DIAGNOSTIC, PROGNOSTIC AND THERAPEUTIC USES OF LONG

NONCODING RNAs FOR PATHOLOGIES AND TOXICITIES INDUCING HEART

DISORDERS CROSS REFERENCE TO RELATED APPLICATIONS

This application claims the benefit and priority of United States provisional application 62/518,418, filed on June 12, 2017.

The present invention provides new biomarkers and methods for the diagnosing, monitoring and prognostication of primary and secondary cardiac disorders in a subject based on IncRNA expression. The invention also provides methods for predicting heart failure (HF) after myocardial infarction, or differentiation between Ischemic (ICM) versus non-ischemic (Non- ICM) HF (e.g., dilated cardiomyopathy (DCM)). The assessment/quantification of these IncRNAs in a single mode or in combination with other IncRNAs can also be used as a marker for monitoring drug-induced cardiac toxicities and for the assessment of cardiac involvement during systemic diseases and others disorders/toxicities impacting cardiac function. These IncRNAs are cardiac tissue enriched and may be involved in different pathophysiological events pertaining to cardiac function and represent a potential target for therapeutic approaches. These therapeutic approaches may be inhibitors or activators of these IncRNAs or the products activated or inhibited by these IncRNAs.

FIELD OF THE INVENTION

The present invention provides a list of cardiac associated or cardiac-enriched IncRNAs and methods for monitoring and diagnosing cardiac disorders in a subject based on IncRNA expression. The invention also provides methods for diagnosing different types of HF such as ICM versus Non-ICM (e.g., DCM), methods for predicting HF after myocardial infarction, and for monitoring treatment efficacy and drug-induced cardiac toxicities.

BACKGROUND OF THE INVENTION

In recent years, long non-coding RNA (IncRNAs) have emerged as a new type of non-coding RNA and many studies have shown their potential as powerful biomarkers in various pathologies such as cancer. In contrast to other non-coding R A such as miRNA or snoRNA, IncRNA lack strong whole sequence conservation across different species but rather appear to contain short, highly conserved elements. Despite only a few IncRNA having been shown to be biologically relevant and functionally annotated, there's growing evidence that the majority of them are likely to be functional. While the exact function of most IncRNAs remain unknown, they have been implicated in various biological processes, mainly relating to transcriptional, post- transcriptional and epigenetic regulation. The majority of IncRNAs to date, that are functionally characterized, are believed to regulate developmental processes. However, recent profiling of the mice cardiac transcriptome, after myocardial infarction in mice cardiac tissue, has shown their role in controlling mature tissue as well as the relevance of their expression level in cardiac pathologies. There are publications which have argued for apparent similar roles of certain IncRNAs in humans e.g., WO2015092020,

Cardiac disorders such as coronary artery disease (CAD), acute myocardial infarcation (AMI) and heart failure (HF) are leading causes of mortality and morbidity in the world and cardiac toxicities such as those induced by drugs and drug candidates are the most important cause of drug withdrawal. Thus, there is a very important unmet medical need for diverse types of biomarkers for assessing cardiac function, including but not limited to diagnosis, prognosis, monitoring of drug effects and diseases activity. Several cardiac pathologies remain still incurable or need less aggressive and more personalized treatment. IncRNA represent a novel family of targets useful for these diagnostic and therapeutic applications in the cardiovascular area. The present invention relates to IncRNAs that are cardiac enriched and described for the first time in human cardiac tissues. They represent good therapeutic and diagnostic candidates for cardiac related disorders. SUMMARY OF THE INVENTION

Given that expression levels of IncRNAs could be associated with heart disease in human cardiac biopsies, the inventors set out to characterize IncRNA specifically relevant to cardiac tissue and involved in cardiac remodeling.

The present invention relates to IncRNAs having a sequence selected from the group consisting of SEQ ID NO I to SEQ ID NO 3238 (Human sequences) isoforms thereof, fragments thereof and variant sharing at least 80% nucleotide sequence homology (hereinafter named "IncRNA of the invention") suitable for the diagnosis, prognosis and monitoring of subjects suffering from cardiovascular disorders.

In particular, the invention provides a method for diagnosing and monitoring cardiac disorders, the method comprising determining the level of expression, in a biological sample derived from said subject, of one or more IncRNAs of the invention and calculating differential expression of one of more IncRNAs of the invention compared to one or more IncRNA in a biological sample from a control subject, wherein differential expression of one or more IncRNAs of the invention indicates that the subject has developed or is at risk of developing a cardiac disorder. This method of the invention is also suitable for the prognostication of cardiac disorders. In another aspect, the invention provides a method for predicting the development of heart failure (HF) in a subject having suffered myocardial infarction, a method for monitoring treatment efficacy in a subject suffering from cardiac injury and receiving a pharmaceutical cardiac therapy, a method for evaluating drug-induced cardiac toxicity in a subject receiving an effective amount of pharmaceutical composition, a method for diagnosing ischemic cardiomyopathy (ICM) in a subject, a method for diagnosing dilated cardiomyopathy (DCM) in a subject, a method for differentiating ICM vs Non-ICM (e.g., DCM) in subjects suffering heart failure, the methods comprising determining the level of expression, in a biological sample derived from said subject, of one or more IncRNAs of the invention and calculating differential expression of one of more IncRNAs of the invention compared to one or more IncRNA in a biological sample from a control subject.

In another aspect, the invention concerns a diagnostic/prognostic kit for carrying out any of the before cited methods.

In still another aspect, the present invention provides a method for treating a cardiac pathology in a subject comprising administering to said subject an effective amount of a pharmaceutical agent modulating the expression of one or more IncRNAs of the invention.

It yet another aspect, the invention provides for a method of detecting one or more IncRNAs (e.g., IncRNAs having a sequence selected from the group consting of SEQ ID NO 1 to SEQ ID NO 3238). In one aspect, the method comprises the step of obtaining the IncRNA from a human biological sample (e.g., a human plasma sample). In still another aspect, the invention provides a method of obtaining one or more IncR As, wherein the method comprises selection and isolation of total RNA. In one aspect, the IncRNA is correlated with the risk or development of a cardiac disorder. In one aspect the IncRNA is obtained from a biological sample (e.g., a cardiac biopsy or blood sample (e.g., plasma sample)).

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows the sequencing data analysis and the selection procedure of known IncRNA relevant to the cardiac pathologies.

Figure 2 shows the sequencing data analysis and the selection procedure of novel identified IncRNA relevant to the cardiac pathologies.

Figures 3A and 3B show the correlation between results obtained by sequencing with both Cuffdiff (middle bar) and DeSeq (right bar) analysis and results obtained by PCR (left bar) on patients of the same conditions. Figure 3A compares ICM and Control. Figure 3B compares DCM and Control. Figure 4 shows the expression of 4 IncRNA in human plasma samples as analyzed by qRT- PCR after preamplification: AMI indicated by a square and Control indicated by a circle.

Figure 5 shows a histogram with the number of IncRNA, which passed the different threshold of coverage depth (in horizontal axis). In total RNA-seq protocol (left bar), half of 3238 IncRNA have an average coverage depth less than 2x. In FiMICS (targeted sequencing) protocol (right bar), more than 3000 IncRNA have at least an average coverage depth of 2x.

Figure 6 shows Venn diagram of the significantly expressed IncRNAs from analysis of RNASeq and FiMICS data generated in serum samples collected at D3 of patients with AMI for the prediction of ventricular remodeling measured by the Echocardiography at month 1 post PCI. Low LVEF corresponding to the ventricular remodeling is grouped using two thresholds: either LVEF <40% or 45%. DETAILED DESCRIPTION OF THE INVENTION

The Inventors intended to characterize the cardiac long non-coding transcriptome and more particularly the dynamically modulated fraction after left ventricular remodeling. The Inventors performed deep RNA- sequencing of cardiac biopsies coupled to novel transcript reconstruction and integration in genome-wide data sets as well as previously characterized predicted human cardiac-specific IncR A to systematically identify and annotate heart-specific IncR As.

Surprisingly, it has been found that the IncRNAs of the invention are highly cardiac and context specific, thus providing a high potential as biomarkers of cardiac disorders as well as pathological response and physiological homeostasis. In addition, using novel transcripts reconstruction, novel IncRNA never described before that are cardiac-enriched and differentially expressed in cardiomyopathies have been found.These findings have been validated by comparing their RNA-Seq data with qPCR data from patients suffering the same conditions. A number of these human IncRNAs are detected in human plasma samples, supporting the feasibility of measuring their expression in patient biofluids for diagnosis and prognosis purposes. Furthermore, the inventors have identified IncRNAs which are differentially expressed in blood sample between the low LVEF (left ventricular ejection fraction) group and the high LVEF group after PCI (Percutaneous Coronary Intervention). Collectively, a novel panel of heart-specific IncRNAs with unique prognosis value relevant to cardiac disorders has been found. As used herein, a control sample refers to a biological sample such as tissue or cells (e.g., blood sample) from a normal subject (e.g. an individual who does not have cardiac disease or any condition or symptom associated with).

As used herein, "identity" refers to the sequence matching between two polypeptides, molecules or between two nucleic acids. When a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit (for instance, if a position in each of the two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by a lysine), then the respective molecules are identical at that position. The "percentage identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared times 100. Such alignment can be provided using, for instance, the program Basic Local Alignment Search Tool (BLAST) from the National Center for Biotechnology Information NCBI.

The one or more IncRNAs, fragments thereof, isoforms thereof and variants sharing at least 80% nucleotide sequence identity thereto listed in Table 1 are not part of the present invention. The sequences of these one or more IncRNAs, excluded from the present invention, are described in PCT/EP2014/078868 (Universite de Lausanne) and in filed in ST25 format.

Table 1

XLOC 019010 2 Lncl9010

XLOC 022236 2 Lnc22236

XLOC 011236 3 Lnc-SLC38A2

XLOC 012015 3 Lnc-KCNJ6

XLOC 012884 3 Lnc-NKX2.5

XLOC 004797 3 Lnc4797

XLOC 003851 3 Lnc-SPNB2

XLOC 011237 3 Lnc-SLC38A2

XLOC 014898 3 Lnc-SE-14989

XLOC 030839 3 Lnc-CDH13

XLOC 012194 3 Lnc-ACAP2

XLOC 031308 3 Lnc-IRX3

XLOC 026621 3 Lnc-ATOH8

XLOC 002721 3 Lnc-TXLNB

XLOC 003170 3 Lnc-KITLG

XLOC 002849 4 Lnc-Novlnc6

XLOC 016279 4 Lnc-Novlnc25

XLOC 024141 4 Lnc-CARDl l

XLOC 021524 4 Lnc-NFIB

XLOC 021715 4 Lnc-FOX06

XLOC 020321 4 Lnc-ANX5A

XLOC 006274 4 Lnc-MAX

XLOC 021416 4 Lnc21416

XLOC 003767 4 Lnc-LIF

XLOC 014118 4 Lnc-LCLATl

XLOC 004833 4 Lnc4833

XLOC 009582 4 Lnc-PPIF

XLOC 024449 4 Lnc24449

XLOC 006146 4 Lnc6146

Lnc-Dedbt

XLOC 033521 4 (Lnc033521)

XLOC 025643 4 Lnc25643

XLOC 004910 4 Lnc-SPARC

XLOC 010967 4 Lnc-miPv30b

XLOC 002503 4 Lnc-SOCS2

XLOC 017764 4 Lnc-IDl

XLOC 020119 4 Lnc20119

XLOC 001065 4 Lnc-GPCl

XLOC 009131 4 Lnc-OTX2

XLOC 000264 4 Lnc-FAM124B

XLOC 032325 4 Lnc-TALINl

XLOC 002546 4 Lnc-KRPvl

XLOC 006241 4 Lnc-DACTl

XLOC 029781 4 Lnc29781

XLOC 030722 4 Lnc-SE-30722 XLOC 032031 4 Lnc-KCNJ

XLOC 020634 4 Lnc-SE-20634

XLOC 031524 4 Lnc-IRF2BP2

XLOC 020212 4 Lnc-CYR61

XLOC 000336 4 Lnc-HDAC4

XLOC 015960 4 Lnc-ITPRIP

XLOC 004067 4 Lnc-MYOCD

XLOC 015277 4 Lnc-SMAD7/ Novlnc23

XLOC 020313 4 Lnc20313

XLOC 008190 4 Lnc8190

XLOC 033125 4 Lnc33125

XLOC 032788 4 Lnc32788/ Novlnc90

XLOC 014917 4 Lncl4917

XLOC 014935 4 Lncl4935

XLOC 007419 4 Lnc7419

XLOC 006561 4 Lnc6561

XLOC 024370 4 Lnc24370

XLOC 006255 4 Lnc6255

XLOC 029637 4 Lnc29637

XLOC 010855 2 Lncl0855

XLOC 007852 4 Lnc7852/ Novlncl5

XLOC 009335 4 Lnc9335/ Novlnc32

XLOC 019782 2 Lncl9782/ Novlnc35

XLOC 010735 4 Lncl0735/ Novlnc44

XLOC 007917 4 Lnc7917/ Novlnc61

XLOC 033357 4 Lnc33357

XLOC 023848 4 Lnc23848/ Novlnc49

XLOC 016979 4 Lnc 16979

The present invention relates to IncR As having a sequence selected from the group consisting of SEQ ID NO 1 to SEQ ID NO 3238 (Human sequences) isoforms thereof, fragments thereof and variant sharing at least 80% (e.g., at least 90%>, at least 95%, at least 98%>, or at least 99%) nucleotide sequence homology suitable for the diagnosis, prognosis and monitoring of subjects suffering from cardiovascular disorders.

In some embodiments, the IncRNA which is detected is selected from any of SEQ ID NO: 1 - SEQ ID NO: 3238.

In some embodiments, the IncRNA which is detected is selected from the group consisting of:

(i) 15 IncRNAs of SEQ ID 1204, SEQ ID 1736, SEQ ID 0544, SEQ ID 0915, SEQ ID2368, SEQ ID 1595, SEQ ID 2382, SEQ ID 0859, SEQ ID 3112, SEQ ID 1869, SEQ ID 1406, SEQ ID 0043, SEQ ID 0363, SEQ ID 0069 and SEQ ID 1947; (ii) 11 IncRNAs of SEQ ID 2373, SEQ ID 1748, SEQ ID 3112, SEQ ID 1231, SEQ ID 0664, SEQ ID 1686, SEQ ID 0791, SEQ ID 2126, SEQ ID 2750, SEQ ID 3010, and SEQ ID 2241;

(iii) 14 IncRNAs of SEQ ID 2150, SEQ ID 1534, SEQ ID 0311, SEQ ID 2952, SEQ ID 2838, SEQ ID 1437, SEQ ID 1297, SEQ ID 1059, SEQ ID 1465, SEQ ID 2826, SEQ ID 0180, SEQ ID 0538, SEQ ID 0258, and SEQ ID 2273;

(iv) 20 IncRNAs of SEQ ID 0190, SEQ ID 0359, SEQ ID 0776, SEQ ID 1421, SEQ ID 1795 , SEQ ID 0477, SEQ ID 1511 , SEQ ID 0435 , SEQ ID 1418, SEQ ID 1025 , SEQ ID 0265, SEQ ID 1311, SEQ ID 2540, SEQ ID 2323, SEQ ID 3011, SEQ ID 2447, SEQ ID 2863, SEQ ID 2697, SEQ ID 3128, and SEQ ID 2265;

(v) 11 IncRNAs of SEQ ID 2540, SEQ ID 0545, SEQ ID 1766, SEQ ID 3011, SEQ ID 0968, SEQ ID 2371, SEQ ID 1533, SEQ ID 0749, SEQ ID 0609, SEQ ID 1446, and SEQ ID 2986;

(vi) 8 IncRNAs of SEQ1204, SEQ2454, SEQ0334, SEQ1403, SEQ1089, SEQ2692, SEQ2273, SEQ0502;

(vii) 4 IncRNAs of SEQ0097, SEQ 1947, SEQ 1051 and SEQ2996; and

(viii) IncRNAs in Table 4, Table 5, Table 8, Table 9, Table 12, Table 15, Table 18, Table 19, Table 20, Table 21, Table 22, Table 24, Table 25, Table 28, Table 29, Table 32, Table 33, Table 34, Table 35, Table 36, Table 37, Table 38, Table 39, Table 40, and/or Table 41.

As used herein, a biological sample may be any sample that may be taken from a subject, such as whole blood, serum, plasma, semen, saliva, tears, urine, fecal material, sweat, buccal smears, skin, cardiac tissue, liver, brain tissue, amniotic fluid, nerve tissue and hair. It also includes specific cellular subtypes or derivatives extracted from those such as PBMCs. The sample used in this invention is preferably blood or cardia tissue, more preferably blood, e.g., serum.

The expression level of IncRNAs may be determined by any technology known by a man skilled in the art. In particular, the expression level of IncRNAs is determined by measuring the amount of nucleic acid transcripts of each IncRNA. The amount of nucleic acid transcripts can be measured by any technology known by a man skilled in the art. The measure may be carried out directly on an extracted RNA sample or on retrotranscribed complementary DNA (cDNA) prepared from extracted RNA by technologies well-known in the art. From the RNA or cDNA sample, the amount of nucleic acid transcripts may be measured using any technology known by a man skilled in the art, including nucleic acid microarrays, quantitative PCR, sequencing (e.g., next generation sequencing), and hybridization with a labeled probe. In some embodiments, the expression level of IncRNAs is determined using sequencing, e.g., next generation sequencing. Sequencing may be carried out after converting extracted RNA to cDNA using reverse transcriptase or RNA molecules may be directly sequenced. In a particular embodiment, which should not be considered as limiting the scope of the invention, the measurement of the expression level using next generation sequencing may be performed as follows. Briefly, RNA is extracted from a sample (e.g., blood sample). After removing rRNA, RNA samples are then reverse transcribed into cDNA. To ensure strand specificity, single stranded cDNA is first synthetized using Super-Script II reverse transcriptase and random primers in the presence of Actinomycin D, and then converted to double stranded cDNA with the second strand marking mix that incorporates dUTP in place of dTTP.

Resulting blunt ended cDNA are purified using AMPure XP magnetic beads. After a 3 'end adenylation step, adaptor is attached to cDNA. So obtained cDNA (sequencing library) may be amplified by PCR. The sequencing libraries can be sequenced by any next generation sequencing technology known by a man skilled in the art.

In some embodiments, the measurement of the expression level of IncRNAs, e.g., by sequening (e.g., next generation sequencing), is facilitated by capturing and enriching nucleic acids (RNA or cDNA) corresponding to IncRNAs of interest prior to the measurement. As used herein, enrichment refers to increasing the percentage of the nucleic acids of interest in the sample relative to the initial sample by selectively purifying the nucleic acids of interest. The enrichment of nucleic acids corresponding to IncRNAs of interest can be carried out on extracted RNA sample or cDNA sample prepared from extracted RNA. In some

embodiments, nucleic acids corresponding to IncRNAs of interest are captured and enriched by hybridizing RNA or cDNA sample to oligonucleotide probes specific to IncRNAs of interest (e.g. oligonucleotide probes comprising a sequence complementary to a region of IncRNAs of interest) under conditions allowing for hybridization of the probes and target nucleic acids to form probe-target nucleic acid complexes. Probes may be DNA or RNA, preferably DNA. The length of probes may be from 30 to 80 nucleotides, e.g., from 40 to 70, from 40 to 60, or about 50 nucleotides. The probe-target nucleic acid complexes can be purified by any technology known by a man skilled in the art. In a preferred embodiment, probes are biotinylated. The biotinylated probe-target nucleic acid complexes can be purified by using a streptavidin-coated substrate, e.g, a streptavidin-coated magnetic particle, e.g., Tl streptavidin coated magnetic bead.

In some embodiments, the expression level of IncRNAs may be determined using quantitative PCR. Quantitative, or real-time, PCR is a well known and easily available technology for those skilled in the art and does not need a precise description. In a particular embodiment, which should not be considered as limiting the scope of the invention, the determination of the expression profile using quantitative PCR may be performed as follows. Briefly, the realtime PCR reactions are carried out using the TaqMan Universal PCR Master Mix (Applied Biosystems). 6 μΐ cDNA is added to a 9 μΐ PCR mixture containing 7.5 μΐ TaqMan Universal PCR Master Mix, 0.75 μΐ of a 20X mixture of probe and primers and 0.75μ1 water. The reaction consisted of one initiating step of 2 min at 50 deg. C, followed by 10 min at 95 deg. C, and 40 cycles of amplification including 15 sec at 95 deg. C and 1 min at 60 deg. C. The reaction and data acquisition can be performed using the ABI 7900HT Fast Real-Time PCR System (Applied Biosystems). The number of template transcript molecules in a sample is determined by recording the amplification cycle in the exponential phase (cycle threshold or CQ or CT), at which time the fluorescence signal can be detected above background fluorescence. Thus, the starting number of template transcript molecules is inversely related to

In some embodiments, the expression level of IncRNAs may be determined by the use of a nucleic acid microarray. A nucleic acid microarray consists of different nucleic acid probes that are attached to a substrate, which can be a microchip, a glass slide or a microsphere-sized bead. A microchip may be constituted of polymers, plastics, resins, polysaccharides, silica or silica-based materials, carbon, metals, inorganic glasses, or nitrocellulose. Probes can be nucleic acids such as cDNAs ("cDNA microarray") or oligonucleotides ("oligonucleotide microarray"), and the oligonucleotides may be about 25 to about 60 base pairs or less in length. To determine the expression profile of a target nucleic acid sample, said sample is labelled, contacted with the microarray in hybridization conditions, leading to the formation of complexes between target nucleic acids that are complementary to probe sequences attached to the microarray surface. The presence of labelled hybridized complexes is then detected. Many variants of the microarray hybridization technology are available to the man skilled in the art.

The present invention provides Method 1. Method 1 is a method of diagnosing or monitoring or treating cardiac diseases or disorders in a subject, the method comprising a. ) obtaining a sample from said subject; b. ) detecting the level of expression of one or more IncRNAs (e.g., having a sequence consisting of SEQ ID NOl to SEQ ID NO 3238, isoforms thereof, fragment thereof and variant sharing at least 80% nucleotide sequence homology) ; and c. ) diagnosing the subject with one or mores cardiac diseases or disorders based upon the level of expression of one or more IncRNAs compared to a control, with the proviso that the one or more IncRNAs, fragments thereof, isoforms thereof and variants sharing at least 80% nucleotide sequence identity thereto listed in Table 1 are not part of the present invention.

In various aspects, Method 1 includes the following:

1.1 Method 1 , wherein the method wherein the level of expression or the differential expression of one or more said IncRNAs indicates that the subject has developed or is at risk of developing a cardiac disorder.

1.2 Method 1 or 1.1, wherein cardiac disorder is selected from the group consisting of: pathologies or abnormalities with Interventricular Septal Thickness (IVS), heart failure (e.g., left and right ventricle dilatation / dysfunction), EF, LVID, MI , HFrEF, myocardial infarction, myocarditis (e.g., viral myocarditis), cardiac toxicity, brachycardia, arrhythmia, congenital heart defects, hypertension, diabetic cardiomyopathy, idiopathic and dilated cardiomyopathy, pathologies characterized by malformation, pathologies characterized by tissue remodeling, pathologies characterized by affected function, pathologies characterized by disorders of the right heart, pathologies characterized by arrhythmias, pathologies characterized by intoxication, pathologies characterized by cancer, pathologies characterized by neurologic disorders, pathologies characterized by trauma, pathologies characterized by a change in hemodynamic, pathologies characterized by vascular disorders altering cardiac functions such as Coronary artery disease (CAD), and pathologies resulted from cardiac dysfunction/disorders inducing ischemic (embolic / thrombotic) stroke.

The method of Method 1, 1.1, or 1.2, wherein the diagnosis step includes predicting the development of heart failure in a subject having suffered AMI, the method comprising determining the level of expression, in a biological sample derived from said subject, of one or more IncRNAs of the invention or calculating differential expression of one of more IncRNAs compared to one or more IncRNAs in the same biological sample, wherein the level of expression or the differential expression of one or more said IncRNAs predicts the risk for the subject to develop HF.

The method of any of Method 1 - 1.3, wherein the method optionally further comprises the step of administering at least one pharmaceutical to the subject in order to treat one or more cardiovascular diseases or disorders.

The method of any of Method 1 - 1.4, wherein the level of expression refers to the differential expression of IncRNAs, the presence of IncRNAs, or the absence of IncRNAs.

The method of any of Methods 1-1. 5, wherein the level of expression of one or more said IncRNAs indicates that the subject suffers ICM. .

The method of any of Methods 1-1. 5, wherein the level of expression of one or more said IncRNAs indicates that the subject suffers Non-ICM (e.g., DCM). The method of any of the preceding methods, wherein the subject has been previously diagnosed with Heart Failure (e.g., congestive heart failure) The method of 1.8, wherein the level of expression of one or more said IncRNAs indicates that the subject with Heart Failure also suffers Non-ICM (e.g.,DCM).

Any of the preceding methods, wherein the biological sample is selected from the group consisting of: whole blood, serum, plasma, semen, saliva, tears, urine, fecal material, sweat, buccal smears, skin, cardiac tissue, liver, brain tissue, amniotic fluid, nerve tissue and hair (e.g, wherein the sample is preferably plasma or cardiac tissue).

