The present invention relates to an isolated or synthetic nucleic acid from microsporidia, a complementary nucleic acid, an isolated polypeptide encoded by the nucleic acid, an isolated antibody that specifically binds to a polypeptide encoded by the nucleic acid or polypeptide, an immunogenic composition comprising a microsporidian nucleic acid, related treatments, diagnostics, methods for testing an agent for the prevention and/or treatment of a

microsporidian infection, and kits for screening for a microsporidian infection in an animal. In particular embodiments, the microsporidia are from the species Tetramicra brevifilum and/or the animal is a fish, particularly lumpfish.

Cleaner fish species are used as a biological control method for the parasitic copepod Lepeophtheirus salmonis (Krayer) and are widely used as part of an integrated pest management control programme. Sea lice, L. salmonis and Caligus spp, are the most widespread pathogenic marine parasite in the Atlantic salmon (Salmo salar, L.) farming industry and those with the greatest economic impact. Sea lice treatments are a significant cost to the industry, may have an impact on the local environment and can negatively influence the public perception of aquaculture. Furthermore, tolerance has developed in some lice populations to specific medicines.

The acquisition and stocking of wild-caught wrasse species has been reported to cost less than one medical treatment. To ensure sustainability and biosecurity, the long-term aim is to provide the salmon farming industry with farmed, certified specific pathogen-free cleaner fish to take pressure off wild stocks and avoid potential disease transmission to the salmon.

Lumpfish {Cyclopterus lumpus, L.) have proven an effective alternative to wrasse species, with the advantage of being resistant to and effective at low water temperatures. In Ireland, lumpfish aquaculture is developing. However, at present the salmon farming industry largely relies on the use of wild-caught wrasse as cleaner fish. Infectious diseases are currently one of the biggest challenges and have caused high levels of mortality. Several pathogens have been described in lumpfish, including atypical Aeromonas salmonicida, Pasteurella spp., Vibrio anguillarum, Vibrio ordali, Tenacibaculum maritinum, Kudoa islandica, Myxobolus albi, Nucleospora cyclopteri and Neoparamoeba perurans. Microsporidians are intracellular parasites common in teleosts, with some species causing severe disease in their host species. To date, Nucleospora cyclopteri is the only

microsporidian parasite reported in Atlantic lumpfish. Nucleospora cyclopteri is an intranuclear microsporidian in lymphocytes and lymphocyte precursor cells that was found to be common in wild lumpfish along the Icelandic coast, and has been described in lumpfish in sea pens in Norway. A microsporidian species causing chronic mortalities in a recirculation facility in Canada, not fully characterized at the time, was likely also N. cyclopteri. A limited number of genera and species of microsporidia are known to infect fish. This poses a technical challenge requiring the use of a combination of analyses to describe new isolates.

The present invention relates to a novel infection of aquatic animals by a microsporidian, in particular Tetramicra brevifilum (Matthews et al, 1980, Journal of Fish Diseases 3 : 495-515). There is a need for reagents and methods for the diagnosis, prevention and/or treatment of such infections.

Accordingly, a first aspect of the invention provides an isolated or synthetic nucleic acid having a sequence selected from the group consisting of SEQ ID NOs: 9, 13 and 1-8, homologues thereof or a sequence having at least about 60%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 99.5% sequence identity to any of SEQ ID NOs: 9, 13 and 1-8.

Amongst other things, these nucleic acid sequences may be useful for expression of microsporidia-encoded proteins or fragments, variants, or derivatives thereof, generation of antibodies against microsporidia proteins, generation of primers and probes for detecting microsporidia and/or for diagnosing microsporidia infection, generating immunogenic compositions against microsporidia, and screening for drugs effective against microsporidia. "Identity" in the context of two or more nucleic acids or polypeptide sequences, refers to the percentage of nucleotides or amino acids that two or more sequences or subsequences contain which are the same. A specified percentage of nucleotides can be referred to such as: 60% identity, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more identity over a specified region, when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using a sequence comparison algorithms known to the skilled person or by manual alignment and visual inspection. Preferably, identity is assessed over regions of contiguous nucleic acids or polypeptides two or more sequences or subsequences.

Encompassed by the invention are polynucleotide sequences that are capable of hybridizing to the claimed polynucleotide sequences, including any of the nucleic acid sequences disclosed herein, and fragments thereof under various conditions of stringency

Polynucleotides homologous to the sequences described herein, can be identified, e.g., by hybridization to each other under stringent or under highly stringent conditions. The term "nucleic acid hybridization" refers to anti-parallel hydrogen bonding between two single- stranded nucleic acids, in which A pairs with T (or U if an RNA nucleic acid) and C pairs with G. Nucleic acid molecules are "hybridizable" to each other when at least one strand of one nucleic acid molecule can form hydrogen bonds with the complementary bases of another nucleic acid molecule under defined stringency conditions. The stringency of a hybridization reflects the degree of sequence identity of the nucleic acids involved, such that the higher the stringency, the more similar are the two polynucleotide strands. Stringency of hybridization is determined, e.g., by (i) the temperature at which hybridization and/or washing is performed, and (ii) the ionic strength and (iii) concentration of denaturants such as formamide in the hybridization and washing solutions, as well as other parameters.

