Endophytes from wild populations of barley increase crop yield

Field of the Invention

This invention relates to the uses of isolated and cultured endophytes from wild populations of barley. In particular, the invention relates to isolated and cultured endophytes from wild populations of barley who are vertical transmission (VT) competent and use of those VT competent endophytes in a method for improving dry shoot weight, mean dry grain weight, and suppression of seed-borne infection in a crop by inoculation with at least one or a combination of the isolated VT competent endophytes.

Background to the Invention

If a cereal grower wants a higher grain yield then the widely accepted course of action is to increase chemical inputs. However, this causes two serious and linked problems; high economic cost and high environmental cost. Chemical fertiliser costs can represent as much as a quarter of direct costs for the tillage farmer. These fertilisers, and other regularly applied chemical treatments, can also have a detrimental effect on the wider environment and on the microorganisms, that are important for maintaining a healthy soil. It is widely recognised that the current level of fertiliser use is unsustainable in many farming systems and if a more sustainable approach to maintaining crop yield was developed, then chemical fertiliser inputs can be reduced. It has been increasingly demonstrated over the past few years that part of the answer to reducing these cost burdens on the grower and the environment will be to use bioactive agents to help improve crop health and yield. Endophytes are one group of bioactive agents that have shown the greatest promise. Endophytes are microorganisms that spend all or part of their lives inside plant tissue without causing disease symptoms, they have great potential as beneficial crop inoculants (Murphy et al. 2014). While much of the experimental work with endophytes has focused on a relatively limited range of endophytic species, endophytes recovered from wild relatives of crops have been less studied and offer a largely untapped and vast potential for improving agronomic traits in crop cultivars (Murphy et at. 2015; Murphy et at. 2017b). Crop wild relatives represent a valuable repository of symbiotic microorganisms which can be beneficial for modern crop relatives (Murphy et al. 2014a). Genes from crop wild relatives have proved to be of great utility to breeders who wish to mine this resource for useful genetic traits that will improve crop performance, and there is every reason to believe that the diversity and functional traits of endophytes in crop wild relatives will be just as useful. The added benefit of using microbial crop inoculants is that they are easier to apply and develop compared to the often expensive and lengthy process of developing a genetically modified (GM) product, and they may also be more acceptable to regulatory authorities and the general public in jurisdictions where GM crops are not widely grown.

Endophytes isolated and cultured from wild plant populations have proved to be extremely diverse, and these are often relatively novel and previously undescribed organisms with unknown potential as crop inoculants, even within a single host species (Murphy et at. 2015b). Previous work by the inventors has demonstrated that these endophytes can enhance barley yield and other agronomic traits under a range of stressful environments, and they have recently demonstrated that these beneficial results translate to field-grown barley (Murphy et at. 2017b). Those endophytes are applied to crops as seed-coating compositions and cannot be passed on to the next generation of seeds produced by the plant sprouted from those coated seeds.

In POT Publication No. WO 2016/030535, endophytes are described as playing a role in increasing grain yield and dry shoot weight in plants, and improving tolerance to development of seed-borne fungal infections on germinated and ungerminated seeds. In POT Publication No. WO 2014/121366, endophytes are described as playing a role in plant biomass production and yield in plants such as barley, and also enhances tolerance to environment stresses. However, the patent only claims increases of seed germination vigour and the fresh weight and yield of seedlings, but not the mature plants or seed (i.e. grain in the case of cereals). In GB 2490249, compositions are described which increased seed vigour and growth. However, the compositions are organic wax coatings used to coat the seeds, which enhance growth and vigour in monocots by acting as a protectant from environmental stress. The document makes no specific mention of using endophytes as a component of the coating.

It is an object of the present invention to overcome at least one of the above-mentioned problems. Summary of the Invention

Endophytes isolated from natural populations of plants stimulate an increase in cultivated crop yield without the use of chemical inputs (such as nitrogenous fertilisers, manures) when inoculated onto seeds of a crop cultivar. A formulation containing spores of the endophyte(s) is applied to the crop cultivar seed before sowing. The formulation increases crop yield (such as grain dry weight) and biomass, and promotes biotic and abiotic stress resistance in crops. The endophytes of the claimed invention were isolated from the seeds of wild barley ( Hordeum murinum), not the root tissue of the plant as is the source of endophytes accepted by those working in the field. The source of the endophytes shows that they have seed tissue specific localisation, which is a trait shown by agents who have vertical transmission properties.

According to the description provided herein, there is provided, as set out in the appended claims, a seed coating composition comprising a fungal endophyte isolated from a tissue of a plant, such as Hordeum murinum, and a carrier medium for application of said composition to a target seed, wherein at least one of the fungal endophytes is vertical transmission competent.

In one embodiment, the fungal endophyte is isolated using primers defined by SEQ ID NOs 1 and 2.

In one embodiment, the endophyte is characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from SEQ ID NOs: 3 to 12, or variants thereof, or a combination thereof.

In one embodiment, the endophyte is characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from SEQ ID NOs: 3, 6, 1 1 or 12, or variants thereof, or a combination thereof.

According to one aspect of the invention, there is provided a seed coating composition comprising one or more fungal endophytes isolated from a seed or a husk of the seed of Hordeum murinum and a carrier medium for application of said composition to a target seed, wherein the fungal endophytes are vertical transmission competent, and in which the endophytes are characterised as being selected from an Alternaria sp., a Penicillium sp., or a Cladosporium sp. and having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from SEQ ID NOs: 3, 4, 5, 10, 1 1 or 12. Preferably, the endophytes are characterised as being Alternaria alternata, Penicillium brevicompactum , Cladosporium ramontenellum, or Cladosporium herbarum.

