The invention relates to an aptamer - a single-stranded nucleic acid molecule having affinity for the PD-L1 (Programmed Death-Ligand 1) protein and its use to produce a functional covalent complex containing either a fluorescent tag or an affinity substance. The invention also includes a functional covalent complex containing either a tag or an affinity substance and an oligonucleotide and its use in diagnostic imaging, particularly in cancer imaging. PD-L1 plays a key role in tumour transformation and metastasis formation in advanced stages of the disease. A nucleotide sequence capable of specifically binding the PD-L1 protein has been developed, which will enable its use in molecular imaging during cancer diagnosis and treatment.

The development of immune checkpoint inhibitors has allowed for a paradigm shift in treatment of many advanced cancer types. The PD1/PD-L1 pathway is now being used in cancer therapy as a target for immune checkpoint inhibitors, which is widely recognised as one of the most important discoveries in recent years. PD-L1 protein expression on tumour or immune cells is considered a potential biomarker to predict the sensitivity of the immune system to checkpoint inhibitor therapies. Elevated expression of PD-1 (receptor for PD-L1) and impaired effector functions are mostly characteristics of T lymphocytes located in tumour- affected tissue. Elevated PD-L1 expression has also been observed in a number of tumour types, some of which correlated strongly with unfavourable prognosis. Therefore, a rapid and accurate assessment of PD-L1 expression levels within the tumour is extremely important for the selection of appropriate therapy and subsequent monitoring of its progress during treatment.

DESCRIPTION OF THE INVENTION

Biomedical imaging is one of the key pillars of modern diagnostics, including cancer diagnosis, and applies to all steps of the diagnostic and therapeutic process. Effective cancer diagnosis is critical to reducing mortality, treatment costs and length of hospital stay. Advances in molecular imaging will improve cancer diagnosis at the systemic level and should ultimately enable clinicians not only to localise tumours, but also to assess the activity of biological processes within these tumours (Weissleder and Pittet, 2008) (James and Gambhir, 2012). Over the past 2 decades, monoclonal antibodies (mAbs) have become an effective treatment for a wide range of diseases (inflammatory and cancer) due to their high specificity and affinity. Due to these properties, there is great interest in the use of mAbs in molecular imaging targeting the detection of key antigens in vivo (Warram et al., 2014). Molecular probes are fundamental to molecular imaging and must offer high sensitivity, low background noise, low toxicity and relative stability (Chakravarty, Goel and Cai, 2014).

Several studies indicate that aptamers have advantages over mAbs in terms of stability, target specificity and affinity. Aptamer probes offer the additional advantages of reduced immunogenicity, structural stability and smaller size (~3 nm compared to 10-15 nm for antibodies) (Que-Gewirth and Sullenger,2007). In experimental studies, aptamer probes improved imaging performance compared to antibody-based probes in STimulated Emission Depletion (STED) microscopy (Gomes de Castro, Hbbartner and Opazo, 2017) and were able to recognise a wider repertoire of epitopes than antibodies. Moreover, a study comparing lllln-labelled aptamers and EGFR-specific antibodies in pSPECT/CT imaging showed higher aptamer specificity in mice with highly malignant human OSC-19 cancer (Melancon et al., 2014). The above studies clearly demonstrated the superiority of aptamer-based probes compared to mAbs in vivo. Practical applications of aptamers in diagnostics is currently the subject of several clinical trials (Yoon and Rossi, 2018).

The technical problem to be solved by the invention is to provide a functional nucleotide sequence that binds specifically to the PD-L1 protein, which could be used to obtain selective markers for use in cancer imaging across a broad spectrum of diagnostic techniques.

A first subject of the invention is an aptamer with affinity for the PD-L1 protein comprising a nucleotide sequence of at least 95% identity to the sequence of SEQ. 1, preferably comprising the sequence shown as SEQ.l, particularly preferably having this sequence.

Determination of the sequence identity is possible using standard DNA sequencing methods and bioinformatic sequence analysis methods, whereby the introduction of single changes in the nucleotide sequence of the aptamer does not lead to a change in its conformation that determines the match to the PD-L1 target protein. Since the aptamer is made of 90 nucleotides, it is not possible to study all combinations of single changes for all nucleotides. A second subject of the invention is the use of the aptamer of the invention to produce a functional covalent complex comprising a fluorescent tag or an affinity substance and the aptamer of the invention. In a preferred embodiment of the invention, the fluorescent tag is selected from the group comprising: fluorescein, preferably fluorescein isothiocyanate, or Cy5.5. According to the invention, the tag is to be understood as any known substance suitable and used for oligonucleotide labelling by its covalent attachment to the oligonucleotide. An exemplary tag suitable for obtaining the covalent complex of the invention is fluorescein.

