation of ABICyanol with exogenous polynucleotides is performed after treatment of the EPS of ABICyanol by the conjugation technique as described in Elhai and Wolk. 1988 by using a helper plasmid pRL32B.

[0339] In certain embodiments, generated plasinids containing oiiVT are used for conjugation. The shuttle vectors are transformed into ABICyaaol following a modified conjugation protocol which includes the pretreatment of ABICyaao l to reduce its EPS l ayer as described herein,

[0540] In an embodiment, successful transformation of an exogenous polynucleotide into

ABICyanol occurs using triparental mating with E. coii strain J53 bearing a conjugative RP4 plasinid, E. coli strain HB101 containing the exogenous cargo to be introduced into ABICyanol and the pRi .528 helper plasmid.

Transformation of ABICyanol hy decrroporatios

[0341] In an embodiment, electroporation is used for successful transformation of ABICyanol using, for example, the same plasmids as for conjugation, but with, lower efficiency.

[0342] As with fee conjugation transformation protocol disclosed herein, strain-specific

adaptations of standard electroporation protocols maybe made to avoid D A digestion by endogenous restriction enzymes and to allow DNA entry through the EPS layer of ABICyanol host cells. To achieve successful electroporation, DNA may be protected against endogenous restriction enzymes by methy lation, Prior to electroporation using techniques w ll known in the art. ABICyanol cells ma be pretreated with positively charged polyammoacids such as poly-L- ly siiie hydrobromide or poiy-L-onatiiine hydrochloride or combinations thereof (in particular poly-L-Iysine hydrobromide) in order to increase the DMA uptake efficiency.

Selecting for successful transforma tion of ABICyanol

[0343 j In an embodiment, fee presence of a foreign gene encoding antibiotic res stance in a cell is selecte d by placing putativeiy transformed cells into a media containing an amount of the corresponding antibiotic and selecting cells that survive. The selected cells are then grown in fee appropriate culture medium to allow for further testing.

[0344] In another embodiment, colony PCR methods are used to confirm transfonnants. In certain embodiments of this procedure, fliree primer sets are used and are directed against parts of the p ABICyanol-6.8 shuttle vectors to detect specific fragments of the shuttle vector.

Trausformants exhibiting fee predicted PCR products are analyzed further by plasmid rescue. In one embodiment for plasmid rescue, a 25 mL liquid culture is subjected to DNA isolation.. [0345] In a non-limiting example of plasmid rescue, 500 eg to ίμ% of isolated DNA from

ABICyanol transfomiaiits containing the transformed plasmids is re-transformed into E. co!i and usually insults in approximately 10-20 fraasformants per iraiisfomiation implemented Plasmid DNA often E. coii colonies is isolated and analyzed by PC using specific primers for the transformed plasniids. The plasmid DNA is further analyzed with specific restriction enzymes and then sequenced.

Transformation of p6,8 kJb into other cyanobacterial species

[0346] In another embodiment, the modified plasmid vector based on the endogenous 6.8 kb plasmid backbone from ABICyanol, in addition to being useful for transformation to other

Cyanobact ium sp. host cells, is u ed to transform other cyanobacterial genera.. As an example, a shuttle vector containing fee 6.8 kb endogenous plasmid from ABICyanol with a kanamycin resistance cassette (Km*) and the oriVT for replication, in E. coh is transformed into

Symckococc PCC 7002 by natural uptake.

[0347] hi another embodiment, a modified vector based on the endogenous 6.8 kb plasmid from ABICyanol is transformed into other genera of cyanobactefia. Examples of cyanobacteria mat can be transformed with p6.8 derived vectors disclosed herein include, but are not limited to

Sytiec ocystis, Syneckocoecus, AcaryocMoris, Anabaena^ Themwsynechococctis _* Chamaesiphon, Microcystis,. Prochlorococeus, Prochloron, Ck ococcidiopsis, Cyanocysits, DermocarpeMa, Myxosarcma, Pieurocapsa, Stametia, Xenococcus, Artkrospir . Borzia, Ctinalmm, Geitle mi,

Ηαΐα ρίηίΐίηβ, Leptofyngby . Lmmothrix, Lyrtgbya, Microco! ns, Cycmodictyon, A phmtocapsa, Oscilhitorm, Planktothrix, Prochlo tkrix, Pseudanabaen _* Spimima, Stmiia, Symphc , Tnchodesmumi, Tychonema,. Atiabaenopsis, Aphan izomenon, Ca thrix, Cyanospir ,

Cylmdrospennopsis, Cyiindrospemtmii, Nodularia, Nastoc, Chioragheopsis, Fischere!l , Geitleti , Nasiochopsis, fyeng riell , Stigonema _> R dari , Scyfonema, Tolypothrix,

Cy ioihece, Pkormidium,. Adr menia, and the like.

Promoters

[0348] hi an embodiment any desired promoter can be used to regulate the expression of the genes for the production of a desired compound in ABICyanol . Exemplary promoter types include but are not limited to. for example, constitutive promoters, inducible promoters (e.g., by nutrient starvation, heat shock, mechanical stress, eiiwonniental stress, metal concentration, light exposure, etc.). endogenous promoters, heterologous promoters, and the like.

[0349] hi an embootimeni, reconib nant genes are placed under the transcripti onal control

(operably linked) of one or more promoters selected from PA _C US _* PmcA, Ρ,&ΙΑ, issA. P _j «a, ρ<*£-

Pcoj-T, P«m6A., Pzi*A, PsigB, biA? PfeipG-. PfcspA, PclpBi, P¾ii¾ PggjS, Pj«bA2, PpsaA, PaaA, PasrB, PnrtA., PisiB, msBi PktA _f Pna-gA- P sts- and PciJsC- hi an embodiment, synthetic promoters are used.

[0350] Recombinant ge es disclosed herein may be regulated by one promoter, or they can each b regulated by individual promoters. The promoters can be constitutive or inducible. Th promoter sequences can be derived, for example, from the hos cell from another organism, or can be synthetically derived.

[0351 j Exemplary promoters for expression in cyanobacteria include, but are not limited to, P _pet j,

PpsfcDt Po iA _* PipeA PkiB> PateAs Pri iAs PisiA» pet*. petE _* PcrarT» ssflA ziaAi PsigB> PittAr

Pi _S£5 A, PcipBi, Pj-u P _S gps _: Pi> _s ¾A2, ps*A _f PekA, jarB, PariA, ct&c _* and additional metal ion inducible promoters and the like. Examples of constitutive promoters: that can be used incl ud . but are oof limited to, Ρ _ΛεΣ ., P^, P^, Ρ _ιροΑ , PpsaA, ρ,ω ps D, P _C JK-B-

[0352] The promoters hspA, cipBi, and iB can be induced by heat shock (raising the growth temperature of the host cell culture from 30 °C to 40 °C), cold shock (reducing the growth temperature of the cell culture from 30 °C to 20 ^" ), oxidative stress (for example by adding oxidants such as hydrogen peroxide to the culture), or osmotic stress (for example by increasing the salinity). The promoter sigB can be induced by stationary growth, heat shock, mid osmotic stress. The promoters ntcA and nblA can be induced by decreasing the concentration of nitrogen in the growth medium and the promoters psaA and psbA2 can be induced by low light or high light conditions. The promoter htpG can be induced by osmotic stress and heat shock. The promoter crhC can be induced by cold shock. An increase in copper concentration can be used in order to induce the promoter petE, whereas the promoter petJ is induced by decreasing the copper concentration. Additional details of these promoters can be found, for example, in the patent application PCT/EP2009 060526, which is herein incorporated by reference in its entirety.

[0353] In an embodiment, truncated or partially truncated versions of promoters diselose d herein can be used including only a small portion of the native promoters upstream of the transcription s l point such as the region ranging from -35 to the transcription start Furthermore, introducing nucleotide changes into the promoter sequence, e.g. into the TATA box, the operator sequence and/or the ribosomai binding site (BBS) can be used to tailor or improve the promoter strength and/or its induction conditions, e.g. the concentration of inductor required for induction. For example, the inducible promoter can be P _E kA, and can b P^A from ABICyanol, which is repressed by aramoiiiom and induced by nitrite. This promoter may contain nucleotide changes in either one of the ribosomai binding site., the TATA box, the operator, and the 5 ^* -UTR

(untransl ated region) .

[0554] In certain embodiments, the present invention includes a polynucleotide comprising or consisting of any of the promoter sequences described herein, or variants thereof, including those having at least 80%, at least 0% at least 9.5%, at least 98%, or at least 99% identity to the reference promoter sequence,

[0355J In one embodiment, P^A (SEQ ID NO: 1 12) can have th following generalized

nucleotide sequence:

5 ^; (K) I f <«ATGC AAAAAACGAATQSTbA^ i ^GTAGTCA

A GTTAC(M) ₂₂ TAA GT( } ₅₅ CCG GGACAAA(]^r) ₂ AΓG-3 ^,

Each of the nucleotides N is independently selected from a group consisting of A, T, C and G, and the two ATGs in the 5 ' -region of the promoter are the start for NtcB binding sites and the capital letter GTA is the start for the NtcA binding site, and the bold letters CCG denotes the start of the RBS, and the 3*-ATG is the start codon for the first recombinant, gene transcriptionally controlled by this promoter.

[0556] Another generalized BNA sequence of promoter nil A (SEQ ID NO: 113) includes nucleotide changes in the ribosomai binding site leading to the folio whig general DNA sequence:

5 ^'' (N) ₁₁ ^TGC AA AAAACGAAT{ ?>7ATGTGTAAAAAG A AA(N i sGTAGTCA AAGT ACf^?7TAATGT0^^GGAGGATCAGCC( ATG-3 ^>

The bold and underlined nucleotides denote nucleotide changes hi comparison to the nativ promoter.

[0357] In another embodiment, modified promoter ni A (SEQ ID NO: 1 14) can include changes in the operator region (binding site for NtcB and NtcA) and the TATA box leadin to the

following general nucleotide sequence:

5 YN ?; s <sATGCAAAAAACGCATf N ATGCGTAAAAAGC ΑΤΓΝ ¾ sGTAATCA AAGTTAC^ ₂₂ TAATAT(N) ₅ sCCGAGGACAAA(N) ₂ ATG-3 '

The bold and underlined nucleotides denote nucleotide changes in comparison to the native promoter. [0358] Another variant of P^A (SEQ ID NO; 115) combines the above changes and: has the following DNA sequence:

5 ' OSP n 1 ATGC AAAAAACG ΑΤΓ >ι ATGCGTAA AAAGCAT( ¾ t --GTAATC A

AAGTTACfN _?? TAAIATm)^GGAGGATCAGCC hAIG-3

[0359] Another embod netit of the disclosure provides the Co ^" inducible promoter corT (SEQ ID NO: 116). which has the general nucleotide sequence of:

5 ⁱ CAT( ) ₇ GTTTACTCAAAACClTGACATTGACACTAATGTrAAG<-iT TA

GGCT(N) _{:t 5} C AAGTT AAAAAGC ATG-3 ^* ,

Each of the nucleotides N is independently selected from a group consisting of; A, T. C and G, and the 5 "-CAT is the start eodon of corR (antisense orientation), the 3'ATG is the start eodon for the first recombinant gene transcriptionally controlled by this promoter.

[0360] A modified variant of P _£i>fT (SEQ ID NO: 117) includes changes hi the RBS having the following nucleotide sequence:

5 ' C AT( b GTTT ACTC AAAACCTTG AC ATTGAC ACTAATG ^' TT AAGGTTTA

GGCT(N) _iS GAGGATAAAAAGCATG-3 ⁵ ,

Tlie bold and underlined nucleotides denote nucleotide changes in compaiison to the native promoter.

[0361] In an embodiment another variant of Ρ _£ΟΓ τ (SEQ ID NO: 118) includes changes in the TATA bo having the general DNA sequence of:

5 ^j CAT{N} ₇ GTTTACTCAAAACC ^' TTGACATTGA<:ACTAATGTTAAGGTTTA

GAAT ( ) j ₅ C AAGTT AAAAAGC ATG-3 ' .

The hold and underlined nucleotides denote nucleotide changes in comparison to the native promoter.

[0362] In another embodiment, a modified corT promoter (SEQ ID NO: 1 19} combines the above mentioned two iBodifieations to the RBS and the TATA box, and has the following DNA sequence:

5'CAT S0 _? GTTrACTCAAAAOnTGACATTGACACTAATGTTAAGGI TA

GAAT(N)i 5GAGGAT AAAAAGC ATG-3 '

[0363] h yet another embodiment the Zn ^2" inducible promoter smf A (SEQ ID NO; 120) from Syneehococc s sp. PCC 700:2 can he used having tlie following general nucleotide sequence:

5'(N) _S AA ACCTGAATAATTGTTCATGTGTT(N) ₄ TAAAAATGTGAACAAT CG'TTCAACTATTTA(N) GGAGGT(N)7ATG-3' [0364] In an embodiment changes in the ribosomai binding site can lead to the following generalized nucleotide sequences of P _sm tA SEQ ID NO: 121 and SEQ ID NO: 122, respectively:

5 ^N) _S A ATACCTGA ATA ATT^

CGTTCAACTATTTA( )»iAAGGAGGTGATfN)jATG-3 ^; .. or

S^CN^AATACCTGAATAATTGTTCATGTGTTCN^TAAAAATGTGAACtAAT

CGTTCAACTATTTAfN ^' )iii 4AGGAGGTATfK ¾ATG-3 '

The bold and underlined nucleotides denote nucleotide changes in comparison to the native promoter.

[0365 j In an embodiment, disclosed herein are recombinant, genes of a shuttle vector that comprise or are operably linked to an inducible promoter and/or a constitutive promoter, The promoter can be upstream of one gene to regulate that gene, or the promoter can be upstream of s everal genes so thai one promoter regulates the expression of more man one gene . Alternatively, in some embodiments, each recombinant gene can be regulated by a separate promoter, hi an embodiment the promoter can be derived from a cyanobacterial host cell, can be derived from another cyanobacterial species, or can be derived from another organism.

[0366] In an embodiment, a promoter controlling the transcription of at least one recombinant gene is a cyanobacterial promoter. In an embodiment cyanobacterial promoters include, bat are not limited to. promoter psbA2 from Syttechocystis sp, PCC 6803. promoter cpcBA from

Sy chocystis sp. PCC 6 ^" 8G3, P ₁ i and P_ A.7.2& &om Nosioc sp. PCC 7120, Jhkcuesm from

Synechocysiis sp. PCC 6803 and the PsmiAisss promoter from Synechocoec s sp. PCC 7002.

[0367] In another embodiment, a promoter used herein is a heterologous promoter from a different cyanobacterial or bacterial species. For example, the transcriptional regulator gene and promoter combinations Synech& ystis sp. PCC68G3, smtB-PsmtA. from

Syn choccocus sp. PCC 7002. coiR-P _{i i:lT} from Synech cystis sp. PCC6803. from Synechocystis sp. PCC 6 SO 3, and aztR-PaztA from Anaba a (Nosioc) sp. strain PCC 7120 can be used to control the transcription of the at least one recombinant gene in Cyanobacterium sp, such as ABICyarioL fo example.

[0368] Examples of inducible promoters disclosed herein include, bat are not limited to

promoter/regulator pair aztR-P _aE tA, winch can be activated by adding ΖΪΓ ⁺ ; Syneehococcas PCC 7002 smtB-PaajA which is induced b Zn ² * and corR-P _COi -x by adding Co ² *; the regulator/promoter combination which is induced by the addition ofNi' ; and the combination ofziaR- ΡζώΑ with the ziaA promoter and lite ziaR repressor which can be induced by the addition ofZxf*.

[0369] hi another embodiment, the promoter sniiA. which is endogenous to Symchococcus PCC 7942 and Syneckococcm PCC 7002, is used to control the expression of genes encoded on vectors disclosed herein. The gene smtA (SYNPCC7002_A2563), which is transcriptionally controlled by promoter snrtA, codes for a meiaJlothionein (YP_001735795.I) involved in resistance to, inter alia, zinc. A repressor protein (YP_001735796.1) binds to PsoaA i the

uninduced state and is encoded by the gene smiB (SYNPCC7002_A2564).

[0370] In an embodiment,, promoter aztA from Av baena PCC 7120 is used to control expression of genes of interest on vectors disclosed herein. In An ba ia PCC 7120. the gene aztA (alr7622) codes for a Zi\ , C f and PtT transporting ATPase (NP_478269.1) which is transcriptionally controlled by promoter aztA. Promoter aztA is blocked in the uninduced state by a repressor protein (NP_478268.1) encoded by the gene aztR (aII7621).

[0371] In an embodiment, promoter corT from Sytieekocystis sp. PCC 6803 is used to control expression of genes of interest on vectors disclosed herein. In Synechocystis sp . PCC 6803, the gene corT (slr0797) encodes a cobalt transportiiig ATPase (NP_442633.1). This gene is

transcriptionally controlled by promoter corT which is transcriptionally controlled by a regulator protein (NP_442 32J) coded by the gene corEL (sD0794) which binds to the corT promoter. The promoter corT is one example of a cobalt inducible promoter, whereas promoters ziaA, smtA, and smtB are examples of zinc inducible promoters.

[0372] In an embodiment, the tightness and the level of expression of the protein involved in a biosynthetic pathway for the production of a compound or marker protein can be improved through mutations introduced in the TATA-box, the operator sequence and/or the ribosomal binding site of the promoter controlling the recombinant gene. The sequence of the mutated promoter can have at least 90%, at least 95%. at least 98%, or at least 99% sequence identity to an endogenous promoter of ABICyanol or to another cyanobactersai promoter.

[0373] In an embodiment, a promoter disclosed herein can be an inducible promoter selected from the group consisting of P _OS A, PsatA, and ABICyanol, for example. In another embodiment, a. promoter is a constitutive promoter s lec ed from the group consi ting of P^. Pa _t , P p B a d Pp^ which can all be endogenous promoters of ABICyanol , for example.

[0374] In an embodiment, more than one recombinant gene is used in a recombinant vector. In one embodiment, a first and second recombinant gene can be controlled, by one promoter, thereby forming a transcriptional operon. In another embodiment, the first and second recombinant genes are controlled by different first and second promoters. In the case that the first recombinant gene codes for a protein catalyzing a reaction not present in the wild-type Cyanab cterimm sp. that directs the carbon flux away from the metabolic pathways of the wild-type Cyemobacteriwn sp.. such as pyruvate decarboxylase, in particular embodiments this gene is controlled by an inducible promoter such as from ABICyanol. Such a configuration ensures that the gene is only turned on upon induction.

[0375] In an embodiment, the recombinant gene under control of the promoter is induced if a sufficiently high culture densit of Cyanobacierium sp. is reached. In the case that the second recombinant gene codes for a protein catalyzing a chemical reaction present in the wild-type Cy iiobacterium sp., such as alcohol dehydrogenase, the gene can be under the control of either an inducible or a constitutive promoter because it does not disturb the carbon flux to the same extent as fee non-native protein encoded by the first recombinant gene. The second recombinant gene then may be under the control of constitutive promoters such as P¾CL, ρ«ε, or φ^., all from ABICyanol . for example.

[0376] hi an embodiment a fianscrip ion terminator is present between the first and second recombinant gene in order to ensure a separate transcriptional control of the first and second recombinant gene and to provide for a hig production of a compound of interest, such as ethanol. In certain embodiments, the present invention includes ethanologenic cassettes. In an embodiment for an ethanologenic cassette used to produce ethanol as a compound of interest, a first recombinant gene encodes pyruvate decarboxylase and the second recombinant gene encodes alcohol dehydrogenase. The first recombinant gene pdc) is under the transcriptional control of a first inducible promoter and the second recombinant gene (adh) is under the transcriptional control of a second constitutive promoter . The first inducible promoter can be selected from, for example, PnirA, P irA variants PnirA*2. PnirA*3, PairA*4, PmntC, PsnifA (Porf3 I26). Porf221 , Porf222, Porf223, Porf3 l6, Porf3232 ₅ and Porf3461 and the second constitutive promoter can be selected from, for example. PrpsL, PrpsL*4, Prbc*(optRBS), and PcpcB. The promoter ipsL (SEQ ID NO: 123} controls the transcription of me 30 S ri osonial protein SI 2 in ABICyanol and has the folio wing sequence:

GAGCTC AGAAAAACTAffTGACA^CCCATAAAAAATGAGAffAAGATtTATAGATTG TCACTGGTATTTTATACTAGAGGCAAAT ATATTTATATATACAAAAATGCTGTA TAAj

AAAL¾.CATCTCATATG-3 ^;

[0377 j The 3 -ATG is the start codon of the gene controlled by the rpsL promoter, the boxed sequence AAA A A is the riboson al binding site and the other boxed sequences are the regions for tile binding of the regulator and the TA A box,

[0378] The following modified promoter sequence PrpsL*4 (SEQ ID NO: 124) contains modifications in the regulator binding- sites and me ribosonial binding site as indicated by the bold-faced under! hied nucleotides : 5'-

GAGCTCTAGAAAAACTAfrTGACALAAC^

TCACTGGTATTTTATACTAGAGGCAAATTATATTTATATATACAAAAATGOTGTA^

LAGGAtrCAGCCATATG-3

[0379] hi an embodiment a non-nararaliy occuring ABICyanol host cell comprising any of the ethanoiogenic cassettes described herein produces ethaiiol in quantities of at least 0.0! 2% (v v) per day, at least 0,025% (V v) per day. preferably at least 0.03 % (v/v) per day, most preferred at least 0.094 % (v/v) per day . hi certain other embodiments, the transcription of both the first and second recombinant gene encoding the pyruvate decarboxylase enzyme and the recombinant gene encoding the alcohol dehydrogenase enzymes are controlled by the same single promoter . For these embodiments, an inducible promoter may be used. In such a ease, the second recombinant, gene encoding the alcohol dehydrogenase may be arranged upstream of the first recombinant gene encoding the pyruvate decarboxylase enzyme, so that transcription of the alcohol dehydrogenase gene occurs before transcription of the pyruvate decarboxylase gene. In this way. a delay in ADH enzyme expression relative to PDC enzyme expression can be avoided and a sufficiently high ADH enzyme expression level of ADH can be accomplished, so that transient aeetaldehyde accumulation is effectively reduced,

[0380] In an embodiment a transcription terminator is present between the first and second recombinant gene in order to ensure a separate transcriptional c ontrol of the firs t and second recombinant gene and to provide for a high production of a compound of interest, such as ethanoL In an embodiment for an ethanologenk cassette used to produce ethanol as a compound of interest, a first recombinant gene encodes pyruvate decarboxylase and the second recombinant gene encodes alcohol dehydrogenase, In particular embodiments, the first recombinant gene (pde) is under the transcriptional control of a first inducible promoter a d the second recombinant gene (adh) is under the transcriptional control of a second constitutive promoter. [0381] Promoter elements disclosed herein may be operably linked with any genes encoding any enzymes useful for the production of compounds of interest by using standard molecular cloning t chniqu s.

End.oge.seus promoters from ABICyanoI

[0382} In an embodiment, promoters used herein can be endogenous to ABICyanoI. In another embodiment endogenous promoters frotn ABICyanoI can be modified in order t© increase or decrease efficiency and/or promoter strength. In an embodiment, endogenous promoters used to control the expression of genes on vectors disclosed herei include, bat are not limited to promoter cpcB from ABICyanoI (SEQ ID NO: 9% promoter nirA (SEQ ID NO: 10) from

ABICyanoI , promoter IrtA (SEQ ID NO: 11) (light-repressed protein, ribosonial subimit interface protein) from ABICyanoI, promoter inrgA (SEQ ID NO: 12) (214 bp) from

ABICyanoI, promoter nblA (SEQ ID NO: 13) (338 bp) from ABICyanoI. promoter ggpS (glucosylglycerol-phosphate synthase) (SEQ ID NO: 14) (408 bp) from ABICyanoI , promoter petJ (SEQ ID NO; 15) (411 bp) from ABICyanoI, promoter ppsA (phosphoenolpyruvate synthase gene) (SEQ ID NO: 16) (211 bp) from .ABICyanoI , promoter m A. (Ribonaciease P) (SEQ ID NO: 17) (542 bp) from ABICyanoI , promoter pstS (SEQ ID NO; IS) (380 bp) from ABICya oI.

[0383} RNA-Seq experiments were conducted an ABICyano I m order to identify potential metal-ion inducible promoters in ABICyanoI. In an. embodiment, the upstream regions of metal ion responding iiidiicibie genes in ABICyanoI, listed in table 2 below, were selected to drive/control expression of an ethanologenic gen cassette i ABICyanoI. The nucleic acid sequences of the promoters are provided for in the sequence listing corresponding to SEQ ID NOs 19-41. All of the potential inducible promoters may be used for the transcriptional contr ol of at least one recombinant gene.

Table 2

ABICy alio i _orf3164 SEQ ID ferrochelatase nickel

NO: 21

ABICyano Ϊ _orf32 3 SEQ ID hypothetical protein L81 6 16134 nickel

NO: 22

ABICyano l_orf3621 SEQ ID hypothetical protein Cyaa7S22_l 798 nickel

NO: 23

ABICyanol_orf363S SEQ ID carbohydrate-selective porin nickel

NO: 24

ABICyano l_orf3858 SEQ ID manganese/iron superoxide disnrutase-iike protein nickel

NO: 25

ABICyano l orf 1071 SEQ ID Ma transporter zinc

NO: 26

ABICyanoi_<Mfi 072 SEQ ID ABC transporter family protein zinc

NO: 27

ABICyaaol_orfl074 SEQ ID ABC 3 transport fenily zinc

NO: 28

ABICyano Ϊ orfl 075 SEQ ID No hits found -f- EGG: -j- CyanoBase zinc

NO: 29

ABIC ano Ϊ orfl 542 SEQ ID hypothetical protein PCC8SQI_4423 zinc

NO: 30

ABIC ano 1 _orfl 823 S E Q ID RNA polymerase sigrna factor .zinc

NO: 31

ABICyanol_orfl S24 SEQ ID No hits found -j- KEGG: CyanoBase zinc

NO; 32

ABICyano I_orf3126 SEQ ID Metallot ionein zinc

NO: 33

ABICy alio i_orf] 389 SE Q ID Hti 2 peptidase zinc

NO: 34

ABICyaaol_orfi)221 SE Q ID CopA family copper-resistance protein copper

NO: 35

ABICyaiioi_oi-©222 SEQ ID copper resistance B copper

NO: 36

ABICyanol_orf&223 SE Q ID No Slits found -j- KEGG: -j- CyanoBase copper

NO: 37

ABICy ano l_orfD316 S E Q ID hypothetical protein CYOi 10_i 1047 copper

NO: 38

ABICyano l_orf3232 SE Q ID cation-transporting ATPase copper

NO: 39

ABICyano i_orB461 SEQ ID petJ copper

NO: 40

ABICyanoI_orf3749 SEQ ID conserved hypothetical protein cobalt

NO: 41 Codon improvement of recombinant enes

[0384] At least some of the nucleic acid sequences to be expressed in cyaiiobacteiial host cells can be codon improved for optimal expression in the target cyanobacterial strain. The underlying rationale is that the codon usage ftequency of highly expressed genes is generally correlated to the host, cognate tRNA abundance. (Buhner, Nature 325:728-730; 1987). Codon improvement (sometimes referred to as codon optimization or codon adaptation) can be perfotnned to increase the expression level of foreign genes such as antibiotic resistance genes, ethanologenic (or other compounds of interest) cassettes, and any other expressed genes on a plasniid, for example.

[0385] Codon improvement of heterologously derived genes such as genes encoding antibiotic resistance genes, and the recombinant production genes, such as genes in an ethaiiologenic cassette) was conducted using the software Gene Designer (DNA 2.0. Menlo Park, CA), and was guided by the ABICyanol codon usage table derived from libosomal proteins and highly expressed genes (such as photosynthesis genes). To improve heterologous gene expression, original sequences of interest (such as Z, mobilts pdc and Synechmysiis PCC 6803 adh) were assessed with the online software OPTIMIZER (Puigbo P. Guzman E. Romeu A. <& Gareia- Vallve S (2007) OPTIMIZER: a web server for optimizing the codon usage of DNA sequences Nti eic Acids Research 35(suppl 2):W126-W131) based on the codon-usage table derived from ABICyanol genome. The pre-optimized sequences were further modified with Gene Designer 2.0 (available at dna20.com genedesigner2 ) to ensure that their codon adaptation index (Sharp PM & Li W-H (1987).

[0386] The codon adaptation index is a measure of directional synonymous codon usage bias, and its potential applications., (se Nucleic Acids Research 15(3):1281-I295 . The effective number of co ons (see. Wright F (1 90) Gene S7(i):23-29) are designed match those of highly expressed genes (such as ribosomal proteins) in the ABICyanol genome. The resulting polynucleotides usin improved codons were further modified and optimized to avoid the presence of any known or predicted putative ABICyano ϊ endonuc!ease restriction sites (Aval, BsaHI, KasL Xhol etc.); internal Shine-Dalgarno sequence and RNA destabilizing sequences; an interna! terminator sequence: and a repeat sequence of greather man about 10 bp (see, Welch ef al., _: PLOS One 4, _: e?002; 2009; and We!c et al.. Journal of the Royal Society; Interface 6 (Suppl 4). S467-S476: 2009).

[0387] In an embodiment, the nucleic acid sequences of the recombinant genes are modified so that they will have improved expression in cyanobacteria. For example, the selectable marker gene that confers gentatnycin or kananiycin resistance was codon optimized for higher expression in cyanobacieiia.. Additionally, the selectable marker gene that confers kanamycia resistance was co es optimized for higher expression in cyanobacieria. in an embodiment, as a result of eodoii improvement, tlie GC ¾ of the antibiotic resistance genes decreased from. 40-53% to 33-40%., which is similar to that of ABICyanol coding genes (about 36% on average). The codon adaptation inde of the cod n improved antibiotic resistance genes is significantly improved from less than 0.4 to greater than 0.8, which is similar to that of ABICyanol endogenous genes.

[0388] Table 3 depicts the codon usage statistics within ABICyanol.