Preferably, the one or more endophytes selected are isolated from the seed and are characterised as being Cladosporium herbarum and having a nuclear ribosomal internal transcribed spacer (nrlTS) defined by SEQ ID NOs: 1 1 or 12. The composition further comprises one or more endophytes isolated from the husk of the seed, and in which the endophytes are characterised as being Penicillium brevicompactum , Cladosporium ramontenellum or Alternaria alternata and having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from SEQ ID NOs: 3, 4 or 5.

Preferably, the composition further comprises one or more fungal endophytes isolated from a tissue of Hordeum murinum other than the seed or the seed husk, in which the endophyte is characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from SEQ ID NOs: 6 to 9 and selected from a Penicillium sp., a Cladosporium sp., a Humicola sp., or a Talaromyces sp.. Ideally, the endophyte is selected from Penicillium glabrum, Cladosporium ramontenellum, Humicola grisea, and/or Talaromyces purpurogenus.

Preferably, the composition comprises endophytes characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from SEQ ID NOs: 6, 8, 1 1 and 12, and classified as being Cladosporium herbarum, Humicola grisea, and/or

Talaromyces purpurogenus.

In one aspect, there is provided a seed coating composition comprising one or more fungal endophytes isolated from a tissue of a plant, such as Hordeum murinum, and a carrier medium for application of said composition to a target seed, wherein at least one of the fungal endophytes is vertical transmission competent; in which the endophyte is characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from SEQ ID NOs: 3 to 12. Preferably, the one or more endophytes are classified as Alternaria alternata, Penicillium brevicompactum, Penicillium glabrum, Cladosporium ramontenellum, Cladosporium herbarum, Humicola grisea, and/or

Talaromyces purpurogenus.

Preferably, the composition comprises the endophytes are characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from SEQ ID NOs: 6, 8, 1 1 and 12, and classified as being Cladosporium herbarum, Humicola grisea, and/or Talaromyces purpurogenus.

In one aspect, there is provided a seed coating composition comprising one more fungal endophytes isolated from a root of Hordeum murinum and a carrier medium for application of said composition to a target seed, and in which the endophyte is characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from SEQ ID NOs: 6, 7, 8 or 9. Preferably, the one or more endophyte is Alternaria alternata, Penicillium brevicompactum , Penicillium glabrum, Cladosporium ramontenellum, Cladosporium herbarum, Humicola grisea, and/or Talaromyces purpurogenus.

Preferably, the plant sprouted from the coated target seed exhibits a trait selected from one or more of an increased grain dry weight, an increase in the number of heads, an increase number of grains and shoot dry weight.

In one embodiment, the plant is Hordeum murinum subsp. murinum L (Hmm).

In one embodiment, the plant Hordeum murinum is in low-nutrient conditions.

In one embodiment, the plant Hordeum murinum is in drought-stressed conditions. In one embodiment, the plant Hordeum murinum is in light-stressed conditions. In one embodiment, the plant Hordeum murinum is in temperature-stressed conditions. In one embodiment, the Hordeum murinum plant is in multiple-stressed conditions.

In one embodiment, the plant sprouted from the coated target seed exhibits an increased grain weight, an increase in the number of heads, an increase number of grains and shoot dry weight.

In one embodiment, the concentration of the fungal endophyte isolate in the composition is between 0.001% (w/v) to 1.0% (w/v).

In one embodiment, the carrier medium is selected from water, distilled water, sterilised water, sterilised distilled water, an emulsified suspension, wettable powder, encapsulation of spores of the fungal endophyte in alginate beads, or a film-coating.

There is also provided a plant grown from a seed coated with a seed-coating composition comprising a fungal endophyte isolated from a tissue of the plant Hordeum murinum and a carrier medium for application of said composition to a target seed, wherein at least one of the fungal endophytes is vertical transmission competent, and wherein the plant grown from the coated seed comprises at least one feature selected from the group consisting of (i) an endophyte isolated using primers defined by SEQ ID NOs 1 and 2; (ii) an endophyte characterised in having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from SEQ ID NOs: 3 to 12, or variants thereof, or a combination thereof.

Preferably, the one or more endophytes are Alternaria alternata, Penicillium brevicompactum , Penicillium glabrum, Cladosporium ramontenellum, Cladosporium herbarum, Humicola grisea, and/or Talaromyces purpurogenus.

In one embodiment, the plant grown from the coated seed exhibits a trait selected from disease resistance, drought tolerance, heat tolerance, cold tolerance, salinity tolerance, tolerance to a nutrient-deficient environment, increase in biomass, increase in crop yield, increase in seed weight, an enhanced seed oil composition, an increase in photosynthetic efficiency, an increase in growth rate, an increase in root mass.

In one embodiment, the plant grown from the coated seed is from a grass.

In one embodiment, the grass is a cereal crop selected from barley ( Hordeum vulgare), wheat ( Triticum aestivum), oats ( Avena sativa), maize ( Zea mays), rye ( Secale cereale), spelt ( Triticum spelta), rice ( Oryza sativa), millet ( Panicum miliaceum, Eleusine coracana, Setaria italica, Pennisetum glaucum), sorghum ( Sorghum bicolor), triticale (x Triticosecale), teff ( Eragrostis tef), fonio ( Digitaria exilis), wild rice ( Zizania spp.), canary grass ( Phalaris sp.), quinoa ( Chenopodium quinoa), amaranth ( Amaranthus spp.), buckwheat ( Fagopyrum esculentum).

There is also provided a seed comprising one or more fungal endophytes selected from a Cladosporium strain, a Penicillium strain, a Humicola strain or a Talaromyces strain, or a combination thereof, and wherein the endophytes are originally isolated from a tissue of the plant Hordeum murinum.

