Title:
DIAGNOSTIC METHOD COMPRISING WT1 SEQUENCES
Document Type and Number:
WIPO Patent Application WO/2001/006005
Kind Code:
A2
Abstract:
This invention provides a method of detection of cancer in a subject by detecting altered genomic imprinting and a method determining the long term prognosis of a subject diagnosed with cancer, using the differential methylation state of a specific nucleotide sequence to predict the long term prognosis.
Inventors:
MALIK KARIM (GB)
BROWN KEITH (GB)
BROWN KEITH (GB)
Application Number:
PCT/GB2000/002741
Publication Date:
January 25, 2001
Filing Date:
July 17, 2000
Export Citation:
Assignee:
UNIV BRISTOL (GB)
MALIK KARIM (GB)
BROWN KEITH (GB)
MALIK KARIM (GB)
BROWN KEITH (GB)
International Classes:
G01N33/53; A61K45/00; A61K48/00; A61P35/00; C12N15/09; C12Q1/68; G01N33/566; G01N33/574; (IPC1-7): C12Q1/68; C07K14/47
Domestic Patent References:
| WO1999001580A1 | 1999-01-14 |
Foreign References:
| US5350840A | 1994-09-27 |
Other References:
MALIK K T A ET AL: "IDENTIFICATION OF AN ANTISENSE WT1 PROMOTER IN INTRON 1: IMPLICATIONS FOR WT1 REGULATION" ONCOGENE,GB,BASINGSTOKE, HANTS, vol. 11, 1995, pages 1589-1595, XP002910386 ISSN: 0950-9232
HILTUNEN M O ET AL.: "Hypermethylation of the WT1 and calcitonin gene promoter regions at chromosome 11p in human colorectal cancer" BRITISH JOURNAL OF CANCER, vol. 76, no. 9, 1997, pages 1124-1130, XP000979772
LAUX D E ET AL.: "Hypermethylation of the Wilms' tumor suppressor gene CpG island in human breast carcinomas " PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 38, 1997, page A1195 XP000979879
HUANG T H-M ET AL.: "Identification of DNA methylation markers for human breast carcinomas using the methylation-sensitive restriction fingerprinting technique" CANCER RESEARCH, vol. 57, 1997, pages 1030-1034, XP002161163 cited in the application
FEINBERG A P: "Imprinting of a genomic domain of 11p15 and loss of imprinting in cancer: an introduction" CANCER RESEARCH, vol. 59, 1999, pages 1743s-1746s, XP002161164 cited in the application
TYCKO B: "DNA METHYLATION IN GENOMIC IMPRINTING" MUTATION RESEARCH,NL,AMSTERDAM, vol. 386, no. 2, 1997, pages 131-140, XP002070305 ISSN: 0027-5107
MOULTON T ET AL.: "Genomic imprinting and Wilms' tumor" MEDICAL AND PEDIATRIC ONCOLOGY, vol. 27, 1996, pages 476-483, XP000979774
MOORWOOD K ET AL.: "Definition of a novel negative regulatory element of the WT1 antisense promotor" ANTICANCER RESEARCH, vol. 18, no. 6C, 1998, pages 4909-4910, XP000979768
MOORWOOD K ET AL.: "Antisense WT1 transcription paralleles sense mRNA and protein expression in fetal kidney and can elevate protein levels in vitro" JOURNAL OF PATHOLOGY, vol. 185, 1998, pages 352-359, XP000981275 cited in the application
GESSLER M AND BRUNS G A P: "Sequence of the WT1 upstream region including the Wit-1 gene" GENOMICS, vol. 17, 1993, pages 499-501, XP000981270 cited in the application
CAMPBELL C E ET AL.: "Antisense transcripts and protein binding motifs within the Wilms tumour (WT1) locus" ONCOGENE, vol. 9, 1994, pages 583-595, XP000981271 cited in the application
MALIK K ET AL.: "Identification and differential methylation of the WT1 antisense regulatory region and relaxation of imprinting in Wilms' tumor" CANCER RESEARCH, vol. 60, 2000, pages 2356-2360, XP002161165
HILTUNEN M O ET AL.: "Hypermethylation of the WT1 and calcitonin gene promoter regions at chromosome 11p in human colorectal cancer" BRITISH JOURNAL OF CANCER, vol. 76, no. 9, 1997, pages 1124-1130, XP000979772
LAUX D E ET AL.: "Hypermethylation of the Wilms' tumor suppressor gene CpG island in human breast carcinomas " PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 38, 1997, page A1195 XP000979879
HUANG T H-M ET AL.: "Identification of DNA methylation markers for human breast carcinomas using the methylation-sensitive restriction fingerprinting technique" CANCER RESEARCH, vol. 57, 1997, pages 1030-1034, XP002161163 cited in the application
FEINBERG A P: "Imprinting of a genomic domain of 11p15 and loss of imprinting in cancer: an introduction" CANCER RESEARCH, vol. 59, 1999, pages 1743s-1746s, XP002161164 cited in the application
TYCKO B: "DNA METHYLATION IN GENOMIC IMPRINTING" MUTATION RESEARCH,NL,AMSTERDAM, vol. 386, no. 2, 1997, pages 131-140, XP002070305 ISSN: 0027-5107