Table 3

Codou Fraction Number Frequency

Acid (/lOOO)

Ala GCA 0,293 20724 1S.356

Ala GCC 0.2 14 15144 13.41

Ala GCG 0. 14 9870 8,742

Ala GCT 0,353 24915 22,068

Arg AGA 0.347 16040 14,207

Ai-g AGG 0.09 4158 3,683

Arg CGA 0J 06 4886 4,328

Arg CGC 0,131 6043 5,3.53

Arg CGG 0.039 1813 Ϊ.606

Arg CGT 0,288 13329 1 1,806

Asn AAC 0,22 14609 1254

Am AAT 0,78 51712 45,804

Asp GAG 0.193 11063 9,799

Asp GAT 0.807 46399 41,098

Cys TGC 0.218 2501 2,215

Cys TGT 0,782 8976 7,95

G n CAA 0.806 43747 38,749

[0389] In a further embodiment the gene (adh) t at encodes alcohol dehydrogenase was codon improved for higher expression in cyanobacteria, namely ABICyano L and the gene (pdc) feat encodes pyruvate decarboxylase was codon improved for higher expression in cyanobacteria, namely ABICyanol. In another embodiment, the gene that encodes the GFP marker was also codon optimized for higher expression in cyanobacteria. Restriction systems is Cyan bacterium sj . ABICyanol

[0390] Restriction systems are barrier for the introduction of DNA in cyanobacteria. Foreign DNA is degraded by restriction enzymes and other non-specific nucleases during its entry into a cell. An understanding of Hie restriction systems is therefore critical in developing new transfomiatioii systems and protocols, especially in imcliai aeterized bacteria.

[0391] In a cyanobacterial cell, restriction systems occur in pairs comprising a restriction enzyme (restriction endonuclease) and a specific DNA methyiuansferase. Methylation of the restriction enzyme recognition sequence protects DNA in the cell from degradation by the corresponding restriction enzyme, hi natural systems, this is one mechanism of protecting the cell from foreign invasion.

[0392] Different cyanobacterial ceils have different restriction systems (compiled at, for example, http://rebase.neb.con.). Knowing which restriction systems exist in a given host cell can allow one to protect foreign plasmid DNA prior to entry into the ceil by treating it with either a specific methyiase, or a general niethy!ase, that allows for protection of the DNA from

degradation by the host cell's restriction eiizyme(s . This ty e of DNA methylation can provide an effective protection against restriction barriers during the tiansfomiation or conjugation process. The selection of suitable DNA methyl transferases relies on the thorough understanding of the restriction enzyme repertoire of the organism. Since restriction enzymes and DNA methylfransferases occur in pahs, identification of the restriction enzymes implies the existence and specificity of the corresponding DNA memyitransferases.

[0393] ABICyanol was found to have an endogenous restriction enzyme system. This was initially observed using sequence analysis, which predicted the presence of Aval and HgiDi (Acyl) in ABICyanol. Subsequent detection of restriction act v ty in ABICyanol crude extracts confirmed this finding. As a result of detecting restriction activity, the appropriate methylating agent can be added to protect foreign genes from being degraded soon after entry into the cell. In an embodiment, methylation is performed in vivo darin conjugation using a "helper plasmid" having genes encoding specific methylases that are capable of protecting the identified restriction sites from degradation, in another embodiment, the nucleic acid constructs to b transferred to ABICyanol are first incubated with methylases and then these methylated nucleic acid constructs are transformed into ABICyano l .

[0394] Figure 6 depicts an image of an agarose gel having under gone electrophoresis to sho w how mefeyiatioB of a plasmid only containing antibiotic resistance genes may at least partially protect it from digestion by a crude extract of ABICyanol . A plasniid incfudiiig Aval and Acyl (BsaHI) restriction s tes, was mciibated with ABICyaiiol crade extract, either with or without methylation to protect the plasniid (first plasmid: Aval; 2x, _: Acyl: 2x). From left to right: lane 1 : plasmid without crude extract, lane 2: methylated plasinid without crade extract, lane 3: plasmid with crude extract (digestion), lane 4: methylated plasmid with crude extract, Thus, as depicted in FIG. 55. the plasmid was fully protected from digestion by the methylation procedure.

[0395] Restriction enzymes whose recognition sites contain a CG stretch might be impaired or blocked in cleavage by use of the CG-methylase M.SssI which memylates cyiosine at the C5 position. Acyl and Aval, which were detected in the ABICyaiiol crude extract, recognize

GRCGYC and CYCGRG, respectively. For example, pRL52S, a. helper plasniid for conjugal transfer, as described in Elhai and Wolk, 1988, can be used for in vivo methylation of the vectors to be transferred to Cymwbacterium sp., in particular ABICyanol. Helper plasmid pRL-528 includes the M. Aval gene coding for the methyitraiisf erase protecting against tlie restriction endomiclease Aval and the respective gene coding for M. Avail. The latter is not required for transformation of ABICyanol , as it lacks Avail endoiioclease activity.

Transformed. ABICyanol

[0396] In an embodiment, genetically enhanced Cyanobacierium sp. host ceils, in particular ABICyanol host cells, include at least one recombinant gene encoding at least one protein mat is involved in a biosyntlhetic pathway for the production of compound or marker protein. In certain ernbodiments. they comprise an ethanologenic cassette. In certain embodiments,, the genetically enhanced Cyanob cietitmt host cells can be used for the production of various compounds of interest by culturmg the host cells under harsh conditions of high temperature, high oxygen levels and in the case of the compound being emanol, under high levels of ethanol in the medium. In an embodiment, a. marker protein, or reporter protein, can be a fluorescent protein, such as a red or green fluorescent protein. In an embodiment, a marker protein, or reporter protein, can be a marker gene conferring resistance to a. biocide such as an antibiotic which can be used to select for and maintain cultures of Cyanobactetium sp. host cells in the presence of othe bacterial contaminating strains,

[0397] hi another embodiment, a recombinant gene is present on an extraciiioi iosoiiial plasmid that can replicate independently from the chromosomes of the Cyanobacierium. sp, host cells such as ABICyanol . In an embodiment, the exuachromosomal plasmids described herein are present in high copy numbers in the host cells so that a compound o f interest can be produced in a high yield.

[0398] Genetically enhanced Cycmob cterhtm sp., for example ABICyanol host cells, can include farther genetic enhancements soch a s partial deletions of endogenous genes of

Cy nobacieri n sp. or other recombinant genes which can increase the overall yield of the coil-pound being produced by the host cells. For example, if the compound to be produced is ethanol, the genetic enhancements can relate to the knock out of endogenous genes coding for enzymes converting pyruvate or acetyl-CoA into a reserve or storage compound. In another embodiment, if the compound to be produced is ethanol, the genetic enhancements can relate to the overexpression of enzymes of the glycolysis pathway. Calvin-cycle, amino acid metabolism, the fermentation pathway, the citric acid cycle, and other intermediate steps of metabolism m order to increase the production of ethanol by the Cy iohactermm sp. host cells. Examples of sacfa genetic enhancements are described in PCT patent piibiicatioa number WO 2009/098089 A2 starting from page 70 and following, which is hereby incorporated by reference for this purpose.

[0399] hi another embodiment, genetic enhancements of the genes encoding enzymes of the carbon fixation and subsequent carbohydrate metabolism (for example, pathways which compete with an ethanol production pathway) can be genetically enhanced to further increase the

production of a compound of interest. Genetic enhancement targets include, but are not limited to. components of the photosystems (antennas and pigment modification), aad components of the photosynthetk and respiratory electron transport systems. Genetic enhancement targets include local and global regulatory factors including,, but not. limited to, the two component system, sigma factors, small regulating RNAs and antisense RNAs.

[0400] In an embodiment, Cyanobacteiimn sp. host cells, e.g.. ABICyanol host cells, contain knockout mutations of endogenous genes that do not affect the toleration of being cultured in at least one of the following conditions: i % (v/vj ethanol in the medium for at least. 6, 12 or 16 weeks; 48 °C, 50 °C, 53 to 55 °C for at least 2 hours per day over a time period of at least 7 days, purging with 60% to 80% (v v) oxygen (resulting in oxygen concentrations of up to 1000 μηιοΙ L in the culture during the day). Compounds of interest p duced by ABICyanol

[0401] In certain embodiments, a variety of different compounds of interest can be produced using genetically enhanced ABICyanol host cells. Plasmid vectors disclosed herein (e.g., derivatives of 6,8) can be used to cany a g ne or genes involved in various biosyiifheti

pathways that produce a compound of interest in the ABICyanol cell. Exemplary compounds of interest include, but are not limited to. organic carbon compounds, alcohols, fatty acids, oils, earotenoids, proteins, enzymes, biofuels, nuUaceiiticals, pharmaceuticals, and the like. Additional nfonnatioii o -compounds feat can be produced from cyanobaeieria can be found, for example, in PCT/EP2G09/0GGS92 and in PCT/EP2009/060326, both of which are incorporated by reference herein in their entirety . Genes involved in .th biosyiithetic pathway for the production of a compound of interest can be inserted into the vector.

[0402] In one enibodiment, propa ol and butanol are compounds of interest. Similar to ethanol, they can be produced by fermentation processes. In certain embodiments, genes encoding enzymes involved in isopropanol and isobutanol fennentation are incorporated into recombinant vectors and transformed into ABICyanol. Examples of enzymes invoked in isopropanol fermentation include aeeiyi-CoA acetvitransferase (EC 2.3.1.9), acetyl- CoA:aeetoaeetyl-C A transferase (EC 2.8.3.8), acetoacetate decarboxylase (EC 4.1.1.4) and isopropanol dehydrogenase (EC 1.1.1.80). Examples of enzymes involved in isobutanol fermentation include acetolactate synthase (EC 2.2.1.6), acetolactate rediicteisoinerase (EC I . L i.86), 2,3-dihydroxy-3- methylbutanoate dehydratase (EC 4.2.1 ,9). -ketoisovalerate decarboxylase (EC 4..1.L74). and alcohol dehydrogenase (EC 1 , 1.1.1),

[0403] In another embodiment, ethylene is produced as a compound of interest, in an

embodiment, at least one recombinant gene encodes an enzyme for ethylene formation, Examples of enzymes involved in the production of ethylene include ethylene forming enzyme 1- aminocyclopropane-1 -carboxylate oxidase (EC 1.14.17.4), which catalyzes the last step of ethylene formation, the oxidation of i-an iocyclopropane-i -carboxyiic acid to ethylene. The substrate for the ethylene forming enzyme is synthesized by the enzyme l-amiiiocyclopropane-i- carboxylic acid synthase (EC 4.4,1 ,14) from the amino acid methionine.

[0404] In another embodiment, the compound of interest, is isoprene. In an embodiment the recombinant vector used to transform cyanobacterial host cell fox the production of isoprene includes at least one recombinant gene encoding an enzyme such as isoprene synthase. Isoprene synthase (EC 4,2.3.27) catalyzes the chemical reaction from dknethylallyl diphosphate to isoprene and pyrophosphate.

[0405] hi another embodiment, compounds of interest are terpenes and terpenoids. Terpenes are a large and very diverse class of organic compounds, produced primarily by a wide variety of plants, particularly conifer's. Terpenes are derived biosynthetieally from units of isoprene and are major bios niheiic building blocks in nearly every living organism. For example, steroids are derivatives of the trirerpeiie squalene. When terpenes are modified chemically, such as by oxidation or rearrangement of the carbon skeleton, the resulting compounds are generally referred to as terpenoids. Terpenes and terpenoids are the primary constituents of the essential oils for many types of plants and flowers. Examples of biosynthetie enzymes are faraesyl diphosphate synthase (EC 2.5.1.1), which catalyzes the reactio of d nethylaUyl diphosphate and isopentenyl diphosphate yielding famesyl diphosphate. Another example is geranylgeranyl diphosphate synthase (EC 2.5.1.29), which catalyzes the reaction between irmisfaniesyl diphosphate and isopentenyi diphosphate yielding pyrophosphate and gexaiiylgeranyl diphosphate.

[0406] hi and embodiment, the compound of interest is hydrogen, and the recombinant genes can, for example, encode for hydrogenase. in an embodiment, hydrogenase is an enzyme catalyzing the followin reaction; 12H ^÷ + l2 . _tS vi£— 6 Hi + 12Χ _∞ _ Βζ _β< ί _ί where X is an electron carrier such as ferredoxm.

[0407] In an embodiment examples of compounds of mterest mclude non-ribosomal peptides ( RP) and the polyketides (PK). These compounds are synthesized by plants, fungi and only a few bacteria such as actinomyceies, myxobacteria and eyaaobacteria. The are a group of structurally diverse secondary metabolites and often possess bioacti ines that are of

pharmacological relevance. Hybrids of non-ribosomal peptides and polyketides also exist, exhibiting both peptide and polyketide parts. Recombinant genes for the production of non- ribosomal peptides as compounds of interest. are encoded b , for example, gene clusters encoding for non-ribosomal peptide synthetases (MRPS). RPS are characteristic modular multidornain enzyme complexes encoded by modular non-ribosomal peptide synthetase gene clusters .

Examples for non-ribosomal peptide synthetases are actinomycin synthetase and gramicidin synthetase.

[0408] In an embodiment, polyketides are compounds of interest. In general, there are two distinct groups of polyketides, the reduced polyketides of type I, macrolides, and me aromatic polyketides of type II. Type I polyketides a e synthesized by modular polyketide synthases (PKS), which are characteristic modular niuif idoiiiain enzyme complexes encoded by modular P S gene clusters. Examples for recombinant genes useful for encoding enzymes for the production of type I polyketides are the rapamycm synthase gene cluster and the oleandomycin synthase gene cluster. One example for a recombinant gene fox type Π polyketides is the aciinorhodin polyketide synthase gene cluster.

[0409 j In another embodiment, hybri ds of polyketides and non-ribosonial pepti des are

compounds of interest Examples for recombinant, genes for the production of hybrids of

polyketides and non-ribosonial peptides are the microcystis synthetase gene cluster, microginm synthetase gene cluster, and myxothiazole .synthetase gene cluster.

[0410] In another embodiment, alkaloids are compounds of interest. Alkaloids are a group of compounds containing mostly basic nitrogen atoms and which are synthesized by man

organisms, incliiding plants. Alkaloids have highly complex chemical structures and pronounced pharmacological activities. Examples for biosynflietie enzymes for alkaloids which ca be encoded by recombinant genes for the production of the compound are strietosidine synthase, which catalyzes the reaction of tiypta me and secologanin to form 3a(S)-striciosidine.

Strietosidine is a precursor for the biosynflietie pathway of ajmaliiie and it also initiates all pathways leading to an entire monoterpene indole alkaloid family . Another example of an enzyme thai could be encoded by a recombinant gene is strictosidine giucosidase from the ajmaliiie biosynthetic pathway. This enzyme is able to activate strictosidine by deglycosyiatioii. thus generating an aglycon which is the precursor for more than.2,000 monoterpenoid indole alkaloids.

[0411] In an embodiment additional examples of enzymes encoded by at least one recombinant gene are ( ,S)-3 ^, -liydi-oxy-N-metliykoclaiirine 4 ^> -0-methyltransferase (4ΌΜΤ) which is central to the biosynthesis of n osf tetrahydrobenzyHsoqiihiolki-dei ed alkaloids; bexberine bridg enzyme (BBE) of the sangiunarine pathway; (R,S)-refieuime 7-O-metiryltraasferase (70MT) part of iaiidanosine formation; as well as salniaridinol 7-O-aceryitransferase (SalAT) and codeiiione reductase involved in the production of morphine.

[0412] In yet another embodiment, vitamins are compounds of interest. Vitamins are organic compounds mat are essential nutrients for certain organisms and act mainly as cofactors in enzymatic reactions but can also have further importance, e.g. as antioxidants. In plants, vitamin C can be made via the L-ascorbic acid (L-AA) biosynthetic pathway starting from D- glucose. In an embodiment recombinant genes encoding for enzymes mvolved in vitamin C synthesis are disclosed and include Iiexekiiiase, glucose-6-phosphate isomerase. maimose-6-phosphate isomerase, phospho annoniutase, mannose- 1 -phosphate guanylyitramferase. GDP-mamiose-3,5- epimerase. GDP-L-ga!actose phosphorylase, L-galacfose 1 -phosphate phosphatase, L-galactose dehydrogenase, and L-galactono-i,4-lactone dehydrogenase.

[0413] In another embodiment amino acids are conf unds of interest Amino acids as compounds of interest include naturally occurring amino acids as well as amino acid derivatives.

[0414] In an embodiment lactams are compounds of interest. Lactams are cyclic amides and the prefix indicates how many carbon atoms (apart from the earbo ryl moiety) are present in the ring. For example, β-lactam (2 carbon atoms outside the earbonyl, 4 ring atoms in total), γ-lactam (3 and 5). -lactam (4 and 6), One example for a γ-lactam is pyrrohdone, a colorless liquid which is used in industrial settings as a high-boiling, non-corrosive, polar solvent for a wide variety of applications. Pyrrolidine is also an intermediate in the manufacture of polymers such as polyvmylpyn jlidone and po!ypyrro!idone.

[0415] In another embodiment, ethers are compounds of interest. Ethers are a class of organic compounds that contain an ether group, an oxygen atom connected to two alkyl or aryl groups of general formula R-O-R. An example of an ether is f etrahydrofuran (THF) which is a colorless, water-miscible organic liquid. THF is a heterocyclic compound and is one of the most polar ethers miseible in many solvents, THF is also useful as a solvent and as a precursor to polymers. Oilier examples of ethers that are compounds of interes include natural occurring ethers such as divinyl ether oxylipins. Enzymes involved in the biosynthesis of divmyl ether oxylipins include lipoxygenase and divinyl ether synthase.

[0416] In yet another embodiment, alkanes (also known as saturated hydrocarbons) are compounds of interest. Alkanes consist only of the elements carbon (C) and hydrogen (H), i.e. hydrocarbons. When the carbon and hydrogen atoms of alkanes are linked together exclusively by single bonds, the alkanes are saturated alkanes. Each carbon atom must have 4 bonds (either C-H or C-C bonds), and each hydrogen atom must be joined to a carbon atom (H-C bonds). The simplest possible alkane i methane, C¾. There is no limit to the number of carbon atoms that can be linked together. Alkanes, observed throughout nature, are produced directly from fatty acid metabolites. A two gene pathway, widespread in cyanobacteria, is responsible for alkane biosynthesis. In an embodiment, these genes may be part of the recombinant vector and include genes encoding for acyi-ACP reductase (EC 1.3.1.9) whic converts a fatty acyt-ACP into a fait}' aldehyde that may subsequently be converted into an aJkane alkene by an aldehyde decaiboiiylase (EC 4.1.99.5).

[0417] In an embodiment, biopo!ymers such as polyhydroxyalkanoates (PHAs) are compounds of interest. PHAs are linear polyesters produced in nature by bacterial fermentation of sugar or lipids. They are produced by the bacteria to store carbon and energy. The simplest and most commonly occurring form of PHA is the fermentative production of poly-3-hydroxybufyrate P3HB) but many other polymers of this class are produced by a variety of organisms. PHAs include poly-4 iydrox>¼ityrate (P4HB), polyhydroxyvaleraie (PHV), polyhydroxyhexanoate (PHH). polyhydroxyoctanoate (PHO) and their copolymers.. In an embodiment, recombinant genes encoding for enzymes involved in P3HB synthesis are part of recombinant vectors . These genes include gen.es encoding β-ketothioiase (EC 2.3.1.9) that produces acetoacetyJ-CoA which is converted to {R)-3-hydroxybirtyryi-CoA (3HBCoA) by NADPH-dependent aeetoaceryl-CoA reductase (EC 1,1.1.36). The 3HBCoA is subsequently poiymerized by poly(3-lry hOxyalkanoate) synthase (EC 2.3.1) and is converted to P3HB.

[0418] hi an embodiment, esters, including fatty acid esters, are a compound of interest. Simple esters with lower chain alcohols (methyl-, ethyl-, n-propyl-, isopropyl- and bury! esters) are used as emollients in cosmetics and other personal care products and as lubricants. Esters of fatty acids with other alcohols, such as sorbitol, ethylene glycol, diethylene glycol and polyethylene glycol are consumed in foods, personal care, paper, water treatment, metal working fluids, rolling oils and synthetic lubricants. Fatty acids are typically present in the raw .materials used for the production of biodiesel A fatty acid ester (FAE) can be created by a transesterifieation reaction between fats or fatty acids and alcohols. The molecules in biodiesel are primarily fatty acid methyl esters FAMEs, usually obtained from vegetable oils by transesterifieation with methanol. The esterification of the ethanol ith the acyl moieties of coenzyme A thioesters of fatty acids can be obtained enzymaticalty by a nonspecific long chain alcohol O-fatry-acyltransferase (EC 2.3.1.75) from Aci tabacter baylyi strain ADPI, for example.

[0419] In an embodiment, Cyanobacterium sp. host, cells naturally contain the entire sequences of recombinant genes coding for enzymes used for the production of a compound of interest In another embodiment, the Cyanobacierium sp. host ceil contains the entire sequences of recombinant genes that encode for all of the enzymes used in a. cascade of enzyniatically catalyzed reactions thai results in the production of a compomid of interest. [0420] In an embodiment a firs* protein encoded by a first recombinant gene can produce a. first intermediate which is further converted by a second protein encoded by a second recombinant gene into a second intermediate, whic then in turn is further converted by a third protein encoded by a third recombinant gene into a third intermediate such that a sequenc of r eactions provide intermediates for the next enzyme leading to the eventual production of a compound of interest In an embodiment, the recombinant genes encoding for the enzymes that catalyze the sequence of reactions can be introduced into ABICyaaol or other Cymwbactemmt sp. host cells.

[0421] In an embodiment the compounds of interest tha t are prodiiced from recombinant ABICyanol can be removed intermittently as the culture grows, or the compounds can be separated at. the end of a batch growth period. The cultures can be grown indoors, or can be grown outdoors in enclosed containers such as bioreaetors, or in another suitable type of

container.

Production of ethanol in ABICyanol

[0422] hi an embodimen th 6.8 kb endogenous plastnid vector from ABICyaiiol is genetically enhanced to include recombinant genes encoding for enzymes that produce a compound of interest, in an embodiment, the 6.8 kb endogenous plasmid vector from ABICyanol is used as the backbone of a vector useful for introducing exogenous polynucleotides into non-naturally occurring ABICyanol organisms for the productio of a compound of interest

[0423] Li an embodiment a compound of interest is ethanol, and the genetic enhancements to ABICyanol include transforming with a p6.8 based vector that comprises on or more

recombinant genes encoding for an enzyme used in ethanol production. In an embodiment the genes are adh and pdc. The gene pdc encodes for pyruvate decarboxylase (PDC), winch catalyzes the mterconvemon between pyruvate and acetaldehyde. The gene adh encodes for alcohol dehydrogenase (ADH) which catalyzes the interconversioii between acetaldehyde and ethanol. Thus, PDC and ADH act in concert to produce ethanol In another embodiment, the gene is adhE which encodes for AdhE enzyme (alcohol dehydrogenase E) which catalyzes the interconversion between acetyl-coenzyme A and ethanol.

[0424] Et anol prodiiced by non-naturally occurring ABICyaii l organisms can be measured by any means well blow in the ait, In an embodiment, ethanol prodiiced by ethanoiogenic non- natorally occurring ABICyano l organisms is measured using gas cinematographic analysis of a growth media and/or the headspace above a growth media. [0425] In an embodiment PDC activity is measured by a photometric kinetic reaction that can be monitored at 340 am using a spectrophotometer. Pyruvate is enzymatically converted to acetaldehyde by pyruvate decarboxylase, which is reduced to efeanol by ethanot dehydrogenase under NADH oxidation. In an embodiment, the PDC enzyme activity is related to the protein content and expressed as the specific activity of PDC,

[0426] In particular embodiments, the ADH enzyme is, for example, a Zn ^±T -dependent alcohol dehydrogenase such as AdhX from Zymomonas mobilis (ZmAdh) or the Adh enzyme from

Synechocysiis PCC 6803 (SynAdli encoded by the synadh gene). Alternatively or in addition, the enzyme is an iron-dependent alcohol dehydrogenase (e.g. Adhfi from Zmobi is). The Zi ^÷ - dependent alcohol deiiydrogena.se can, for example, be an alcohol dehydrogenase enzyme having at least 60%, 70%, 80%, 90% or even more than 90% sequence identity to the amino acid sequence of ΖΆ ^1÷ dependent alcohol dehydrogenase from Smechoeystis PCC 6803. Relative to other alcohol dehydrogenases, SynAdh (annotated open reading frame sir! 192 from the

Symckocystis PCC 6803 genome) favors higher overall ethanol production because the reduction of acetaldehyde to ethane! is preferred to the reaction from ethanol to acetaldehyde. Thus, in an embodiment a. SynAdh encoding recombinant gene is useful for production of ethanol in a host cell.

[0427] AdhE is an iron-dependent bifoiictional enzyme that intercenverts acetyl coenzyme A to ethanol. One characteristic of iron-dependent alcohol dehydrogenases (e.g. AdliE and Adlill) is their sensitivity to oxygen. In an embodiment. AdhE used to transform ABICyanol is derived from theniiophilic organisms such as T ermosyn chococats e ngahts BP-L In another embodiment. AdhE is from E. coli. In the case of AdliE from E. a mutant was described that exhibited alcohol dehydrogenase activity under aerobic conditions, see Holland-Staley et al., J Bacterid, 2000 Nov; 182 (21} ^* .6049-54. The: E568.K AdhE mutant ofthe , coli AdhE was active both aerobic-ally and anaerobieaHy. Thus, in a embodimen site-directed mutants of various AdhE enzymes could impart catalytic function to AdhE enzymes under both aerobic and

anaerobic conditions in genetically enhanced ABICyanol host cells.

[0428] In an embodiment, pyruvate decarboxylase can, for example, be from Zymomonas mobilis, Zymobacter palmm or the yeast S cchoromyces cer isi e. In an embodiment, nucleic acid sequences, protein sequences and properties of ethanologenic enzymes such as alcohol dehydrogenases and pyruvate decarboxylases disclosed herein, can be found within PCT patent application WO 2009/098089 A2. which is hereby incorporated for this purpose. [0429] In an embodiment, PDC and: ADH are expressed in a genetically enhanced ABICyanol that produces ethanol. In an embodiment additional genes that are involved in iosyiiihetic pathways are inserted For example, FIG. 7 depicts a map of the plasmid construct TK225 (pABICyaaol -6.8 Pn rAABICyanol-PDC(optl)-synADH(optl)-PrbcABICymo i-Km**-oriVT). Its nucleotide sequence is SEQ ID NO: 42, from Cyanob cteri m sp. ABICyanol runs loin nucleotides 3574 to 4099, the codon improved kanamycin resistance cassette Km** is located from nucleotides 4101 to 4916, the origin of replication and transfer oriVT is located from nucleotides 5159 to 6217 in an antisense direction, P _iliiA runs from nucleotides 96 to 378, the codo improved variant of SyiiAdh denoted "synADH" is located from nucleotides 2203 to 3210, the codon improved variant from pyruvate decarboxylate runs from nucleotides 379 to 2085. The genes can be codon optimized for optimal expression in ABICyanol and can utilize any suitable promoter and regulatory sequences .

Edtanologenic cassettes

[0430] hi a embodiment ethanoiogenic cassettes are introduced into ABICyanol host cells and those ABICyanol host cells are us d for the production of ethanoL Ethanoiogenic cassettes disclosed herein vary in promoters used as well as the source of adh and pdc genes.

[0431] In an embodiment, a emanologenic gene cassette is codon-opfiniized for ABICyanol . As described in the examples, two different codon-opfimized ethanoiogenic gene cassettes were used for the transformation of ABICyano l and subsequent production of ethane], pdc(opt l )- synadh(optl). and pde(opt3)-synadh(opt3). The pdc genes were derived from the Z. mobi s pdc and the adli genes from S nechocysiis PCC 6803 adh. Optimization of the optl version was manually codon optimized by replacing all rare codons for one amino acid by the most frequently occurring codon for that amino acid based on ABICyan l codon usage. The ethanoiogenic gene cassette opt3 was optimized using a two-step process which involved two programs (Optimizer and GENE designer DNA 2.0) which led to codon optimization similar to the codon usage of ABICyanol.

[0432] In an embodiment, and as depicted in table 4, ethanoiogenic plasmids derived from p6.8 and containing an ettianologenic cassette are used for the transformation of ABICyanol . Table 8 also depicts the ethanol production in transformed ABICyanol ceils. The ethanol production was measured in GC vials. These plasmids of table 4 contain various configurations of ethanoiogenic cassettes, having a gene encoding PDC and a gene encoding ADH. Various promoters, as listed in table 4 below, were used. Also, tlie genes were codoii improved for expression in. ABiCyaaol . Different origins of tlie genes from various organisms are also noted in table 4. Any of the etliano!ogenic cassettes may be preseiif in modified organisms of tlie present invention.

Table 4

zniPDC ABICyano 1 (o S)-?^, _!,

FIG. 12 ABICyano 1 -ADH ABlCyanol

SEQ ID NO: 47 (opt3)_ter-P _ite ABICyano 1- ni**

#1578 ABICya ol- -P^A ABICyano 1- 0.031

zmPDC ABlCyanol (opt3)-dsrA- FIG., 13 P-^*(opiRBS)-synA H\oc¾ -P _t¾c

SEQ ID NO: 48

ABICyano 1 -Km* *

#1581 p ABIC ano 1-6.S:: Ρ _Β ½Α ABICyano 1 - 0.030

zniPDC ABICyano i (opi3)-dsrA-P _ipsjL

FIG.. 14 ABICyano 1 -ADH ABICyano 1

SEQ ID NO; 49

(opl3) ter-Pjfe ABICyano! -Km**

TK441 pABICyanol-6.8: iPp^ ABICyano 1 - 0.017

PDCoptl-P _ipSLL ABlCyanol -

FIG.. 15 synADHopt I -Pax ABICyano 1 -Km* * -

SEQ ID NO; 50

oriVT

[0433] Figure 16 depicts a map of the plasmid construct # 1629 ^ABICyanol-6.S::PnirA(opt2)- zniPlX (op i)_dsrA-Pri c*(opti S)^ynADH(opf I)Jer^ (SEQ ID NO; 5 } including the endogenous mi Ά promoter from ABlCyanol with an unproved ri osomal binding site

(nucleotides 1 to 287 of SEQ ID NO; 51} in comparison to the respective native promoter. This modified promoter controls the transcription of a ile gene, which can be codon im rove ,

[0434] Figure 17 depicts a map of the plasmid construct # 1636 (ρΑΒΙ€¾¾ηο1^.8;:ΡηίίΑ*3- zmPlX:(op l)_dsrA-M c*{optimS)^yi-ADH(opfl)Jer) (SEQ ID NO: 52) including the endogenous nil A promoter from ABICyano 1 with an improved binding site fas- the regula tors NtcA and NtcB and an improved TATA box (nucleotides 6 to 283 of SEQ ID NO; 52) i comparison to the respective native promoter. This modified promoter controls the transcription of a pdc gene, which can be codon improved.