In one embodiment, the endophytes are isolated using primers defined by SEQ ID NOs 1 and 2. In one embodiment, the endophyte is characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) according to any one of SEQ ID NOs: 3 to 12, or variants thereof.

In one aspect, there is provided a seed comprising one or more fungal endophytes selected from an Alternaria strain, a Cladosporium strain, a Penicillium strain, a Humicola strain or a Talaromyces strain, and wherein the endophytes are originally isolated from a tissue of the plant Hordeum murinum, and are characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from SEQ ID NOs: 3 to 12. Preferably, the one or more endophytes are Alternaria alternata, Penicillium brevicompactum , Penicillium glabrum, Cladosporium ramontenellum, Cladosporium herbarum, Humicola grisea, and/or Talaromyces purpurogenus.

In one embodiment, the endophyte is characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from one of SEQ ID NOs: 3, 6, 8, 1 1 or 12, or variants thereof, or a combination thereof.

There is also provided a seed coated with, mixed with, or encapsulated with the seed coating composition described above.

In one embodiment, the carrier medium is alginate beads.

There is also provided a plant grown from the seed described above.

There is also provided a seed obtained from the plant above.

There is also provided a method of producing a plant from a target seed, the method comprising the steps of coating the target seed with the composition described above; planting the coated seed in an appropriate medium; growing the plant from the seed and harvesting a crop from the plant.

In one embodiment, the medium is a soil-based medium, an artificial growth medium, moss peat and moss peat mixes, or mixes thereof of all medium. Preferably, the soil- based medium is a low-nutrient soil.

In one embodiment, where the method is for agricultural use, the seed would be planted in a field of soil using standard agricultural equipment. In one embodiment, where the method is for controlled environmental use, the seed is manually planted at a depth of 30-40mm in the chosen medium.

There is also provided a method of increasing one or more traits selected from grain dry weight, the number of heads, the number of grains per head, and shoot dry weight in a plant grown from a target seed, the method comprising applying a composition comprising a fungal endophyte isolated from a tissue of the plant Hordeum murinum and a carrier medium for application of said composition to the target seed; planting the coated target seed in an appropriate medium and allowing the plant to grow.

In one embodiment, the endophytes are isolated using primers defined by SEQ ID NOs 1 and 2.

In one embodiment, the endophyte is characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) according to any one of SEQ ID NOs: 3 to 12, or variants thereof.

In one embodiment, the endophyte is characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from one of SEQ ID NOs: 3, 6, 8, 1 1 or 12, or variants thereof, or a combination thereof.

In one aspect, there is provided a method of increasing one or more traits selected from grain dry weight, the number of heads, the number of grains per head, and shoot dry weight in a plant grown from a target seed, the method comprising applying a composition comprising a fungal endophyte isolated from a seed or a husk of the seed of the plant Hordeum murinum and a carrier medium for application of said composition to the target seed, wherein the fungal endophytes are vertical transmission competent, and in which the endophytes are characterised as being selected from an Alternaria sp. a Penicillium sp., or a Cladosporium sp. and having a nuclear ribosomal internal transcribed spacer (nrlTS) selected from SEQ ID NOs: 3, 4, 5, 10, 1 1 or 12; planting the coated target seed in an appropriate medium and allowing the plant to grow.

In one embodiment, the medium is soil, an artificial growth medium, moss peat and moss peat mixes, or mixes thereof of. Preferably, the soil is a low-nutrient soil.

There is also provided an endophyte characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) according to any one of SEQ ID NOs: 3 to 12, or variants thereof. In one embodiment, the endophyte is isolated from a tissue of the plant Hordeum murinum.

In one embodiment, the endophytes are isolated using primers defined by SEQ ID NOs 1 and 2.

In one aspect, there is provided an endophyte isolated from Hordeum murinum and characterised as having a nuclear ribosomal internal transcribed spacer (nrlTS) according to any one of SEQ ID NOs: 3 to 12 and in which the endophyte is Alternaria alternata, Penicillium brevicom pactum , Penicillium glabrum, Cladosporium ramontenellum, Cladosporium herbarum, Humicola grisea, and/or Talaromyces purpurogenus.

In general, the fungal endophyte is isolated from a tissue of the plant Hordeum murinum. The tissue can be the root, seed, seed husk or other appropriate parts of the plant, such as a shoot, leaf tissue and meristem. In one embodiment, the fungal endophyte is isolated from a root of the plant Hordeum murinum. In one embodiment, the fungal endophyte is isolated from a seed husk of the plant Hordeum murinum. In one embodiment, the root endophyte is isolated from a seed of the plant Hordeum murinum. Preferably, the plant is Hordeum murinum subsp. murinum L. (Hmm).

In one embodiment, the fungal endophyte is selected based on having a nuclear ribosomal internal transcribed spacer selected from one of SEQ ID NOs 3 to 12, or variants thereof, or any combination thereof.

In one embodiment, the fungal endophyte is selected based on having a nuclear ribosomal internal transcribed spacer with at least 90% sequence identity to any one of SEQ ID NOs 3 to 12, or any combination thereof.

Definitions

In the specification, the term“ruderal” should be understood to mean a plant species that is first to colonize disturbed lands. The disturbance may be natural or a consequence of human activity.

In the specification, the term“isolated endophyte” should be understood to mean fungal emergents from tissue of the plant Hordeum murinum, which have been inoculated onto culture medium and subsequently individually sub-cultured from single spores or mycelia to obtain a single uncontaminated organism. Typically, the tissue is a root piece, a seed or a seed husk of the plant. Typically, the plant is Hordeum murinum subsp. murinum L. ( Hmm ).