MOULTON T ET AL.: "Genomic imprinting and Wilms' tumor" MEDICAL AND PEDIATRIC ONCOLOGY, vol. 27, 1996, pages 476-483, XP000979774
MOORWOOD K ET AL.: "Definition of a novel negative regulatory element of the WT1 antisense promotor" ANTICANCER RESEARCH, vol. 18, no. 6C, 1998, pages 4909-4910, XP000979768
MOORWOOD K ET AL.: "Antisense WT1 transcription paralleles sense mRNA and protein expression in fetal kidney and can elevate protein levels in vitro" JOURNAL OF PATHOLOGY, vol. 185, 1998, pages 352-359, XP000981275 cited in the application
GESSLER M AND BRUNS G A P: "Sequence of the WT1 upstream region including the Wit-1 gene" GENOMICS, vol. 17, 1993, pages 499-501, XP000981270 cited in the application
CAMPBELL C E ET AL.: "Antisense transcripts and protein binding motifs within the Wilms tumour (WT1) locus" ONCOGENE, vol. 9, 1994, pages 583-595, XP000981271 cited in the application
MALIK K ET AL.: "Identification and differential methylation of the WT1 antisense regulatory region and relaxation of imprinting in Wilms' tumor" CANCER RESEARCH, vol. 60, 2000, pages 2356-2360, XP002161165
Attorney, Agent or Firm:
Dean, John Paul (Hays Lane London SE1 2HW, GB)
Download PDF:
Claims:
Claims
| 1. | A nucleotide sequence encoding a WT1 antisense regulatory region comprising at least a portion of the sequence shown in SEQ. 1 or at least a portion of a variant, due to base substitutions, deletions, and/or additions, of the sequence shown in SEQ. 1. |
| 2. | A nucleotide sequence according to claim 1 which encodes a WT1 antisense regulatory region negative regulatory element (NRE). |
| 3. | A WT1 antisense regulatory region negative regulatory element (NRE) comprising at least a portion of the nucleotide sequence shown in SEQ. 2 or at least a portion of a variant, due to base substitutions, deletions, and/or additions, of the sequence shown in SEQ. 2. |
| 4. | A WT1 antisense regulatory region NRE according to claim 3 wherein the NRE comprises the sequence shown in bold in SEQ. 2, or variants of such a sequence due to base substitutions, deletions and/or additions. |
| 5. | A nucleotide sequence or NRE according to any preceding claim wherein the nucleotide sequence is a DNA sequence. |
| 6. | An RNA sequence encoded by a nucleotide sequence according to any preceding claim. |
| 7. | A method of disease diagnosis and prognosis in a subject diagnosed with a Wilms' tumour cancer, the method comprising determining the differentially methylated state of a specific nucleotide sequence or sequences in the subject, or in a sample derived from the subject. |
| 8. | A method according to claim 7 wherein the specific nucleotide sequence or sequences form part of the WT1 antisense regulatory region (ARR). |
| 9. | A method according to claim 7 or claim 8, comprising determining the methylation state of a negative regulatory element (NRE) or an ARR of a WT1 gene in a sample isolated from the subject, and correlating the methylation state of the NRE or ARR with the diagnosis and expected longterm recovery prognosis of the subject. |
| 10. | A method according to claim 9 wherein hypermethylation of the NRE or ARR indicates that the subject has a positive long term recovery prognosis, and hypomethylation of the NRE or ARR indicating that the subject is predisposed to relapsing after treatment. |
| 11. | A method according to claim 7 or 8, wherein hypomethylation of the specific nucleotide sequence or sequences indicates that the subject has a positive long term recovery prognosis, and hypermethylation of the specific nucleotide sequence or sequences indicates that the subject is predisposed to relapsing after treatment. |
| 12. | A method according to any one claims 7 to 11 wherein the NRE is a nucleotide sequence according to any one of claims 1 to 6. |
| 13. | A method according to any one of claims 7 to 12 wherein the methylation state is detected by restriction digest analysis. |
| 14. | A method according to claim 13 wherein at least enzyme Bshl2361 is used to restrict the NRE. |
| 15. | A method according to any one of claims 7 to 12 wherein the methylation state is detected using a PCRbased assay system. |