[0435] Figure 18 depicts a map of the plasmid construct ^■ # 1630 {pABICyanol-6.8:;corR- PcorT* I -zmPIX (opti)_dsrA-Prtw*(optRBS synADH(optl)_ter) (SEQ ID NO: 53} including the endogenous corT promoter from S nechacystis PCC 6803 with an improved ribosomal binding site (nucleotides 1 1 8 to 1247 of SEQ ID NO: .53) in comparison to the respective native promoter. This modified promoter controls; the transcription of a pdc gene, which can be codon improved. [0436] Figure 19 depicts a map of the p!asmid construct ^■ # 1631 (pABICyaiiol-6.S: :corR- PeorT*2-zmPDC(opt!)_dsrA-Pr c*(opt BS)-synADH(optl)Jer) (SEQ ID NO: 54) including the endogenous corT promoter fro Synechacystis PCC6S03 wife an improved TATA box

(nucleotides 1169 to 1247 of SEQ ID NO: 54) in comparison to the respective native promoter. This modified promoter controls the transcription of a pdc gene, which can be eodon improved.

[0437] Figure 20 depicts a map of the plasmid construct # 1632 (pABICyanol-6.8:xorR.-

including the endogenous corT promoter from Symcfwcpsiis PCC6S03 with an improved TATA box and ribosoinal binding site (nucieo tides 1169 to 1247 of SEQ ID NO: 55) in comparison to the respective native promoter. This modified promoter controls the transcription of a pdc gene, which can be eodon improved. The nucleotide sequence of he plasmid is depicted in FIG. 37 including the annotation of the genes and promoters done with the program vector NT!..

[0438] Figure 21 depicts a map of fee plasmid construct # 1635 (pABICyaaol-6.S:.:sintB-PsmtA- zniPDC(optl)_dsiA-Pi¼*(o|:ttRBS)-s iiADH(opi i)_ier) (SEQ ID NO: 56) including the native smtA pmaioter from. Synechococciis PCC7G02 (nucleotides 480 to 581. of SEQ ID NO: 56). This promoter controls the transcription of a pdc gene, which can be eodon improved,

[0439] Figure 22 depicts a map of fee plasmid construct # 1639 (pABICyanol-6.S::smtB- (SEQ ID NO: 57) mchiding a. modified smtA promoter from Sy chococcws PCC7Q02 which includes a modified RBS

(nucleotides 394 to 494 of SEQ ID NO: 57) in comparison to the native promoter. This modified promoter controls the transcription of a pdc gene, which can be eodon improved.

[0440] Figure 23 depicts a map of fee - plasmid construct # 1.640 (pABICyanol -6.8 : :smtB- PsmtA*2-zmPDC( pti)_d¾A-F^*(optRBS)-^4DH(optl)_ter ) (SEQ ID NO: 58) including a modified smiA promoter from Syn chococc s POC7002 which includes another modified RBS (nucleotides 393 to 494 of SEQ ID NO: 58) in comparison to the native promoter. This modified promoter controls the transcription of a pdc gene, which can be e odon improved.

[0441] Figure 24 depicts a sequence comparison between the native promoter nil A from

ABICyaaol and different variants of the promoter harboring nucleotide changes in the rib-osomal binding site, the binding sites for the regulators NtcA and NtcB and fee TATA bos. These promoters are included in fee plasmids # 1606 (pABICyaaol : :PnirA-zniPDC(optl)_dsrA- Prbc*(optRBS)-syiiADH(optI)_ter ) (FIG. 25) (SEQ ID NO: 59), #1629 and #1636. [0442] Figure 25 depicts a map of the p!asmid construct #1606 pABICyanoi-6.8::PnirA- zmPDC(opi 1 )_dsrA-Prbc*(optRBS)-syiiADH{op« )Jer) (SEQ ID NO: 51) including the endogenous sir A promoter from ABICyanoi (nucleotides 1 to 287 of SEQ ID NO: 51), This promoter controls the transcription of a pdc gene, which, in an embodiment can be codon improved.

[0443] Figure 26 depicts a nucleotide sequence comparison between different corT promoters including the native promoter from Syn chocystis PCC 6803 and variants containing nucleotide changes in the TATA box, ribosomal bind ng site and the binding sites for the regulator corR is also depicted in FIG. 26. The promoters depicted in FIG. 26 axe part of plasmids #1630. #1631 and #1632.

[0444] Figure 27 depicts a nucleotide sequence comparison between the native smtA promoter from Synechococcus PCC 7002 and two different variants of the promoter containing mutations in the ribosomal binding site. These promoters are part of plasmids #1635, #1 39 and #1640.

[0445] Figure 28 depicts the ethanol production normalized to the growth (OD750 _B01 ) determined by the CGvia! method for ABICyanoi strains transformed with the plasmids #1606, plasmid #1629 and plasmid #1636 cultivated in 0.5L PBRs for a period of time of at least 20 days.

[0446] Figure 29 depicts the specific activity of PDC determined by the CG vial method for ABICyanoi steins transformed with the plasmids #1606. plasmid #1629 and plasmid #1636 for a period of ^' time of about 20 days.

[0447] Figure 30 depicts the specific activity of ADH determined by the CG vial method for ABICyanoi strains transformed with the plasmids #1606. plasmid #1629 and plasmid #1636 cultivated in 0.5L PBRs for a period of time of about. 20 days.

[04481 Figure 31 depicts the ethanol production normalized to the growth (OD?¾ .) determined by the CG vial method for ABICyanoi strains transformed with the plasmids plasmids # 1606, plasmid #1 31 and plasmid #1 32 cultivated hi 0. L PBRs for a period of time of at ieast 20 days.

[0449] Figure 32 depicts the specific activity of PDC determined by the CG vial method for ABICyanoi strains transformed with the plasmids # 1606, plasmid # 1631 and plasmid # 1632 cultivated in 0.5L PBRs for a period of time of at least 20 days.

[0450] Figure 33 depicts the specific activity of ADH determined by the CG vial method for ABICya oi steins transformed with the plasmids # 1606, plasmid # 163! and plasmid # 1632 cultivated in 0.5L PBRs for a period of time of at least 20 days.

Si. [0451] Figure 34 depicts the production of ethane! and acetaldeliyde determined by the GC vial assay method from Cywiobactermm sp. ABICyanol strains containing either one of

ethanologenic plasmids TK293 and T 225.

[0452] Figures 35A to 35D depict the ethano. production rate, acetaldeliyde accumulation and

ADH and PDC activities of about a 15 day cultivation of Cyanobacterittm sp. ABICyanol containing tiie ethanologenic plasmid T 225. Panel A depicts etiianoli production (percent ethanoi per volume per day) panel B depicts acetaldeliyde (percent /v), panel C depicts PDC enzyme activity over time, and panel D depicts ADH enzyme activity over time.

[0453] Figures 36A to 36C depict ethanoi production rate, cell growth and maximum, ethane! production rate for 7 days from a 1 day cultivation of Cycmobaeterium sp. ABICyanol

containing the ethanologenic plasmid TK293.

[0454] Figure 37 depicts the ethane! production rates and the acetaldeliyde accumulation determined by the GC vial method for Cy nobacieri m sp. ABICyano i strains variously containing different ethanologenic piasnridsTK293, # 1495. # 1.578 and # 1581 that were cultivated for 40 hours.

[0455] Figure 38 depicts and compares (in t e left panel) the PDC enzyme activity and (in the right panel) the ADH enzyme activity between ABICyanol host cells each containing one of the plasmids TK293. #1495, #1578, and #1581.

[0456 j In an embodiment, transformed ABICyanol ceils containing ethanologenic cassettes are grown under inducing conditions in rnBGl 1 medium, and may be tested for ethanoi production. ABICyanol containing the pksmids TK293 and T 225 produced 0.086% (v/v) and 0.019% (v/v) ethanoi, respectively, over a 50 h period in an online GC vial system (FIG. 34). Cultivation of ethanologenic ABICyanol cells was performed in 0.5 L round PBR glass vessels containing marine BG11 culture medium, pH was controlled vi CO2 flux. Cell growth and ethanoi

production are shown in FIG. 35 and FIG. 36 for ABICyanol containing ^' TK225 and T 293, respectively,

[0457] Genetically enhanced ABICyanol containing extrachromosomal plasinids with a pdc gene under the transcriptional control of either the native nirA promoter, or modified variants thereof, were cultured in 0.5 L photobioreactors. These enhanced ABICyanol variously contained plasmids #1606. #1629 and #1636. Figure 28 shows the ethanoi production normalized to growt (ODTJ& _BO ) as determined by the CG vial method for ABICyano I transformed with plasmids # 1606 (a pdc gene under the control of the native PS _B A), plasniid # 1629 (a pdc gene

S2 under the control of a. variant of Ρ,^Α with changes in the RBS) and p!as nid # 1636 (a. pdc gene under the control of a modified variant of P^A with changes in the operator sequence and the TATA box). Ethanol production was measured over a period of at least 20 days after induction. Induction ofPa _kA was realized by transition of the pre-enSture to niBGI i medium containing nitrate for induction at the beginning of the cultivation experiment, Figure 28 depicts that the normalized eihanoi productio is higher for ABICyanol containing the pSasmkis with modified promoters. Figures 2 and 30 depict the specific activity of PDC enzyme and ADH enzyme during the course of cultivation. The inducible, modified nirA promoter variants PnirA*2 (#1 29) and PnirA*3 (#1636) result in higher activity of PDC enzyme compared to the native promoter (#1606).

[0458] In an embodiment a petJ promoter endogenous to ABICyanol was identified and farther characterized. Expression of P _p ^ is tightly repressed under high copper (ί-3 μΜ) conditions and induced under copper depletion as depicted in FIG. 39 A. An ABICyano l TK441 strain having the endogenous P _p es upstream o f an ethanologenk gene cassette produced the same amount of ethanol (percent v/v) under copper depletion conditions as compared to an ABICyanol TK293 strain grown in marine BG11 (FIGs. 39A and 39B).

[0459] Figure 31 depicts ethanol production, as determined by the GC vial method, normalized to growth, as represented by absorbance at OE sofnu, for ABICyanol transformed with plasmids #1606 (a pdc gene wilder the control of ^' the native P^A) . plasmid # 1631 (a pdc gene under the control of a modified P _cor x with modifications in the TATA box) and piasmid #· 163:2 (a pdc gene under th control of a modified P _corX with modifications in the TATA bo and the RBS). Ethanol productio was measured for a period of time of at least 20 days while the cells were cultured in 0.5 L photobioreactors. The value for ethanol production of ABICyanol transformed with piasmid #1606 is close to the value for ethanol production of ABICyanol transformed with piasmid #1 32. The ethanol production of the ABICyanol transformed with piasmid #1631 exhibits a. lower ethanol production rate than ABICyanol transformed with plasmids #1606 and #1632, especially in the time period starting from about the tenth day of cultivation.

[0460] Figures 32 and 33 depict the specific activity of PDC enzyme and ADH enzyme during the course of cultivation. ABICyanol transformed with plasmids #1632 and #1606 demonstrated higher activity of PDC enzyme man ABICyanol transformed with piasmid #1631.

[0461] Figures 40. 41 and 42 depict the ethanol production rates of the ABICyanol transformed with piasmid #1635, or piasmid #1639, or piasmid #1 40, respectively. ABICyanol strains

S3 contahiing plasmid #1635, or plasinid #1639. or piasmid #1640 all include the native P^A from Syneehococcus PCC 7002 as well as modified versions of Ρ _ΒΠΛ Α- Figures 40, 41 and 42 demonstrate that the promoters are repressed in the absence of Zn ^* and can be induced upon addition of Zn ² *

[0462] In an example, modified vectors such as TK293, and #1536, as described herein, each containing an ethanologenic cassette and an antibiotic resistance gene under the transcriptional control of an ABIC anol and/or an endogenous promoter of Syne.chococa.ts PCC 7602, respectively, are transformed into Syneehococcus PCC 700:2 using electroporation, conjugation or natural uptake. The transfoniiants are selected for on an agar plat using the appropriate antibiotic. The putative transfomiants ar then confirmed by PCR analysis. Positive cells are streaked and scaled up to grow as a culture. Ethane! production is measured. By use of this method, et anol would he produced using a p6.8 derived vector containing an ethanologenic cassette using organisms other than those of the genus Cy nobacier m and/or ABICyanol .

Continuous production of ethanes!

[0463] Figure 164 depicts the growth of T 293 (OD at ?50nm) which lias an ethanologenic cassette with, a pdc gene under control of the nirA promoter. As depicted in FIG. 164, TK293 was cultivated in a 0.5L Crises PBR system, and illuminated with 450μ.Ε *m ^' *s ^"1 from two sides depicts. In FIG. 164, the red arrows indicate dilution steps conducted in order to keep the culture productive.

[0464] Figure 165 depicts the ethanol production of the non-natorally occurring ethanologenic ABICyanol strain T 293 which has a ethanologenic cassette with a pdc gene under control of the nirA promoter. As depicted in FIG. 65, a single inoculum of TK293 was cultivated in repeated dilutions in a 0.5L Crison PBR system ilhtminated with 450μΕ *ni ^" *s ^"! from two sides. In an embodiment, FIG, 165 depicts ethanol production from a single inoculum of T 293 over the course of 120 days, hi an embodiment, about 2.89% (vol νοί) ethanol per bioreactor volume is produced as calculated by the sum of increase in percent ethanol (vol/vol) for each batch wherein all batches are derived from a single TK293 inoculum, hi an embodiment, as depicted in FIG. 165, a first batch produces 0.65% ethanol (vol/vol) (rate of production is 0.0323% (vol/vol) per day), a second batch produces 0.25% ethanol (vol/vol) (rate of production is 0.0174%

(vol/vol) per day), a third batch produces 0.17% ethanol (vol/vol) (rate of production is 0.0199% (vol/vol) per day), a fourth batch produces 0.43% ethanol (vol/vol) (rate of production is 0.0218% (vol vol) per day), a fifth batch produces 0.48% ethanol (vol/vol) (rate of production is 0,0324% (vol/vol) per a , a sixth batch produces 0.46% ethane! (vol/vol) (rate of production is 0.0229% (vol/vol) per day ), a seventh batch, produces 0.37% ethanol (vol ol) (rate of production is 0.0.201 % (vol vol) per day), and an eighth batch produces 0.08% eihanoi (vol/vol) (rate of production is 0.01 6% (vol/vol) per day), the sum total of which is 2,89% (vol/vol) eihanoi per bioreactor volume. In another embodiment, eihanoi per bioreactor vokmie can be calculated by catenating the cunnmuarive grams of eihanoi produced per batch.

Improved ethanoiogenic gene cassettes for ABICyano 1

[0465] In an embodiment,, ethanoiogenic ABICyano 1 strains with improved properties in relation to a T 293 reference strain are disclosed. Ethanol production is obtained by improvement of the ethanoiogenic gene cassette. In an embodiment variants ofplasmid TK293 are used as a starting point for modifications mat result in improved ethanoiogenic constructs. In an embodiment, the constructs contain a. pdc gene from Zymamon mobilis under the control of a nirA promoter. Some constructs contain a eodon-optimizaiion Z. mobilis pdc gene (zmpdc) whose expression is controlled by an endogenous oirA promoter.

[0466] In an embodiment, the ethanoiogenic cassettes contain a synadh gene that is codon- optiniized (sjiiadh(optl)). In an embodiment, the expression of synADH{optl) is controlled by the endogenous rpsL promoter.

[0467] ABICyano i strains containing the following constructs were tested for ethanol production, cell growth. ADH activity, and PDH activity;

TK293 [pl7i-6.S_PnirA-mn ⁵ DC(optl)-PipsL-syiiADH(optl)jer]

#1495 [pi 7 i-6..8_PiikA-zmPIX. opt3)-P^sL-synADH(opt3)_ter]

# 1581 [p!71 ^.8_PnkA-zmPDC(op )_dsrA-P^sL-synADH(opt3)_ter]

#1601 [pl71 -6.8_PnirA-zmPDC(opt l)_dsrA-I>rbc*(optRBS>synADH(opt3)_ter] #1606 [ l71^.8_PmrA-zmPDC(o^ _^

TK411 [p 171 -6.8_Pnk A-zniPDC(opt3)-PrpsL-s>¾iADH(opt 1 )_ter]

TK412 [p 17 l-6.8_PnirA-zn PIX (optl P^sL-svmADH(opt3)_ter]

[0468] As depicted in FIG. 43. different variations of the components of the ethanoiogenic gene cassette were created. In an embodimeiit. one of the resulting constructs #1578 resulted in an improved etliaiiol production rate compared to TK293. Construct Ml 578 included itie zmpdc gene with a third version of codon-optimization, an additional introduced transcriptional terminator dsi'A, and the native synadh gene whose expression is controlled by the artificial rbc*(optRBS) promoter which is an improved variant, of the rbcL promoter derived from Syneehocysfis PCC 6803.

[0469] Figure 44 depicts cell growth, etliaiiol production and normalized ethanol production of ABIC anol with TK293 or #1578. Figure 45 depicts PDC and ADH activity in ABICyanol with TK2 or #1578. Figure 46 depicts overlays of the curve progression in regard to cell growth, overlays of the curve progression in regard to ethane! produc tion, overl ays of the curve progression in regard to the ethano! production ra te and a comparison of the PD and ADH activity between ABICyanol #1.578 and ABICyanol TK293. As depicted in FIGs. 44 to 46, both components in combination with the additional terminator in between both genes result in an increased PDC as well as ADH activity over time which consequently lead to a higher ethanol production rate and at. the same time reduced growth rate. This observation indicates a higher caifeoii-partitioimig (amount of carbon fixed into etliaiiol versus fixed into bioinass) for strain ABICyanol #1578 compared to ABICyanol TK293 and demonstrates the high potential of optimizing t e ethanologenic gene cassette in order to improve the ethanol productivity for ABICya ol and other cyanobacteria.

[0470] As depicted in FIG. 38, ADH expression is controlled by promoter PrpsL. The expression level of the syaADHopt.3 cassette present in #1495 and #1581 is apparently less efficient compared to the expression level of the synADHoptl present in ABICyanol TK293 and

ABICyanol #1580. Not being limited by theory, this might be explained by ie different codon- usage strategy applied for the synADHoptl gene version as exemplified through testing constructs TK411 and TK412, comprising synADH(optl) and synADH(opt3) respectively. TK411 exhibited a similar ADH activity as TK293 whereas TK412 revealed a relatively low ADH activity. This low ADH activity detected for TK412 was accompanied with an elevated acetaldehyde accumulation as found previously for #1495 and #1581, both with synADH(opi3). This clearly demonstrates the better performance of synADH(optl) in relation fo synADH(opt3}..

[0471] Fiuthermore, analyses of ADH activity from ABICyanol strains #1601 and #1606 confirmed the different effic ency when using synADH(opt3) vs. synADH(opt.l). Strain #1601 [p 171-6. S Piiii A-zmPDCfopi I )_dsrA-Prbc * (optRB S )-synADH(opt3)_ter] exhibited a rektivel y low ADH activity and consequently a higher acetaldehyde accumulation in GC vial assay

S6 whereas the experiments witli strain #1606 fp 171 -6.8_PnirA--anPDC(optl)_dsrA- PAc*(optilBS}-syiL4DH(opi l _tei'] indicated a higher ADH acti vity hi relation to #1601 and thus a lower aeetaldehyde accumulation. Nevertheless, the highest activity found for the different gene variants of syaADH was surprisingly accomplished by the native syaADH (ABICyanoi #1578) without any eodon-optimization for use in ABICyanoi . Codon optimization is usually needed for efficient protein expression in ABICyanoi because it has a strong AT bias in endogenous codon- usage.

[0472] Although strains ABICyanoi #1495 and ABICyanoi #1581 differ in the dsrA terminator downstream from the pdc gene, the PDC expression hi ABICyanoi #1581 was found to be substantially increased, see FIG. 47, This is an indication that introduction of an efficient transcript termination signal apparently results in a higher and/or more stable mRNA levels and consequently in an increased PDC protein expression, hi ABICyanoi #1578 growth is thereby reduced but fee e hanoi production is significantly increased demonstrating that the unproved PDC expression results in an improved relative production of ethanoi in comparison to biomass.

[0473] The dat depicted in table 5 demonstrate the improved (when compared to TK293) production rare of ethanoi as well as the reduced aeetaldehyde accumulation due to elevated PDC and ADH activities for ABICyanoi that has been genetically enhanced with construct #1578, FIGs 44 and 45 depict the cultivation of the corresponding cell lines TK2 3 and #1578 performed in 0,5 L Crison PBR round bottles illuminated from two sides with 450 fiE m ^"2 s~ ^l (900 uE s ^{" 1} total) for about 45 days including two dilution steps (see FIGs 44 and 45). During this long- term cultivation the OD, the chlorophyll content, and the ethanoi amount were measured.

Table 5 avg. GC rate production rate avg. Aeetafde yde cane. AcetaMe≠emnc. construct in relation to TK293 m relation to TK293

TK293 0.0239 +/-Q.0007 100 % O.OmSlS +/-Q.0Q004 100 %

§2495 0.0225 +/-0.0010 94 % 0.000818 +/-Q.0OO13 132 % s?s 0.030? +/-0,0012 128 % 0.000303 +/-0.0O0O5 49 %

81582 0.0300 +f-0.WQ6 125 % 0.000832 +/-Q.QQ016 135 %

[0474] As depicted in FIG. 47, the intioduction of alterations in the eiliaiiologeiiic gene cassette resulted i improved expression and improved activity of PDC and syaADH. The alterations enhanced ethanoi productivity in ABICyanoi by about 20-25%. While not being limited by

S7 theory, FIG. 48 depicts the higher ethanol production rate and lower growth for ABICyanol #1578 as compared to T 293 and shows that PDC regulates the partitioning of carbon fixed by photosynthesis into bioniass and ethanol. ABICyaaol #1578 thus increases total carbon fixation and ethanol production by about 10% compared to ABICyaaol 1X293.

[0475] Figure 49 depicts ethanol production in several ABICyanol strains including copper- inducible promoters controlling the pdc expressiao. As depicted in FIG. 49, strainTK483 ^' which contains P _o om strain TK487 and strain #1772 which both contain ^' P _at i6 produce more ethanol over the same amount of time than does strai T 293 that contains a P^- _A promoter controlling the pdc expression. All of the strains depicted in FIG, 49 were cultivated in a vPBR system at 230μΕ*ηί''*& ^"ί (illuminated from one side) n a 12h/12 day/night cycle.

Ethanol production by ABICyanol using endogenous metal inducible promoters

[0476} Promoters controlling the open reading frames found to be regulated by addition of the respective metal ions (based on RNAseq data and verified by qRT-PCR), were chosen to be use in constructs for ethanol production in ABICyan l, in an embodiment, a 300-500 bp fragment upstream of each start codon was selected and cloned into pksmid #1646 ((pABIcyano I -PnirA- zniPDC(optl }dss:A-Prbe*(o tRBS)- ADHi 1 l(opt)_ter) whose plasmid map is depicted in FIG. 125 (SEQ ID NO: 75), replacing the nirA promoter, in order to drive pdc transcription.

ABICyanol transfomiants were tested for ethanol productivity under repressed and induced conditions in GC vial experiments. Figure 50 depicts the ethanol production of ABICyanol T 293 (pni-6 :iPnhA-PDC(opti)-PipsL-s}¾iADH(optl)_ter) compared to ABICyanol TK4S3 (pl71-6.S::Porfi>221-zmPIX^optl)(^ in the presence and absence of 3 uM Cu . In the absence of copper, ethanol producti on rates are very low, indicating the tightness of PorfD221. By contrast, ethanol production of ABICyanol TK483 in the presence of 3 μΜ Cir ^" is even higher compared to ABICyaaol TK293.

[0477] The ethanol productivity (percent ethanol (v v)/OD/day) of each construct i shown in table 6 under repressed (without the respective metal ion) and induced conditions (10 uM Ni ⁱ⁺ , 15 μΜ Zn ^2÷ , 3 μΜ Cu ^2÷ or 5 itM Co ^2" ). ^' Tightness and strength of each promoter were also rated with a-*-/- scale, (see legend below Table 3). In an enibod iient ethanol production rates of all tested promoters can be divided into different categories as follows: 1) ethanol productivity was very tow, even under inducing conditions (e.g. T 500), 2) ethanol productivity was quite high, however, the promoter was not repressibie (e.g., ΤΚ5Θ1) and 3) ethasoi productivity was quite

S8 high and promoter repressible inducible (e.g. TK4S3). In some cases two constructs were generated for one promoter (e.g. T 493/TK527 for PorfOl 28). as two putative start codons for the respective gene couid be deduced.

Table 6

[047® j In another embodiment, producer ABICyaiio Ϊ host ceil strains were hybrids carrying the Zn ²⁺ inducible constructs TK4S0 and TK490 as well as the Cu ² * inducible TK483, TK4S7 and TK504. All five constructs are very tightly repressed under appropriate conditions (lack of inducer metal) and led to high ethanes! production, rates after metal ion addition. TK480 uses a mntC promoter, which was shown in Syneckocysiis PCC 6803 to be regulated by manganese (Ogawa et al... 2002), Hence repression by addition of Mn ^2" was tested, see table 6. and addition of 40-50 μΜ n ^ir led to a repression. [0479] Thus, orf0221 encodes for a putative multi-copper oxidase (copper-resistance protein), while orf0223 and orf0316 are hypothetical genes with unknown function. Ail three

genes/prof eiiis are believed to have not been previously described in the literature, hidu ti ii by copper wa s not known. Based on homology to other copper regulated genes, non of the three endogenous promoters from ABICyanol would have been chosen to control pdc expression. However, the three promoters respond strongly to copper and were shown to tightly control ethanol production in ABICyanol . Because the response to copper declines within about 5 days, additional copper needs to be supplemented during long term ethanol production experiments. In an embodiment, the copper repressible promoter of petJ (orf3461) is useful. No ethanol production was observed with the promoter of orf3232. encoding for a heavy metal ATPase. As the copper response stayed at a constant level up to about day 5, the promoter of orf3232 could be useful for longer productivity. Not being bound by theory, one explanation is that both cloned translational start codons are selected in the upstream region of about 500 bp and might not use the entire functional promoter.

[0480] hi another embodiment, the Zn" ^÷ responding promoter of the smiA like or£ i26 improved amounts of produced ethanol. However , basal, (repressed) production rates were too high.

Additional genetic improvement of Porf31.26 could enhance the tightness of control for expression of PDC and ethanol production in non-natrually occurring ethanoiogenie ABICyanol organisms.. By contrast, the Zn ² ~ responding promoter of the manganese transporter operon

(mntC) is substantially repressed by addition of 40 μΜ Ma ^21" .

[0481] Thus, at least three€ιΓ ^÷ responding (PorfD221 , Pori0223 and Porf0 16) and two Zn^ responding promoters (Porfi07 i and Port! 126) are useful as promoters to drive pdc expression in ABICyanol ethanol enie strains.

[0482] In an embodiment, the sequences, putative operator regions, putative - 10 regions, putative transcription starting points, start codons, and putative ribosonie binding sites of endogenous copper inducible promoters Porf0316. Porf3416 (PpetX). and zinc inducible promoters Porf3 l26 (PsmtA-like), Port! 071 (PmntC, also manganese inducible) are depicted in FIG. 51.

[0483] In an embodiment, a transcription temiinator can be present between the first and second recombinant gene in order to ensure a separ ate transcriptional control of the first and second recombinant gene and to provide for a. high production of a compound of interest, such as ethanol. In an embodiment for an ethanoiogenic cassette used to produce ethanol as a compound of interest, a first recombinant gene encodes pyruvate decarboxylase and the second recombinant gene encodes alcohol dehydrogenase. Tlie first recombinant gene (pdc) is under the transcriptional control of a first inducible promoter and the second recombinant gene (adh) is under the transcriptional control of a second constitutive promoter. The first inducible promoter can be selected from, for example, PnirA, variants PairA*2, PnkA*3, PnirA*4, PaiiitC. Porfjise. Po _f ffl22i, Pc»fl{223, and and the second constitutive promoter can be selected from, for example, PrpsL*4 _f Prbc*(optRBS), and PcpcB.

[0484] RNA-seq experiments were conducted in order to identify potential metal-ion inducible promoters in ABICyanol. The upstream regions of the metal-ion respondmg/inducible genes in ABICyanol, listed in the table below, were selected to drive control expression of the ethanoiogenic gene cassette in ABICyanol. Tlie nucleic acid sequences are given in the Figures as listed in this table. All of the below potential inducible promoters ar prime candidates for the transcriptional control of the at least one recombinant gene. Expres ion of etJ is tiglitly repressed under high copper (1-3 μΜ) conditions and induced under copper depletion (FIG. 39).

ABICya ol TK441 strains carrying the endogenous pet J promoter upstream of an ethanoiogenic gene cassette, produce the same amoun of efhanol (%v/v) under copper depletion conditions compared to an ABICyanol TK293 strain grown in marine BG11 (FIGs, 39 A and 3 B).

[0485] A piasmid map for TK480 ( BICyanol -6.8 :¾natC ABICyanol -zmPDC(optl)dsi A- Prbc*(optRBS)-ADHi 1 ί (opt)) is depicted in FIG. 52, The sequence of TK4S0 is listed in SEQ ID NO: 60.

[0486] A piasmid map for TK4S3 (pABICyaiiol -6.8: PorfD22 i-zmPDC(optl)dsrA- Prbc*(opfRBS)- ADH111(opt)) is depicted i FIG. 53. The sequence ofTK4S3 is listed in SEQ ID NO: 61.

[0487| A piasmid map for TK487

ADH 11 i(opt)jtcr) is depicted i FIG. 54. The sequence of T 487 is listed in SEQ ID NO: 62.

[0488] A piasmid map for TK4SS (pABICya∞l-6.8::PdgHABICyaaol-zmPDC(optl)dsrA- Prbc*(optRBS)- ADH11 l(opt)) is depicted in FIG. 55. The sequence of TK48S is listed in SEQ ID NO: 63.

[0489] A piasmid map for TK48 (pABIC5¾nol-6.8::Porfl542-zniPDC(optl)dsrA- Prfec*(optRBS)- ADH11 l(opf)) is depicted in FIG. 56. The sequence of TK4S9 is listed in SEQ ID NO: 64. |0490j A piasmid map for TK4900>ABICyanol-6.8::PorBl26-zniPDC(i¾>tl) ½-A- Prl>c*{optRBS)- ADH111 (opt)) is depicted in FIG. 57. The sequence of TK 80 is listed in SEQ ∑D NO: 65.