In a further preferred embodiment of the invention, the affinity substance is biotin . According to the invention, the affinity substance is to be understood as any known substan ce suitable for isolation by affinity chromatography. An exemplary substance suitable for obtaining the covalent complex of the invention is biotin.

A further subject of the invention is a functional covalent complex comprising the tag or the affinity substance and the aptamer of the invention.

In a preferred embodiment of the invention, the fluorescent tag is selected from the group comprising: fluorescein, preferably fluorescein isothiocyanate, or Cy5.5.

In another preferred embodiment of the invention, the affinity substance is biotin.

Another subject of the invention is the use of the functional covalent complex of the invention in diagnostics, in particular in diagnostic imaging, preferably in tumour imaging.

The present invention is based on the development of an anti-PD-Ll nucleic acid aptamer that specifically recognises human PD-L1 (Programmed Death-Ligand 1). With the use of SELEX methodology, a functional oligonucleotide sequence was identified and subsequently tested for specificity and ability to selectively label cancer cells in multiple in vitro and in vivo models. The evidence showed potential for in vivo cancer imaging in two different mouse models. The probe provided is a good starting point for the development of a tool for universal imaging of different tumour types depending on their ability to overexpress PD-L1.

Among the available diagnostic imaging techniques in which the 2c2s aptamer, which is the subject of the present invention, can be used are: optical imaging (fluorescence and bioluminescence), magnetic resonance imaging, positron emission tomography, single photon emission tomography, computed tomography and ultrasonography. As well as other techniques that can be used to determine PD-L1 protein levels on the cell surface, whereby imaging can relate to cancer and other diseases in which changes in PD-L1 protein levels are involved.

The object of the invention is made apparent in the examples and the drawing, which is not limiting to the scope of the application, wherein: Fig. 1 presents the aptamer pool enrichment after successive rounds of selection relative to the starting library, using the ELISA technique. Selection of anti PD-L1 aptamers. The enrichment of the single-stranded DNA pool with aptamers recognising the extracellular domain of PD-L1 after the indicated number of selection cycles was analysed with ELISA (binding of the biotinylated ssDNA pool to the PD-L1 protein);

Fig. 2 presents the level of binding of the extracellular domain of PD-L1 by the selected aptamer. Binding capacity of 2c2s to PD-L1. (A) ELISA analysis (B) Protein immobilisation assay (C) Specificity analysis of 2c2s;

Fig. 3 presents the effect of 2c2s aptamer in cell cultures in vitro using flow cytometry. Interaction of FITC-2c2s with human PD-L1 on the cell surface analysed with flow cytometry. (A) LN18 WM115 (B) WM266.4 (C) LN18 and (D) 786-0;

Fig. 4 presents the feasibility of using 2c2s aptamer as a detection marker for cancer cells with high PD-L1 expression using animal models.

A- Non-invasive in vivo cancer imaging using Cy5.5-2c2s aptamer. Mice with CHO-K1 tumour (overexpressing PD-L1) were injected intravenously with Cy5.5-2c2s aptamer and monitored for fluorescence signal through the skin in the tumour and adjacent areas.

B- Imaging of the renal tumour with the 2c2s probe. PD-Ll-specific Cy5.5-2c2s probe was injected intraperitoneally into animals with induced renal tumour (786-Luc cells) and tumour fluorescence was monitored at time points Data are presented as a timeline of tumour site fluorescence intensity.

Example 1. In vitro selection of oligonucleotides showing affinity for the extracellular domain of the PD-L1 protein.