| 16. | A method according to claim 15 wherein the PCR assay system uses at least one of the following primers to amplify a region of nucleotide sequence: Tf: 5'GGGTGGAGAAGAAGGATATATTTAT3'. Tr: 5'TAAATATCAAATTAATTTCTCATCC3'. TfN: 5'GATATATTTATTTATTAGTTTTGGT3' (nested primer). TrN: S'AAACCCCTATAATTTACCCTCTTC3' (nested primer). |
| 17. | A method according to claim 16 wherein the amplified nucleotide sequence is cloned and sequenced. |
| 18. | A probe comprising a nucleotide sequence according to any one of claims 1 to 6. |
| 19. | A diagnostic kit, assay, or monitoring method using a nucleotide sequence according to any one of claims 1 to 6 or a probe according to claim 18. |
| 20. | A diagnostic kit, assay, or monitoring method using a method according to any one of claims 7 to 17. |
| 21. | A method of cancer detection in a subject or in a sample isolated from the subject comprising detection of the methylation state of a specific nucleotide sequence or sequences. |
| 22. | A method according to claim 21 comprising correlating the methylation state of the specific nucleotide sequence or sequences with the presence or absence or cancer cells in the subject. |
| 23. | A method according to claim 22 wherein hypomethylation of the specific nucleotide sequence or sequences indicates the presence of cancer cells in the subject. |
| 24. | A method of cancer detection in cells derived from a subject comprising detection of tumourspecific alteration of genomic imprinting. |
| 25. | A method according to claim 24 comprising the detection of tumourspecific relaxation of genomic imprinting by determining the methylation state of a specific nucleotide sequence. |
| 26. | A method according to claim 24 or claim 25 wherein the tumourspecific alteration of genomic imprinting is detected by reverse transcriptionPCR (RTPCR). |
| 27. | A method according to any one of claims 24 to 26 wherein the cancer is Wilms' Tumour (WT). |
| 28. | A method according to claim 27 comprising detection of the relaxation of genomic imprinting of the antisense WT1 RNA sequence. |
| 29. | A method according to claim 28 wherein the RTPCR uses two primers, designed to anneal to the tumourspecific gene sequence on opposite sides of an allelic polymorphism which introduces a restriction site in one allele only. |
| 30. | A method according to claim 29 wherein the RTPCR uses the following primer pair Primer 1: WT18 CTTAGCACTTTCTTCTTGGC Primer 2: WITKBF2 TTGCTCAGTGATTGACCAGG. |
| 31. | A method of treating a subject with a specific cancer comprising altering the genomic imprinting of a tumourspecific gene. |
| 32. | A method according to claim 31 wherein the genomic imprinting of a tumourspecific gene is altered by altering the methylation state of a specific nucleotide sequence. |
| 33. | A method according to claim 31 or claim 32 wherein the genomic imprinting is altered to relax the genomic imprinting of the tumourspecific gene. |
| 34. | A method according to claim 31 or claim 32 wherein the genomic imprinting is altered to reverse the relaxation of the genomic imprinting of the tumourspecific gene. |
| 35. | A diagnostic kit, assay or a monitoring method using a method according to any one of claims 24 to 30. |
| 36. | A method of detection of the methylation state of a WT1 antisense regulatory region comprising detection of a tumourspecific alteration of genomic imprinting using a method according to any one of claims 21 to 30 and correlating adetected alteration in relaxed genomic imprinting with differential methylation of the WT1 antisense regulatory region. |
| 37. | A method according to claim 36 wherein the alteration in genomic imprinting is a relaxation in genomic imprinting. |
| 38. | Method of treatment comprising selecting a particular course of therapy on the basis of the results of a method according to any preceding claim. |
Description:
INTERNATIONALSEARCH REPORT Inte onal Application No PCT/GB 00/02741 C. (Continuation) DOCUMENTS CONSIDERED TO BE RELEVANT Category Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No. X HILTUNEN M 0 ET AL. :"Hypermethylation of 7,11,15, the WT1 and calcitonin gene promoter 17,21,22 regions at chromosome 11p in human colorectal cancer" BRITISH JOURNAL OF CANCER, vol. 76, no. 9,1997, pages 1124-1130, XP000979772 the whole document Y LAUX D E ET AL.:"Hypermethylation of the 7-11,13, Wilms'tumor suppressor gene CpG island in 20-23,36 human breast carcinomas" PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 38,1997, page A1195 XP000979879 abstract Y WO 99 01580 A (UNIV CASE WESTERN RESERVE) 7,13,15, 14 January 1999 (1999-01-14) 24-29, 31-37 the whole document Y HUANG T H-M ET AL.:"Identification of 7-10,13, DNA methylation markers for human breast 15,17, carcinomas using the methylation-sensitive 21,22, restriction fingerprinting technique"24-29, CANCER RESEARCH, 31,32,36 vol. 57,1997, pages 1030-1034, XP002161163 cited in the application the whole document Y FEINBERG A P:"Imprinting of a genomic 24-29, domain of llpl5 and loss of imprinting in 31-37 cancer: an introduction" CANCER RESEARCH, vol. 59,1999, pages 1743s-1746s, XP002161164 cited in the application the whole document Y TYCKO B:"DNA METHYLATION IN GENOMIC 7-15,17, IMPRINTING"21-29, MUTATION RESEARCH, NL, AMSTERDAM, 31-37 vol. 386, no. 2,1997, pages 131-140, XP002070305 ISSN: 0027-5107 the whole document Y MOULTON T ET AL.:"Genomic imprinting and 24-29, Wilms'tumor"31-37 MEDICAL AND PEDIATRIC ONCOLOGY, vol. 27,1996, pages 476-483, XP000979774 the whole document 1 1 INTERNATIONAL SEARCH REPORT Lute onal Application No PCT/GB 00/02741 C. (Continuation) DOCUMENTS CONSIDERED TO BE RELEVANT Category ° Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No. A MOORWOOD K ET AL.:"Definition of a novel negative regulatory element of the WT1 antisensepromotor" ANTICANCER RESEARCH, vol. 18, no. 6C, 1998, pages 4909-4910, XP000979768 abstract A MOORWOOD K ET AL.:"Antisense WT1 transcription paralleles sense mRNA and protein expression in fetal kidney and can elevate protein levels in vitro" JOURNAL OF PATHOLOGY, vol. 185,1998, pages 352-359, XP000981275 cited in the application the whole document A US 5 350 840 A (ITO CARYN Y ET AL) 27 September 1994 (1994-09-27) cited in the application the whole document A GESSLER M AND BRUNS G A P :"Sequence of the WT1 upstream region including the Wit-1 gene" GENOMICS, vol. 17,1993, pages 499-501, XP000981270 cited in the application the whole document A CAMPBELL C E ET AL.:"Antisense transcripts and protein binding motifs within the Wilms tumour (WT1) locus" ONCOGENE, vol. 9,1994, pages 583-595, XP000981271 cited in the application the whole document P, X MALIK K ET AL. :"Identification and 1-37 differential methylation of the WT1 antisense regulatory region and relaxation of imprinting in Wilms'tumor" CANCER RESEARCH, vol. 60,2000, pages 2356-2360, XP002161165 the whole document 1 FURTHER INFORMATION CONTINUED FROM PCT/ISA/210 Continuation of Box 1. 2 Claims Nos.: 38 Present claim 38 relates to a method defined by reference to a desirable characteristic or property, namely non-predictable results deriving from non-defined methods. Lacking any support by disclosing no technical feature at all, a meaningful search over the whole of the claimed scope is impossible. Independent of the above reasoning, the claim also lacks clarity (Article 6 PCT). Consequently, no search has been carried out for this claim which does not appear to be clear, supported and disclosed. The applicant's attention is drawn to the fact that claims, or parts of claims, relating to inventions in respect of which no international search report has been established need not be the subject of an international preliminary examination (Rule 66.1 (e) PCT). The applicant is advised that the EPO policy when acting as an International Preliminary Examining Authority is normally not to carry out a preliminary examination on matter which has not been searched. This is the case irrespective of whether or not the claims are amended following receipt of the search report or during any Chapter II procedure. INT : RNATIONAL SEARCH REPORT, te bnal Application No Informationon patent family members PCT/GB 00/02741 PCT/GB 00/02741 Patent document Publication Patent family Pubiication cited in search report date member (s) date WO 9901580 A 14-01-1999 AU 8381698 A 25-01-1999 US 5350840 A 27-09-1994 DE 69033127 D 01-07-1999 DE 69033127 T 14-10-1999 EP 0453560 A 30-10-1991 JP 4503014 T 04-06-1992 WO 9107509 A 30-05-1991 US 5726288 A 10-03-1998