[0491] A piasmid map for TK504 (pABICyai-ol-6.S;;Forf0223_ABICyai-ol-zmPDC(optl)dsfA- Prbc*(optRBS ADH1 ! l(opt)) is depicted in FIG. 58. The sequence of T 504 is listed hi SEQ ID NO: 66.

[0492] Figures 59 to 66 depict the ethanol production of various different ABICyanol strains carrying different nietal-ind cible promoters upstream of the pdc gene determined by the GC online vial method,

[0493] Figure 59 depicts the ethanol production of Cyanobacterium sp. ABICyanol containin the plas nid TK480 wherein a codon improved variant of a gene coding for the native PDC e zyme is under the transcriptional control of the promoter mntC (orfl071) thorn ABICyano I . whereas the adh with the nucleotide sequence shown hi FIG. 52 (nucleotides 2390 to 3406 of S EQ ID NO: 60 whose expressed enzyme is ADH111) is under the control of a variant of the native rbc promoter from ABICyanol with an improved lihosomal binding site (RBS).

Furthermoce, the ethanol production of Cyanobacterium sp, ABICyanol containing the piasmid # 1770 is depicted in FIG. 59, which is comparable to the ethanol production of Cyanobact r mt sp. ABICyanol with the piasmid TK480. This piasmid # 1770 only differs from piasmid T 4S0 by replacing the Adh enzyme of FIG. 52 (nucleotides 2390 to 3406 of SEQ ID NO: 60) with the Synechoc-ystis Adh enzyme. It can clearly be seen that upon addition of 10 μΜ Ζη ^27" the ethanol production increased compared to the unindueed state with Zn ²⁺ and 15 μΜ ΜΩ ^2÷ (repression by the absence of Zn ² ~and presence of Mn ^2~ ) for both, strains transformed with the plasmids # 1770 and 1X480, respectively. The ethanol production of Cyanobacterium sp. ABICyano i including the piasmid TK4SS after addition of 15 μΜ ZB^ is shown in FIG. 60 in comparison to the usind ced state without Zn ^1÷ . Addition of Zn ^l÷ leads to a nearly 4-fold increase in ethanol production.

[0494] The ethanol production of Cyanobacterium sp. ABICyanol containing the piasmid

TK489 is depicted h FIG. 61. This graph shows a continuously rising ethanol production with increasing cultivation time in the induced state upon addition of 15 uM Zn ^iT . However under unindnced conditions a high ethanol production can also b observed, which shows that this promoter is not very tight. [0495] FIG, 62 depicts a graph evidencing the ethanol production in ABICyanol transformed with the plasmid TK490 including a codon improved variant of pdc gene under the

transcriptional control of the promoter controlling the en reading frame (ORF) 3126 versus the eihanol production of the same strain transformed with the plasmid # 1773, This plasniid differs froin TK490 only in the Adh enzyme which is Synechocystis Adh for # 1773 versus the adli with the sequence of FIG, 52 {nucleotides 2390 to 3406 of SEQ ID NO: 60) in TK490. Both

ABICyanol strains have a comparable ethanol production u to 40 oars of cultivation, but the ethanoi production appears to be higher for #1773 after 40 hours compared to TK490, A clear increase hi ethanoi production can he observed upon induction by 15 uM Zsi for both strains transformed with # 1773 and TK490. A clear rise in ethanol production can also be seen upon induction with C " in Cya hactenum sp. ABICyanol transfornied with the plasniid 1X487 and the plasniid # 1772 (see FIG. 63) . TK4S7 includes a codon improved variant of the Z mcmonas mohilis gene coding for PDC under the transcriptional control of the promoter controlling the ORF0316 and codon improved variant of the gene coding for ADH with the nucleotide sequence shown in FIG, 52 {nucleotides 2390 to 3406 of SEQ ID NO: 60) under the transcriptional control of Prbc with an improved RBS. The plasniid # 1772 contains a gene coding for Syneehocystis ADH instead of the ADH with the sequence of FIG. 52 (nucleotides 2390 to 3406 of SEQ ID NO: 60). Induction with copper leads to an increase in ethanol production for both ABICyanol strains (see FIG, 63). The ethanol production increases hi comparison to the miinduced state (copper-free medium) upon addition of 0.3 μΜ Cir^ and further increases, when both strains are induced with 6 uM Ca ^2' . A clear rise in ethanol production can be observed in comparison to the lutinduced slate (copper-free medium) by copper induction in ABICyanol with strains containing the plasiiiids TK483 and # 17 1 upon addition of 0.3 μΜ and 6 μΜ Cir ^* (see FIG. 64). TX483 contains a copper inducible promoter controlling ORF02 1 in. ABICyanol upstream of pdc. Similar to earlier mentioned plasmids, this plasniid also includes a codon improved variant of the gene coding for ADH111 with the nucleotide sequence shown in FIG. 52 (nucleotides 2390 to 3406 of SEQ ID NO: 60) under the transcriptional control of Prbc with an improved RBS.

whereas plasniid # 1771 includes a gene coding for Syneehocystis ADH instead of the ADH with the sequence of FIG, 52 {nucleotides 2390 to 3406 of SEQ ID NO: 60). The ethanol production of the ABICyanol strain with the TK483 is slightly higher during a 60 hour cultivation in comparison to a strain transformed with plasniid # 1771, [0496] Figure 65 depicts tiie ethanol production of a genetically enhanced Cyanabacteritmi sp. ABICyanol transformed with plasraid TK504 and plasmid # 1774. Plasrai TK504 includes the Cu ^2" inducible promoter, which normally controls the transcription of ORF 0223. In plasmid TK504 this promoter controls the haascription of the codon improved gene coding for ZmPdc. As depicted in FIG. 65, T 504 produces ethanol at about 0.07% (vol/vol) per day. As ia the above mentioned constructs TK504 ADHi I I (nucleotides 2390 to 3406 of SEQ ID NO: 60) is controlled by Prbc with an improved RBS, whereas in plasmid # 1774 the same promoter controls the transcription of a gene coding for SynAdh eazniye. Figure 65 depicts ethanol production rate of ABICyanol strains iraiisfoniied with either of constructs #1774 and TK5G4. Strains #1774 and T 504 both comprise the endogenous copper-mducibie promoter Porf0223 and were tested with (lOCu = 3μΜ Cu ^"4 ) and without copper (1 lOCu = 0.03μ,Μ Cu^*) and ethanol production was analyzed by the GC vial assay. As depicted in FIG, 65, the observed ethanot production rate of TK504 hi the presence of 3μΜ Ctr ⁴ * of 0.00292 %(v v)/li over about 50 hours corresponds to about 23.1 nig (h*L) and to the produc ion of ethanol at about 0,07% (v/v) per iia as calculated from, the rate of ethanol production depicted ia FIG. 65 by T 504 of 0.00292 %(ν/ν).··ϊι multiplied b 24 hours day. Th highest productivity of TK504 ia the presence of 3μΜ Cu^ was observed in the period from about 40-52 hours of the cultivation experiment when the rate of ethanol production was about 0.00392 %(v/v) h which corresponds 31 mg/(h*L) and corresponds to the a non-nahirally occurring ethanologenic ABICy anol organism capable of producing ethanol at 0.094% (vol/vol) per day as calculated from the rate of ethanol production depicted in FIG. 65 by T 504 of 0.00392 %(v v) h multiplied by 24 hours day. In another embodiment the rate of ethanol production depicted in FIG. 65 by TK504 is 0.047% (vol/vol) per twelve hours as calculated from the rate of ethanol production from hours 40 to 52 of growth of 0.00392 % (viWii multiplied by 12 hours.

[0497] Figure 66 depicts the activities ofPDC enzymes in the various ABICyanol strains fransformed with ihe lasmids TK483, TK4S7, T 504, # 1 71 _. , # 1772 and # 1774 in tiie uninduced state and . with the addition of 0.3. 6. 12 and 24 μΜ Or ^* *. While the activities of PDC are very low in the repressed state, increasin activities can be detected with rising concentration of Cu ²⁺ , which clearly demonstrates thai the new promoters found in ABIcyanol can be induced by Ca ⁱ⁺ . Table 7 is a listing of ABICyanol endogenous promoters inducible by a change in the concentration of Ni ² *, Cu ² * Co ^2* and Zir ^{^} . Table 8 depicts etliaiiol production data of ABICyanol strains containing piasmids with genes coding for PDC under the control of endogenous inducible promoters; "n.d ^M means "not determined":

Table 7

»rf3232 ATPase

ABICyaiiol TK441 petl O ^' depletion orl3 K;l

ABICyaiiol TK4S6 conserved Co"

*rf3749 liypothetical

protein

Table 8

Geae id Plasmid EtOH EtOH

(v v)/OD*d (v/v)/OD*d ressed Induced conditions conditions

ABICyaiiol TK501 0.02! 0.024

ABIC aiioi_ TK502 0.0024 0.0029 c.13164

ABICyaiiol _ T 500 0.0026 0.0035

ABICyaiiol_ TK491 0.003 0.007 oii 621

ABICyanoi_ TK492 0.0 IS 0.017 orf3635

ABICyaiiol li d. U.<!. orfSSSS

ABICy noi_ TK4S 0.004 0.025

ABICyano 1 TK489 0.015 0.021 orfl542

ABICy noi_ TK488 0.003 0.011 orfl823

ABICyanol i .il. n,d.

orflS24

ABICyanoi_ T 490 0.007 0.02

ABICyanoi_ a d. ii. d.

orS389

ABICyanoi._ TK483 0.00 Ϊ 0.023

off 0221

ABICyariol_ TK504 0.007 0.025

ABICyaaol_ TK4S7 0,003 0.021

orfi)316

ABICyanol _ TK441 0 0001 0.017

orf3461

ABICyaaol_ TK4S6 0.00! 0.001

or£3749

[0498] In ail embo imen the plasmids TK4 1 to TK49G contain the inducible promoters from ABICyanol listed in the table 7 and/or 8 controlling the transcription of codon improved variant genes coding for Zymomon s m biiis Pdc enzyme, in the following called ZniPdc. These plasmids further harbor different codon improved genes coding either for Synechocystis ADH or ADH with the nucleotide sequence shown in FIG. 52 (nucleotides 2390 to 340 of SEQ ID NO: 60), which are all controlled by constitutive promoters. PrpsL or Prbc* from ABICyanol .

[0499] The plasmid map of plasmid TK441 is shown in FIG. 15 aad its nucleic acid sequence is depicted in SEQ ID NO: 50. The gene coding for ZmPdc is under the transcriptional control of the native PpetJ and a codon improved gene of SynAdh enzyme is controlled by the native PrpsL promoter from ABICyanol . Figure 52 shows the plasmid map of the plasmid TK480 including die native Pmnic promoter of ABICyaaol controlling the gene c ding for ZmPdc and Prbc with an improved RBS controlling the codon improved gene coding for Adh enzyme. Figure 53 depicts the plasniid map of 1X483. This plasmid contains the C ² * inducible promoter from ORF0221 of Cymwbactemmt sp. ABICyaaol coding for a Cop A family copper-resistance protein. The adh gene in TK483 is muter control of Prbc*with a improved RBS. Figure 54 depicts a plasmid map of TK487. This plasnii includes the Cir~ inducible promoter from ORF0361 of ABICyaaol directly upstream of ZmPdc and Prbc* with an improved RBS controlling the transcription of a codon improved gene coding for the ADH enzyme with the nucleotide sequence shown in FIG, 52 (nucleotides 2390 to 3406 of SEQ ID NO: 60· whose expressed enzyme is ADHl 11). The plasmid map of TK488 is depicted in FIG.55. This construct harbors the native Zii ^~ ~ inducible PsigH from ABICyaaol for transcriptional control of a codon improved ZmPdc gene and Prbc * for the transcriptional control of the gen coding for ADH with the nucleotide sequence shown in FIG . 52 (nucleotides 2390 to 3406 of SEQ ID NO: 60). The gene encoding ZmPdc is controlled by the Zn ^~ ~ inducibl promoter from the ORF ! 542 from Cyanobacteri m sp. ABICyaaol in the construct TK48 (FIG. 56). The plasmid map of TK490 is depicted hi FIG. 57. hi this plasmid the gene coding for ZmPdc is controlled by the 2η ^2τ

inducible promoter which con trols the transcription of the ORF3126 in. Cymobact ium sp, ABICyaaol. The map of plasmid T 504 is depicted in FIG. 58, la TK504 the pdc gene is controlled by th Ca ²⁺ inducible Porf0223 and the adh gene FIG. 52 (nucleotides 2390 to 3406 of SEQ ED NO; 60) by Prbc* with an improved RBS.

Copper-mdttcible strains and Ziac-mducibie strains

[0500] In an embodiment non-naturally occurring ABICyaaol organisms containing p6.8 derived vectors with etlianologenic cassettes containing copper-inducible promoters are disclosed that exhibit stable ethanol production for prolonged periods of time. Ia an embodiment, cepper- indueible ABlCyano 1 ethanologenic strains containing an exogenous adh/pdc cassette enabl high and stable PDC activity over time (in contrast to using a PnirA promoter) are disclosed herein.

[0501] Ia another embodiment, non-naturally occurring ABICyaaol organisms containing p6.8 derived vectors such as a #1770 plasmid containing a zinc inducible PmntC promoter linked to the pdc adh cassette are disclosed herein. As depicted in FIG. 67, eopper-indueible strains such as #1771 (Ρ &22ΐ)· _> #1772 (P _ot s g) and #1 74 (PorfS223) ^as well as a . ziac-inducible strain #1770 (Pousse) exhibit a higher ethanol productivity tliaa a nitrate inducible strain ^' TK293 that uses a PnirA promoter. Induction protocols use initial Cu" addition and also further Cu" additions. As depicted in FIG. 68, the PDC activity of strains #1770. #1771 , #1772 and #1774 were greater than TK2 3. The strains depicted in FIGs. 67 and 68 were cultivated in a vertical photobtoreactor (vPBR) at 200 μ.Ε*ηι ² *8 ^"! in a I2h/12 day/night cycle.

[0502] As depicted in FIG. 162, the ethanologenic acitivify of a aon-naturally occurring

ethanologenic ABICyanol strain comprising piasmid #1772 with the endogenous copper- iiidiicible promoter Porf0316 was tested with 20xCu (6 Μ Cu at a start OD of 2 either grown with mmnonia/urea (2n M each) or nitrate (BG1 1 recipe) as the sole nitrogen source, Ethanol production was analyzed by GC vial assay. The observed ethanol production rate of 0,00409 %{v v) h over about 40 hours corresponds to about 32.3 mg (h*L). The greatest productivity measured was observed in the period from about 5 - 25 hours of the cultiva tion experiment having a rate of about 0.00440 %(v v) h w ich corresponds to 34.8 mg/(h*L),

[0503] Initial induction with 1.6 μΜ Ci ^÷ (which is about five times the Cu ²⁺ concentration of BG11) in all four treatments of TK4S7 for ethanol production is depicted in FIG. 69 and for cell growth of TK487. in FIG. 70. TK4S7 is identical to #1772 (Ρ^^), except for a different adh gene. PDC activity in TK4S is depicted in FIG. 71. Ethanol per cell density of induced TK487 is depicted in FIG. 72. In an embodiment, weekly and bi-weekly (day 7 and 21) copper addition results in the highest tested ethanol production and lowest biomass accumulation.

[0504] Figures 73 through 76 respectively depict the effect on cell growth, PDC activity., ethanol production, and ethanol production per OD750 of releasing copper into solution over a prolonged period of time and at various concentrations of copper to TK4S7 strain. In an embodiment, the PDC activity and ethanol production per OD73& of TK487 increase with increasing amounts of copper chelated Cu{H) disodruni EDTA in the solution and cell growth is inversely related to increasing amounts of copper dielated€¾(Π) disod imi EDTA in the solution. Not being limited by theory, in contrast to the treatment with free copper, the use of C (II) disodiiun EDTA enables a stable PDC expression and activity without further additions of copper during the course of cultivation.

[0505] Figures 77 through 79 depict cross-reactivity of ABICyanol endogenous eopper-inducibie promoters Ρ««22ΐ, ^ _ot mu, and Ρ< _Β «223 in the presence of other divalent metal ions. Figure 77 depicts the ethanol production over time of an ABICyanol strain #1771 that, lias a piasmid containing an ethanologenic cassette encoding for a PDC enzyme that is operabiy linked to promoter P _Ci ®22i while synADH is operabiy linked to Prbc*(optRBS). As depicted in FIG. 77, ¥∞%ΐ22ΐ is induced by copper ion and not by zinc, nickel or cobalt ions. Figure 78 depicts the ethaaoi production over time of n ABICyanol strain #1772 that has a plasrraid containing an ethanoiogenic cassette encoding for a PDC enzyme that is operabiy linked to promoter P _OI -SBIS while synADH is operabiy linked to Prbc*(opiRBS). As depicted in FIG. IB, Vermis is induced by copper ion and to a lesser extent by zinc ion, but not by nickel or cobalt ions. Figure 79 depicts the ethanol production over time of an ABICyanol strain #1774 that has a plasmid containing an ethanoiogenic cassette encoding for a PDC enzyme thai is operabiy linked to promoter P _0iS j ₂₂ 3 while synADH is operabiy linked to Prbc*(optRBS). As depicted in FIG. 79. PorfD223 is induced by copper ion and not by zinc, nickel or cobalt, ions. Thus. in. an embodiment endoiigenous copper inducible promoters from ABICyanol exhibit a high selectivity for copper and can be used to control expression of operabiy linked genes in ABICyan l by the addition of copper to the medium.

[0506] Figure SO depicts the prodactioii of ethaaoi by ethanoiogenic ABICyano l strains TK441 and #1769 that contain the promoter Ppef J. Promoter P^e _t s is inducible by the deprivation of copper. ABICyanol strains TK441 and #1769 contain an etiianologfinic cassette that encodes for ADH and PDC enzymes whose expression is operabiy linked to Ppet . As depicted in FIG, SO, both ethanoiogenic ABICyanol strains T 4i and #1769 produce ethane] in growth media substantially lacking copper ion while producing less ethanol in the presence of 3 «M copper ion. Thus, in an embodiment _: , promoter P^ operabiy linked to an efhanoiogenic cassette hi a non- naturally occurring ABICyano l organism can be used to control me production of ethanol.

[0507] Table 9 depicts the ethanol production data for various ABICyanol strains. The third column shows the ethanol production rate as determined by a G vial online assay. The fourth to sixth column depicts the ethanol production determined for 0.5 L Crison PBR, and for vPBR with different illumination intensities for a period of cultivation of 14 days or 21 days, respectively. These ethanol production data were determined with GC single measurements. The term "vPBR" indicates "vertical photobioreactors". The following procedure describes the standard lab conditions under which a 1 2L vPBR is operating as well as the necessary parts, ports, etc. to construct mis 1.2L vPBR. Table 9 depicts a list of plasmids for used for transformation of

ABICyanol with ethanoiogenic cassettes and also depicts ethanol production in ABICyanol host cells created thereby.

Table 9

OF Sytiechocystis ADH (#1770)

TK483/# pABICyanoi- 0.0305 0 0286 0.0104 / 0.0115 0.0166 / 0.0140

Ϊ771 6.S:;I¾rfD22I-

A- l¾bc*(opiRBS>- ADHIU (T S3)

or Syaedsocysiis

ADH (#177i)

T 4S7/# pABICysaio. 0.0323 0.0300 0.0150 /0.0120 0.020S / 0.0161 1772 6.8;.l½ri¾3i6- zmPDC(opti)dsi-

A-

Pt c*(opt BS

ADHlIi 0X48?)

or Syneckxyslis

ADH (#1772)

T 490/# pABICyanoi- 0.0329 n.d. ad. ad. 1773 6.8::PcffGl26- zniPDC(opil)d¾r

A-

ADH1 i I. (T 490)

or Syn ci-i s

ADH (#1773)

T 504 # pABICyanoI- 0.0333 0.0307 a.d. 0-0172 /0.0148 177 6-8::Pori¾223- ziiiPDC(opil}dsi- A-

¾&c*(optRBS

ADH 11 0K5O4)

or jiieclj cystis

ADH (#1774)

[0508] In another embodiment, genetically enhanced Cytmobacfer nm sp. ABICyanol strains including estmclwomosomal plasmids all containing a pdc geae wider die transcriptional control of either the native nirA promoter or modified variants thereof, were cultured in 0.5 L

photobioreactors. These strains included the plasmids # 1606, # 1629 and # 1636. Figure 28 depicts the ethanol production normalized to the growth (OD?50 _BI O) determined by GC single measu ements for ABICyanol strains transformed with the plasniids # Ϊ606 (pdc geae under the control oi : the native Pa A), p!asmid # 1629 (pdc gene under the control of a modified variant of PnirA with changes in the RBS) and plasmid # Ϊ636 (pdc gene under the control of a modified variant of PnirA with changes in tiie operator sequence and the TATA box) for a period of time of at least 20 days after induction was realized by transition of the pre-cuiture to usual mBGI 1 medium (containing nitrate for induction) at the beginning of the cultivation experiment The graph depicts thai the normalized ethanol production is higher for ilie steins including the pi a«fflids with the modified promoters. Figures 29 and 30 depict the specific activity of PDC and ADH during the coarse of the above mentioned cultivation. As depleted in FIGs 29 and 30 the inducible modified nirA promoter variants PnirA*2 (#1629) and PnirA*3 (#1636) result in a higher aclivity of PDC enzyme compared to the na tive promoter (#1606),

[050 1 Figure 31 depicts the ethanol production normalized to the growth (OD?¾ .) determined by the GC single measurement method for ABICyanol strains transformed with the plasuiids # 1606 (pdc ene under the control of the native PnirA), plasmid # 1631 (pdc gene under the control of a modified PcorT with modifications in tiie TATA box) and plasmid # Ϊ 32 (pdc gene under the control of a modified PcorT with modifications in tiie TATA box and tiie RBS) for a period of time of at least 20 days cultured in 0.5 L photobioreaetors. The ethanol production of the strain transformed with the plasmid containing the native PnirA with pdc gene is comparable to the ethanol production of the strain containing the plasmid with th pdc gene controlled by the modified corT promoter variants PcorT*3 (#1632) with modifications in the TATA box and RBS. whereas the ethanol product ion of the strain containing the plasmid with P corT with modifications only in the TATA box PcorT*2 (#1631) exhibits a lower ethaiio! production rate, especially in the time period starting from the tenth day of cultivation on.

[0510] Fig, 32 and 33 depict the specific activity of PDC enzyme and ADH enzyme during the course of th above mentioned cultivation. The strains with the native PnirA as well as the PeorT*3 comprising modifications in the TATA box and the RBS show higher reactivity of PDC e zyme than the other strain.

[0511] Figures 40 to 42 depict the ethanol production rates of the ABICyanol sh ams transformed with the plasmids #1635, #1639 and #1640 including the native PsmtA promoter from

S mchococc PCC 7002 as well as modified versions of PsmtA. It can clearly be seen mat all promoters are repressed hi the absence of Zir ^" and can be induced upon addition of Zii ^* .

[0512] FIG. SI depicts the activity of Pdc enzyme in the uninduced state and after 72 hours of induction for ABICyanol strains transformed with the piasmids # 1578, #1701, # 1658. #1697 and # 1663. including an unmodified endogenous nirA promoter (plasmid # 1578), and four different modified nirA promoter variants PnirA*! (plasrnid # 1701), PnirA*2 (piasmid # i 658), PoirA*3 (piasmid # 1697) and PnirA *4 (piasmid # 1663 ), Cultivation of those ethaiioiogenic hybrids was performed in GC vials for 72 hoars. The Pdc activity after induction is indicated by the blue bars whereas the much lower activity of Pdc enzyme in the repressed state is given by the red bars. The induction factors for these plasniids # 1578, # 1701. # 1658, #1697 and # .1663 are 12, 10» 14, 8, and 7 times the PDC activity in the induced state vs. the repressed state. This figure depicts thai specific nucleotide changes introduced into the ribosomal binding site and or the promoter .region of the nirA promoter in the respective variants PnirA* 1 , PnirA*2, PnirA*3 and PnirA*4 increased the exp essio level of the PDC in the induced state, but had relativel little impact on the tightness of the modified promoter in the repressed state.

[0513 j Figures 82 and 83 depict the activity of PDC and their respective OD750am- o inalized etfianol production (% EiOH per during the course of a 29 day cultivation grown at 125 ¾E*si ^"i *s ^"i in a 12h ^' 12 day/night cycle for the above mentioned strains of FIG. SI except for # 1701 which was omitted. The PDC activity of #1697 (PnirA*3) and #1663 (PnirA*4) is higher and more stable over time than that of #1578 (PnkA) and #1658 (PnirA* 2). Therefore the ratio of carbon distributio into etliaiiol and bioinass (EtOH OD ratio) is thereby higher and appeal s to be more stable over time for the traiisfomiaiits. Figures 84 and 85 depict the OD jscam- and the ethanot production in % (v/v) of this about 30 day cultivation grown at i 25uE*m ^'2 *s ^"1 in a

12h 12 day/night cycle. The piasmid maps as well as the nucleic acid sequences of these plasniids have already been described above.

[0514] In an embodiment, higher C-branciiing (EtOH/OD ratio) for the stems transformed with plasniids #1697 (PnkA*3) and #1663 (PnirA *4) is related to the reduced growth compared to ABICyanol steins transformed with pl&smids #1578 (PnirA) and. #1658 (PnirA*2)., that show a similar ethanol production rate over about 29 days. Strains with a higher carbon branching ratio and thus reduced growth rate will eater the "light limited" growth phase later enabling a longer duration of high ethanol production. Delayed growth will extend the phase of "unlimited

resources ¹ ' for high etliaiiol yield (less cell aging effects, lower accumulation of inhibitory substance and lower respiration demand due to lower cell density).

Strains with higher ADH activity

[0515] High activity of syiiADH is accompanied with elevated PDC activity. Without being bound by theory, this is thought to occur because of reduced acetaldehyde exposure prevents PDC aetivation by reduced enzyme adduct fomialioa with acetaldehyde (and/or other unknown iiihibitory effects). Thas, in an embodiment, strains with increased expression of ADH from an adh cassette also ave increased ethanol production even in the presence of high ethanol

conoenfrations. In another embodiment, method to reduce acetaldehyde exposure is disclosed that uses an increased amount of ADH that ma work by stabilizing PDC activity over time.

[0 161 Figure 86 depicts ADH and PDC activity in TK293, #1578 and 1792. Figure 87 depicts total ethanol production in TK293, 1578 and 1792, Figure 88 depicts ethanol production per OJ 7S8 in TK293, #1578 and #1792. TK293 is pABICyaiiol-6„8::PiiirA.-ziBPDC(optl)-Pr| sL- synADH(opt.l)_ten #1578 is pABICymol-6.S::PoaA-zinPDC:(opt3)darA-Prhc ^!i: (optRBS}- synADHjBop; #1749 is pABICyanol-6.8: :PnirA-zmPDC(opt3)dsrA-PrpsL*4-synADH_oop (SEQ ID NO: 80) having a plasmid map depicted in FIG. 130 and #1792 is pABICyanol- 6..S::PiikA-zmPDC(opt3>dsrA-PepcB-syiiADH_TrbcS.

[0517] Plasmid #1792 results in improved synADH expressio and shows better and more stable ethanoi production under standard conditions. As depicted in FIGs. 89-9!, increased ADH activity prevents PDC inactivation. Figure 89 depicts acetaldehyde accumulation of TK293, #1578, #1749, and #1792. Figure 90 depicts ADH activity in TK293, #1578. #1749, and #1792.. Conversely, acetaldehyde exposure during cultivation reduces PDC activity. Thus, there is an inverse relationship between ADH activity and acetaldehyde accumulation for different synADH expressing strains in GC vial assay. Figure 1 depicts specific PDC: activity in varying amounts of acetaldehyde added to the cells, Acetaldehyde is completely converted in to ethanol by the cells within 1-2 hours.

[0518] Higher ADH activity helps to prevent PDC inactivaiion. A decrease in PDC activi y was detected for several strains with very low ADH activity (in spite of identical PDC cassettes). Figure 92 depicts ADH activity and .FIG. 93 depicts PDC activity with or without the addition of acetafclebye (3 mM and incubation for 5 hoars) for ste ns T 293, #1.578, #1749, and #1792 each having different ADH activity levels.

[0519] In an embodiment, ABlCyanoI ethanoiogenic pdc adli cassettes use different adh genes encoding ADH enzymes from differehit organisms, hicliiding, but not limited to, ADH111

(Lyfigbya), ADH 1520 (Mi -ocysfis), ADH553 (Cyanot ece) and ADH242 (Arthrospim), ADH916 (Syrtechococcus) and ADH 1102 (Craococcidiopsis). As an example, pdc adh cassettes useful for extended production of ethanol in a ABICyanol host cell include #1792 (pABICyanol- 6.8::PnkA-zmPDC(opt3)_dsrA-Pcp«B-synADH_TrbcS); #1791 (pABICyaiiol-6,8;:PiikA- zmPDC(opO)_dsrA-PcpcB-ADHl l l(opt)_IrbcS); #1793 (pABICyaaol-6.8::Pnh-A- zmPDC(opi3LdsrA-PcpcB-ADH916(opt)_TrbcS); i794(pABICy∑mol-6.8::i¾irA- zmPDC(<¾^3)_dsrA-PcpcB-ADHi520(opt)_Tri>cS); #Ϊ795 pABICyaaoi-6.8::PnirA- zmPDC(op 3}_dsrA-PcpcB-ADH553(opt)_TrbeS) a.iid #1749 (pABICyanol-6.S::PakA- zmPDC(op }_dsrA-PipsL*4-syiiADH_oop).

[0520] In another embodiment, the expression of heterologous adh genes from, other

cyanobaeterial species that have been improved for codon usage patterns in ABICyanol resulted in increased ADH activity. Figure 94 depicts ADH activity of various expressed adh genes, some of which were codon improved for expression in ABICyanol. ADH242 is derived from

Arthrospir platensis and ADH111 is derived froin Lyngb species. Constructs #1 46 and #1754 (pABIcyanol-PnirA-zmPDC^ (SEQ ID

NO: 78) whose plasmid map with annotation is depicted in FIG. 128, had codon improved adfa genes for ADH111 and ADH242. respectively. As depicted in FIG. 94, codon improvement for expression in ABICyanol for the genes encoding for ADH111 a d ADH242 resulted hi an increase in ADH activity by about 30 % to about 50 ¾. Figure. 1.29 depicts a plasmid map with sequence annotation of plasmid #1735 (pASIcyanol-PnkA-znaPDC(optl)_dsrA-Pi¾c*(optRBS)- Adhl694_ter) (SEQ ID NO: 79).