In the specification, the term “variants thereof”, should be understood to mean polynucleotides sequences which are substantially identical to the full nuclear ribosomal internal transcribed spacer of an isolated endophyte. Thus, for example, the term should be taken to include polynucleotides that are altered in respect of one or more nucleic acids. Preferably such alterations involve the insertion, addition, deletion and/or substitution of 15 or fewer nucleic acids, more preferably of 12 or fewer, even more preferably of 9 or fewer, most preferably of 3 or 6 nucleic acids only. The variant may have conservative nucleic acid changes, wherein the nucleic acid being introduced does not change the structure or activity of the translated nucleic acid sequence. Typically, any sequence which has been altered by substitution or deletion of catalytically-important nucleic acids will be excluded from the term“variant”. Generally, the variant will have at least 70% sequence identity, preferably at least 80% sequence identity, more preferably at least 90% sequence identity, and ideally at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the wild-type nuclear ribosomal internal transcribed spacer of the isolated endophyte as depicted in SEQ ID NOs 3 to 12; and wherein the variant is capable of increasing crop yield (such as grain yield/grain dry weight) and/or dry shoot weight and/or biomass and/or tolerance to the development of seed-borne fungal infections on germinated and ungerminated seeds and/or can have its genetic material moved by the vertical transmission of DNA from a parent plant (via plant grown from a coated target seed) to its offspring. In other words, where the endophytes are passed from F ₀ to Fi to F ₂ and future generation of plants by vertical transmission.

In the specification, the term“film-coated” should be understood by those skilled in the art to mean a thin polymer-based coat applied to a solid form such as a seed or a tablet. The coating can be aqueous or non-aqueous based. The thickness of such a coating is usually between 20-100 pm. Film coating formulations generally comprise a polymer (for example, cellulose derivatives or acrylic polymers and copolymers such as-Hypromellose,-Hydroxyethyl cellulose, Hydroxyethyl methyl cellulose, Carboxymethylcellulose sodium, Hydroxypropyl cellulose, Polyethylene glycol, ethyl cellulose,· Hypromellose phthalate, Polyvinyl acetate phthalate, Cellulose acetate phthalate,· Polymethacrylates, -Shellac), a plasticiser (such as, for example, glycerol, propylene glycol, PEG (Polyethylene glycol), phthalate esters, dibutyl sebacete, citrate esters, triacetin, castor oil, acetylated, monoglycerides, fractionated coconut oil) and a carrier (generally, water or organic solvents such as alcohols, ketones, esters and chlorinated hydrocarbons). Water is the preferable carrier.

In the specification, the term“light-stressed” conditions should be understood to mean where the seeds and plants have been stressed by either too much or too little light. A control‘ideal’ light intensity would be about 420 pmol nr ² s ¹ at leaf level; so less than this is low light-stressed and greater than this is high light-stressed.

In the specification, the term“temperature-stressed” conditions should be understood to mean where the seeds and plants have been stressed by temperatures under 5 °C) or over 25 °C). This is in controlled conditions where availability of water and uptake by the plant can be controlled. The degree of temperature stress is related to the availability of water and its uptake in the plant, and the atmospheric humidity.

In the specification, the term“multiple-stressed” should be understood to mean where plants have been stressed by a number of factors such as one or more of drought, nutrient-depleted or nutrient-poor soils, low or too much light, pathogen infection, cold and heat.

In this specification, the term“vertically transmitted infection” or“vertical transmission competent” as applied to an endophyte means that the endophyte when coated on to a seed of a parent plant is capable of vertical transmission from the coated seed of the parent plant (F ₀ ) to the next generation of seeds (Fi). Examples include the endophytes having a wild-type nuclear ribosomal internal transcribed spacer as depicted in SEQ ID NOs 3 to 12, or variants thereof which are also vertical transmission competent. A test for identifying an endophyte capable of vertically transmitted infection is described below.

In the specification, the term“artificial growth medium” should be understood to mean vermiculite or perlite, and the like. Brief Description of the Drawings

The invention will be more clearly understood from the following description of an embodiment thereof, given by way of example only, with reference to the accompanying drawings, in which

Figure 1 illustrates the inferred evolutionary history of the five Cladosporium strains using the Maximum Parsimony method. The most parsimonious tree with length = 284 is shown. The consistency index is 0.855634 (0.677165), the retention index is 0.405797 (0.405797), and the composite index is 0.347214 (0.274792) for all sites and parsimony-informative sites (in parentheses). Yield-enhancing endophyte strains are outlined in bold dash.

Figure 2 illustrates the inferred evolutionary history of the two yield-enhancing Cladosporium strains (highlighted in bold) and 5 randomly chosen GenBank accessions using the Maximum Parsimony method. Tree #1 out of 2 most parsimonious trees (length = 48) is shown. The consistency index is 0.979167 (0.977273), the retention index is 0.976744 (0.976744), and the composite index is 0.956395 (0.954545) for all sites and parsimony-informative sites (in parentheses).

Detailed Description of the Drawings

Hordeum murinum subsp. murinum L. ( Hmm ) is an annual grass species and a ruderal of roadsides, rough grassland and waste places. As the species generally grows in stressed environments, it may have evolved symbiotically-conferred stress tolerance associated with endophyte infection, and these endophytes may help the plants to grow in stressed conditions. Endophytes isolated from Hmm may have the potential to benefit cultivated barley in low-nutrient, drought-stressed and multiple-stressed conditions.