A characteristic feature of the oligonucleotide molecules obtained by the procedure described below is their ability to bind the extracellular domain of the PD-L1 protein. The aptamer specifically binding PD-L1 was obtained using the Systematic Evolution of Ligands by Exponential enrichment (SELEX) method. Aptamer selection was performed using a singlestranded DNA library of 5'-CATGCTTCCCCAGGGAGATG-N50-GAGGAACATGCGTCGCAAAC-3' (SEQ. 2), (50-nucleotide random sequence) synthesised at 0.2 pM scale and purified with HPLC (I BA, Germany). Aptamers were selected for their specific binding to the extracellular domain of PD-L1. A recombinant PD-L1 protein fragment constituting the PD1 (Programmed Death receptor 1, PD-1) binding domain (fusion protein: extracellular domain of PD-L1: amino acid residues 18-134, C-terminal His-tag), was obtained according to the protocol described by Zak et al. (Zak et al., 2016). The correct folding of the purified PD-L1 protein was confi rmed using NMR spectroscopy. In the first step of aptamer selection, PD-L1 was immobilised on commercially available Dynabeads™ (Thermo Fisher Scientific, Waltham, USA) i n so-called binding buffer (100 mM sodium phosphate, pH 8.0, 600 mM NaCI, 0.02% Tween™-20) and washed with selection buffer (Phosphate-Buffered Saline (PBS) containing 5 mM MgCl ₂ , 10 mM KCI and 0.01% Tween 20, pH 7.4). The ssDNA library or ssDNA pool was denatured (5 min at 92°C, 10 min at 4°C, 15 min at RT) before each subsequent selection cycle and resuspended in binding buffer (selection buffer supplemented with 40-120 pg/mL of yeast tRNA ( Invitrogen, Waltham, USA) and 125 pg/mL of BSA (BioShop Canada Inc., Burlington, Canada)). The immobilised target protein resin was then added and incubated for 20 minutes at 24°C with shaking. To increase the selection pressure during the selection process, the concentration of ssDNA (30 to 0.18 pM) and the amount of immobilised protein (3 to 0.3 pl) were gradually reduced while the concentration of the competitor (yeast tRNA) was increased from 40 to 120 pg/mL. After incubation, unbound aptamers were removed by washing with the selection buffer using a magnetic concentrator (Invitrogen, Waltham, USA). Subsequently, the resin with the immobilised protein and bound DNA was resuspended in 400 pl of PCR mixture containing: 1 pM primers (For: 5'-CATGCTTTCCCCAGGGAGATG-3' (SEQ. 3) and 5’- phosphorylation-Rev: 5'-GTTTGGACGCATGTTCCTC-3' (SEQ.4 )), 5 mM dNTPs, 2.5 mM MgCI ₂ and 1.25 U/100 pl Taq polymerase (Thermo Fisher Scientific, Waltham, USA). PCR was conducted for 35 cycles consisting of the following steps: 30 sec at 95°C, 30 sec at 53°C and 30 sec at 72°C. Final extension was conducted at 72°C for 5 min. PCR products were then extracted with phenol-chloroform-isoamyl alcohol (Sigma-Aldrich, St.Louis, USA) and precipitated with ethanol overnight at -20°C. After washing with 70% ethanol, the DNA precipitate was dried and dissolved in dH ₂ O. The resulting dsDNA was digested with 100 U of A. exonuclease (Thermo Fisher Scientific, Waltham, USA) to recover the corresponding single strand. Digestion was carried out for 1 h at 37°C with gentle shaking. The digested products (ssDNA) were re-extracted with a phenol-chloroform-isoamyl alcohol mixture, precipitated and dissolved in dH ₂ O.

In order to eliminate non-specific binding, negative selection was conducted by incubating the ssDNA pool/library with free Dynabeads™ prior to the aptamer selection cycles. During the selection, the increase in PD-Ll-binding sequence enrichment of the aptamer pool was monitored with ELISA (Fig. 1). The aptamer pools after the 5 ^th , 6 ^th , and 7 ^th cycles of selection were subjected to NGS sequencing (Genomed SA, Warsaw, Poland).

The obtained sequences were grouped into clusters with similar nucleotide sequence. In subsequent steps, the binding strength of the extracellular domain of PD-L1 by the selected aptamers was verified. ELISA technique was used to select the aptamer of the highest affinity, which provided identification of the aptamer with the best properties, i.e. 2c2s with the sequence SEQ.l: 5'-CATGCTTCCCCAGGGAGATGGGGGGACGGTAAGAGGGGCGGGGCATGGAGGGGGTCT GCTCG GGATTGCGGAGGAACATGCGTCGCAAAC-3'

Example 2. Preparation of covalent complexes of the invention

Covalent complexes containing 2c2s aptamer and a functional substance selected from the group: fluorescent tag (Example 3B In vitro analysis of 2c2s and Example 3C In vivo imaging, affinity substance (Example 3 (A) Affinity tests) were ordered from a company specializing in the synthesis of modified and unmodified oligonucleotides (Millipore), where fluorescein (fluorescein isothiocyanate), Cyanine 5.5 (Cy5.5), as a tag, or biotin, as an affinity substance, were introduced into the 2c2s aptamer molecules by standard chemical synthesis methods (C. K. Brush "Fluorescein Labelled Phosphoramidites", U.S. Patent 5,583,236, 1996); R. T. Pon "A long chain biotin phosphoramidite reagent for the automated synthesis of 5'-biotinylated oligonucleotides", Tetrahedron Lett, 1991).