[0521] In another embodiment increased ADH activity results in resistance to decreased ethanoi production resulting from higher ethanoi concentrations in the growth media. Figure 95 depicts the effect of ethanoi productivity of various ethanologenic ABICyanol strains in growtli media containing 1 % vol vol ethanoi. As depicted in FIG. 95. the difference between the productio rate of ethanoi in growtli media containing no added ethanoi and growtli media containing 1 % added ethanoi is less when the expression of ADH is higher. Figure 95 depicts the daily ethanoi production rate in percent vol/vol per day over 10 days as measured from ABICyanol strains iihuiiinated with 450μΕ*ην ² *8 ^" * (from two sides each) in 12h 12 day/night cycles. As is depicted in FIG. 95, the stronger the ADH activity the less the impact of higher ethanoi concentrations on ethanoi production. As depicted in FIG. 95, ABICyanol strain #1803 (plasmid map depicted in FIG. 137) (pABIcyanol-PmrA-zniPDC(opil)^ ) (SEQ ID NO: 87) that expresses ADH from Microcystis emg os operahly linked to the cpcB promoter exiiibiis less of a decrease in ethanoi productivity (7 % less) in a 1 % emanol growth solution when compared to the decrease in ethanoi productivity of strain #1792 expressing ADH from. Synechocystis PCC 6803 operabiy linked to the cpcB promoter (17% less). [0522] In an embodiment ethanol production from ABICyanol strains each containing a different adh gene operabiy linked to an endogenous ABICvanol cpcB promoter and each stain containing a nil A promoter operabiy linked to pdc expression is depicted in FIG. 96, Figure 96 also depicts the production, of ethanol from strain TK293 {pi71-6.8_Pi«rA-z3iiPDC(optl)-PipsL- syiiADH(opil)_ier). Each strain depicted in FIG. 96 was cultivated in a vPBR system with exposure to light at. 23ϋμΕ*ηι-2½-1 (iem one side) in a 12li/12 day/night cycle. As depicted in FIG. 96,. the ethano! production of ABICyanol strains #1790, #1791 , #1792, #1793, #1794, sad #1795 was greater than that of TK293 after about day 10 to about day 31 of growth. ABICyan© i strain #1 90 (SEQ ID NO: 81) has a piasniid map with annotations as depicted in FIG. 131. ABICyanol strain #1791 (SEQ ID NO: 82) has a piasniid map with annotations as depicted in FIG. 132. ABICyanol strain #1792 (SEQ ID NO: 83) has a plasmid map with annotations as depicted is FIG. 133. ABICyanol strain #1 93 (SEQ ID NO: 84) has a piasniid map with annotations as depicted in FIG. 134. ABICyanol strain #1794 (SEQ ID NO: 85) has a plasmid map with annotations as depicted in FIG. 135. ABICyanol strain #1795 (SEQ ID NO: 86) has a plasmid map wit annotations as depicted in FIG. 136.

Dual inducible dc genes

[0523] In an embodiment. ABICyanol host cells are transformed with eihanologenic vectors thai contain more than one pdc gene. Inductio of second pdc gene increases PDC activity by about 2.5 times when compared to the induction of only a single pdc gene. Induction of a more than one pdc gene results in an increase in etlianol productio and a decrease in cell growth. Thus ethanol production per OD750 s higher for #1743 when both pdc genes are active. Figure 97 depicts the PDC activity in strain #1743 with and without induction by 6 μΜ copper at about day 16 and tlie additional induction with 5 μΜ copper at about day 30. Figure 98 depicts the total etlianol production of strain #1743 with and without the induction by copper. Figure 99 depicts total ethanol per ceil d sity measured at OD?¾.

[0524] In an embodiment, dual pdc genes are introduced into an ABICyano l host cell either on an integrative plasmid or on a implicative plasmid. Thus, the dual pdc genes, and other

components of the eihanologenic cassette, can be integrated into the genome of ABICyano l and/or exist on an extra-cfawnosonial plasmid within the ABICyanol host cell. Strain # 743 is an ABICyanol host cell containing a recombinant piasniid pABICyanol -6.8: :PnirA- zniPDC Ϊ 71 (opt3) dsrA-Prbc*(optRBS .sy¾ADHoop*-PorfD221 -zmPDC(optl )dsrA. Strain #1743 has two independently inducible pdc copies where one pdc gene is inducible by nitrate and the other pdc gene is inducible by copper. Strain #1743 was analyzed for PDC activity in comparison to the corresponding single pdc strains #1578 (pdc under control of promoter PnirA) and #1771 (pdc under control of promoter Porf0221). The analyses revealed independently inducible expression of both pdc genes from one construct Without nitrate and copper addition, the pdc genes of strain #1743 were as tightly repressed as the single pdc strains #1578 and #1771. Long-term cultivation experiments using a copper inducible pdc construct, resulted in increased PDC expression when compared to other inducible pdc constructs such as nitrate inducible pdc constructs.

[0525J The second pdc gene of strain #1 43 was induced at day 16 of cultivation in a

photobi oreactor (at an OD750 of about 5.5) by addition of Co" . Strain # 1744 comprising plasmid

#1744 (FIG. 161) (pABIcymol-I^A-zmPDC{opt3)-d^^^

Porfi 126-zmPDC( ptl)\dsrA) (SEQ ID NO: 111) having two pdc genes under control of PnirA and Porf3126 (Zn ²⁺ ) was also induced at day 16 of cultivation in a photobioreactor (at an OD750 of about 5.5). The PDC activity in each strain increased to a value of about 5-6 p.mol mg¾iiii in comparison to a value of about 2.5 μΐΐΐοί ηι»*η ϊη for the control replicates without copper addition. Ethanol production increased about 10-15% at day 37 of cultiva tion. Additionally, the ethanot to OD7S0 ratio increased.

[0526] In an embodiment, the growth of strain #1 43 containing t o pdc genes, one pdc gene operably linked to a nirA promoter and a second pdc gene operably hnked to the endogenous copper-kducible promoter Porf022 i . is analyzed by measuring absorption at OD ₇₅₀ of the _. growth media after induction of the copper-inducible promoter Porf0221. As depicted in FIG. 100, cells were grown for 135 days and the addition of copper at. day 48. 78 and at about day 106 caused a. slight, decrease in the rate of growth of ABICyanol strain #1743 when compared to the control lacking copper in the growth media. s depicted in FIG. 100, a 1:12 dilution or a 1 : 16 dilution of the cultures is indicated by the thin arrows, the thick arrow depicts the first detection of revertants not having n firs pdc gene expressing PDC enzyme.

[0527] As depicted in FIG. 101 , the production of ethanes! from strain #1743 was measured in the same growth media as depicted in the OD ₇₅₀ measurements of FIG. 100. In an embodiment, as depicted in FIG. 101, the overall ethanol production increased when copper was added to the growth media at days 48, 78 arid 106. m another' embodiment, PDC activity from strain #1743 was measured over about 135 days of growth. As depicted in FIG. 101, a 1 :12 dilution or a 1:16 dilution of the cultures is indicated by the thin arrows, tlie thick arrow depicts the first detection of revertants not having 11 first pdc gene expressing PDC enzyme.

[0528] Figure 102 depicts the PDC activity in ABICyanol strain #1743 cells from growth media over the course of about 135 days. liie growth media was diluted at about days 48, 78 and 106 of growth. In another embodiment the total ethanoi produced per ceil density was measured. As depicted in FIG. 102. a 1:12 dilution or a 1 :16 dilution of the cultures is indica ted by the thin arrows, the thick arrow depicts the first detection of revertants not having n first, pdc gene expressing PDC enzyme.

[0529] As depicted in FIG, 103, strain #1743 was grown for about 135 days and was diluted at about days 48, 78 and 106 of growth and amount of ethanoi in percent volume per volume per OD750 was measured. As depicted in FIG. 103 the induction of the pd gene by introduction, of copper into the growth, media results in an increase in the amount of ethanoi produced per OE^so of ABICyanol strain #1743 when compared to the ABICyanol strain #1743 grown in media lacking copper. As depicted in FIG. 103. a 1 : 12 dilution or a 1 : 16 dilution of the cultures is indicated by th thin arrows, the thick arrow depicts the first detection of revertants not having 11 first pdc gene expressing PDC enzyme. As depicted in FIG. Ϊ03, the fat red arrow indicates the defection of first revertants (at about day 90). The top and bottom arrows on the far rights of FIG. 103 indicate the trend of carbon-partitioning (EtOH/OD) with and without copper addition respectively. With an increasing number of revertants,, a decrease in carbon-paititioning towards ethanoi is detectable. This decrease in carbon-partitioning towards ethanoi can be compensated by activation of the second pd copy (+ Cu ^2" ), after which the EtOH OD ratio remains about constant.

[0530] In another embodiment, and as depicted hi FIG. 163, the PDC activity of strains #1578.

#1743 and #1744 were tested with and without induction by nitrate and copper (#1578 and

#1743) and with and without induction by nitrate and zinc (#1744). Strains #1 43 (pABICyanol-

#1744 &ABICyanoI-6.S::I kA-zmPDC

zmPDC(optl)dsrA) have two pdc copies on the pABXcyanoi- kb plasmid under control of different promoters (inducible either by N<¾7Cu ^2÷ or N0 ₃ 7Zn ^÷ ). both show functional and independent inducible expression of both pdc genes. As depicted in FIG. 163, PDC activity was measured abou 48h after induction. ABICyanol strain #1578 (p ABICyanol -6.8: :PiiiiA- zmPDC(opt3)dsrA-Pibc* (optRBS)-syiiADH_oop) lacks a second pdc gene on the ethanologenic cassette. The second pdc gene can be turned on when the PDC activity from the first pdc gene is declining (due to decrease in promoter activity and/or PDC inactivation by genetic instability). Thus, PDC activity can be both maintained longer and at a higher rate in ABICyanol strains comprising more than one pd gene.

Homologous recombination in ABICyanol

[0531] In an embodiment, homologous recombination is used to introduce genes int

ABICyanol host cells. An ethanologenic gene cassette was successfully incorporated into the chromosome of ABICyanol by using homologous recombination. Figure 104 depicts the results of various homologous recombination (HR) events in ABICyano l . Different antibiotic resistance markers were introduced into the genome of ABICyanol b using homologous recombination including GmR and KrnR. The results of homologous recombination experiments in ABICyanol host cells are depicted in FIG. 104. The single to double crossover ratio is about 10: 1 using 2 kb homology amis. The use of 3 kb flanking regions for HR increases the frequency of double crossover events,

[0532] hi an embodiment, transformation of Cyanobacteriimi sp. ABICyanol with integrative plasmids which can integrate into the chromosomal DNA can be done in the same way as the transfomration wit extradiromosoinai self-replicat ing plasmids as disclosed herein, in an embodiment, the oriVT present in the integrative plasmids described in the following is only necessary for propagation of the plasmids in E. coli and for conjugative transfer into

Cymiobaci rium sp. ABICyanol. These integrative plasmids cannot replicate in Cyanobacteriimi sp., i particular in ABICyanol .

[0533] In an embodiment, integration of target genes into the genome of ABICyanol will be conducted with the hel of plasmid TK471 (pABICyanol :rpilT-PrbcLABICyanol_ m**pilC- sacB-oriVT) whose plasmid map is depicted in FIG. 105 (SEQ ID NO: 67), which was generated to integrate a kanamycin resistance gene in th pilT/pilC region, resulting in a ρίίΤ/pi C minus strain. The TK180 based plasmid contains a pilT Saaking region of ABICyanol upstream as well as a pilC flanking region of ABICyanol downstream of the kanamycin resistance gene to generate a double crossover event hi ABICyaool . Moreover, sacB from Bacillus subniis is encoded on T 471. Express on of sacB in gram negative bacteria grown on media supplemented with sucrose is toxic for the bacteria. Hence, only the bacteria which lose the sacB gene are able to grow on sucrose plates. ABICyanol T 471 strains grown on .siictOse kanamycin plates are therefore forced to induce homologous recombination to flip fee kanarnycin resistance gen into the genome a d to lose the piastnid T 471 due to the presence of the sacB gene. In order to integrate the EtOH cassette into the genome, plasniid TK471 will be modified carrying the EtOH cassette adjacent to me Km gene (also within the pilT and piiC flanking region).

[0534] Integration of target genes into the genome of ABICyanol was conducted with the help of plasniid TK541 (ori\ _flv3-iip_PAcL.-Gm**_tlv3-down) whose ptasmid map is depicted in FIG. 106 (SEQ ID NO: SB), which was generated to integrate a gentamyein resistance gene into orf2849 f.Sv3). The oriVT based plasmid Τ .54Ϊ contains a flanking region of orf2849 of

ABICyanol upstream as well as a flanking region of ©r£2849 of ABICyanol downstream of the gentamychi resistance gene to generate a double crossover event in ABICyanol in order to insert the sequence between both flanking regions of orf2849 into the genome of ABICyanol via homologous recombination.

[0535] Figure 107 depicts &DNA agarose gel of a PCR reaction using two PCR primers including one primer specific for the gentamychi resistance gene and the other primer binding within the genome of ABICyanol. This PCR was performed in order to identify the integration of the gentamyein resistance gene info the genome of Cyanobactenum sp. ABICyanol via transfomration with the above mentioned plasmid TK541. The line marked with "'M' ^" " denotes the marker. Lanes 1 and 2 show PCR signals using two different clones of Cyanobacterimn sp.

ABICyanol transformed with, the plasmid TK541, whereas lanes 3 and 4 are PCR reactions using and analyzing the mtransfornied wild-type of Cyanobacterium sp. ABICyano l sadE.c h containing plasmid TK541, respectively (negative control). It can clearly be seen that only lanes 1 and 2 give a PCR signal thereby evidencing the integration of the gentamychi resistance gene into tlie genome. The integration shown on the DN.A agarose gel of FIG. 107 relates to a single cross-over' integration where only one flanking region of or£2849 (fiv3) is involved, but. not the other one. This results hi an integration of the antibiotic resistance conferring gentamyein cassette of TK541 into the genome of ABICyanol without excision of parts of the chromosome of ABICyanol. The recombination frequency for a double crossover involving both flanking regions of orf2S49 is lower man for a single cross over recombination so that a double crossover event with plasmid T 541 could also have been identified if more transf miant were screened.

[0536] An additional plasmid. TK554 (4oriVTflv3-upPor-¾223ABICyaiK»l - zmPDCABICyano 1 (op t)dsi A-Prbc* (optRB S) - ADH 1 1 1 ( ABICyano ! )Prbd_Gm* *fiv3 -down) whose plasmid map is depicted in FIG. 108 (SEQ ID NO; 69). wa constructed which is a derivative of TK541 and which includes an etliaiiologenic cassette in addition to the antibiotic resistance conferring gentamycin cassette. This plasmid will be used in order to introduce recombinant genes involved in eflianol production into the genome of ABICyan i via

homologous recombination in the same way as for TK541.

[0537] Another integrative plasmid TK552 (oriVT_flv3-up_PcpcB ABICyaao 1 -Gm* *_flv3- down) whose plasmid map is depicted in FIG. 109 (SEQ ID NO; 70) was constructed which in comparison to the piasniids I 541 and TK554 contains different promoter. PepcB, for the gentamycin. gene. This promoter is also an endogenous promoter of ABICyano i . For this plasmid integration into the genome of ABICyanoi was shown via a double cross-over homologous recombination event, thereby resulting in the excision of a genomic region of the chromosome of ABICyanoi whic is located between, both Hanking regions fiv3up and ilv3down (see FIG. 110). Figure i 10 shows in lane "1" and ^** 2 ^W PCR reaction performed with primers specific for the gene .Sv3. Lane 2 corresponding to the ABICyanoi strain transformed with TK552 shows that the ge e Sv3 was deleted, whereas a clear signal of flv3 can be detected in lane "1" corresponding to the wild type ABICyanoi, The lane denoted with "M" is a marker. Therefore the integrative p!asmids can also be used in order to delete genomic regions of ABICyanoi by integrating a recombinant gene into its genome. This strategy can for example be use in order to provide targeted knock outs or gene disruptions of endogenous genes of Cyanobacferium sp. _f in particular ABICyanoi and at the time hitegratmg at least one recombinant gene into the genome.

[0538] In another embodiment, plasmid T 540 (ori\T?jpilT-up_PrbcL-Gm* ^sf; jpilC-down) whose plasmid map is depicted in FIG. I l l (SEQ ID NO: 71) was constructed, which can integrate into a different locus pilT/pilC in comparison to the piasniids TK541, TK552. and TK554. As depicted in FIG. 1 12. a. 0.8% DNA agarose gel depicts analysis for single and double cross over integration of mis plasmid into the genome of. Lanes i to 4 show the PCR analysis for a potential double cross-over event in the pilT/pilC region with printers specific for regions outside the pilT/pilC region. These primers give a positive signal for ABICyano wild-type and would give a small PCR product if a double cross-over integration took place. Lane I shows the lack of a doable cross-over PCR signal for pilT/pilC for ABICyanoi transformed with TK540. Lane 2 depicts the expected wild-type ABICyanoi band and lane 3 shows the lack of a. PCR signal for E. co!i containing plasmid TK540 as a. negative control. Lane 4 shows the PCR reaction using ¾0 instead of DNA (technical negative control). Lanes 5 to 8 depict the detection of single crossover integration into the pilT upstream region with lane 5 showing the PCR signal for ABICyanol transformed with TK540. Lane 6 again de ict fee wild type ABICyanol and lane 7 shows tlie lack of a. PCR signal for E.coif containing plasmid TK540, Lane S shows a PGR reaction "with ¾0. Lanes 9 to 12 depict, the detection of a single crossover integration into the downstream region of pilC with lane 9 presenting no PCR signal for ABICyanol transformed with TK540, and lane 10 showing the wild type ABICyanol. Lane 11 shows background PCR signals for E. cah containing plasmid T 540 and lane 12 is a negative control PCR reaction with water. M denotes tlie marker.

[0539] Li an embodiment, plasmids for chromosomal mtegration in the ABICyanol genome at the pilTC locus were constructed. The plasmids used optimized promoters P ^: OSTA*2- PimA*3, Ρ _ι ώΑ* _ί and P _or sie driven PDC(optl) along with a P^g-s nADH cassette. Tlie plasnaids used KmR, GmR and CmR marker genes. As depicted in FIG. 113, strains used for transformation included #1817 (SEQ ID NO: 107) (pfiv3 : :^A-zmPDC(optl)_dsrA-Pfbc.*(optRBS> synADH oop-PrbcL-Gm**) whose plasmid map is depicted in FIG. 157, and #1818 (SEQ ID NO: 10S) dsrA-P _i¾i *(optRBS)-synADH oop-P,¾cL-Gm**) whose plasmid map is depicted hi FIG. 15S _; both of which already would have one PDC/ADH cassette in the crornosome in the Sv3 locus.

[0540] Figure Ϊ 13 depicts the results of various HR experiments including particular gene knockouts in the genome of ABICyanol as well as various gene introductions into the genome of ABICyanol host cells fay HR. Knockouts created by HR include AnarB., AargH, and AieuB. Gene introductions include PmiA-pdc/adh, PorfG3«i dc/adh. and promoters used variously include PrbcL and/or PcpcB for expression of the Gm resistance. In an example, iiirA and adhE genes are knocked out by HR in ABICyanol,

[05411 In an embodiment, chromosomal integrative plasmids were used to integrate a marker gene into the chromosome of ABICyanol at tlie ffv3 gene. As depicted hi FIG. 114, PCR-based segregation analysis shows that an ABICyanol organism transformed with construct TK552 (pOriVT_flv3-iip_PepcB-Giii**_ilv3-dow i) successfully integrated an antibiotic resistance marker gene (Gm**) into to th f!v3 gen in the chromosome of ABICyanol. Figure 114 also depicts various stages of segregating the cell populations having the marker integrated into only some of fee population of transformed ABICyanol cells and populations having the marker integrated into all of the population of transformed ABICyanol cells. As depicted in FIG. 114, ABICyanol clone TK552.5 is completely segregated whereas ABICyanol clone T 552.S is only partially segregated (about 80%). [0542] In another embodiment, chromosomal integrative plasmids were used to integrate a Gm marker gene into the chromosome of ABICyanol at the ycf37 gene. As depicted in FIG. 115. PCR-based segregation analysts shows that an ABICyaaol organism transformed wife construct ΤΚ6Ί 6 (pC^\T_yc©7-i¾>_FRT-PcpcB-Gm* *-ter-FRT_ycf37-down) successfully integrated an antibiotic resistance marker gene (Gm**) into to the ycf37 gene in the chromosome of ABICyaaol. Figure 1 Ϊ 5 also depicts various stages of segregating the ceil popul tions having the marker integrated into only some oi the population of transformed ABICyaao l cells and populations having the marker integrated into all of the population of transformed ABICyanol cells. As depicted in FIG, 1 15, ABICyanol clone TK616.5 is completely segregated whereas ABICyaaol clone TK6I 6.4 is. only partially segregated (about 80%).

[0543 j In an embodiment, chroniosonial integration of a construct resulted in the creatioa of an ABICyanol strain auxotrophic for arginine. Chromosomal integrative plasmids were used to integrate a marker gene into the chromosome of ABICyanol at the argH gene. As depicted in FIG. 116, PCR-based segregation analysis shows feat an ABICyanol organism transformed wife construct TK597 (pOiiVT_argH-iip_FRT-PcpcB-Gin* *-tei-FRT_argH-down) successfully integrated an antibiotic resistance marker gene (Gm**) into to fee argH gens in the chromosome of ABICyanol, As depicted in FIG. 116 fee auxotiophy for arginine of fee ABICyanolTK597 strains was tested by growing on a BGl 1 agarose plate lacking arginine. As depicted in FIG. 116, all of fee iiuxoti spiiic clones cannot grow on the BG11 agarose plate lacking arginine whereas the wild-type ABICyanol can grow.

[0544] In an embodiment, chromosomal integration of eihanoSogenie constructs into the

chromosome of ABICyanol resulted in ABICyanol strains that produced et anol. As depicted in FIG. 117 plasniids #1817, #1818, #1819, and #1820 were inircducted into ABICyanol host cells and chromosomal integration occurred via homologous recombination. The piasmid map of #1819 (pfiv3:;I¾rA-zniFDC^ (SEQ ID

NO: 109) is depicted, in FIG. 159. Then piasmid map of #1820 (pflv3::Porfi)316- ID NO: 110) is depicted i FIG. 160. Strains resulting from fee integration events contained an exogenous ethanologenic cassette having an adli gene operabiy linked to a constitutive promoter Prbc*(optRBS) and having a. pdc gene operabiy linked to either a. nitrate inducible promoter PairA (#1817 and #1 1 ) or a copper hiducible promoter Porf03!6 (#1818 and #1820). [0545] In an embodiment a knockout of an ABICyanol homolog of a red gene in is disclosed to increase the efficiency of homologous recombination in ABICyanol , In S^ echocystis sp. PCC 6803 deletion of sill 354 (encoding for ssDN A- specific exonuclease red) increased the iransformability with suicide constmcts by two orders of irag fude (Kufryk et aL 2001). The gene all 1354 encodes for a 759 aa enzyme that is homologous to two Red proteins in

ABICyanol . A first Red homolog is 30% identical to sill 354 and is 575 aa (SEQ ID NO: 125) encoded by orfWSS is (SEQ ID NO: 127). A second Red homolog is 25% identical to slli3.54 and is 800 aa (SEQ ID NO; 126) encoded by orf23S4 (SEQ ID NO: 128). In an embodiment, H is improved in ABICyanol. by the deletion of orf0488 and/or or£2384. A knockout of or£2384 ("red2 ^s1 ) from the genome of ABICyanol was successful and is embodied in construct TK567.

[054<Sj In an embodiment, an integrative pl&smid is TK539 (onVT_flv3_ap_PrbeL- Km**_flv3_do n), the plasmid map with annotation is depicted in FIG. 138 and sequence depicted in SEQ∑D NO: 88.

[0547] In an embodiment, an integr ative plasmid is TK541 (onVT_flv3_up_Pii>cL- Gia**_ih'3_dowtt) the plasmid map with annotation is depicted in FIG. 139 and sequence depicted in SEQ ID NO: 89.

[0548] In an embodiment an integrative plasmid is T 552 (oriVT_flv3_up_PcpcB- Gm**_fiv3_down) the plasmid map with annotation is depicted in FIG, 140 and sequence is depicted in SEQ ID NO: 90.

[0549] In another embodiment, i integrative plasmid is ΤΚ6Γ7 (oriVT_flv3_up_ikb_FRT- PcpcB-Gni**-tB0014-FRT-flv3_down_lkb} the plasmid map with annotation is depicted in FIG.

141 and the sequence is depicted in SEQ ID NO: 91.

[0550] In yet another embodiment, an integrative plasmid is TK618 (oriVT_flv3_up_2kb_FR.T- PepcB-Gin**_tB001 -FRT-flv3_dciWK_2kb) the plasmid map with annotation is depicted in FIG.

142 and the sequence is depicted inSEQ ID NO: 92,

[0551] In an embodiment an integrative plasmid is T 619 (oriVT_flv3_itt>_3kb_FRT-PcpcB- Gni**_ter-FRT-fhe_down_3kb) the plasmid map with annotation is depicted, in FIG. 143 and the sequence is depicted in SEQ ID NO: 93.

[0552] hi an embodiment an integrative plasmid is TK572 {oriV _red_up_FRT-PcpcB-Gni**- tB0014-FRT_red_down) the plasmid map with annotation is depicted in FIG. 1 4 and the sequence listing is depicted in SEQ ID NO: 94. [0553] In an embodiment an integrative plasmid is T 567 (onVT_recJ2jap_FRT-PcpcB- Gni**-tB0014-FRT_i¾cJ2_dowii) the plas id ma -with annotation is depicted in FIG. 145 and the sequence listing is depicted in SEQ ID NO: 95.

[0554] In an embodiment, an integrative plasmid is T 596 (oriVT_narB_iip_FRT-PepcB-Gm**- tB0014-FRT_aarB_d n) the plasmid map with annotation is depicted in FIG. 146 and the sequence listing is depicted in SEQ ID NO: 96.

[0555] In a certain embodiment, an integrative plasmid is T 597 (oriVT_argH_up_FR.T-PcpcB-

Gm**-tB0014-FRTjargH_down) the plasmid map with annotation is depicted in FIG. 147 and the sequence listing is depicted in SEQ ID NO: 97.

[0556] In an embodiment, an integrative plasmid is K598 (oriVT_ieiiB_up_FRT-PcpcB-Gm* *- tB0014-FRT_leuB_down) the plasmid map with annotation is depicted in FIG. 148 and the sequence listing is depicted in SEQ∑D NO; 98.

[0557] In an embodiment, an integrative plasmid is T 616 (oriVT_ycB7_up_FRT-PcpcB- Gm**-tB0014-FRT_ycB?_down) the plasmid map with annotation is depicted in FIG> 149 and the sequence listing is depicted in SEQ ID NO: 99.

Kits for producing compounds of interest

[0558] In an embodiment, a kit for producing a compound of interest using genetically enhanced ABICyanol host cells includes genetically enhanced ABICyanoI host ceils, a vessel for culturing the host cells and a means for iOum ation of the host cells. In an embodiment, the host ceils of the kit produce ethanol and the means for illumination is photosyntketically active radiation from the sim. In an embodiment, the means for mumhtation of the host cells include lamps or light emitting diodes or a combination thereof. The vessel of the kit can he a phoiohi oreaetor which is at least paitly transparent for the radiation emitted by the means for iJiimihiation of the host cells . In particular embodiments, any of the phoiohioreactors disclosed in the PCT application WO 2008/055190 A2. which is hereby incorporated in its entirety by reference, can he used.

Furthermore the kit also can also include means for separating the compound, preferably ethanol from the growth medium as, for example, disclosed in the PCT application WO2011/103277 Al, which is hereby incorporated in its entirety by reference.

AEiCyanoi free from antibiotic resistance genes

111 [0559] In certain strains of genetically enhanced eyanobacteria, antibiotic resistance genes are paired with inserted genes of interest in order to improve the genetic stability of the inserted gene when an antibioti c is present in the medium. It would be beneficial, however, to be able to construct a stable, genetically enhanced Cyanobacteri ^' tmi sp. ABICyanol strain that does aof contain an antib iotic resistance gene, and does not require the presence of the corresponding antibiotic in order to maintain, the inserted genes.

[0560] In an example, a genetically enhanced ethaaologenic Cyanobacteri tm sp. ABICyanol mat is free of antibiotic resistance genes is prepared. The construction of an anfibiotic-resisfanee- cassetie free strain is based on the inaetrva ion of an essential gene (e.g. argH) or a conditionally essential gene (e.g. narB) located on the chromosomal DNA, and its replacement on the plasmid that carries the inserted genes of interest .

[0561] 111 a more specific example, the construction of an antibiotic-resistaiice-cassette free strain is based on the iiactivation of the endogenous (conditionally) essential genes, narB and argH, which are both located on the chromosomal DNA, and then placing a functional narB or argH gene on the extrachroniosomal plasmid that contains the ethano! cassette (or other inserted gene of interest). Essentially, this results in fee functional narB or argH gene being relocated from the cbrotnosomal DNA to the recombinant plasmid.

[0562] Because the argH and narB gene products are (conditionally) essential for the survival of the cell, the presence of the plasmid that the argH or narB gene lias been moved to also becomes essential for the survival of the cell. This is a way of preserving the extrachromosomal plasmid (and any genes it carries) without the need of using antibiotics in the medium. This method is particularly useful for commercial scale growth of a given strain.

[05631 In one illustrative embodiment, the method involves the following steps: the location of the argH and narB gen is identified in the ABICyanol genome. ^' The greater than 2000 kb upstream and downstream flanking regions of the argH and narB gene are identified. A DNA fragment for the knockout of argH or narB is prepared, having the greater than 2,000 kb upstream region of the narB or argH gene; the sacB cassette or the galK gene driven by a suitable inducible promoter, a gentamycin resistance gene driven by a suitable promoter, and a. greater than 2,000 kb downstream region of the narB or argH gene as well as oriVT enabling replication in E. coli and conjugafive transfer. This construct introduced to Cyanohacteri m sp. ABICyanol by conjugation. Successful transfomiaiits will contain a sacB Gm or galK/Gm fragment in place of the original narB or argH gene. [0564] Additionally, the cells have also been transformed with an exiraelifoiiiesoinal plasrmd having I) a functional narB or argH gene and 2) the ethanoi cassette genes,

[0565] The fcaii&fonned ceils are grown on increasing amounts of genta ycin in order to select for transformed ceils where all wild-type copies of me narB or argH gene are completely absent and replaced by the mutated gene copy version. The step of growth on high amounts of antibiotic is repeated as needed until a cell is selected that lias no chromosomal copies of the original narB or arsH gene.