Hybridization requires that the two strands contain substantially complementary sequences. Depending on the stringency of hybridization, however, some degree of mismatches may be tolerated. Under "low stringency" conditions, a greater percentage of mismatches are tolerable (i.e., will not prevent formation of an anti-parallel hybrid). Hybridization conditions for various stringencies are known in the art and are disclosed in detail in at least Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, 3rd Ed, Cold Spring Harbor

Laboratory Press: Cold Spring Harbor, N.Y. In embodiments of the invention, the nucleic acid has a sequence comprising at least 5, at least 7, at least 10, at least 15, at least 18, at least 19, at least 20, at least 21, at least 25, at least 50, at least 100, at least 250, at least 500, at least 600, at least 700, or at least 800 consecutive nucleotides having a sequence selected from the group consisting of SEQ ID NOs: 9, 13 and 1-8.

In embodiments of the invention, the nucleic acid is complementary to a sequence selected from the group consisting of SEQ ID NOs: 9, 13, 10-12, 14 and 1-8, homologues thereof or a sequence having at least about 60%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 99.5% sequence identity to any of SEQ ID NOs: 9, 13, 10-12, 14 and 1-8. In embodiments of the invention, the sequence comprises at least 5, at least 7, at least 10, at least 15, at least 18, at least 19, at least 20, at least 21, at least 25, at least 50, at least 100, at least 250, at least 500, at least 600, at least 700, or at least 800 consecutive nucleotides having a complementary sequence to a sequence selected from the group consisting of SEQ ID NOs: 9, 13, 10-12, 14 and 1-8.

In embodiments of the invention, the isolated nucleic acid of the invention is DNA, cDNA, RNA, or a combination of two or more thereof.

In embodiments of the invention, the nucleotide sequence has an additional sequence at the 5' - and/or 3 '-end that would not be found in that position relative to the sequence found in nature. In embodiments of the invention, each or the additional sequence comprises 1 or more, 2 or more, 3 or more, 5 or more, 6 or more nucleotides. In embodiments of the invention, this sequence is not TAA, RAG or TGA, and/or the complimentary sequences thereof.

A second aspect of the invention provides an isolated polypeptide encoded by the nucleic acid of the invention.

It will be understood that, for the particular microsporidian polypeptides described here, natural variations can exist between individual microsporidian strains. These variations may be demonstrated by (an) amino acid difference(s) in the overall sequence or by deletions, substitutions, insertions, inversions or additions of (an) amino acid(s) in said sequence. Amino acid substitutions which do not essentially alter biological and immunological activities, have been described, e.g. by Neurath et al. (1979) in The Proteins, Academic Press New York. Amino acid replacements between related amino acids or replacements which have occurred frequently in evolution are, for example, Ser/Ala, Ser/Gly, Asp/Gly, Asp/Asn, Ile/Val (see Dayhof, M. D. (1978), Atlas of protein sequence and structure, Nat. Biomed. Res. Found., Washington D.C., vol. 5, suppl. 3). Other amino acid substitutions include Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/ Val, Thr/Phe, Ala/Pro, Lys/Arg, Leu/Ile, Leu/Val and Ala/ Glu. Based on this information, Lipman and Pearson developed a method for rapid and sensitive protein comparison (Science, 1985, 227: 1435) and determining the functional similarity between homologous proteins. Such amino acid substitutions of the exemplary embodiments of this invention, as well as variations having deletions and/or insertions are within the scope of the invention as long as the resulting proteins retain their immune reactivity. It is know that polypeptide sequences having one or more amino acid sequence variations as compared to a reference polypeptide may still be useful for generating antibodies that bind the reference polypeptide.

These polypeptides may be useful for multiple applications, including, but not limited to, generation of antibodies and generation of immunogenic compositions. A peptide of at least 8 amino acid residues in length can be recognized by an antibody (MacKenzie et al., 1984, Biochemistry 23 : 6544-6549). In certain embodiments, the invention is directed to fragments of the polypeptides described herein, which can, for example, be used to generate antibodies.

In embodiments of the invention, the isolated polypeptide comprises at least 5, at least 6, at least 7, or at least 8, or at least 9, or at least 10, at least 15, at least 20, at least 30, at least 50, at least 100, at least 150, at least 200, at least 250, or at least 260 amino acids.

In embodiments of the invention, the isolated polypeptide is a recombinant protein.