Any of the preceding methods, wherein the IncR A expression levels are detected in a sample (e.g., biological sample) using a technique selected from the group consisting of: SI nuclease protection assay, microarray analysis, polymerase chain reaction (PCR), hybridization technologies, reverse transcriptase polymerase chain reaction (RT-PCR), Northern blot, serial analysis of gene expression (SAGE), immunoassay, and mass spectrometry.

Any of the preceding methods, wherein the IncRNA expression level of IncRNA in sample (e.g., biological sample) is detected using a singleplexed or multiplexed method selected from a group consisting of: fluorescence, luminescence, radio-marking, sequencing, e.g., next generation sequencing, and coded microdisks.

Any of the preceding methods further comprising administering a pharmaceutical composition which modulates one or more IncRNAs, wherein the pharmaceutical composition is selected from the group consisting of: a chemical agent, a RNA mimic, an antibody, an engineered protease, a CRISPR based technology and enzymatically active RNA.

The method of 1.13 , wherein the enzymatically active RNA is selected from the group consisting of: a miRNA, a siRNA, a piRNA, a hnRNA, a snRNA, esiRNA, shRNA, decoys, RNA aptamers and an antisense oligonucleotide.

Any of the preceding methods, wherein the method is a method of diagnosis.

Any of the preceding methods, wherein the method is a method of monitoring.

Any of the preceding methods, wherein the method is a method of treatment.

Any of the preceding methods, wherein the expression level of the IncRNAs of the invention are detected by measuring the levels of cDNAs, amplified RNAs or DNAs or quantities of DNA probes, or other molecules, in a sample (e.g., biological sample) that are indicative of the expression level of the IncRNA.

Any of the preceding methods, wherein the IncRNA which is detected is selected from any of SEQ ID NO: 1 - SEQ ID NO: 3238.

Any of the preceding methods, wherein the IncRNA which is detected is selected from selected from the group consisting of:

(i) 15 IncRNAs of SEQ ID 1204, SEQ ID 1736, SEQ ID 0544, SEQ ID 0915, SEQ ID2368, SEQ ID 1595, SEQ ID 2382, SEQ ID 0859, SEQ ID 3112, SEQ ID 1869, SEQ ID 1406, SEQ ID 0043, SEQ ID 0363, SEQ ID 0069 and SEQ ID 1947;

(ii) 11 IncRNAs of SEQ ID 2373, SEQ ID 1748, SEQ ID 3112, SEQ ID 1231, SEQ ID 0664, SEQ ID 1686, SEQ ID 0791, SEQ ID 2126, SEQ ID 2750, SEQ ID 3010, and SEQ ID 2241;

(iii) 14 IncRNAs of SEQ ID 2150, SEQ ID 1534, SEQ ID 0311, SEQ ID 2952, SEQ ID 2838, SEQ ID 1437, SEQ ID 1297, SEQ ID 1059, SEQ ID 1465, SEQ ID 2826, SEQ ID 0180, SEQ ID 0538, SEQ ID 0258, and SEQ ID 2273;

(iv) 20 IncRNAs of SEQ ID 0190, SEQ ID 0359, SEQ ID 0776, SEQ ID 1421, SEQ ID 1795, SEQ ID 0477, SEQ ID 1511, SEQ ID 0435, SEQ ID 1418, SEQ ID 1025, SEQ ID 0265, SEQ ID 1311, SEQ ID 2540, SEQ ID 2323, SEQ ID 3011, SEQ ID 2447, SEQ ID 2863, SEQ ID 2697, SEQ ID 3128, and SEQ ID 2265;

(v) 11 IncRNAs of SEQ ID 2540, SEQ ID 0545, SEQ ID 1766, SEQ ID 301 1, SEQ ID 0968, SEQ ID 2371, SEQ ID 1533, SEQ ID 0749, SEQ ID 0609, SEQ ID 1446, and SEQ ID 2986;

(vi) 8 IncRNAs of SEQ1204, SEQ2454, SEQ0334, SEQ1403, SEQ1089, SEQ2692, SEQ2273, SEQ0502;

(vii) 4 IncRNAs of SEQ0097, SEQ 1947, SEQ 1051 and SEQ2996; and

(viii) IncRNAs in Table 4, Table 5, Table 8, Table 9, Table 12, Table 15, Table 18, Table 19, Table 20, Table 21, Table 22, Table 24, Table 25, Table 28, Table 29, Table 32, Table 33, Table 34, Table 35, Table 36, Table 37, Table 38, Table 39, Table 40, and/or Table 41. 1.21 Any of the preceding methods, wherein the expression level of IncR A (e.g., SEQ ID NO: 1 - SEQ ID NO: 3238) is compared to a control.

1 .22 Any of the preceding methods, wherein cardiac disorder can be selected from the group consisting of: pathologies or abnormalities related to heart failure (HF) e.g., left and right ventricle dilatation / dysfunction, reduced ejection fraction (HFrEF), independently from HF etiology: I CM ( Ischemic 11 F- related with coronary artery disease, myocardial infarction, etc. ) vs Non- ICM (Non-lsehemic HF - related with myocarditis, cardiac toxicity, arrhythmia, hypertension, congenital heart defects, diabetic, idiopathic cardiomyopathy or others).

The invention also provides Method 2. Method 2 is a method for monitoring treatment efficacy in a subject suffering from a cardiac disease or disorder and receiving a pharmaceutical cardiac therapy, the method comprising a. ) administering a pharmaceutical to a subject suffering from cardiac injury; b. ) obtaining a sample (e.g., a biological sample) from the subject; c. ) detecting the level of expression of one or more IncRNAs (e.g., having a sequence selected from the group consisting of SEQ ID NOl to SEQ ID NO 3238, isoforms thereof, fragment thereof and variant sharing at least 80% nucleotide sequence homology) in the sample, wherein the expression level of IncRNA is compared to a control; and d. ) determining the the level of expression of one or more IncRNAs, wherein the level of expression of said one or more IncRNAs indicates the efficacy of the treatment, with the proviso that the one or more IncRNAs, fragments thereof, isoforms thereof and variants sharing at least 80% nucleotide sequence identity thereto listed in Table 1 are not part of the present invention. aspects, Method 2 includes the following:

2.1 Method 2, wherein the level of expression of one or more said IncRNAs

indicates that the subject has developed or is at risk of developing a cardiac disorder despite the administration of a pharmaceutical.

2.2 Method 2 or 2.1, wherein cardiac disorder is selected from the group consisting of: pathologies or abnormalities with Interventricular Septal Thickness (IVS), heart failure (e.g., left and right ventricle dilatation / dysfunction), EF, LVID, MI , HFrEF, myocardial infarction, myocarditis (e.g., viral myocarditis), cardiac toxicity, brachycardia, arrhythmia, congenital heart defects, hypertension, diabetic cardiomyopathy, idiopathic and dilated cardiomyopathy, pathologies characterized by malformation, pathologies characterized by tissue remodeling, pathologies characterized by affected function, pathologies characterized by disorders of the right heart, pathologies characterized by arrhythmias, pathologies characterized by intoxication, pathologies

characterized by cancer, pathologies characterized by neurologic disorders, pathologies characterized by trauma, pathologies characterized by a change in hemodynamic, pathologies characterized by vascular disorders altering cardiac functions such as Coronary artery disease (CAD), and pathologies resulted from cardiac dysfunction/disorders inducing ischemic (embolic / thrombotic) stroke.

2.3 The method of Method 2, 2.1, or 2.2, wherein the diagnosis step includes predicting the development of heart failure in a subject having suffered AMI, the method comprising determining the level of expression, in a biological sample derived from said subject, of one or more IncRNAs of the invention or calculating differential expression of one of more IncRNAs compared to one or more IncRNAs in the same biological sample, wherein the level of expression or the differential expression of one or more said IncRNAs predicts the risk for the subject to develop HF.

2.4 The method of any of Method 2 - 2.3, wherein the method optionally further comprises the step of administering at least one pharmaceutical to the subject depending on the efficacy of the treatment. . The method of any of Method 2 - 2.4, wherein the level of expression refers to the differential expression of IncRNAs, the presence of IncRNAs, or the absence of IncRNAs.

The method of any of the preceding methods, wherein the subject has been previously diagnosed with Heart Failure (e.g., congestive heart failure) Any of the preceding methods, wherein the biological sample is selected from the group consisting of: whole blood, serum, plasma, semen, saliva, tears, urine, fecal material, sweat, buccal smears, skin, cardiac tissue, liver, brain tissue, amniotic fluid, nerve tissue and hair (e.g, wherein the sample is preferably plasma or cardiac tissue).

Any of the preceding methods, wherein the IncRNA expression levels are measured by technique selected from the group consisting of: SI nuclease protection assay, microarray analysis, polymerase chain reaction (PCR), hybridization technologies, reverse transcriptase polymerase chain reaction (RT-PCR), Northern blot, serial analysis of gene expression (SAGE), immunoassay, and mass spectrometry.

Any of the preceding methods, wherein the IncRNA expression level is detected using a singleplexed or multiplexed method selected from a group consisting of: fluorescence, luminescence, radio-marking, next generation sequencing and coded microdisks.

Any of the preceding methods further comprising administering a pharmaceutical composition which modulates one or more IncRNAs, wherein the pharmaceutical composition is selected from the group consisting of: a chemical agent, a RNA mimic, an antibody, an engineered protease, a CRISPR based technology and enzymatically active RNA.

The method of 2.10, wherein the enzymatically active RNA is selected from the group consisting of: a miRNA, a siRNA, a piRNA, a hnRNA, a snRNA, esiRNA, shRNA, decoys, RNA aptamers and an antisense oligonucleotide.

Any of the preceding methods, wherein the expression level of the IncRNAs of the invention are determined by measuring the levels of cDNAs, amplified RNAs or DNAs or quantities of DNA probes, or other molecules that are indicative of the expression level of the IncRNA.

Any of the preceding methods, wherein the IncRNA which is detected is selected from any of SEQ ID NO: 1 - SEQ ID NO: 3238.

Any of the preceding methods, wherein the IncRNA which is detected is selected from selected from the group consisting of:

(i) 15 IncRNAs of SEQ ID 1204, SEQ ID 1736, SEQ ID 0544, SEQ ID 0915, SEQ ID2368, SEQ ID 1595, SEQ ID 2382, SEQ ID 0859, SEQ ID 3112, SEQ ID 1869, SEQ ID 1406, SEQ ID 0043, SEQ ID 0363, SEQ ID 0069 and SEQ ID 1947;

(ii) 11 IncRNAs of SEQ ID 2373, SEQ ID 1748, SEQ ID 3112, SEQ ID 1231, SEQ ID 0664, SEQ ID 1686, SEQ ID 0791, SEQ ID 2126, SEQ ID 2750, SEQ ID 3010, and SEQ ID 2241;

(iii) 14 IncRNAs of SEQ ID 2150, SEQ ID 1534, SEQ ID 0311, SEQ ID 2952, SEQ ID 2838, SEQ ID 1437, SEQ ID 1297, SEQ ID 1059, SEQ ID 1465, SEQ ID 2826, SEQ ID 0180, SEQ ID 0538, SEQ ID 0258, and SEQ ID 2273;

(iv) 20 IncRNAs of SEQ ID 0190, SEQ ID 0359, SEQ ID 0776, SEQ ID 1421, SEQ ID 1795, SEQ ID 0477, SEQ ID 1511, SEQ ID 0435, SEQ ID 1418, SEQ ID 1025, SEQ ID 0265, SEQ ID 1311, SEQ ID 2540, SEQ ID 2323, SEQ ID 3011, SEQ ID 2447, SEQ ID 2863, SEQ ID 2697, SEQ ID 3128, and SEQ ID 2265;

(v) 11 IncRNAs of SEQ ID 2540, SEQ ID 0545, SEQ ID 1766, SEQ ID 301 1, SEQ ID 0968, SEQ ID 2371, SEQ ID 1533, SEQ ID 0749, SEQ ID 0609, SEQ ID 1446, and SEQ ID 2986;

(vi) 8 IncRNAs of SEQ1204, SEQ2454, SEQ0334, SEQ1403, SEQ1089, SEQ2692, SEQ2273, SEQ0502;

(vii) 4 IncRNAs of SEQ0097, SEQ 1947, SEQ 1051 and SEQ2996; and

(viii) IncRNAs in Table 4, Table 5, Table 8, Table 9, Table 12, Table 15, Table 18, Table 19, Table 20, Table 21, Table 22, Table 24, Table 25, Table 28, Table 29, Table 32, Table 33, Table 34, Table 35, Table 36, Table 37, Table 38, Table 39, Table 40, and/or Table 41. 2.15 Any of the preceding methods, wherein cardiac disorder can be selected from the group consisting of: pathologies or abnormalities related to heart failure (HF) e.g., left and right ventricle dilatation / dysfunction, reduced ejection fraction (HFrEF), independently from HF etiology: ICM (Ischemic HF- related with coronary artery di.sea.se, myocardial infarct ion, etc. ) vs Non-

ICM ( on-Ischemic I I F - related w ith myocarditis, cardiac toxicity, arrhythmia, hypertension, congenital heart defects, diabet ic, idiopathic cardiomyopathy or others).

The invention also provides for Method 3. Method 3 is a method for diagnosing drug-induced cardiac toxicity in a subject receiving a pharmaceutical composition, wherein the method comprises a. ) obtaining a sample from the subject; b. ) measuring the level of expression, (e.g., in a biological sample derived from said subject) of one or more IncRNAs of the invention from the sample c.) diagnosing the subject as having a cardiac toxicity from the pharmaceutical composition depending upon the level of expression of one or more said IncRNAs (e.g, wherein the IncRNA is one or more sequences selected from SEQ ID NO: 1 to SEQ ID NO: 3238)., with the proviso that the one or more IncRNAs, fragments thereof, isoforms thereof and variants sharing at least 80% nucleotide sequence identity thereto listed in Table 1 are not part of the present invention.

The invention also provides for Method 4. Method 4 is a method of detecting one or more IncRNAs (e.g., IncRNAs having a sequence selected from the group consisting of SEQ ID NO 1 to SEQ ID NO 3238) useful for Method 1 et seq, Method 2 et seq, and Method 3 et seq. In one aspect, the method comprises the step of obtaining the IncRNA from a human biological sample (e.g., a human plasma sample). The sample can be any biological sample as described in Method 1 et seq, Method 2 et seq, and Method 3 et seq. Method 4 comprises: a.) obtaining a sample (e.g., biological sample) from a subject; and b.) measuring the expression level of the IncRNA (e.g, wherein the IncRNA is detected by sequencing (e.g., next generation sequencing), SI nuclease protection assay, microarray analysis, polymerase chain reaction (PCR), hybridization technologies, reverse transcriptase polymerase chain reaction (RT-PCR), Northern blot, serial analysis of gene expression (SAGE), immunoassay, and mass spectrometry) (e.g, wherein the IncRNA is one or more sequences selected from SEQ ID NO: 1 to SEQ ID NO: 3238), with the proviso that the IncRNAs, fragments thereof, isoforms thereof and variants sharing at least 80% nucleotide sequence identity thereto listed in Table 1 are not part of the present invention. various aspects, Method 4 includes the following:

4.1 Method 4, wherein the expression level of the IncRNA is measured by sequencing (e.g., next generation sequencing).

4.2 The method of any of the preceding methods, wherein measuring the expression level of the IncRNA comprises the steps of:

(i) extracting RNA from the sample (e.g., blood sample),

(ii) converting the RNA to cDNA,

(iii) optionally, amplifying the cDNA by PCR, and

(iv) sequencing the cDNA.

4.3 The method of any of the preceding methods further comprising a step of capturing and enriching extracted RNA or cDNA corresponding to IncRNAs of interest prior to sequencing, comprising the steps of:

(1) hybridizing extracted RNA or cDNA to oligonucleotide probes specific to IncRNAs of interest (e.g., oligonucleotide probes comprising a sequence complementary to a region of IncRNAs of interest) under a condition allowing for hybridization of the probes and RNA or cDNA corresponding to IncRNAs of interest to form probe-target nucleic acid complexes, and

(2) purifying the probe-target nucleic acid complexes. The method of Method 4.3 wherein oligonucleotide probes are hybridized to cDNA.

The method of any of Methods 4.3-4.4 wherein the oligonucleotide probe is biotinylated and purifying the probe-target nucleic acid complexes comprises binding the probe-target nucleic acid complexes to a streptavidin-coated substrate. The method of Method 4.5 wherein the streptavidin-coated substrate is a streptavidin coated magnetic particle, e.g., Tl streptavidin coated magnetic bead. The method of any of the preceding methods wherein the sample is blood sample. Any of the preceding methods, wherein the IncRNA which is detected is selected from selected from the group consisting of:

(i) 15 IncRNAs of SEQ ID 1204, SEQ ID 1736, SEQ ID 0544, SEQ ID 0915, SEQ ID2368, SEQ ID 1595, SEQ ID 2382, SEQ ID 0859, SEQ ID 3112, SEQ ID 1869, SEQ ID 1406, SEQ ID 0043, SEQ ID 0363, SEQ ID 0069 and SEQ ID 1947;

(ii) 11 IncRNAs of SEQ ID 2373, SEQ ID 1748, SEQ ID 3112, SEQ ID 1231, SEQ ID 0664, SEQ ID 1686, SEQ ID 0791, SEQ ID 2126, SEQ ID 2750, SEQ ID 3010, and SEQ ID 2241;

(iii) 14 IncRNAs of SEQ ID 2150, SEQ ID 1534, SEQ ID 0311, SEQ ID 2952, SEQ ID 2838, SEQ ID 1437, SEQ ID 1297, SEQ ID 1059, SEQ ID 1465, SEQ ID 2826, SEQ ID 0180, SEQ ID 0538, SEQ ID 0258, and SEQ ID 2273;

(iv) 20 IncRNAs of SEQ ID 0190, SEQ ID 0359, SEQ ID 0776, SEQ ID 1421, SEQ ID 1795, SEQ ID 0477, SEQ ID 1511, SEQ ID 0435, SEQ ID 1418, SEQ ID 1025, SEQ ID 0265, SEQ ID 1311, SEQ ID 2540, SEQ ID 2323, SEQ ID 3011, SEQ ID 2447, SEQ ID 2863, SEQ ID 2697, SEQ ID 3128, and SEQ ID 2265;

(v) 11 IncRNAs of SEQ ID 2540, SEQ ID 0545, SEQ ID 1766, SEQ ID 3011, SEQ ID 0968, SEQ ID 2371 , SEQ ID 1533, SEQ ID 0749, SEQ ID 0609, SEQ ID 1446, and SEQ ID 2986;

(vi) 8 IncRNAs of SEQ1204, SEQ2454, SEQ0334, SEQ1403, SEQ1089, SEQ2692, SEQ2273, SEQ0502;

(vii) 4 IncRNAs of SEQ0097, SEQ 1947, SEQ 1051 and SEQ2996; and (viii) IncR As in Table 4, Table 5, Table 8, Table 9, Table 12, Table 15, Table 18, Table 19, Table 20, Table 21, Table 22, Table 24, Table 25, Table 28, Table 29, Table 32, Table 33, Table 34, Table 35, Table 36, Table 37, Table 38, Table 39, Table 40, and/or Table 41.

The invention also provides for Method 5. Method 5 is a method for identifying IncRNA from a sample (e.g., a biological sample as described in any of Method 1 et seq, Method 2 et seq, and Method 3 et seq), wherein the IncRNA can be used to treat, diagnose, and/or predict primary and secondary cardiac disorder(s) in a subject. The method comprises a.) isolating total RNA from the biological sample (e.g. cardiac biopsy, serum, or plasma) b. ) sequencing total RNA from the sample and determining which are IncRNA; and c. ) comparing the expression (e.g., either relative levels or presence or absence) of IncRNA to a control; wherein the expression of the IncRNA, compared to a control, means that the IncRNA can be indicative of primary and secondary cardiac disorder(s) in a subject, with the proviso that the one or more IncRNAs, fragments thereof, iso forms thereof and variants sharing at least 80% nucleotide sequence identity thereto listed in Table 1 are not part of the present invention. Method 5 uses any detection method described in Method 1 et seq, Method 2, et seq, Method 3, et seq., and/or Method 4 et seq.

In still a further aspect, the present invention also encompasses a diagnostic/prognostic kit for carrying out any of the previously cited methods (any of Method 1 et seq, Method 2, et seq, Method 3, et seq., and/or Method 4 et seq and/or Method 5 et seq . In some embodiments, the diagnostic/prognostic kit comprises one or more oligonucleotide probes specific to IncRNAs of interest (e.g., IncRNAs selected from the group consisting of SEQ ID NOl to SEQ ID NO 3238, isoforms thereof, fragment thereof and variant sharing at least 80% nucleotide sequence homology) and a reagent for purifying the probe-target nucleic acid complexes. The oligonucleotide probes comprise a sequence complementary to a region of the IncRNAs of interest. The oligonucleotide probes may be DNA or RNA. The oligonucleotide probes are preferably DNA. The length of oligonucleotide probes may be from 30 to 80 nucleotides, e.g., from 40 to 70, from 40 to 60, or about 50 nucleotides. In a preferred embodiment, the oligonucleotide probes are biotinylated and the reagent for purifying the probe-target complexes is a streptavidin-coated substrate, e.g, a streptavidin-coated magnetic particle, e.g., Tl streptavidin coated magnetic bead.

In some embodiments, the diagnostic/prognostic kit comprises one or more oligonucleotide probes specific to one or more IncRNAs (i.e., oligonucleotide probes comprising a sequence complementary to a region of the IncRNAs of interest) selected from any of SEQ ID NO: 1 - SEQ ID NO: 3238.

In some embodiments, the diagnostic/prognostic kit comprises one or more oligonucleotide probes specific to one or more IncRNAs selected from the group consisting of:

(i) 15 IncRNAs of SEQ ID 1204, SEQ ID 1736, SEQ ID 0544, SEQ ID 0915, SEQ ID2368, SEQ ID 1595, SEQ ID 2382, SEQ ID 0859, SEQ ID 3112, SEQ ID 1869, SEQ ID 1406, SEQ ID 0043, SEQ ID 0363, SEQ ID 0069 and SEQ ID 1947;

(ii) 11 IncRNAs of SEQ ID 2373, SEQ ID 1748, SEQ ID 3112, SEQ ID 1231, SEQ ID 0664, SEQ ID 1686, SEQ ID 0791, SEQ ID 2126, SEQ ID 2750, SEQ ID 3010, and SEQ ID 2241;

(iii) 14 IncRNAs of SEQ ID 2150, SEQ ID 1534, SEQ ID 0311, SEQ ID 2952, SEQ ID 2838, SEQ ID 1437, SEQ ID 1297, SEQ ID 1059, SEQ ID 1465, SEQ ID 2826, SEQ ID 0180, SEQ ID 0538, SEQ ID 0258, and SEQ ID 2273;

(iv) 20 IncRNAs of SEQ ID 0190, SEQ ID 0359, SEQ ID 0776, SEQ ID 1421, SEQ ID 1795, SEQ ID 0477, SEQ ID 1511, SEQ ID 0435, SEQ ID 1418, SEQ ID 1025, SEQ ID 0265, SEQ ID 1311, SEQ ID 2540, SEQ ID 2323, SEQ ID 3011, SEQ ID 2447, SEQ ID 2863, SEQ ID 2697, SEQ ID 3128, and SEQ ID 2265;

(v) 11 IncRNAs of SEQ ID 2540, SEQ ID 0545, SEQ ID 1766, SEQ ID 3011, SEQ ID 0968, SEQ ID 2371, SEQ ID 1533, SEQ ID 0749, SEQ ID 0609, SEQ ID 1446, and SEQ ID 2986; (vi) 8 IncRNAs of SEQ1204, SEQ2454, SEQ0334, SEQ1403, SEQ1089, SEQ2692, SEQ2273, SEQ0502;

(vii) 4 IncRNAs of SEQ0097, SEQ 1947, SEQ 1051 and SEQ2996; and

(viii) IncRNAs in Table 4, Table 5, Table 8, Table 9, Table 12, Table 15, Table 18, Table 19, Table 20, Table 21, Table 22, Table 24, Table 25, Table 28, Table 29,

Table 32, Table 33, Table 34, Table 35, Table 36, Table 37, Table 38, Table 39, Table 40, and/or Table 41.

EXAMPLES

Example 1 Identification of IncRNAs of the invention

The inventors incorporate deep RNA- sequencing of cardiac biopsies starting from total RNA to characterize both coding and non-coding transcriptomes and identify cardiac relevant lncRNA through a multistep analysis procedure. The Inventors use differential expression analysis as well as novel transcript reconstruction and data integration into genome-wide data sets as well as previously characterized predicted human cardiac-specific lncRNA to systematically identify heart-specific IncRNAs. Using the aforementioned techniques, the Inventors can identify 3,238 IncRNAs potentially relevant to cardiac disorders. Indeed, hundreds of known lncRNA are differentially expressed in a control subject compared to a subject suffering from ischemic or dilated cardiomyopathies. The Inventors are able to determine that 1027 novel IncRNAs, including some orthologs predicted in the art, that are differentially expressed and/or cardiac-enriched.