[0566] Subsequently, in order to remove the gentamyem resistance gene and the counter- selectable marker sacB or galK gene, the foil owing method can he used. Hie sacB gene encodes the enzyme levansucra.se from Bacillus sub lis that confers sucrose sensitivity on gram-negative bacteria suc as cyanobacteria. SacB is lethal to the cyanobacterial ceils in the presence of sucrose. This causes any cells having the gene sacB to die in the presence of sucrose. Thus, by adding sucrose to the sacB Gm transformed ceils, and then selecting for snrviving cells, one can select for cells that have lost the sacB/Gni cassette, hi another embodiment, if galK is used as a. counter-selection marker which encodes the gaiaetokinase gene from E. coli and confers sensitivity to 2-deoxy-galactose (2 -DOG) on gram-negative bacteria such as cyanobacteria. GalK is lethal to the cyanobacterial cells in the presence of 2-DOG. This causes any cells having the gen galK to die in tlie presence of 2-DOG. Tims, by adding 2-DOG to the galK Gm transformed cells and then selecting for surv vin cells, one can select for cells that have lost the galK Gm cassette

[0567] Resulting ceils would have the narB/ethanol cassette or argH ethanol cassette located on the extrachromos mal plasrnid. but would not contain sacB or galK, an antibiotic resistance gene, or the original (cliromosomally located) narB or argH gene.

[0568 j By use of this and related methods, genetically enhanced, ethanoi producing

cyanebacteriai cells are obtained that do not have antibiotic resistance genes, and mat also maintain the ethanoi cassette without the need for antibiotics. Further essential or conditionally essential genes whick can be applied alternatively to narB and argH to create antibiotic free ceils include ieuB, pyrF, nirA and ggpS; narB, nirA and ggpS are conditionally essential genes while leuB and pyrF are essential genes.

ABICyanol p6.S derived plasmids [0569] In an embodiment #1658 (pABIcyaiio i-PiiirA2-zmPDC(opt3)-dsrA-Prt c(op†RBS)- syiiADHoop) wiiose plasmid map is depicted in FIG. 1 IS (SEQ ED NO: 72) is a piasmid useful for production of compounds of interest in ABICyaa l .

[0570] In another embodiment, #1663 (ρΑΒΐ€γ3ίΐοϊ-ΡηίίΑ*4-ζιιίΡΒΟ(ορί3) -ί1¾ι~Α-

Prbc*(optRBS)-sytiADHoop) whose piasmid ma is depicted in FIG. 119 (SEQ ID NO; 73) is a piasmid useful for production of compounds of interest in ABICyaiiol .

[0571] In another embodiment, #1697 (pABIcyaiiol-PnirA*3-zinPDC(opt3)-dsfA-

Prbc*(oplRBS)-sy-iADHoop) whos piasmid map is depicted in FIG. 120 (SEQ ID NO: 74) is a piasmid useful for production of compounds of interest in ABICy aiio l ,

[0572] In an embodiment, #1932 (pABIcyano iPmrA*2-zmPDC(opt3)\dsarA-PcpcB-

ADHi 1 l(opt)_trbcS) whos piasmid map is depicted in FIG. 150 (SEQ ID NO: 100) is a piasmid useful for production of compounds of interest in ABIC aaol.

[0573] hi anomer embodiment, #1933 ^ABIcya∞l-PnirA*2-znd ^> DC(opi3)\0¾A-PcpcB- Adh916{ pt)_trbcS) wiiose piasmid. map is depicted in FIG. 1 1 (SEQ ID NO: 1 1) is a piasmid useful for production of compounds; of interest in ABICyaaol.

[0574] In an embodiment, #1934 ^ABIcyaiioi-Piiii A*2-ziiiPDC(op l) dsi A--PcpcB- ADHI520(opt)_trbcS) whose piasmid map is depicted hi FIG. 152 (SEQ ID NO.:. 102) is a piasmid useful for production of compounds of interest: in ABICyaaol >

[0575] In yet. another embodiment, #1 35 (pABIcyai:io l-Porf0316-zniPDCiopt3) dsfA-PcpcB- ADH! 1 l(opi)_JjrbcS) whose piasmid map is depicted in FIG. 153 (SEQ ID NO: 103) is a piasmid useful for production of compounds of interest in ABICyaiiol .

[0576] hi an embodiment, #1936 (pABIcymol-Porf&316-zmPDC(opt3)kisrA-PcpcB- Adli 16(opt)_trbcS) whose piasmid map is depicted in FIG. 154 (SEQ ID NO: 104) is a piasmid useful for productio of compounds of interest in ABICyaaol .

[0577] In another embodiment. #193 (pABIcyanol-P©rf0316-zmPDC(optl)\dsrA-PcpcB- ADHl 52G(opr)_trbcS) whose piasmid map is depicted hi FIG. 155 (SEQ ID NO: 105) is a piasmid useful for production of compounds of interest in ABICyaiiol,

Optimized promoters

[0578] In an embodiment copper-promoter variants with improved RBS are depicted in FIG, 121. In another effifaodmieiit copper-promoter valiants with improved -10 region (Pribnow box) are depicted in FIG. 122. in yet another embodimen optimized Porf3126 (PsmtA) derived from ABICyanol is depicted in FIG. 123.

PDC activity in Ziac-iuducible strains

[0579] In an embodiment, and as depicted i FIG. 124. PDC activity in Zn ^" induced ABICyaiioI s rains TK490 and #1762 was measured. In an embodiment, ABICyaiioI strain #1762

(pABIeyanol -PorfB 126*-zmPDC(opti}dsrA-Pibc*(opti¾S)-ADH. 1 i(opt) ^' \ter} whose pksmid map with annotations is depicted in FIG. 126 (SEQ ID NO: 76) comprises an improved variant of the native zmc-indiicihle orf3126 promoter that exhibits substantially higher PDC activity compared to the strain TK490 comprising the native orf3126 promoter. When induced with 5 μΜ zinc, strain TK4 0 exhibits PDC activity of 0.62 μηιο1ίίι¾*ηιίη . while in strain #1762. the PDC activity is 5.8 is about 10-fold greater due to the use of the improved Porf3126* variant with introduced nucleotide changes within both snitB binding sites and the RBS as depicted in FIG. 123. A piasnnd map of #1753 (pABIcyanol-Piiii-A-zniPDC(optl}_dsrA- Prbc*(optRBS)-Adhl 1 l_ter) with sequence annotation is depicted in FIG. 127 (SEQ ID NO: 77),

[0580] The present disclosure is further described by the following non-limiting example .

However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present disclosure.

EXAMPLES

Example 1: Bacterial strains, growth conditions, and selection of transformants

[05S1] E. colt strains HB101 (Promega)., XLIO-Gold (Strata ene), and o-seleet (Biolhie) were grown in Luria-Berfani (LB) medium at 37 °C. Ampicillin (50 ug/mL), kanamycin (50 ug rnL), and chloramphenicol (34 ttg rnL) were used when appropriate. Cultures were continuously shaken overnight at 200 rpin and at 100 rpm when used for conjugation. ABICyanol was cultured at from 28 °C to 37 °C in liquid BG1 ί fresh water medium on a reciprocal shaker at 150 rpm under continuous illurniiiatioii of approximately 30 - 40 μιηοΐ pfaotons*m ^"'i *sec ^"1 .

[0582] Unless otherwise noted, the ABICyanol sansfoonants were selected on solid BG11 medium containing 0 - 20 ug/mL kanamycin and were maintained on BGl 1 plates containing 40 pg/mL kanamycin. For growth in liquid freshwater BGl I medium, 30-40 ug/mL of

kanamycin was applied. [0583] Plasmid DNA from E. coi, strains was isolated using a GeneJet Plasmid Miiiiprep Kit (Femieiiias) according to the manufac tare's protocol. For plasmid isolation from putative ABICyanol transforaiaiits, total DMA was prepared according to Salia et al. (2005), World Jour. Microbiol Bioteclmol 21:877-881.

[0584] For plasmid rescue from putative ABICyanol transfonnants. total DNA was isolated and transformed in both «-select and XLIO-Gold. E. coli colonies were selected for kanamyem resistance, DNA was isolated from single colonies and analyzed by PCR. and restriction analysis for the presence of the correct plasmid. In particular, the endogenous plasmid of ABICyanol was captured with the EZ-Th5 CR-6Kyo?¾ AN-2) Tnp Transposome kit (Epicentre, Madison, WI) by following me protocol provided by the manufacture. The rescued clones were amplified in

TransforMax.™ EC lO0D™_p» ^* -l 16 electro-competent E. c !i ost cells (Epicentre, Madison, WI). Plasmid DNA was prepared with Qiagen plasmid Maxi kit (Qiagen Inc., Vakncis, CA). Approximately S to 16 rescued clones were selected for sequencing via the conventional Sanger sequencing protocol. Protein-coding genes from each of the plasmids were predicted with the gene finder Glimmer (Deicher AL, Bratke KA, Powers EC. & Salzberg SL (2007) identifying bacterial genes and endosynibioni DNA with Glimmer. Biomformaiics 23(6):673-679) version 3.02,. followed by BLAST against the NCBI N database.

Example 2: Preparation of cyaHobacteriitl culture medium

[0585] BG-11 stock solution was purchased from Sigma Aldrich (Sigma Aldrich, St. Louis, MO). Stock solutions of the antibiotics spectinomycin (100 mg mL) and kanamycin (50 mg/mL) were purchased from Teknova (Tekiiova, Holiisler, CA), Stock solution of the antibiotic gentamyciii (10 mg mL) was purchased from MP Biomedicals (MP Biomedicals. Solon, OH). Marine BG-1 i (niBG-l 1) was prepared by dissolving 35 g Crystal Sea Marinemix (Marine Enterprises International, Inc., MD) in 1 L water and supplementing with BG-11 stock solution. Vitamin Bo (Sigma Aldrich) was supplemented to mBG-11 to achieve a final concentration of 1 jig/L, as needed.

Example 3: Ethanol tolerance of ABICyanol

[0586] ABICyanol strain was tested to determine its toleranc to the presence of ethanol in the culture medium, in comparison to two publicly available strains. S nechocysns PCC 6803 and Sy chococcHS PCC 7002. The cells were cultured in 100 mL Erlennieyer flasks with 50 mL culture volume in marine BG11 media (35 psu). Edianol was added to the cultures to obtain a. concentration of 1% (v/v) ethanol. T e cultures were examined weekly for cell viability and remaining ethanol concentration. At each of the weekly samplings, the ethanol level was replenished as needed in order to maintain the 1% (v/v) ethanol concentration. The ceils were also examined using a microscope (light microscope, phase contrast, auto- Siioresceiice). If more than 50% of cells wer intact the test ^' was continued. Cyanobacterial cells were deemed to be intact if ceil morphology did not change significantly upon addition of ethanol, the cells were still gr een, and cells were not. lysed after additi on of ethanol. The number of weeks that each of the strains remained at least 50% viable in the cultures spiked with 1% ethanol was determined. Growth for at least S weeks is considered to be a positive screening result. The results indicate that S techocystis sp. PCC 6803 can withstand at least 1% ethanol in the medium for 3 weeks, that Syn chococc s sp. PCC 7002 can withstand at least 1% ethanol in tlie medium for 13 weeks and that Cymiobacteritfm sp,. in particular ABICyanol, can withstand at least ϊ% ethanol in the medium for at least 16 weeks.

Example 4; Temperature tolerance of ABICyanol

[0587] Wild type ABICyanol was tested to determine its ability to grow at various temperatures. The initial starting cultures (50 mL in an Erlenmeyer flask) were grown under standard growth conditions (continuous 2S °C and light). The cultures were diluted to a chlorophyll content of about 5 pg mL. The temperature changes during the assay were made without, any prior temperature adaptation of th cultures. All tests were performed in marine media in a day/night cycle (1.4/lOh) for temperature (test depending) and light intensity (40 pmolE nT'see ^"1 or

darkness). The temperature tolerance tests were performed with increasing temperature profiles: maximum peak of 2 h at 45° C. 48* C, 50 ^s C, 53° C, 55 °C and a day/night difference: f 18 °C. Each temperature profile (45 C, 48 °C, 50 °C, 53 ^S C and 55 ^C C) was run for 7 days. Cultures were sampled on days 0, 2 , 5 and 7 with determination of OD ₇₅₀ (if possible) and chlorophyll. If a stein was grown under one temperature profile, the culture was diluted to same startin

chlorophyll content, and directly tested in the next higher temperature profile. An increase in chlorophyll content was used a the growth indicator. As depicted in Table 1, the results of the test indicate thai ABICyanol can tolerate eulturing condition of at 48 °C, 50 °C, and at least 53 to 55 °C for at least two hours over a period of time of at least 7 days. [0588] Tlie growth of wild type ABICyanol was compared with. Synechococcus PCC 7002 to elucidate its ability to grow in a p otobioreactor environment while wider extreme temperature fluxuations. Cultivation of ABICyaaol was performed in 0,5 L round photobioreactor (PBR) glass vessels (Sehott) with implemented ports for sampling, in and out gas tubing, and pH as well as oxygen sensors. Mixing was via a magnetic stir bar,. pH is controlled via C ¾ inflow. The oxygen and pH sensors ar connected to an oxygen and pH measurement bo (Crison

.instruments, SA), and the gas flow is controlled by mass flow controller system (Vdgrlin

Instruments). All parameters (oxygen, temperature, gas flow, pH) are controlled and monitored using a computer software programmed by HT Hamburg, Tli system temperanires of the PBRs were set to be comparable to me temperature profiles used in tlie temperature tolerance test, t e results of which are depicted in Table X, with maximum temperanires of 45 °C. 50 °C and 55 °C as compared to the standard PBR growth temperature of 37 T. Each temperature profile was ran on an experimental culture for 7 days. Culture sampling was performed three times per week and OD ₇₅ & chlorophyll content and protein content were measured. At the beginning, and at tlie end of each week, the dry weight of the accumulated biomass was determined. If a strain survived a given temperature profile, the culture was diluted to the same starting condition (chlorophyll content of about 10 g iiiL) and the next higher temperature profile was tested.

[0589] As depicted in FIG, 2. ABICyanol is able to grow well at high temperatures, as compared to other genera, such as Syneckococcits PCC 7002,

Example 5: Oxygen tolerance of ABICyanol

[0590] ABICyanol ceils containing a recombinant pdc gene under the transcriptional control of R _o ii _A and a recombinant Synadh gene under the control of P _jpsL (Ρ _φύ . is the promoter of the 3 OS ribosomal protein S I 2) were grown in niBGi 1 medium. Cells were diluted to a starting OD of approximately OD ₇₅₀ = 1. Cells were cultivated in 500 mL phoiobioreactors, round vessels with a 9.5 cm diameter, PBRs were iUurninated with day/night cycle of 12li/12k from two sides with fluorescent tubes. Tlie light intensity was approximately 400 μΕι ί ² s ^"1 from each side.

Temperature followed the day/night cycle with 37 °C during the iUumina ion phase and 28 °C during the night. Cultures were constantly mixed with a magnetic stirrer with 450 rpm. C ⁽ ¾ was supplied and regulated by monitoring pH (on/off modus): pH was maintained at 7.3 ± 0.05 by computer-controlled supply of C(¾ (as 5% (v/v) C0 ₂ in air) into tlie medium. Growth medium was mBGI I. Three PBRs were run hi parallel. The PBRs were purged with three different oxygen nitrogen mixtures with a flow rate of 100 niL rein during tlie illumination period.

During the night phase, gas was not supplied to the PBEL Tlie mixtures of oxygen and nitrogen (here given in percent oxygen (v/v)) were obtained with computer-controlled mass flow meters. The actual oxygen concentration in the medium was measured online with optical oxygen sensors and a multi-channel fiber optic oxygen transmitter (GXY-4 mini; PreSens). in contrast to Clark- type oxygen electrodes, this setup allows the measurement of very high oxygen concentrations.

[0591] At different time points samples were taken and analyzed for (i) ethanol and acei aldehyde in the medium, (ii) Absorbance at OD7 _S& , (iit) chlorophyll content and (iv) total protein.

Chlorophyll content and total protein were measured as in Tandeau De Marsac, N. and Houmard, J. in: Methods hi Enzymology, Vol. 1 9, 318-328. L. Packer, ed.. Academic Press, 1988, which is hereby incorporated by reference. In order to characterize tl e energy metabolism oi : the cells, the oxygen production rates hi the light and the oxygen consumption rate in the dark were also measured. A Clark-type electrode {Rank brothers, diameter I cm) was used. Cells were diluted with ii BG l I to 5 to 10 pg ciuorophyil/ ^' rnL. NaHC<¾ was added to 5 niM. Temperature was adjusted to 37 °C. lihmimatioii was with a slide projector H50 (Pentacon). For the measurement of P/I curves, light intensities were adjusted by varying the distance between projector and electrode,

[0592] Tlie cultures of ABICyano l cells containing a recombinant pdc gene under the transcriptional control of P^A and a recombinant Synadh gene under ^' the control of P^L w ere purged with gas mixtures containing 21%, 70% and 80% (v/v) oxygen in nitrogen. Twenty one percent oxygen in nitrogen corresponds to air. Purging the cultures with 21% oxygen resulted in an oxygen concentration in the growth medium of approximatel 200 μηιοΙ L. Purging the cultures with 70% oxygen resulted hi oxygen concentration of greater than 650 μτηοΙ L during the day period and greater than 300 μΐΒθΙ/L during the "night". Purging the cultures with 80% oxygen resulted in a reading dur ing tlie day of greater than 900 μπιοΙ L (in some cases greater man 1000 μηιοΙ/L) and greater than 600 umoi L during the "night". The higher oxygen concentrations in the growth medium are caused by an increased oxygen production through photosynthesis.

[0593] The growth rates for the parameters of absorbance at OD ₇₅₀ , ethanol production rates, and chlorophyll content were calculated. The results are summarized in table 10. For these

calculations, the measured data were fitted to a regression line, and the slope was used to

calculate the increase per 24 li. The quantitative analyses depicted in table 5 shows that even for die high oxygen concentrations of 70 and 80% oxygen, tlie decrease in ethanol production and growth in ABICyanol was small.

Table 10

[0594 j ABICyanol growth and ethanol production were compared to Synechococcus PCC 7002 growth and ethanol production. As with ABICyanol, Synechococcus PCC 7002 was transformed with a recombinant pde gene under the transcriptional control of P^ _A and a recombinant. Synadh ge e under the control of Ρ^. In contrast fo ABICyanol, significant effects on ethaiiol production, cellular growth and chlorophyll content were found for the recombinant

Synechococcus PCC 7002 strain when purged with the differe t oxygen concentrations. Table 11 shows that purging with 80% oxygen decreased the ethanol production rate by 28%, decreased cell growth by 36%- and decreased chlorophyll content by 5 I% _; during the course of the experiment A comparison of tables 10 and 11 shows that the adverse effect of high oxygen concentrations on Synechococcus PCC 7002 growth, ethanol production and chlorophyll is significantly greater than for ABICyanol .

Table 11

100% 7 % 72%

Growth 0.959 OD _?5S /d 0.797 OE d 0.612 OE d

100% 83% 64%

Chlorophyll 3.710 Chi/d 2.455 Chi/d 1.800 Chi/d

100% 66% 49%

[0595] The above results show thai ABICyanol is less sensitive to oxygea, man the ethauol producing Sy chococcus PCC 7002, which was tested ia parallel under comparable conditions. For the latter strain 70% (v v) oxygea in nitrogen was sufficient to significantly inhibit growth and ethanol production.

Example 6; Transformation of ABICyanol with p6.8 kb based shuttle vector

[0596] The endogenous 6.8 kb plasmid of ABICyanol can be used as a means of shuttling exogenous DNA to cyanobacteiial host ceils. By inserting an origin of replication that is effective in E. coli (such as R6KOri), the p6.8 kb plasmid DNA can be manipulated in bacteria, suc as E. c lL to incorporate genes and sequences of interest into recombinant p6.S kb. For example, mod fications to decrease tlie effectiveness of endogenous restriction systems that are present in ABICyanol, such as methylaiioii, can be performed.

[0597] The presence of an origin of replication mat is already on ABICyanol can assist with replication of the recombinant p6.8 kb once it is transferred into a host cell. Multiple cloning sites can be added to allow for several different antibiotic resistance genes to be added, if desired. Multiple cloning sites can. also be inserted to allow for ease of insertion of various expression cassettes, such as the pdc dh gene cassette for ethanol production. In this way, various sequence segments of the plasmid can be replaced with other sequence segments as needed.

Example 7: Detection of endogenous restriction endoniicleases in ABICyanol

[0598] Restriction endonucleases (RENs) expressed by cyanobacteria can be a major barrier for successful transformation of cyanobacterial host cells. Accordingly, the presence of RENs in ABICyanol has been analyzed. Bioinformatk analyses predicted the following RENs for ABICyanol: HgiDI (Acyl), Aval, Avalll, BstEIL and HpaXL Prediction of RENs was conducted by comparing a query set of alt the encoded amino acid (AA) sequences in ilie ABICyanol draft genome against fee REBASE (httpi/A^base ieb on^rebase/rebase.iiliril), restriction enzyme database maintained by the New England Biolabs (NEB) using the basic local alignment search tool (BLAST). Significant lists were pooled and manually examined for the presence of restriction-modification motifs using b oinformatic analyses including BLAST against NR.

(iicbi.. nlm .nih. gov. biast/bla s t_datab ases . shtrnl), PFam (pfam.sanger. a , uk ) and SMART

(smart.embl-heidelberg.de/). These bioinfo raticaliy predicted RENs were further verified through biochemical assay of crude cellular extract of ABICyanol.

[059 1 Lane 3 of FIG. 55, depicts that plasniids intended for transformation were cleaved by a crude extract of ABICyanol. In order to improve the efficiency of a transfomiation protocol, protection against the damaging effects of RENs was needed. This was achieved by ethylation using the commercial CpG meth lase M.SssI, the results of which are depicted in Fig, 55, lane 4.

[0600] Crude extract from ABICyano l was prepared as follows; 50 rnL of liquid pi¾-culiure was inoculated to an OE - _5¾ i _m 0.5- 1. After growth for 10 days. 30 mL of the ABICyanol culture of was pelleted (5 minutes at 3000 x g at room temperature), washed once with lysis buffer (40 niM sodium hydrogeriphosphate pH 7.4. 1 mM EDTA, 5 % (v v) glycerol) and resuspended in 1 mL lysis buffer. ABICyanoi cells were disrupted by glass beads using a tissue lysis apparatus at foil speed for 4 minutes. The supernatant was then withdrawn and eeiitrifuged twice at 14000 x g at room temperature. One U of RNase per mL was added to th final supernatant. Restriction analysis on plasmids followed by sequencing was used to determine the presence of RENs HgiDI (Acyl). and Aval in the crude extract of ABICyanol.

Example 8: Competent ABICyanol cells for transformation by conjugation

[0601] Many cyanohaeteria produce extracellular polymeric substances (EPS), however, the appearance and composition of the EPS layer are strain specific and dependent on environmental conditions. EPS can be associated to the cell surface or released to the suiToundtng medium (Pereira. et al., 2009, FEMS Microbiol. Rev. 33: 17-941). While the released substances can in some cases be easy to remove from being associated with the cyanohacterial ceils, hi other cases the EPS is difficult to remove.

[0602] ABICyanoi was stained with sciibtol black (drawing ink for calligraphy. Pelican), which cannot penetrate EPS, to test for the presence of EPS. As depicted hi FIG.. IB. staining of ABICyanol cells with scnbtol black resulted in a white/yellowish layer around the ABICyanol cells indicating a lack ȣ staining by scnbtol black. Thus, FIG. IB depkis micrographs of stained ABICyanol cells showing that the EPS is attached fo the cells. ^' This layer inay decrease the ability of the ABICyanol cells to accept foreign DNA during tlie conjugation process for transfomiatioii.

[0603] After several unsuccessful attempts, the inventors were able to successfully transf rm th ABICyanol cells after using methods to decrease the EPS layer. Thus, the following method was used to decrease the EPS layer prior to conjugation. The method involves several steps: treatment of cells with NAQ washing steps that utilize NaCL treatment with lysozyme, and subsequent washing followed by a conjugation procedure.

[0604 j Two hundred mL of a exponentially growing culture (00?5&Μ__ greater than about 0.5 and less than about 1.0) was incubated with NAC for 2 days at 16 °C (end concentration of MAC is about 0.1 mg/niL) without shaking. This pretreatment was followed by several steps to degrade the EPS and to weaken the ceil wall The pretreated culture was pelleted at 4400 rpni and washed with 0.9% NaCl containing S wM EDTA.

[0605] For further treatment with iysozynie. the cell pellet was resuspended in 0.5 M sucrose and incubated 60 min at room temperature (RT) with slow shaking (85 rpm). Then,, cells were centrifuged and resuspended in 40 mL of a solution containing 50niM Tris (pH 8.0), 10 mM EDTA (pH 8.0), 4% sucrose, and 20-40 ug i L Isozyme. After incubation at rt for 10-15 min, cells were centrifuged and washed three times using different washing solutions: i) 30 mM Tris containing 4% sucrose and 1 mM EDTA: ii) 100 mM Tris containing 2 % sucrose and iii) with BG1 1 medium. All centrifngatian steps before lysozyme treatment were performed at 4400 rpm for 10 min at 10 °C. All centrimgaiions after the lysozyme treatment were performed at. 2400 rpm for 5 min at 4 °C. Resuspended ceils were used for conjugation.

Example ; Transformation of ABICyanol by Conjugation

[0606 j Gene transfer to ABICyanol was performed, using conjugation. Generated, plasmids containing oriVT were used for conjugation. The shuttle vectors were transformed into

ABICyanol following a modified conjugation protocol which includes the pre treatment of ABICyanol to reduce its EPS layer- as described in example 17.

[0607] Triparental mating was performed as follows: E. c !i strain J53 bearing a eoajegative RP4 plasTiikl and £. coli strain HB101 bearing the cargo to be introduced into ABICyanol and the pRL32S helper plasiiiM (for in vivo ethylation) were used. E. coif strains were grown in LB broth supplemented with the appropriate antibiotics overnight at 37 °C with shaking at 100 ipni. Aa aliquot of 3 - 5 niL of each culture was centrifuged, washed twice with LB medium and resuspeaded in 200 L LB medium. Subsequently, the E. coli strains were mixed, centrifuged and resiispeiided in 100 uL BG11 medium. Two hundred niL of exponentially growing cyanobacterial culture (OD^s& _a n _. of greater than 0.5 and less than 1.0) was centrifuged (3000 rprn, 10 mm), preheated to degrade the EPS iayer as described in. example 17, aad subsequently washed and resiispeiided ia 400 uL BGl 1 culture medium containing Tris suerose buffer

(example 17). A 100 jtL aliquot of resiispeiided cyanobacterial and.£. coli cultures was mixed and applied onto a membrane filter (Miilipore GVWP, 0.22 pm pore size) placed on the surface of solid BGl I medium supplemented with 5% LB. Petri dishes were incubated under dim light (5 μΕ m ^"2 s ^"1 ) for 2 days. Cells were then resiispeiided in fresh BGl 1 medium and plated onto selective medium containing 10 and 15 pg/niL kanamycin. respectively. The following selection conditions were used: light intensity of approximately 20 - 40 μΕ m ^~~ s ^"1 at a temperature of approximately 28 °C. Transfomiants were visible after approximately 7-10 days. The

traasfonnajii colo ies were then plated on BGl 1 media containing 15 ug niL kanamycia and then transferred stepwise to higher kanamycia concentrations {up to kaaamycin 60 ug niL) to aid in the selection process.

Example 10: Transformation of ABICyanol by electroporatioii

[0608] Eleciroporation can also be used for successful transformation of ABICyaiio l using, for e am le; the same piasmids as for conjugation, but with lower efficiency.

[060 1 As with the conjugation transformation protocol (example 18), strain-specific adaptations of standard eleciroporation protocols need to be made to avoid DNA digestion by endogenous restriction enzymes and to allow- DNA entry through fee EPS layer. To aciiieve successful electroporation, DNA is protected against endogenous restriction enzymes by nieihyiation. Prior to electroporation, ABICyaiiol cells are pretreaied -with positively charged olyaminoacids such as poiy-L- lysine hydrobromide or poly-L -ornithine hydrochloride or combinations thereof (in particular poly-L-lysine hydrobromide) in order to increase the DNA uptake efficiency,

[0610] As an example, one hundred niL of exponentially growing ABICyaiiol cultures

(corresponding to a cell density of approximately 2x10'' cells mL), were harvested, washed and resuspended in 0.9 % NaCl containing 25 mM Tris-HCl (pH 8.0). Poly-L-lysine hydrobromide was added to the resuspended cells to obtain a final concentration of 50 ftg niL. ABICyano! cells were then incubate for several hours or overnight before eiectroporation,

[0611] Ih a typical procedure, SO niL of polry-L-rysine hydrobromide treated ABICyanol cells were harvested and treated with 30 niL ke-cold BGI ί containing 6% DMSO, After incubation on ice for 20 iiiie, cells were harvested and frozen in liquid nitrogen for 1 min. ^' These pre-frozen cells were thawed by adding 15 rnL ice-cold buffer containing I inM HEPES (pH7,5), 0.2 mM 2HPO ₄ and 0.2 mM MgC ^' l?, The cells were washed sequentially once more with 1 mM HEPES and ETMT buffer containing 0.1 mM HEPES. 0.2 mM ₂ HP0 ₄ and 0.2 mM MgC¾. The cells were harvested by eentrifugation at 15000 a for 5 min. All of the washes and cen ifugations were carried out on ice or in a pre-chilied centrifuge (4 °C). For each eiectroporation procedure, 3 jig methylated DNA is added to 100 ttL of concentrated cells. Cells were electroporated in a cuvette with a 2 mm gap between the electrodes and pulsed once in a Gene Pulse X-ceU (Bio- Rad) using an exponential decay protocol (electric field strength of 8 kV/cm, capacitance of 25 μ¥, resistance of 460 ohms, for a time of approximately 8-9 ins). After' electi'oporation.. 1-2 inL BG 11 mediuni was immediately added to the cyanobacferial suspension, which was subsequently transferred to a 50 mL flask containing 15 mL fresh BGI 1 medium. After incubation for 1- 2 days under normal light (30— 40 Ε m ² s ^"1 ) with gentle shaking at 30 °C, recovered cultures were centrifuged, resiispended in 500 uL BG! 1 medium and placed onto selective media (BGI I containing 20 pg/eiL Km or 40-60 μ g.½L of spectinomycin).