A third aspect of the invention provides, an isolated antibody that specifically binds to a polypeptide encoded by the nucleic acid having a sequence selected from the group consisting of SEQ ID NOs: 9, 13 and 1-8, fragments and variants thereof.

The antibodies may be chimeric (i.e., a combination of sequences from more than one species, for example, a chimeric mouse-human immunoglobulin). Species specific antibodies avoid certain of the problems associated with antibodies that possess variable and/or constant regions from other species. The presence of such protein sequences from other species can lead to the rapid clearance of the antibodies or can lead to the generation of an immune response against the antibody by an antibody.

An antibody described in this application can include or be derived from any mammal, such as but not limited to, a bird, a dog, a human, a mouse, a rabbit, a rat, a rodent, a primate, or any combination thereof and includes isolated avian, human, primate, rodent, mammalian, chimeric, humanized and/or CDR-grafted or CDR-adapted antibodies, immunoglobulins, cleavage products and other portions and variants thereof.

Any method known in the art for producing antibodies can be used to generate the antibodies described herein. Exemplary methods include animal inoculation, phage display, transgenic mouse technology and hybridoma technology.

The antibodies of the present invention can be used to modulate the activity of any polypeptide of the invention, variants or fragments thereof. In certain embodiments, the invention is directed to a method for treating an animal, the method comprising administering to the animal an antibody of the invention.

In embodiments of the invention, the antibody of the invention may interfere or inhibit the function of the polypeptide, thus providing a method to inhibit pathogen propagation and spreading. In other embodiments, the antibody does not interfere or inhibit the function of the polypeptide.

In embodiments of the invention, the antibodies of the invention can be used to purify a polypeptide of the invention. In other embodiments, the antibodies of the invention can be used to identify expression and localization of the polypeptide of the invention. In embodiments of the invention, the antibodies of the invention can be used to analyse the expression and localization of a polypeptide of the invention, which may be useful in determining potential role of the polypeptide. In other embodiments, the antibodies of the present invention can be used in various immunoassays to identify animals exposed to and/or samples that comprise polypeptides, in particular antigens, from microsporidians. Any suitable immunoassay which can lead to formation of polypeptide-antibody complex can also be used. For example, suitable methods known in the art include ELISA, lateral flow assays for detection of analytes in samples and immunoprecipitation. In various

embodiments, the polypeptide and/or the antibody can be labelled by any suitable label or method known in the art. For example, enzymatic immunoassays may use solid supports, or immunoprecipitation. Immnunoassays which amplify the signal from the polypeptide- antibody immune complex can also be used.

Thus, in embodiments of the invention, the isolated antibody a binds to a microsporidian, preferably a Tetramicra brevifilum. Typically, the antibody binds to a microsporidian polypeptide, preferably or a Tetramicra brevifilum polypeptide.

In embodiments of the invention, the isolated antibody inhibits, neutralizes or reduces the function or activity of the microsporidian, microsporidian polypeptide, Tetramicra brevifilum or the Tetramicra brevifilum polypeptide.

In embodiments of the invention, the antibody is a polyclonal antibody, or a monoclonal antibody. In embodiments of the invention, the antibody is purified.

A fourth aspect of the invention provides an immunogenic composition comprising a microsporidian nucleic acid, preferably a Tetramicra brevifilum nucleic acid.

The immunogenic compositions are capable of inducing an immune response against a microsporidia. The immunogenic composition comprising a nucleic acid is administered to the animal, and the immunogenic proteins or peptides encoded by the nucleic acid are expressed in the animal, such that an immune response against the proteins or peptides is generated in the animal. To make the nucleic acid immunogenic compositions of the invention, nucleic acid sequences of the invention may be incorporated into a plasmid or expression vector containing the nucleic acid. Any suitable plasmid or expression vector capable of driving expression of the protein or peptide in the animal may be used. Such plasmids and expression vectors should include a suitable promoter for directing transcription of the nucleic acid. The nucleic acid sequence(s) that encodes the protein or peptide may also be incorporated into a suitable recombinant virus for administration to the animal. Examples of suitable viruses include, but are not limited to, vaccinia viruses, retroviruses, adenoviruses and adeno-associated viruses. The skilled person could readily select a suitable plasmid, expression vector, or recombinant virus for delivery of the nucleic acid sequences of the invention.

In embodiments of the invention, the nucleic acid of the immunogenic composition comprises the nucleic acid having the sequence as defined in the first aspect of the invention.

A fifth aspect of the invention provides an immunogenic composition comprising a microsporidian polypeptide, preferably a Tetramicra brevifilum polypeptide.