Sample collection

Cardiac biopsies are obtained from 5 control patients, 11 patients suffering ICM and 10 patients suffering DCM. Biopsies of control hearts are provided from subjects with either head injury (n=2) or subarachnoid haemorrhage (n=3). The protocol is approved by the Local Ethics Committee at Cardinal Stefan Wyszynski Institute of Cardiology (approval number IK-NP- 0021-48/846/13 (April 09, 2013). No donors or their relatives completed the National Refusal List. Heart biopsies obtained from the left ventricle are snap-frozen and stored at -80°C until RNA isolation.

RNA isolation

Total RNA is extracted from cardiac biopsies using the mirVana isolation kit (Life technologies, Merelbeke, Belgium). Potential contaminating genomic DNA is digested with DNase I (Qiagen, Venlo, The Netherlands). RNA concentration is measured with a Nanodrop spectrophotometer (Nanodrop products, Wilmington, USA) and RNA integrity is verified using a 2100 Bioanalyzer (Agilent technologies, Santa Clara, USA).

Biopsies sequencing

Sequencing libraries are prepared from O^g of total RNA using the Illumina TruSeq stranded total RNA library preparation kit combined with the human/mouse/rat RiboZero rRNA removal kit (Illumina Inc. San Diego, USA, C). All steps are performed with the low-throughput protocol and according to the manufacturer's instructions. Briefly, cytoplasmic rRNA are hybridized to biotinylated target-specific oligos and removed using streptavidin coated magnetic beads. rRNA depleted RNA samples are then fragmented by heat digestion with divalent cations (8 minutes, 94°C) and reverse transcribed into cDNA. To ensure strand specificity, single stranded cDNA is first synthetized using Super-Script II reverse transcriptase (Invitrogen) and random primers in the presence of Actinomycin D, and then converted to double stranded cDNA with the second strand marking mix that incorporates dUTP in place of dTTP. Resulting blunt ended cDNA are purified using AMPure XP magnetic beads. After a 3 'end adenylation step, Illumina's adapters ligation is performed. The singled indexed libraries thus obtained are washed twice using AMPure XP beads to remove excess adapters and enriched by PCR (15 cycles). PCR products are purified with a final AMPure XP beads wash and sequencing ready libraries are eluted in 30μ1 of resuspension buffer.

For quality control, Ιμΐ of each library is run on the Agilent Technologies 2100 Bioanalyzer using a DNA 1000 chip according to the manufacturer's recommendations. Absence of adapter dimers is checked and the average library size is determined by a region table. Libraries are quantified by qPCR using the KAPA Library quantification kit for Illumina Platforms (KAPAbiosystems,). Samples are run in duplicate and quantified against a standard curve ranging from 20 to 2.10-4 pM. Library size previously determined on the Bioanalyzer is used for size correction of the calculated concentrations.

All libraries are sequenced with the Illumina NextSeq500 (2x75bp).

Sequencing analysis for known transcripts

All RNA-seq reads of 26 samples are aligned to human reference genome (hgl9) using Tophat 2.1.0 (1). Bowtie index of UCSC reference sequences are downloaded from Illumina iGenomes. The transcript assembly is performed using cufflinks 2.2.1 (1) with -G option and the featureCounts function of Rsubread R package (2). The GTF file is generated by integrating GENCODE comprehensive gene annotation release 19 (3) and human IncRNAs identified by Ounzain et al. (4). Cuffdiff (1) and DESeq2 (5) are respectively used for differential expression analysis. Transcripts with an adjusted p-value < 0.05 between controls and failing hearts, or with a p-value < 0.05 between ICM and DCM are considered to be differentially expressed. Pipeline of novel IncRNA prediction

De novo transcript assembly

RABT (Reference Annotation Based Transcript) assembly (6) is performed using cufflinks with -g option for 3 control samples, 3 ICM samples and 3 DCM samples. The GTF file is the same as the one used for known transcripts. The cuffcompare (1) program is used to compare the assembled transcripts to the reference annotated GTF file and to generate a new GTF file with all transcripts from 9 samples for further analysis.

Filtering for novel IncRNAs

Filtering is done on Transfrag class codes generated by cuffcompare, transcript length, number of exons and protein coding potential. Firstly, the transcripts with code 'i', 'j', Ό', V, 'x' and '.' are extracted, all of which could potentially include novel IncRNAs. The 'i' category, for example, could contain the IncRNAs entirely within the intron of known genes. Similarly, the 'j' category could be long non-coding isoforms of known genes. The Ό' category could include novel IncRNAs having generic exonic overlap with known transcripts. The 'u' category could be long intergenic non-coding RNAs (lincRNAs). The 'x' category could contain novel IncRNAs on the opposite strand of reference genes. The '.' category may be sequences with multiple classifications. The combined GTF file is converted to a BED file using UCSC table browser (7). Following this, only the transcripts with a length of >200nt and with at least 2 exons are kept for the next step. Finally, the BED files of transcripts from the last 2 filtering steps are uploaded to CP AT (Coding-Potential Assessment Tool) (8) to calculate the coding potential score. The transcripts with CP AT scores < 0.364 are considered as non-coding. A new GTF file is generated with the final list of selected novel IncRNAs.

Differential expression of novel IncRNAs

The cuffdiff (1) is used for all 26 samples with the new GTF file of novel IncRNAs. Transcripts with an adjusted p-value < 0.05 are considered to be differentially expressed.

Analysis for public dataset

Fastq files of GSE45326 are downloaded from ArrayExpress (9). The dataset includes RNA- seq data of 12 normal human tissues. The paired-end sequencing is performed on ribominus total RNA library. Reads alignment and transcript assembly for known genes are performed as described before. Cufflinks (1) with the GTF file of novel IncR As is used to calculate FPKM of novel IncRNAs in each tissue. The transcripts with FPKM>1 and at least twice higher than the FPKM of any other tissues are considered as cardiac-enriched.

The selection of the IncRNA of the panel is a multistep procedure:

Known transcripts selection.

In a first step, the inventors focused on the identification of known IncRNA that are relevant to cardiac pathophysiology. After data alignment and transcript reconstruction using both Cufflink and features counts using Gencodel9, the authors used two distinct tools that use different approaches for differential expression analysis, respectively Cuffdiff and DeSeq2, and only transcripts showing high expression (fragments per kilobase of transcript per million mapped reads (FPKM) FPKM or FPM>1) in at least half the samples of one group are considered. Differential expression using both tools is analysed in controls vs ICM samples, controls vs DCM samples, as well as ICM vs DCM samples. 80 and 1193 differentially expressed transcripts between any of the groups are identified with Cuffdiff and DeSeq2 analysis respectively. This difference is mainly due to the low number of IncRNA flagged OK by Cuffdiff (ie, neither NOTEST nor HID AT A). As those excluded IncRNA are included in the DeSeq2 analysis, Cuffdiff default settings are not modified. Interestingly, we observed from the DeSeq2 analysis that even if the majority of differentially expressed transcripts in controls vs ICM samples are also differentially expressed in controls vs DCM samples (and vice versa), about one third of them are ICM or DCM specific, illustrating that as the coding transcriptome, the noncoding transcriptome shows features common to a common heart defect (cardiomyopathies) but also specific ones differentiating the physiological bases of this defect (ischemic vs non-ischemic). Moreover, 97 IncRNAs are also differentially expressed between ICM and DCM patients, differentiating the 2 pathologies. Similar observations are made from the Cuffdiff analysis.

The authors also focused on highly expressed non coding transcripts and thus selected 687 IncRNA having a FPKM or FPM>2 to include in the panel.

In summary, the authors identified 1,835 IncRNA corresponding to 1,501 genes, previously annotated in Gencodel9, as relevant for cardiac function.

Predicted human orthologs selection

In order to validate the relevance of the humans orthologs identified by Ounzain et al, the authors realized the same analysis using the GTF file containing the predicted human orthologs as reference for transcripts reconstruction. Surprisingly, the inventors identified few predicted orthologs that are expressed in human tissue: 86 corresponding to 77 genes. Among them, 75 are differentially expressed IncRNA across the control, ICM and DCM groups, 16 highly expressed (FPKM or FPM>2) IncRNA and 5 of them fitted the 2 criteria. This unexpected low amount of validated predicted human orthologs can in part be explained by the different sequencing approaches used in the 2 studies. Nonetheless, the so identified IncRNAs, shown to be highly tissue and context specific in mice and validated in human cardiac disorders appear to be promising bio marker candidates playing crucial roles in cardiac function regulation. Cardiac-enriched transcripts selection

As stated in the previous study from Ounzain et al, IncRNA regulating cardiac homeostasis identified in mice are highly context specific but also and importantly, cardiac tissue specific. This led us to look for non-coding transcripts that are enriched in the cardiac tissue compared to others and thus might play important roles in cardiac functions. By comparing public RNA- seq data from 12 human tissues (heart, brain, bladder, colon, breast, skin, lung, ovary, kidney, prostate, liver, muscle), the inventors identified 470 and 24 IncRNA, from known and Human predicted transcripts respectively, that had at least a 2 fold higher expression rate in cardiac tissue than in any other tissue.

Novel transcripts selection

The growing interest on IncRNA together with the development of next generation sequencing techniques over the past years has led to a better knowledge of these non-coding transcripts. Nonetheless, non-coding transcripts account for the majority of the human transcriptome and have so far not been completely characterized. The authors thus performed very deep sequencing to allow for discovery of novel transcripts. After de novo transcript reconstruction and transcript selection as detailed in the material and methods, the inventors can identify over 13,000 new transcripts with no coding potential. Among them, they can identify 696 IncRNA differentially expressed between the 3 groups (FDR<0.05) and 810 IncRNA enriched in cardiac tissue. The transcripts having class codes Ό', 'j' or 'i' and highly positively correlated with overlapped known genes are eliminated. ( category, for example, could contain the IncRNAs entirely within the intron of known genes, the 'j' category could be long non-coding iso forms of known genes and the Ό' category could include novel IncRNAs having generic exonic overlap with known transcripts). The transcripts with class codes 'j ' or Ό' and overlapping with exons of known protein-coding genes on the same strand are discarded. This resulted in a total number of novel IncRNAs of 755 relevant to cardiac physiology.

In summary, the inventors identified a highly relevant panel of 3,092 cardiac-related IncRNAs. This panel encompasses 2,317 known transcripts here shown to be relevant to cardiac physiology, as well as 755 IncRNA, here described for the first time and relevant to cardiac tissue.

EXAMPLE 2

LncRNA detection in plasma samples and PCR validation in biopsies

Sample selection: Mitocare Aidbank/

Like miRNA, IncRNA can be released from the original tissue into the body circulation. Thus such markers may be detected in body fluids like whole blood or plasma which facilitates their use in clinics. The expression of four IncRNA previously identified is verified in plasma samples from patients who suffered AMI versus control patients.

Plasma samples from 3 control subjects and 3 subjects who suffered AMI are used. RNA extraction is performed using Norgen Serum/plasma extraction kit according to the manufacturer's instructions. Isolated RNAs are then subjected to reverse transcription using the high capacity cDNA synthesis kit with the following thermal conditions: 25°C for 10 min, 37°C for 2 hours, 85°C for 5 min. Preamplification reactions are prepared using Applied Biosystems preamplication master mix with 0.1X (ΙΟΟηΜ) of each of the 4 primers pairs corresponding to the IncRNAs of interest (sequences listed below). 16 preamplification cycles are performed as recommended by the furnisher (50°C 2 minutes, 96°C 10 minutes, 40 cycles at 95°C for 15 seconds and 60°C for 1 minute). Preamplified products are then diluted 1/20 in TE buffer and quantified by qPCR using the Biorad Ssoadvanced SYBR green kit. Briefly, 15μ1 reactions containing 6ul of each diluted sample are amplified in a IX ready to use reaction mix containing 500μ1 of the diluted sample, IX biorad reaction mix and and 500nM sense and reverse primers are amplified on a ABIHT7900 with the following conditions: 30 sec 95 °C, 40 cycles of 15sec at 95 °C denaturation and 30 sec at 60 °C annealing and extension). Relative expression level is determined against a standard curve realized on a 5 log scale. TABLE 2

Lnc21524Se TTGAATCCTGGCTTTGCTCT

Lnc21524As GGAAAGGCAATTGAGTGAGG

Lnc23749Se TTGGTCTTTCACCCTTCCTG

Lnc23749As GAAAACGTCCTCCCTCCTTC

Lncl9889Se ACACGGGAAGCTCTTTGAGA

Lncl9889As TCAAGAGGGAAGGATGGATG

LncAnx5aSe GAATTTCTGGGGACCTTTCC

LncAnx5aAs GCAAAGGGAGAGAAAGCAGA

In Figure 4, the authors showed that IncRNA are indeed detectable in plasma samples. Moreover expression profile compared to NGS data (lnc21524 identified with NGS need more precision on DE).

EXAMPLE 3: LncRNA detection in serum samples using a total RNA-seq protocol

Material and Methods:

Quantification of IncRNAs in body fluids like whole blood, serum or plasma is a non- invasive way to develop a diagnostic test to use in clinics. The expression of circulating IncRNA released by the tissues was studied in serum samples from patients with AMI and control subjects. Serum samples collected at discharge of patient between D3 and D5 from 30 patients with AMI from the MitoCare cohort were used for IncRNA profiling. Mitocare is a multicenter, randomized, double-blind, placebo controlled study. The study population includes AMI patients undergoing PCI (Percutaneous Coronary Intervention), older than 18 years. The primary endpoint is the level of left ventricular ejection fraction (LVEF) less than 40% at 1 month. Patients demographics are presented in Table 3. Control serum samples were selected from subjects of ADDIA Chronobiological study.

Table 3: Demographic data of Mitocare samples:

Systolic Blood

103.5 116.9 113.6

Pressure

Diastolic Blood

67.4 70.2 66.5

Pressure

Heart Rate 83.3 75.9 69.3

Serum samples sequencing

RNA is extracted from 1.5ml of serum, using Norgen Serum extraction and RNA Clean-Up and Concentration Micro-Elute Kits according to the manufacturer's instructions. Sequencing libraries are prepared from the total amount of extracted RNA, using the Illumina TruSeq stranded total RNA library preparation kit combined with the human/mouse/rat RiboZero rRNA removal kit (Illumina Inc. San Diego, USA, C). All steps are performed with the low- throughput protocol and according to the manufacturer's instructions, with no fragmentation step. Briefly, cytoplasmic rRNA are hybridized to biotinylated target-specific oligos and removed using streptavidin coated magnetic beads. rRNA depleted RNA samples are then reverse transcribed into cDNA. To ensure strand specificity, single stranded cDNA is first synthetized using Super-Script II reverse transcriptase (Invitrogen) and random primers in the presence of Actinomycin D, and then converted to double stranded cDNA with the second strand marking mix that incorporates dUTP in place of dTTP. Resulting blunt ended cDNA are purified using AMPure XP magnetic beads. After a 3 'end adenylation step, Illumina' s adapters ligation is performed. So obtained singled indexed libraries are washed twice using AMPure XP beads to remove excess adapters and enriched by PCR (15 cycles). PCR products are purified with a final AMPure XP beads wash and sequencing ready libraries are eluted in 30μ1 of resuspension buffer.

For quality control, 1 μΐ of each library is run on the Agilent Technologies 2100 Bioanalyzer using a DNA 1000 chip according to the manufacturer's recommendations. Absence of adapter dimers is checked and the average library size is determined by a region table.

Libraries are quantified on Qubit 2.0 using Qubit dsDNA High Sensitivity assay kit

(Invitrogen). Library size previously determined on the Bioanalyzer is used to calculate molar concentrations from mass concentrations.

All libraries are sequenced with the Illumina NextSeq500 (2x75bp).

Sequencing analysis for the 3238 IncRNAs

RNA-seq data analysis is performed using Partek Flow (Partek Inc., St Louis, MO, USA build 6). The pre-alignment QA/QC module of Partek Flow is used to visualize the read quality of the FASTQ files. All reads are examined. The raw FASTQ files are trimmed at the 3' end in function of their quality score (Phred score). The parameters used are an end minimum quality level of 30 and a minimum trimmed read length of 50. Unaligned reads are mapped using the Homo sapiens hgl9 genome and using as guide a GTF file with the patented IncRNA annotation. This mapping is done using the software STAR version 2.5.3. The default parameters are used. The post-alignment QC module of Partek Flow is used to visualize the average base quality score per position as well as the mapping quality per alignment. The mapped reads are quantified using the GTF file with the patented IncRNA annotation for quantification using the Partek Expectation/Maximization (E/M) algorithm. The default parameters are used. The transcript counts are normalized by CPM (counts per million). Only transcripts showing high expression (CPM > 10) in at least half the samples of one group are considered.

Statistical analysis and predictive modelling

For the statistical analysis, samples are grouped into 2 groups based on the left ventricular ejection fraction (LVEF) measured by echocardiography at 1 -month after the PCI. To identify differentially expressed IncRNA, a statistical analysis is performed using a non-parametric Wilcoxon-Mann- Whitney test and a parametric T-test. A IncRNA with a p-value < 0.05 is considered as differentially expressed.

In order to build classification models for the 2 classifications, the Classification for

MicroArrays (CMA) package of R (Slawski et al, 2008) with a leave-one-out cross-validation is used. The algorithms used for this predictive modelling are (a) random forest, (b) linear discriminant analysis and (c) naive Bayes.

Results:

Comparison between low LVEF (LVEF < 40) and high LVEF (LVEF > 40)

First, samples were grouped into 2 groups by a dichotomized variable: 1 -month LVEF < 40% considered as LV dysfunction (Ventricular remodeling) and 1- month LVEF >40% considered as preserved LV function. The volcano plot showed the differential expression of IncRNA. 192 IncRNAs are differentially expressed and among these, 20 lncRNAs are differentially expressed and have a fold change > 2 or < 0.5 between the low LVEF (LVEF < 40) and the high LVEF (LVEF > 40) groups. The p-value and the fold-change of these

IncRNA are listed in the Table 4. 316 IncRNAs which have a P<0.05 and/or an individual AUC >0.7 or <0.3 are listed in Table 5. Table 4: List of 20 IncRNAs which are differentially expressed between the low LVEF group (LVEF < 40) and the high LVEF group (LVEF > 40)

Table 5: List of 316 IncRNAs which are differentially expressed and/or have an AUC > 0.7 or < 0.3 between the low LVEF group (LVEF < 40) and the high LVEF group (LVEF > 40)

SEQ0189 0.024 0.755 SEQ1198 0.016 0.765 SEQ1947 0.091 0.733 SEQ2698 0.052 0.705

SEQ0190 0.043 0.73 SEQ1204 0 0.88 SEQ1950 0.156 0.71 SEQ2699 0.022 0.325

SEQ0199 0.004 0.83 SEQ1205 0.001 0.8 SEQ1954 0.174 0.29 SEQ2702 0.041 0.34

SEQ0208 0.027 0.283 SEQ1214 0.045 0.71 SEQ1979 0.04 0.72 SEQ2703 0.005 0.805

SEQ0216 0.087 0.735 SEQ1231 0.037 0.3 SEQ1983 0.002 0.865 SEQ2715 0.032 0.25

SEQ0226 0.083 0.72 SEQ1240 0.044 0.74 SEQ2026 0.031 0.71 SEQ2720 0.054 0.7

SEQ0243 0.041 0.73 SEQ1271 0.109 0.715 SEQ2049 0.012 0.78 SEQ2726 0.04 0.735

SEQ0244 0.01 0.24 SEQ1276 0.053 0.725 SEQ2053 0.121 0.71 SEQ2750 0.047 0.735

SEQ0283 0.016 0.27 SEQ1281 0.016 0.22 SEQ2061 0.068 0.29 SEQ2752 0.025 0.695

SEQ0290 0.079 0.715 SEQ1286 0.409 0.71 SEQ2074 0.004 0.215 SEQ2753 0.06 0.735

SEQ0312 0.065 0.25 SEQ1301 0.087 0.71 SEQ2100 0.007 0.78 SEQ2785 0.039 0.275

SEQ0321 0.022 0.815 SEQ1319 0.048 0.32 SEQ2114 0.062 0.725 SEQ2794 0.035 0.32

SEQ0334 0.017 0.785 SEQ1329 0.006 0.245 SEQ2121 0.058 0.725 SEQ2800 0.18 0.705

SEQ0339 0.042 0.71 SEQ1340 0.084 0.283 SEQ2126 0.032 0.25 SEQ2825 0.11 0.7

SEQ0363 0.001 0.87 SEQ1347 0.065 0.705 SEQ2157 0.049 0.695 SEQ2830 0.018 0.72

SEQ0366 0.216 0.3 SEQ1348 0.013 0.275 SEQ2162 0.051 0.705 SEQ2833 0.158 0.295

SEQ0383 0.052 0.7 SEQ1356 0.099 0.705 SEQ2190 0.109 0.705 SEQ2853 0.003 0.785

SEQ0386 0.113 0.715 SEQ1373 0.024 0.215 SEQ2209 0.074 0.81 SEQ2875 0.047 0.28

SEQ0388 0.116 0.71 SEQ1377 0.121 0.7 SEQ2216 0.077 0.71 SEQ2882 0.037 0.24

SEQ0392 0.029 0.74 SEQ1385 0.117 0.71 SEQ2240 0.069 0.27 SEQ2896 0.02 0.27

SEQ0398 0.027 0.795 SEQ1391 0.133 0.71 SEQ2253 0.006 0.19 SEQ2912 0.119 0.7

SEQ0405 0.051 0.73 SEQ1398 0.004 0.195 SEQ2260 0.063 0.285 SEQ2921 0.06 0.295

SEQ0420 0.06 0.72 SEQ1403 0.018 0.775 SEQ2273 0.064 0.72 SEQ2922 0.015 0.25

SEQ0454 0.06 0.295 SEQ1404 0.109 0.705 SEQ2274 0.043 0.27 SEQ2928 0.016 0.775

SEQ0493 0.05 0.715 SEQ1406 0.083 0.74 SEQ2282 0.023 0.235 SEQ2930 0.046 0.295

SEQ0495 0.072 0.755 SEQ1410 0.008 0.235 SEQ2286 0.06 0.295 SEQ2960 0.057 0.28

SEQ0502 0.065 0.75 SEQ1412 0.042 0.775 SEQ2287 0.048 0.27 SEQ2971 0.024 0.755

SEQ0538 0.083 0.715 SEQ1420 0.042 0.75 SEQ2288 0.007 0.2 SEQ2973 0.039 0.28

SEQ0544 0.002 0.825 SEQ1428 0.006 0.225 SEQ2294 0.086 0.705 SEQ2974 0.067 0.7

SEQ0552 0.039 0.775 SEQ1442 0.026 0.715 SEQ2299 0.015 0.765 SEQ2982 0.007 0.22

SEQ0560 0.063 0.725 SEQ1444 0.057 0.29 SEQ2314 0.019 0.735 SEQ2998 0.022 0.765

SEQ0565 0.064 0.7 SEQ1449 0.089 0.7 SEQ2320 0.005 0.83 SEQ3002 0.04 0.69

SEQ0586 0.032 0.775 SEQ1454 0.098 0.708 SEQ2344 0.024 0.72 SEQ3006 0.023 0.77

SEQ0615 0.008 0.825 SEQ1462 0.071 0.728 SEQ2349 0.1 0.275 SEQ3007 0.041 0.26

SEQ0638 0.017 0.77 SEQ1468 0.002 0.81 SEQ2352 0.033 0.32 SEQ3013 0.05 0.725

SEQ0643 0.072 0.725 SEQ1483 0.041 0.27 SEQ2353 0.075 0.705 SEQ3040 0.066 0.705

SEQ0664 0.007 0.815 SEQ1518 0.154 0.71 SEQ2360 0.045 0.295 SEQ3048 0.017 0.31

SEQ0677 0.073 0.74 SEQ1528 0.018 0.735 SEQ2368 0.002 0.85 SEQ3066 0.009 0.805

SEQ0685 0.014 0.79 SEQ1556 0.102 0.72 SEQ2373 0 0.85 SEQ3070 0.052 0.3

SEQ0688 0.079 0.72 SEQ1564 0.018 0.765 SEQ2374 0.016 0.245 SEQ3080 0.045 0.25

SEQ0702 0.035 0.77 SEQ1576 0.051 0.725 SEQ2377 0.036 0.73 SEQ3085 0.034 0.725 SEQ0745 0.029 0.725 SEQ1583 0.083 0.715 SEQ2382 0.012 0.835 SEQ3112 0.029 0.265

SEQ0748 0.052 0.71 SEQ1595 0.152 0.715 SEQ2385 0.05 0.72 SEQ3113 0.024 0.28

SEQ0753 0.063 0.7 SEQ1601 0.007 0.24 SEQ2402 0.003 0.82 SEQ3118 0.085 0.265

SEQ0781 0.015 0.76 SEQ1618 0.056 0.275 SEQ2405 0.102 0.7 SEQ3128 0.034 0.295

SEQ0796 0.065 0.7 SEQ1626 0.004 0.785 SEQ2407 0.1 0.275 SEQ3129 0.005 0.19

SEQ0821 0.033 0.738 SEQ1632 0.048 0.305 SEQ2411 0.047 0.7 SEQ3133 0.019 0.765

SEQ0858 0.129 0.7 SEQ1638 0.091 0.275 SEQ2454 0.015 0.755 SEQ3141 0.126 0.74

SEQ0861 0.082 0.715 SEQ1656 0.083 0.725 SEQ2457 0.027 0.74 SEQ3142 0.107 0.295

SEQ0866 0.036 0.735 SEQ1667 0.022 0.735 SEQ2461 0.031 0.245 SEQ3143 0.025 0.305

SEQ0904 0.042 0.73 SEQ1674 0.006 0.8 SEQ2466 0.138 0.71 SEQ3153 0.005 0.795

SEQ0910 0.054 0.72 SEQ1683 0.024 0.745 SEQ2470 0.001 0.15 SEQ3156 0.051 0.71

SEQ0915 0.009 0.81 SEQ1692 0.084 0.745 SEQ2472 0.032 0.255 SEQ3170 0.044 0.295

SEQ0917 0.025 0.765 SEQ1693 0.05 0.7 SEQ2478 0.02 0.23 SEQ3180 0.039 0.725

SEQ0925 0.037 0.72 SEQ1705 0.12 0.295 SEQ2484 0.038 0.28 SEQ3184 0.024 0.28

SEQ0930 0.037 0.3 SEQ1707 0.016 0.77 SEQ2485 0.026 0.375 SEQ3187 0.024 0.33

SEQ0935 0.039 0.72 SEQ1712 0.063 0.71 SEQ2501 0.008 0.805 SEQ3200 0.049 0.26

SEQ0944 0.055 0.725 SEQ1715 0.01 0.665 SEQ2502 0.049 0.745 SEQ3203 0.002 0.19

SEQ0948 0.073 0.28 SEQ1719 0.022 0.77 SEQ2518 0.091 0.29 SEQ3204 0.017 0.75

SEQ0959 0.029 0.745 SEQ1726 0.006 0.23 SEQ2521 0.015 0.3 SEQ3210 0.044 0.665

SEQ0994 0.12 0.715 SEQ1732 0.002 0.855 SEQ2523 0.019 0.76 SEQ3221 0.002 0.135

SEQ1001 0.11 0.713 SEQ1733 0.046 0.74 SEQ2540 0.019 0.745 SEQ3230 0.036 0.3

For this classification, the variable selection was performed by using a Random Forest model. A combination of 15 pre-selected IncRNAs through a Random Forest Classifier (Table 6) is the best predictive model obtained here. The IncRNAs were selected using a random forest algorithm. This model has an area under the receiver-operating characteristic curve (AUC) of 0.988, an accuracy of 0.9, a sensitivity of 0.8, a specificity of 0.95, a Positive Predictive Value (PPV) of 0.889 and Negative Predictive Value (PNV) of 0.905. The confusion matrix is presented in Table 7. Table 6: List of 15 pre-selected IncRNAs through a Random Forest Classifier for the classification low LVEF (LVEF < 40) and high LVEF (LVEF > 40)

SEQ1595 6

SEQ2382 7

SEQ0859 8

SEQ3112 9

SEQ1869 10

SEQ1406 11

SEQ0043 12

SEQ0363 13

SEQ0069 14

SEQ1947 15

Table 7: Confusion matrix of the best model for this classification

Comparison between low LVEF (LVEF < 45) and high LVEF (LVEF > 45)

In this analysis, samples were grouped into 2 groups using the threshold of 45% LVEF: low LVEF (LVEF < 45) and high LVEF (LVEF > 45). The volcano plot showed the differential expression of IncRNA. 147 IncRNAs are differentially expressed and among them 15 IncRNA are differentially expressed and have a fold change >2 or <0.5 between the low LVEF (LVEF < 45) and the high LVEF (LVEF > 45) groups. The p-value and the fold- change of these IncRNA are listed in the Table 8. 206 IncRNAs which have a P<0.05 and/or an individual AUC >0.7 or <0.3 are listed in Table 9.

