FOR CANCER

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 61/216,758, filed September 10, 2015, and UK Application No. 1419072.2 filed October 27, 2014, which are incorporated by reference herein in their entireties.

BACKGROUND OF THE INVENTION

[0002] Cancer is an abnormal disease state in which uncontrolled proliferation of one or more cell populations interferes with normal biological function. The proliferative changes are usually accompanied by other changes in cellular properties, including reversion to a less differentiated state. Cancer cells are typically referred to as "transformed". Transformed cells generally display several of the following properties: spherical morphology, expression of foetal antigens, growth- factor independence, lack of contact inhibition, anchorage-independence, genome instability and growth to high density. Cancer cells form tumors and are referred to as "primary" or "secondary" tumors. A primary tumor results in cancer cell growth in an organ in which the original transformed cell develops. A secondary tumor results from the escape of a cancer cell from a primary tumor and the establishment of a secondary tumor in another organ. The process is referred to as metastasis and this process may be aggressive, for example as in the case of hepatoma or lung cancer; or non-aggressive, for example early prostate cancer. The

transformation of a normal cell to a cancer cell involves alterations in genes and gene expression that results in the altered phenotype of the cancer cell. In some examples the genes expressed by cancer cells are unique to a particular cancer.

[0003] The most common cancer deaths are cancers of lung, liver, stomach, colorectal and breast. Cancer is often treated through surgery, radio- or chemotherapy. However, early detection of cancer is vital for the success of these methods as once the cancer has spread cancer leads most likely to death. [0004] Therefore, there is a need for the identification of early events in cell transformation to allow early diagnosis. In addition there is a desire to analyse whether a particular treatment regimen is successful in controlling tumor growth or preventing metastasis.

[0005] Tumor biomarkers are molecules present in cancer patients that are used for various purposes including screening, early detection, diagnosis, prognosis, treatment decisions and treatment efficacy of cancer patients. Ideal cancer markers should fulfil criteria such as i) specific expression of the marker by pre-malignant or malignant tissue, ii) expression at detectable levels in all patients, iii) levels correlate with tumor volume, biological behaviour, or disease progression, iv) short half-life, v) existence of validated objective and quantitative assays, vi) high sensitivity and disease specificity and vii) present in easily accessible tissue such as blood.

[0006] Existing cancer biomarkers are mostly specific for a particular cancer and rarely for a few related cancer types and no general cancer biomarker been identified to date. Furthermore, current tumor biomarkers are not sufficiently sensitive or specific to be used on their own for screening of patients such as the Prostate-Specific Antigen (PSA). Although, increased levels of PSA in patients often do correlate with prostate cancer, they are also frequently elevated in patients with benign prostate conditions, giving false positive results making screening inefficient. Blood-based biomarkers are of great clinical interest when primary tumor or metastatic tissue samples are not available, and are useful for monitoring response to therapies and minimal residual disease. However, no current clinical biomarker fulfils all the criteria as set out above.

[0007] The genome integrity is constantly challenged by environmental genotoxic agents (chemicals, radiation etc.) and endogenous genotoxic stress (replication, oxidative stress, etc.) (Burhans and Weinberger, NAR, 35:7545-7556 (2007)). The ability to repair damaged DNA is vital for living organisms, as a failure can endanger the survival of the individual cell as well as that of the organism. Tumor cells often experience additional genotoxic stress due to higher oxidative and replication stress as a consequence of tumorigenesis (Burhans and Weinberger, NAR, 35:7545-7556 (2007)) leading to genome stability (Georgakilas et al., Molecular bioSystems 6: 1162-1172 (2010); Kryston et al., Mutation Research 711 : 193-201 (2011)).

Genomic DNA can also be damaged by errors during DNA replication leading to translocations, breaks and deletions (Zlotorynski et al., Molecular and Cellular Biology, 23:7143-7151 (2003)). Oncogene induced replication stress affects genomic loci where progression of replication forks is slow or problematic due to 'replication barriers' such as chromosomal fragile sites (CFSs), telomeres, repetitive sequences or RNA:DNA hybrids, and the like. (Branzei and Foiani, Current Opinion in Cell Biology 17:568-575 (2005); Halazonetis et al., Science, 319: 1352-1355 (2008); Jackson and Bartek, Nature 461: 1071-1078 (2009)). Studies have also suggested that collisions between replication and transcription machineries contribute to replication stress and CFSs expression (Bermejo et al., Molecular Cell 45:710-718 (2012); Helmrich et al., Molecular Cell 44:966-977 (2011)), and triplex DNA or G-quadruplex DNA structures are known to cause genome instability by interfering with replication fork progression (Jain et al., Biochimie 90: 1117-1130 (2008); Voineagu et al., PNAS 105:9936-9941 (2008); Wang and Vasquez, PNAS 101: 13448-13453 (2004)) and binding of repair proteins to DNA damaged sites (Wang and Vasquez, Mol. Carcinog, 48:286-298 (2009)).

BRIEF SUMMARY OF THE INVENTION

[0008] The present disclosure relates to methods for the early detection of precancerous cells or cancer cells by the detection of MUS81 and/or cytosolic or extracellular DNA from the cells. Also provided are methods to screen for agents with DNA damaging activity.

BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 is a diagram of generation of cytosolic and cytosol-derived serum DNA in tumor cells. Double strand breaks (DSB) lesions and the ensuing activation of the DNA repair leads to the presence of single-stranded (ss) DNA, double-stranded (ds) DNA and RNA:DNA hybrids in the cytosol of tumor cells. Cytosolic DNA species are secreted as free DNA and microvesicular DNA.

[0010] Figure 2 is a schematic showing non-B DNA formation during replication and transcription of DNA. Replication and transcription of dsDNA exposes ssDNA, which can form non-B DNA structures. Non-canonical DNA is sensitive to DNA breaks, chemical modifications and mutagens. Repair of non-B DNA structures can lead to deletion, amplification and recombination of DNA.

[0011] Figures 3A, 3B, 3C, 3D, and 3E are images showing constitutive presence of cytosolic DNA in human cancer cell lines and mouse B-cell lymphomas. Figure 3A shows B220 ⁺ B-cell lymphomas arising in Έμ-Myc mice stained for cytosolic DNA using ssDNA- (Left panel) or dsDNA-specific (Right panel) antibodies. Mild permeabilization conditions were used to minimize nuclear staining. For Figures 3B-3E, the mouse lymphoma cell line Yac-1 (3B), the human lung carcinoma cell line A549 (3C), the human lung fibroblast cell line MRC5 (3D), and the human leukemic monocyte cell line THP1 cells (3E) were stained for cytosolic DNA using ssDNA- (Left panel) or dsDNA-specific (Right panel) antibodies. All cells were co-stained for the mitochondrial marker COX IV in the presence of DAPI. Z-stack images were acquired by confocal microscopy and analyzed using Imaris to generate iso-surface plots. Scale bars denote 10 μιτι. Data are representative of at least three independent stainings.

[0012] Figures 4A and 4B are images showing cytosolic DNA is not present in T cells and fibroblasts. Figure 4A shows naive or 3 μg/ml ConA-treated murine T cells treated with 10 μΜ Ara-C or DMSO for 16 hrs. Cells were stained for dsDNA in the presence of DAPI. Figure 4B shows murine fibroblasts derived from tails were treated with Ara-C or DMSO and analyzed as described in (Fig. 4A). Mild permeabilization conditions were used to minimize nuclear staining.

[0013] Figures 5A, 5B, 5C, 5D, 5E, 5F, 5G and 5H show cloning of cytosolic DNA present in lymphoma cells. Figure 5 A is an image of a gel showing 0.5 μg of a 1 kb DNA ladder (Lane 1), 0.5 μg of a 0.1 kb DNA ladder (Lane 2), 9 μg (Lane 3) and 5.5 μg (Lane 4) of independently purified cytosolic fractions of BC2 cells treated with 10 μΜ Ara-C for 16 hrs electrophoresed in a 2% agarose gel and stained using SYBR Safe DNA gel stain. Figures 5B and 5C are graphs showing the number of dsDNA (Fig. 5B) and ssDNA (Fig. 5C) sequences cloned from tumor cells derived from Εμ-Myc mice (White columns), Yac-1 cells (Grey columns) and BC2 cells treated with 10 μΜ Ara-C for 16 hrs (Black columns) with the indicated number of base pairs. Figure 5D shows frequency of dsDNA and ssDNA clones derived from Εμ-Myc tumor cells, Ara-C-treated BC2 cells and Yac- 1 cells localizing to intragenic and intergenic regions of the mouse genome, nd = not determined. Figure 5E shows frequency of the indicated retroelements in the mouse genome (Left column), dsDNA clones derived from Εμ-Myc tumors (Middle column) or dsDNA clones of BC2 cells treated with 10 μΜ Ara-C for 16 hrs (Right column). Fold enrichment over average percentage of retroelements in mouse genome (Numbers in left column) are indicated according to the color scale below the table for clones derived from Εμ- Myc tumors (Middle column) and BC2 cells (Right column). Figure 5F shows frequency of dsDNA and ssDNA clones with non-B DNA motifs and triplex DNA forming potential within the cloned DNA or within 500 base pairs of the surrounding genomic loci was determined using online databases (Hon et al., Bioinformatics, 29: 1900-1901 (2013)). nd = not determined. Figure 5G is a schematic of a representative sequenced dsDNA clone purified from the cytosolic fraction of Ara-C-treated BC2 cells (Bold letters (SEQ ID NO:54)) is shown in the genomic context (SEQ ID NO:249). The predicted triplex sequence according to the web-based triplex search tool at http://helix.fi.muni.cz/triplex/www/ is shown as SEQ ID NO:250) and putative triplex DNA structures are indicated below the dsDNA clone. Figure 5H are images showing B220+ B-cell lymphomas arising in Eu-Myc mice were stained for RNA:DNA hybrids using the RNA:DNA-specific antibody S9.6 in the presence of DAPI. Z-stack images were acquired by confocal microscopy and analyzed using Imaris to generate iso-surface plots. Scale bar denotes 5 μπι.

[0014] Figures 6A and 6B are images showing presence of cytosolic RNA:DNA hybrids in human tumor cell lines. Figure 6A are images showing the human colorectal carcinoma cell lines LoVo, HCT 116, HT29, the lung carcinoma cell line A549, the SV40 transformed kidney cell line HEK293T, the acute monocytic leukemia (AML) cell line THP-1, the promyelocytic leukemia cell line HL-60 and the Hodgkin lymphoma L-540 stained for the presence of

RNA:DNA hybrids in the presence of Hoechst. Figure 6B are images showing A549 and THP-1 cells stained for RNA:DNA hybrids, the mitochondrial marker Cox IV in the presence of Hoechst. Mild permeabilization conditions were used to minimize nuclear staining. Confocal images were rendered 3D using the iso-surface function of Imaris.

[0015] Figures 7A and 7B are images showing cytosolic dsDNA is present in CLL and stage II prostate adenocarcinoma. Figures 7A and 7B are images showing purified B220+ blood samples (>90% purity) of two healthy donors (Left panel) and two CLL (Fig. 7A) or stage II prostate adenocarcinoma (Fig. 7B) (Right panel) patients stained for dsDNA using dsDNA-specific antibodies in presence of DAPI. In the lower row DAPI staining was removed for better visualization of the dsDNA staining. Mild permeabilization conditions were used to minimize nuclear staining.

[0016] Figures 8A, 8B, and 8C are images showing tumor cells secrete cytosolic DNA in microvesicles. Figure 8A are images showing live cell imaging of HeLa cells stained with 3 μΐ/ml of the dsDNA-specific vital dye PicoGreen for 1 hour, 100 nM of the mitochondria- specific vital dye MitoTracker and 2 μ^ηιΕ of the plasma membrane stain CellMask for 30 minutes. HeLa cells were analyzed by confocal live cell imaging using a frame-capture rate of 9 seconds. Images taken every 27 seconds are shown. In the lower row, CellMask staining was removed for better visualization of the PicoGreen staining. Figure 8B are images showing HeLa cells secrete dsDNA in microvesicles. HeLa cells were stained as indicated in (Fig. 8A). White boxes mark dsDNA in microvesicles in (Fig. 8A) and (Fig. 8B). Figure 8C are images showing HeLa cells treated with 1 μΜ Monensin (right panel) or DMSO (left panel) and stained with PicoGreen and Mitotracker. All images were taken on an Olympus FV1000 confocal scanning microscope (Olympus, Singapore) using a 100 x 1.45 oil immersion objective and FV10-ASW 1.7 software.

[0017] Figures 9A, 9B, 9C, and 9D show cytosolic DNA accumulation in prostate cancer cells depends on the DNA structure-specific endonuclease MUS81. Figure 9A are images and a graph showing murine TRAMP-C2 (left panels), human DU145 (middle panels) and human PC-3 (right panels) prostate cancer cells pulsed with 5 μΜ BrdU for 75 minutes. One (1) hour or 16 hours following the BrdU pulse, cells were labelled for BrdU in the presence of DAPI. White boxes in the upper left corners indicate magnified sections. Bar graph shows quantification of the mean fluorescence intensity (MFI) ± SD of cytosolic (cyto) BrdU staining in BrdU-pulsed TRAMP-C2 (white columns), DU145 (grey columns) or PC-3 (black columns) cells (n>300). Figure 9B are images and graphs showing TRAMP-C2 cells (upper row) transduced with a lentiviral vector encoding either a control shRNA (left panel) or one of two different Mus81- specific shRNAs (middle and right panels). DU145 (middle row) and PC-3 (lower row) cells were transfected with 20 nM control siRNA (left panel) or Mus81 -specific siRNAs (middle and right panels). Cells were labelled with dsDNA-specific antibodies in the presence of DAPI. Fluorescent microscope images were analyzed using Imaris software to generate iso-surface 3-D plots. Bar graphs show quantification of the MFI of cytosolic dsDNA (n>300 cells). Data are presented as mean ± SD of 3 independent experiments. Figure 9C are images and a graph showing representative confocal images of SV40 large T-antigen immortalized Mus81 ^+I+ (left panels) and Mus81 ^~ ' ^~ (right panels) MEFs transduced with MSCV- wsSi-IRES-G p (Mus81) or MSCV-IRES-G/p (ctrl). Two days after transduction, MEFs were stained for cytosolic dsDNA in the presence of DAPI. Quantification of the MFI of cytosolic DNA in Mus81 ^+I+ (white bars) and Mus8 (black bars) MEFs (n>300) transduced with MSCV -Mus81-IKES-Gfp or MSCV-IRES- Gfp is shown in the bar graph. Data are presented as mean ± SD of 3 independent experiments. Figure 9D are a schematic, images and graph showing Mus8r' ^~ MEFs stably transfected with empty vector control (white bars) or synthetic pAT ₂₅ tetA plasmids (black bars). Stably transfected cells were subsequently transduced with MSCV-IRES-G p (ctrl) or MSCV-Mus81- IRES-G/p (Mus81) before being subjected to fluorescence in situ hybridization using a pAT ₂₅ tetA DNA probe in the presence of DAPI. A schematic diagram of the experimental approach is indicated in the upper panel. Representative confocal images are shown on the left. Bar graph indicates quantification of the MFI of cytosolic pAT ₂ stetA signals in the cells (n>300). Data are presented as mean ± SD of 3 independent experiments. Scale bar, 10 μπι. *p<0.05; **p<0.01 ; ***p<0.001 ; ****p<0.0001.