Example 11: Determination of etlianol production

[0612] GC headspace measurements were performed on a Shhnadzu GC-2010 gas

chromatograph with a flame ionization detector. The instrument is connected in-line with a Shiniadzu PAL LHS2-SHIM/AOC-5000 autosampler . The autosampler has a gas-tight syringe for transfer of headspace aliquots from the culture samples to the analytical unit. Culture samples in the autosampler are illuminated from the bottom with a. LED acrylic sheet equipped with a dimmer. Mixing of the samples in fee autosampler is accomplished with the IKA R05 power magnetic stirrer. A heating mat. KM-SM3 ofMohr & Co in combination with the JUMO dTRON 316 temperature regulator is used for themiosfatisaiioii of the culture samples in the autosampler. The gas chromatograph uses helium as a. earner gas as well as hydrogen and artificial air as fuel gas and oxidizer gas. respectively,, for the flame ionization detector. Oxidizer air is generated with the generator WGAZA50 from Science Support. The gas chromatograph is equipped with a FS-CS-624 medium bore capillary with a length of 30 m, interna! diameter of 0.32 mm and film thickiiess of ! .8 pm from the GC supplier Chroimtographie Service GmbH.

[0613] Sample preparation for GC headspace measurements was as follows. Hybrid closes were grown oil BG11 plates containing inducing agent or without supplementation of the inducing agent. A sample was prepared by scratching an indi vidual clone from the BG I Ϊ plate and ^suspen ing t e corresponding clone in mBGl 1 liquid medium. The addition of inducing agent triggered ethanol production in the sample by induction of the inducible promoter driving overexpre sion of the recombinant pdc and adh genes. The cell density in the sample was men adjusted to an optical density at 750 nm of approximately 0.7. Two iitL of sample were then filled into a gas-tight GC vial for headspace autosampling with a. nominal volume of 20 mL. The sample headspace was supplemented with 5 mL CO,. T e vial was tightly closed with a cap containing a self-sealing silicone septum and was then placed into the autosampier rack, The autosampler rack was temperature controlled at a given temperature, for example 37 °C.

[0614] If necessary, reference samples can he prepared as 2 mL aliquots with 0.005. 0.0 L 0.02, 0.05,. 0.1 , 0,2, 0.5, 1, 2, 5 and 1.0 mg/mL e hanol in 35 psu NaCl. Reference samples were placed into the same 20 mL sample containers with self-sealing silicon septum caps for headspace aiitosampling. For each reference sample, at least six measurements were applied. After the measurements, the resulting peak areas of the reference samples were used for generating two ealibratioa curves, the first in the concentration range f om 0.005 to 0.5 mg mL- ethanol and th second one for the concentration range from 0.5 to 10 mg/mL ethanol. The calibration curves were linear.

[0615] The sample incubation temperature in the autosampler was adjusted to a given

temperature, for example 37 °C. The illumination is set from about 90 uE m ^"2 s ^"1 to about 150 μ.Ε m ^'1 s ^"1 . In an embodiment, the illumination was set to 120 Ε m ^'1 s ^'1 . The magnetic stirrer was configured for interval mixing of the samples, with cycles of 2 min mixing at 400 rpm, followed by 90 niinutes without mixing. An automated process follows wherein after given periods of time., aliquots of 500 ^L of the headspace of the samples are automatically drawn from the headspace with a gas-tight syringe and injected via the injection port into the gas dbromatograph for analysis. Before each headspace autosampiing, the mixing is changed for 10 min to continuous mixing with 750 rpm at 37 °C incubation temperature. The syringe temperature was set at 70 °C. The fill speed was 250 uL per second, following an initial lag time of 1 second after the septum of the samples has been pierced by the syringe needl . The injection of t he aliquot into the gas chromatograph happens wife an injection speed of 500 μί per second. Afterwards, the syringe flushes for 3 min with air to prevent sample carryover between two injections. The gas duomatograph runtime was 4 min and 30 s. The injection temperature on fee gas

chromatograph was 23© °C. The column temperature was 60 °C. Detection was accomplished with the flame ionization detector at 250 ^C C process temperature. The makeu gas was nitrogen at 30 mL per minute, the fuel gas is hydrogen a 35 mL per minute and the oxidizer gas is artificial air at 400 mL per minute.

[0616] After the filial measurement, the final optical density at 750 iiai of the samples was measured and an average ceil density for each sample was delenmned by calculating the

arithmetic mean of the optical density at the starting point and the optical density at the end point of the process, Afterwards, the average ethanol production rate per cell density was calculated.

[0617] Two kinds of measurements were performed, GC online measurements (applied for clone testing and short-term characterizations, and single GC measurements (applied for measurements of EiOH concentration of samples taken from PBR cultivations).

[0618] hi a typical experiment for the quantitative deteniiinatioii of acetaldehyde and/or ethanol content in gr owth media by headspace gas chromatography (GC), the ethanol production of the respecti ve cyanobacteriat culture has to be induced 1-3 days prior to the GC measurement to trigger the overexpression of the pdc and Synadh production genes. For instance, to repress the P _fl i _A (e.g. hi TK225. TK293) hybrids were grown in mBGil (artificial seawatef) depleted of NO¾ ^~ , with 2 mM Urea and 2 mM NH .CI. To induce the iiirA promoter, ceils were transferred prior to the GC measurement into mBGll (artificial seawater salts) with nitrate. For GC measurements, cells were harvested from liquid cultures by eentri ugation and then resiispended in the appropriate fresh marine medium ensuring, that the induction conditions were maintained. The medium was furthe supplemented with 50 mM TES, pH 7.3 and 20 mM NaHCOj. The sample was adjusted to an OD _? s ₀ of 0,7. Two mL samples were men ahquoted per 20 mL GC vial loaded with 3 mL pure CC¾. The tightly closed GC vials were placed onto an illuminated (120 μΕ m ^'2 s ^"1 from the bottom) headspace auto sampler and were analyzed on the same day on a

Shimadzu GC-20I0 gas chroma .tograph equipped with a medium-bore capillary column (FS-CS- 624. length 30 m; inner diameter 0.32 mni; film L8 uni) and a flame ionisation detector,

[0619] T!ie culture was stirred once in an hour under constant light (approximately 120 Ε m ^* s ^{" J} ) in GC vials (at 35 °C) on the GC sampling tray. Acetaldehyde and ethanol content were measured online at four different time points during 40 h to 48 . Measurements could be extended to 72 h.

[0620] After completion of the GC measurements, t e final OD?JO was determined and used to normalize the ethanol production rate according to the average OD?so of me cyanobacteiial s ample. The average OD ₇₅₀ was calculated as the arithmetic mea of the ODT _S&HJ , at the time of sample preparation and the 00 55 after completion of the GC measurement

[0621] Figure 34 depicts the results of the ethanol quantitation. ABICyanol containing TK293 produced a higher amount ofethanol (-0,02 % (v v)/OD*d) about 2-4 fold higher versus the production of ethanol when transformed with plasmids T 225.

[0622] The data generated for and depicted in table 9 includes the ethanol production data for various ABICyanol strains. The third column shows the ethanol production rate as determined by a GC vial online assay. The fourth to sixth column show the etlianol production determined for 0.5 L Crison PBR, and for vPBR with different imunination intensities for a period of cultivation of 1 days or 21 days, respectively. These ethanol production data were determined with GC singl measurements. The term "vPBR" indicates ''vertical photobioreactors". The following procedure describes the standard lab conditions under which a I 2L vPBR is operating as well as the necessary parts, ports, etc, to construct this 1..2L vPBR. The I column vPBR consists of an autoclavable polypropylene flexible film [Profol Kunststoffe GmbH; Germany) with the dimensions of 750 mm total height and a diameter of 50 mm whe filled with liquid. The filling volume is about 1.2 L leading to a liquid height of about 620 ± 20 mm and a headspace of about 150 ± 20 mm. The vPBR is equipped with several ports for operation, located on specific positions of the vPBR from bottom to top; a sampling port (60 mm from the bottom), a ga.¾ port (130 mm f om the bottom), a pH probe port (300 mm from the bottom), DC¾ probe port (350 nan from the bottom), a m di m^ port (650 mm from the bottom) and a gas _OB t port (700 mm from the bottom). The illuminated surface ar ea when ilhiminated from one side is 0.04 m ^A . The standard light conditions is a uniform light field from one side with 125 or 230 uraol mf s ^"1 at the vPBR surface generated by a hg t panel which consists of 9 to 12 T5 54W 6500 fluorescent bulbs operating is a 12/12h day/night cycle. The temperature is set to 39 °C ± 2 ^C C during day and 29 °C ± 2 °C during night. The niixing is realized via the ascending air bubbles through the liquid culture. The gas flow is operating in a constant sparging mode (day and night) with air enriched with. 15% CO? introduced, on demand via pH control (pH sefpoint = 7,3. day and night) and a flow rate of 38 mL tain ^"1 . The number of holes in the sparging tube for a 1.2L vPBR is app ox. 50 holes (perforated from both sides) and the sparging tube length is 220 mm. The standard cell density for starting a cultivation experiment OB7S8 _BH - = 0.5 in mBGl 1 medium with 35ppt (parts, per thousand) salt (about 35 psu) (for strains that do not aggregate under high-light illumination}. Table 9 depicts a list of plasmids for used for transformation of ABICyanoi with ethanologenic cassettes and also depicts ethanoi production hi ABICyanoi host cells created thereby.

Example 12: Determination of ethanoi production using gas chromatography

[06231 Two kinds of GC headspace measurements were performed:

a) GC online vial measurements (applied for clone testing and short-term characterizations of cultures cultivated in GC vials with a duration of up to 72 hours,

b) single GC single measurements (applied for measurements ofEtOH concentrations in samples dayly taken from PBR cultures) by measuring the ethanoi content after transferring 0.5 niL of the PBR cultures into GC vials after certain points of time of cultivation in the PBR.

GC single measurements do not invol ve the cultivation; of the strains in the GC vials. GC single measurements wer e performed in order to characterize the long term ethanoi production of strains, which are already known to produce ethanoi in sufficient quantities in GC online vial measurements, GC single measurements further differ from GC onl ine vial measurements in the volume of the culture (2 niL in GC online vial and 0.5 mL aliquots taken from a PBR culture in GC single measurements). In single GC measurements only the absolute amount of ethanoi produced at a certain point of time is detenmned, whereas the GC online vial measurements determines the course of ethanoi production during a certain period of time up to 72 hours of growing the cells a GC vial under constant illumination. For GC single measurements the sample was heated to 60 ^C C hi order to transfer all ethanoi from the liquid phase to the gas phase for the GC headspace chromatography, which resulted in a disruption of the culture, in contrast to that this 60 ^C C heating step was omitted during GC online vial measurements in order not to destroy the culture and in order to further continue with fee culturing of the cells is the GC vial. In the following GC online vial measurements are described.

[0624] GC online vial headspace measurements are performed on a Shiniadzu GC-2010 gas ehromatograph with Flame Ionization Detector. The detection limit for ethanoi quantification is at 0.0005%, but a calibration has to be done for detecting quantities below 0.001%. The instrument is connected in-line with a Shiniadzu PAL LHS2-SHIM/AOC-50QQ autosampler, comprising a gas-tight syringe for transfer of headspace aliquots from, the culture samples to th analytical unit. Specific modifications were hidroduced as follows: Each sample tray is exposed with a. LED acrylic sheet (length: 230mm, wide: 120mm. diameter: 8 mm, 24Chip, S4. 53GGK), equipped with a dimmer by company Sfingl GmbH. Beiow the sample tray a magnetic stirrer is installed (IKA RO 5 power) allowing for mixing of cultures which are cultivated in GC vials that s nd in the sample tray. Hie sample trays are penetrating of maximum, so thai the GC Vial stands in the Tray, A heating mat between LED acrylic sheet and the magnetic stirrer (MOHR &Co, one heating circuit, 230 V, 200 Watt, lengt : 250 mm, wide: 150 mm, diameter" ca, 2,5 mm) with a temperature regulator {JUMO dTRON 31 ) allows for the incubation of cultures in. GC vials at specific temperatures. The gas chronratograph is connected to helium carrier gas as well as hydrogen and artificial air as fuel gas and oxidizer gas. respectively, for the flame ionization detector. Oxidizer air is generated with the generator WGAZA50 from Science Support. The gas cinematograph h equipped with a FS-CS-624 medium bore capillary with a length of 30 m. iiitemal diameter of 0,32 mm and film thickness of L8 urn from the GC supplier Cm miatographie Service GmbH.

[0625] The ethanol product on in the culture as io be induced 1-2 days before the GC online vial experiment is realized by triggering the overexpression of Pdc and Adh. For induction hybrid cells are harvested from liquid cultures by centrifiigatioa and are resuspended in a sterile tube with niBGl 1 media with additional 50i¾M TES pH 7.3, 20mM NaHC(¾ _; antibiotics and nitrate until they reached an OD of 2. For the hybrids wim nirA promoter the induction is realized by transfer to nitrate containing medium. The clones were incubated on a small shaker at 180 rpm for 48 hours at 28°C. The shaker is armed wim a dimmable light table adjusted to 120 μΕ

(30θ«Ε- ^: 0μ.Ε). After 48 h centrifuge the lube at 20*C for 10 minutes. 4500 rpm and discard the supernatant. The Pellet is resuspended in mBGl 1 medium suppl. with 50mM TES pH 7.3, 20mM NaHCOi, containing nitrate and no antibiotics. For hybrids under control of copper responsive promoters the induction is realized by addition of 3-6μΜ copper, for zinc inducible promoters is the induction is reahzsd by addition of ΙΟμΜ zinc sulfate (heptahydrate) and for hybrids with the petJ promoter the induction is done by transfer to copper-free medium. The clones were incubated on a small shaker at 180 rpm for 24-48 hours at 28°C. The shaker is armed with a dkmiiabie light table adjusted to 120 μΕ (300μΕ-0μ.Ε).. After 24h - 48h cells were harvested by centrifugation in a 50mL Falcon tube at 2G°C for 10 minutes, 4500 rpm and discard the supernatant The pellet is resuspended in mBGll medium supplemented with 50 mM TES pH 73, 20mM NaHCQ$, and appropriate metal ions for induction without antibiotics. The sample will be adjusted to an ODTSQ of about 0.7 (- /- 0.1) for 4 replicates. 2 mL are filled in 20 mL GC vials equipped with a magnetic stir bar {12 mm) in which the lid is not completely tightened. 5 mL pure carbon dioxide is injected for 1-3 days with the 30 niL syringe through the septum, and then the lid tightly closed (gas tight). The tightly closed GC vials are placed into the lieadspace auto sampler rack which is temperature controlled at a given temperature for example 37 ^C C and are analyzed at the same day. After the GC measurements the final OD750 is determined for the calculation of the ethanol production rate per average OD? _¾ >. The average cell density for each sample is determined by calculating the arithmetic mean of the optical density at the starting point and the optical density at the end point of the process.

[0626] If necessary, reference samples, for the calibration of the gas chromatograph can be prepared as 2 rnillilitre aliquots with 0.005, 0.01, 0.02, 0.05, 0.1, .2, 0.5, 1, 2, 5 and 10 mg/mL etliaiioi in 35 psu sodium cloride. Reference samples are placed into the same 20 mL sample containers with self-sealing silicon septum caps for headspace autosampling. For each reference sample at. least six measurements are applied. After the measurements, the resulting peak areas of the reference samples are used for generating two calibration curves, the first in the concentration range from 0.005 to 0,5 mg rnL ethanol and the second one for the concentration range from 0.5 to 10 mg niL ethanol. The calibration curves have to fulfill linearity.

[0627] The sample incubation temperature for the GC online measurements in the aiitosampier is adjusted to a given temperature for example 37 °C. The illumination is set at 90 μΕ to Ϊ 50 μΕ. preferably 1.20 uE. The magnetic stirrer is configured for interval mixing of the samples, with cycles of 2 minutes mixing at 400 rprn, followed by 90 minutes without mixing. An automated process follows, wherein after given periods aliquots of 500 \iL of th lieadspace of the samples are automatically drawn with th gas-tight headspace syringe and injected via the injection port into tiie gas chromatograph for analysis. Before each headspace autosa pling, the mixing is changed for 10 tnin to continuous mixing with 750 rpm at 37 °C incubation temperature. Tiie syringe temperature is set at 70 °C. The fill speed i 250 μΤ. per second, following an initial lag time of 1 second after the septum of th samples has been pierced by the syringe needle. The injection of t e aliquot into th gas chromatograph happens with an injection speed of 500 uL per second. Afterwards, the syrmge flushes for 3 minutes with air to prevent sample carryover between two injections. The gas chromatograph runtime is 4 minutes and 30 seconds. The injection temperature on the gas chromatograph is 230 °C. The column temperature is 60 °C. Detection is accomplished with the flame ionization detector at 250 °C process temperature. The makeup gas is nitrogen at 30 mL per minute, the fuel ga is hydrogen at 35 niL per minute and the oxidizer gas is artificial air at 400 mL per minute.

[0628] After the final GC online vial measurement, the final opti cal density at 750 am of the samples is measured and an average cell density for each sample is determined by calculating the arithmetic mean of the optical density at the starting point and the optical density at the end point of the process divided by two. Afterwards, the average ethane! production rate per cell density is calculated.

[0629] hi a typical GC online vial experiment for the quantitative determination of acetaldehyde and/or ethanol content in growth media by headspae gas chromatography (GC), the ethanol production of the respective cyanobacterial culture has to be induced 1-3 days prior to the GC measurement to trigger the expression of the pdc and adh production genes. For instance, to repress the PnirA promoter (e.g. in TX225, T 293) hybrids were grown in niBGl l (artificial seawater) depleted ofNOj ^" , with 2 mM Urea and 2 naM NH ₄ CI as alternative nitrogen source. To induce the nirA promoter, cells were transferred prior to the GC online vial measurement into iriBG! ! (artificial seawater salts) with nitrate. For GC measurements ceils were harvested from Uqpid cultures by cenuifuga&on and then resuspended in the appropriate fresh marine medium ensuring thai, the induction conditions were maintained. The medium was further supplemented with. 50 mM TES, pH 73 and 20 mM NaHCOj. The sample was adjusted to an ODTSB _OHI of 0.8 and 2 mL samples were then a!iquoted per 20 mL GC vial loaded with 4-5 mL pure CO > depending on the planned duration of the culture experiment The tightly closed GC vials were placed onto an illuminated (120 Ε m ^"2 s ^"1 ) headspaee auto sampler and were analyzed on the same day o a Shknadzii GC-2010 gas chrornatograph equipped with a inedmiii-bore capillary column (FS-CS-624, length 30 ni; I.D. 0.32 mm; filin 1 ,8 μηι) and a flame ionization detector.

[0630 j The culture was suited once in an hour under constant light (approximately 120 μΕ) in GC vials (temperature 37 °C) on the GC sampling tray. Acetaldehyde and ethanol content were measured online at. four different time points during 40— 48 hours. Measurements can be extended up to 72 hours.

[0631] After completion of the GC online vial measurements, the final ODrsam. w s fetermined to normalize the ethanol production rate according to the average ΟΒ _75¾1ΙΪΪ of the bacterial sample. The average w s calculated as the arithmetic mean of the OD750nm at the time of sample preparation and the after completion of the GC measurement. [0632] Tlie results of the ethane! quantitation are exemplaiily shown in FIG. 47 and e.g. tables 4, 5. and 9. ABICyanoi with TK293 produced a high amount ofeihanoi (-0.02 % (v/v)/OD*d ), which is about 4 fold higher than wife plas idT 225,

Example 13: Activity assay for pyruvate decarboxylase enzyme

[0633] Tlie Pdc enzyme activity assay is a photometric kinetic reaction that, can be monitored, at. 340 mil using a spectrophotometer. Pyruvate is eiizyniaiically converted to acetaideliyde by pyruvate decarboxylase, which is reduced to ethanol by ethanol dehydro enase tinder NADH oxidation. The determined Pdc enzyme activity is related to the protein content.

[0634| Spin down 5-1.5 mL fresh culture material in a 15 mL tube (5,000 g, 10 min, 4 °C). Adapt culture volume to optical density: OD75CX1: 20 ml, OD750 1-2: 15 ml, OD750 2-5: 5 ml,

OD750>5: 3 mL culture as approximation. Resuspend the pellet in 0.9 mL pre-cliilled (4 ^* C) Purification Buffer (50 niM MES, _: 100 μ.Μ EDTA, 1 mM TPP, 2 mM DTT, 0.025mg/niL

lysozynie). Take 0.9 mL supernatant and add 750 ^iL pre-c illed glass beads in a 2.0 mL safe- lock Eppendorf tube. Cell disruption is done with the mixer mill (Ketsch) for 15 min at 30 Hz. The resulting suspension is incubated at 35°€ for 30 min in a mermomixei'. Afterwards the samples are centrifuged (10,000 g, 10 min) and the supernatant is then used for the analysis.

[0635] Tlie PDC enzyme measurement can be done in a photometer or in a plate reader. For the measurement in a cuvette mix 500 uL- supernatant sample, 2 Τ (15 mg/mL) ADH and 463 \{L of Reaction Buffer (1) (43.2 mM MES buffer, 0.43 mM NADH, 10.8 mM CaC12) in the cuvette. For the measurement in a plate reader mix 20 |iL supernatant sample and 173 μL of Reaction Buffer (2) (23.1 mM MES buffer, 0.231 inM NADH, 5.8 mM CaCl2 _: . 0.031 mg/ mL ADH) i ^' the plate. Incubate the sample in the spectrophotometer resp. plate reader until a stable baseline is observed (-200 s).

[0636] Start the reaction by addition of 35 300 rnM pyruvate into the cuvette resp . 7 pL in each well of the 96 deep-well plate and record adsorption at a wavelength of 340 sm for 60 s.

[0637] Oxidation of NADH is observed as a. decrease of absorbance at 340 urn. Typical values from the bench top PBR are 100-300 iiniol* mis- 1 *mg- 1 -protein.

[0638] For calculating the specific Pdc enzyme activity in the cell extract, the protein amount in the supernatant based on th method Lowry et al. is determined. For the sample preparation the DOC/TCA precipitation method (DOC =Na deoxycholate, detergent; TCA = trichloroacetic acid) is used. Example 14: on-naturally occurring ethmiologefiie ABICyanol organisms

[§639] Various embodiments of non-nateally occurring ethanoiogenic ABICyaaol organisms of the invention disclosed herein are exemplified through the depieiion of ethanol production, PDC acti vity and other characieristics of tlie non-nari&ally occurring organisms as exemplififed in the following figures.

[0640] Figure 28 depicts the ethanol production normalized to the growth (O js& _t m) determined by the CG vial method for ABICyaaol strains transformed with the plasmids #1606, plasmid #1629 and plastnid #1636 .tor a period of time of at least 20 days.

[0641] Figure 29 depicts the specific act ty of PDC determined by the CG vi al method for ABICyanol strain transformed with the plasmids #1606, plasmid #1629 and plasmid #1636 for a period of time of about 20 days.

[0642] Figure 30 depicts the specific activity of ADH determined b the CG vial method for ABICyaaol strains, transformed with the plasmids #1606. plasmid #1629 and plasmid #1636 for a period of time of about 20 days.

[0643] Figure 31 depicts the ethanol production normalized to the growth (O jsoam) determined by the CG vial method for ABICyanol strains transformed with the plasmids plasmids # 1606. plasmid # 1631 and plasmid # 1632 for a period of time of at least 20 days .

[0644] Figure 32 depicts the specific activity' of PDC determined by the CG vi al method for ABICyanol strains taasfonned with the plasmids # 1606, plasmid # 1631 and plasmid # 1632 for a period of time of at least 20 days.

[0645] Figure 33 depicts the specific activity of ADH detemiiiied by the CG vial method for ABICyanol strains transformed with the plasmids # 1606, plasmid # 1631 and plasmid # 1632 for a period of time of at least 20 days.

[0646] Figure 34 depicts the production of ethanol and a etaldehyde determined by the GC vial method from C ^' yanohaci rmm sp. ABICyanol strains containing either one of ethanoiogenic plasmids TK2 3 and T 225.

[0647] Figures 35A to 35D depict the ethanol production rate, acetaldehyde accumulation and ADH and PDC activities of about a 15 day ciilfivatioa of Cyanobacterium sp. ABICyaaol containing tlie ethanoiogenic plasmid T 225. Panel A depicts ethanol production (percent ethanol per volume per day) panel B depicts acetaldehyde (percent w/v), panel C depicts PDC enzyme activity over time, and panel D depicts ADH enzyme activity over time. [0648] Figures 36A to 36 depict ethasol production rate, cell growth and aximum ethanoi production rate for 7 days from a Ϊ4 day cultivation of C tmabacterittm sp. ABICyanol containing the emanologertic plasmid TK293.

[0649] Figure 37 depicts the ethanoi production rates and the aceiaMehyde accumulation determined by the GC vial method for Cy nobactenum sp. ABICyano I strains variously containing different ethanologenic plasmidsTK293. # 1495. # 1578 and# 1581 thai were cultivated for 40 hours.

[0650] Figure 38 depicts and compares (in the left panel) the PDC enzyme activity and (in the right panel) the ADH enzyme activity between ABICyano 1 host celts each containing one of the plasmids TK293, #1495, #1578, and #1581.

[0651 j In an embodiment, transformed ABICyano 1 cells containing ethanologenic cassettes are grown under inducing conditions in mBGl 1 medium, and may be tested for ethanoi production. ABICyanol containing the plasmids T 293 and TK225 produced 0.086% (v/y) and 0,019% (v/v) ethanoi, respectively, over a 50 h period in an online GC vial system (FIG. 34). Cultivation of etiianologeeic ABICyanol ceils was performed in 0.5 L round PBR glass vessels contaimng marine BG11 culture medium. pH was controlled via C ¼ flux. Cell growth and ethanoi production are shown in FIG. 35 sad FIG. 36 for ABICyanol containing TK225 and T 293, respectively.

[0652J ABICyanol organisms variously containing plasmids #1606, #1629 and #1636 with dc gene under the transcriptional control of either the native nirA promoter, or modified variants thereof, were cultured in 0.5 L photobioreactors. These enhanced ABIC ano 1 variously contained plasiiiids #1606. #1629 and #1636. Figure 28 shows the ethanoi production normalized to growth (OD _75¾JBl as determined by the CG vial method for ABICyano i transformed with plasmids # 1606 (a pdc gene raider the control of the native P^A}, plasmid # 1629 (a pdc gene under the control of a variant of P^ _A with changes in the RBS) and plasmid # 1636 (a pdc gene under the control o f a modified variant of P^ _A with changes in the operator sequence and the TATA box). Ethanoi production was measure over a period of at least 20 days after induction. Induction ofPakA was realized by transition of the pre-eu ture to mBGl 1 medium containing nitrate for induction at the begkmiiig of the cidtivaiioii experiment. Figure 28 depicts that the normalized ethanoi production is higher for ABICyanol containing the plasmids w ith modified promoters. Figures 2 and 30 depict the specific activity of PDC enzyme and ADH enzyme during the course of cultivation. The inducible, modified nirA promoter variants PnirA*2 (#1629) and PtiirA*3 (#1636) result in higher activity ofPDC enzyme compared to the native promoter (#1606).

[0653] A petJ promoter endogenous to ABICyanol was identified and further characterized. Expression of P^i is tightly repressed under hig copper (1-3μΜ) conditions and induced under copper depletion as depicted i FIG. 39A. An ABICyanol TK441 strain having the endogenous P- _j e upstream, of an ethanologenic gene cassette produced the same amount of ethanoi (percent v v) under copper depletion conditions as compared to an. ABICyanol TK2 3 strain grown in marine BG11 (FTGs. 39A and 39B).

[0654] Figure 3 J. depicts ethanoi product ion, as determined by the GC vial method, normalized to growth, as represented by absorb asce at OD ₇ s _¾sm , for ABICyanol trans formed with plasniids #1606 (a pdc gene under th control of fee na tive P^A)- plasmid # 1631 (a pdc gene under the controi of a modified P _eorT with modifications in the TATA box) and plasmid # 1632 (a pdc gene under the control of a modified P _tssrX with modifications in ilie TATA box and the RBS). Ethanoi production was measured for a period of time of at least 20 days while the cells were cultured in 0.5 L piiotohior aetors. The va½e for ethanoi production of ABICyanol transformed with plasniid #1606 is close to the value for ethanoi production of ABICyanol transformed wife plasmid #1632. The ethanoi production of the ABICyanol transformed with plasmid #1631 exhibits a lower ethanoi production rate than ABICyanol transformed with plasniids #1606 and #1632, especially hi the time period starting from about the tenth day of cultivation.

[0655] Figures 32 and 33 depict the specific activity of PDC enzyme and ADH enzyme during the course of cultivation. ABICyanol transformed with plasniids #1632 and #1606 demonstrated higher activity of PDC enzyme than ABICyanol transformed with plasmid #163 i .

[0656| Figures 40, 41 and 42 depict the ethanoi prodiiction rates of the ABICyanol transformed with plasmid #1635. or plasmid #1639. or plasniid #1640, respectively.. ABICyanol strains containing plasmid #1635, or plasmid #1639, or plasniid #1640 all include the native P _smt A from S nechsococcus PCC 7002 as well as modified versions fPsmtA. Figures 40, 41 and 42

demonstrate that the promoters are repressed in the absence of n^ and can be induced upon addition of Ζη ^2τ .

[0657] Modified vectors such as TK293, and #1536 each containing an ethanologenic cassette and an antibiotic resistance gene under the transcriptional control of an ABICyano Ϊ and/or an endogenous promoter of Syneckococms PCC 7002, respectively, are transformed into

Sy ch cocciis PCC 7002 using eiectroporation, conjugation or natural uptake. The transfoniiaiits are selected for on an agar plate using the appropriate antibiotic. The putative Iransfomiaiits are then confirmed by PGR analysis. Positive cells are streaked and scaled up to grow as a culture. Ethanol production is measured. By use of this method, ethanol would be produced using a p6.8 derived vector containing an ethanologemc cassette using organisms other than those of the genus Cy nobaciermm and or ABICyanol.