Unmodified aptamers or pools (mixtures of aptamers) were only used during selection. All analyses conducted to characterise the developed molecules were carried out using aptamers modified with (a tag): biotin Fig. 1, Fig. 2, fluorescent tag Fig. 3, Fig. 4.

Example 3 Determination of specificity and functionality of the obtained aptamers and covalent complexes

One of the most important features of molecular probes is their high affinity for the target protein, and another equally important one is their high selectivity for this protein. For the aptamers of the invention, a number of analyses have been carried out to confirm their ability to specifically bind the extracellular domain of the PD-L1 protein.

(A) Affinity tests The binding affinity and specificity of the developed molecules to the PD-L1 protein was assessed with ELISA and with immobilisation.

ELISA: a 96-well microtiter plate (Nunc, Rochester, NY, USA) was coated with 100 pl of human PD-L1 or other proteins (bovine albumin (10 pg/mL), mouse and human serum) and incubated overnight at 4°C. Unbound protein was removed by washing with the selection buffer. Biotinylated 2c2s aptamer or a non-specific biotinylated oligonucleotide (5'- CATGCTTCCCCAGGGAGATG-12(ACTG)- GAGGAACATGCGTCGCAAAC-3' (SEQ. 5)) was added to the wells and incubated for 30 minutes. Unbound aptamers were removed by vigorous washing with the selection buffer. 100 pl of HRP-conjugated streptavidin at a dilution of 1:200 (R&D Systems, Inc., Minneapolis, USA) in the selection buffer were added to the wells. After 20 minutes of incubation, unbound streptavidin was removed by washing and 100 μl of HRP reagent substrate (R&D Systems, Inc., Minneapolis, USA) were added. The reaction was stopped by adding 50 pl of 2N H2SO4. Absorbance at 450 nm and 570 nm (correcting for imperfections of the optical plate) was determined using an Infinite 200 PRO multimode reader (Tecan Group Ltd., Switzerland). The results are shown in Fig. 2A. In addition, the affinity was verified in a different assay format: the reverse component system i.e. the immobilisation assay, which analysed the binding of the PD-L1 protein to the aptamer immobilised on a resin (Fig. 2B).

Immobilisation assay: biotinylated aptamers (4 pM; 2c2s or non-specific biotinylated control oligonucleotide) were immobilised on Streptavidin Mag Sepharose (GE Healthcare, Chicago, USA) by incubation in PBS buffer for 20 minutes at RT. After washing with PBS, the resin was incubated with 0.2% BSA (BioShop Canada Inc., Burlington, Canada) in SELEX buffer for 30 minutes at room temperature to block non-specific binding sites, followed by washing with SELEX buffer. The resin was then resuspended in SELEX buffer containing 40 pg/mL tRNA and incubated with PD-L1 (18-239 or 18-134 Cterm His-tag; final concentrations: 90 pg/mL, 45 pg/mL and 22.2 pg/mL) for 20 minutes at RT with continuous mixing. After incubation, the resin with bound protein was washed with SELEX buffer and the bound protein was eluted by heat denaturation (short boiling) in loading buffer (3% SDS, 10% glycerol, 12.5 mM Tris-HCI, 100 mM DTT, 0.05% bromophenol blue). Recovered proteins were analysed with SDS/PAGE. Gels stained with Coomassie blue were imaged using ChemiDoc (Bio-Rad Laboratories, Inc. Hercules, USA). Both assays documented significant binding of 2c2s aptamer to the PD-L1 construct consisting of IgV and IgC-like domain (residues 18-239, no His-tag), as well as the IgV-only construct (18- 134, His-tag) compared to the non-specific ssDNA sequence used as a negative control (Fig. 2A, B). Furthermore, biochemical analysis showed very strong binding to the PD-L1 protein compared to bovine BSA and human and mouse serum, further confirming the high selectivity and affinity of 2c2s aptamer for the target protein (Fig. 2C).