Table 8: List of 15 IncRNAs which are differentially expressed and have a fold change >2 or <0.5 between the low LVEF group (LVEF < 45) and the high LVEF group (LVEF > 45)

SEQ0664 0.00001 0.253 SEQ1692 0.00763 0.453

SEQ1239 0.02909 0.499 SEQ1707 0.00490 0.463

SEQ2709 0.04561 0.433 SEQ2477 0.02006 2.142

SEQ1385 0.03278 0.490

Table 9: List of 206 IncRNAs which are differentially expressed and/or have an AUC > 0.7 or < 0.3 between the low LVEF group (LVEF < 45) and the high LVEF group (LVEF > 45)

SEQ0615 0.066 0.70 SEQ1483 0.032 0.27 SEQ2402 0.012 0.83 SEQ3080 0.033 0.26

SEQ0664 0.000 0.95 SEQ1489 0.141 0.26 SEQ2411 0.077 0.70 SEQ3084 0.034 0.73

SEQ0670 0.032 0.74 SEQ1499 0.078 0.30 SEQ2420 0.043 0.73 SEQ3096 0.044 0.31

SEQ0688 0.040 0.72 SEQ1564 0.011 0.73 SEQ2454 0.015 0.75 SEQ3104 0.070 0.30

SEQ0724 0.019 0.72 SEQ1576 0.096 0.70 SEQ2466 0.041 0.70 SEQ3112 0.010 0.22

SEQ0758 0.043 0.75 SEQ1601 0.078 0.29 SEQ2470 0.072 0.28 SEQ3125 0.041 0.71

SEQ0778 0.524 0.73 SEQ1667 0.063 0.71 SEQ2471 0.039 0.76 SEQ3128 0.041 0.32

SEQ0781 0.031 0.71 SEQ1674 0.055 0.73 SEQ2472 0.022 0.27 SEQ3133 0.080 0.70

SEQ0790 0.038 0.72 SEQ1692 0.008 0.82 SEQ2478 0.027 0.27 SEQ3137 0.163 0.73

SEQ0821 0.039 0.71 SEQ1707 0.005 0.78 SEQ2485 0.033 0.33 SEQ3184 0.049 0.28

SEQ0838 0.027 0.73 SEQ1719 0.048 0.71 SEQ2502 0.061 0.71 SEQ3187 0.038 0.30

SEQ0845 0.068 0.70 SEQ1728 0.042 0.32 SEQ2512 0.042 0.70 SEQ3193 0.065 0.71

SEQ0867 0.039 0.72 SEQ1737 0.008 0.27 SEQ2521 0.031 0.32 SEQ3196 0.030 0.29

SEQ0885 0.035 0.30 SEQ1748 0.111 0.72 SEQ2523 0.066 0.73 SEQ3197 0.029 0.71

SEQ0886 0.041 0.71 SEQ1767 0.036 0.29 SEQ2558 0.160 0.72 SEQ3200 0.015 0.26

SEQ0891 0.059 0.30 SEQ1793 0.067 0.73 SEQ2571 0.013 0.76 SEQ3210 0.036 0.70

SEQ0892 0.055 0.28 SEQ1804 0.048 0.69 SEQ2583 0.115 0.28 SEQ3215 0.012 0.24

SEQ0914 0.037 0.23 SEQ1819 0.035 0.74 SEQ2622 0.023 0.24 SEQ3230 0.012 0.27

SEQ0915 0.018 0.76 SEQ1820 0.048 0.26 SEQ2625 0.027 0.72 SEQ3231 0.016 0.75

SEQ0917 0.009 0.78 SEQ1821 0.055 0.71 SEQ2637 0.046 0.31

SEQ0935 0.030 0.69 SEQ1858 0.054 0.27 SEQ2657 0.036 0.65

For this classification, the 2 groups (low LVEF (LVEF < 45) and high LVEF (LVEF > 45)) have the same number of samples. The variable selection was performed by using a Random Forest model. A combination of 11 pre-selected IncRNAs through a Random Forest Classifier (Table 10) is the best predictive model obtained here. The IncRNAs were selected using a random forest algorithm. This model has an area under the receiver-operating characteristic curve (AUC) of 0.996, an accuracy of 0.933, a sensitivity of 0.882, a specificity of 1 , a Positive Predictive Value (PPV) of 1 and Negative Predictive Value (PNV) of 0.867. The confusion matrix is presented in Table 11.

Table 10: List of 11 pre-selected IncRNAs through a Random Forest Classifier for the classification low LVEF (LVEF < 45) and high LVEF (LVEF > 45)

SEQ0664 5

SEQ1686 6

SEQ0791 7

SEQ2126 8

SEQ2750 9

SEQ3010 10

SEQ2241 11

Table 11 : Confusion matrix

Correlation between LncRNA and Left Ventricular Ejection Fraction

Instead of applying a threshold to predict patients as HF or non HF, the expression level of LncRNAs can be considered as a continuous value. For this approach, spearman correlation factor is calculated to measure the correlation between LVEF value at one month and expression level of LncRNA. When a threshold of (+ or -) 0.45 for correlation factor is applied, the expression of 73 IncRNAs are positively or negatively correlated with LVEF at 1 month. Among these 73 IncRNAs, 26 have a positive correlation factor whereas 47 have a negative correlation factor (Table 12).

Table 12: List of 73 IncRNA with spearman correlation factor higher than 0.45 (absolute value)

SEQ0664 0.547218 SEQ2100 0.534861 SEQ2637 0.455663 SEQ3230 -0.50558

SEQ0688 -0.45551 SEQ2157 -0.52703 SEQ2645 -0.49274

SEQ0758 -0.46513 SEQ2216 -0.53537 SEQ2703 0.459314

SEQ0914 -0.55591 SEQ2253 -0.50086 SEQ2742 -0.45062

SEQ1109 -0.5676 SEQ2281 -0.46295 SEQ2746 -0.47907

SEQ1144 -0.45238 SEQ2287 -0.63378 SEQ2750 0.542019

SEQ1204 -0.45716 SEQ2311 -0.58252 SEQ2753 0.514263

SEQ1281 0.466222 SEQ2368 0.510665 SEQ2830 0.460882

EXAMPLE 4: LncRNA detection in serum samples with a targeted IncRNA-seq (FiMICS) protocol

Circulating IncRNAs in body fluids such as whole blood, serum or plasma are numerous and released from many different tissues. Thus, performing total RNA sequencing on peripheral samples implies to generate a high amount of data to get sufficient data on the IncRNAs of interest. To optimize cardiac IncRNA quantification in peripheral blood samples, a targeted sequencing kit is developed to specifically quantify the cardiac IncRNAs of interest. For this purpose, capture probes of 50 nucleotides specific and complementary to the sequence of IncRNAs associated to the cardiac tissue (SEQ ID NO 1 to SEQ ID NO 3238) are designed. Each probe covers region of 200 bp. Multiple probes are designed for each IncRNA over 200 bp to cover specific region. Maximum probe coverage is limited to 2000 nucleotides.

Celemics technology was used to develop the assay but similar technologies using capture probes for targeting sequencing panel can be used.

Material and Methods:

Serum samples collected at discharge of patient between D3 and D5 from 30 patients with AMI from the MitoCare cohort were used for IncRNA profiling. Mitocare is a multicenter, randomized, double-blind, placebo controlled study. The study population includes AMI patients undergoing PCI, older than 18 years. The primary endpoint is the level of left ventricular ejection fraction (LVEF) less than 40% at 1 month. Demographics of the patients are presented in Table 13. Control serum samples were selected from subjects of ADDIA Chronobiological study. Table 13: Demographic data for Mitocare patients used with Fi-MICS test

Sequencing libraries constructed in Example 3 from Serum RNA of 18 patients who suffered AMI, (6 who developed heart failure (HF) and 12 who did not) and 6 control subjects are used. The IncRNA capture panel called Fi-MICS kit is used to capture 3238 cardiac IncRNAs of interest, according to the manufacturer instructions. Briefly, biotinylated target capture probes, specific for the IncRNAs of interest, are hybridized to the sequencing libraries for 24 hours. So, captured IncRNA sequences are purified on Tl streptavidin coated magnetic beads. Six successive washes are performed to eliminate all libraries sequences not specific to the panel probes. Finally, captures sequenced are enriched by PCR (14 cycles) and PCR products are purified with a final AMPure XP beads wash. Captured libraries are eluted in 30μ1 of nuclease-free water.

For quality control, 1 μΐ of each library is run on the Agilent Technologies 2100 Bioanalyzer using a DNA 1000 chip according to the manufacturer's recommendations. Absence of adapter dimers is checked and the average library size is determined by a region table.

Libraries are quantified on Qubit 2.0 using Qubit dsDNA High Sensitivity assay kit

(Invitrogen). Library size previously determined on the Bioanalyzer is used to calculate molar concentrations from mass concentrations. All libraries are sequenced using the Illumina NextSeq500 (2x75bp).

Sequencing analysis and statistical analysis

The read alignment and the quantification are performed as described in Example 3. The transcript counts were normalized by CPM (counts per millions). To determine differentially expressed IncRNAs, a statistical analysis is performed using a non-parametric Wilcoxon- Mann- Whitney test and a parametric T-test. A IncRNA with a p-value < 0.05 is considered as differentially expressed.

Results:

Coverage in targeted sequencing is improved

The average coverage depth across all bases in the sample is the sum of the read depths of each base in each region divided by the sum of the lengths of every region. Using the FiMICS kit, the average coverage is improved (11 times better in average with equivalent number of reads) compared to a total RNA-seq protocol, as shown in Table 14. Among the 3238 IncRNAs present in the panel, 2432 IncRNAs passed the threshold of 10 CPM in serum samples. Detection and quantification in function of coverage depth is presented in Figure 5. Whereas 2744 IncRNAs are measured with a coverage of at least lx by total RNA-Seq experiment, 3162 IncRNAs are measured with a coverage of at least lx with FiMICS panel with 10 fold less reads generated. At a coverage of at least 2x, half of the IncRNAs are excluded with total-RNA-Seq approach (1385) whereas 3041 IncRNAs are passing the threshold in FiMICS panel. Efficiency of the targeted panel is highly enhanced (Figure 5). The FiMICS (targeted sequencing) detects more IncRNA in terms of numbers of IncRNAs and their level of expression and thus using much less total sequencing reads. Table 14: Number of reads and average coverage for 18 samples in the 2 sequencing protocols

Sample 12 33,302,080 54.82 6,725,419 105.28

Sample 13 29,673,123 50.11 8,178,840 123.15

Sample 14 56,386,693 76.81 5,613,486 105.63

Sample 15 75,267,997 107.00 6,789,160 124.8

Sample 16 40,789,456 66.70 5,875,488 81.59

Sample 17 54,651,503 78.11 7,038,893 85.31

Sample 18 66,866,920 78.91 5,275,438 82.16

Comparison between samples after myocardial infarction and control samples

First, the statistical analysis was performed by comparing 18 samples after myocardial infarction (AMI) and 6 control samples with the goal to diagnose myocardial infraction. The volcano plot showed the differential expression of IncRNA. 20 IncRNAs are differentially expressed between the samples AMI and the control samples. The p-value and the fold- change of these IncRNA are listed in the Table 15.

Table 15: List of 20 IncRNAs which are differentially expressed between samples AMI and control samples

For this classification, a combination of 14 pre-selected IncRNA through a Random Forest Classifier (Table 16) is the best predictive model obtained here. The IncRNAs were selected using a random forest algorithm. This model has an area under the receiver-operating characteristic curve (AUC) of 0.971, an accuracy of 0.870, a sensitivity of 0.941, a specificity of 0.667, a Positive Predictive Value (PPV) of 0.889 and Negative Predictive Value (PNV) of 0.800. The confusion matrix is presented in Table 17.

Table 16: List of 14 pre-selected IncRNAs through a Random Forest Classifier for the classification between the samples AMI and the control samples

Table 17: Confusion matrix of the Random Forest model

Predicted AMI Predicted Control

Real Control 4 2

True AMI 1 16

Comparison between low LVEF (LVEF < 40) and high LVEF (LVEF > 40)

In this analysis, the 18 samples AMI were grouped into 2 groups based on the 1 -month LVEF: low LVEF (LVEF < 40) and high LVEF (LVEF > 40). The volcano plot showed the differential expression of IncRNA. 95 IncRNAs are differentially expressed and among them, 6 IncRNAs are differentially expressed with a fold change >2 or <0.5 between the samples with low LVEF and the samples with high LVEF. The p-value and the fold-change and individual AUC of these 6 IncRNAs are listed in the Table 18 and 353 IncRNAs which have a P<0.05 and/or an individual AUC >0.7 or <0.3 are listed in Table 19.

Table 18: List of 6 IncRNAs which are differentially expressed and have a fold change >2 or <0.5 between the low LVEF group (LVEF < 40) and the high LVEF group (LVEF > 40)

Table 19: List of 353 IncRNAs which are differentially expressed and/or have an AUC > 0.7 or < 0.3 between the low LVEF group (LVEF < 40) and the high LVEF group (LVEF > 40)

SEQ0151 0.01 1 0.182 SEQ1052 0.221 0.727 SEQ2021 0.037 0.212 SEQ2768 0.14 0.758

SEQ0155 0.023 0.833 SEQ1065 0.045 0.212 SEQ2022 0.27 0.258 SEQ2784 0.09 0.742

SEQ01 0 0.05 0.242 SEQ1075 0.025 0.197 SEQ2050 0.1 17 0.273 SEQ2788 0.15 0.288

SEQ01 1 0.064 0.818 SEQ1076 0.275 0.288 SEQ2084 0.104 0.788 SEQ2789 0.426 0.727

SEQ0205 0.047 0.212 SEQ1089 0.002 0.97 SEQ2086 0.065 0.242 SEQ2796 0.162 0.773

SEQ0208 0.051 0.197 SEQ1093 0.037 0.197 SEQ2091 0.214 0.712 SEQ2806 0.058 0.773

SEQ0222 0.018 0.833 SEQ1 109 0.1 14 0.788 SEQ2109 0.22 0.242 SEQ2819 0.1 1 1 0.727

SEQ0228 0.171 0.712 SEQ1 11 1 0.139 0.288 SEQ2141 0.128 0.242 SEQ2827 0.024 0.894

SEQ0236 0.06 0.788 SEQ1 146 0.039 0.182 SEQ2149 0.071 0.227 SEQ2834 0.098 0.288

SEQ0239 0.121 0.712 SEQ1 156 0.28 0.742 SEQ2151 0.064 0.242 SEQ2841 0.014 0.818

SEQ0241 0.097 0.288 SEQ1 162 0.019 0.803 SEQ2161 0.051 0.273 SEQ2856 0.13 0.273

SEQ0242 0.462 0.727 SEQ1 164 0.181 0.273 SEQ2170 0.099 0.227 SEQ2857 0.135 0.742

SEQ0285 0.149 0.758 SEQ1 179 0.078 0.197 SEQ2172 0.023 0.773 SEQ2870 0.035 0.212

SEQ0295 0.076 0.273 SEQ1 186 0.135 0.273 SEQ2174 0.01 0.848 SEQ2881 0.014 0.818

SEQ0308 0.12 0.273 SEQ1 191 0.064 0.242 SEQ2192 0.013 0.864 SEQ2903 0.19 0.712

SEQ0312 0.075 0.212 SEQ1204 0.012 0.848 SEQ2198 0.027 0.803 SEQ291 1 0.177 0.742

SEQ0334 0.021 0.864 SEQ1207 0.047 0.864 SEQ2205 0.047 0.758 SEQ2914 0.012 0.985

SEQ0345 0.107 0.758 SEQ1217 0.13 0.742 SEQ2207 0.088 0.197 SEQ2917 0.226 0.712

SEQ0350 0.017 0.152 SEQ1232 0.086 0.773 SEQ2218 0.078 0.788 SEQ2924 0.147 0.727

SEQ0354 0.346 0.727 SEQ1252 0.208 0.273 SEQ2220 0.105 0.758 SEQ2939 0.06 0.258

SEQ0358 0.161 0.288 SEQ1273 0.016 0.182 SEQ2221 0.105 0.788 SEQ2945 0.727 0.727

SEQ0362 0.25 0.273 SEQ1288 0.021 0.197 SEQ2226 0.214 0.712 SEQ2955 0.089 0.288

SEQ0366 0.095 0.758 SEQ1326 0.056 0.258 SEQ2227 0.058 0.258 SEQ2958 0.071 0.758

SEQ0371 0.349 0.258 SEQ1333 0.199 0.712 SEQ2235 0.032 0.167 SEQ2959 0.34 0.879

SEQ0380 0.141 0.727 SEQ1338 0.097 0.288 SEQ2238 0.024 0.197 SEQ2961 0.009 0.121

SEQ0384 0.026 0.803 SEQ1350 0.162 0.242 SEQ2244 0.102 0.742 SEQ2963 0.1 14 0.758

SEQ0394 0.029 0.152 SEQ1354 0.059 0.803 SEQ2273 0.098 0.773 SEQ2967 0.042 0.227

SEQ0412 0.342 0.227 SEQ1399 0.021 0.242 SEQ2285 0.107 0.242 SEQ2969 0.22 0.727

SEQ0434 0.179 0.712 SEQ1403 0.063 0.788 SEQ2286 0.16 0.712 SEQ2973 0.17 0.773

SEQ0441 0.05 0.197 SEQ1405 0.17 0.727 SEQ2294 0.079 0.803 SEQ2982 0.069 0.818

SEQ0443 0.21 1 0.712 SEQ1412 0.097 0.712 SEQ231 1 0.388 0.273 SEQ2995 0.063 0.273

SEQ0445 0.446 0.288 SEQ1422 0.04 0.758 SEQ2318 0.1 14 0.758 SEQ3001 0.088 0.727

SEQ0460 0.046 0.227 SEQ1433 0.056 0.258 SEQ2325 0.482 0.288 SEQ3007 0.217 0.712

SEQ0468 0.059 0.727 SEQ1439 0.029 0.152 SEQ2327 0.097 0.727 SEQ3013 0.059 0.758

SEQ0469 0.09 0.288 SEQ1449 0.073 0.227 SEQ2338 0.012 0.818 SEQ3015 0.147 0.727

SEQ0487 0.091 0.212 SEQ1459 0.125 0.242 SEQ2341 0.086 0.242 SEQ3029 0.03 0.212 SEQ0502 0.106 0.758 SEQ1465 0.182 0.288 SEQ2345 0.102 0.227 SEQ3035 0.004 0.136

SEQ0542 0.068 0.727 SEQ1467 0.067 0.742 SEQ2364 0.149 0.742 SEQ3036 0.071 0.818

SEQ0547 0.016 0.803 SEQ1475 0.034 0.242 SEQ2368 0.045 0.742 SEQ3052 0.064 0.773

SEQ0551 0.196 0.742 SEQ1476 0.022 0.833 SEQ2371 0.144 0.258 SEQ3053 0.002 0.909

SEQ0552 0.042 0.833 SEQ1484 0.124 0.288 SEQ2375 0.01 0.121 SEQ3058 0.037 0.803

SEQ0561 0.192 0.712 SEQ1485 0.143 0.727 SEQ2379 0.029 0.773 SEQ3060 0.371 0.712

SEQ0581 0.057 0.758 SEQ1515 0.014 0.136 SEQ2395 0.1 13 0.773 SEQ3064 0.048 0.758

SEQ0597 0.108 0.742 SEQ1516 0.076 0.818 SEQ2406 0.018 0.182 SEQ3065 0.16 0.742

SEQ0601 0.075 0.803 SEQ1527 0.185 0.273 SEQ2407 0.27 0.773 SEQ3069 0.328 0.258

SEQ0604 0.284 0.258 SEQ1534 0.038 0.212 SEQ241 1 0.02 0.864 SEQ3090 0.046 0.773

SEQ0612 0.071 0.288 SEQ1535 0.284 0.712 SEQ2422 0.138 0.742 SEQ3091 0.161 0.712

SEQ0621 0.21 0.742 SEQ1556 0.133 0.727 SEQ2425 0.15 0.712 SEQ3098 0.094 0.212

SEQ0629 0.176 0.758 SEQ1573 0.045 0.258 SEQ2429 0.049 0.212 SEQ3101 0.102 0.833

SEQ0631 0.022 0.848 SEQ1578 0.197 0.742 SEQ2436 0.1 1 0.758 SEQ3107 0.221 0.258

SEQ0659 0.052 0.848 SEQ1580 0.229 0.712 SEQ2440 0.238 0.258 SEQ3124 0.008 0.864

SEQ0661 0.157 0.742 SEQ1598 0.146 0.712 SEQ2441 0.067 0.242 SEQ3130 0.134 0.742

SEQ0670 0.053 0.742 SEQ1624 0.048 0.227 SEQ2451 0.205 0.712 SEQ3134 0.158 0.727

SEQ0677 0.035 0.788 SEQ1635 0.089 0.758 SEQ2454 0.054 0.758 SEQ3142 0.1 1 1 0.242

SEQ0680 0.045 0.227 SEQ1660 0.014 0.864 SEQ2475 0.045 0.197 SEQ3146 0.1 14 0.712

SEQ0681 0.047 0.773 SEQ1661 0.038 0.258 SEQ2497 0.109 0.712 SEQ3147 0.237 0.273

SEQ0701 0.159 0.212 SEQ1678 0.075 0.258 SEQ2513 0.189 0.712 SEQ3148 0.33 0.758

SEQ0702 0.365 0.712 SEQ1696 0.231 0.288 SEQ2517 0.189 0.758 SEQ3169 0.138 0.742

SEQ0724 0.058 0.742 SEQ1710 0.056 0.742 SEQ2520 0.176 0.727 SEQ3172 0.033 0.758

SEQ0726 0.515 0.712 SEQ1722 0.091 0.864 SEQ2529 0.256 0.273 SEQ3176 0.037 0.879

SEQ0729 0.017 0.864 SEQ1740 0.162 0.712 SEQ2544 0.259 0.742 SEQ3183 0.006 0.909

SEQ0730 0.076 0.818 SEQ1744 0.021 0.167 SEQ2546 0.055 0.258 SEQ3190 0.085 0.788

SEQ0732 0.098 0.758 SEQ1754 0.453 0.727 SEQ2553 0.196 0.242 SEQ3195 0.186 0.273

SEQ0751 0.03 0.212 SEQ1760 0.086 0.727 SEQ2562 0.099 0.712 SEQ3196 0.036 0.773

SEQ0758 0.03 0.242 SEQ1773 0.146 0.288 SEQ2572 0.227 0.727 SEQ3197 0.1 19 0.758

SEQ0766 0.033 0.803 SEQ1806 0.168 0.258 SEQ2584 0.206 0.288 SEQ3199 0.081 0.788

SEQ0779 0.36 0.742 SEQ1816 0.06 0.833 SEQ261 1 0.1 12 0.288 SEQ3208 0.015 0.197

SEQ0789 0.03 0.258 SEQ1818 0.106 0.288 SEQ2613 0.105 0.758 SEQ3209 0.133 0.258

SEQ0821 0.004 0.864 SEQ1833 0.14 0.273 SEQ2621 0.152 0.727 SEQ3213 0.027 0.152

SEQ0823 0.1 17 0.273 SEQ1852 0.008 0.864 SEQ2627 0.068 0.788 SEQ3222 0.051 0.197

SEQ3236 0.293 0.712 Comparison between low LVEF (LVEF < 45) and high LVEF (LVEF > 45)

In this analysis, the 18 samples AMI were grouped into 2 groups using the threshold of 45% LVEF: low LVEF (LVEF < 45) and high LVEF (LVEF > 45). The volcano plot showed the differential expression of IncRNA. 80 IncRNA are differentially expressed and among them, 1 IncRNA has a fold change > 2 or < 0.5, which is shown in Table 20. 467 IncRNAs which have a P<0.05 and/or an individual AUC >0.7 or <0.3 are listed in Table 21.