[0018] Figures 10A and 10B show nuclear MUS81 foci correlate with the presence of cytosolic DNA in prostate cancer tissues. Figure 10A are representative confocal images of consecutive sections of stage II prostate adenocarcinoma (P), stage I breast cancer (B), stage II colorectal cancer (C), stage III/IV melanoma (M), healthy skin (S) and cancer-adjacent tissue within normal limits (N). Sections were stained for MUS81 (left columns) or dsDNA (right columns) in the presence of DAPI. Bar graphs show quantification of the average number of nuclear MUS81 foci (left graph) and the MFI ± SD of cytosolic DNA (right graph) in cells (n>1000) of the different tissues. Data from one out of 8 (P) and one out of >3 (other tissues) patients are shown. Figure 10B are representative confocal images of consecutive sections of prostate cancer-adjacent normal tissue (N), stage II hyperplastic tissue (H), and stage I-III prostate adenocarcinoma from different patients. Tissues were stained for MUS81 (1 ^st column) or cytosolic dsDNA (2 ^nd column) in the presence of DAPI. DAPI staining was removed in some pictures to enable better visualization of dsDNA staining (3 column). Bright-field images of the tissues were merged with immunofluorescence images in the 4 ^th column. Bar graphs show quantification of the number of nuclear MUS81 foci (left graph) and the MFI ± SD of cytosolic dsDNA (right graph) in cells (n>1000) of different normal prostate (MUS81 and dsDNA, n=6 each), stage II hyperplastic prostate (MUS81 and dsDNA, n=6 each), stage I prostate cancer (MUS81 and dsDNA, n=4 each), stage II prostate cancer (MUS81 , n=16; dsDNA, n=148) and stage III prostate cancer sections (MUS81, n=10; dsDNA, n=22). White boxes in the lower left corner indicate magnified sections. Scale bars, 10 μιτι. *p<0.05; **p<0.01; ***p<0.001;

****p<0.0001.

[0019] Figures 11 A, 1 IB, 11C, 1 ID, 1 IE, 1 IF, 11G, 11H, and 1 II show Mus81 induces STING-dependent expression of type I IFNs in prostate cancer cells. Figure 11 A shows an immunoblot analysis of TRAMP-C2 cells transduced with retroviruses encoding control (white column) or Mus81 -specific (grey column) shRNAs and probed with antibodies specific for phosphorylated IRF3, total IRF3, or GAPDH. Levels of phosphorylated IRF3 were normalized to those of total IRF3 and GAPDH. Bar graph shows the mean ± SEM of 3 independent experiments. Figure 1 IB shows relative fold change of Ifna4 (white columns), Ifnb (grey columns) and Ccl2 (black columns) transcripts in TRAMP-C2 cells 5 days after transduction with retroviruses encoding either control or Mus81 -specific shRNA. Figure 11C shows an immunoblot analysis of Mus81 ^+I+ and Mus8V' ^~ MEFs transduced with MSCV-IRES-G p (white columns) or MSCV-Mus81-lKES-Gfp (grey columns) and probed with antibodies against phosphorylated IRF3, total IRF3, and GAPDH. Bar graph shows quantification of

phosphorylated IRF3 levels normalized against total IRF3 and GAPDH (mean of 3 independent experiments ± SEM). Figure 1 ID shows relative fold change in Ifna4 (white columns), Ifnb (grey columns) and Ccl2 (black columns) transcripts in Mus81 ^+I+ and Mus8V' ^~ MEFs 48 hours after transduction with MSCV-IRES-G p (ctrl) or MSCV- wsSi-IRES-G p (Mus81). Data represent mean ± SEM of 3 independent experiments. Figure 1 IE shows representative confocal microscopy images of Sting CTRL and Sting CRISPR TRAMP-C2 cells (left panels) stained for dsDNA in the presence of DAPI. The MFI of cytosolic DNA (n>300 cells) in Sting ⁰ ™ (white column) and Sting ^CRlsPR (grey columns) TRAMP-C2 cells was quantified in the right panel. Data represent mean ± SD of 3 independent experiments. Figure 1 IF shows representative confocal images of Sting ^CTR and Sting ^CR]sm SV40 large T-antigen immortalized Mus8V' ^~ MEFs analyzed two days after transduction with MSCV-IRES-G/p or MSCV- wsSi-IRES-G/p (left panels). Cells were stained for dsDNA in the presence of DAPI. Bar graph shows quantification of the MFI of cytosolic DNA in Sting ^CTR and Sting ^CR1SRR Mus8V'- MEFs (n>300) transduced with MSCV-IRES-G/p (white column) or MSCV- wsSi-IRES-G p (grey columns). Data represent mean ± SD of 3 independent experiments. Figure 11G shows relative expression of Ifna4 (white columns), Ifnb (grey columns) and Ccl2 (black columns) in the TRAMP-C2 cells described in part (Fig. 1 IE). Figure 11H shows relative expression of Ifha4 (white columns), Ifnb (grey columns) and Ccl2 (black columns) in MEFs described in part (Fig. 1 IF). Figure 111 shows gene set enrichment analysis (GSEA) of human IFN-β induced genes (>2-fold change in expression level upon cytokine exposure). Shown is the IFN-P-induced expression profile and genes ranked by extent of differential expression in stage II and stage III TCGA prostate cancer dataset (left panel). IFN-P-regulated genes with a rank metric score (RMS) >0.2, >0.3 or >0.4 are shown in the right table. ES, enrichment score; RLM, ranked list metric; NES, normalized enrichment score; FDR, false discovery rate. Scale bar, 10 μιτι. ns = non-significant; *p<0.05; **p<0.01 ; ***p<0.001.

[0020] Figures 12A, 12B, 12C, 12D, 12E, 12F, 12G, 12H, and 121 show STING-dependent immune rejection of TRAMP-C2 prostate cancer cells depends on Mus81. TRAMP-C2 cells transduced with retroviruses encoding either control shRNA (filled symbols) or Mus81 -specific shRNA (open symbols) were labelled with 2 μΜ PKH-26, a fluorescent dye (Fig. 12A). The labelled tumor cells were then mixed in a 1 : 1 ratio with control shRNA-transduced TRAMP-C2 cells labelled with 10 μΜ CellTrace Violet dye. The tumor cell mixture was injected i.p. into syngeneic Ifnar ^+I+ (circles) or Ifnaf ^1' (squares) C57BL/6 mice (n=5) (Fig. 12B), C57BL/6 mice (n=5) that received 500 μg isotype control antibody (circles) or neutralizing anti-IFNAR antibody (squares) 24 hours prior to administration of TRAMP-C2 cells (Fig. 12C), syngeneic Ifngr ^+I+ (circles) and Ifngf ^1' (squares) C57BL/6 mice (n=5) (Fig. 12D), C57BL/6 mice (n=5) that received 500 μg isotype control antibody (circles) or neutralizing anti-NKl.l antibody (PK136; squares) 24 hours prior to administration of TRAMP-C2 cells (Fig. 12E) or C57BL/6 mice (n=5) treated with 2 mg/ml clodronate liposomes (squares) or control PBS-loaded liposomes (circles) 24 hours prior to administration of TRAMP-C2 cells (Fig. 12F). Peritoneal exudates were analyzed by flow cytometry 24 hours after injection of the TRAMP-C2 cell mixture (Figs. 12A- 12F). Data are presented as the ratios of differentially labelled TRAMP-C2 cells recovered from each mouse. Figure 12G are images showing bone marrow-derived macrophages (BMDMs) co- cultured for 2 hours with equivalent numbers of PKH-26 ⁺ control shRNA-transduced TRAMP - C2 cells (white column) or PKH-26 ⁺ Mus81 -specific shRNA-transduced TRAMP-C2 cells (grey column). The percentage of PKH-26 ⁺ BMDMs was determined by confocal microscopy (n>300) or flow cytometry (n>10 ⁵ ). Figure 12H is a graph showing short-term tumor rejection assay described in (Fig. 12A) using Simg CTRL " (filled symbols) and Sting C ^{^} RISPR (open symbols) TRAMP-C2 cells. Data show mean ± SD of 5 mice per group. Figure 121 is a graph showing phagocytosis assay described in (Fig. 12G) using Sting (white column) and Sting (grey column) TRAMP-C2 cells. Scale bar, 10 μιτι. ns = non-significant; *p<0.05; **p<0.01 ;

***p<0.001.

[0021] Figures 13A, 13B, 13C, 13D, 13E, 13F, 13G, 13H, 131, and 13J show inhibition of ATR or PARP impairs accumulation of cytosolic DNA in tumor cells. Figure 13A are images of murine TRAMP-C2, human DU145 and human PC-3 prostate cancer cells labelled with antibodies against dsDNA and the mitochondrial marker COX IV in the presence of DAPI stain. Z-stacks were acquired by confocal microscopy and 3-D iso-surface rendered using Imaris software to exclude mitochondrial and nuclear DNA. Figure 13B are images showing TRAMP - C2, DU145 and PC-3 cells were labelled with 3 μΐ/ml of the dsDNA-specific dye PicoGreen for 1 hour and with 100 nM mitochondria-specific dye MitoTracker for 30 minutes. Z-stacks were acquired by confocal microscopy and 3-D iso-surface rendered using Imaris software to exclude mitochondrial DNA. Figure 13C are images showing TRAMP-C2 (left panels), DU145 (middle panels) or PC-3 (right panels) cells treated as described in Figure 1 in the absence of BrdU. One (1) hour and 16 hours after treatment, cells were labelled using BrdU-specific antibodies in the presence of DAPI. Figure 13D are images and a graph showing TRAMP-C2 cells treated for 16 hours with DMSO only (left), the ATR inhibitor VE-821 (2 μΜ; ATRi; middle), or with the PARP inhibitor NU1025 (10 μΜ; PARPi; right). Cytosolic dsDNA was stained and analyzed by confocal microscopy in the presence of DAPI. Bar graph shows mean ± SD of dsDNA MFI per TRAMP-C2 cell after treatment with DMSO only (white), VE-821 (grey), or NU1025 (black). Data are representative of 3 independent experiments. Figure 13E are images showing DU145 (left panels) and PC-3 (right panels) cells treated with DMSO only or 10 μΜ NU1025 (PARPi) for 16 h. Cytosolic dsDNA was stained and analyzed by confocal microscopy in the presence of DAPI. Bar graphs show mean ± SD of dsDNA MFI per cell after treatment with DMSO only (white) or PARPi (black). Data are representative of 3 independent experiments. Figure 13F are images showing BC2 cells were treated for 16 hours with DMSO only, 4 μΜ aphidicolin, 10 μΜ Ara-C, or 10 mM hydroxyurea. Cells were then stained for cytosolic dsDNA in the presence of DAPI. Figure 13G are graphs showing relative levels of Mus81 transcripts as determined by realtime RT-PCR in puromycin-selected TRAMPC2 cells (left panel) transduced with retroviral constructs encoding different Mus81 -specific shRNAs. Mus81 levels were normalized to levels of Hprt and Mus81 transcripts in control shRNA-transduced cells (See Methods in the Examples below). Mean values ± SEM from 3 independent experiments are shown. DU145 (middle panel) and PC-3 (right panel) cells were transfected with 20 nM of control or wsSi-specific siRNAs. 48 hours after transfection, Mus81 transcript levels were determined as described above. Figure 13H shows representative immunoblot analysis of Mus81-I- and Mus81+/+ MEFs transduced with MSCV-IRES-G p or MSCV- wsSi-IRES-G/p and probed with antibodies against MUS81 and GAPDH. Figure 131 shows representative confocal image of dsDNA staining in BC2 cells transduced with MSCV-IRES-G/p (upper panel) or MS CV-Mus81 -IRES - Gfp (lower panel). Bar graph shows the quantification of the MFI of cytosolic DNA staining per cell (n>300 cells). Data are presented as mean ± SD of 3 independent transductions. Figure 13J shows Mus81-I- MEFs stably transfected with control or synthetic pAT25tetA plasmids. Stably transfected cells were subsequently transduced with MSCV-IRES-G/p (Ctrl) or MSCYMus81-IRES-Gfp (Mus81) before fluorescence in situ hybridization using GFP-encoding DNA probes in the presence of DAPI. Representative confocal images are shown. Scale bar, 10 μιτι. *p<0.05; **p<0.01 ;

***p<0.001 ; ****p<0.0001.

[0022] Figures 14 A, 14B, 14C and 14D show MUS81 and dsDNA staining of primary human cancer tissues. Figure 14A shows representative confocal images of consecutive sections of stage II prostate adenocarcinoma, stage I breast cancer, stage II colorectal cancer, stage III/IV melanoma, cancer-adjacent tissue within normal limits and healthy skin. Tissues were stained with IgG2a isotype controls for MUS81- and dsDNA-specific antibodies in the presence of DAPI. Figure 14B shows representative confocal images of consecutive sections of stage IB endometrial cancer (E) and WHO Grade III astrocytoma (A). Sections were stained for MUS81 (left column) or dsDNA (right column) in the presence of DAPI. Quantification of the number of nuclear MUS81 foci and the MFI of cytosolic dsDNA staining detected per cell (n>1000 cells in different sections from two individual patients) is shown in the lower graphs. Figure 14C shows labelling of bone marrow tissues from a healthy control and a patient with chronic lymphocytic leukemia (CLL) showing cytosolic dsDNA and DAPI staining. In the right-hand column, DAPI staining has been removed to improve visualization of the dsDNA distribution. Quantification of the MFI of cytosolic dsDNA staining in bone marrow cells (n>400 cells in different sections from two individual patients and two healthy controls) is shown in the lower graph. Figure 14D is a graph depicting the average number of nuclear MUS81 foci and the MFI of cytosolic dsDNA staining detected per cell in consecutive sections of human prostate cancer samples. Scale bar, 10 μιη. **p<0.01.

[0023] Figures 15A, 15B, 15C, and 15D show generation of STING-deficient Mus81-I- MEFs using CRISPR/Cas9. Figures 15 A and 15B are images of Western blot analysis of expanded clones following transfection of Mus81-I- MEFs (Fig. 15A) or TRAMP-C2 cells (Fig. 15B) with control gRNA (StingCTRL) or SYmg-specific gRNA (SYmgCRISPR) and labelling for STING. Tubulin levels are shown as a loading control. Figures 15C and 15D are graphs showing IFN-β levels measured by ELISA in the culture supernatant of clone 5 Mus81-/- MEFs (Fig. 15C) or clone 3 TRAMP-C2 cells (Fig. 15D) 24 hours after transfection with 2 μ^πιΐ plasmid DNA (pDNA), 10 μg/ml poly(LC) or medium only. Data are presented as mean ± SEM of 3 independent transfections. *****p<0.0001.

[0024] Figures 16A, 16B, 16C, 16D, 16E, 16F, 16G, 16H, and 161 show wsS -shRNA does not affect cell-intrinsic apoptosis in TRAMPC2 cells. Figure 16A is a graph showing Annexin V- PI staining of TRAMP-C2 cells transduced with either control (ctrl) or Mus81 (Mus81 )-specific shRNA. Grouped data from 3 independent experiments show mean percentage ± SEM of annexin V-PI- (white), annexin V+PI+ (light grey) and annexin V+PI- (dark grey) TRAMP-C2 cells. Figure 16B is a graph showing TRAMP-C2 cells transduced with control (white column) or Mus81 (grey column)-specific shRNA were examined by flow cytometry to determine BrdU incorporation and DNA content (7-AAD staining). Shown are the percentages of BrdU- cells with 2N DNA content (GO/1), BrdU+ cells with 2N-4N DNA content (S), BrdU+ cells with 4N DNA content (G2/M) and apoptotic BrdU- cells with <2N DNA content. Data are presented as mean ± SEM of 3 independent experiments. Figure 16C is a graph showing TRAMP-C2 cells transduced with wsSi-specific shRNA (grey bars) or control shRNA (white bars) and labelled with 10 μΜ CellTrace Violet. The labelled shRNA-transduced TRAMP-C2 cells were then mixed with control shRNA-transduced TRAMP-C2 cells labelled with 2 μΜ PKH-26 to obtain a 1 : 1 ratio. The ratio of differentially labelled cells was analyzed prior to cell culture in vitro (0 h) and 24 hours after cell culture in vitro (24 h) by flow cytometry. Figure 16D is a graph showing differentially labelled TRAMP-C2 cells described in (Fig. 16C) were mixed in a 1 : 1 ratio and injected i.p. into C57BL/6 mice (n>5). The ratio of differentially labelled TRAMP-C2 cells was analyzed by flow cytometry prior to injection (0 h) and in the peritoneal exudate 24 hours after injection of the TRAMP-C2 cell mixture (24 h). Figure 16E is a graph representing fold change in lymphocyte subset numbers in the mouse peritoneal exudates 24 hours after i.p. injection of TRAMP-C2 cells (grey symbols). Numbers were normalized to lymphocyte subset counts in mice injected with PBS only (white symbols). Data represent mean ± SEM of 3 independent experiments (n=5 mice each). Figures 16F and 16G are graphs showing percentage of IFN-y+ (Fig. 16F) or CD107a+ (Fig. 16G) lymphocytes in mouse peritoneal exudates 24 hours after injection with PBS only (white symbols) or TRAMP-C2 cells (grey symbols). Data represent mean ± SD of n=5 mice. Figure 16H shows natural killer (NK) cell depletion in C57BL/6 mice confirmed by flow-cytometric analysis of blood CD3-CD49b+ cell numbers 24 hours after intraperitoneal administration of 500 μg isotype control antibodies (white bar) or anti-NKl . l (PK136) antibodies (grey bar). Figure 161 shows density plots on the left showing peritoneal exudate labelling for GR1 and F4/80 24 hours after administration of 2 mg/ml clodronate liposomes (clodronate) or PBS-loaded control liposomes (PBS). Boxes indicate the gating strategy used to identify GR1+ or F4/80+ cells. Percentage of GR1+ (N) and F4/80+ (MP) cells in the peritoneal exudates are indicated in the right panel. Data represents mean ± SEM of 3 independent experiments (n=5 mice each). MP = macrophages; NKT = NK T cells. *p<0.05; **p<0.01 ; ***p<0.001.

[0025] Figure 17 is a schematic of a proposed model of Mus81 -dependent host rejection of tumor cells. The occurrence of MUS81 substrates in the genome of cancer cells promotes tumor cell accumulation of dsDNA in the cytosol. Sensing of cytosolic dsDNA then triggers STING- mediated expression of type I IFNs; these cytokines subsequently increase IFN-γ production by various leukocyte populations. The increase in local IFN-γ concentration promotes the recruitment and activation of macrophages that recognize SYmg-dependent pro-phagocytic signals on tumor cells.