To produce the immunogenic compositions comprising a polypeptide of the invention, nucleic acid sequences of the invention are delivered to cultured cells, for example by transfecting cultured cells with plasmids or expression vectors containing the nucleic acid sequences, or by infecting cultured cells with recombinant viruses containing the nucleic acid sequences. The polypeptides of the invention may then be expressed in the cultured cells and purified. The purified proteins can then be incorporated into compositions suitable for administration to animals. Methods and techniques for expression and purification of recombinant proteins are well known in the art, and any such suitable methods may be used.

In embodiments of the invention, the polypeptide of the immunogenic composition is as defined in the second aspect of the invention.

In embodiments of the invention, the immunogenic composition further comprises at least one excipient, additive or adjuvant. In embodiments of the invention, the immunogenic composition further comprises at least one other polypeptide.

In embodiments of the invention, the at least one other polypeptide is selected from the group consisting of: one or more polypeptides from a different micro-organism; one or more polypeptides from the same micro-organism; and one or more promiscuous T-cell epitopes.

In embodiments of the invention, the polypeptides of the immunogenic composition are in admixture, or form a fusion protein.

A sixth aspect of the invention provides the nucleic acid as defined in the first aspect of the invention, the polypeptide as defined in the second aspect of the invention, the antibody as defined in the third aspect of the invention, or the immunogenic composition as defined in the fourth or fourth aspect of the invention for use in the treatment of an animal.

In embodiments of the invention, the nucleic acid, the polypeptide, the antibody, or the immunogenic composition for use according to the invention induces an immune response in the animal. In embodiments of the invention, the nucleic acid, the polypeptide, the antibody, or the immunogenic composition for use according to the invention prevents or reduces a microsporidian infection in the animal. The microsporidian infection may be a Tetramicra brevifilum infection. In embodiments of the invention, the nucleic acid, the polypeptide, the antibody, or the immunogenic composition for use according to the invention is administered orally, by immersion or by injection. The animal may be an aquatic animal, in particular, a fish. In embodiments of the invention, the animal is a lumpfish (Cyclopterus lumpus, L ). A seventh aspect of the invention provides a method of inducing an immune response in an animal, the method comprising administering the nucleic acid as defined in the first aspect of the invention, the polypeptide acid as defined in the second aspect of the invention, the antibody as defined in the third aspect of the invention, or the immunogenic composition acid as defined in the fourth or fifth aspect of the invention.

In embodiments of the invention, the method prevents or reduces a microsporidian infection in the animal. The microsporidian infection may be a Tetramicra brevifilum infection.

In embodiments of the invention, the administration is orally, by immersion or by injection. The animal may be an aquatic animal, in particular, a fish. In embodiments of the invention, the animal is a lumpfish (Cyclopterus lumpus, L ).

An eighth aspect of the invention provides an oligonucleotide probe comprising an isolated or synthetic nucleic acid complementary to a sequence selected from the group consisting of SEQ ID NOs: 1-9, 13 and 14, or a sequence having at least about 60%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 99.5% sequence identity to any of SEQ ID NOs: 1-9, 13 and 14.

In embodiments of the invention, the sequence comprises at least 5, at least 7, at least 10, at least 15 consecutive nucleotides having a complementary sequence to a sequence selected from the group consisting of SEQ ID NOs: 1-9, 13 and 14.

In embodiments of the invention, the nucleic acid is DNA, cDNA, RNA, or a combination of two or more thereof.

A ninth aspect of the invention provides a method for determining the presence or absence of a microsporidian infection, preferably a Tetramicra brevifilum infection, in a biological sample, the method comprising: a) contacting nucleic acid from the biological sample with one or more primers having a sequence selected from the group consisting of SEQ ID NOs: 1-9 and 13, homologues thereof or a sequence having at least about 60%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 99.5%) sequence identity to any of SEQ ID NOs: 1-9, 13 and 14; b) subjecting the nucleic acid and the primer to amplification conditions; and c) determining the presence or absence of amplification product, wherein the presence of amplification product indicates the presence of nucleic acid associated with the microsporidian infection in the sample. In embodiments of the invention, the one or more primer sequences comprise at least 5, at least 7, at least 10, at least 15 consecutive nucleotides having a sequence selected from the group consisting of SEQ ID NOs: 1-9 and 13.

In embodiments of the invention, the one or more primers sequences are selected from the group consisting of SEQ ID NOs: 1-8.

A tenth aspect of the invention provides a method for determining the presence or absence of a microsporidian infection, preferably a Tetramicra brevifilum infection, in a biological sample, the method comprising: a) contacting a biological sample with an antibody defined in the third aspect of the invention; and b) determining whether or not the antibody binds to an antigen in the biological sample, wherein binding indicates the presence of the

microsporidian infection in the biological sample.

An eleventh aspect of the invention provides a method for determining the presence or absence of a microsporidian infection, preferably a Tetramicra brevifilum infection, in a biological sample, the method comprising determining whether a biological sample contains antibodies that specifically bind to a polypeptide defined in the second aspect of the invention.