Table 20: List of 1 IncRNA which is differentially expressed with a fold change >2 or <0.5 between the low LVEF group (LVEF < 45) and the high LVEF group (LVEF > 45)

Table 21 : List of 467 IncRNAs which are differentially expressed and/or have an AUC > 0.7 or < 0.3 between the low LVEF group (LVEF < 45) and the high LVEF group (LVEF > 45)

SEQ0130 0.07 0.757 SEQ1034 0.077 0.714 SEQ1913 0.165 0.286 SEQ2726 0.051 0.229

SEQ0134 0.047 0.186 SEQ1036 0.052 0.186 SEQ1944 0.039 0.786 SEQ2727 0.399 0.3

SEQ0136 0.234 0.714 SEQ1053 0.044 0.229 SEQ1947 0.1 0.757 SEQ2729 0.129 0.243

SEQ0139 0.089 0.771 SEQ1055 0.127 0.729 SEQ1951 0.196 0.243 SEQ2735 0.241 0.729

SEQ0141 0.007 0.143 SEQ1056 0.151 0.7 SEQ1962 0.071 0.229 SEQ2740 0.19 0.271

SEQ0155 0.065 0.743 SEQ1057 0.191 0.257 SEQ1972 0.129 0.757 SEQ2741 0.714 0.3

SEQ0161 0.162 0.7 SEQ1080 0.139 0.743 SEQ1976 0.193 0.7 SEQ2745 0.086 0.729

SEQ0162 0.191 0.3 SEQ1086 0.045 0.786 SEQ1995 0.174 0.743 SEQ2751 0.102 0.2

SEQ0167 0.142 0.729 SEQ1088 0.075 0.771 SEQ2003 0.106 0.729 SEQ2760 0.017 0.186

SEQ0170 0.151 0.257 SEQ1089 0.184 0.786 SEQ2021 0.06 0.214 SEQ2765 0.208 0.7

SEQ01 3 0.129 0.271 SEQ1093 0.129 0.271 SEQ2024 0.097 0.729 SEQ2768 0.333 0.714

SEQ0194 0.029 0.2 SEQ1099 0.169 0.3 SEQ2031 0.032 0.186 SEQ2777 0.066 0.243

SEQ0200 0.186 0.3 SEQ1 106 0.199 0.7 SEQ2068 0.147 0.3 SEQ2785 0.029 0.2

SEQ0208 0.647 0.3 SEQ1 109 0.141 0.771 SEQ2079 0.261 0.3 SEQ2788 0.161 0.257

SEQ0215 0.202 0.743 SEQ1 11 1 0.48 0.3 SEQ2082 0.052 0.771 SEQ2795 0.201 0.3

SEQ0217 0.099 0.3 SEQ1 115 0.347 0.743 SEQ2085 0.141 0.743 SEQ2796 0.276 0.7

SEQ0219 0.149 0.7 SEQ1 116 0.1 0.771 SEQ2086 0.101 0.286 SEQ2805 0.054 0.243

SEQ0236 0.1 1 1 0.771 SEQ1 121 0.268 0.3 SEQ2109 0.12 0.271 SEQ2815 0.196 0.3

SEQ0239 0.01 1 0.771 SEQ1 129 0.108 0.257 SEQ2113 0.125 0.2 SEQ2827 0.061 0.771

SEQ0242 0.184 0.757 SEQ1 136 0.069 0.214 SEQ2114 0.057 0.743 SEQ2829 0.076 0.814

SEQ0267 0.146 0.286 SEQ1 146 0.139 0.286 SEQ2131 0.005 0.1 SEQ2834 0.216 0.257

SEQ0273 0.14 0.757 SEQ1 164 0.136 0.271 SEQ2138 0.209 0.3 SEQ2852 0.145 0.286

SEQ0299 0.122 0.257 SEQ1 182 0.126 0.743 SEQ2157 0.043 0.743 SEQ2857 0.034 0.843

SEQ0309 0.383 0.729 SEQ1 184 0.015 0.814 SEQ2159 0.228 0.7 SEQ2859 0.1 1 1 0.3

SEQ0317 0.082 0.214 SEQ1 189 0.097 0.757 SEQ2171 0.2 0.7 SEQ2860 0.075 0.214

SEQ0331 0.2 0.286 SEQ1 192 0.1 15 0.3 SEQ2176 0.036 0.771 SEQ2891 0.18 0.286

SEQ0334 0.155 0.757 SEQ1204 0.19 0.7 SEQ2177 0.335 0.714 SEQ2916 0.101 0.257

SEQ0343 0.1 19 0.743 SEQ1207 0.016 0.829 SEQ2192 0.285 0.729 SEQ2920 0.084 0.229

SEQ0359 0.081 0.257 SEQ1213 0.008 0.086 SEQ2202 0.173 0.3 SEQ2922 0.126 0.186

SEQ0373 0.209 0.714 SEQ1222 0.068 0.214 SEQ2204 0.122 0.243 SEQ2924 0.034 0.829

SEQ0393 0.175 0.271 SEQ1237 0.059 0.186 SEQ2205 0.154 0.743 SEQ2928 0.268 0.7

SEQ0394 0.041 0.157 SEQ1241 0.22 0.3 SEQ2217 0.195 0.286 SEQ2930 0.247 0.257

SEQ0395 0.096 0.729 SEQ1242 0.347 0.257 SEQ2226 0.12 0.729 SEQ2933 0.081 0.229

SEQ0398 0.32 0.714 SEQ1268 0.06 0.757 SEQ2227 0.024 0.157 SEQ2956 0.1 13 0.271

SEQ0405 0.168 0.286 SEQ1270 0.121 0.257 SEQ2234 0.16 0.257 SEQ2957 0.091 0.286

SEQ0412 0.522 0.229 SEQ1273 0.147 0.257 SEQ2235 0.065 0.214 SEQ2959 0.885 0.7 SEQ0425 0.284 0.714 SEQ1291 0.067 0.257 SEQ2244 0.63 0.7 SEQ2961 0.014 0.186

SEQ0426 0.1 19 0.7 SEQ1300 0.097 0.8 SEQ2252 0.006 0.9 SEQ2963 0.128 0.714

SEQ0427 0.128 0.757 SEQ1304 0.216 0.714 SEQ2264 0.206 0.3 SEQ2967 0.134 0.257

SEQ0434 0.381 0.7 SEQ1310 0.022 0.157 SEQ2268 0.013 0.086 SEQ2972 0.378 0.743

SEQ0440 0.15 0.714 SEQ1321 0.081 0.257 SEQ2270 0.146 0.257 SEQ2974 0.169 0.743

SEQ0441 0.122 0.243 SEQ1328 0.129 0.3 SEQ2273 0.026 0.857 SEQ2977 0.043 0.129

SEQ0467 0.201 0.7 SEQ1336 0.047 0.743 SEQ2279 0.121 0.3 SEQ2978 0.261 0.271

SEQ0474 0.252 0.757 SEQ1343 0.132 0.714 SEQ2281 0.108 0.714 SEQ2986 0.062 0.229

SEQ0479 0.073 0.214 SEQ1345 0.188 0.286 SEQ2289 0.145 0.7 SEQ2988 0.141 0.257

SEQ0482 0.231 0.714 SEQ1350 0.1 18 0.3 SEQ2294 0.082 0.729 SEQ2993 0.026 0.171

SEQ0490 0.13 0.714 SEQ1354 0.181 0.714 SEQ2297 0.619 0.714 SEQ2995 0.152 0.286

SEQ0493 0.142 0.714 SEQ1369 0.141 0.271 SEQ2305 0.082 0.757 SEQ2996 0.197 0.3

SEQ0494 0.095 0.743 SEQ1378 0.28 0.286 SEQ2309 0.1 17 0.757 SEQ2997 0.054 0.243

SEQ0501 0.093 0.271 SEQ1379 0.181 0.743 SEQ2318 0.066 0.714 SEQ2998 0.089 0.243

SEQ0502 0.178 0.7 SEQ1381 0.757 0.286 SEQ2319 0.264 0.3 SEQ3009 0.224 0.3

SEQ0510 0.108 0.3 SEQ1384 0.095 0.271 SEQ2321 0.021 0.771 SEQ3017 0.168 0.271

SEQ0515 0.085 0.229 SEQ1398 0.468 0.3 SEQ2326 0.126 0.743 SEQ3027 0.389 0.3

SEQ0534 0.43 0.743 SEQ1403 0.096 0.757 SEQ2334 0.285 0.257 SEQ3030 0.165 0.271

SEQ0536 0.074 0.743 SEQ1406 0.108 0.271 SEQ2336 0.085 0.757 SEQ3040 0.036 0.8

SEQ0538 0.259 0.7 SEQ1409 0.218 0.229 SEQ2339 0.15 0.729 SEQ3042 0.214 0.186

SEQ0540 0.038 0.2 SEQ141 1 0.091 0.757 SEQ2347 0.043 0.743 SEQ3054 0.188 0.243

SEQ0542 0.021 0.857 SEQ1426 0.165 0.714 SEQ2355 0.207 0.3 SEQ3058 0.091 0.757

SEQ0547 0.12 0.729 SEQ1433 0.006 0.129 SEQ2375 0.349 0.3 SEQ3064 0.171 0.714

SEQ0549 0.104 0.743 SEQ1439 0.056 0.229 SEQ2379 0.036 0.857 SEQ3067 0.148 0.286

SEQ0550 0.137 0.743 SEQ1440 0.198 0.3 SEQ2382 0.072 0.229 SEQ3069 0.291 0.3

SEQ0552 0.151 0.743 SEQ1445 0.229 0.7 SEQ2386 0.172 0.257 SEQ3077 0.212 0.3

SEQ0571 0.415 0.271 SEQ1458 0.149 0.771 SEQ2388 0.289 0.271 SEQ3078 0.057 0.786

SEQ0574 0.168 0.3 SEQ1474 0.092 0.257 SEQ2389 0.015 0.171 SEQ3079 0.031 0.186

SEQ0581 0.081 0.729 SEQ1478 0.27 0.3 SEQ2392 0.189 0.243 SEQ3083 0.171 0.286

SEQ0596 0.208 0.229 SEQ1490 0.223 0.3 SEQ2393 0.124 0.257 SEQ3092 0.283 0.243

SEQ0598 0.352 0.3 SEQ1491 0.195 0.3 SEQ2395 0.068 0.714 SEQ3102 0.209 0.3

SEQ0603 0.238 0.286 SEQ1493 0.042 0.2 SEQ2402 0.438 0.714 SEQ311 1 0.303 0.286

SEQ0615 0.231 0.257 SEQ1495 0.185 0.3 SEQ2405 0.001 0.929 SEQ3119 0.042 0.229

SEQ0617 0.174 0.714 SEQ1504 0.21 1 0.271 SEQ2406 0.049 0.186 SEQ3124 0.04 0.829

SEQ0620 0.06 0.257 SEQ1508 0.1 15 0.157 SEQ2408 0.22 0.257 SEQ3126 0.158 0.714

SEQ0635 0.089 0.214 SEQ1515 0.251 0.257 SEQ2409 0.045 0.829 SEQ3129 0.152 0.271 SEQ0636 0.148 0.743 SEQ1516 0.21 0.729 SEQ2410 0.102 0.257 SEQ3140 0.185 0.271

SEQ0659 0.005 0.914 SEQ1536 0.066 0.229 SEQ2420 0.08 0.743 SEQ3141 0.036 0.214

SEQ0677 0.081 0.757 SEQ1537 0.127 0.7 SEQ2427 0.038 0.8 SEQ3142 0.015 0.157

SEQ0698 0.048 0.771 SEQ1539 0.168 0.729 SEQ2429 0.082 0.186 SEQ3144 0.145 0.243

SEQ0702 0.074 0.757 SEQ1548 0.183 0.3 SEQ2433 0.105 0.257 SEQ3147 0.037 0.171

SEQ0707 0.092 0.757 SEQ1558 0.079 0.229 SEQ2437 0.058 0.757 SEQ3148 0.19 0.714

SEQ0709 0.137 0.286 SEQ1570 0.014 0.171 SEQ2440 0.157 0.257 SEQ3154 0.302 0.714

SEQ0716 0.017 0.186 SEQ1573 0.107 0.271 SEQ2450 0.101 0.229 SEQ3156 0.09 0.257

SEQ0724 0.048 0.814 SEQ1576 0.044 0.786 SEQ2454 0.058 0.771 SEQ3157 0.092 0.243

SEQ0731 0.108 0.2 SEQ1587 0.009 0.9 SEQ2459 0.03 0.8 SEQ3169 0.005 0.914

SEQ0748 0.1 1 0.286 SEQ1591 0.192 0.714 SEQ2472 0.2 0.271 SEQ3170 0.428 0.286

SEQ0750 0.009 0.143 SEQ1592 0.24 0.743 SEQ2475 0.303 0.286 SEQ3176 0.032 0.771

SEQ0751 0.102 0.2 SEQ1593 0.032 0.814 SEQ2487 0.1 15 0.786 SEQ3178 0.017 0.2

SEQ0766 0.16 0.714 SEQ1594 0.147 0.286 SEQ2492 0.147 0.3 SEQ3179 0.235 0.3

SEQ0772 0.134 0.286 SEQ1599 0.101 0.729 SEQ2497 0.149 0.729 SEQ3182 0.064 0.786

SEQ0779 0.716 0.714 SEQ1609 0.059 0.186 SEQ2501 0.138 0.743 SEQ3183 0.059 0.743

SEQ0805 0.504 0.714 SEQ1623 0.153 0.271 SEQ2503 0.122 0.7 SEQ3186 0.092 0.2

SEQ0806 0.16 0.3 SEQ1638 0.1 0.3 SEQ251 1 0.314 0.286 SEQ3207 0.123 0.257

SEQ0833 0.067 0.214 SEQ1647 0.181 0.7 SEQ2513 0.048 0.857 SEQ3208 0.138 0.3

SEQ0839 0.178 0.714 SEQ1649 0.054 0.229 SEQ2518 0.075 0.243 SEQ3209 0.1 1 0.257

SEQ0851 0.103 0.743 SEQ1656 0.102 0.271 SEQ2521 0.153 0.286 SEQ3210 0.055 0.757

SEQ0852 0.122 0.243 SEQ1660 0.067 0.786 SEQ2529 0.099 0.271 SEQ3213 0.052 0.157

SEQ0862 0.023 0.843 SEQ1671 0.421 0.257 SEQ2532 0.164 0.714 SEQ3221 0.207 0.3

SEQ0864 0.174 0.257 SEQ1678 0.148 0.286 SEQ2533 0.02 0.157 SEQ3222 0.092 0.229

SEQ0866 0.095 0.7 SEQ1691 0.223 0.7 SEQ2552 0.107 0.214 SEQ3228 0.265 0.3

SEQ0874 0.152 0.7 SEQ1692 0.207 0.7 SEQ2555 0.504 0.3

Correlation between LncRNA and Left Ventricular Ejection Fraction

LncRNAs expression level can be considered as a continuous value. Spearman correlation factor is calculated to measure the correlation between LVEF value at one month and expression level. When a threshold of (+ or -) 0.45 for correlation factor is applied, the expression of 159 IncRNAs is positively or negatively correlated with prediction of LVEF at 1 month. Among these 159 IncRNAs, 94 have a positive correlation factor whereas 65 have a negative correlation factor (Table 22). Table 22: List of 159 IncRNAs with spearman correlation factor higher than 0.45 (absolute value)

SEQ0731 0.518 SEQ1682 0.451 SEQ2513 -0.525 SEQ3176 -0.457

SEQ0766 -0.476 SEQ1687 -0.49 SEQ2542 -0.536 SEQ3178 0.46

SEQ0772 0.524 SEQ1698 -0.53 SEQ2576 0.542 SEQ3183 -0.582

SEQ0833 0.471 SEQ1723 -0.581 SEQ2586 0.524 SEQ3200 0.543

SEQ0841 -0.527 SEQ1740 -0.533 SEQ261 1 0.452 SEQ3207 0.451

SEQ0884 0.472 SEQ1794 0.517 SEQ2636 0.493 SEQ3209 0.533

SEQ0 14 0.454 SEQ1852 -0.541 SEQ2642 0.514 SEQ3213 0.665

SEQ0946 -0.451 SEQ1854 -0.534 SEQ2645 0.471

Comparison of the total RNA-Seq and FiMICS analysis

Detection level and performance of the IncRNAs can vary in function of the method and number of samples used. Figure 6 represent the Venn diagram for each analysis using a threshold of LVEF at 40% and 45% for total RN A- Sequencing and FiMICS test. For the comparison of the 4 conditions, 8 IncRNAs are common to all conditions (SEQ1204, SEQ2454, SEQ0334, SEQ1403, SEQ1089, SEQ2692, SEQ2273, and SEQ0502).

An example of probes sequences designed on FiMICS for the first IncRNA (SEQ1204) includes the below sequences;

j FIMICS Probe sequence IncRNA

GTTCTACTCAAAGGGTCAGTTTAGGGCATAATTAAAGTCAATTACTTT CTGAAAGGCCATCAGGACAACTGTTAGAGAAAATGATAGCAGCCCCG SEQ1204 CACTTGCTGTAGGAATTATTAGCTT

CAGGACAACTGTTAGAGAAAATGATAGCAGCCCCGCACTTGCTGTAG

GAATTATTAGCTTGTCAGCCTCCAGGCTTATGGAGACAAAGGATCAAA SEQ1204

AAGTTAGAGAGATCCAGGTGTTCAC

GTCAGCCTCCAGGCTTATGGAGACAAAGGATCAAAAAGTTAGAGAGA TCCAGGTGTTCACCTATTTGTTCACTAATTCTTTTATTGTGAGTGTGCA SEQ1204 TGTGTGTGGGTGGGTGTGACATTT

CTATTTGTTCACTAATTCTTTTATTGTGAGTGTGCATGTGTGTGGGTGG GTGTGACATTTATTATGAACCAGAGGGCAGGAGCCAGTGACACAGTG SEQ1204 GTGCAGAGAATAATCATATTCCCT

ATTATGAACCAGAGGGCAGGAGCCAGTGACACAGTGGTGCAGAGAAT AATCATATTCCCTGCCTTCCTGGGGTCATACAGCTTGGTGGAGGACAC SEQ1204 AGATGTGAATTCGGTAATCACTCCA

GCCTTCCTGGGGTCATACAGCTTGGTGGAGGACACAGATGTGAATTCG SEQ1204 GTAATCACTCCAATAAATATTCTCCTACAGATGAAGAAAGATGATACG ATGTGATGGACAACAGAGACTTAT

ATAAATATTCTCCTACAGATGAAGAAAGATGATACGATGTGATGGAC

AACAGAGACTTATATGGTGGGGTCTGGGCTGGTCTTTCTGAAGCTAAG SEQ1204

ACTGGCAGGATGAGCAGGAGTTTGC

ATGGTGGGGTCTGGGCTGGTCTTTCTGAAGCTAAGACTGGCAGGATGA

GCAGGAGTTTGCCAGACAAAGAGGAGTGGAGTTGTTTTCCAAACACA SEQ1204

TCTCAGCACAAAGTGTTGTCTTTGC

CAGACAAAGAGGAGTGGAGTTGTTTTCCAAACACATCTCAGCACAAA \

GTGTTGTCTTTGCTGGGAGCTGAAAAAAGATAGTGTGGGCAGAGACC j SEQ1204 ATTAGGTGAGACGCTTGATATGAGAT

TGGGAGCTGAAAAAAGATAGTGTGGGCAGAGACCATTAGGTGAGACG CTTGATATGAGATACAACCTCAACAGGTGGAAGAAGATCATGAGAGA SEQ1204 TGAAGAGAGGAATATAGTACAGCAGA

ACAACCTCAACAGGTGGAAGAAGATCATGAGAGATGAAGAGAGGAA TATAGTACAGCAGAGAGGACACAGAAGCTGACGTCAGGGTGTCTCAG SEQ1204 TTTGAAACCAGTGGCCACCCTGTTCCT

GAGGACACAGAAGCTGACGTCAGGGTGTCTCAGTTTGAAACCAGTGG

CCACCCTGTTCCTCTCCCATGTGGTCCCATCATGGGCCTCTAGGGTCTG SEQ1204

GGATAAGAGGTTAATGAATATCTC

CTCCCATGTGGTCCCATCATGGGCCTCTAGGGTCTGGGATAAGAGGTT j

AATGAATATCTCATACCCTAAGCAGGGGTGGTCCCTGCACTTTAGCAA | SEQ1204 AAAGTTAAGGAACTAGGGAAAAGA

ATACCCTAAGCAGGGGTGGTCCCTGCACTTTAGCAAAAAGTTAAGGA ACTAGGGAAAAGAGATGGAAATAATAAAGAGATGGGACAAAGACTTT | SEQ1204 GAAGACCAAAGCCCCTGGGCTATTCT

GATGGAAATAATAAAGAGATGGGACAAAGACTTTGAAGACCAAAGCC j

CCTGGGCTATTCTCTTTTTTAAATTTTTTTATTTAAATTTTCATTTATTT | SEQ1204 TTATCAAGATAGGGTCTCACTAT

CTTTTTTAAATTTTTTTATTTAAATTTTCATTTATTTTTATCAAGATAGG j

GTCTCACTATGTTGCCCAGGTTGGTCTCAAACTTTTGGCCTAAAGCAA | SEQ1204 TCCTCCCACCTTGGCCTCCCAA

GTTGCCCAGGTTGGTCTCAAACTTTTGGCCTAAAGCAATCCTCCCACC |

TTGGCCTCCCAATGTGCTGGGATTACAATGTGAGCCACCACGTCCAGC SEQ1204 CTCCTGGGATATTTCTCAATGAAA

TGTGCTGGGATTACAATGTGAGCCACCACGTCCAGCCTCCTGGGATAT j

TTCTCAATGAAACATTGGATGCCAAGATTGGTTTTGTGCCACATGCCA I SEQ1204 ATTTCACAGAAGCCAGTCTATGAG CATTGGATGCCAAGATTGGTTTTGTGCCACATGCCAATTTCACAGAAG CCAGTCTATGAGCCACCAGCTCTACTCAGCAATTACAGTTTCTGGAAC TTTGGCTAAATTCCTGTAGATGCA

CCACCAGCTCTACTCAGCAATTACAGTTTCTGGAACTTTGGCTAAATT CCTGTAGATGCACCACTGCTTGTGGCCTGACTCTTTGCCACCCAAGTG CGCTCAGCCTCCCCTGGGGAGTCT

CCACTGCTTGTGGCCTGACTCTTTGCCACCCAAGTGCGCTCAGCCTCCC

CTGGGGAGTCTGCCAGGCTTGCATGGCTCCCACTGCACTTGCTGTGCT

GGGACCGAAAACAGTTTTTGTGC

GCCAGGCTTGCATGGCTCCCACTGCACTTGCTGTGCTGGGACCGAAAA CAGTTTTTGTGCCCCTAGCTTAACTCCACTGGATTCATAGAGGCTTTGG CCTCCTCAATGGCTGTCCTGGGA

CCCTAGCTTAACTCCACTGGATTCATAGAGGCTTTGGCCTCCTCAATG GCTGTCCTGGGACAGGGAGGCTGGTTAGCACAATTAACACAACCTGG SEQ1204 TCATGCAAGGCATTGATGGTCCGTA

CAGGGAGGCTGGTTAGCACAATTAACACAACCTGGTCATGCAAGGCA TTGATGGTCCGTAACATGAACTTTGACCAGTAGGAGACAGAGAATGG SEQ1204 AAAAAAGCCAGCAGATAAATCATCTG

ACATGAACTTTGACCAGTAGGAGACAGAGAATGGAAAAAAGCCAGCA

GATAAATCATCTGGCCTTCCTCCCCTATGACAGACTGTTCTGAGCCAC SEQ1204

AGTGTTTCACATGTCTTCCTGGAGA

GCCTTCCTCCCCTATGACAGACTGTTCTGAGCCACAGTGTTTCACATGT CTTCCTGGAGATGTCCCACATGACTTGAGCAACCAGCTGGAGCTCTGG SEQ1204 AGAAACTGTGGCCATCCTGGTAA

TGTCCCACATGACTTGAGCAACCAGCTGGAGCTCTGGAGAAACTGTGG ]

CCATCCTGGTAACATATGACCTTGTATTTGCTTTCTCTCCTTCCTGCTTT | SEQ1204 ATTTCCCTATGTCCCTTACTTT

CTGTGGCCATCCTGGTAACATATGACCTTGTATTTGCTTTCTCTCCTTC CTGCTTTATTTCCCTATGTCCCTTACTTTGGTTGTTGGGATTGCACCTCC | SEQ1204 CAATAAAGCATTAGCATGTCC

EXAMPLE 5: LncRNA detection in PAXgene samples using a mRNA-seq protocol

Material and Methods:

Paxgene samples collected at discharge of patient between D3 and D5 from 57 patients with AMI from the MitoCare cohort are used for IncRNA profiling. Mitocare is a multicenter, randomized, double-blind, placebo controlled study. The study population includes AMI patients undergoing PCI, older than 18 years. The primary endpoint is the level of left ventricular ejection fraction (LVEF) less than 40% at 1 month. Demographics data are presented in Table 23. Table 23 : Demographic data of patients used from Mitocare study

RNA extraction, preparation of sequencing libraires and sequencing are performed as described in Example 3. Results:

Comparison between low LVEF (LVEF < 40) and high LVEF (LVEF > 40)

In this analysis, the 57 samples AMI were grouped into 2 groups using the threshold of 40%> LVEF: low LVEF (LVEF < 40) and high LVEF (LVEF > 40). The volcano plot showed the differential expression of IncRNA. 102 IncRNA are differentially expressed and among them, 19 IncRNA have a fold change > 2 or < 0.5, which are shown in Table 24. 171 IncRNAs with P<0.05 and/or individual AUC >0.7 or <0.3 are listed in Table 25.