[0026] Figures 18A, 18B, 18C, and 18D show specificity control of cytosolic DNA stainings. Figure 18A are graphs showing anti-dsDNA mouse monoclonal antibody preferentially recognizes double-stranded nucleotides. ELISA plates were coated with indicated amounts of calf thymus DNA. Coated plates were incubated with dsDNA-specific antibody (all panels) or isotype control antibody (right panel). As a control some wells were incubated in the presence of calf thymus DNA (CT), DNase I, Poly G:C, Poly A:U, Poly I:C. Specific antibody staining was visualized by ELIS A. Figure 18B shows BC2 and Figure 18C shows Yac- 1 cells treated with DNase I or S 1 nuclease before staining for ssDNA or dsDNA and Cox IV in presence of DAPI. Figure 18D shows BC2 cells treated with DMSO (Upper panels) or 4 μΜ aphidicolin (Lower panels) for 14 hours were incubated with vital dsDN A- specific dye PicoGreen for 1 hour, followed by 15 minutes with MitoTracker. After fixation and permeabilization, cells were treated with DNase I (Right panel). Staining was analyzed by confocal microscopy.

DETAILED DESCRIPTION OF THE INVENTION

[0027] It is disclosed herein that cytosolic DNA accumulates in tumor cells in response to DNA damage. Analysis of cloned cytosolic DNA from tumor cells showed that cytosolic DNA derives from genomic DNA and often contains retro-elements and sequences with the potential to form non-B DNA. The disclosure relates to a diagnostic test for the early detection of cancer by the detection of cytosolic DNA produced by cancerous cells which is detected either in the cytoplasm or secreted into the circulatory system or both. The disclosure also relates to a prognostic test for assessing the efficacy of a particular cancer treatment.

[0028] Provided is a diagnostic or prognostic method for determining if a subject has, or is predisposed to, a pre-cancerous condition or to cancer, or whether a subject is or is not responding to a therapeutic treatment regimen for the treatment of cancer, comprising the steps: i) obtaining a biological sample from a subject to be tested; ii) contacting the sample with at least one agent that binds or anneals to nuclear genomic nucleic acid contained in said sample to form a complex of the agent[s] and nuclear genomic nucleic acid; iii) detecting the binding of said agent[s] to said nuclear genomic nucleic acid wherein the detection of nuclear genomic nucleic acid in the cytosol and/or an extracellular location is diagnostic of cancer or a predisposition to cancer, or determines whether said subject is responding to a therapeutic treatment regimen for cancer or not; and optionally iv) comparing the binding of said agent[s] to an equivalent control sample.

[0029] In certain embodiments, the step of detecting comprises a polymerase chain reaction (PCR) based method for the detection of a nuclear genomic nucleic acid in a biological sample. [0030] In certain embodiments, the PCR based method is real time PCR for the detection and quantification of nuclear genomic nucleic acid.

[0031] In certain embodiments, the PCR based method is a multiplex PCR.

[0032] In certain embodiments, the step of detecting comprises an in situ PCR method for detection of genomic nucleic acid in a sample comprising cancer cells.

[0033] In certain embodiments, the step of detecting comprises an in situ hybridization method for detection of nuclear genomic acid in a biological sample.

[0034] In certain embodiments, the step of detecting comprises an immunofluorescence based assay for detection of nuclear genomic nucleic acid in a biological sample.

[0035] In certain embodiments, the immunofluorescence -based assay is flow cytometry.

[0036] In certain embodiments, the immunofluorescence -based assay is fluorescence activated cell sorting (FACS).

[0037] In certain embodiments, the immunofluorescence -based assay is an enzyme-linked immune assay (ELISA).

[0038] In certain embodiments, the step of detecting comprises a spectrometer-based assay for the detection and quantification of a nuclear genomic nucleic acid in a biological sample.

[0039] In certain embodiments, the step of detecting comprises a microarray-based assay.

[0040] In certain embodiments, the microarray-based assay comprises one or more oligonucleotide probes comprising a sequence complementary to a sequence of one or more nuclear genomic acid molecules.

[0041] In certain embodiments, the cytosolic or extracellular genomic nucleic acid comprises one or more retro-elements nucleotide sequences.

[0042] In certain embodiments, the retro-elements are selected from the group consisting of short interspersed nuclear elements (SINEs), long interspersed nuclear elements (LINEs) and long terminal repeats (LTRs). [0043] In certain embodiments, the retro-elements are selected from the group consisting of: LINE-1, HERV-K, and Alu retro-elements.

[0044] In certain embodiments, the genomic nucleic acid is double stranded DNA, single stranded DNA, DNA/RNA hybrids, triplex DNA or quadruplex DNA.

[0045] In certain embodiments, the agent is an antibody or a dye specific for said genomic nucleic acid. Antibodies that are specific for DNA structures are known in the art. For example, the triplex DNA specific antibody S9 or the quadruplex DNA-specific antibody is Sty49. In certain embodiments, the agent is a DNA or RNA-specific dye. In certain embodiments, the dye recognises non-B DNA, triplex or quadruplex DNA. Non-B-DNA structures include for example G-quadruplex, Z-DNA, cruciforms, triplex and different types of repeats. In certain

embodiments, the dye is plasma membrane-specific.

[0046] In certain embodiments, the nuclear genomic nucleic acid is present as a free DNA or comprised in micro-vesicles. Microvesicles are distinctively different from exosomes and apoptotic bodies. Microvesicles are plasma-membrane-derived particles that are released into the extracellular space by outward budding and fission of the plasma membrane. Their size ranges from 200 nm to 1 μπι in diameter. Exosomes are much smaller and range from 50 nm to 80 nm. Microvesicles can be separated by differential centrifugation from other components such as apoptotic bodies, nuclei, mitochondria, lysosomes, ribosomes and cytosol. In certain

embodiments, the levels of secreted microvesicles correlate with tumor cell invasiveness and disease progression.

[0047] In certain embodiments, the biological sample is contacted with a second agent specific for nuclear genomic DNA or a nuclear or nuclear pore protein. In certain embodiments, the biological sample is contacted with a further agent specific for mitochondrial DNA or a mitochondrial specific protein.

[0048] As used herein, the term "cancer" refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histo-pathologic type or stage of invasiveness. The term "cancer" includes malignancies of the various organ systems, such as those affecting, for example, lung, breast, thyroid, lymphoid, gastrointestinal, and genitourinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. Thus, the term "cancer" includes all types of cancer, neoplasm, or malignant tumors found in mammals, including leukemia, carcinomas and sarcomas. Exemplary cancers include cancer of the brain, breast, cervix, colon, head and neck, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus and MeduUoblastoma. Additional examples include, Hodgkin's Disease, Non-Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, cancer, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenal cortical cancer, neoplasms of the endocrine and exocrine pancreas, and prostate cancer.

[0049] The term "carcinoma" is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term "carcinoma" also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An "adenocarcinoma" refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures.

Exemplary carcinomas include, for example, acinar carcinoma, acinous carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, carcinoma adenomatosum, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, carcinoma basocellulare, basaloid carcinoma, basosquamous cell carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma, chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, carcinoma durum, embryonal carcinoma, encephaloid carcinoma, epiermoid carcinoma, carcinoma epitheliale adenoides, exophytic carcinoma, carcinoma ex ulcere, carcinoma fibrosum, gelatiniforni carcinoma, gelatinous carcinoma, giant cell carcinoma, carcinoma gigantocellulare, glandular carcinoma, granulosa cell carcinoma, hair-matrix carcinoma, hematoid carcinoma, hepatocellular carcinoma, Hurthle cell carcinoma, hyaline carcinoma, hypemephroid carcinoma, infantile embryonal carcinoma, carcinoma in situ, intraepidermal carcinoma, intraepithelial carcinoma, Krompecher's carcinoma, Kulchitzky-cell carcinoma, large-cell carcinoma, lenticular carcinoma, carcinoma lenticulare, lipomatous carcinoma, lymphoepithelial carcinoma, carcinoma medullare, medullary carcinoma, melanotic carcinoma, carcinoma molle, mucinous carcinoma, carcinoma muciparum, carcinoma mucocellulare, mucoepidermoid carcinoma, carcinoma mucosum, mucous carcinoma, carcinoma myxomatodes, nasopharyngeal carcinoma, oat cell carcinoma, carcinoma ossificans, osteoid carcinoma, papillary carcinoma, periportal carcinoma, preinvasive carcinoma, prickle cell carcinoma, pultaceous carcinoma, renal cell carcinoma of kidney, reserve cell carcinoma, carcinoma sarcomatodes, schneiderian carcinoma, scirrhous carcinoma, carcinoma scroti, signet- ring cell carcinoma, carcinoma simplex, small-cell carcinoma, solanoid carcinoma, spheroidal cell carcinoma, spindle cell carcinoma, carcinoma spongiosum, squamous carcinoma, squamous cell carcinoma, string carcinoma, carcinoma telangiectaticum, carcinoma telangiectodes, transitional cell carcinoma, carcinoma tuberosum, tuberous carcinoma, verrucous carcinoma, and carcinoma villosum.

[0050] The term "sarcoma" generally refers to a tumor which is made up of a substance like the embryonic connective tissue and is generally composed of closely packed cells embedded in a fibrillar or homogeneous substance. Sarcomas include a chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abemethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, chorio carcinoma, embryonal sarcoma, Wilms' tumor sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, fibroblastic sarcoma, giant cell sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented hemorrhagic sarcoma, immunoblastic sarcoma of B cells, lymphoma, immunoblastic sarcoma of T-cells, Jensen's sarcoma, Kaposi's sarcoma, Kupffer cell sarcoma, angiosarcoma, leukosarcoma, malignant mesenchymoma sarcoma, parosteal sarcoma, reticulocytic sarcoma, Rous sarcoma, serocystic sarcoma, synovial sarcoma, and telangiectaltic sarcoma. [0051] The term "melanoma" is taken to mean a tumor arising from the melanocytic system of the skin and other organs. Melanomas include, for example, acral-lentiginous melanoma, amelanotic melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma, juvenile melanoma, lentigo maligna melanoma, malignant melanoma, nodular melanoma, subungal melanoma, and superficial spreading melanoma.

[0052] The disclosure also encompasses "lymphomas." Lymphomas are cancers that initiate in lymphocytes and form solid tumors in the lymph nodes. Lymphoma is a term that classifies a large number of lymphocyte originating cancers. For example B-cell tumors such as chronic lymphocyte leukaemia, B-cell prolymphocytic leukaemia, Waldenstrom macroglobulinemia, Burkitt' s lymphoma; T-cell tumors such as T-cell prolymphocytic leukaemia, NK cell leukaemia, T-cell large granular lymphocytic leukaemia, adult T-cell leukaemia. In addition lymphoma includes the classical Hodgkin's lymphomas which themselves can be sub-divided as non-Hodgkin's lymphoma. In addition to the above, lymphomas associated with

immunodeficiency are prevalent, for example those associated with HIV infection, post transplantation lymphomas and those associated with methotrexate treatment. Also, within the scope of the present disclosure are germ cell cancers, for example teratoma.

[0053] In certain embodiments, the cancer is prostate cancer. In certain embodiments, the cancer is a lymphoma. In certain embodiments, the cancer is breast cancer. In certain embodiments, the cancer is lung cancer. In certain embodiments, the cancer is colorectal cancer.

[0054] As noted above, the term cancer includes all types of stages of invasiveness.

Optionally, the cancer is stage 0, stage I, stage II, stage III or stage IV cancer. Classifying a cancer by stage uses numerals I, II, III, and IV (plus the 0) to describe the progression of cancer. The stage of a cancer indicates how much the cancer has spread and may take into account size and metastasis of the tumor to distant organs. Stages 0, 1 and II cancers are considered early stage tumors. Stages III and IV are considered late stage cancers. Stage 0 indicates cancer in situ, i.e., an early form of a cancer defined by the absence of invasion of surrounding tissues. Stage I cancers are localized to one part of the body. Stage II cancers are locally advanced, as are Stage III cancers. Whether a cancer is designated as Stage II or Stage III can depend on the specific type of cancer. The specific criteria for Stages II and III therefore differ according to diagnosis. Stage IV cancers have often metastasized, or spread to other organs or throughout the body. The provided methods can be used to diagnose early stage cancers (stages 0, 1, and II) as well as late stage (stages III and IV) cancers.

[0055] In certain embodiments, the subject is a non-human animal. In certain embodiments, the subject is human.

[0056] In certain embodiments, the biological sample is a tissue biopsy. In certain

embodiments, the biological sample is a fluid or viscous sample. In certain embodiments, the biological sample is selected from the group consisting of: urine, seminal fluid, blood, blood plasma or serum, lymph fluid, saliva, sputum, lavage, bronchoaveolar lavage, cerebrospinal fluid. In certain embodiments, the biological sample is a frozen or paraffin tissue sample.

[0057] In certain embodiments, the method determines a treatment or prevention regimen for said subject if genomic nucleic acid is detected in a cytosolic and/or an extracellular location.

[0058] In certain embodiments, the method determines said treatment regimen is inhibiting or retarding the progress of cancer and is continued or is ceased.

[0059] In certain embodiments, the method determines said treatment regimen is not inhibiting or retarding the progress of cancer wherein said treatment regimen is altered or amended.

[0060] The treatment regimens comprise therapeutic agents that are administered in effective amounts. An "effective amount" is that amount of a therapeutic agent that alone, or together with further doses, produces the desired response. In the case of treating cancer, the desired response can include inhibiting or retarding the progression of the cancer or reducing the size of the tumor. This may involve only slowing the progression of the cancer temporarily or halting the progression of the cancer permanently. This can be monitored by routine methods. Such amounts of therapeutic agent will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual therapeutic agents or combinations of therapeutic agents thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.

[0061] Treatment regimens include but are not limited to one or more of surgery, radiotherapy, chemotherapeutic therapies, cancer growth inhibitors, angiogenesis inhibitors, vaccines, hormonal therapies or antibody based therapies.

[0062] "Antibody-based therapies" include antibodies that, for example, inhibit cancer cell division or angiogenesis. In general, doses of therapeutic antibodies (or fragments thereof) of between 10 μg/ml and 500 μg/ml generally will be formulated and administered according to standard procedures. Exemplary doses can range from 10 μg/ml to 250 μg/ml, 30 μg/ml to 250 μg/ml, 50 μg/ml to 250 μg/ml, 30 μg/ml to 100 μg/ml, or 50 μg/ml to 100 μg/ml, such as 10 μ^ιηΐ, 20 μ^ιηΐ, 30 μ^ιηΐ, 40 μ^ιηΐ, 50 μ^ιηΐ, 60 μ^ιηΐ, 70 μ^ιηΐ, 80 μ^ιηΐ, 90 μ^ιηΐ, 100 μ^ητΐ, 250 μg/ml, 400 μg/ml or 500 μg/ml. Other protocols for the administration of compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration and the like vary from the foregoing.

[0063] "Chemotherapeutic therapies" typically use small chemical compounds that can kill and/or at least partially inhibit the growth of cancer cells by various mechanisms. The agents can be divided with respect to their structure or mode of action. For example, chemotherapeutic agents include alkylating agents, anti-metabolites, anthracyclines, alkaloids, plant terpenoids and toposisomerase inhibitors. Chemotherapeutic agents typically produce their effects on cell division or DNA synthesis, examples include cisplatin, carboplatin or oxaliplatin. Some chemotherapuetic agents act as an anti-metabolic drug for example pyrimidine or purine analogues. Purine analogues are known in the art; for example thioguanine is used to treat acute leukaemia; fludarabine inhibits the function of DNA polymerases, DNA primases and DNA ligases and is specific for cell-cycle S-phase; pentostatin and cladribine are adenosine analogues and are effective against hairy cell leukaemias. A further example is mecrcaptopurine which is an adenine analogue. Pyrimidine analogues are similarly known in the art. For example, 5- fluorouracil (5-FU), floxuridine and cytosine arabinoside. 5-FU has been used for many years in the treatment of breast, colorectal cancer, pancreatic and other cancers. 5-FU can also been formed from the pro-drug capecitabine which is converted to 5-FU in the tumor. Anti-metabolic drugs can be co-administered with leucovorin. Leucovorin, also known as folinic acid, is administered as an adjuvant in cancer chemotherapy and which enhances the inhibitory effects of 5-FU on thymidylate synthase. Other examples of chemotherapeutic drugs include vinca alkaloids, for example vincristine or vinblastine or terpenoids such as a taxane [e.g. paclitaxel].

[0064] Treatment regimens can be implemented or altered in response to the diagnostic or prognostic tests as described herein.

[0065] Diagnostic or prognostic tests as described herein or the administration of therapeutic compositions to mammals other than humans, (e.g. for testing purposes or veterinary therapeutic purposes), is carried out under substantially the same conditions as described above. A subject, as used herein, is a mammal, for example a human, and including a non-human primate, cow, horse, pig, sheep, goat, dog, cat or rodent.

[0066] Also provided is a kit comprising one or more agents for detection of nuclear genomic nucleic acid. Optionally, the agent binds to or anneals to nucleic genomic nucleic acid.

Optionally, the nuclear genomic DNA is present in the cytosol of a cell or is extracellular.

Optionally, the nuclear genomic DNA is present in micro vesicles. Optionally, the agent is an antibody or a dye as described herein. Optionally, the kit comprises one or more anti-dsDNA antibodies for the detection of double stranded DNA including polyclonal and monoclonal antibodies. Optionally, the kit comprises one or more dyes for detecting nucleic acids.