Materials and Methods

Replicated glasshouse trials were used to examine the effects on a barley cultivar of ten fungal endophytes isolated from a wild barley relative. In order to examine the effect of the endophytes on barley grown under different light and temperature conditions, one trial was conducted from October to February (autumn/winter) and the other from March to June (spring/summer). Field sampling

Whole plants and seeds of mature wall barley ( Hordeum murinum L) were collected from three suburban populations in Dublin, Ireland. Environmental and plant variables were recorded at the time of collection and included: soil pH, soil salinity (measured as osmotic potential in bars), soil moisture content, plant height (cm), Zadoks growth stage (Zadoks et al., 1974) and plant health (scored on a five-point scale, with a score of five indicating large plants of excellent health with no apparent disease or physiological stress symptoms and a score of zero indicating plants with severe disease or stress symptoms). The overall vegetation type and soil type for each site was assessed using a numerical equivalent. For vegetation type: 1 = a site without any significant soil and with no other vegetation (for example the edge of a roadside kerb), 2 = an open site with short grass, 3 = an open site with short weedy vegetation, 4 = a site with shading from deciduous trees and short grass, 5 = a site at the base of a wall with no other vegetation. For soil type: 1 = a light sandy silt, 2 = a light sandy loam, 3 = a dark clay loam with few stones.

Endophyte isolation

Roots, seeds and seed husks were separated from whole plants and surface-sterilised by immersing in 70% EtOH for one minute, then placed in 5% NaCIO for 5 minutes, immersed for another minute in 70% EtOH then rinsed five times with sterile water. Ten root pieces of 5 mm length and 10 halved seeds and halved husks from each plant were inoculated onto culture plates of potato dextrose agar (Oxoid CM0139) and incubated in the dark at 21 °C for 28 days. The powdered medium was mixed to half- strength of the manufacturers’ recommendations (to avoid osmotic shock to the endophytes) using pure water, then sterilised by autoclaving. From previous experience of the inventors, 28 days is considered to be sufficient time to allow recovery of the slowest emerging endophytes. Dishes were inspected daily and those containing root, seed or husk pieces with surface fungal growth were discarded (i.e. not emerging from the cut root area). Emergent endophytes were removed and subcultured on the same medium in the dark at 21 °C for a further 14 days. From a total of 82 individual cultures recovered, ten were selected for DNA sequencing and glasshouse trials based on selection criteria of early sporulation and high spore yield at room temperature (18 - 21 °C). Three of the selected endophyte isolates were recovered from seeds, three from husks and four from root tissue. DNA extraction and internal transcribed spacer (ITS) sequencing

For the DNA analysis, 20 mg of fungal material was scraped from the agar surface and placed into shaker tubes. DNA was extracted using a Qiagen DNeasy mini kit, following the Qiagen protocol, producing 200 mI of DNA extract for each isolate. PCR was carried out on the DNA extracts using the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) primers ITS1 (forward primer) (SEQ ID NO: 1 - 5’

T CCGT AGGT G AACCTGCGG 3’) and ITS4 (reverse primer) (SEQ ID NO: 2 - 5’ TCCTCCGCTTATTGATATGC 3’). The PCR reaction contained 1 mI of DNA extract (ca. 20 ng mI-1 ), 5 mI of 5x buffer (Promega), 0.5 mI of 10 mM dNTPs, 0.25 mI at 20 pmol, 0.25 mI of each primer at 20 pmol mI-1 , 2 mI of 25 mM MgCI2, and 0.125 mI of Go Taq Flexi DNA Polymerase (Promega). Thermal cycling in an Applied Biosystems Proflex® thermal cycler included a premelt of 94 'Ό for 30 seconds followed by 32 cycles of 94 'Ό for 2 mins, 57 °C for 1 min and 72‘Q for 1 min, followed by a final extension of 7 mins at 72 ^q C. A further PCR was carried out to increase DNA yield and the products were sent for sequencing to an outside service supplier (Macrogen Europe, Netherlands). The full nuclear ribosomal internal transcribed spacer (nrlTS) sequences for the ten endophyte isolates can be found as SEQ ID NOs: 3 to 12, as follows: SEQ ID NO. 3 >161024-038_G12_195EZAA186. abl 1973

GGTCATCCTAGTGAAGGCCTCTGGGTCCACCTCCCACCCGTGTTTATTTTACCTTGTTGC TTCG GCGAGCCTGCCTTTTGGCTGCCGGGGGACATCTGTCCCCGGGTCCGCGCTCGCCGAAGAC ACCT TAGAACTCTGTCTGAAGATTGTAGTCTGAGATTAAATATAAATTATTTAAAACTTTCAAC AACG GATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTG CAGA ATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCAT GCCT GTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTCCGTCCTCCTTCCG GGGG ACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCA CCCG CTTTGTAGGACTGGCCGGCGCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGA TCAG GTAGGGATACCCGCTGAACTTAAGCATATCAAAAACTC

SEQ ID NO. 4 >161024-038_A16_195EZAA188. abl 1905

GTGGTTATGGTGACAGGACTACGGCCGGGATGTTCATAACCCTTTGTTGTCCGACTCTGT TGCC TCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCAAACTCTTGCGTAA CTTT GCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGTTCTG GCAT CGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATC GAAT CTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTT CACC ACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGTCCGGCT GGGT CTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACGCCG TAAA ACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCAT ATCA AAGCCGGGAAGGAAAAAATTACCAGGGGACCCAGCAACCGCCGGGAAGCTTCAAAACCCT GTGC