Table 24: List of 19 IncRNAs which are differentially expressed with a fold change >2 or <0.5 between the low LVEF group (LVEF < 40) and the high LVEF group (LVEF > 40)

SEQ2007 0.0027 0.289 0.744

SEQ0430 0.0039 0.394 0.717

SEQ0110 0.0053 0.33 0.745

SEQ1331 0.0071 0.202 0.712

SEQ0388 0.0104 0.294 0.699

SEQ0585 0.0156 2.091 0.194

SEQ0117 0.0174 0.356 0.673

SEQ0415 0.0204 0.407 0.653

SEQ1263 0.0223 0.471 0.672

SEQ0383 0.0269 0.38 0.708

SEQ0187 0.0281 0.436 0.741

SEQ0611 0.0310 0.355 0.656

SEQ2446 0.0364 0.363 0.663

SEQ0548 0.0389 0.488 0.592

SEQ0074 0.0461 12.549 0.221

Table 25: List of 171 IncRNA, which are differentially expressed and/or have an AUC > 0.7 or < 0.3 between the low LVEF group (LVEF < 40) and the high LVEF group (LVEF > 40)

SEQ0360 0.0816 0.263 SEQ1 116 0.01 18 0.23 SEQ1976 0.0367 0.643 SEQ2814 0.1279 0.298

SEQ0367 0.0418 0.666 SEQ1 151 0.0542 0.255 SEQ2003 0.0712 0.714 SEQ2855 0.022 0.217

SEQ0383 0.0269 0.708 SEQ1 170 0.0012 0.744 SEQ2007 0.0027 0.744 SEQ2863 0.0823 0.298

SEQ0388 0.0104 0.699 SEQ1209 0.0023 0.184 SEQ2025 0.028 0.676 SEQ2878 0.0148 0.191

SEQ0409 0.0056 0.73 SEQ121 1 0.0298 0.758 SEQ2042 0.0214 0.704 SEQ2887 0.082 0.298

SEQ0415 0.0204 0.653 SEQ1252 0.0275 0.222 SEQ2057 0.025 0.245 SEQ2928 0.0927 0.286

SEQ0430 0.0039 0.717 SEQ1263 0.0223 0.672 SEQ2070 0.0208 0.714 SEQ2967 0.0218 0.296

SEQ0435 0.0126 0.214 SEQ1265 0.1 1 12 0.291 SEQ2084 0.0164 0.23 SEQ2992 0.0096 0.209

SEQ0459 0.093 0.733 SEQ1285 0.0491 0.626 SEQ2095 0.082 0.288 SEQ301 1 0.0128 0.189

SEQ0460 0.0418 0.676 SEQ1290 0.0851 0.288 SEQ2150 0.0561 0.224 SEQ3029 0.0721 0.268

SEQ0477 0.0012 0.156 SEQ1300 0.0452 0.625 SEQ2229 0.5132 0.707 SEQ3080 0.0223 0.24

SEQ0493 0.0178 0.722 SEQ1319 0.0549 0.273 SEQ2254 0.0465 0.714 SEQ3118 0.0086 0.194

SEQ0534 0.0453 0.656 SEQ1325 0.0718 0.288 SEQ2277 0.0804 0.276 SEQ3128 0.0276 0.224

SEQ0548 0.0389 0.592 SEQ1331 0.0071 0.712 SEQ2291 0.0315 0.27 SEQ3154 0.0255 0.288

SEQ0559 0.0698 0.273 SEQ1386 0.0312 0.676 SEQ2325 0.0406 0.651 SEQ3160 0.02 0.247

SEQ0566 0.0805 0.263 SEQ1406 0.0161 0.689 SEQ2369 0.0483 0.296 SEQ3184 0.1028 0.26

SEQ0585 0.0156 0.194 SEQ1421 0.1 131 0.264 SEQ2371 0.3109 0.745 SEQ3186 0.0802 0.291

SEQ0598 0.0505 0.263 SEQ1451 0.0196 0.709 SEQ2387 0.1645 0.296 SEQ3203 0.0226 0.235

SEQ0608 0.0648 0.714 SEQ1458 0.0329 0.635 SEQ2436 0.0619 0.247 SEQ3235 0.01 14 0.232

SEQ061 1 0.031 0.656 SEQ1460 0.1292 0.298 SEQ2446 0.0364 0.663

For this classification, the variable selection was performed by using a Random Forest model. A combination of 20 pre-selected IncRNA through a Random Forest Classifier (Table 26) is the best predictive model obtained here. The IncRNAs were selected using a random forest algorithm. The model was produced with Naives Bayes algorithm. This model has an area under the receiver-operating characteristic curve (AUC) of 0.834, an accuracy of 0.895, a sensitivity of 0.918, a specificity of 0.75, a Positive Predictive Value (PPV) of 0.957 and Negative Predictive Value (PNV) of 0.6. The confusion matrix is presented in Table 27. Table 26: List of 20 pre-selected IncRNA through a Random Forest Classifier for the classification low LVEF (LVEF < 40) and high LVEF (LVEF > 40)

SEQ1418 9

SEQ1025 10

SEQ0265 11

SEQ1311 12

SEQ2540 13

SEQ2323 14

SEQ3011 15

SEQ2447 16

SEQ2863 17

SEQ2697 18

SEQ3128 19

SEQ2265 20

Table 27: Confusion matrix of the best model for this classification

Comparison between low LVEF (LVEF < 45) and high LVEF (LVEF > 45)

In this analysis, the 57 samples AMI were grouped into 2 groups using the threshold of 45% LVEF: low LVEF (LVEF < 45) and high LVEF (LVEF > 45). The volcano plot showed the differential expression of IncRNA. 110 IncRNA are differentially expressed and among them 11 IncRNA have a fold change > 2 or < 0.5, which are in Table 28. 112 IncRNAs with P<0.05 and/or individual AUC >0.7 or <0.3 are listed in Table 29.

Table 28: List of 11 IncRNAs which are differentially expressed with a fold change >2 or <0.5between the low LVEF group (LVEF < 40) and the high LVEF group (LVEF > 40)

SEQ2168 0.04815 0.452 0.627

Table 29: List of 112 IncRNAs which are differentially expressed and/or have an AUC > 0.7 or < 0.3 between the low LVEF group (LVEF < 40) and the high LVEF group (LVEF > 40)

For this classification, the variable selection was performed by using a Random Forest model. A combination of 11 pre-selected IncRNA through a Random Forest Classifier (Table 30) is the best predictive model obtained here. The IncRNAs were selected using a random forest algorithm. This model has an area under the receiver-operating characteristic curve (AUC) of 0.905, an accuracy of 0.807, a sensitivity of 0.927, a specificity of 0.5, a Positive Predictive Value (PPV) of 0.826 and Negative Predictive Value (PNV) of 0.727. The confusion matrix presented in Table 31.

Table 30: List of 11 pre-selected IncRNA through a Random Forest Classifier for the classification low LVEF (LVEF < 45) and high LVEF (LVEF > 45)

Table 31 : Confusion matrix of the best model for this classification

Example 6: Analysis control subject versus AMI patients at DO Total Seq on Cardiac enriched IncRNAs

Quantification of IncRNAs in body fiuids including but not limited to whole blood, serum, plasma, urine, saliva is a non-invasive way to develop a diagnostic test to use in clinics. The expression of circulating IncRNA is studied in serum samples from patients with AMI and control subjects.

Serum samples collected at DO of patient with AMI from the MitoCare cohort and control subject of chronobio logical study are used for IncRNA profiling. Mitocare demographics are presented in Table 3. Technical workflow is identical as described in Example 3. Results:

Comparison between control subject versus AMI patients at DO

First, samples are grouped into 2 group by a dichotomized variable: patients with cardiac disorder (AMI) and subjects with no cardiac disease. We found that 1736 IncRNAs are differentially expressed (p<0.05). Most of the IncRNAs are overexpressed in patient undergoing an AMI. We show here that the IncRNAs identified in heart biopsie are biomarkers for diagnosis of heart diseases. By selecting IncRNAs with p<0.01 ; a fold change >2 or < 0.5 and an individual AUC > 0.8 or < 0.2, we identified a list of 288 IncRNAs that can diagnose AMI or heart diseases (Table 32).

Table 32: list of 288 IncRNAs differentially expressed, with a fold change >2 or < 0.5 and an individual AUC > 0.8 or < 0.2.

SEQ0350 0.00000 0.38 0.10 SEQ121 1 0.00000 0.47 0.02 SEQ2065 0.00000 0.43 0.02

SEQ0365 0.00001 0.47 0.14 SEQ1220 0.00000 0.41 0.12 SEQ2070 0.00000 0.32 0.12

SEQ0368 0.00022 0.32 0.20 SEQ1239 0.00001 0.43 0.14 SEQ2071 0.00001 0.37 0.13

SEQ0372 0.00009 0.35 0.18 SEQ1253 0.00030 0.28 0.17 SEQ2077 0.00005 0.10 0.07

SEQ0374 0.00032 0.23 0.17 SEQ1276 0.00164 0.40 0.19 SEQ2082 0.00000 0.42 0.12

SEQ0383 0.00054 0.49 0.19 SEQ1291 0.00000 0.38 0.08 SEQ2085 0.00002 0.28 0.14

SEQ0387 0.00006 0.41 0.18 SEQ1297 0.00000 0.43 0.02 SEQ2093 0.00000 0.26 0.10

SEQ0396 0.00019 0.34 0.17 SEQ1301 0.0001 1 0.25 0.16 SEQ2108 0.00000 0.21 0.07

SEQ0402 0.00021 0.36 0.20 SEQ1306 0.00015 0.15 0.17 SEQ2127 0.00322 0.36 0.16

SEQ0439 0.00029 0.45 0.19 SEQ1307 0.00005 0.30 0.16 SEQ2129 0.00000 0.47 0.13

SEQ0465 0.00000 0.31 0.05 SEQ1314 0.00001 0.46 0.14 SEQ2133 0.00061 0.45 0.19

SEQ0486 0.00041 0.46 0.19 SEQ1320 0.00004 0.18 0.12 SEQ2148 0.00000 2.04 0.89

SEQ0494 0.00003 0.42 0.16 SEQ1336 0.00006 0.48 0.17 SEQ2156 0.00010 0.18 0.16

SEQ0499 0.00000 0.38 0.13 SEQ1350 0.00008 0.48 0.19 SEQ2161 0.00000 2.05 0.93

SEQ0507 0.00001 0.17 0.13 SEQ1357 0.00008 0.29 0.13 SEQ2163 0.00000 0.19 0.05

SEQ051 1 0.00016 0.44 0.17 SEQ1367 0.00010 0.34 0.16 SEQ2173 0.00000 0.46 0.04

SEQ0523 0.00000 0.21 0.01 SEQ1372 0.00063 0.46 0.19 SEQ2184 0.00006 0.32 0.14

SEQ0538 0.00059 0.29 0.20 SEQ1374 0.00000 0.48 0.02 SEQ2192 0.00000 0.47 0.1 1

SEQ0559 0.00016 0.47 0.19 SEQ1393 0.00000 0.37 0.12 SEQ2196 0.00005 0.44 0.16

SEQ0560 0.00027 0.34 0.19 SEQ1404 0.00001 0.42 0.14 SEQ2198 0.00010 0.49 0.18

SEQ0564 0.00000 0.28 0.08 SEQ1415 0.00000 0.23 0.06 SEQ2207 0.00004 0.24 0.13

SEQ0572 0.00000 0.21 0.09 SEQ1424 0.00024 0.31 0.17 SEQ2245 0.00002 0.38 0.16

SEQ0589 0.00018 0.48 0.19 SEQ1434 0.00005 0.26 0.17 SEQ2250 0.00000 0.49 0.05

SEQ0594 0.00000 20.93 1.00 SEQ1469 0.00000 0.45 0.03 SEQ2260 0.00024 2.31 0.82

SEQ0597 0.00009 0.17 0.09 SEQ1477 0.00000 2.06 0.90 SEQ2280 0.00012 0.12 0.12

SEQ0599 0.00001 0.40 0.12 SEQ1484 0.00000 0.42 0.04 SEQ2295 0.00000 0.41 0.13

SEQ0639 0.00005 2.02 0.85 SEQ1492 0.00007 0.26 0.18 SEQ2310 0.00002 0.21 0.16

SEQ0647 0.00000 0.43 0.10 SEQ1499 0.00000 0.37 0.09 SEQ2343 0.00017 0.33 0.20

SEQ0657 0.00000 0.49 0.08 SEQ1502 0.00004 0.22 0.17 SEQ2373 0.00000 0.47 0.03

SEQ0662 0.00024 0.31 0.17 SEQ1509 0.00000 0.32 0.12 SEQ2406 0.00014 2.65 0.81

SEQ0664 0.00001 0.42 0.15 SEQ1523 0.00027 0.31 0.16 SEQ2420 0.00001 0.40 0.12

SEQ0668 0.00015 0.29 0.18 SEQ1532 0.00005 0.17 0.16 SEQ2462 0.00000 0.36 0.08

SEQ0674 0.00000 0.47 0.13 SEQ1534 0.00000 0.48 0.00 SEQ2479 0.00063 0.49 0.19

SEQ0685 0.00009 0.46 0.17 SEQ1537 0.00009 0.40 0.15 SEQ2488 0.00000 0.40 0.09

SEQ0696 0.00010 0.29 0.16 SEQ1567 0.00012 0.47 0.16 SEQ2489 0.00018 2.10 0.81

SEQ0697 0.00000 0.23 0.12 SEQ1572 0.00003 0.43 0.15 SEQ2571 0.00001 0.36 0.14

SEQ0707 0.00000 0.43 0.05 SEQ1582 0.00026 0.13 0.17 SEQ2584 0.00000 0.45 0.07

SEQ0710 0.00003 0.40 0.17 SEQ1585 0.00026 2.17 0.83 SEQ2603 0.00000 0.42 0.02

SEQ0714 0.00002 0.37 0.1 1 SEQ1587 0.00000 0.40 0.10 SEQ2676 0.00000 0.49 0.12

SEQ0745 0.00044 0.38 0.19 SEQ1597 0.00009 0.19 0.16 SEQ2682 0.00000 0.46 0.05

SEQ0755 0.00000 0.19 0.08 SEQ1601 0.00001 6.65 0.88 SEQ2766 0.00001 0.19 0.12

SEQ0772 0.00006 2.32 0.82 SEQ1608 0.00046 0.44 0.20 SEQ2832 0.00064 0.45 0.19

SEQ0804 0.00012 0.35 0.20 SEQ1612 0.00000 0.08 0.10 SEQ2842 0.0001 1 0.40 0.19

SEQ0809 0.00075 0.20 0.19 SEQ1624 0.00000 0.41 0.05 SEQ2868 0.00001 0.16 0.07 SEQ0818 0.00000 0.46 0.01 SEQ1625 0.00000 0.21 0.05 SEQ2904 0.00242 0.20 0.14

SEQ0839 0.00000 0.42 0.04 SEQ1638 0.00001 2.06 0.85 SEQ2924 0.00000 2.10 0.87

SEQ0846 0.00000 0.41 0.03 SEQ1646 0.00000 0.42 0.08 SEQ2939 0.00000 0.49 0.13

SEQ0862 0.00024 0.32 0.19 SEQ1647 0.00000 0.44 0.05 SEQ2946 0.00000 0.41 0.04

SEQ0866 0.00000 0.25 0.1 1 SEQ1652 0.00539 0.21 0.15 SEQ2985 0.00000 0.47 0.03

SEQ0884 0.00004 0.44 0.17 SEQ1670 0.00036 0.34 0.20 SEQ2996 0.00047 0.15 0.17

SEQ0886 0.00001 0.32 0.12 SEQ1680 0.00003 0.26 0.13 SEQ3006 0.00002 0.43 0.16

SEQ0899 0.00000 0.38 0.10 SEQ1716 0.00000 0.12 0.10 SEQ3073 0.00037 0.37 0.19

SEQ0 16 0.00000 0.41 0.03 SEQ1717 0.00062 0.05 0.15 SEQ3133 0.00000 0.39 0.02

SEQ0917 0.00003 0.33 0.15 SEQ1719 0.00038 0.30 0.20 SEQ3139 0.00000 0.28 0.07

SEQ0936 0.00005 0.45 0.17 SEQ1721 0.00001 0.37 0.15 SEQ3198 0.00000 0.46 0.08

SEQ0939 0.00009 0.29 0.19 SEQ1731 0.00000 0.06 0.09 SEQ3212 0.00000 0.49 0.09

SEQ0949 0.00000 0.45 0.05 SEQ1732 0.00002 0.45 0.14 SEQ3220 0.00033 0.41 0.19

Correlation between IncRNA expression at DO and LVEF at 3 days

In order to predict outcome of patient suffering from AMI at day 3 and recovery of the patients, LVEF at day 3 is considered as continuous value and spearman correlation is performed between IncRNA expression at DO and LVEF at day 3. We found that 72 IncRNAs present a correlation factor over 0.45 or below -0.45 as represented in Table 33. These IncRNAs can be used as predictor of outcome 3 days after AMI to evaluate LVEF.

Table 33: 72 IncRNAs with spearman correlation factor over 0.45 or below -0.45 wit LVEF at D3.

SEQ0741 -0.598 SEQ1848 0.666 SEQ2829 0.587

SEQ0777 -0.617 SEQ1932 -0.531 SEQ2858 -0.457

SEQ0786 -0.529 SEQ1947 -0.477 SEQ2900 0.470

SEQ0900 -0.469 SEQ2091 -0.553 SEQ2907 -0.481

SEQ0903 -0.629 SEQ2095 -0.496 SEQ2996 -0.514

SEQ0947 -0.473 SEQ2244 -0.458 SEQ3054 0.455

SEQ1021 -0.508 SEQ2258 -0.595 SEQ3166 0.551

Among these IncR A, 4 IncR A (SEQ0097, SEQ1947, SEQ1051 and SEQ2996) are differentially expressed between controls and AMI, and are correlated to LVEF value at D3. Example 7: Analysis of Gencode IncRNAs from serum RNA-Seq data.

Quantification of IncRNAs in body fluids including but not limited to whole blood, serum, plasma, urine, saliva is a non-invasive way to develop a diagnostic test to use in clinics. The expression of circulating IncRNA is studied in serum samples from patients with AMI and control subjects.

Serum samples collected at DO and D3-D5 of patient with AMI from the MitoCare cohort and control subject of chronobiological study are used for IncRNA profiling. Mitocare demographics are presented in Table 3. Technical workflow is identical as described in Example 3 and sequencing data are aligned against Gencode database from LNCipedia 5.0. Cardiac enriched IncRNAs (SEQOOOl to SEQ3238) are removed from the analysis. A threshold of 10 CPM in half of samples in one group is applied to consider the IncRNA as positive.

In this analysis, focus is done on circulating IncRNAs to be used as biomarkers for the prediction and monitoring of Left Ventricular Remodeling and development of heart failure.

Comparison between low LVEF (LVEF < 40%) and high LVEF (LVEF > 40%) at D3- D5 serum samples

First, samples are classified into 2 group by a dichotomized variable: 1 -month LVEF < 40% considered as LV dysfunction (Ventricular remodeling) and 1- month LVEF >40% considered as preserved LV function.

291 IncRNA are differentially expressed and among these, 82 IncRNA are differentially expressed and have a fold change > 2 or < 0.5 between the low LVEF (LVEF < 40%) and the high LVEF (LVEF > 40%). The p-value and the fold-change of these IncRNA are listed in the Table 34. 468 IncRNAs which have a p<0.05 and/or an individual AUC >0.7 or <0.3 are listed in Table 35.