Optionally, the kit comprises PicoGreen or OliGreen. Also provided are kits comprising one or more agents for the detection of MUS81. Optionally, the agent is an antibody. Optionally, the provided kits further include reagents that allow efficient and specific binding. In certain embodiments, the reagents are selected form the group PCR reaction reagents, hybridisation buffer, primary and secondary antibodies, DNA polymerase, fluorescent or non-fluorescent dyes as herein disclosed. Typically, the kits include instructions for use. The instructions can be instructions for carrying out any of the methods provided herein. For example, the instructions for use can include directions for carrying out a method of detection of MUS81 and/or a method for detection of nuclear genomic nucleic acid in the cytosol of a cell or in microvesicles.

Optionally, the reagents and agents are contained in one or more containers, e.g., vials or packets. Thus, the provided kits can include one or more detecting reagents and/or a detecting apparatus capable of detection of the nucleic genomic nucleic acid or MUS81. The kit can further include assay containers (tubes), buffers, or enzymes necessary for carrying out the detection assay. Kits can also include components for comparing results such as a suitable control sample, for example a positive and/or negative control. The kit can also include a collection device for collecting and/ or holding the sample from the subject. The collection device can include a sterile swab or needle (for collecting blood), and/or a sterile tube (e.g., for holding the swab or a bodily fluid sample).

[0067] Provided is a screening method to determine whether a test agent induces or causes DNA damage comprising the steps: i) providing a cell sample to be tested; ii) contacting the cell sample in (i) above with an agent to be tested to form a

reaction mixture; iii) incubating the reaction mixture under cell culture conditions allowing cell

division of said cell sample; iv) contacting the reaction mixture with at least one agent that binds or anneals to nuclear genomic nucleic acid contained in said sample to form a complex of the agent[s] and nuclear genomic nucleic acid; v) detecting the binding of said agent[s] to said nuclear genomic nucleic acid

wherein the detection of nuclear genomic nucleic acid in the cytosol and/or an extracellular location indicates said test agent induces DNA damage either directly or indirectly; and optionally vi) comparing the binding of said agent[s] to an equivalent cell sample that has not be contacted with said test agent.

[0068] In certain embodiments, the cell sample comprises human cells. In certain

embodiments, the sample comprises cancer cells as herein disclosed. In certain embodiments, the detection of nuclear genomic DNA is by methods herein disclosed.

[0069] In certain embodiments, the test agent is a chemotherapeutic agent. [0070] In certain embodiments, the method further includes detecting circulating tumor cells (CTCs).

[0071] Also provided are methods of increasing cytosolic DNA in a cell, the method comprising the steps of contacting the cell with MUS81 or one or more modulators of MUS81 activity in an amount effective to increase the cytosolic DNA in the cell. The contacting can include contacting the cell with MUS81 or an active fragment thereof. Optionally, the contacting comprises contacting the cell with an MUS81 activator. As used herein, the term "MUS81 modulator" of "modulator of MUS81 activity" refers to an agent, e.g., nucleic acid, amino acid, small molecule or antibody that modulates the activity of MUS81. As used herein, the term "modulates" is meant to refer to the upregulation, downregulation, activation, antagonism, or otherwise alteration in form or function. As used herein, the term "activities" of a protein include, for example, transcription, translation, intracellular translocation, secretion,

phosphorylation by kinases, cleavage by proteases, homophilic and heterophilic binding to other proteins, ubiquitination. In certain embodiments, the MUS81 modulator is an activator of MUS81 activity. An increase in activity can result from direct or indirect action on MUS81. For example, the activity of MUS81 can be increased by increasing the amount of MUS 81 present in a cell, e.g., by increasing the expression of MUS81 or by inhibiting the degradation of MUS81. In certain embodiments, the MUS81 modulator activates MUS81, resulting in an increase production of cytosolic DNA. Optionally, the cell is a cancer cell. Optionally, the cancer cell is a prostate cancer cell, a breast cancer cell, a colorectal cancer cell, an adenocarcinoma cell, a melanoma cell, an endometrial cancer cell, an astrocytoma cell, or chronic lymphocytic leukemia cell.

[0072] Provided herein is a method of treating cancer in a subject, the method comprising the steps of (a) contacting a biological sample with an agent to determine the level of MUS 81 in the biological sample; and (b) determining the amount of MUS81 in the biological sample, wherein increased levels of MUS 81 in the biological sample as compared to a control indicating the subject has cancer. Optionally, the method further includes treating the subjects with cancer with radiation, surgery, one or more agents for treatment of the cancer or a combination thereof.

[0073] In certain embodiments, the biological sample comprises cells and the determining comprises determining the number of nuclear MUS81 foci in the cells. [0074] In certain embodiments, the cancer is prostate cancer, colorectal cancer breast cancer, adenocarcinoma, melanoma, endometrial cancer, astrocytoma, or chronic lymphocytic leukemia. Optionally, the cancer is prostate cancer.

[0075] In certain embodiments, the one or more agents for treatment of the cancer is administered to the subject. In certain embodiments, the agent is a chemotherapeutic agent.

[0076] In certain embodiments, the biological sample comprises cells and the method further comprising determining the amount of nuclear genomic nucleic acids in the cytosol and/or extracellular location of the cells.

[0077] In certain embodiments, the determining the amount of MUS81 comprises in situ hybridization. In certain embodiments, the determining the amount of MUS81 comprises an immunofluorescence based assay, Western blot or PCR.

[0078] In certain embodiments, the method further includes detecting circulating tumor cells.

[0079] As used herein, MUS81 refers to MUS81 and homologs, variants and isoforms thereof. There are a variety of sequences that are disclosed on Genbank, at www.pubmed.gov and these sequences and others are herein incorporated by reference in their entireties as well as for individual subsequences contained therein. For example, the amino acid and nucleic acid sequences of human MUS81 can be found at GenBank Accession Nos. NP_079404 and NM_025128.4, respectively. Thus provided are amino acid sequences of MUS81 comprising an amino acid sequence at least about 70%, 75%, 80%, 85%, 86%, 90%, 95%, 98%, 99% or more identical to the sequence found at the aforementioned GenBank accession numbers. Also provided are nucleic acids encoding MUS81 comprising a nucleotide sequence at least about 70%, 75%, 80%, 85%, 86%, 90%, 95%, 98%, 99% or more identical to the nucleotide sequence found at the aforementioned GenBank accession numbers or complement thereof. As used herein, the term peptide, polypeptide, protein or peptide portion is used broadly herein to mean two or more amino acids linked by a peptide bond. Protein, peptide and polypeptide are also used herein interchangeably to refer to amino acid sequences. The term fragment is used herein to refer to a portion of a full- length polypeptide or protein. It should be recognized that the term polypeptide is not used herein to suggest a particular size or number of amino acids comprising the molecule and that a peptide can contain up to several amino acid residues or more. As with all peptides, polypeptides, and proteins, it is understood that substitutions in the amino acid sequence of the MUS81, MUS81 homolog or fragments of MUS81 or MUS81 homolog can occur that do not alter the nature or function of the peptides, polypeptides, or proteins.

[0080] A "control" sample or value refers to a sample that serves as a reference, usually a known reference, for comparison to a test sample. For example, a test sample can be taken from a test condition, e.g., in the presence of a test compound, and compared to samples from known conditions, e.g., in the absence of the test compound (negative control), or in the presence of a known compound (positive control). For example, a test sample can be taken from a patient suspected of having a given disease (e.g. an autoimmune disease, inflammatory autoimmune disease, cancer, infectious disease, immune disease, or other disease) and compared to a known normal (non-diseased) individual (e.g. a standard control subject). A control can also represent an average value gathered from a number of tests or results. A control value can also be obtained from the same individual, e.g. from an earlier-obtained sample from the patient prior to disease onset. One of skill in the art will recognize that controls can be designed for assessment of any number of parameters. For example, a control can be devised to compare therapeutic benefit based on pharmacological data (e.g., half-life) or therapeutic measures (e.g., comparison of side effects).

[0081] One of skill in the art will understand which controls are valuable in a given situation and be able to analyze data based on comparisons to control values. Controls are also valuable for determining the significance of data. For example, if values for a given parameter are widely variant in controls, variation in test samples will not be considered as significant.

[0082] The terms higher, increases, elevates, or elevation refer to increases above a control. The terms low, lower, reduces, or reduction refer to any decrease below control levels. For example, control levels are in vivo levels prior to, or in the absence of, addition of an agent. The reduction includes a complete elimination of the invasiveness. Inhibit, inhibiting, and inhibition mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels.

[0083] As used herein, "treating" or "treatment of a condition, disease or disorder or symptoms associated with a condition, disease or disorder refers to an approach for obtaining beneficial or desired results, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of extent of condition, disorder or disease, stabilization of the state of condition, disorder or disease, prevention of development of condition, disorder or disease, prevention of spread of condition, disorder or disease, delay or slowing of condition, disorder or disease progression, delay or slowing of condition, disorder or disease onset, amelioration or palliation of the condition, disorder or disease state, and remission, whether partial or total.

"Treating" can also mean prolonging survival of a subject beyond that expected in the absence of treatment. "Treating" can also mean inhibiting the progression of the condition, disorder or disease, slowing the progression of the condition, disorder or disease temporarily, although in some instances, it involves halting the progression of the condition, disorder or disease permanently. As used herein the terms treatment, treat, or treating refers to a method of reducing the effects of one or more symptoms of a disease or condition characterized by expression of the protease or symptom of the disease or condition characterized by expression of the protease. Thus in the disclosed method, treatment can refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% reduction in the severity of an established disease, condition, or symptom of the disease or condition. For example, a method for treating a disease is considered to be a treatment if there is a 10% reduction in one or more symptoms of the disease in a subject as compared to a control. Thus the reduction can be a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percent reduction in between 10% and 100% as compared to native or control levels. It is understood that treatment does not necessarily refer to a cure or complete ablation of the disease, condition, or symptoms of the disease or condition. Further, as used herein, references to decreasing, reducing, or inhibiting include a change of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or greater as compared to a control level and such terms can include but do not necessarily include complete elimination. [0084] Provided are compositions comprising one or more agents for treatment of cancer, e.g., chemotherapeutic agents. The provided compositions are, optionally, suitable for formulation and administration in vitro or in vivo. Suitable carriers and excipients and their formulations are described in Remington: The Science and Practice of Pharmacy, 21st Edition, David B. Troy, ed., Lippicott Williams & Wilkins (2005). By pharmaceutically acceptable carrier is meant a material that is not biologically or otherwise undesirable, i.e., the material is administered to a subject without causing undesirable biological effects or interacting in a deleterious manner with the other components of the pharmaceutical composition in which it is contained. If

administered to a subject, the carrier is optionally selected to minimize degradation of the active ingredient and to minimize adverse side effects in the subject.

[0085] The compositions disclosed herein can be administered by any means known in the art. For example, compositions may include administration to a subject intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intrarectally, topically, intratumorally, intramuscularly, intrathecally, subcutaneously, subconjunctival, intravesicularlly, mucosally, intrapericardially, intraumbilically, intraocularly, orally, locally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion, via a catheter, via a lavage, in a creme, or in a lipid composition. Administration can be local, e.g., at or near the site of a tumor, or systemic.

[0086] The compositions for administration will commonly comprise an agent as described herein dissolved in a pharmaceutically acceptable carrier, e.g. an aqueous carrier. A variety of aqueous carriers can be used, e.g., buffered saline and the like. These solutions are sterile and generally free of undesirable matter. These compositions may be sterilized by conventional, well known sterilization techniques. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of active agent in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight and the like in accordance with the particular mode of administration selected and the subject's needs. [0087] The formulations of compounds can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials. Thus, the composition can be in unit dosage form. In such form the preparation is subdivided into unit doses containing appropriate quantities of the active component. Thus, the compositions can be administered in a variety of unit dosage forms depending upon the method of administration. For example, unit dosage forms suitable for oral administration include, but are not limited to, powder, tablets, pills, capsules and lozenges.

[0088] Compositions can be formulated to provide quick, sustained or delayed release after administration by employing procedures known in the art. Certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of composition being administered. Suitable formulations for use in the provided compositions can be found in Remington: The Science and Practice of Pharmacy, 21st Edition, David B. Troy, ed., Lippicott Williams & Wilkins (2005).

[0089] Combinations of agents, e.g., detection agents or therapeutic agents, may be administered either concomitantly (e.g., as an admixture), separately but simultaneously (e.g., via separate intravenous lines into the same subject), or sequentially (e.g., one of the compounds or agents is given first followed by the second). Thus, the term combination is used to refer to either concomitant, simultaneous, or sequential administration of two or more agents. The course of treatment is best determined on an individual basis depending on the particular characteristics of the subject and the type of treatment selected. The treatment, such as those disclosed herein, can be administered to the subject on a daily, twice daily, bi-weekly, monthly or any applicable basis that is therapeutically effective. The treatment can be administered alone or in combination with any other treatment disclosed herein or known in the art. The additional treatment can be administered simultaneously with the first treatment, at a different time, or on an entirely different therapeutic schedule (e.g., the first treatment can be daily, while the additional treatment is weekly).

[0090] As used herein, biological samples include, but are not limited to, cells, tissues and bodily fluids. Optionally, the biological sample is the stomach or stomach tissue. Bodily fluids that used to evaluate the presence or absence of the herein disclosed biomarkers include without limitation blood, urine, serum, tears, lymph, bile, cerebrospinal fluid, interstitial fluid, aqueous or vitreous humor, colostrum, sputum, amniotic fluid, saliva, perspiration, transudate, exudate, and synovial fluid. Biopsy refers to the removal of a sample of tissue for purposes of diagnosis. For example, a biopsy is from a cancer or tumor, including a sample of tissue from an abnormal area or an entire tumor. Optionally, the biological sample is a stomach-derived biological sample.

[0091] Methods for detecting and identifying nucleic acids and proteins and interactions between such molecules involve conventional molecular biology, microbiology, and

recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature (see, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; Animal Cell Culture, R. I. Freshney, ed., 1986). For example, for the detection of double stranded DNA, anti-dsDNA antibodies, e.g., MAB1293, clone AE-2, (Millipore, Billerica, Massachusetts) or fluorescent dyes, e.g., picogreen live dye (Quant-iT Picogreen, Invitrogen (Carlsbad, CA)), can be used. Optionally, anti-dsDNA antibodies are used for the detection of double stranded DNA include polyclonal and monoclonal antibodies. Such antibodies for detection of double stranded DNA include commercially available antibodies, e.g., anti DNA double stranded antibodies from antibodies-online (Atlanta, GA), mouse anti-human DNA double stranded monoclonal antibody, clone AE-2 from GenWay Biotech, Inc. (San Diego, CA), anti-DNA double stranded antibodies from Acris Antibodies GmbH (San Diego, CA), double stranded DNA monoclonal antibody, clone AE-2, from Thermo Fisher Scientific (Rockford, IL), double stranded DNA antibody from Biorbyt (San Francisco, CA), and anti-DNA, double stranded, clone AE-2 from EMD Millipore (Billerica, MA). Antibodies can also be used to detect Mus81, e.g., anti-MUS81 antibody from Santa Cruz Biotechnology, Inc. (Dallas, TX), sc- 47692, clone 2G10/3.

[0092] Methods for detecting nucleic acids are largely cumulative with the nucleic acid detection assays and include, for example, Northern blots, RT-PCR, arrays including microarrays and sequencing including high-throughput sequencing methods. In some embodiments, a reverse transcriptase reaction is carried out and the targeted sequence is then amplified using standard PCR. Quantitative PCR (qPCR) or real time PCR (RT-PCR) is useful for determining relative expression levels, when compared to a control. Quantitative PCR techniques and platforms are known in the art, and commercially available (see, e.g., the qPCR Symposium website, available at qpersymposium.com). Nucleic acid arrays are also useful for detecting nucleic acid expression. Customizable arrays are available from, e.g., Affymatrix.

[0093] Optionally, the nucleic acids are detected using a DNA binding dye. Exemplary DNA binding dyes include, but are not limited to, acridines (e.g., acridine orange, and acriflavine), actinomycin D (Jain, et al. J. Mol. Biol. 68:21 (1972), which is incorporated by reference herein in its entirety), anthramycin, B0B0™-1, BOBO™-3, B0-PR0™-1, cbromomycin, DAPI (Kapuseinski, et al. Nucl. Acids Res. 6(112): 3519 (1979), which is incorporated by reference herein in its entirety), daunomycin, distamycin (e.g., distamycin D), dyes described in U.S. Patent No. 7,387,887, which is incorporated by reference herein in its entirety, ellipticine, ethidium salts (e.g., ethidium bromide), fluorcoumanin, fluorescent intercalators as described in U.S. Patent No. 4,257,774, which is incorporated by reference herein in its entirety, GelStar® (Cambrex Bio Science Rockland Inc., Rockland, Me.), Hoechst 33258 (Searle and Embrey, Nucl. Acids Res. 18:3753-3762 (1990), which is incorporated by reference herein in its entirety), Hoechst 33342, homidium, JO-PRO™- 1, LIZ dyes, LO-PRO™-l, mepacrine, mithramycin, NED dyes, netropsin, 4',6-diamidino-a-phenylindole, proflavine, POPO™-l, POPO™-3, PO- PRO™-l, propidium iodide, ruthenium polypyridyls, S5, SYBR® Gold, SYBR® Green I (U.S. Patent No. 5,436,134 and 5,658,751), SYBR® Green II, SYTOX blue, SYTOX green, SYTO® 43, SYTO® 44, SYTO® 45, SYTOX® Blue, TO-PRO®-l, SYTO® 11, SYTO® 13, SYTO® 15, SYTO® 16, SYTO® 20, SYTO® 23, thiazole orange (Aldrich Chemical Co., Milwaukee, Wis ), TOTO™-3, YO-PRO®-l, and YOYO®-3 (Molecular Probes, Inc., Eugene, OR), among others. SYBR® Green I (see, e.g., U.S. Patent Nos. 5,436, 134; 5,658,751 ; and or 6,569,927, which are incorporated by reference herein in their entireties), for example, has been used to monitor a PCR reactions. Other DNA binding dyes may also be suitable as would be understood by one of skill in the art. See, for example, U.S. Patent Nos. 4,883,867; 5,658,751; 8,865,904; 8,883,415; 9,040,561; and 9,115,397, which are incorporated by reference herein in their entireties. Optionally, the DNA binding dye is OliGreen or PicoGreen. See, e.g., U.S. Patent No. 5,436,134, which is incorporated by reference herein in its entirety.