A twelfth aspect of the invention provides a method of testing an agent for the prevention and/or treatment of a microsporidian infection, preferably a Tetramicra brevifilum infection, comprising: a) contacting cells with the agent; b) contacting cells with microsporidia, preferably Tetramicra brevifilum; and c) measuring the number of cells infected with microsporidia, wherein if the number of cells infected with the microsporidia is decreased as a result of contact with the agent, the agent is a preventative and/or therapeutic agent for microsporidian infection. In embodiments of the invention, steps a) and b) are reversed. A thirteenth aspect of the inventions provides a kit for screening for a microsporidian infection, preferably a Tetramicra brevifilum infection, comprising: a) one or more primers having a sequence selected from the group consisting of SEQ ID NOs: 1-9 and 13, homologues thereof or a sequence having at least about 60%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 99.5% sequence identity to any of SEQ ID NOs: 1-9 and 13; and optionally b) primers or adapters suitable to enable sequencing of the amplified nucleic acid and determination of the presence of the microsporidia.

In embodiments of the invention, the one or more primer sequences comprise at least 5, at least 7, at least 10, at least 15 consecutive nucleotides having a sequence selected from the group consisting of SEQ ID NOs: 1-9 and 13. The present invention will now be described by way of example with reference to the accompanying drawings in which:

Figure 1 shows a lumpfish (C. lumpus) infected with T. brevifilum. (a) Dissection showing nodules in skeletal muscle and on visceral organs. Note external cysts, material in eye and remnants of ascitic fluid. The measure indicates centimetres, (b) Exophthalmus and external parasitic cysts, (c) Heavily encysted liver, (d) Large composite cyst on peduncle. The rule indicates centimetres;

Figure 2 shows the histology of C. lumpus infected with T. brevifilum in which the sample was stained with haematoxylin and eosin (H + E). (a) Multiple and partly confluent (circle) cysts containing xenomas in the liver, (b) Xenomas in the choroid of the eye (arrow). Note multiple space occupying xenomas in the retrobulbar muscle (x). Note the absence of inflammatory host response in all cases, (c) Large xenoma within cyst in dermis (x) and multiple xenomas in the skeletal muscle, (d) Microvillous xenoma surface (arrow) in muscle tissue;

Figure 3 shows transmission electron microscopy of T. brevifilum in C. lumpus liver (a, b) and spores in fresh smear (c). (a) Spore showing five coils of polar filament (arrows), posterior vacuole (Pv), electron dense inclusion bodies (E), nucleus (Nu), polaroplast (P), anchor disc (Ad), (b) Sporoblast with large electron dense inclusion body (E), offset nucleus (Nu) with small inclusion body and paracrystalline pattern of polyribosomes around polar filament (arrow), (c) Spores in a fresh smear from ascetic fluid demonstrating characteristic posterior vacuole with inclusion; Figure 4a and 4b form a table showing the percentage of nucleotide identity obtained by pairwise comparison of the small subunit rRNA microsporidia sequences used in the phylogenetic analysis;

Figure 5 shows a parsimony tree showing phylogenetic relations between fish -infecting microsporidia (group 4) based on nucleotide sequence comparisons of the small subunit rRNA gene. Percentages of bootstrap values are given at each node. Branch lengths are informative and drawn to scale. Nucleospora cyclopteri sequence was included as outgroup; and

Figure 6 shows a consensus tree obtained by Bayesian inference analysis using the small subunit rRNA sequences from the fish -infecting microsporidia included in the study. The value at each node indicates posterior probability. Lumpfish samples are underlined.

Examples

Example 1 - Fish population Wild-caught lumpfish juveniles were collected in south-west Ireland between July and August 2014, weighing on average 1.7 ± 2.42 g and ranging from 0.09 to 16 g (N = 145). Fish were maintained for 3 months in a recirculation system at Carna Research Station, Ryan Institute, National University of Ireland, Galway. They were fed on locally caught ghost shrimp (Palaemonetes spp.) and cultured Artemia salina before being weaned onto a moist pellet made using a commercial diet (Amber Neptune, Skretting), gluten (acting as a binder) and hot water. The fish were then moved to tanks with 800 litre capacity supplied on a flowthrough system. Intake water was unfiltered and oxygen was kept at >6 mg/L, supplied to the tanks using diffusers. Water temperatures measured in these tanks ranged from 5.3 to 18°C. Temperatures fluctuated due to shallow water intake, which was affected by tides and weather conditions. The fish were moved into a system supplied with chilled water (constant 12°C) in early July 2015. The first case of a T. brevifilum infection was diagnosed on the 26 June 2015 when investigating low-level mortalities and the last case was observed in early October 2015. The broodstock population comprised 43 fish, and the total mortality attributed to T. brevifilum was 30%.