TTGTCGGACACTCCTTGCCTCCGGGGGGG

SEQ ID NO. 5 >161024-038_I14_195EZAA192. abl 1711

TGGGCAAGCATACAAGCAGGGCTGGACACCCCCCGCTGGGCACTGCTTCACGGCGTGCGC GGCG GGGCCGGCCCTGCTGAATTATTCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGG GCTC GCCCGCCCTCAGGACCAACCACAAACCTTTTGCAATAGCAATCAGCGTCAGTAACAACGT AATT

AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGA AATGCGA

TACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCG CCCTTTG

GTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGT GTTGGGC

GTCTTTTGTCTCCAGTTCGCTGGAGACTCGCCTTAAAGTCATTGGCAGCCGGCCTAC TGGTTTC

GGAGCGCAGCACAAGTCGCGCTCTTTGCCAGCCAAGGTCAGCGTCCAGCAAGCCTTT TTTTCAA

CCTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATATAAACGCGG AAGGAAA

AAA

SEQ ID NO. 6 >161024-038_K14_195EZAA190. abl 1140

GGGTTCGAGTTGCAACTCCCAACCATTGTGAACATACCTTCAACGTTGCTTCGGCGGGTT GGCC

CCGGTCTCCGGGGTCCCCGGCCCTACTCGGGCGCCCGCCGGAGGTATCTAACTCTTG AACTTTT

ATGGCCTCTCTGAGTCTTTGTACTTAATAAGTCAAAACTTTCAACAACGGATCTCTT GGTTCTG

GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTG AATCATC

GAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGC GTCATTT

CAACCATCAAGCCCCCGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAA CCAGTGG

CGGGCTCGCTAGTCACTCCGAGCGTAGTAATACATCTCGCTCAGGGCGTGCTGCGGG TTCCGGC

CGTTAAAAAACCTTATTTACCCAAGGTTGACCTCGGATCAGGTAGGAAGACCCGCTG AACTTAA

GCATATCAAAAACC

SEQ ID NO. 7 >161024-038_E16_195EZAA194. abl 1323

ACCTCCCACCCGTGTTTATTGTACCTTGTTGCTTCGGTGCGCCCGCCTCACGGCCGCCGG GGGG

CTTCTGCCCCCGGGTCCGCGCGCACCGGAGACACCATTGAACTCTGTCTGAAGATTG CAGTCTG

AGCATAAACTAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGA TGAAGAA

CGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTT TGAACGC

ACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCT CAAGCAC

GGCTTGTGTGTTGGGCTCCGTCCCCCCGGGGACGGGTCCGAAAGGCAGCGGCGGCAC CGAGTCC

GGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCCAGCC GACAACC

AATCATCCTTTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG CATATCT

AAAACCGGGAAAAAGATCATTACTGAGTGAGGGCCCTCTGGGTCCACCTCCACCCGT GTTTATT

GTACCTTGTTGCTTCCGTGCGCCGCCTCAGGCCGCCGGGGGGCTTCTGCCCCCGGGT CCCGCGC

ACGGAAACCCATTGAACTCTGTCTGAAGATTGCAGTCGGAGCATAAACTAAATAAGT TTAAAAC

TTT

SEQ ID NO. 8 >161024-038_K12_195EZAA196. abl 1701

TGGTCTATCGAGTGCGAGTACTCGTGGCCAACCTCCCACCCTTGTCTCTATACACCTGTT GCTT

TGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACATCTGTCCCCGGGCCTGCGC CCGCCGA

AGCGCTCTGTGAACCCTGATGAAGATGGGCTGTCTGAGTACTATGAAAATTGTCAAA ACTTTCA

ACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAA TGTGAAT

TGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCC GGGGGGC

ATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGCGGTC CCCCCGG

GGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTTT GTCACTC

GCTCGGGAAGGACTGGCGGGGGTTGGTCACCACCAAAATTTTACCACGGTTGACCTC GGATCAG

GTAGGAGTTACCCGCTGAACTTAAGCATATCATAAGCCGGGAGAAAATCATTACCGA GTGCGGG

CCCTCGTGGCCCAACCTCCCACCCTTGGTCTCTATACACCTGGTTGCTGTTGGCCGG GGCCACC

GGGGGCCACCTGGGTCGCCGGGGGGACATCTTGTCCCCGGGGCCTGCGCCCGCCGAA AGCGCTT

TTGTGAACCCCTGATAAAGGATAGGGCTGTTCTGAAGTTACTAATGAAAAAATTTGA TCAAAAA

CTTTTCACAAATGGGAAATCTCTTGGGGTTTTCCGGCCCTCGAATTAA

SEQ ID NO. 9 >161024-038_M14_195EZAA198. abl 1415

AGGCAACAGTGAGAGGATCTACCACCGGGATGTTCATAACCCTTTTGTTGTCCGACTCTG TTGC

CTCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCAAACTCTTGC GTAACTT

TGCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGT TCTGGCA

TCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT CATCGAA

TCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTC ATTTCAC CACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGC TGGG

TCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTAC GCCGTAA

AACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA GCATATC

ATAAACCGGGAAGAAAATCATTACAAGTGGACCCGGTCTAACCACCGGGGATGTTCA CAACCCT

TTGCTTGTCCGACTCTCTTGCCTCCGGGGCGACCCTGCCCTCGGGCGGGGGCTCCGG GTGGACA

CTTCAT

SEQ ID NO. 10 >161024-038_A14_195EZAA200. abl 1160

GGGCAATCGTGAGCAGGACTACGGCCGGGATGTTCATAACCCTTTGTTGTCCGACTCTGT TGCC

TCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCAAACTCTTGCG TAACTTT

GCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGTT CTGGCAT

CGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATC ATCGAAT

CTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCA TTTCACC

ACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGTCCG GCTGGGT

CTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACG CCGTAAA

ACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG CATATCA

TAAGCCGGGAAGAAAACAATTACAAGTGACCCCGGCGACCGCCGGGGATGTTCATAA CCCTTTG

GTTGTCCGACGCTTTTGCCTCCGGGGCGACCCTGCCGTCGGGCGGGGGCTCCCGGTG GACACTT

CATACTCTTGCGTAACTTTGCAGTCTGAGTAAACTTAATTAATAAAATTAAAACTTT T

SEQ ID NO. 11 >161024-038_E12_195EZAA202. abl 1248

GGGCATAGGACGCCAGGAGCTTCGGCCTGGTTATTCATAACCCTTTGTTGTCCGACTCTG TTGC

CTCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCAAACTCTTGC GTAACTT

TGCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGT TCTGGCA

TCGATGAAGAACGCAGOGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT CATCGAA

TCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTC ATTTCAC

CACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGTCC GGCTGGG

TCTTCTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTAC GCCGTAA

AACAACCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA GCATATC

SEQ ID NO. 12 >161024-038_A12_195EZAA205. abl 1371

GGGAGCTCGCCATCCCTACCTGATCCGAGGTCACCTTAGAAATGGGGTTGTTTTACGGCG TAGC

CTCCCGAACACCCTTTAGCGAATAGTTTCCACAACGCTTAGGGGACAGAAGACCCAG CCGGACG

ATTTGAGGCACGCGGCGGACCGCGTTGCCCAATACCAAGCGAGGCTTGAGTGGTGAA ATGACGC

TCGAACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGATTCGA TGATTCA

CTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCA GAACCAA

GAGATCCGTTGTTAAAAGTTTTAATTTATTAATTAAGTTTACTCAGACTGCAAAGTT ACGCAAG

AGTTTGAAGTGTCCACCCGGAGCCCCCGCCCGAAGGCAGGGTCGCCCCGGAGGCAAC AGAGTCG

GACAACAAAGGGTTATGAATAACCAGGCCGAAGCCCGGGCGTTCTTGTAATGATCCC TCCGCAG

TCACCCTTC

Sequence analysis

Isolate sequences were recovered and compared with GenBank (NCBI) accessions using the Basic Local Alignment Search Tool (megaBLAST), and identified using morphological and DNA characters. BLAST similarity criteria for assigning taxonomic rank to the endophyte strains was allocated based on an initial survey of existing fungal taxa in GenBank, as follows: >97% similarity was assigned to the same species, 90- 96% to the same genus, 85-90% to the same order and <85% to no significant match. In all cases, genetic identity assignment was confirmed or further assessed by examination of morphological characters of the fungi using light microscopy and by referencing the taxonomic descriptions found in Cannon and Kirk (Cannon, P.F., Kirk, P.M., editors. 2007. Fungal families of the world. London: CABI).

Every recovered sequence was combined into a matrix and analysed to detect recombination events using the RAT Recombination Analysis Tool, which uses the distance-based method of recombination detection. Window size was set to 93 characters (0.1 of sequence length) and Increment size was 46 characters (0.5 of Window size).

The evolutionary history of the five Cladosporium strains was inferred using the Maximum Parsimony (MP) method. The MP tree was obtained using the Subtree- Pruning-Regrafting (SPR) algorithm with search level 0 in which the initial trees were obtained by the random addition of sequences (10 replicates). The analysis involved 5 nucleotide sequences. All positions containing gaps and missing data were eliminated. There were a total of 1015 positions in the final dataset. Evolutionary analyses were conducted in MEGA7 (Kumar et al. 2016).

The above analysis was repeated, using the same process and parameters, for the two Cladosporium strains that induced significant yield increases by analysing them in relation to 5 randomly selected Cladosporium ITS sequences from GenBank (search term:‘Uncultured Cladosporium’ AND‘ITS’).

Test for assessing Vertical Transmission of Endophyte in a plant grown from a seed coated with the composition described here

To test whether an endophyte has been vertical transmission competent, seeds from the original seeds or seeds coated with the composition described herein (termed‘F ₀ seeds’) and subsequent generations are sampled. In brief, the steps of the test are: sample F ₀ seeds for endophyte presence, sub-culture recovered endophytes from single-spores, extract and sequence nrlTS gene and compare with the nrlTS sequences described herein. If they are similar (at least 90% identical), then the isolated endophytes are vertical transmission competent. When the F ₀ seeds are planted and grown, the seeds produced from the plant generated from the F0 seeds (F1 seeds) are tested as described above. If they are similar (at least 90% identical), then the isolated endophytes are vertical transmission competent. This confirms that the endophyte in the seed-coating composition has been passed on from the F ₀ generation to the Fi generation, that is, the endophyte is vertical transmission competent.

Experimental protocol

Two replicate glasshouse trials were carried out: one from October to February (autumn/winter) and the other from March to June (spring/summer). The same protocol was followed for each trail. Individual endophyte inoculants were prepared by washing mature culture plates of the endophyte strains with 10 ml pure water to dislodge the spores. The spore solution was transferred to individual 50 ml plastic tubes and further diluted with pure water to give a final concentration of 1 x 10 ⁶ spores/ml (measured with a haemocytometer). For the inoculant treatment of all ten endophyte strains, equal aliquots from each of the individual spore solution preparations were combined.