[0094] Optionally, methods for detecting nucleic acids include sequencing methods.

Sequencing methods are known and can be performed with a variety of platforms including, but not limited to, platforms provided by Ulumina, Inc., (La Jolla, CA) or Life Technologies (Carlsbad, CA). See, e.g., Wang, et al., Nat Rev Genet. 10(l):57-63 (2009); and Martin, Nat Rev Genet. 12( 10):671-82 (2011), which are incorporated by reference herein in their entireties. Optionally, methods for detecting nucleic acids include microarray methods, which are known and can be performed with a variety of platforms including, but not limited to, platforms provided by Ambion, Inc., (Austin, TX) and Life Technologies (Carlsbad, CA).

[0095] Immunodetection methods are used for detecting, binding, purifying, removing and quantifying various molecules including the disclosed biomarkers. Further, antibodies and ligands to the disclosed biomarkers are detected. For example, the disclosed biomarkers are employed to detect antibodies having reactivity therewith. Standard immunological techniques are described, e.g., in Hertzenberg, et al., Weir's Handbook of Experimental Immunology, vols. 1-4 (1996); Coligan, Current Protocols in Immunology (1991); Methods in Enzymology, vols. 70, 73, 74, 84, 92, 93, 108, 116, 121 , 132, 150, 162, and 163; and Paul, Fundamental

Immunology (3d ed. 1993), each of which is incorporated herein by reference in its entirety and specifically for teachings regarding immunodetection methods.

[0096] The steps of various useful immunodetection methods have been described in the scientific literature, such as, e.g., Maggio et al., Enzyme-Immunoassay, ( 1987) and Nakamura, et al., Enzyme Immunoassays: Heterogeneous and Homogeneous Systems, Handbook of

Experimental Immunology, Vol. 1 : Immunochemistry, 27.1-27.20 ( 1986), each of which is incorporated herein by reference in its entirety and specifically for its teaching regarding immunodetection methods. Immunoassays, in their most simple and direct sense, are binding assays involving binding between antibodies and antigen. Many types and formats of immunoassays are known and all are suitable for detecting the disclosed biomarkers. Examples of immunoassays are enzyme linked immunosorbent assays (ELISAs), radioimmunoassays (RIA), radioimmune precipitation assays (RIPA), immunobead capture assays, Western blotting, dot blotting, gel-shift assays, Flow cytometry, protein arrays, multiplexed bead arrays, magnetic capture, in vivo imaging, fluorescence resonance energy transfer (FRET), and fluorescence recovery/localization after photobleaching (FRAP/ FLAP).

[0097] In general, immunoassays involve contacting a sample suspected of containing a molecule of interest (such as the disclosed biomarkers) with an antibody to the molecule of interest or contacting an antibody to a molecule of interest (such as antibodies to the disclosed biomarkers) with a molecule that is bound by the antibody, as the case may be, under conditions effective to allow the formation of immunocomplexes. Contacting a sample with the antibody to the molecule of interest or with the molecule that is bound by an antibody to the molecule of interest under conditions effective and for a period of time sufficient to allow the formation of immune complexes (primary immune complexes) is generally a matter of simply bringing into contact the molecule or antibody and the sample and incubating the mixture for a period of time long enough for the antibodies to form immune complexes with, i.e., to bind to, any molecules (e.g., antigens) present to which the antibodies can bind. In many forms of immunoassay, the sample-antibody composition, such as a tissue section, ELISA plate, dot blot or Western blot, is washed to remove any non-specifically bound antibody species, allowing only those antibodies specifically bound within the primary immune complexes to be detected.

[0098] Immunoassays include methods for detecting or quantifying the amount of a molecule of interest (such as the disclosed biomarkers or their antibodies) in a sample, which methods generally involve the detection or quantitation of any immune complexes formed during the binding process. In general, the detection of immunocomplex formation is achieved through the application of numerous approaches. These methods are generally based upon the detection of a label or marker, such as any radioactive, fluorescent, biological or enzymatic tags or any other known label. See, for example, U.S. Patents 3,817,837; 3,850,752; 3,939,350; 3,996,345;

4,277,437; 4,275, 149 and 4,366,241, each of which is incorporated herein by reference in its entirety and specifically for teachings regarding immunodetection methods and labels.

[0099] As used herein, a label includes a fluorescent dye, a member of a binding pair, such as biotin/streptavidin, a metal (e.g., gold), or an epitope tag that specifically interacts with a molecule to be detected, such as by producing a colored substrate or fluorescence. Substances suitable for detectably labeling proteins include fluorescent dyes (also known herein as fluorochromes and fluorophores) and enzymes that react with colorometric substrates (e.g., horseradish peroxidase). The use of fluorescent dyes is generally used in the practice of the methods described herein as they are detected at very low amounts. Fluorophores are compounds or molecules that luminesce. Typically fluorophores absorb electromagnetic energy at one wavelength and emit electromagnetic energy at a second wavelength. In the case where multiple antigens are reacted with a single array, each antigen is labeled with a distinct fluorescent compound for simultaneous detection. Labeled spots on the array are detected using a fluorimeter, the presence of a signal indicating an antigen bound to a specific antibody.

[0100] Labeling is either direct or indirect. In direct labeling, the detecting antibody (the antibody for the molecule of interest) or detecting molecule (the molecule that is bound by an antibody to the molecule of interest) includes a label. Detection of the label indicates the presence of the detecting antibody or detecting molecule, which in turn indicates the presence of the molecule of interest or of an antibody to the molecule of interest, respectively. In indirect labeling, an additional molecule or moiety is brought into contact with, or generated at the site of, the immunocomplex. For example, a signal-generating molecule or moiety such as an enzyme is attached to or associated with the detecting antibody or detecting molecule. The signal-generating molecule then generates a detectable signal at the site of the immunocomplex. For example, an enzyme, when supplied with suitable substrate, produces a visible or detectable product at the site of the immunocomplex. ELISAs use this type of indirect labeling.

[0101] As another example of indirect labeling, an additional molecule (which is referred to as a binding agent) that can bind to either the molecule of interest or to the antibody (primary antibody) to the molecule of interest, such as a second antibody to the primary antibody, is contacted with the immunocomplex. The additional molecule optionally has a label or signal- generating molecule or moiety. The additional molecule is, for example, an antibody, which is termed a secondary antibody. Binding of a secondary antibody to the primary antibody forms a so-called sandwich with the first (or primary) antibody and the molecule of interest. The immune complexes contacted with the labeled, secondary antibody under conditions effective and for a period of time sufficient to allow the formation of secondary immune complexes. The secondary immune complexes are generally washed to remove any non-specifically bound labeled secondary antibodies, and the remaining label in the secondary immune complexes can then be detected. The additional molecule includes one of a pair of molecules or moieties that can bind to each other, such as the biotin/avidin pair. In this mode, the detecting antibody or detecting molecule includes the other member of the pair.

[0102] Other modes of indirect labeling include the detection of primary immune complexes by a two-step approach. For example, a molecule (which is referred to as a first binding agent), such as an antibody, that has binding affinity for the molecule of interest or corresponding antibody is used to form secondary immune complexes, as described above. After washing, the secondary immune complexes is contacted with another molecule (which is referred to as a second binding agent) that has binding affinity for the first binding agent, again under conditions effective and for a period of time sufficient to allow the formation of immune complexes (thus forming tertiary immune complexes). The second binding agent is linked to a detectable label or signal-generating molecule or moiety, allowing detection of the tertiary immune complexes thus formed. This system provides for signal amplification.

[0103] Immunoassays that involve the detection of as substance, such as a protein or an antibody to a specific protein, include label-free assays, protein separation methods (i.e., electrophoresis), solid support capture assays, or in vivo detection. Label-free assays are generally diagnostic means of determining the presence or absence of a specific protein, or an antibody to a specific protein, in a sample. Protein separation methods are additionally useful for evaluating physical properties of the protein, such as size or net charge. Capture assays are generally more useful for quantitatively evaluating the concentration of a specific protein, or antibody to a specific protein, in a sample. Finally, in vivo detection is useful for evaluating the spatial expression patterns of the substance, i.e., where the substance is found in a subject, tissue or cell. For example, endoscopy can be used in combination with labeled antibodies to detect the biomarkers, i.e., proteins of interest, in vivo.

[0104] Also contemplated are immunoassays wherein the protein or antibody specific for the protein is bound to a solid support (e.g., tube, well, bead, or cell) to capture the antibody or protein of interest, respectively, from a sample, combined with a method of detecting the protein or antibody specific for the protein on the support. Examples of such immunoassays include Radioimmunoassay (RIA), Enzyme-Linked Immunosorbent Assay (ELISA), Flow cytometry, protein array, multiplexed bead assay, and magnetic capture.

[0105] In some examples of the disclosed methods, when the level of a biomarker(s) is assessed, the level is compared with the level of the biomarker(s) in a reference standard. By reference standard is meant the level of a particular biomarker(s) from a sample or subject lacking a cancer, at a selected stage of cancer, or in the absence of a particular variable such as a therapeutic agent. Alternatively, the reference standard comprises a known amount of biomarker. Such a known amount correlates with an average level of subjects lacking a cancer, at a selected stage of cancer, or in the absence of a particular variable such as a therapeutic agent. A reference standard also includes the level of one or more biomarkers from one or more selected samples or subjects as described herein. For example, a reference standard includes an assessment of the level of one or more biomarkers in a sample from a subject that does not have a cancer, is at a selected stage of progression of a cancer, or has not received treatment for a cancer. Another exemplary reference standard includes an assessment of the level of one or more biomarkers in samples taken from multiple subjects that do not have a cancer, are at a selected stage of progression of a cancer, or have not received treatment for a cancer.

[0106] When the reference standard includes the level of one or more biomarkers in a sample or subject in the absence of a therapeutic agent, the control sample or subject is optionally the same sample or subject to be tested before or after treatment with a therapeutic agent or is a selected sample or subject in the absence of the therapeutic agent. Alternatively, a reference standard is an average level calculated from a number of subjects without a particular cancer. A reference standard also includes a known control level or value known in the art. In one aspect of the methods disclosed herein, it is desirable to age-match a reference standard with the subject diagnosed with a cancer.

[0107] Optionally, the methods further include detecting protein biomarkers. In one technique to compare protein levels of expression from two different samples (e.g., a sample from a subject diagnosed with a cancer and a reference standard), each sample is separately subjected to 2D gel electrophoresis. Alternatively, each sample is differently labeled and both samples are loaded onto the same 2D gel. See, e.g., Unlu et al. Electrophoresis, 1997;18:2071-2077, which is incorporated by reference herein for at least its teachings of methods to assess and compare levels of protein expression. The same protein or group of proteins in each sample is identified by the relative position within the pattern of proteins resolved by 2D electrophoresis. The expression levels of one or more proteins in a first sample is then compared to the expression level of the same protein(s) in the second sample, thereby allowing the identification of a protein or group of proteins that is expressed differently between the two samples (e.g., a biomarker). This comparison is made for subjects before and after they are suspected of having a cancer, before and after they begin a therapeutic regimen, and over the course of that regimen. [0108] In another technique, the expression level of one or more proteins is in a single sample as a percentage of total expressed proteins. This assessed level of expression is compared to a preexisting reference standard, thereby allowing for the identification of proteins that are differentially expressed in the sample relative to the reference standard.

[0109] Optionally, the provided methods further comprise detecting circulating tumor cells (CTCs). Methods for detecting circulating tumors cells are known and include flow cytometry, the CellSearch system (Allard et al., Clin Cancer Res. 10(20):6897-6904 (2004), which is incorporated by reference herein in its entirety), high-definition fluorescence scanning microscopy, fiber-optic array scanning technology (FAST), isolation by size of epithelial tumor cells (ISET), and laser scanning cytometers. See, e.g., 6,365,362; 6,645,731 ; 9,127,302; and WO 04076643, which are incorporated by reference herein in their entireties. Biological methods for detecting CTCs are separation methods based on antigen-antibody bindings. Antibodies against tumor specific biomarkers including EpCAM, Her2, PSA can be used. The most common technique is magnetic nanoparticle -based separation (immunomagnetic assay) as used in CellSearch or Magnetic-activated cell sorting (MACS). Other techniques under research include microfluidic separation and combination of immunomagnetic assay and microfluidic separation. Oncolytic viruses such as vacinia viruses have been developed to detect and identify CTCs. Physical methods are often filter-based, enabling the capture of CTCs by size. ScreenCell is a filtration based device that allows sensitive and specific isolation of CTCs from human whole blood (Desitter, et al. Anticancer research 31 (2): 427-442 (2011), which is incorporated by reference herein in its entirety).

[0110] In the claims which follow and in the preceding description of the invention, except where the context requires otherwise due to express language or necessary implication, the word "comprises", or variations such as "comprises" or "comprising" is used in an inclusive sense i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.

[0111] All references, including any patent or patent application, cited in this specification are hereby incorporated by reference. No admission is made that any reference constitutes prior art. Further, no admission is made that any of the prior art constitutes part of the common general knowledge in the art. [0112] Preferred features of each aspect of the provided methods may be as described in connection with any of the other aspects. Other features will become apparent from the following examples. Thus, features, integers, characteristics, compounds or chemical moieties described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein, unless incompatible therewith.

[0113] Moreover, unless stated otherwise, any feature disclosed herein may be replaced by an alternative feature serving the same or a similar purpose. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

Examples

Material and Methods

[0114] Cells. ΕμΜΙ cells were generated by culturing splenocytes of an Εμ-Myc mouse bearing lymphomas in a 75-cm flask (BD Biosciences, Singapore). BC2 cells were as described in Corcoran et al., Journal of immunological methods 228, 131-138, (1999). Yac-1 cells were purchased from ATCC (USA). Cells were cultured in RPMI (Invitrogen, Singapore)

supplemented with 10% FCS (Hyclone, USA), 50 μΜ 2- mercaptoethanol, 100 μΜ asparagine (for BC2 and ΕμΜΙ cells), 2 mM glutamine (Sigma, Singapore) and 1% pen/strep (Invitrogen, Singapore). WT HCT116 and Mus81-/- HCT116 cell lines were as described in Hiyama et al., Nucleic Acids Research 34:880-892 (2006)), and cells were cultured in McCoy (Invitrogen, Singapore) supplemented with 10% FCS (Hyclone, USA). All cells were treated with Plasmocin (Invivogen, USA) to treat potential mycoplasma.

[0115] Reagents. Cytosine-D-arabinofuranoside hydrochloride (Ara-C) and DMSO were purchased from Sigma (Singapore). Aphidicolin was purchased from Calbiochem (Singapore).

[0116] Microscopy. Suspension cells were washed with PBS and spun onto slides (Biomedia, Singapore) with Shandon single cytofunnel and Shandon filter cards (Thermo, Singapore) at 700 rpm for 3 minutes using Shandon Cytospin 4 (Thermo, Singapore). For double-stranded DNA (dsDNA) stainings, some cells were pretreated with 100 U/ml DNase (Sigma, Singapore) for 1 hour at 37°C. For single-stranded DNA (ssDNA) stainings, some cells were incubated with 1000 U/ml SI nuclease (Fermentas, USA) for 1 hour at 37°C. After washing with PBS, cells were stained with ssDNA- (clone F7-26, Millipore, Singapore) or dsDNA- (MAB1293, Millipore, Singapore) specific antibodies, followed by anti-mouse IgG coupled to Cy3 (AP124C, Millipore, Singapore), or anti-mouse IgM coupled to Cy3 (AP128C, Millipore, Singapore) antibodies. Cells were mounted in Dako fluorescent mounting medium (Dako, UK) containing 0.5 μg/ml of the DNA fluorochrome DAPI. For S9.6 staining, cell were fixed in 3.7% paraformaldehyde for 10 minutes followed by permeabilization in 0.2% Triton-X/PBS for another 10 minutes. After washing in PBS, cells were treated without or with 2 mg/ml RNase A for 1 hour at 37°C.