Example 2 - Sampling procedures

The fish were observed in situ before they were anaesthetized with tricaine (tricaine methane sulphonate, Pharmaq, 100 mg/L), and skin, gills, eyes and fins were examined

macroscopically. A total of eight fish showing typical signs were sampled for further analysis. Tissue samples were taken for histology, molecular analysis and transmission electron microscopy (TEM). Euthanasia was carried out with a tricaine overdose followed by percussive stunning. Fish were dissected, and all internal organs including the brain were examined.

Example 3 - Macroscopic analysis

Externally, affected fish showed bilateral or unilateral exophthalmos, abdominal distension and multifocal to coalescing nodules of 1-7 mm in diameter (visible as raised blisters with irregular milky content) on skin, fins and in the buccal cavity (Fig. la,b,d). In some cases, milky patches were also visible in the eye, covering up to a third of the corneal surface (Fig. la,b). Clinically, some of the fish appeared lethargic and had a decreased appetite prior to death, while no abnormal behaviour was observed in others.

Upon opening, irregular white nodules of approximately l x l mm were visible in the skeletal muscle (Fig. la). In some cases, muscle liquefaction was noted and a mucus substance was released when cutting the skeletal muscle. The abdominal cavity contained clear or pale blue mucoid fluid, with white flocculent material. All livers had numerous cysts on the organ surface, covering over 50% of the surface area in severe cases (Fig. lc). Cysts, of

approximately 2 x 2 mm in size, were filled with a mucoid fluid and contained white flocculent material. Some livers were pale yellow in colour and mottled. A mucoid fluid was released from the liver when sectioned. Similar white nodules were visible on all other internal organs, the peritoneum and around the optical nerve (associated with exophthalmos). Example 4 - Cytology and histology

Fresh smears were taken from ascitic fluid, internal organs with nodules, skin and gills and were examined under 400 to lOOOx magnification by microscopy. Tissue samples from gills, skin and skeletal muscle, visceral organs, eye, brain and fins were fixed in 10% (w/v) buffered formalin, embedded in paraffin wax blocks, sectioned (4 μπι thick) and stained with haematoxylin and eosin.

Fresh smears from ascitic fluid and visibly affected organs showed numerous microsporidian spores, partly aggregated in sporophorous vesicles. Spores (average size 4.6 x 2 μπι) were ovoid and slightly wider at the posterior end and had a prominent posterior vacuole containing an inclusion body occupying the posterior third (Fig. 3c).

The histopathology assessment showed microsporidian xenomas in the liver, kidney, heart, spleen, gastrointestinal tract, gonads, muscle, skin, gills and the eye but not in the brain (Fig. 2). Xenomas were often elongated and branched in form and located in the lumen of cysts. Single cysts were up to 220 μπι in diameter and were frequently aggregated, forming large composite cysts (Fig. 2a). Some xenomas had a microvillous surface (Fig. 2d).

Microsporidian stages had a partly eosinophilic appearance under H + E. Ruptured xenomas and free micro microsporidians, singly or aggregated and associated with a mild

inflammatory host response, were observed. The dermis and subdermal tissue contained large xenomas and composite cysts often displacing the epidermis (Fig. 2c). In the skeletal muscle, most xenomas appeared to originate in the endo-, peri- and epimysium but in some cases myocytes appeared affected. Pathology in the muscle fibres included focal necrosis, vacuolation, fibrosis, hyaline degeneration and mechanical separation of myofibrils. No inflammatory host response was associated with unruptured xenomas. Xenomas were observed in the gills, associated with the adductor muscles in the gill arches. In affected eyes, the xenomas were present in the retina, adjacent to the epineurium of the optical nerve and in the connective tissue and muscle around the bulbus (Fig. 2b).

The liver was the most severely affected organ in most cases, as was observed acroscopically. Large cysts occupied most of the organ's volume in severe cases. In the kidney, xenomas were found in the interstitial tissue. Aggregations of free microsporidian stages were observed in the spleen. Xenomas were present in the mucosa, submucosa and lamina muscularis of the gastrointestinal tract as well as in the peritoneum and the peri-pancreatic fat. Xenomas were present in both male and female gonadal tissues. In some instances, single and small aggregations of microsporidians were observed in the lumen of blood vessels. No evidence of infection was observed in any neural tissues.

Thus, microsporidian xenomas were observed in all internal organs, gills, skin, skeletal muscle and eyes. Observations made by TEM and spores visualized by light microscopy matched the morphological description of T. brevifilum by Matthews & Matthews (1980), Figueras et al. (1992; Diseases of Aquatic Organisms 14: 127-135) and Maillo et al. (1998; Parasitology Research 84: 208-212).