B) In vitro analysis of 2c2s

Cell culture and binding assay. Binding of the aptamer to the PD-L1 protein on the cell surface was confirmed. For this purpose, cells with high endogenous PD-L1 expression were used; human melanoma cells WM115 and WM266.4 (ATCC - CRL-1675 and ATCC - CRL-1675), human glioma LN18 (ATCC - CRL-2610) and renal adenocarcinoma cells 786-0 (JCRB Cell Bank, 786-0- Luc, Cell No. JCRB1397). The cells were cultured at 37°C with 5% CO ² in appropriate culture medium supplemented with 10% FBS (InvivoGen) and 1% penicillin/streptomycin. Melanoma and 786-0 cells were cultured in RPMI1640 medium, LN18 cells were cultured in DMEM (4.5 g/L of glucose).

Analysis using flow cytometry. Flow cytometry was used to assess aptamer binding to PD-L1 on the cell surface. Cells (WM115, WM266.4, LN18 and 786-0) were incubated in HBSS/Dextran solution (Thermo Fisher Scientific, Waltham, USA) containing 10% FBS for 30 min at 37°C. FITC-conjugated 2c2s aptamer (or non-specific sequence) was then incubated with the cell suspension (lxlO ⁵ ) for 30 min, in the dark, with gentle shaking (180 rpm). Cells were then washed three times with HBSS and harvested using accutase enzyme (Thermo Fisher Scientific, Waltham). Samples were analysed on a FACSCalibur instrument (Becton Dickinson, Franklin Lakes, USA) using CellQuest software or a Guava cytometer (Merck Millipore). The data were analysed in FlowJo vlO.8.0. The analyses confirmed strong binding of the aptamer to the cell surface of the lines analysed; the non-specific sequence oligonucleotide (NC) showed no binding to the PD-L1 protein on the cell surface (Fig. 3).

(C) In vivo imaging

The utility of 2c2s for specific, non-invasive tumour identification in vivo was confirmed. Two animal models were used to confirm the properties of the developed molecule.

I Subcutaneous tumour study of PD-L1 aAPC/CHO-Kl cells using the aptamer.

Tumour induction: 12-week-old male BALB/c nude mice (mean weight, 16±5 g) were purchased from AnimaLab, Poland. Mice were maintained in a pathogen-free environment, on a 12/12 night/day cycle, with food and water provided ad libitum for the duration of the experiment. All experiments were performed in accordance with decision no. 190/2018 issued by the 1 ^st Local Institutional Animal Care and Use Committee. A suspension of PD-L1 aAPC/CHO-Kl cells (overexpressing PD-L1) (Promega) in PBS/BD Matrigel Matrix Growth Factor Reduced (Ixio ⁷ cells) was injected subcutaneously into the left flank of each animal. The diagnostic procedure was initiated when tumours reached more than 0.5 cm in each diameter (tumour volume of approximately 80-100 mm ³ ; up to 21 days post tumour implantation). For tumour imaging, aptamer at 2 mg/kg body weight was injected d irectly into the tail vein, and tumours were then localised/imaged by observing the fluorescence spectrum of a Perkin Elmer LS spectrofluorometer equipped with fibre optics dedicated to tumour imaging. Measurements were carried out up to 96 h post aptamer administration. Specific fluorescence from the tumour and skin of the adjacent tissue was collected at consecutive time points. A strong signal was obtained from the PD-L1 aAPC/CHO-Kl tumour site compared to an almost undetectable increase in signal from skin distant from the palpable tumour site (Fig. 4A).

II Identification of renal tumour in mice using the aptamer.

Kidney tumour induction: 8-week-old female Athymic Nude mice were purchased from Janvier Labs, France. Animals were maintained in individually ventilated cages at 50-60% humidity, a 12-hour I ight/da rk cycle and a temperature of 22±2°C. All animal procedures were performed in accordance with decision no. 264/2020 issued by the 1 ^st Local Institutional Animal Care and Use Committee in Krakow, Poland. Mice under peripheral anaesthesia (Ketamine, Xylazine, Biowet, Poland) were implanted with JCRB1397-786-Luc tumour cells (lxl0 ⁵ /50 pL/kidney) suspended in PBS into the renal pouch area using a 0.5 mL syringe with a 30 G needle. Mice in the control group were injected with PBS at the same site. Tumour growth monitoring was initiated 4 weeks after cell implantation and continued every 10 days by bioluminescence using the MS- Lumina SIII in vivo imaging system (PerkinElmer, Waltham, MA, USA). For this purpose, 0.2 mL (15 mg/mL) of D-luciferin (D-luciferin potassium salt XenoLight, PerkinElmer, USA) was infused into the peritoneum of mice and visualisation was performed 10 minutes after. During imaging, the mice remained under the influence of an inhalation anaesthetic (Aerrane, Baxter, Poland).