Washed slides were stained with Cox IV-specific (Abeam) antibodies, followed by anti-Rabbit IgG-dylight 488 (Jackson ImmunoResearch, USA), S9.6 antibody (Gift from Clinton E. Leysath NIH, USA) and anti-mouse IgGCy3 (Millipore) sequentially. Cells were mounted in mounting medium containing 0.5 μg/ml DAPI. Thiazole orange staining was done as described in reference (Lubitz et al., Cell 134:587-598 (2010)). Images were taken on an Olympus FV1000 confocal scanning microscope (Olympus, Japan). Pictures were further analyzed using Photoshop CS5 (Adobe, USA), Metamorph (Metamorph NX, Molecular Devices, USA) or Imaris X64 (Version 6.1.5, Bitplane, USA). Surface rendering of 3D Z-stacks were done with 'threshold levels' set in respective experiments based on DNase I treated slides and slides of cells stained in the absence of primary antibodies.

[0117] For fluorescence in situ hybridization, a modified protocol described in Janes et al., J. Histochem. Cytochem. 52: 1011-1018 (2004) was used. Briefly, cytospins were prepared and cells were fixed in 4% paraformaldehyde for 10 minutes at room temperature. After fixation, cells were washed twice in PBS and permeabilized in 0.2% Triton X- 100 for 10 minutes at room temperature. Cells were washed twice in PBS before treatment with 0.1 mg/ml DNase I-free RNase A (Sigma- Aldrich) for 90 minutes at 37°C followed by washing twice in PBS. Biotin-14- dCTP (Invitrogen, Singapore) was incorporated into DNA fragments by using standard Taq polymerase (NEB, Singapore) supplemented with 200 μΜ of each dATP, dGTP, dTTP, 40 μΜ dCTP and 160 μΜ biotin-14-dCTP. 2.5 ng/μΐ biotinylated cloned DNA probes were dissolved in hybridization buffer (0.2% BSA, 2 x sodium citrate buffer, 10% dextran sulfate, 50% formamide with 0.5 μg/μl competitor salmon sperm DNA (Invitrogen, Singapore)) and denatured by heating at 65 °C for 10 minutes and then briefly transferred to ice. Meanwhile slides were denatured in a solution of pre-warmed 70% formamide/2 x SSC in 79°C water bath for 2.5 minutes and probes were spotted immediately on the denatured cell pellet. Slides were overlaid and sealed with one piece of parafilm (Sigma, Singapore), then left to hybridize overnight at 37°C in a dark and humidified hybridization oven (Labnet, Singapore). Next day slides were rinsed in descending concentrations of SSC at 37°C. After washing the slides were equilibrated in 4 x SSC for 1-2 minutes. Slides were incubated with streptavidin-HRP conjugate (Invitrogen, Singapore) and signals were amplified by using TSA Plus Cyanine 3 System as instructed by the manufacturer (Perkin Elmer, Singapore). Finally, samples were rinsed in PBS, counterstained with 0.5 μg/ml DAPI for 10 minutes, washed once in PBS and mounted in fluorescence mounting medium (Dako, Singapore).

[0118] Cloning of Cytosolic DNA Cytosolic fraction of cells was purified as described in Stetson et al., Cell 134:587-598 (2008). For dsDNA cloning, purified cytosolic DNA was treated with DNA polymerase I, Large (Klenow) fragment (1 U^ig DNA; NEB, USA) supplemented with 33 μΜ of each dNTP to blunt DNA. Blunted DNA fragments were precipitated by adding 1/10 volume of 3 M sodium acetate (pH 5.2) and 2.5 volumes of 100% ethanol followed by incubation at -70°C for 30 minutes and centrifugation for 15 minutes at 12 x 103 rpm in a bench- top centrifuge. The pellet was washed with 70% ethanol and air-dried. 3 ' -A-overhangs were added to DNA fragments by using standard Taq polymerase (NEB, USA). dsDNA fragments were cloned into pCR4-TOPO vector according to the manufacturer's instructions (Invitrogen, Singapore). Cytosolic ssDNA was cloned as described in Stetson et al., Cell 134:587-598 (2008). Insert sequences were mapped to the mouse genome using the BLASTN search function of Ensembl (http://www.ensembl.org; Release 46) for which the RepeatMasker option was deselected. Sequences were separately analyzed for presence of endogenous retroelements using the RepeatMasker program (http://www.repeatmasker.org, open-3.3.0 version). Blast Analysis of Cloned Cytosolic DNA Nucleotide blast (Blastn) function located on the Ensembl website was implemented to search for sequences in the mouse genome with high similarity as the cloned cytosolic DNA. Cloned cytosolic DNA was input as query sequence, which was blasted against the mouse (Mus musculus) genome based on GRCm38.pl genome assembly released on January 2012 (http://www.ensembl.Org/Mus_musculus/Info/Annotation/#assemb ly). Repeat Masker filter was unchecked to ensure that the alignment process of cloned cytosolic DNA against mouse genome is not compromised as most of the cytosolic DNA contains repetitive sequence. Analysis for Putative Transcription Start Site and Putative Terminator Genomic sequences flanking cytosolic DNA to be analyzed were obtained from the Ensembl mouse genome database (http://www.ensembl.org/index.html). Promoter 2.0 prediction server

(http://www.cbs.dtu.dk/services/Promoter/) was chosen to predict putative transcription start site (TSS) at the 3' genomic sequences flanking cytosolic DNA. It basically searches for putative transcription start site of vertebrate polymerase II promoters by implementing principles that are common to neural networks and genetic algorithms. Another web-based tool named ARNold (http://rna.igmors.u-psud.fr/toolbox/arnold/index.php) was chosen to detect putative Rho- independent terminators in 5' genomic DNA sequences flanking cytosolic DNA. For analysis of structural and physical properties of DNA, DNAlive (b !E^I Ilbj^ was used, which was specially designed for the analysis of structural and physical characteristics of genomic DNA based on the primary structure of nucleotide sequence. DNAlive only accepts genomic coordinates from the mm9 mouse genome assembly, an earlier version, which was established in July 2007. The genomic coordinates of the cytosolic DNA sequence in the mouse genome have to be determined in the UCSC genome browser by performing blat search against the mm9 assembly on the UCSC website (http://genome.ucsc.edu/cgi-bin/hgBlat). BLAT is an alignment algorithm that incorporates the same principle as BLAST, with lower sensitivity but faster speed. The resulting blat hits were verified with the blast hits to make sure that they are located at the same chromosomes and have identical neighboring sequences. An additional feature is that DNAlive provides is that it also extends its analysis to a three dimensional graphical view on the genome.

[0119] Statistical analyses. Intensity calculations of cytosolic stainings were done by Metamorph (Metamorph NX, Molecular Devices, USA) by deducting nucleus staining using logical operations. Calculations were based on at least 100 cells and 4 different areas.

Statistically significant differences in intensity quantification between cells are indicated (*p<0.05, ** p<0.01).

Example 1

[0120] Recently, evidence was provided that cytosolic DNA including ssDNA, dsDNA and RNA:DNA hybrids are present in all tested mouse and human cancer cells lines (Figure 1; Lam et al., Cancer Research, 74(8): 1-11 (2014); and Shen et al., Cell Reports 11, 460^173 (2015)). Cloning of cytosolic DNA from different mouse lymphoma cells showed that cytosolic DNA is derived from unique genomic loci, which often contain retroelements and have the potential to form non-B DNA structures. Replication and transcription of DNA requires the transient separation of complementary dsDNA strands allowing the separated ssDNA to assume non-B DNA structures (Figure 2).

[0121] Oncogene-induced replication stress and transcriptional RNA:DNA hybrids can provoke stalling of DNA replication forks leading to the accumulation of separated ssDNA at the replication fork in tumor cells. Stalled replication forks are resolved by structure-specific endonucleases and associated DNA repair processes, which have also been implicated in the processing of non-B DNA structures. The data provided herein show that the presence of cytosolic DNA depends on structure specific-nucleases. Consistent with the conclusion that cytosolic DNA is generated by cancer-specific processes, cytosolic DNA was present in mouse B-cell lymphoma, human chronic lymphocytic leukemia (CLL) and stage II prostate

adenocarcinoma samples, but not healthy tissue. Furthermore, cytosolic DNA was only detected in freshly derived T cells or fibroblasts after treatment with replication fork inhibitors (Shen et al., Cell Reports 11, 460^-73 (2015)). Strikingly, the experiments suggest that cytosolic DNA is secreted by tumor cells as free DNA and DNA in micro vesicles. Tumor cells were shown to secrete various microvesicles that are distinct from exosomes and apoptotic bodies.

Microvesicles are plasma-membrane-derived particles that are released into the extracellular space by outward budding and fission of the plasma membrane. Their size ranges from 200 nm to 1 μπι in diameter, while exosomes range from 50 nm to 80 nm. Interestingly, a large body of evidence has shown that microvesicles contain nucleic acids including retroelements, mRNAs, miRNAs, noncoding RNAs, and genomic DNA. LINE-1, HERV-K, and Alu retroelements were also detected in microvesicles, some of which were also found in cloned cytosolic DNA. The levels of secreted microvesicles correlate with tumor cell invasiveness and disease progression. In contrast, healthy cells have not been reported to secrete microvesicles. In summary, cytosolic DNA and cytosol-derived serum DNA may have key advantages over current cancer markers. First, activation of oncogenes is thought to be one of the initial changes in cancer cells. Cytosolic DNA is therefore expected to be present at early stages of cancer development. Second various oncogenes induce replication stress and stalling of replication forks. Hence, cytosolic DNA is anticipated to be present in many cancer types. Cytosolic DNA is secreted in microvesicles by tumor cells. For that reason, cytosolic DNA might be present in the serum of cancer patients.

Example 2

[0122] It was previously found that ssDNA and dsDNA are constitutively present in the cytosol of the mouse lymphoma cell line Yac-1 and Εμ-Myc B-cell lymphomas (Figure 3; Lam et al., Cancer Research, 74(8): 1-11 (2014); and Shen et al., Cell Reports 11, 460^173 (2015)). To extend these observations to human cancer cell lines, the human lung carcinoma cell line A549, the acute monocytic leukemia cell line THPl, and the lung fibroblast cell line MRC5 was stained for the presence of cytosolic ssDNA and dsDNA using specific antibodies (Figure 3). Previously established were the specificity of the antibodies by different means. The specificity control of cytosolic DNA staining is shown in Figures 18A-18D. Staining of cells with the vital dsDNA- specific dye PicoGreen confirmed the antibody staining data. Similar to Yac-1 cells and Εμ-Myc lymphomas, ssDNA and dsDNA were constitutively present in the cytosol of the tested human cell lines (Figure 3). To test if ssDNA and dsDNA are present in mitochondria, cells were co- stained with the mitochondrial marker cytochrome c oxidase subunit IV (COX IV). Three- dimensional iso-surface rendering of confocal images showed that a majority of the extranuclear DNA is present outside of mitochondria (Figure 3). In contrast to tumor cells, no cytosolic ssDNA or dsDNA was present in primary fibroblasts and T cells (Figure 4). However, treatment of fibroblasts or ConA-activated T cells with the replication fork inhibitor Ara-C induced the presence of cytosolic DNA consistent with conclusion that stalling of replication forks and associated DNA damage induces the presence of cytosolic DNA. Ara-C did not induce the presence of cytosolic DNA in naive T cells possibly because proliferation is required for Ara-C responsiveness.

Example 3

[0123] To determine the origin of cytosolic DNA, cytosolic ssDNA and dsDNA was cloned from primary Εμ-Myc B-cell lymphomas and Ara-C-treated BC2 cells, a B-cell lymphoma cell line derived from Εμ-Myc mice (Shen et al., Cell Reports 11, 460^173 (2015)). DNA in cytosolic fractions showed a length distribution consistent with DNA wrapped around nucleosome core particles (Figure 5A). No long genomic DNA fragments were detected in gel electrophoresis of cytosolic DNA fractions. Failure to amplify genomic loci by PCR using primers specific for Gapdh and Hprt suggested that the purified fractions were largely free of genomic DNA. A total of 234 dsDNA sequences (SEQ ID NOs: 1-234) were cloned from Ara-C- treated BC2 cells and tumor cells present in Εμ-Myc mice (Figure 5B). The length of the cloned sequences varied from 18 base pairs (bp) to 1128 bp (Figure 5B). Comparison of the cloned DNA sequences to the mouse genome database showed that all the clones from Ara-C-treated BC2 cells and 98.2% of the clones from tumors of Εμ-Myc mice were derived from unique loci on the mouse genome.

[0124] To characterize the origin and nature of cytosolic ssDNA, a cloning method was adopted for ssDNA described by Stetson et al., Cell 134:587-598 (2008). Twenty-four (24) different ssDNA sequences from Ara-C-treated BC2 cells and Yac- 1 cells, but were unable to clone ssDNA from tumors of Εμ-Myc mice (Figure 5C). In contrast to dsDNA clones, ssDNA sequences were shorter, ranging from 14 to 59 base pairs (Figure 5C) as shown in SEQ ID NOs:235-248. 88.8% of ssDNA clones derived from Ara-C-treated BC2 cells and 57.1% derived from Yac- 1 cells matched unique sequences in the mouse genome. The remaining ssDNA sequences aligned with several sequences in the mouse genome. In summary, the data indicate that at least a fraction of cytosolic DNA is derived from genomic DNA loci in the tested lymphoma cells.

[0125] Analysis of the cloned DNA by RepeatMasker, a programme that screens DNA sequences for interspersed repeats and low complexity elements, showed that 58.9% of dsDNA clones derived from tumor cells of Εμ-Myc mice and 35.6% of dsDNA clones derived from BC2 cells contain retroelements close to the average percentage of 41.2% retroelements in the mouse genome (Figure 5D). Analysis of the cloned dsDNA sequences showed the presence of most major classes of retrotransposons including short interspersed nuclear elements (SINEs), long interspersed nuclear elements (LINEs) and long terminal repeats (LTRs), although none of the clones contained functional retroelements (Figure 5D). Satellites, small RNA and ERV class III were enriched in clones derived from tumors present in Εμ-Myc mice. Line L3 and to a lesser degree ERV class I, TcMar-Tigger and satellites were more abundant in cloned sequences derived from Ara-C-treated BC2 cells. In contrast, no SINE ID, SINE MIR, LINE2, L3 ERV class I and DNA elements were found in clones derived from Εμ-Myc mice, while small RNA sequences, simple repeats and ERV class III elements were underrepresented in dsDNA clones derived from Ara-C-treated BC2 cells. In contrast, no retro-elements, interspersed repeats or low complexity elements were found in the ssDNA clones derived from BC2 cells or Yac-1 cells possibly due to their short size. Deviation from the average presence of retroelements in the mouse genome within the cloned sequences is consistent with the conclusion that cytosolic fraction used for cloning were not contaminated with genomic DNA.

Example 4

[0126] To test whether the cloned DNA sequences have the potential to form non-canonical DNA structures, the sequences for non-B DNA motifs were analyzed using on-line tools. Non-B- DNA structures include G-quadruplex, Z-DNA, cruciforms, triplex and different types of repeats. Analysis of cytosolic dsDNA sequences from Εμ-Myc tumors revealed that 32.2% of the clones were predicted to contain stretches capable of forming non-B DNA structures (Figure 5E). The percentage increased to 98.2% of clones when 500 bp around the genomic loci were included. Similarly 60% of sequences derived from Ara-C-treated BC2 cells potentially contained non-B DNA structures and 98.9% when 500 bp around the genomic loci were considered. For ssDNA clones, non-B DNA forming sequences were found within 500 bp of all ssDNA clones derived from Yac- 1 cells and Ara-C-treated BC2 cells. Putative triplex DNA- forming stretches were present in 5.36% of the clones from tumors of Εμ-Myc mice and 29% when 500 bp of the surrounding genomic loci were included in the analysis (Figures 5E and 5F). In clones derived from Ara-C-treated BC2 cells, 16% of the sequences contained a putative triplex DNA forming sequence and 52% of clones when 500 bp around the genomic loci of the clones were considered (Figures 5E and 5F). Triplex DNA can form when ssDNA folds during replication or between nascent RNA transcripts and DNA template (RNA:DNA hybrids, also called R-loops) (Figure 2). If triplex DNA is not processed properly, unscheduled

recombinogenic events and genome rearrangements can arise in cells. Interestingly, around 50% of dsDNA sequences cloned from Ara-C-treated BC2 cells and tumors of Εμ-Myc mice localized to intragenic genomic sequences that are potentially transcribed in lymphoma cells. Figure 5G is a schematic of a representative sequenced dsDNA clone purified from the cytosolic fraction of Ara-C-treated BC2 cells (Bold letters (SEQ ID NO:54)) is shown in the genomic context (SEQ ID NO:249). The predicted triplex sequence according to the web-based triplex search tool at http://helix.fi.muni.cz/triplex/www/ is shown as SEQ ID NO:250) and putative triplex DNA structures are indicated below the dsDNA clone. Figure 5H are images showing B220+ B-cell lymphomas arising in Εμ-Myc mice were stained for RNA:DNA hybrids using the RNA:DNA- specific antibody S9.6 in the presence of DAPI. To further investigate if RNA:DNA hybrids are present in the cytosol of tumor cells, cells were stained using the RNA:DNA hybrid-specific S9.6 antibody. S9.6 staining of colorectal carcinoma cell lines LoVo, HCT 116, HT29, the lung carcinoma cell line A549, the SV40 transformed kidney cell line HEK293T, the acute monocytic leukemia (AML) cell line THP- 1 , the promyelocytic leukemia cell line HL-60 and the Hodgkin lymphoma L-540 showed the presence of RNA:DNA hybrids in the cytosol (Figure 6A). As RNA:DNA hybrids can also form during replication of mitochondrial DNA20, we co-stained cells with the mitochondria-specific marker COX IV. Three-dimensional iso-surface rendering of confocal images showed that the majority of RNA:DNA hybrids are localized outside of mitochondria (Figure 6B).