These TEM findings are consistent with a T. brevifilum infection. Example 5 - Transmission electron microscopy

A liver sample from one fish was diced into 2 x 2 mm blocks, placed in vials containing 4% glutaraldehyde in 0.2 M sodium cacodylate buffer and mixed in a rotator for 2 h. The liver samples were then transferred into 5% sucrose in 0.1 M sodium cacodylate buffer and stored at 4°C for one week before being processed. Liver blocks were then post-fixed in 1% osmium tetroxide in 0.1 M sodium cacodylate buffer for 2 h prior to dehydration through an ascending series of ethanol to propylene oxide. They were infiltrated and embedded in Durcupan epoxy resin (Sigma-Aldrich Co. Ltd.), which was polymerized for 48 h at 60°C. Using 1-μπι sections stained with 1% (w/v) aqueous toluidine blue and examined by light microscopy to select appropriate areas of each block face, ultrathin sections (100-120 nm) were cut from the resin blocks using a Leica EM UC7 ultramicrotome. These sections were mounted on uncoated nickel grids, double-stained with uranyl acetate and lead citrate and viewed in a JEOL JEM-1400 transmission electron microscope with an AMT Activue XR16 digital camera system, operating at an accelerating voltage of 80 kV.

A cyst containing microsporidian spores, sporoblasts and stages of merogony was observed in the liver sections examined. The cyst was surrounded by layers of fine lamellar structures resembling collagen and organized into bundles of parallel orientation. Bundles were variable in their density and differed in orientation. They overlapped each other in a layer up to 26 μιη wide in parts and were partly separated by host cells.

Spores measured 4.7 x 2 μιη on average and were oval and slightly asymmetrical in shape, being slightly wider at the posterior end. Features included a clear exo- and endospore, a large posterior vacuole containing an inclusion, polaroplast, anterior anchor disc, electron dense inclusion bodies, sporoplasm and nucleus. Five coils of polar filament surrounded the anterior hemisphere of the posterior vacuole (Fig. 3a). Sporoblasts had a large central electron dense inclusion body and a laterally offset nucleus. Polyribosomes were observed arranged in a paracrystalline pattern around the polar tube of the sporoblast (Fig. 3b).

Microsporidians were within host cells measuring 5.7-18 μπι in diameter, although they were not associated with any obvious changes in cell morphology.

These TEM findings are consistent with a T. brevifilum infection.

Example 6 - Molecular analysis

Three liver samples and two sera samples were collected from five separate fish showing typical clinical signs and subjected to molecular analysis. Liver samples were preserved in RNAlater. Blood samples were taken from the caudal vein and centrifuged and the obtained serum was frozen prior to analysis. DNA was extracted using the QIAamp DNA Mini Kit (Qiagen) following the manufacturer's instructions.

Table 1 - Sequence of primers employed in the present study for the detection and sequencing of Tetramicra brevifilum small subunit rRNA gene

The PCR product size was 2043 bp, and was based on the sequence of Enter ocytozoon bieneusi (accession number AF023245). Aliquots of 2 μΐ extracted DNA were subjected to conventional PCR using the HotStartTaq DNA Polymerase kit (Qiagen). The final PCR mixture (20 μΐ) contained 2 μΐ of the PCR buffer, forward and reverse primers designed for this study (Table 1) (micr For:

CACCAGGTTGATTCTGCCTG [SEQ ID NO: 1] and micr Rev:

GGTCCGTGTTTCAAGACGG [SEQ ID NO: 2]) at a final concentration of 1 μΜ and 0.4 μΐ of dNTP mix. The thermal profile consisted of an initial activation step at 95°C for 15 min, 45 cycles of 94°C for 15 s, 55°C for 30 s and 72°C for 2 min and a final extension at 72°C for 10 min.

Based on the nucleotide sequences alignment of the small subunit rRNA gene from 50 fish microsporidian species available in GenBank, micr For and micr Rev primers, used in the conventional PCR, were designed to amplify a DNA fragment of approximately 2000 bp.

DNA amplicons were gel-purified using the QIAquick gel extraction kit (Qiagen) and subjected to sequencing reaction using the ABI PRISM dye terminator ready reaction kit following the manufacturer's instructions (Perkin-Elmer Cetus). The primers used initially in the sequencing reaction (micr For [SEQ ID NO: 1] and micr Rev [SEQ ID NO: 2]) were those employed in the conventional PCR. DNA sequencing was carried out using an AB310 analyser, and electropherograms were interpreted using Vector NTI software (Informax, Invitrogen). Based on the nucleotide sequence obtained, a further six eight primers (Table 1; SEQ ID NOs: 3 to 8) were used to complete the sequencing of the PCR product. Thus, SEQ ID NOs: 1 to 8 were used for sequencing.