Imaging of mouse renal tumour using the developed aptamer: 2 mg/kg body weight of Cy5.5- 2c2s aptamer or cyanine 5.5-la bel led non-specific sequence (Sigma Aldrich) was administered systemically by intraperitoneal injection. Measurements were taken using an IVIS - Lumina Sill in vivo imaging system (PerkinElmer, Waltham, MA, USA) at 5 min intervals until the fluorescence signal disappeared. A strong fluorescence signal was observed in the kidney region up to 15 min post aptamer administration (Fig. 4B), closely correlating with the presence of the tumour in the same kidney of the animal, previously identified using bioluminescence.

Bibliography

1. JM, Warram, de Boer E, Sorace AG, Chung TK, Kim H, Pleijhuis RG, van Dam GM, and Rosenthal EL. 2014. "Antibody-Based Imaging Strategies for Cancer." Cancer Metastasis Reviews 33(2-3)309-22.

2. KM, Zak, Grudnik P, Guzik K, Zieba BJ, Musielak B, Domling A, Dubin G, and Holak TA. 2016. "Structural Basis for Small Molecule Targeting of the Programmed Death Ligand 1 (PD-L1)." Oncotarget 7(21)30323-35.

3. MA, Gomes de Castro, Hobartner C, and Opazo F. 2017. "Aptamers Provide Superior Stainings of Cellular Receptors Studied under Super-Resolution Microscopy." PloS One 12(2).

4. ML, James and Gambhir SS. 2012. "A Molecular Imaging Primer: Modalities, Imaging Agents, and Applications." Physiological Reviews 92(2)397-965.

5. MP, Melancon, Zhou M, Zhang R, Xiong C, Allen P, Wen X, Huang Q, Wallace M, Myers JN, Stafford RJ, Liang D, Ellington AD, and Li C. 2014. "Selective Uptake and Imaging of Aptamer- and Antibody-Conjugated Hollow Nanospheres Targeted to Epidermal Growth Factor Receptors Overexpressed in Head and Neck Cancer." ACS Nano 8(5):4530-38.

6. NS, Que-Gewirth and Sullenger BA. 2007. "Gene Therapy Progress and Prospects: RNA Aptamers." Gene Therapy 14(4) :283— 91.

7. R, Chakravarty, Goel S, and Cai W. 2014. "Nanobody: The 'Magic Bullet' for Molecular Imaging?" Theranostics 4(4)386-98.

8. R, Weissleder and Pittet MJ. 2008. "Imaging in the Era of Molecular Oncology." Nature 452(7187)380-89.

9. S, Yoon and Rossi JJ. 2018. "Targeted Molecular Imaging Using Aptamers in Cancer." Pharmaceuticals (Basel, Switzerland) 11(3). SEQUENCE LISTING

<110> Jagiellonian University in Krakow

<120> DNA aptamer showing affinity for PD-L1 protein and its use, functional

<130> PZ/9833/RW/PCT

<160> 5

<170> Patentin version 3.5

<210> 1

<211> 90

<212> DNA

<213> artificial

<220>

<223> aptemer

<400> 1 catgcttccc cagggagatg gggggacggt aagaggggcg gggcatggag ggggtctgct 60 cgggattgcg gaggaacatg cgtcgcaaac 90

<210> 2

<211> 41

<212> DNA

<213> artificial

<220>

<223> library of ssDNA

<220>

<221> n

<222> (21)..(21)

<223> n means 50 nucleotide random sequence

<220>

<221> misc_feature

<222> (21)..(21)

<223> n is a, c, g, or t

<400> 2 catgcttccc cagggagatg ngaggaacat gcgtcgcaaa c <210> 3

<211> 20

<212> DNA

<213> artificial

<220>

<223> primer FOR

<400> 3 catgcttccc cagggagatg 20

<210> 4

<211> 19

<212> DNA

<213> artificial

<220>

<223> primer Rev

<400> 4 gtttggacgc atgttcctc 19

<210> 5

<211> 88

<212> DNA

<213> artificial

<220>

<223> control oligo

<400> 5 catgcttccc cagggagatg actgactgac tgactgactg actgactgac tgactgactg 60 actgactgga ggaacatgcg tcgcaaac 88