[0127] To test if cytosolic DNA is present in samples of cancer patients, chronic lymphocytic leukemia (CLL) and stage II prostate adenocarcinoma were stained for dsDNA. Strikingly, cytosolic dsDNA was detected in purified blood B220+ cells of two CLL patients, but not healthy donors (Figure 7A). Moreover, cytosolic DNA was also present in stage II prostate adenocarcinomas (Figure 7B). In contrast, no cytosolic DNA was observed in healthy prostate tissue. The results highlight that cytosolic DNA is specific for cancer and is useful as a diagnostic marker for cancer including CLL and prostate cancer.

Example 5

[0128] Time-lapse microscopy of HeLa cells using PicoGreen, a vital dye specific for dsDNA and RNA:DNA hybrids, suggested that cytosolic DNA is secreted in vesicles (Figure 8A and B). Monensin was shown to increase the release of exosomes and vesicles. Treatment of HeLa cells with Monensin for 4 hours induced the accumulation of cytosolic DNA at the cell surface, while leading to a depletion of DNA in the cytosol consistent with the conclusion that cytosolic DNA is secreted (Figure 8C).

Example 6. DNA structure-specific endonuclease MUS81 mediates STING-dependent host rejection of prostate cancer cells

METHODS [0129] Mice. 7-8 week old male C57BL/6 wild-type mice were purchased from In Vivos (Singapore). Male Ifnaf ^1' and Ifngf ^1' C57BL/6 mice were kindly provided by Dr. L. Renia (Singapore Immunology Network (SIgN), Singapore) and Dr. D.M. Kemeny (NUS, Singapore), respectively. Mice were housed according to the IACUC guidelines of National University of Singapore (021/12).

[0130] Cell lines. The TRAMP-C2 prostate cancer cell line was kindly provided by Dr. D. H. Raulet (University of California, Berkeley, USA). TRAMP-C2 cells were derived from the transgenic adenocarcinoma mouse prostate (TRAMP) model which specifically expresses SV40 large T-antigen in prostate epithelial cells (Hurwitz, Curr. Protoc. Immunol., Chapter 20, Unit 20-25, "The TRAMP mouse as a model for prostate cancer"). The human prostate cell lines DU145 and PC-3 were provided by Dr. R.E. Chee (SIgN, Singapore). Wild-type (WT) and Mus8r' ^~ SV-40 immortalized MEFs were a generous gift from Dr. A. Hakem (University of Toronto, Canada). Cells were cultured either in DMEM (Invitrogen) supplemented with 10% heat-inactivated fetal calf serum (FCS, Hyclone) and 1% pen/strep (Invitrogen), or RPMI (Invitrogen) supplemented with 10% FCS, 50 μΜ 2-mercaptoethanol, 100 μΜ asparagine, 2 mM glutamine (Sigma) and 1% pen/strep. All cells were grown at 37°C in a humidified 5% C0 ₂ incubator (Thermo Scientific).

[0131] Reagents and constructs. Murine Mus81 cDNA (#BC026560) was purchased from Open Biosystems (Thermo Scientific) and cloned into a retroviral MSCV 2.2 construct containing IRES-GFP (MSCV-GFP) using Not\ (3' site) and Xhol (5' site) restriction enzymes (New England Biolabs). Murine Mus81 -specific shRNA (Accession No. NM_027877) and negative control GIPZ lentiviral constructs were purchased from Open Biosystems. Retroviral supernatants were generated as previously described(Diefenback and Raulet, Curr. Opin.

Immunol. 15:37-44 (2003)). Two days post-transduction, GFP ⁺ cell within the top 10% of fluorescence intensity were sorted using a MoFlo apparatus (Beckman Coulter) or the transduced cells were selected using 10 μg/ml puromycin (Sigma). A total of 20 nM negative control (sicOOl-lnmol), or human MUS81 (SASI_Hs_00146003 and SASI_Hs_00146004) siRNAs were used for transfection.

[0132] CRISPR-Caspase9. Target cells were transfected in a 10 mm tissue culture dish using 30 μΐ TransFectin (Bio-Rad) and 12 μg Cas9 plasmid (#48138 Addgene) together with 12 μg U6- pgRNA vector (#44248 Addgene) or Sting U6-pgRNA vector targeting Sting exon 3

(GTTAAATGTTGCCCACGGGCTGG (SEQ ID NO:251)). After 24 hours, GFP ⁺ cells within the top 2% of fluorescence intensity were isolated by cell sorting. Individual clones were seeded into wells of a 96-well plate and STING deficiency was verified by immunoblotting, sequencing and functional assays.

[0133] Immunofluorescence and immunohistochemistry. Cytosolic dsDNA staining was performed as described previously using anti-dsDNA antibodies and PicoGreen (Invitrogen) reagents of verified specificity(Shen, et al., Cell Rep. 11:460-473 (2015), Lam, Cancer Research 74:2193-2203 (2014)). Frozen prostate cancer, breast cancer, colorectal cancer, astrocytoma, melanoma, CLL and healthy tissue sections were obtained from Origene or Singapore General Hospital (IRB # 2011/826/B). Paraffin-embedded prostate, breast, colorectal, and endometrium cancer tissue sections were obtained from the Singapore General Hospital (IRB # 2011/826/B). Sections were rehydrated in PBS for 2 hours and blocked using 5% goat serum and 0.5% BSA in PBS for 1 hour before staining. For MUS81 staining, slides were rehydrated and fixed with PFA for 20 minutes. Slides were blocked in 1% BSA and 2% goat serum for 1 hour before incubation with mouse monoclonal anti-MUS81 antibodies (MTA30 2G10/3, Santa Cruz) for 16 hours at 4°C followed by goat anti-mouse IgG coupled to Cy3 (Jackson ImmunoResearch).

[0134] pAT ₂₅ tetA. The pAT ₂ stetA plasmid was as described in Giraud-Panis, The EMBO Journal, 16:2528-2534 (1997). Mus81 ^~ ' ^~ MEFs were co-transfected with 12 μg pAT ₂₅ tetA plasmid or empty vector control along with 12 μg of pBabe-puro plasmid (#1764 Addgene). After 48 hours, the cells were selected with 5 μg/ml puromycin. Integration of pAT ₂ stetA into genomic DNA was verified by PCR using the primers pAT ₂₅ tetA-5': cggctccagatttatcagca (SEQ ID NO:266); pAT ₂₅ tetA-3': tcccggcaacaattaataga (SEQ ID NO:267). The thermo-cycling parameters were 94°C (2 min) and 30 cycles of 94°C (30 s), 63°C (30 s), 72°C (1 min) and finally 72°C (10 min). Stably-transfected cells were transduced 3 weeks later using retrovirus encoding either Mus81 or empty vector.

[0135] The FISH protocol was modified from Bayani et /.(Bayani and Squire, Current Protocols in cell biology, Ed. Bonifacino et al., Fluorescence in situ hybridization (FISH), Chapter 22, Unit 22-24). Briefly, cells were grown on coverslips and fixed with 4% PFA followed by permeabilization with 0.1% Triton-X for 10 minutes. The coverslips were then treated with 0.1 mg/ml RNase at 37°C for 90 min, washed twice with PBS, equilibrated in 2x saline-sodium citrate (SSC) buffer, and incubated in 75°C formamide in a water bath for 2.5 minutes. After further washing with 2x SSC, the coverslips were blocked using the avidin/biotin blocking kit (SP-2001) according to the manufacturer's instructions (Vector Laboratories).

pAT ₂₅ tetA and GFP DNA probes were prepared by nick translation according to the procedure described in Bayani et al.( Bayani and Squire, Current Protocols in cell biology, Ed. Bonifacino et al., Fluorescence in situ hybridization (FISH), Chapter 22, Unit 22-24). Labelled DNA probes were denatured at 75°C for 5 minutes and annealed at 37°C for 1 hour. Coverslips were incubated with 200 ng probe in PBS (or PBS-only control) at 37°C for 24 hours and then washed with 50% formamide in 2x SSC at 45°C. The secondary antibody was labelled using Alexa Fluor 546 tyramide signal amplification kit with streptavidin HRP conjugate according to the manufacturer's instructions (Life Technologies). Coverslips were stained and mounted onto slides using DAPI mounting medium. Slide analysis was conducted using an Olympus FV1000 confocal microscope.

[0136] BrdU experiments. Prostate cancer cells were incubated for 75 minutes with 10 μΜ BrdU (BD Pharmingen). Staining was performed according to the manufacturer's instructions (clone BU-1, Millipore). Slides were prepared using DAPI mounting medium and then viewed using an Olympus FV1000 confocal microscope.

[0137] Western blotting. Whole cell extracts were separated in sodium dodecyl sulfate polyacrylamide electrophoresis gels (8, 10 or 12%) and then blotted onto nitrocellulose membranes (Millipore). Antibodies specific for phospho-IRF3 (serine 396) (4D4G), IRF3 (D83B9), STING, GAPDH (Cell Signaling Technology), MUS81 (Abeam) and horseradish peroxidase-coupled second-stage reagents (Thermo) were used to develop the blots, which were then exposed on x-ray film (Fuji).

[0138] Real-Time PCR. Total RNA was isolated using the nucleospin RNA II kit according to the manufacturer's instructions (Macharey Nagel) and reverse transcribed using M-MLV Reverse Transcriptase with random hexamers (Promega). The total reaction volume was 25 μΐ and contained reverse transcribed RNA, 0.2 μΜ forward primer, 0.2 μΜ reverse primer and 12.5 μΐ iTaq SYBR Green Supermix with ROX (Bio-Rad). Triplicate PCR reactions were performed using an ABI PRISM 7700 Sequence Detection System (Applied Biosystems). The thermocycling parameters were 50°C (2 min), 95°C (3 min) followed by 40 cycles of 95°C (15 s), 60°C (30 s) and 72°C (45 s). Samples were normalized to the signal generated by the housekeeping gene Hprt. The primers used were: Hprt-5': tgggaggccatcacattgt (SEQ ID

NO:252); Hprt-V : gcttttccagtttcactaatgaca (SEQ ID NO:253); Mus81-5': gaaaccctggcctgccctcc (SEQ ID NO:254); Mus81-3': gccatcgtgccgagtgctca (SEQ ID NO:255); Ifna4-5':

agtgaccagcatctacaagacc (SEQ ID NO:256); Ifiia4-3': gaggcaggtcacatcctagag (SEQ ID NO:257); Ifnb-5': aatttctccagcactgggtg (SEQ ID NO:258); Ifnb-3': tctcccacgtcaatctttcc (SEQ ID NO:259); Cc/2-5' gtccctgtcatgcttctgg (SEQ ID NO:260) and Cc/2-3' gcgttaactgcatctggct (SEQ ID

NO:261). hMUS81-y -. caaagaccccgctctcgaat (SEQ ID NO:262); hMUS81-T :

gcagcgccttctgaaatacg (SEQ ID NO:263); hGAPDH-5 ': gagtcaacggatttggtcgt (SEQ ID NO:264) and hGAPDH-3 ': gacaagcttcccgttctcag (SEQ ID NO:265). Samples prepared without RNA were used as negative controls.

[0139] Short-term rejection assays. For blocking of type I IFN receptors in vivo, mice were injected i.p. with 500 μg antibody against IFNAR1 (clone MAR1-5A3, BD Biosciences) or an isotype control. For NK cell depletion, mice were injected i.p. with 500 μg antibody against NK1.1 (PK136, ATCC) or an isotype control. For depletion of macrophages, mice were injected i.p. with 2 mg/ml clodronate liposomes or PBS-loaded control liposomes

(ClodronateLiposomes.com). The following day, GIPZ-transduced and Mus81 shRNA- transduced TRAMP-C2 cells were labelled with either 2 μΜ PKH-26 (Sigma Aldrich) or 10 μΜ CellTrace Violet (Life Technologies) according to the manufacturer's instructions. A total of 6 ^χ 10 ⁶ labelled TRAMP-C2 cells (GIPZ-transduced and Mus81 shRNA-transduced cells in a 1 : 1 ratio) were administered via the i.p. route in a 400 μΐ total volume of PBS. The mice were sacrificed 24 hours later, the peritoneum flushed with PBS, and the exudate analyzed by flow cytometry to quantify PKH-26 and CellTrace Violet positive cells.

[0140] Bone marrow-derived macrophages (BMDMs). Bone marrow was harvested from 7- 8 week old male C57BL/6 mice and monocytes were differentiated into macrophages by culture for 7 days in RPMI medium containing 10% macrophage colony stimulating factor (M-CSF) containing supernatant of L929 cells (ATCC).

[0141] In vitro phagocytosis assay. The phagocytosis assay was modified from that previously described in Majeti et a/. (Majeti, Cell 138:286-299 (2009)). Briefly, 2 x 10 ⁴ PKH-26- labelled TRAMP-C2 cells (transduced with either control or Mus81 -specific shRNA) were co- cultured with 5 x 10 ⁴ BMDMs for 2 hours, then washed three times with DMEM, and fixed in 4% PFA for 10 minutes. Covershps were blocked using 1% BSA in PBS and then stained with an anti-mouse CD68 antibody (FA-11, Biolegend) followed by Alexa Fluor 647 -conjugated goat anti-rat IgG antibodies (Jackson ImmunoResearch) in the presence of DAPI. The covershps were then mounted onto microscope slides and analyzed using an Olympus FV1000 confocal microscope. The number of macrophages positive for CD68 and PKH-26 was counted and quantified using ImageJ (n>200). Alternatively, 2 x 10 ⁴ PKH-26-labelled TRAMP-C2 cells (transduced with control shRNA) and 2 x 10 ⁴ CellTrace Violet-labelled TRAMP-C2 cells (transduced with Mus81 shRNA) were combined in a 1 : 1 ratio and added to 10 x 10 ⁴ macrophages and incubated for 2 hours. Cells were then stained with anti-mouse F4/80-APC (BM8, eBioscience) on ice for 30 minutes and washed three times with media before analysis using a BD LSRFortessa apparatus (BD Biosciences).

[0142] Gene Set Enrichment Analysis (GSEA). Gene-level RNA-seq expression data from the provisional TCGA prostate cancer dataset was obtained from the TCGA data portal

(https://tcga-data.nci.nih.gov/tcga/). A subset of samples with available Gleason Score and pathologic T and N information was used for further analysis (n=497). Expression values were loaded into the R statistical environment (http://www.r-project.org) and differential expression analysis was performed using an empirical Bayes t-test from the Limma package (Subramanian, PNAS 102: 15545-15550 (2005)). A list of genes ranked by differential expression was then loaded into the GSEA tool. Enrichment analysis for sets of genes positively regulated by human IFN-β (>2-fold) in fibroblasts and endothelial cells (Rusinova et al., NAR 41 :D1040-1046 (2013)) was performed.

[0143] Statistical analysis. P values were determined using Student's t-tests, ANOVA or Pearson correlation coefficient analysis as appropriate (Prism 6f, Graphpad).

Materials and Methods for Figures 14-17

[0144] Cell lines. BC2 cells were a generous gift from Dr. L.M. Corcoran (Walter and Eliza Hall Institute of Medical Research, Australia). [0145] Reagents and constructs. Cytosine β-D-arabinofuranoside hydrochloride (Ara-C), hydroxyurea (HU) and DMSO were purchased from Sigma Aldrich. The PARP inhibitor NU1025, the ATR inhibitor VE-821 and aphidicolin (APH) were purchased from Calbiochem (USA). All drugs were dissolved in DMSO and added for 16 hours total treatment duration. Final drug concentrations were; 10 μΜ for Ara-C and NU1025, 2 μΜ for VE-821, 10 mM for HU, and 4 μΜ for aphidicolin.

[0146] Cell cycle analysis. TRAMP-C2 cells were labelled with 10 μΜ BrdU for 75 minutes. BrdU incorporation and 7-AAD staining were assessed by flow cytometry according to the manufacturer's protocol (BD Pharmingen).

[0147] Flow cytometry. Peritoneal exudates were stained on ice for 30 minutes with the following specific antibodies; CD45-APC (30-F11), CD49b-APC (DX5), NKl.l-PerCP-Cy5.5 (PK136), CD8a-APC-eFluor 780 (53-6.7), F4/80-PE-Cy7 (BM8), GRl-eFluor 450 (RB6-8C5), Y5TCR-PE (eBioscience), IFNy-FITC (XMG1.2) (all from BD Biosciences), CD3-BV605 (17A2), and CD107a-FITC (1D4B) (Biolegend). Apoptotic cells were stained using the Annexin V-APC kit (BD Bioscience) according to the manufacturer's instructions. All stained samples were analyzed using a BD LSR Fortessa instrument and FlowJo 8.8.6 software (Treestar, USA).

[0148] ELISA. A total of 1.5 x 106 transduced cells were cultured for 24 hours in a 24-well plate. IFN-β levels in the supernatants were determined by duplicate ELISA measurement according to the manufacturer's protocol (PBL interferon source).