A total of 819 bp of the nucleotide sequences obtained were subsequently used in a phylogenetic analysis along with additional fish -infecting microsporidia sequences from group 4 according to the classification described by Lorn & Nilsen (2003; International

Journal of Parasitology, 33 : 107-127) as well as Videira et al. (2015; Parasitology Research 114: 2435-2442). The nucleotide sequence of N. cyclopteri (group 5) was included in the analysis as an outgroup.

The alignment of the nucleotide sequences was initially generated using the DAMBE programme (Xia (2000) Data Analysis in Molecular Biology and Evolution. Kluwer

Academic publishers, Boston. 276; Xia et al. (2001) Journal of Heredity 92: 371-373).

Aligned nucleotide sequences were then imported into PAUP v4.0 programme where a phylogenetic tree was produced using the parsimony method. The tree was bootstrapped using 1000 replicates and drawn using Treeview software

(http://taxonomy.zoology.gla.ac.uk/rod/treeview.html). Pairwise percentage similarities between these nucleotide sequences were calculated using the Lalign programme

(http://www.ch.embnet.org/index.html).

Phylogenetic similarity among the isolates was quantitatively assessed through Bayesian phylogenetic inference using Markov chain Monte Carlo (MCMC) method with Mr Bayes 3.2.6 (Ronquist et al. (2011) Systematic Biology 61 : 539-542). The best-fit model of nucleotide substitution was statistically selected using jModelTest (Guindon et al. (2003) Systematic Biology 52: 696-704; Darriba et al. (2012) Nature Methods 9: 772),

implementing the Akaike information criterion (AIC) and the Bayesian information criterion (BIC) as the model selection strategy. The Bayesian analysis was carried out for 200,000 generations, and the consensus tree was produced with the posterior probability of each node.

An initial BLAST search showed that the five sequences obtained in this study [SEQ ID NOs: 9 to 13] shared the highest sequence similarity to members of the Tetramicra genus. Nucleotide sequence analysis showed that these five sequences shared a very high nucleotide identity (98.3-98.4%) with the sequence of T. brevifilum (Accession number: AF364303; SEQ ID NO: 14), which is the only species described for this genus to date. A lower nucleotide identity (between 81.5% and 95.7%) was observed when compared to the rest of the sequences included in the phylogenetic tree (Fig. 4a,b).

This level of nucleotide identity was similar to or higher than what was observed within the Microgemma (98.8-100%), Spraguea (96.1-99%) and Kabatana (89.7-96.8%) genera (Fig. 4a,b). This result was confirmed by phylogenetic analysis that clearly showed that the new isolates belonged to the strongly supported cluster of the Tetramicra genus (Fig. 5). jModelTest selected the HKY + G as the best model of evolution to use in the Bayesian inference analysis with estimated base frequency of A = 0.2869, C = 0.1858, G = 0.2823. T = 0.2450 and gamma distribution shape parameter = 0.3470. Parsimony (Fig. 5) and Bayesian Tree (Fig. 6) were very similar in topology and relative level of nodal support. In the consensus tree, the Tetramicra cluster was supported by a high posterior probability of 0.94. With a posterior probability of 0.84, the five new microsporidia isolates formed a monophyletic group within the genus.

The molecular sequencing analysis is consistent with a T. brevifilum infections. Five DNA sequences according to this invention will be deposited in GenBank with the accession numbers KX280904 [SEQ ID NO: 9], KX280905 [SEQ ID NO: 10], KX280906 [SEQ ID NO: 11], KX280907 [SEQ ID NO: 12] and KX280908 [SEQ ID NO: 13].

Example 7 - Diagnostic method

The liver from a lumpfish showing typical clinical signs of T. brevifilum infection was removed and preserved in RNAlater. DNA was extracted using the QIAamp DNA Mini Kit (Qiagen) following the manufacturer's instructions.

Aliquots of 2 μΐ extracted DNA were subjected to conventional PCR using the HotStartTaq DNA Polymerase kit (Qiagen). The final PCR mixture (20 μΐ) contained 2 μΐ of the PCR buffer, forward and reverse primers designed for this study (Table 1) (micr For:

CACCAGGTTGATTCTGCCTG [SEQ ID NO: 1] and micr Rev:

GGTCCGTGTTTCAAGACGG [SEQ ID NO: 2]) at a final concentration of 1 μΜ and 0.4 μΐ of dNTP mix. The thermal profile consisted of an initial activation step at 95°C for 15 min, 45 cycles of 94°C for 15 s, 55°C for 30 s and 72°C for 2 min and a final extension at 72°C for 10 min.

DNA amplicons were gel-purified using the QIAquick gel extraction kit (Qiagen) and the amplified DNA fragment of approximately 2000 bp was identified by gel electrophoresis.

The presence of the 2000 bp amplification product indicated the presence of the infection.

This conclusion was confirmed by the sequencing method described in Example 6.