[0658] ABICyanol strains containing the following constructs were tested for ethanol production, cell growth, ADH activity, and PDH activity:

TK293 [pr71-6.8_PnirA-m-PDC(optl)^sL-s iiADH(optI)Jei']

#1495 [pi 71 ^.8_FiiirA-zntfDC(opt3>P^sL-s i-AI>H(opt3)_ter]

#1578 [pl7l-6 J¾k-A-miPDC(opt3}_d^^^

#1581 [p!71-6.8 JPnirA-zmPDC(Qpt3)_dsrA-PrpsL^

#1601 [p!71 -6.8_PnirA-zniPDC(opt I)_dsrA-Pifcc*(optRBS)-synADH{ope)_ter3

# 1 06 [p 17 Ϊ -6.8_PnkA-zniPDC(ept ί i dsrA-Prbc* (optRB S)-synADH{opt 1 )_ter]

TK411 (pl71-6.8_PnkA-.^DC(op )-PipsL-synADH{optl)Jer]

TK412 [pl71-6.8_PnkA-zniPDC(optl)^sL-s>¾LADH(opt3)_ier]

[0659] As depicted in FIG, 43 , different variations of the components of the ethanoiogenic gene cassette were created. In an embodiment one of the resulting constructs #1578 resulted in an improved ethanol production rate compared to T 293. Construct #1578 included the zmpde gene with a third version of codon-optiniizatioii, an additional mtmdiiced transcriptional terminator dsrA, and the native synadh gene whose expression is controlled by the artificial rbc*(opt BS) promoter which is an improved variant of the rbcL promoter derived from Syiiechoc siis PCC 6803.

[0660] Figure 44 depicts cell growth, ethanol production and normalized ethanol production of ABICyanol with TK293 or #1578. Figure 45 depicts PDC and ADH activity in ABICyanol with T 293 or #1578. Figure 46 depicts overlays of the curve progression in regard to cell growth, overlays of the curve progression in regard to ethanol production, overlays of the curve

progression in regard to the ethanol production rate and a comparison of the PE and ADH activity between ABICyanol #1578 and ABICyano l TK293. As depicted in FIGs. 44 to 46, both components in combination with the additional teniiinator in between both genes result in an increased PDC as well as ADH activity over time which consequently lead to a higher ethanol production rate and at the same time reduced growth rate. This observation indicates a higher carbon-paifiiioiiing (amount of carbon fixed into ethanol versus not fixed into ethanol) for strain ABICyanoI #1578 compared to ABICyanoI TK293 and demons testes the high potential of optimizing the ethanoiogenic gene cassette in order to improve the eilianol productivity for ABICyanoI and other cyanobacteria.

[0661] As depicted in FIG, 38. ADH expression is controlled by promoter PrpsL. The expression level of the synADHept.3 cassette present in #1495 and #1581 is apparently less efficient compared to the expression level of the synADHoptl present in ABICyanoI TK293 and

ABICyaaol #1580. Not being limited by theory, this might be explained by the different codon- usage strategy applied for the synADHoptl gene version as exemplified through testing constructs TK411 and T 412, comprising synADHoptl and synADHop respectively. TK411 exhibited a similar ADH activity as TK293 whereas T 41 1 revealed a relatively low ADH activity. This low ADH activity detected for T 12 was accompanied with an elevated acetaldehyde accumulation as found previously for #1495 and #1581, bom with. synADHopt3. This clearly demonstrates the better performance of synADHoptl in relation to synADHoptS.

[0662] Furthermore,, analyses of ADH activity from ABICyaaol strains #1601 and #1606 confirmed the different efficiency when using synADHoptS vs. synADHopt . Strain #1601

[p 171 -6.8_PiurA-zmPDC(opt I )_dsrA-Prbc * (opfRB S>synADH(opt3)_ter] exhib ted a relatively low ADH activity and consequently a higher acet aldehyde accumulation in GC vial assay whereas the experiments with strain #1606 fpl 71 -6.8_PnirA-zniPDC(optl )_dsrA- Prbc*(optRBS)^vnADH{opfl)_fer] indicated a higher ADH activity in relation to #1 01 and thus a lower aceta!dehyde accumulation. Nevertheless, the highest activity found fo the different gene variants of syaADH was surprisingly accomplished by the native synADH (ABICyanoI #1578) without any codoii-optiniizatioii for use in ABICyanoI . Codoii optimization is usually needed for efficient protein expression in ABICyanoI because it has a strong AT bias in endogenous codon- usage.

[0663] As depicted in FIG. 47, although strains ABICyanoI #1495 and ABICyanoI #1581 differ in the dsrA terminator downstream from the pdc gene, the PDC expression in ABICyanoI #1581 was found to be substantially increased. This is an indication that introduction of an efficient transcript temiinaiion signal apparently results in a higher and/or more stable mKNA levels and consequently in an increased PDC protein expression. In ABICyanoI #1578 growth is thereby reduced but the ethanol production is significantly increased demonstrating that the improved PDC expression results in an improved relative production of ethanol in comparison to bioniass. [0664] The data depkfed in table 5 demonstrai e the improved (when compared to TK293) production rate of ethanol as well as the elevated PDC and ADH activities for ABICyanol thai has been genetically enhanced with construct #1578. The cultivation of the corresponding cell lines was performed in 0.5 L Orison PBR. round bottles illuminated from two sides with 450 μΕ in ^" s (900 μΕ mf s ^" total) for 36 days including two dilution steps. During this long-term cultivatio the QD, the chlorophyll content, and the ethanol amount were measured.

[0665] As depicted in FIG. 47, the introductioii of al terations in the ethanelogemc gene cassette resulted in improved expression and improved activity of PDC and syiiADH , The alterations enhanced ethanol productivity in ABICyanol by about 20-25%. While not being limited by theory,. FIG. 48 depicts the higher ethanol production rate and lower growth for ABICyanol #1578 as compared to T 293 and shows that PDC may regulate the partitioning of carbon fixed by photosynthesis into bioniass and ethanol. ABICyanol #1578 thus increases total carbon fixation and ethanol production by about 10% compared to ABICyanol TK293.

[066 j Figure 49 depicts ethanol production in several ABICyanol strains including copper- indiieiMe promoters controlling the pdc expression. As depicted in FIG. 49, straihTK4S3 which contains Parsm.- strain T 487 and strain #1772 which both contain Podssis produce more ethanol over the same amount of time than does strain TK293 that contains a P^ A promoter controlling the pdc expression. All of t he strains depicted hi FIG. 49 were cultivated in a vPBR system at 230pE*m ^'2 *s ^"1 in a 12h 12 day night cycle.

[0667] As depicted in table 6 and the following figures, promoters controlling the open reading frames found to be regulated b addition of the respective metal ions (and verified by qPCR), were chosen to be used in constructs for ethanol production in ABICyanol, A 300-500 bp fragment upstream of each start codon was selected and cloned into plasmid #1646, replacing the nirA promoter, in order to drive pdc transcription. ABICyanol transforniaKts were tested for ethanol productivity under repressed and induced conditions in GC vial experiments. Figure 50 depicts the ethanol production of ABICyanol TK293 (p 171 -6.8 : :PnirA-PDC(optl)-PrpsL- synADH(opil)_ter) compared to ABICyanol TK483 (p 171 -6.8 : :Pori¾221 -zmPDCjopt 1 )dsrA- Prbc*(optRBS)-ADH 1 1 l(opt)_ter) in the presence and absence of 3 uM Cu ²⁺ . hi the absence of copper, ethanol production rates are very low, indicating the tightness of Porf022i . By contrast, ethanol production of ABICyano l T 483 in the presence of 3 pM u ^A+ is even higher compared, to ABICyanol TK293. [0668] The efhaaoi roductivity of each con ra t is shown in table 6 under repressed (without the respecti ve metal ioa) and induced conditions (10 μ.Μ \ 15 μΜ Zn ^2* , 3 μΜ Cu ^2*" or 5 jiM Co ^~+ ). Tightness and strength of each promoter were also rated with a ÷/- scale, (see legend below Table 3). In an embodiment, eihanol production rates of all tested promoters can be divided into different categories as follows: 1) eilianol productivity was very low, even under inducing conditions (e.g. TK500), 2) etlianol productivity was quite high, however, the promoter was not repressible (e.g. TK501) and 3} etlianol productivity was quite high and promoter repressible inducible (e.g. TK483). In some cases two constructs were generated for one promoter (e.g. TK493/T 527 for PorfDl28 ^" as two putative start codoiis for the respective gene could be deduced.

[0669 j Etlianol producing ABICyanol host, cell strains carrying the Zti ^{^} inducible constructs T 480 and TK490 as well as the Cu ² * inducible TK4S3, TK487 and TK504 were analyzed for tightness of promoter control of the expression of ethanoiogenic genes. Ail five constructs are very tightly repressed under appropriate conditions (lack of inducer metal) and led to high ethano! production rates after metal ion addition, T 4S0 uses a mntC promoter, which was shown in S eckocys! s PCC 6803 to be regulated by manganese (Ogaw et aL, 2002). Hence repression by addition ofM ^ was tested, see table 6, and addition of 40-50 μΜ Mn ^2* led to a repression.

[0670} Thus, orf022 Ϊ encodes for a putative multi-copper oxidase (copper-resistance protein), while orfO:223 and orfG 16 are hypothetical genes with unknown function. AH three

genes/proteins are believed to have not been previously described in the literature, i duction by copper was not known. Based on homology to other copper regulated genes, none of the three endogenous promoters from ABICyanol would have been chosen to control pde expression. However, the three promoters respond strongly to copper and were shown to tightly control etlianol production in ABICyanol. Because the response to copper declines within about 5 days, additional copper needs, to be supplemented during long term eihanol production experiments. In an embodiment the copper repressible promoter o petJ (oif3461) is useful. No etlianol

production was observed with the promoter oforf3232, encoding for a heavy metal ATPase. As the copper response stayed at a constant level up to about day 5, the promoter of orf3232 could be useful for longer productivity. Not being bound by theory, one explanation is that both cloned translational start codons are selected in the upstream region of about 500 bp and might not use the entire functional promoter. [0671] The Za ^" responding promoter of the snitA like orf3126 improved amounts of produced ethanoi. However, basal (repressed) production rates were too high. Additional genetic opthnization could enhance fee genetic stability. By contrast, the Zn ^2* responding promoter of the manganese transporter operon (mniABC) is repressed by addition of 40 μΜ Mn^.

[0672 j At least three Cu ² * responding (PoifD221, Porf0223 and Porf¾316) and two Zn ^2*

responding promoters (PorfiOTi and Porf3126) are useful as promoters to drive dc expression in ABICyanol ethanoiogemc strains.

[0673] Figures 59 to 66 depict the ethanoi production of various different ABICyanol strains carrying different metal-indueible promoters upstream of the pdc gene determined by the GC online vial method.

[0674} Figure 59 depicts the ethanoi production of Cyanobacterium sp. ABICyanol containing the piasniid TK4S0 wherein a codon improved variant of a gene coding for the native PDC enzyme is under the transcriptional control of the promoter rnntC (orfl0 ^' 71) from ABICyanol, whereas the adli wife the nucleotide sequence shown in FIG. 52 (nucleotides 2390 to 3406 of SEQ ID NO; 60) is under the control of a variant of fee native roc promoter from ABICyano l with an improved ribosomal binding site (RBS). Furthermore, fee ethanoi production of

Cyanobacterium sp. ABICyanol containing the piasniid # 1.770 is depicted in FIG. 59, which is comparable to the ethanoi production of Cyanobacterhmt sp. ABICyanol with fee piasniid

TK4SG. This piasniid # 1770 only differs from plasinid T 4S0 by replacing the Adh enzyme of FIG. 52 (nucleotides 2390 to 3406 of SEQ ID NO: 60) with the Synechocystis Adh enzyme. It can clearly be seen that upon addition of 10 μΜ Zn ^2* th ethanoi production increased compared to the unreduced state with Zn ^2* and 15 uM Mn ^2* (repression by the absence cffZH ⁴ * and presence of Ma ^2* ) for both strains transformed with the plasmids # 1770 and T 48G, respectively . The ethanoi production of Cymiobacterium sp. ABICyanol including the piasniid TK488 after addition of 15 uM Zn ' ^* is shown in FIG. 60 in comparison to the iminduced state without Zn ^* Additio of Z ^ leads to a nearly 4-foH increase in ethanoi production.

[0675] The ethanoi production of Cyanobacterium sp. ABICyanol containing the piasniid

TK489 is depicted in FIG. 61. This graph shows a continuously rising ethanoi production with increasing cultivation time in fee induced state upon addition of 15 uM Z ' ^" . However under unindttced conditions a high ethanoi production can also b observed, which shows that this promoter is not very tight. [0676] FIG, 62 depicts a graph evidencing the ethanoi production in ABIC anol transformed with the plasmid TK490 including a cod n improved variant of pdc gene under the

transcriptional control of the promoter controlling the open reading frame (ORF) 3126 versus the ethanot production of the same stein transformed with the plasmid # 1773, This plasmid differs from TK490 only in the Adh enzyme which is Synechocystis Adh for # 1773 versus the adh with the sequence of FIG, 52 (nucleotides 2390 to 3406 of SEQ ID NO: 60) in TK490. Both

ABICyanol strains have a comparable ethanoi production up to 40 oars of cultivation, but the ethanot production appears to be higher for #1773 after 40 hours compared to TK490, A clear increase in ethanoi production can be observed upon induction by 15 uM Zsi for both, steins transformed with # 1 73 and TK490. A clear rise in ethanoi production can also be seen upon induction with Qv ^' in C cmohactenum sp. ABICyanol transformed with the plasmid TK487 and the plasmid # 1772 (see FIG. 63) . TK4S7 includes a codon improved variant of the Zymcmonas mobilis gene coding for PDC under the transcriptional control of the promoter controlling, the ORF0316 and codon improved variant of the gene coding for ADH with the nucleotide sequence shown in FIG, 52 (nucleotides 2390 to 3406 of SEQ ID NO: 60) under the transcriptional control of Prbc with an improved RBS. The plasmid # 1772 contains a gene coding for Synecliocystis ADH instead of the ADH with the sequence of FIG. 52 (nucleotides 2390 to 3406 of SEQ ID NO: 60). Induction with copper leads to an increase in ethanoi production for both ABICyanol strains. The ethanoi production increases in comparison to the uninduced state upon addition of 0.3 Μ Cu^ and further increases, when both, steins are induced with 6 uM Cu^. A clear rise in ethanoi production ca be observed by copper induction in ABICyanol with strains containing the plasmids TK4S3 and # 1 71 upon addition of 0.3 μΜ and 6 uM CuT ⁺ (see FIG. 64).

[06771 Table S depicts ethanoi production data of ABICyanol strains containing plasmids with genes coding fo PDC under the control of endogenous inducible promoters.

[0678] As depicted in FIG. 67, copper-inducible strains such as #1771 #1772 (P _sal ms) and #1774 (pcds ) as well as a zine-ffidueible strain #1 70 (Pauae) exhibit a higher ethanoi productivity than a nitrate inducible strain TK293 feat uses a. PnirA promoter. Induction protocols use initial Cu ^2" * ^" addition and also further Cu ²⁺ additions. As depicted in FIG. 68, the PDC activity oi strains #1770. #1771 , #1772 and #1774 were greater than TK293. The steins depicted in

FIGs. 67 and 68 cultivated in a. vertical photobioreactor (vPBR) at 200 ^tE*m ^" ^*s ^"i in a 12h/12 day/night cycle. [0679] Initial induction with 1.6 μΜ Cu ^" (which is about five tunes the Cu" concentration of BG11} in all four treatments; of T 487 for ethanoi production is depicted in FIG. 69 and for cell growth of TK4S7, in FIG. 70. T 487 is identical to #1772 (Por _f ssis)- except for a different adh gene, PDC activity in TK487 is depicted in FIG. 71. Ethanol per cell density of induced TK487 is depicted in FIG. 72. Weekly and bi-weekly (day 7 aad 21) copper addition results ia the highest tested ethanol production and lowest biomass accumulation,

[06S0] Table 9 depicts the ethanol production data for various ABICyano 1 strains hieluding strains and plasmids, #1578/ #1646, #1658/ #1684. #1658 FIG. 118 (SEQ ID NO: 72), #1663 FIG. 119 (SEQ ID NO; 73). #1697 / #1665, #1697 FIG. 120 (SEQ ID NO: 74). TK48O/#1770, TK483/#1 71 , TK487/#1 72, TK490M773., and TK504/S1 74.

[068 Ij Figure 28 depicts the ethanol production normalized to the growth (GD?soem) detenained by GC single rneasuren enis for ABICyano 1 strains transformed wife the plasaiids # 1606 (pdc gene under the coatrol of the native PnirA), plasaiid # 1629 (pdc gene under the control of a modified variant of Pnii A with changes in the RBS) and plasmid # 1636 (pdc gene under the control of a modified variant of PnirA with changes in the operator sequence and the T ATA box) for a period of time of at least 20 days after induction was realized by transition of the pie-culture to usual raBGll medium (containing nitrate for induction) at the beginning of the cultivation experiment T e graph depicts that the normalized ethanol production is higher for the strains including the plasaiids with the modified promoters. Figures 29 and 30 depict the specific activity of PDC and ADH during the course of the above mentioned cultivation. As depicted in FIGs 29 and 30 the inducible modified airA promoter variants PairA*2 (#1629) and PnirA* 3 (#1636) result in a higher activity of PDC enzyme compared to the native promoter (#1606).

[0682 j Figure 31 depicts the ethanol production normalized to the growth iOD?¾ .) detenained by the GC single measurement method for ABICyano! strains transformed with the plasaiids # 1 06 (pdc gene under the control of the native PnirA), plasmid # 1631 (pdc gene under the control of a modified PcorT with modifications in the TATA box) and plasmid # 1632 (pdc gene under the control of a modified PcorT with modifications in tiie TATA box and tiie RBS) for a period of time of at least 20 days cultured in 0.5 L photobioreactofs. The ethanol production of the str ain transformed with the plasmid containing the native PnirA with pdc gene is comparable to the ethanol production of the strain containing the plasmid with the pdc gene controlled by the modified corT promoter variants PcorT*3 (#1632) with modifications i the TATA box and RBS. whereas the et anoi production of the strain containing the plasmid with PcorT with modifications only in die TATA box PcorT*2 (# 163 ! } exhibits a. lower ethano! production rate, especially in the time period starting from the tenth day of cultivation on,

[0683] Fig. 32 and 33 depict the specific activity of PDC enzyme and Ada enzyme during the course of the above mentioned cultivation. The strains with the na tive PnirA as well as the PcorT wi th modifications in the TATA box and the RBS show higher reactivity of PDC enzyme than the other strain,

[0684] Figures 40 to 42 depict the ethanol production rates of the ABICyanol strains hunsformed with the plasaiids #1 3.5. #1639 and #1 40 including the native PsmtA promoter from

Sy c ococctis PCC 7002 as well, as modified versions of PsmtA, It can clearly be seen that all promoters are repressed in the absence of Y.n ^~~ and can be induced upon addition of '·Γ ~

[0685] FIG. S I depicts the activity of PDC enzyme n the uainduced state and after 72 hours of induction for ABICyanol strains transformed with the pksmids # 1578, #1701, # 1658, #1697 and # 1663. deluding an unmodified endogenous nirA promoter (plasmid # 1578), aad four different modified nirA promoter variants PnirA*! (plasinid # 1701), PnirA*2 (plasmid # i 658), PairA*3 (plasmid # 1697) and PnirA*4 (plasmid # 1663 ), Cultivation of those ethanoiogenie hybrids was performed in GC vials for 72 hours. The Pdc activity after induction is indicated by the blue bars whereas the much lower activity of Pdc enzyme in the repressed state is given by the red bars. The induction factors for these plasmids # 1578, # 1701. # 1658, #1697 and # .1663 are 12, 10. 14, 8, and 7 times the Pdc activity m the induced state vs. the repressed state. This figure depicts thai specific nucleotide changes introduced into the ribosomai binding site and/or the promoter region of the nirA promoter hi the respective variants PairA* 1 , PnirA*2. PnirA*3 and PnirA*4 increased the expression level of the PDC in the induced state, but had relativel little impact on the tightness of the modified promoter in the repressed state.

[068<j] Figures 82 and 83 depict the activity of PDC and their respective ODTsoa _m -n rniahzed ethaaol production (% EtOH per OD _754¾Si¾ } during th course of a 29 day cultivation grown at 125|iE*m ⁵ *s ^"1 in a 12h l2 day/night cycle for the above mentioned strains of FIG. 81 except, for # 1701 which was omitted. The Pdc activity of #1697 (PairA*3) and #1663 PairA*4) is higher aad more stable over time than that of #1578 (PnkA) and #1658 (PmrA*2). Therefore the ratio of carbon distributio into ethatioi and biomass (EtOH OD ratio) is thereby higher and appeal s to be more stable over time for the ftansfornianis.. Figures 84 and S.5 depict the ODysooco, aad the ethanot production in % (v/v) of this about 30 day cultivation grown at i 25uE*m ^'2 *s ^~l in a 12li/12 day/night cycle. ABICyanol strains transformed wife . plasmids #1578 (PnirA) and #1658 (PnirA* 2). show a similar ethaiiol production rale over about 29 days.

[06 7] Figure 86 depicts ADH and PDC activity in T 293, 1578 and 1792. Figure 87 depicts total ethanol production in TK293. ί 578 and 1792. Figure 88 depicts ethanol production per OD750 in TK293, 1578 and 1 92. TK293 is pi 71^.8::P irA-zmPDC{c5ptl)-PrpsL- synADH(optl)_ter; #1578 is pi 71 -6.8: :PiikA-zoiPDC(opt3)dsiA-Prbc*(opfRBS)-sym DH_oop #1749 is pi71 -^8:rPnirA-zmPDC(opt3}^ and #1751 is p!7i-

6.8 : :Pnix A-zmPDC(opt3 )dsr A-PepeB-synADH_oo .

[0688] ABICyanol containing plasmid #1792 results in improved synADH expression and shows better and more stable ethanol production under standard conditions. As depicted in FIGs. 89- 1, increased ADH activity prevents PDC inactivaiioa. Figure 89 depicts acetaldehyde accumulation of TK293, #1578, #1749, and #1792. Figure 90 depicts ADH activity in TK293, #1578, #1749, and #1792, Conversely, acetaldehyde exposure during cultivation reduces PDC activity, Thus, there is an inverse relationship between ADH activity and acetaldehyde

accumulation for different synADH expressing stems in GC vial assay. Figure 91 depicts specific PDC activity in varying amounts of acetaldehyde. Acetaldehyde is completely consumed within 1-2 hours.

[0689] Higher ADH activity helps to prevent PDC inactivatkm. A decrease in PDC activity was detected for several strains with very low ADH activity (in spite of identical PDC cassettes). Figure 92 depicts ADH activity and FIG. 93 depicts PDC activity with or t ut the addition of acetaidehye (3 niM for 5 hours) for strains T 293. #1578. #1749, and #1751 each having different ADH activity levels,

[0690] ABICyanol etlianologenic pdc/adh cassettes useful for extended production of ethanol in a ABICyanol host cell include #1578 Cpi i-6,8::PnkA-zmPDC(opt3)_dsrA-PAc*(optaBS)- synADH_oop); #1728 (pl71-6.8::PiiiiA-zsiiPDC(opt3)_dsrA-PcpcB-ADHl I I(opt}_ter); and #1749 ( i 71 -6.8: :PnirA-zmPDC(opt3)_dsrA-PrpsL*4-synADH_oop).

[0691] The expression of heterologous adh genes from other cyanobacterial species thai ha ve been improved for codon usage patterns in ABICyanol resulted in increased ADH activity. Figure 94 depicts ADH activity of various expressed adh genes, some of which were codon improved for expression in ABICyanol. ADH242 is derived from Arthrospira pl tmsis and ADHl 1 1 is derived from Lyngbya species. Constructs #1646 and #1 54 had codon improved adh genes for ADHl 11 and ADH242, respectively. As depicted in FIG. 94, codon improvement for expression in ABICyanol for the genes encoding for ADH111 and ADH242 resulted iii an increase in ADH activity by about 30 % to about 50 %,

[0692] Increased ADH activity results in resistance to decreased ethanol production resulting from .higher ettianol concentrations in. the growth media. Figure 95 depicts the effect of ethanol pimluctsvity of various ethanologenic ABICyanol strains in growth media containing 1 % vol vol ethanoL As depicted in FIG. 95 _f the difference between the production rate of ethanol in growth media containing no added ettianol and growth media contaiiimg 1 % added etiianol is iess when the expression of ADH is higher. Figure 95 depicts the daily ethanol production rate in perceiii vol/vol per day over 10 days as measured from ABICyanol strains ahimiiiated with 250uE*rn ^" in l l ll l day/night cycles. As is depicted in FIG. 95. the stronger the ADH activity the less the impact of higher e hanol concentrations on ethanol production. As depicted in FIG. 95.

ABICyanol strain #1803 that expresses ADH from Microcystis aeruginosa exhibits less of a decrease in ethanol productivity (7 % less) in a 1 % ethanol growth solution when compared to the decrease in ethanol productivity of strain #1792 expressing ADH from Synechocystis PCC 6803 (39% iess).

[0693] Ethanol production from ABICyanol strains each containing a different adh gene operably linked to an endogenous ABICyanol cpcB promoter and each strain containing a nirA promoter operably linked to pdc expression is depicted in FIG. 96. Figure 96 also depicts the production of ethanol from strain T 293 (p l 1-6.S_Piia A-ziiiPDC(opt l )-PipsL- synADH(optl )_ier) Each strain depicted in FIG. 96 was cultivated in a vPBR system with exposure to light at 230μΕ*τη-2*β-1 in a 12h 12 day/night cycle. As depicted in FIG. 96, the ethanol production of ABICyanol strains 1790. 179L 1792, 1793. 1794. and 1.79.5 was greater than that, of TK293 after about day 10 to about day 3 Ϊ of growth.

[0694 j ABICyanol host cells transformed with ethanologenic vectors that contain more than one pdc gene demonstrated an increased duration of ethanol production. Induction of a second pdc gene increases PD activity by about. 2.5 times when compared to the induction of only a single pdc gene . Induction of a more than one pdc gene results in an increase in ettianol produc tion and a decrease in cell growth. Thus ethanol production per OThw is higher for #1743 when bot pdc genes are active. Figure 97 depicts the PDC activity in strain #1743 with and without induction of 6 iiM copper at about day 1 and the additional induction with μΜ copper at about day 30. Figure 98 depict the total ethanol production of strain #1743 with and without the induction of copper. Figure 99 depicts total ethanol per cell density measured at OI 7ss. [0695] Dual pdc genes are introduced inf o an ABICyanoi host cell either on an integrative plasmid or on a repbcative plasmid. Thus, the dual pdc genes, and other components of th etliano!ogeni cassette, can be integrated into the genome of ABIC anoi and/or exist on a plasmid within the ABICyano i host cell Strain #1743 is an ABICyano i host cell containing a recombinant plasmid #1743 (pABIcyanol -PiiirA-zmPIX^(^t3)dsiA--¾bc*(optRBS)- syiiADHoop-Poi'f¾221-zinPDC(optl )dsrA) whose plasmid map is depicted in FIG. 156 and lias a sequence that is depicted in SEQ ID NO: 106. Strain #1743 has two independently inducible pdc copies where one pdc gene is inducible by nitrate and the other pdc gene is inducible by copper. tein #1743 was analyzed for PDC activity in comparison to the corresponding single pdc strains #1578 (pdc under control of promoter Pair A) and #1771 (pdc under control of promoter Porfi>221). The analyses revealed independently inducible expression of both pdc genes from one construct Without nitrate and copper addition, the pdc genes of strain #1743 were as tightly repressed as the single pdc strains #1578 and #1771. Long-temi cultivation experiments using a copper inducible pdc construct resulted in increased PDC expression when compared to other inducible pdc constructs such as nitrate inducible pdc constructs.

[0696] The second pdc gene of strain #1743 was induc ed at day 16 of cultivation in a

photobioreactof (at an OD _S ^ of about 5.5) by addition of Cu' ^~ . Strain #1744 having two pdc genes under control of Pair A and Porf3126 (Zn ² *) was also induced at day 16 of cultivation in a phoiobioreactor (at an OD 30 of about 5,5), The PDC activity in each strain increased to a value of about 5-6 umol/mg*min in coxnparison to a value of about 2,5 pmol/mg*niin for the control replicates without copper addition. Ethanoi production increased about 10-15% at day 37 of cultivation. Additionally, the ethanoi to OD750 ratio increased.

[0697| The growth of strain #1743 containing two pdc genes, one pdc gene operably linked to a nirA promoter and a second pdc gene operabl linked to a endogenous coppei -inducible promoter Porf022 L is analyzed by measuring, absorption at OD _?¾ of the growth media after induction of the copper-inducible promoter Porf0221. As depicted in FIG. 100. the addition of copper at day 19, 48 and at about day 108 caused a slight decrease in the rate of growth of ABICyanoi strain #1743 when compared to the control lacking copper in the growth media. As depicted in FIG . 101. the production of ethanoi from strain #1743 was measured in the same growth media as depicted in the OD ₇₅₈ measurements of FIG. 100. In an embodiment as depicted in FIG. 191, the overall ethanoi production increased when copper was added to the growth media at days 1 and 48. Li another embodiment; PDC activity from strain #1743 was measured over about 115 days of growth. Figure 102 depicts the PDC activity in ABICyanol strain #1743 cells from growth media over t e course of about 115 days. The growth media was diluted at abou days 48 _? 78 a d 106 of growth, hi another embodiment, the total ethanol produced per cell density was measured. As depicted in FIG. 103, strain. #1743 was grown for about 115 days and was diluted at about days 8, 78 and 106 of growth and amount of ethanol is percent volume per volume per OD?so was measured. As depicted in FIG. 103 the induction of the pdc gene by introduction of copper into the growth media results ia an increase hi the amount of ethanol produced per OD750 °f ABICyanol strain #1743 when compared to the ABICyanol strain #1743 grown ia media lacking copper,

[0698] Table 12 depicts a further list of piasmids for used for transformation of ABICyanol with ethanologenie cassettes and also depicts the ethanol production in ABICyanol host cells created thereby.

Table 12

[0699] Articks, patents and other published literature referred to herein is incorporated by reference. Although the present disclosure has been described in considerable detail with reference to certain embodiments thereof, other embodiments are possible. Therefore, the spirit and scop of the appended claims should not be limited to the description of the embodiments contained herein.