Results

[0149] Recognition of self-nucleic acids by the innate immune system plays a key role in host protection against infections and cancers(Barbalat, et al., Annual Review of Immunology, 29: 185-214 (2011), Woo, et al., Immunity, 41 :830-842 (2014), Ahn, et al., Nature

Communications, 5:5166 (2014), Zhu, et al., Journal of Immunology, 193:4779-4782 (2014), Deng, et al., Immunity, 41 :843-852 (2014)). Self-DNA is present in the cytosol of many cancer cells and can promote effective tumor rejection(Shen, et al., Cell Rep. 11:460-473 (2015)), but the mechanisms that generate cytosolic DNA in tumor cells and initiate protective host responses are largely unknown. It is reported herein that cleavage of genomic DNA by the DNA structure- specific endonuclease MUS81 (Methyl methansulfonate, UV-sensitive clone 81) leads to the accumulation of cytosolic DNA in prostate cancer cells. MUS81 has previously been shown to play a role in DNA repair and expression of fragile sites (Minocherhomji and Hickson, Trends Cell Biol. 24:321-327 (2014)). As described herein, the number of nuclear MUS81 foci correlates with the levels of cytosolic DNA detected in different stages of human prostate cancer. Cytosolic DNA generated by MUS81 stimulated STING-dependent type I interferon (IFN) expression and promoted phagocytic host responses, resulting in type I II IFN-mediated rejection of prostate tumor cells via mechanisms that partly depended on macrophages. The results demonstrate that the DNA structure-specific endonuclease MUS81 alerts the immune system to the presence of transformed host cells.

[0150] Prostate cancer is a leading cause of cancer-related death among men (Nelson, et al., N. Engl. J. Med. 349:366-381 (2003)). Immune detection of malignant cells is a critical component of host protection against prostate adenocarcinomas and numerous other types of cancer (Raulet and Guerra, Nature Reviews. Immunology, 9:568-580 (2009)). However, the mechanisms that initiate protective anti-tumor immune responses in body tissues are not fully understood. A common feature of transformed cells is the accumulation of double-stranded DNA (dsDNA) in the cytosol (Shen, et al., Cell Rep. 11:460-473 (2015)). Here, it was observed that labelling of mouse or human prostate cancer cells with antibodies against dsDNA or with the dsDNA- specific dye PicoGreen reliably revealed the presence of dsDNA in the cytosol of prostate cancer cells (Figs. 13A and 13B). Immune detection of pathogen-derived DNA is known to be an important mediator of host protection against infections (Barbalat, et al., Annual Review of Immunology, 29: 185-214 (2011)), but the effects of tumor-derived DNA on anti-cancer immune responses remain poorly defined. It was therefore aimed to uncover the mechanisms that drive the presence of cytosolic DNA in prostate cancer cells and to determine the effects of cytosolic DNA on immune rejection of tumor cells. Following a pulse of BrdU labelling, a progressive accumulation of BrdU-containing DNA was detected in the cytosol of prostate cancer cells (Fig. 9A and Fig. 13C) strongly suggesting that the cytosolic DNA was derived from genomic DNA. Inhibition of the DNA damage response or PARP (poly (ADP-ribose) polymerase)-dependent DNA repair mechanisms reduced the appearance of cytosolic dsDNA in prostate cancer cells (Figs. 13D and 13E) (Shen, et al., Cell Rep. 11 :460-473 (2015), Lam et al., Cancer Research 74:2193-2203 (2014)). Since stalled replication forks activate PARP 1 and the DNA damage response (Bryant, et al., The EMBO Journal, 28:2601-2615 (2009)), these findings suggested that the repair of stalled replication forks promotes dsDNA accumulation in the cytosol of tumor cells. Accordingly, exposure to various different replication fork inhibitors with distinct mechanisms of action increased tumor cell accumulation of cytosolic dsDNA (Fig. 13F) (Shen, et al., Cell Rep. 1 1 :460-473 (2015), Lam et al., Cancer Research 74:2193-2203 (2014)). In summary, these data indicated that genomic DNA repair can lead to the presence of cytosolic DNA in prostate cancer cells.

[0151] The DNA structure-specific endonuclease MUS81 suppresses chromosomal instability arising from stalled replication forks by cleaving potentially detrimental DNA structures (Hanada, et al., Nat. Struct. Mol. Biol. 14: 1096-1 104 (2007), Kai, et al., Genes & Development, 19:919-932 (2005), Shimura et al., J. Mol. Biol. 375: 1152-1 164 (2008), and Osman and Whitby, DNA Repair (Amst), 6: 1004-1017 (2007)). It was therefore hypothesized that MUS81 might be involved in the shedding of genomic DNA into the cytosol in transformed host cells. Consistent with this possibility, genetic inhibition of Mus81 using either shRNAs or siRNAs (Fig. 13G) abrogated cytosolic dsDNA in different prostate cancer cells (Fig. 9B). Mus81 was also critically required for the presence of cytosolic dsDNA in SV40 large T-antigen immortalized mouse embryonic fibroblasts (MEFs) (Fig. 9C). Furthermore, restoration of Mus81 expression was sufficient to induce the accumulation of cytosolic dsDNA in Mus8V' ^~ MEFs (Fig. 9C and Fig. 13H), and overexpression of Mus81 in a B-cell lymphoma cell line led to a corresponding increase in levels of cytosolic DNA (Fig. 131). To confirm that cleavage of genomic MUS81 substrates leads to the accumulation of cytosolic dsDNA, Mus81 ^' MEFs were stably transfected with the plasmid pAT ₂₅ tetA which forms cruciform structures in vitro (Giraud-Panis, The EMBO Journal, 16:2528-2534 ( 1997)). Cruciform structures are known to be cleaved by MUS81 in vivo (Cote and Lewis, Molecular Cell 31 :800-812 (2008)). After transfection, genomic pAT ₂₅ tetA DNA was absent from the cytosol of Mus81 ^' MEFs except when these cells were transduced with a Mus81 -expressing retrovirus (Fig. 9D). No pAT ₂₅ tetA-derived DNA was observed in Mus8r cells transduced with a control plasmid or stained with a control DNA probe (Fig. 9D and Fig. 13J). Thus, the data suggest that cleavage of genomic DNA by MUS81 contributes to the accumulation of cytosolic dsDNA in prostate cancer cells.

[0152] To determine whether cytosolic dsDNA was present in primary human prostate cancers and other types of tumor, the levels of MUS81 and dsDNA were assessed in tissue sections obtained from patients diagnosed with prostate adenocarcinoma, breast cancer, colorectal cancer, melanoma, endometrial cancer, astrocytoma and chronic lymphocytic leukemia. Nuclear MUS81 foci and cytosolic dsDNA were detected in most of the cancer tissues tested here, but not in healthy tissues obtained from the same patients (collected from sites remote from the tumor), or in tissue obtained from cancer-free patients (Fig. 10A, and Fig. 14A-14C). Labelling of consecutive cryostat sections from individual patients with varying stages of prostate cancer revealed that the number of nuclear MUS81 foci and the levels of cytosolic dsDNA increased in tandem from hyperplasia to clinical stage II (Fig. 10B). Intriguingly, the number of nuclear MUS81 foci detected and the levels of cytosolic dsDNA present in prostate cancer tissues at clinical stage III decreased to levels found in healthy and hyperplastic tissues (Fig. 10B), suggesting that reduction of MUS 81 -generated dsDNA in the cytosol could be associated with disease progression. While incompatible labelling protocols prevented co-staining of the same tissue sections, these data indicated that the frequency of nuclear MUS81 foci correlated with the levels of cytosolic dsDNA in human prostate cancer tissues (Fig. 14D; Pearson's coefficient r=0.7323, p<0.0001).

[0153] Recognition of dsDNA by cytosolic sensors stimulates STING (stimulator of IFN genes)-dependent activation of IRF3 (interferon regulator factor 3) (Cai, et al., Molecular Cell, 54:289-296 (2014)). Accordingly, it was observed that shRNA-mediated silencing of Mus81 in TRAMP-C2 cells led to a corresponding reduction in phosphorylation of IRF3 and transcript levels of IRF3 target genes (Figs. 11A and 1 IB). A similar effect of Mus81 deficiency on the activation of IRF3 was also observed in MEFs (Fig. 1 1C and 1 ID). To analyze the role of STING in the Mus81 -mediated activation of IRF3 target genes, the CRISPR-Cas9 system was used to delete STING expression in TRAMP-C2 cells and MEFs before assessing their gene expression profiles (Fig. 15). STING deletion did not alter the levels of dsDNA present in either TRAMP-C2 cells (Fig. 1 IE), or Mus8V' ^~ MEFs transduced with a Mus81 -expressing retrovirus (Fig. 1 IF), but did significantly disrupt the expression of IRF3 target genes in both cell types (Figs. 11G and 11H). These data suggested that STING-dependent DNA sensing pathways recognize Mus81 -generated cytosolic DNA. To investigate whether cytosolic DNA induces the production of type I IFNs in human prostate cancer, we next performed a gene set enrichment analysis (GSEA) of stage II and III prostate adenocarcinoma samples. This approach revealed that IFN-β target genes were enriched among the genes upregulated in stage II prostate adenocarcinoma samples relative to stage III (Fig. 1 II; NES=1.5; FDR=0), consistent with the levels of cytosolic DNA detected at these different cancer stages (Fig. 10B).

[0154] Short-term rejection assays were performed to investigate the effects of Mus81 -induced DNA sensing on the immunogenicity of syngeneic TRAMP-C2 tumor cells in vivo. To do this, TRAMP-C2 cells were transduced with shRNA directed against Mus81 or with a control shRNA. The transduced cells were differentially labelled and co-administered at a 1 : 1 ratio via intraperitoneal injection into C57BL/6 mice (Fig. 12A). This 1 : 1 ratio of tumor cell types was maintained in culture, indicating that wsSi-specific shRNA or labelling did not alter intrinsic rates of apoptosis or cell cycle distribution relative to control shRNA-transduced TRAMP-C2 cells (Figs. 16A-16D). However, when the balance of differentially labelled TRAMP-C2 cells recovered from the mouse peritoneal cavity 24 hours after injection was assessed, significantly higher numbers of Mus81 -silenced cells than control shRNA-transduced cells was attained (Fig. 12B; p=0.0007). To examine whether this preferential rejection of Mus81 -sufficient TRAMP-C2 cells in vivo depended on type I IFNs, these assays were repeated in both Ifnaf ^1' and Ifnar ^+I+ C57BL/6 mice. The survival advantage exhibited by Mus81 -silenced tumor cells in vivo was markedly reduced in Ifnaf ^1' C57BL/6 mice compared with Ifnar ^+I+ animals (Fig. 12B, p<0.05). Administration of blocking antibodies against IFNAR1 exerted similar effects (Fig. 12C;

p<0.05), thus demonstrating that type I IFNs contribute to Mus81 -dependent rejection of

TRAMP-C2 tumor cells in vivo.

[0155] Consistent with previous reports, injection of TRAMP-C2 cells into C57BL/6 mice resulted in increased frequencies of IFN-γ ^" NK cells (+12%), IFN-γ ^" CD8a ⁺ T cells (+15%) and CD 107a ⁺ γδ T cells (+32%) compared with a PBS-only control injection (Figs. 16E and 16G) (Nowak, et al., PloS one 5:el l311 (2010), Martini, et al., Vaccine, 28:3548-3557 (2010)). To study the role of IFN-γ in the Mus81 -dependent rejection of TRAMP-C2 cells, the balance of differentially labelled TRAMP-C2 cells recovered 24 hours after injection of Mus81 -silenced and control shRNA-transduced cells into Ifngf ^1' or Ifngr ^+I+ C57BL/6 mice was analyzed. The preferential rejection of Mus81 -sufficient TRAMP-C2 cells was abrogated in Ifngf ^1' C57BL/6 mice (Fig. 12D), thus indicating that host cell production of IFN-γ is critical for Mus81 -mediated tumor rejection. NK cells are major producers of IFN-γ (Vivier, et al., Science, 331 :44-49 (2011)) and have been implicated in the elimination of tumor cells in the TRAMP cancer model (Guerra, et al., Immunity, 28:571-580 (2008)). However, depletion of host NK cells prior to TRAMP-C2 cell injection failed to alter the balance of cancer cell types recovered from the 24- hour rejection assays (Fig. 12E and Fig. 16H). These data indicated that the preferential killing of wsSi-sufficient tumor cells in vivo is due to IFN-γ produced by lymphocyte populations other than NK cells. IFN-γ regulates the activation of macrophages, which can mediate potent cytotoxic killing of tumor cells (Allavena, et al., Immunological Reviews 222: 155-161 (2008)). The role of macrophages was analyzed in our rejection model by using clodronate-loaded liposomes to deplete phagocytic cells including macrophages prior to tumor cell injection (Fig. 161) (Miselis, et al., Mol. Cancer Ther. 7:788-799 (2008)). When compared with injection of PBS-loaded control liposomes, administration of clodronate-containing liposomes impaired the preferential rejection of Mus81 -sufficient TRAMP-C2 cells in vivo (Fig. 12F, p<0.001).

Accordingly, when bone-marrow-derived macrophages (BMDMs) were co-cultured with Mus81 or control shRNA-transduced TRAMP-C2 cells in vitro, it was observed that BMDMs phagocytosed Mus81 -sufficient tumor cells more efficiently than Mus81- silenced tumor cells (Fig. 12G, p<0.03).

[0156] Since Mus81 induces STING-dependent type I interferon expression, the requirement for STING-dependent DNA sensing in the IFN-mediated rejection of Mus81 -expressing tumors in vivo was confirmed. STING ^CRISPR TRAMP-C2 cells were rejected less efficiently than STING ^Ctrl TRAMP-C2 cells in short-term rejection assays using a balance of STING ^CRISPR and STING ^Ctrl TRAMP-C2 cells. (Fig. 12H, p=0.0072). Furthermore, STING deficiency also decreased the rate of tumor cell phagocytosis (Fig. 121, p<0.001). These data indicated that Mus81 mediates immune rejection of TRAMP-C2 cells at least in part via STING-dependent DNA sensor pathways.

[0157] Taken together, the data presented in this report suggest that cytosolic DNA is a distinctive feature of prostate cancer cells (and potentially also other tumor cell types) that can promote efficient immune recognition and host rejection of these cells in vivo. The rejection mechanisms depended on the DNA structure-specific endonuclease MUS81, which was previously reported to preserve genome integrity by cleaving aberrant DNA structures at sites of stalled replication forks(Hanada, et al., Nat. Struct. Mol. Biol. 14: 1096-1104 (2007), Kai, et al., Genes & Development, 19:919-932 (2005), Shimura et al., J. Mol. Biol. 375: 1 152-1164 (2008), and Osman and Whitby, DNA Repair (Amst), 6: 1004-1017 (2007)). Oncogene-induced replication stress can lead to the arrest of replication forks in tumor cells (Macheret and

Halazonetis, Annual Review of Pathology, 10:425-448 (2015), Gaillard, et al., Nature Reviews. Cancer, 15:276-289 (2015)). The cleavage of genomic DNA at sites of stalled replication forks by MUS 81 and the subsequent sensing of shed genomic DNA may therefore mediate immune recognition and host rejection of tumor cells. Consistent with this concept, the majority of cytosolic DNA clones derived from lymphoma cells were predicted to form DNA structures that can arrest replication forks (Shen, et al., Cell Rep. 11 :460-473 (2015)). Further studies will be required to firmly establish a link between oncogene-induced replication stress and the generation of cytosolic DNA by MUS81.

[0158] Recent studies have provided evidence that DNA-mediated activation of STING and type I IFN expression are critical components of anti-cancer immune responses, but the source of the activating DNA that drives this response has remained unclear (Woo, et al., Immunity, 41 :830-842 (2014), Ohkuri, et al., Cancer Immunology Research 2(12): 1199-208 (2014), Dunn, et al., Nature Immunology, 6:722-729 (2005)). The findings now suggest that MUS 81 -mediated generation of cytosolic DNA can activate STING-dependent DNA sensor pathways that induce pro-phagocytic and possibly other immunomodulatory signals in prostate cancer cells (Fig. 17). Furthermore, since type I Ifii transcript levels were reduced more potently by genetic inhibition of Mus81 than by deletion of STING, it is possible that MUS 81 -mediated generation of cytosolic DNA also activates other dsDNA sensors such as DHX36, DHX9 and TLR9.

[0159] Reliable molecular markers for the detection and prognosis of prostate cancers are not currently available (Chang, et al., Nature Reviews. Clinical Oncology 1 1 :308-323 (2014)). It was found that nuclear MUS 81 foci and cytosolic DNA were present in early prostate cancer tissues and levels correlated with disease severity in human prostate cancer patients. Hence, these features may represent clinically useful biomarkers for the detection and grading of cancers. These data also suggest that the efficacy of conventional chemotherapies that activate MUS 81 may rely in part on the activation of cytosolic DNA sensing pathways. Application of these findings to the rational design of new treatment regimens may lead to the development of more effective therapies. These new approaches might include combinations of MUS 81 -activating drugs and novel agents that can activate DNA sensor pathways, thus potentially increasing host rejection of cancer cells while reducing overall toxicity.