Table 34: List of 86 IncRNAs from Gencode database which are differentially expressed (p<0.05) and have a fold change > 2 or < 0.5 between the low LVEF group (LVEF < 40%) and the high LVEF group (LVEF > 40%)

ENST00000609450.1 0.022 0.498 ENST00000419614.1 0.043 2.574

ENST00000501965.2 0.022 2.161 ENST00000604677.1 0.044 3.502

ENST00000441026.1 0.022 2.312 ENST00000440574.1 0.048 2.392

ENST00000432125.2 0.022 2.253 ENST00000435643.1 0.048 0.212

ENST00000609549.1 0.023 0.393 ENST00000587568.1 0.050 3.194

ENST00000514526.1 0.023 0.286 ENST00000413525.1 0.050 4.403

Table 35: List of 468 IncRNA from Gencode database which are differentially expressed (p<0.05) and/or have an AUC > 0.7 or < 0.3 between the low LVEF group (LVEF < 40%) and the high LVEF group (LVEF > 40%)

ENST00000512712.2 00006 00200 ENST00000507957.1 00034 00690 ENST00000608123.1 00067 00295

ENST00000417420.1 00006 00735 ENST00000443562.1 00034 00245 ENST00000602434.1 00067 00715

ENST00000568686.1 00006 00245 ENST00000577528.1 00034 00250 ENST00000441870.1 00067 00295

ENST00000543490.1 00006 00785 ENST00000415706.1 00034 00675 ENST00000449012.1 00068 00270

ENST00000503815.1 00007 00185 ENST00000439964.1 00035 00260 ENST00000610235.1 00069 00285

ENST00000565044.1 00007 00195 ENST00000503593.1 00035 00675 ENST00000427176.1 00070 00295

ENST00000514942.2 00007 00735 ENST00000498457.1 00035 00285 ENST00000417324.1 00070 00300

ENST00000607216.1 00007 00160 ENST00000451992.2 00035 00205 ENST00000610094.1 00071 00290

ENST00000412294.1 00007 00785 ENST00000608465.1 00035 00740 ENST00000594608.1 00071 00300

ENST00000430666.1 00007 00205 ENST00000244820.2 00035 00720 ENST00000607338.1 00071 00295

ENST00000415330.2 00007 00200 ENST00000413304.2 00035 00275 ENST00000606696.1 00073 00700

ENST00000429666.1 00008 00215 ENST00000515184.1 00035 00260 ENST00000513926.1 00073 00285

ENST00000499713.2 00008 00220 ENST00000452795.2 00035 00243 ENST00000596887.1 00074 00705

ENST00000608574.1 00008 00170 ENST00000427213.1 00036 00750 ENST00000433084.1 00074 00290

ENST00000420365.1 00008 00220 ENST00000424451.1 00036 00665 ENST00000600928.1 00074 00240

ENST00000421998.1 00008 00240 ENST00000503403.1 00036 00700 ENST00000606233.1 00075 00280

ENST00000424244.1 00009 00265 ENST00000416506.1 00037 00240 ENST00000439795.1 00076 00280

ENST00000552220.1 00009 00795 ENST00000432038.1 00037 00255 ENST00000310916.3 00076 00710

ENST00000428156.1 00009 00770 ENST00000521805.1 00037 00255 ENST00000457079.1 00077 00295

ENST00000429725.1 00009 00780 ENST00000425914.2 00037 00285 ENST00000443093.2 00078 00255

ENST00000461943.1 00009 00715 ENST00000604716.1 00037 00260 ENST00000443237.1 00078 00300

ENST00000508572.1 00009 00225 ENST00000507565.1 00037 00720 ENST00000424628.1 00079 00290

ENST00000507932.1 00009 00205 ENST00000367716.3 00037 00255 ENST00000587162.1 00079 00300

ENST00000418602.1 00010 00250 ENST00000514239.1 00037 00270 ENST00000609900.1 00080 00705

ENST00000505680.1 00010 00755 ENST00000498480.1 00038 00270 ENST00000608069.1 00081 00775

ENST00000419578.1 00010 00785 ENST00000512435.1 00038 00270 ENST00000600062.1 00081 00700

ENST00000475939.1 00010 00195 ENST00000455988.1 00038 00660 ENST00000566840.1 00081 00295

ENST00000456255.1 00010 00193 ENST00000606056.1 00038 00220 ENST00000507776.1 00082 00250

ENST00000610058.1 0001 1 00775 ENST00000509057.1 00038 00240 ENST00000453732.1 00083 00290

ENST00000607786.1 0001 1 00735 ENST0000060851 1.1 00038 00240 ENST00000452553.1 00083 00295

ENST00000439898.1 0001 1 00255 ENST00000452212.1 00039 00315 ENST00000504250.1 00084 00285

ENST00000519929.1 0001 1 00185 ENST00000510302.1 00039 00780 ENST00000417926.1 00084 00710

ENST00000447181.1 0001 1 00275 ENST0000051 1602.1 00039 00695 ENST00000512035.1 00084 00285

ENST00000504287.1 00012 00745 ENST00000515186.1 00039 00705 ENST00000515286.1 00084 00270

ENST00000435552.1 00012 00260 ENST00000412092.2 00039 00330 ENST00000587306.1 00085 00280

ENST00000366441.2 00012 00745 ENST00000413828.2 00039 00280 ENST00000557729.1 00086 00245

ENST00000441790.1 00012 00780 ENST00000465215.1 00039 00375 ENST00000610091.1 00086 00715

ENST00000505018.1 00012 00755 ENST00000606582.1 00040 00680 ENST00000602919.1 00086 00300

ENST00000496733.2 00012 00730 ENST00000417786.1 00040 00275 ENST00000441773.1 00086 00295

ENST00000440322.1 00012 00770 ENST00000514368.1 00040 00258 ENST00000589150.1 00087 00300

ENST00000514600.1 00012 00725 ENST00000585826.1 00040 00680 ENST00000589487.1 00087 00258

ENST00000441272.2 00013 00265 ENST00000441245.1 00041 00295 ENST00000503589.1 00087 00280

ENST00000466034.1 00013 00525 ENST00000472821.1 00041 00595 ENST00000414765.1 00090 00295

ENST00000587085.1 00013 00750 ENST00000427439.1 00041 00725 ENST00000433186.1 00090 00278 ENST00000399543.1 00013 00230 ENST00000588108.1 00041 00210 ENST00000427804.1 00091 00295

ENST00000595732.1 00013 00220 ENST00000441504.1 00041 00683 ENST00000439246.1 00091 00265

ENST00000399152.2 00013 00705 ENST00000494582.1 00041 00675 ENST00000431268.1 00091 00260

ENST00000414128.1 00014 00215 ENST00000506465.1 00041 00280 ENST00000510637.1 00091 00745

ENST00000502934.1 00014 00765 ENST0000051 1385.1 00041 00320 ENST00000446029.1 00092 00288

ENST00000441053.1 00014 00255 ENST00000421640.1 00041 00610 ENST00000503488.2 00092 00705

ENST00000422417.1 00014 00253 ENST00000437290.2 00042 00255 ENST00000462835.1 00093 00285

ENST00000422038.1 00014 00765 ENST00000602108.1 00042 00260 ENST00000435557.1 00093 00290

ENST00000607723.1 00015 00750 ENST00000416349.1 00042 00705 ENST00000515405.1 00093 00240

ENST00000503037.1 00015 00195 ENST00000445180.2 00042 00235 ENST00000423921.1 00093 00190

ENST0000051581 1.1 00015 00815 ENST0000051 1592.1 00042 00675 ENST00000515842.1 00094 00295

ENST00000424215.1 00015 00230 ENST00000477246.1 00042 00300 ENST00000599448.1 00094 00235

ENST00000482381.1 00015 00240 ENST00000512155.1 00042 00310 ENST00000605698.1 00095 00300

ENST00000410830.1 00015 00235 ENST00000608077.1 00042 00290 ENST00000510753.1 00095 00715

ENST00000513572.1 00016 00760 ENST00000415629.2 00043 00275 ENST00000414634.1 00097 00293

ENST00000594898.1 00016 00783 ENST00000424474.2 00043 00280 ENST00000517934.1 00098 00270

ENST00000479610.1 00016 00255 ENST00000605740.1 00043 00730 ENST00000510850.1 00099 00700

ENST00000502861.1 00016 00790 ENST00000489690.1 00043 00283 ENST00000414688.1 00099 00710

ENST00000455541.1 00016 00205 ENST00000607950.1 00043 00285 ENST00000273083.3 00099 00290

ENST00000459861.1 00016 00235 ENST00000513219.1 00043 00265 ENST00000552418.1 00099 00285

ENST00000424592.1 00016 00720 ENST00000419614.1 00043 00675 ENST00000436248.3 00100 00275

ENST00000424246.1 00017 00750 ENST00000413234.1 00043 00285 ENST00000439893.1 00102 00250

ENST00000492209.1 00017 00265 ENST00000420549.1 00043 00720 ENST00000427354.1 00102 00235

ENST00000448134.1 00017 00230 ENST00000458698.2 00043 00290 ENST00000517299.1 00103 00295

ENST00000510853.2 00017 00240 ENST00000482019.1 00043 00310 ENST0000056971 1.1 00104 00280

ENST0000043191 1.1 00017 00200 ENST00000509984.1 00044 00270 ENST00000453347.1 00106 00300

ENST0000045171 1.1 00017 00215 ENST00000501927.2 00044 00285 ENST00000507373.1 00107 00295

ENST00000452618.1 00017 00705 ENST00000439024.1 00044 00658 ENST00000453155.1 00108 00295

ENST00000568928.1 00017 00765 ENST0000051 1993.1 00044 00215 ENST00000465946.1 00108 00300

ENST00000563320.1 00018 00775 ENST00000515128.1 00044 00665 ENST00000515086.1 00109 00280

ENST00000437488.1 00018 00240 ENST00000604677.1 00044 00665 ENST00000449086.1 001 10 00745

ENST00000443066.2 00018 00743 ENST00000606180.1 00045 00250 ENST00000540997.1 001 1 1 00705

ENST00000445791.1 00018 00745 ENST00000577914.1 00045 00290 ENST00000572124.1 001 1 1 00705

ENST00000457169.1 00018 00685 ENST00000440900.1 00045 00690 ENST00000508986.1 00120 00288

ENST00000417260.1 00018 00765 ENST0000043131 1.1 00046 00295 ENST00000505028.1 00120 00295

ENST00000448977.1 00018 00705 ENST00000484076.1 00047 00665 ENST00000426444.1 00122 00285

ENST00000509745.1 00019 00230 ENST00000451101.1 00047 00265 ENST00000507916.2 00124 00700

ENST00000420272.2 00019 00250 ENST00000381078.1 00047 00290 ENST00000514265.1 00126 00725

ENST00000447761.1 00019 00720 ENST00000609423.1 00047 00250 ENST00000510632.1 00126 00295

ENST00000449845.1 00019 00220 ENST00000513955.1 00048 00730 ENST00000597651.1 00127 00295

ENST00000527035.1 00019 00215 ENST00000445070.1 00048 00720 ENST00000443800.1 00132 00300

ENST00000484765.2 00020 00255 ENST00000440574.1 00048 00720 ENST00000508255.1 00134 00295

ENST00000428891.1 00020 00240 ENST00000435643.1 00048 00260 ENST00000607847.1 00137 00705

ENST00000450325.1 00021 00255 ENST00000609657.1 00048 00720 ENST00000430904.1 00140 00295 ENST00000430542.1 00021 00785 ENST00000512464.1 00048 00725 ENST00000594622.1 00142 00700

ENST00000522525.1 00021 00735 ENST0000041 1509.1 00048 00635 ENST00000436121.1 00144 00710

ENST00000507582.1 00021 00240 ENST00000607412.1 00049 00675 ENST00000503757.1 00145 00280

ENST00000505877.1 00021 00775 ENST00000430520.1 00049 00260 ENST0000050701 1.1 00146 00270

ENST00000602445.1 00022 00525 ENST00000512882.2 00049 00665 ENST00000609270.1 00146 00735

ENST00000431569.1 00022 00668 ENST0000051 1327.1 00049 00735 ENST00000500526.1 00147 00290

ENST00000609450.1 00022 00225 ENST00000436885.1 00049 00275 ENST00000429230.1 00151 00300

ENST00000501965.2 00022 00710 ENST00000604215.1 00049 00685 ENST00000601684.1 00155 00290

ENST00000441026.1 00022 00725 ENST00000443205.1 00049 00610 ENST00000434306.1 00155 00705

ENST00000431500.2 00022 00735 ENST00000504869.1 00049 00255 ENST00000602820.1 00164 00250

ENST00000432125.2 00022 00765 ENST00000587568.1 00050 00690 ENST00000425449.1 00168 00730

ENST00000505668.1 00023 00720 ENST00000608154.1 00050 00320 ENST00000433377.1 00169 00295

ENST00000609549.1 00023 00250 ENST00000510570.1 00050 00698 ENST00000424528.2 00172 00710

ENST00000505736.1 00023 00755 ENST00000451289.1 00050 00720 ENST00000597871.1 00176 00300

ENST00000523648.1 00023 00255 ENST00000458155.1 00050 00710 ENST00000593876.1 00177 00760

ENST00000458254.1 00023 00215 ENST00000606186.1 00050 00295 ENST00000412674.1 00184 00280

ENST00000508719.1 00023 00750 ENST00000413525.1 00050 00650 ENST00000432658.1 00195 00718

ENST00000514526.1 00023 00175 ENST00000438158.1 00050 00295 ENST00000588796.1 00207 00290

ENST00000601486.1 00023 00225 ENST00000483840.1 00050 00760 ENST00000430540.1 00212 00300

ENST00000461864.1 00023 00755 ENST00000604448.1 00051 00725 ENST00000565748.1 00215 00715

ENST00000502100.2 00023 00210 ENST00000414086.1 00051 00250 ENST00000415543.1 00215 00275

ENST00000510946.1 00024 00655 ENST00000457440.1 00052 00280 ENST00000485338.1 00216 00293

ENST00000417481.1 00024 00255 ENST00000503998.1 00052 00720 ENST00000436706.1 00232 00300

ENST00000504436.1 00024 00250 ENST00000603884.1 00052 00735 ENST00000431691.1 00235 00715

ENST00000508352.1 00024 00235 ENST00000444649.1 00052 00280 ENST00000522762.1 00241 00290

ENST00000509416.1 00024 00780 ENST00000504249.1 00052 00280 ENST00000506086.2 00254 00300

ENST00000521819.1 00025 00245 ENST00000433876.2 00053 00270 ENST00000596220.1 00258 00278

ENST00000455929.1 00025 00810 ENST00000607946.1 00053 00265 ENST00000468859.1 00262 00700

ENST00000507361.1 00025 00250 ENST00000508696.1 00053 00708 ENST0000051 1241.1 00268 00290

ENST00000460796.1 00025 00265 ENST00000503009.1 00054 00275 ENST00000457387.1 00276 00285

ENST00000608774.1 00025 00243 ENST00000488287.1 00054 00705 ENST00000451707.1 00307 00715

ENST00000449783.1 00025 00735 ENST00000504989.1 00055 00295 ENST00000524210.1 00317 00720

ENST00000444037.1 00026 00250 ENST00000431999.1 00055 00250 ENST00000458182.1 00323 00280

ENST00000601586.1 00026 00248 ENST00000513871.1 00055 00265 ENST00000447880.1 00324 00300

ENST00000508847.1 00026 00255 ENST00000450709.1 00055 00255 ENST00000508000.1 00380 00720

ENST00000421696.2 00026 00660 ENST00000416395.1 00056 00275 ENST00000432558.1 00463 00265

ENST00000601500.1 00026 00710 ENST00000568817.1 00056 00700 ENST00000465347.1 00474 00300

ENST00000432981.1 00027 00200 ENST00000437267.2 00056 00245 ENST00000514802.1 00571 00295

Comparison between low LVEF (LVEF < 45%) and high LVEF (LVEF > 45%) at D3- D5 serum samples

First, samples are grouped into 2 group by a dichotomized variable: 1 -month LVEF < 45% and 1- month LVEF >45%. 277 IncRNA are differentially expressed and among these, 70 IncRNA are differentially expressed and have a fold change > 2 or < 0.5 between the low LVEF (LVEF < 45%) and the high LVEF (LVEF > 45%) groups. The p-value and the fold-change of these IncRNA are listed in the Table 36. 369 IncRNAs which have a p<0.05 and/or an individual AUC >0.7 or <0.3 are listed in Table 37.

Table 36: List of 70 IncRNA from Gencode database which are differentially expressed (p<0.05) and have a fold change > 2 or < 0.5 between the low LVEF group (LVEF < 45%) and the high LVEF group

(LVEF > 45%)

ENST00000507011.1 0.022 0.282 ENST00000514661.1 0.044 2.482

ENST00000507932.1 0.022 0.289 ENST00000465215.1 0.046 0.179

ENST00000515405.1 0.024 0.256 ENST00000416453.2 0.048 2.769

ENST00000432978.1 0.024 0.453 ENST00000505339.1 0.048 3.529

Table 37: List of 369 IncRNA from Gencode database which are differentially expressed (p<0.05) and/or have an AUC > 0.7 or < 0.3 between the low LVEF group (LVEF < 45%) and the high LVEF group (LVEF > 45%)

ENST00000504246.1 0.006 0.209 ENST00000448786.1 0.030 0.700 ENST00000608881.1 0.051 0.71 1

ENST00000515286.1 0.006 0.218 ENST00000435580.1 0.030 0.320 ENST00000463978.1 0.051 0.720

ENST00000427825.1 0.006 0.236 ENST00000429230.1 0.030 0.236 ENST00000507782.1 0.051 0.293

ENST00000412294.1 0.006 0.778 ENST00000508752.1 0.030 0.707 ENST00000436475.2 0.051 0.720

ENST00000512882.2 0.007 0.791 ENST00000426716.1 0.031 0.713 ENST00000512464.1 0.052 0.720

ENST00000424246.1 0.007 0.769 ENST00000423600.1 0.031 0.271 ENST00000599387.1 0.052 0.702

ENST00000457815.1 0.007 0.769 ENST00000417976.1 0.031 0.707 ENST00000441587.2 0.052 0.716

ENST00000512458.1 0.007 0.251 ENST00000510261.1 0.031 0.71 1 ENST00000504765.1 0.052 0.716

ENST00000510795.1 0.007 0.791 ENST00000442864.1 0.031 0.698 ENST00000430542.1 0.053 0.720

ENST00000422038.1 0.007 0.756 ENST00000442956.1 0.031 0.276 ENST00000549744.1 0.053 0.284

ENST00000428156.1 0.007 0.813 ENST00000458698.2 0.031 0.284 ENST00000441459.1 0.053 0.298

ENST00000514724.2 0.007 0.267 ENST00000506305.1 0.032 0.280 ENST00000453988.1 0.055 0.249

ENST00000418602.1 0.008 0.244 ENST00000599448.1 0.032 0.258 ENST00000414634.1 0.056 0.278

ENST00000506892.1 0.008 0.258 ENST00000505347.1 0.032 0.293 ENST00000515842.1 0.056 0.289

ENST00000513219.1 0.008 0.240 ENST00000436121.1 0.033 0.760 ENST00000456897.1 0.057 0.284

ENST00000420365.1 0.008 0.249 ENST00000606217.1 0.033 0.284 ENST00000449673.1 0.057 0.276

ENST00000602528.1 0.009 0.778 ENST00000608360.1 0.033 0.298 ENST0000051 1091.1 0.057 0.702

ENST00000430666.1 0.009 0.218 ENST00000439024.1 0.033 0.667 ENST00000449783.1 0.057 0.733

ENST00000508486.2 0.009 0.773 ENST00000414030.1 0.033 0.276 ENST00000414938.1 0.058 0.253

ENST00000607216.1 0.010 0.227 ENST00000437798.1 0.034 0.329 ENST0000051581 1.1 0.058 0.716

ENST00000456255.1 0.010 0.233 ENST00000449845.1 0.034 0.284 ENST00000589853.1 0.060 0.71 1

ENST00000424895.1 0.01 1 0.747 ENST00000566840.1 0.034 0.262 ENST00000476125.1 0.061 0.707

ENST00000565428.1 0.01 1 0.258 ENST00000460574.1 0.034 0.280 ENST00000451992.2 0.062 0.262

ENST00000503037.1 0.01 1 0.240 ENST00000438553.1 0.034 0.729 ENST00000562191.1 0.062 0.724

ENST00000503929.1 0.01 1 0.773 ENST00000605571.1 0.034 0.267 ENST00000505572.1 0.062 0.716

ENST00000427732.1 0.01 1 0.769 ENST00000439186.1 0.034 0.727 ENST00000434572.1 0.062 0.262

ENST00000427804.1 0.01 1 0.209 ENST00000412369.1 0.034 0.298 ENST00000454348.1 0.064 0.271

ENST00000506292.2 0.01 1 0.244 ENST00000412483.1 0.035 0.262 ENST00000482609.1 0.064 0.262

ENST00000452738.1 0.01 1 0.738 ENST00000607830.1 0.035 0.284 ENST0000051 1241.1 0.064 0.213

ENST00000420549.1 0.012 0.804 ENST00000505348.1 0.035 0.729 ENST00000504263.1 0.070 0.716

ENST00000445523.1 0.012 0.769 ENST00000600693.1 0.036 0.267 ENST00000418925.1 0.071 0.298

ENST00000357876.5 0.012 0.249 ENST00000438002.1 0.036 0.293 ENST00000417482.1 0.071 0.271

ENST00000513572.1 0.012 0.751 ENST00000431435.1 0.036 0.716 ENST00000514265.1 0.072 0.742

ENST00000443613.2 0.012 0.240 ENST00000521819.1 0.036 0.331 ENST00000467438.1 0.072 0.244

ENST00000600062.1 0.012 0.764 ENST00000569502.1 0.036 0.293 ENST00000608069.1 0.073 0.71 1

ENST00000479610.1 0.012 0.267 ENST00000508968.1 0.036 0.287 ENST00000587696.1 0.076 0.293

ENST00000588108.1 0.013 0.200 ENST00000413304.2 0.037 0.320 ENST00000609583.1 0.076 0.300

ENST00000446139.1 0.013 0.791 ENST00000562952.1 0.037 0.724 ENST0000044641 1.1 0.076 0.738

ENST00000510381.2 0.013 0.773 ENST00000598349.1 0.037 0.649 ENST00000443093.2 0.077 0.253

ENST00000514877.1 0.013 0.233 ENST00000453568.1 0.037 0.280 ENST00000431759.1 0.077 0.289

ENST00000426551.1 0.013 0.284 ENST00000482019.1 0.037 0.324 ENST00000418387.1 0.078 0.733

ENST00000507361.1 0.013 0.244 ENST00000418244.1 0.037 0.269 ENST00000419609.1 0.079 0.716

ENST00000504046.1 0.013 0.769 ENST00000443800.1 0.037 0.271 ENST00000466225.2 0.079 0.280

ENST00000462431.1 0.013 0.787 ENST00000435023.1 0.037 0.307 ENST00000513926.1 0.081 0.298 ENST00000491676.1 0.013 0.244 ENST00000440545.1 0.037 0.724 ENST00000437631.1 0.082 0.760

ENST00000440516.1 0.013 0.764 ENST00000452509.1 0.037 0.724 ENST00000430520.1 0.082 0.296

ENST00000609900.1 0.014 0.800 ENST00000431569.1 0.038 0.61 1 ENST00000506852.1 0.084 0.751

ENST00000589150.1 0.014 0.258 ENST00000439893.1 0.038 0.187 ENST00000510753.1 0.085 0.707

ENST00000596829.1 0.014 0.227 ENST00000508847.1 0.038 0.31 1 ENST00000447389.1 0.089 0.716

ENST00000601955.1 0.014 0.271 ENST00000453128.1 0.039 0.267 ENST00000436262.1 0.091 0.271

ENST00000608482.1 0.015 0.244 ENST00000458254.1 0.039 0.267 ENST00000496242.1 0.091 0.280

ENST00000457489.1 0.015 0.747 ENST00000594189.1 0.039 0.253 ENST00000453324.1 0.092 0.280

ENST00000422996.1 0.015 0.249 ENST00000502934.1 0.040 0.71 1 ENST00000602108.1 0.096 0.267

ENST00000495228.1 0.015 0.253 ENST00000587568.1 0.040 0.720 ENST00000505538.1 0.099 0.298

ENST00000477539.2 0.016 0.756 ENST00000431985.1 0.040 0.302 ENST00000606056.1 0.101 0.280

ENST00000503616.1 0.016 0.262 ENST00000507344.1 0.040 0.738 ENST00000508719.1 0.102 0.702

ENST00000587306.1 0.016 0.244 ENST00000471990.2 0.041 0.702 ENST00000512370.1 0.107 0.271

ENST00000608123.1 0.016 0.267 ENST00000597543.1 0.041 0.702 ENST00000427421.1 0.107 0.293

ENST00000439878.1 0.017 0.238 ENST00000418620.1 0.041 0.302 ENST00000609097.1 0.108 0.71 1

ENST00000607002.1 0.017 0.249 ENST00000443205.1 0.041 0.684 ENST00000602433.1 0.1 16 0.720

ENST00000466291.1 0.017 0.747 ENST00000483840.1 0.041 0.716 ENST00000512090.1 0.1 17 0.298

ENST00000424244.1 0.018 0.253 ENST00000509497.1 0.041 0.302 ENST00000588944.1 0.1 18 0.702

ENST00000455929.1 0.018 0.796 ENST00000412134.1 0.042 0.742 ENST00000426519.1 0.1 19 0.716

ENST00000512417.1 0.018 0.284 ENST0000051 1517.1 0.042 0.31 1 ENST00000506454.1 0.121 0.720

ENST00000506068.1 0.018 0.769 ENST00000503267.1 0.042 0.31 1 ENST00000515337.1 0.126 0.271

ENST00000431650.1 0.018 0.276 ENST00000607662.1 0.042 0.724 ENST00000505371.2 0.127 0.296

ENST00000607723.1 0.018 0.773 ENST00000507517.1 0.042 0.307 ENST00000503685.1 0.131 0.289

ENST00000417765.1 0.019 0.742 ENST00000527035.1 0.042 0.282 ENST00000503163.1 0.132 0.271

ENST00000607540.1 0.019 0.747 ENST00000498480.1 0.042 0.276 ENST00000504829.1 0.136 0.707

ENST00000502467.1 0.019 0.693 ENST00000507251.1 0.042 0.71 1 ENST00000431856.1 0.136 0.716

ENST00000589024.1 0.019 0.738 ENST00000417651.1 0.042 0.280 ENST00000607164.1 0.138 0.738

ENST00000433219.1 0.019 0.276 ENST00000415629.2 0.043 0.333 ENST000005031 13.1 0.141 0.293

ENST00000426881.2 0.019 0.258 ENST00000417805.1 0.043 0.71 1 ENST00000503320.1 0.150 0.298

ENST00000443928.2 0.019 0.244 ENST00000606069.1 0.043 0.298 ENST00000356684.3 0.156 0.702

ENST00000567904.1 0.020 0.258 ENST00000431362.1 0.043 0.253 ENST00000565748.1 0.156 0.702

ENST00000439479.1 0.020 0.276 ENST00000610091.1 0.043 0.729 ENST00000423921.1 0.158 0.276

ENST00000473001.1 0.020 0.276 ENST00000515422.1 0.044 0.698 ENST00000462835.1 0.158 0.289

ENST00000429666.1 0.020 0.247 ENST00000514661.1 0.044 0.644 ENST00000512185.1 0.158 0.298

ENST00000421498.1 0.021 0.676 ENST00000608605.1 0.044 0.31 1 ENST00000513591.1 0.162 0.298

ENST00000455038.1 0.021 0.280 ENST00000414625.2 0.044 0.316 ENST00000366278.2 0.165 0.71 1

ENST00000433175.2 0.022 0.267 ENST00000514600.1 0.044 0.787 ENST00000505018.1 0.166 0.760

ENST00000451101.1 0.022 0.267 ENST00000416209.2 0.044 0.293 ENST00000453370.1 0.166 0.716

ENST00000608777.1 0.022 0.267 ENST00000597366.1 0.044 0.707 ENST00000502100.2 0.178 0.289

ENST00000602919.1 0.022 0.253 ENST00000417695.1 0.044 0.293 ENST00000416221.1 0.190 0.720

ENST0000050701 1.1 0.022 0.242 ENST00000448901.1 0.044 0.760 ENST00000596220.1 0.195 0.267

ENST00000360083.3 0.022 0.760 ENST00000424612.1 0.045 0.31 1 ENST00000593876.1 0.291 0.742

ENST00000420272.2 0.022 0.280 ENST00000606287.1 0.045 0.289 ENST00000602972.1 0.335 0.284

ENST00000507932.1 0.022 0.298 ENST00000607594.1 0.045 0.689 ENST00000456146.1 0.346 0.718 I ENST00000417644.1 | 0.023 | 0.258 | ENST00000367716.3 | 0.045 | 0.293 | ENST00000607769.1 | 0.539 | 0.293 |

Comparison between low LVEF (LVEF < 40%) and high LVEF (LVEF > 40%) at DO in serum samples of AMI patients

First, samples are grouped into 2 groups by a dichotomized variable: 1 -month LVEF < 40% and 1 - month LVEF >40% .

273 IncRNA are differentially expressed and among these, 83 IncRNA are differentially expressed and have a fold change > 2 or < 0.5 between the low LVEF (LVEF < 40%) and the high LVEF (LVEF > 40%). 3 IncR As are common to D3 samples (ENST00000421563.1, ENST00000443562.1, ENST00000455988.1). The p-value and the fold-change of these IncRNA are listed in the Table 38. In Table 39, 235 IncRNAs which have a p<0.05 and an individual AUC >0.7 or <0.3 are listed in Table 39.

Table 38: List of 83 IncRNA from Gencode database which are differentially expressed (p<0.05) and have a fold change > 2 or < 0.5 between the low LVEF group (LVEF < 40%) and the high LVEF group (LVEF > 40%)

ENST00000513660.2 0.012 3.751 ENST00000415202.1 0.035 6.887

ENST00000511222.1 0.012 2.305 ENST00000599781.1 0.036 0.075

ENST00000439239.2 0.013 2.069 ENST00000497551.2 0.037 2.235

ENST00000549878.1 0.013 2.466 ENST00000597654.1 0.037 0.037

ENST00000444217.1 0.013 2.075 ENST00000439606.1 0.038 7.846

ENST00000435548.1 0.014 5.647 ENST00000455988.1 0.038 2.302

ENST00000607026.1 0.014 0.480 ENST00000597904.1 0.039 2.634

ENST00000515111.1 0.048 2.667 ENST00000505972.2 0.039 0.466

ENST00000503093.1 0.014 4.916 ENST00000609140.1 0.040 68.930

ENST00000443670.1 0.014 2.095 ENST00000443284.1 0.041 2.225

ENST00000429608.1 0.015 2.188 ENST00000502812.2 0.042 0.359

ENST00000518276.1 0.016 2.734 ENST00000552026.1 0.043 2.692

ENST00000420418.1 0.016 4.067 ENST00000522300.1 0.043 0.468

ENST00000511419.1 0.017 3.308 ENST00000440038.2 0.044 7.706

ENST00000431130.2 0.017 2.765 ENST00000413841.1 0.044 2.153

ENST00000412171.2 0.020 988.115 ENST00000443562.1 0.044 2.013

ENST00000419531.2 0.021 0.003 ENST00000457941.1 0.045 17.472

ENST00000442384.1 0.022 2.042 ENST00000605147.1 0.046 0.409

ENST00000446102.1 0.022 0.481 ENST00000456803.1 0.047 0.465

ENST00000414102.1 0.022 0.365 ENST00000578974.2 0.048 0.387

ENST00000507963.1 0.022 4.620 ENST00000509212.1 0.048 0.492

ENST00000609843.1 0.024 2.273

Table 39: List of 235 IncRNA from Gencode database, which are differentially expressed (p<0.05) and have an AUC > 0.7 or < 0.3 between the low LVEF group (LVEF < 40%) and the high LVEF group (LVEF > 40%)

ENST00000508845.1 0.004 0.829 ENST00000452176.1 0.020 0.778 ENST00000607459.1 0.039 0.231

ENST00000506338.1 0.004 0.803 ENST00000510416.1 0.020 0.761 ENST00000584829.1 0.039 0.744

ENST00000430897.1 0.004 0.162 ENST00000503188.1 0.020 0.197 ENST00000471626.1 0.039 0.718

ENST00000601136.1 0.005 0.872 ENST00000509559.1 0.021 0.188 ENST00000514265.1 0.039 0.231

ENST00000430520.1 0.005 0.137 ENST00000508255.1 0.021 0.214 ENST00000451362.1 0.039 0.265

ENST00000522312.1 0.005 0.137 ENST00000419531.2 0.021 0.128 ENST00000595232.1 0.039 0.214

ENST00000451396.2 0.005 0.838 ENST00000430471.1 0.021 0.786 ENST00000473798.1 0.039 0.769

ENST00000453015.1 0.006 0.179 ENST00000442384.1 0.022 0.761 ENST00000427748.1 0.040 0.239

ENST00000397645.2 0.006 0.838 ENST00000446102.1 0.022 0.188 ENST00000607389.1 0.040 0.769

ENST00000449586.1 0.006 0.821 ENST00000414102.1 0.022 0.179 ENST00000602316.1 0.040 0.197

ENST00000356684.3 0.006 0.162 ENST00000428651.1 0.022 0.231 ENST00000439601.1 0.040 0.205

ENST00000505997.1 0.006 0.761 ENST00000507963.1 0.022 0.726 ENST00000462176.2 0.040 0.248

ENST00000508619.1 0.007 0.829 ENST00000473595.1 0.023 0.761 ENST00000512519.1 0.040 0.197

ENST00000507435.1 0.007 0.786 ENST00000326734.1 0.023 0.256 ENST00000609140.1 0.040 0.752

ENST00000510254.1 0.007 0.197 ENST00000435692.2 0.023 0.863 ENST00000512527.1 0.041 0.239

ENST00000440104.1 0.007 0.829 ENST00000513812.1 0.023 0.726 ENST00000514010.1 0.041 0.726

ENST00000504368.1 0.007 0.786 ENST00000609843.1 0.024 0.752 ENST00000444043.2 0.041 0.726

ENST00000438506.1 0.008 0.829 ENST00000449124.1 0.025 0.795 ENST00000429871.1 0.041 0.291

ENST00000420672.1 0.008 0.859 ENST00000433108.1 0.025 0.778 ENST00000443284.1 0.041 0.795

ENST00000412313.1 0.008 0.128 ENST00000425192.1 0.025 0.726 ENST00000461448.1 0.041 0.231

ENST00000504165.1 0.008 0.803 ENST00000514377.1 0.025 0.752 ENST00000609969.1 0.041 0.769

ENST0000051 1234.1 0.008 0.179 ENST00000444346.1 0.025 0.239 ENST00000458097.1 0.041 0.222

ENST00000510879.1 0.009 0.872 ENST00000513770.1 0.026 0.778 ENST00000446073.1 0.042 0.769

ENST0000041231 1.1 0.009 0.722 ENST00000448431.1 0.026 0.214 ENST00000431691.1 0.042 0.752

ENST00000439795.1 0.009 0.222 ENST00000440404.1 0.026 0.197 ENST00000502812.2 0.042 0.239

ENST00000434094.1 0.009 0.179 ENST00000560688.1 0.026 0.248 ENST00000508470.1 0.043 0.761

ENST00000454183.1 0.009 0.774 ENST00000428176.1 0.026 0.248 ENST00000552026.1 0.043 0.735

ENST00000504207.1 0.009 0.179 ENST00000515680.2 0.027 0.765 ENST00000458007.2 0.043 0.256

ENST00000504297.1 0.010 0.846 ENST00000446136.1 0.027 0.769 ENST00000522300.1 0.043 0.248

ENST00000503568.1 0.010 0.821 ENST0000051 1279.1 0.028 0.752 ENST00000366441.2 0.043 0.795

ENST00000412357.1 0.010 0.803 ENST00000423168.1 0.028 0.838 ENST00000429269.1 0.043 0.778

ENST00000460597.1 0.010 0.821 ENST00000429230.1 0.028 0.744 ENST00000595268.1 0.044 0.744

ENST00000422253.1 0.010 0.803 ENST00000421437.1 0.029 0.265 ENST00000440038.2 0.044 0.778

ENST00000506655.1 0.01 1 0.812 ENST00000504728.1 0.029 0.752 ENST00000413841.1 0.044 0.752

ENST00000526176.1 0.01 1 0.821 ENST00000569928.1 0.029 0.239 ENST0000048901 1.1 0.044 0.735

ENST00000402410.2 0.01 1 0.761 ENST00000421298.1 0.029 0.778 ENST00000443562.1 0.044 0.795

ENST00000455121.3 0.012 0.162 ENST00000445565.1 0.030 0.769 ENST00000512349.1 0.045 0.231

ENST00000513660.2 0.012 0.769 ENST00000598710.1 0.030 0.231 ENST00000505736.1 0.045 0.231

ENST0000060241 1.1 0.012 0.778 ENST00000492209.1 0.030 0.786 ENST00000442020.1 0.045 0.761

ENST0000051 1222.1 0.012 0.752 ENST00000492300.1 0.030 0.735 ENST00000440862.1 0.045 0.205

ENST00000607594.1 0.013 0.812 ENST00000508484.1 0.030 0.248 ENST00000464242.1 0.045 0.718

ENST00000450500.1 0.013 0.786 ENST00000415174.1 0.030 0.188 ENST00000499900.2 0.045 0.231

ENST00000439239.2 0.013 0.795 ENST00000432505.1 0.031 0.761 ENST00000457941.1 0.045 0.718

ENST00000549878.1 0.013 0.761 ENST0000052331 1.1 0.031 0.756 ENST00000470263.1 0.045 0.761 ENST00000418015.1 0.013 0.821 ENST00000434796.1 0.031 0.735 ENST00000512581.1 0.045 0.735

ENST00000444217.1 0.013 0.786 ENST00000440266.2 0.031 0.778 ENST00000464428.2 0.045 0.752

ENST00000435548.1 0.014 0.795 ENST00000447876.1 0.031 0.239 ENST00000523745.1 0.046 0.222

ENST00000607026.1 0.014 0.188 ENST00000506070.1 0.031 0.274 ENST00000522173.1 0.046 0.214

ENST00000503093.1 0.014 0.739 ENST00000426083.1 0.032 0.248 ENST00000585718.1 0.046 0.248

ENST00000509184.1 0.014 0.821 ENST00000576302.1 0.032 0.761 ENST00000605147.1 0.046 0.188

ENST00000443670.1 0.014 0.769 ENST00000607950.1 0.032 0.778 ENST00000509496.1 0.047 0.735

ENST00000486767.1 0.015 0.786 ENST00000588145.1 0.032 0.701 ENST00000449298.1 0.047 0.769

ENST00000457402.1 0.015 0.188 ENST00000503259.1 0.032 0.761 ENST00000456803.1 0.047 0.226

ENST00000515789.1 0.015 0.197 ENST00000454380.1 0.032 0.205 ENST00000509212.1 0.048 0.256

ENST00000429608.1 0.015 0.782 ENST00000608925.1 0.032 0.239 ENST00000442036.1 0.048 0.735

ENST00000592182.1 0.016 0.786 ENST00000608442.1 0.032 0.214 ENST00000564300.1 0.048 0.239

ENST00000422259.1 0.016 0.231 ENST00000602470.1 0.032 0.739 ENST00000426504.1 0.048 0.231

ENST00000442200.1 0.016 0.786 ENST0000051401 1.1 0.033 0.239 ENST00000457686.1 0.049 0.205

ENST00000432733.1 0.016 0.214 ENST00000605589.1 0.033 0.735 ENST00000515542.1 0.049 0.735

ENST00000518276.1 0.016 0.744 ENST00000497379.2 0.033 0.171 ENST00000429469.1 0.050 0.701

ENST00000420418.1 0.016 0.761 ENST00000609352.1 0.034 0.752 ENST00000443008.1 0.050 0.265

ENST00000297163.3 0.016 0.744 ENST00000507476.1 0.034 0.726 ENST00000427524.1 0.034 0.778

ENST00000453155.1 0.016 0.821

Comparison between low LVEF (LVEF < 45%) and high LVEF (LVEF > 45%) at DO in serum samples of AMI patients

First, samples are grouped into 2 groups by a dichotomized variable: 1 -month LVEF < 45% and 1- month LVEF >45%.

243 IncRNA are differentially expressed and among these, 69 IncRNA are differentially expressed and have a fold change > 2 or < 0.5 between the low LVEF (LVEF < 45%) and the high LVEF (LVEF > 45%). 2 IncRNAs are common to D3 samples (ENST00000429230.1, ENST00000599448.1). The p-value and the fold-change of these IncRNA are listed in the Table 40. 211 IncRNAs which have a p<0.05 and an individual AUC >0.7 or <0.3 are listed in Table 41.

Table 40: List of 76 IncRNA from Gencode database which are differentially expressed (p<0.05) and have a fold change > 2 or < 0.5 between the low LVEF group (LVEF < 45%) and the high LVEF group (LVEF > 45%)

ENST00000435895.1 0.000 0.486 ENST00000523895.1 0.024 0.435

ENST00000552026.1 0.001 3.770 ENST00000419531.2 0.025 0.000

ENST00000415543.1 0.001 0.237 ENST00000444361.1 0.025 0.254

ENST00000436488.1 0.001 0.431 ENST00000601854.1 0.026 5.663

ENST00000599448.1 0.003 0.203 ENST00000441036.1 0.026 2.509

ENST00000441345.2 0.005 0.117 ENST00000505149.1 0.027 0.448

ENST00000430555.1 0.005 2.363 ENST00000435492.1 0.030 0.316

ENST00000608111.1 0.006 17.287 ENST00000512401.1 0.031 0.057

ENST00000607026.1 0.006 0.439 ENST00000507842.1 0.032 2.843

ENST00000435643.1 0.006 0.249 ENST00000510648.1 0.032 3.873

ENST00000597904.1 0.006 3.537 ENST00000606314.1 0.033 3.833

ENST00000496733.2 0.007 0.488 ENST00000474250.1 0.034 4.009

ENST00000607985.1 0.007 0.109 ENST00000509105.1 0.034 8.823

ENST00000465283.1 0.007 0.082 ENST00000588145.1 0.035 13.232

ENST00000429230.1 0.008 4.740 ENST00000470860.1 0.035 0.238

ENST00000443562.1 0.008 2.248 ENST00000485020.1 0.037 0.412

ENST00000461448.1 0.010 0.467 ENST00000447876.1 0.037 0.323

ENST00000507698.1 0.010 2.574 ENST00000426892.1 0.037 2.191

ENST00000594976.1 0.011 0.206 ENST00000512603.1 0.039 0.433

ENST00000606468.1 0.011 2.875 ENST00000602528.1 0.040 0.441

ENST00000431130.2 0.011 2.733 ENST00000424788.1 0.040 0.169

ENST00000605147.1 0.012 0.351 ENST00000424084.1 0.044 6.957

ENST00000469289.1 0.013 5.727 ENST00000507639.1 0.044 3.312

ENST00000427042.1 0.013 2.802 ENST00000426178.1 0.044 0.170

ENST00000413525.1 0.013 0.248 ENST00000417516.1 0.044 2.784

ENST00000461864.1 0.014 0.440 ENST00000416279.1 0.044 2.637

ENST00000439745.1 0.016 0.470 ENST00000443270.1 0.044 3.375

ENST00000402410.2 0.017 6.982 ENST00000469846.2 0.045 0.256

ENST00000507476.1 0.017 4.500 ENST00000508998.1 0.047 3.937

ENST00000421563.1 0.018 2.113 ENST00000598740.1 0.047 2.006

ENST00000515263.1 0.019 0.304 ENST00000597654.1 0.047 0.068

ENST00000433475.1 0.019 9.721

Table 41 : List of 211 IncRNA from Gencode database, which are differentially expressed (p<0.05) and have an AUC > 0.7 or < 0.3 between the low LVEF group (LVEF < 45%) and the high LVEF group (LVEF > 45%)

ENST00000436488.1 0.001 0.103 ENST00000564407.1 0.017 0.222 ENST00000608740.1 0.035 0.769

ENST00000492300.1 0.002 0.872 ENST00000507476.1 0.017 0.821 ENST00000456327.1 0.035 0.744

ENST00000506655.1 0.002 0.872 ENST0000043271 1.1 0.018 0.795 ENST00000588145.1 0.035 0.803

ENST00000588227.1 0.002 0.838 ENST00000421563.1 0.018 0.812 ENST00000452901.1 0.035 0.786

ENST00000432210.1 0.002 0.889 ENST00000415342.1 0.019 0.222 ENST00000499583.1 0.036 0.248

ENST00000442020.1 0.002 0.872 ENST00000430471.1 0.019 0.786 ENST00000509559.1 0.036 0.256

ENST00000414065.1 0.002 0.829 ENST00000515263.1 0.019 0.205 ENST00000514608.1 0.036 0.214

ENST00000599448.1 0.003 0.188 ENST00000433475.1 0.019 0.872 ENST00000485020.1 0.037 0.291

ENST00000496154.2 0.004 0.137 ENST00000507056.1 0.019 0.248 ENST00000447876.1 0.037 0.282

ENST00000444672.1 0.004 0.872 ENST00000428647.1 0.019 0.786 ENST00000608851.1 0.037 0.265

ENST00000440786.1 0.005 0.829 ENST00000492307.1 0.020 0.803 ENST00000426892.1 0.037 0.752

ENST00000356133.3 0.005 0.855 ENST00000507781.1 0.020 0.291 ENST00000606200.1 0.037 0.752

ENST00000514010.1 0.005 0.855 ENST00000522173.1 0.020 0.205 ENST00000425176.1 0.037 0.295

ENST00000441345.2 0.005 0.1 1 1 ENST00000521803.1 0.020 0.795 ENST00000601136.1 0.037 0.829

ENST00000603264.1 0.005 0.162 ENST00000448129.1 0.021 0.197 ENST00000438978.1 0.038 0.761

ENST00000602433.1 0.005 0.205 ENST00000436293.2 0.021 0.855 ENST00000510254.1 0.038 0.214

ENST00000430555.1 0.005 0.846 ENST00000506425.1 0.021 0.214 ENST00000423410.1 0.038 0.752

ENST00000428083.1 0.006 0.838 ENST00000422841.1 0.021 0.222 ENST00000512603.1 0.039 0.265

ENST000006081 1 1.1 0.006 0.915 ENST00000431244.1 0.022 0.222 ENST00000414120.1 0.040 0.282

ENST00000607026.1 0.006 0.248 ENST00000509057.1 0.022 0.786 ENST00000602528.1 0.040 0.265

ENST00000435643.1 0.006 0.188 ENST00000430520.1 0.023 0.222 ENST00000414625.2 0.040 0.239

ENST00000597904.1 0.006 0.880 ENST00000457686.1 0.023 0.282 ENST00000502410.1 0.040 0.778

ENST00000496733.2 0.007 0.188 ENST00000429315.3 0.023 0.744 ENST00000601940.1 0.041 0.239

ENST00000446520.1 0.007 0.188 ENST00000523895.1 0.024 0.222 ENST00000505162.1 0.041 0.744

ENST00000607985.1 0.007 0.235 ENST00000504728.1 0.024 0.752 ENST00000492209.1 0.041 0.786

ENST00000465283.1 0.007 0.261 ENST00000607148.1 0.025 0.214 ENST00000427748.1 0.042 0.239

ENST00000421933.1 0.007 0.162 ENST00000326734.1 0.025 0.248 ENST00000522975.1 0.042 0.726

ENST00000499346.2 0.007 0.812 ENST00000428624.1 0.025 0.222 ENST00000606855.1 0.042 0.744

ENST00000429230.1 0.008 0.786 ENST00000419531.2 0.025 0.214 ENST00000508031.1 0.043 0.744

ENST00000443562.1 0.008 0.846 ENST00000564261.1 0.026 0.769 ENST00000609032.1 0.043 0.231

ENST00000435692.2 0.009 0.846 ENST00000601854.1 0.026 0.735 ENST00000446073.1 0.043 0.761

ENST00000461448.1 0.010 0.179 ENST00000566904.1 0.026 0.812 ENST00000424084.1 0.044 0.778

ENST00000522312.1 0.010 0.197 ENST00000441036.1 0.026 0.812 ENST00000507639.1 0.044 0.718

ENST00000425776.1 0.010 0.872 ENST00000442036.1 0.026 0.786 ENST00000413531.1 0.044 0.274

ENST00000512349.1 0.010 0.162 ENST00000594101.1 0.026 0.239 ENST00000434346.1 0.044 0.299

ENST00000507698.1 0.010 0.816 ENST00000335577.4 0.026 0.786 ENST00000417516.1 0.044 0.803

ENST00000425896.1 0.010 0.769 ENST00000607594.1 0.027 0.778 ENST00000416279.1 0.044 0.795

ENST00000594976.1 0.01 1 0.299 ENST00000510165.1 0.027 0.214 ENST00000443270.1 0.044 0.795

ENST00000606468.1 0.01 1 0.812 ENST00000505149.1 0.027 0.282 ENST00000436262.1 0.045 0.222

ENST00000517595.1 0.01 1 0.205 ENST00000507681.1 0.027 0.222 ENST00000503179.1 0.046 0.231

ENST00000431130.2 0.01 1 0.821 ENST00000417636.1 0.027 0.795 ENST00000510240.1 0.046 0.256

ENST00000507627.1 0.01 1 0.812 ENST00000605082.1 0.028 0.752 ENST00000607744.1 0.046 0.231

ENST00000515842.1 0.012 0.179 ENST00000438623.1 0.028 0.222 ENST00000512428.1 0.046 0.274

ENST00000435880.2 0.012 0.197 ENST00000470263.1 0.028 0.778 ENST0000051 1390.1 0.046 0.774 ENST00000432267.2 0.012 0.812 ENST00000509641.2 0.029 0.752 ENST00000456519.1 0.046 0.274

ENST00000528818.1 0.012 0.205 ENST00000607804.1 0.029 0.786 ENST00000506950.1 0.047 0.265

ENST00000512417.1 0.012 0.812 ENST00000435492.1 0.030 0.226 ENST00000598740.1 0.047 0.744

ENST00000605147.1 0.012 0.171 ENST00000431139.2 0.030 0.769 ENST00000520041.1 0.047 0.752

ENST00000469289.1 0.013 0.855 ENST00000425275.1 0.030 0.214 ENST00000417927.1 0.047 0.282

ENST00000444721.1 0.013 0.812 ENST00000428176.1 0.030 0.265 ENST0000052331 1.1 0.047 0.756

ENST00000507653.1 0.013 0.179 ENST00000505109.1 0.031 0.769 ENST00000432395.1 0.047 0.214

ENST00000427042.1 0.013 0.829 ENST00000504207.1 0.031 0.231 ENST00000502467.1 0.047 0.248

ENST00000584829.1 0.013 0.803 ENST00000512401.1 0.031 0.226 ENST00000609166.1 0.047 0.744

ENST00000454595.1 0.013 0.821 ENST00000517916.1 0.031 0.752 ENST00000609005.1 0.047 0.761

ENST00000413525.1 0.013 0.218 ENST0000051 1213.1 0.031 0.778 ENST00000444042.2 0.047 0.795

ENST00000418050.1 0.014 0.821 ENST00000567486.2 0.031 0.761 ENST0000051 1616.1 0.048 0.282

ENST00000453569.1 0.014 0.222 ENST00000507842.1 0.032 0.769 ENST00000426539.1 0.048 0.299

ENST00000461864.1 0.014 0.162 ENST00000510648.1 0.032 0.786 ENST00000412204.2 0.048 0.735

ENST00000608056.1 0.015 0.171 ENST00000513851.1 0.032 0.752 ENST00000436950.1 0.048 0.761

ENST00000439745.1 0.016 0.226 ENST00000430677.1 0.032 0.256 ENST00000496220.1 0.048 0.726

ENST00000470739.1 0.016 0.197 ENST00000452283.1 0.032 0.726 ENST00000569928.1 0.049 0.239

ENST00000569694.1 0.016 0.162 ENST00000606314.1 0.033 0.803 ENST00000433108.1 0.049 0.752

ENST00000314957.3 0.016 0.752 ENST00000426702.1 0.033 0.256 ENST00000507398.1 0.049 0.274

ENST00000513304.1 0.016 0.179 ENST00000451396.2 0.033 0.735 ENST00000414199.1 0.049 0.769

ENST00000452176.1 0.034 0.786

The IncR As listed can be used as biomarkers for the prediction of Left Ventricular Remodeling and as therapeutics targets to prevent development of Heart Failure.