Seeds of the barley cultivar Propino (Goldcrop Ltd., Cork, Ireland) were soaked in warm water for 3 hours. Three seeds per pot were sown into John Innes No. 2 compost (Westland Garden Health) at 20 mm depth into 3 litre plastic pots. Five pots per treatment were sown and the pots were labelled with a reference number (reference numbers were anonymous to the plant grower). Seeds were inoculated with either 200 mI (-200,000 spores/seed) of the endophyte inoculant (10 individual strains and one combination of all strains) or 200 mI of pure water for the controls, and the seeds covered with the compost. Pots were randomly distributed in two blocks in the glasshouse and repositioned every week during the experimental period. Supplementary overhead lighting of 6 hrs was used for the first trial running from October to February. Plants were watered to field capacity when the compost moisture level dropped below 15% as measured with a Delta-T Devices (https://www.delta- t.co.uk) WET-2 moisture sensor probe at 50mm depth, and no supplementary feeding was given for the entire growing period.

The barley plants were harvested after Zadoks growth stage 89 (Zadoks et at. 1974) was reached (maturity). The number of tillers, number of heads and number of grains per plant were recorded. After drying to 15% moisture content the grain and shoot dry weight were measured.

The presence of the endophytes in seed or root tissue of the mature plants were tested for. Ten seeds from each plant were surface sterilised (as above) then split in half. The prepared seed halves were inoculated onto half-strength PDA, with cut side in contact with the agar, and incubated at I d'Ό. Ten x 10mm pieces of root tissue from the same plants were also processed in a similar fashion.

Data analysis was carried out using single and two-factor ANOVA with Bonferroni correction and Pearson’s correlation statistical analyses supplied with the Data Analysis module within Microsoft Excel® and Datadesk 6.1®.

RESULTS

For the 10 selected candidate endophyte strains, the three host plant sampling sites were characterised by a relatively high soil salinity (mean = 1.37 bars), high soil pH (mean 7.7) and low soil moisture content (mean 10.7%), with two sites having no measurable soil moisture (Table 1 ). All sites had the same soil type, a light sandy silt.

Table 1. Environmental variables for collection sites. Soil pH, Moisture content %, Salinity are mean values ± standard error (n = 10).

^* Salinity is Osmotic Pressure in bars

The 10 endophyte isolates were compared with known GenBank accessions, revealing four different genera, ranging from 93% to 99% pairwise similarity (Table 2).

Table 2. Identities and GenBank submissions

^* Cladosporium ramontenellum

No differences were found between treatments in seed germination percentage or seedling emergence, where 100% of all seeds germinated within two days starting at day 4 from sowing. In both replicate trials, it was found that two strains of Cladosporium recovered from seeds at site 2 (HmS160909G3 and HmS160913G3) significantly increased the grain yield (P < 0.05), and in trial 1 by more than double that of the control (Table 3).

Table 3. Barley cultivar Propino mean harvest parameter values per pot of three plants ± S.E. for seed endophyte strain and control treatments. Significant differences with the

In trial 2 the combined endophyte treatment (EE) significantly also increased the grain dry weight (P < 0.05). While only these three endophyte treatments significantly increased the grain dry weight (use of strains defined by SEQ ID NO. 1 1 , SEQ ID NO. 12 and all strains), in both trials the grain dry weight for all endophyte treatments was equal to or greater than the controls. Although there were no differences between treatments in the number of tillers per plant in either trial (data not shown), there were major differences between trials in the other measured agronomic traits. The number of heads, number of grains, grain dry weight and shoot dry weight were all lower for trial 1 for all treatments except the two yield-increasing Cladosporium strains HmS160909G3 (defined by SEQ ID NO. 1 1 ) and HmS160913G3 (defined by SEQ ID NO. 12), which maintained parameter values similar to and in some cases greater than in trial 2. The likely and immediately obvious cause for the greater parameter values in trial 2 was the more favourable growing conditions during the spring/summer trial period, while trial 1 was conducted over an autumn/winter period. The fundamental parameter differences between these two trials precluded a combined trial analysis of variance (ANOVA). However, correlative statistical analyses were possible for individual and combined trial results.

In both trials there was a positive correlation between grain weight and both the number of heads and number of grains (r < 0.05), and for the combined trial analysis a positive correlation between grain weight and the number of heads, number of grains and shoot dry weight was found (r < 0.05).

The reconstructed Cladosporium phylogeny for the strains used in this experiment revealed that the two yield-enhancing strains, (HmS160909G3 and HmS160913G3) were more closely related to each other than to the others (Figure 1 ). However, the phylogenetic analysis of Cladosporium for strains HmS160909G3, HmS160913G3 and the 5 randomly selected GenBank accessions showed that HmS160909G3 and HmS160913G3 did not cluster together but were on two completely separate branches (Figure 2). DISCUSSION

The results from this study show for the first time that Cladosporium strains and a consortium of ten fungal endophytes (containing five Cladosporium strains) can induce a significant increase in yield for a barley crop. Two individual Cladosporium strains, and the consortium in trial 2, significantly increased barley grain yield in both trials. The yield increases associated with the two individual strains were consistent over both trials, thus eliminating any causal and confounding environmental influences. These two strains were most closely related to C. herbarum, which have been shown to induce significant increases in grain and straw yields in wheat when used as part of a consortium (Singh and Kapoor 1999). Even without testing for statistical significance in grain yield differences, there was an endophyte-induced increase in grain weight with every strain in both trials, with an overall increase of 50% in trial 1 and 1 1% in trial 2.

The differences in most measured agronomic traits between trial 1 (autumn/winter) and trial 2 (spring/summer), where these values were lower in trial 1 , were most likely due to the environmental differences during the two trial periods. Less light and heat are available for plants during the winter months in the northern hemisphere and this has detrimental effects on plant growth and development. While this was true for all other treatments, the two yield-inducing Cladosporium strains maintained parameter values similar to and in some cases greater than trial 2, which was remarkable considering the less favourable growing conditions during trial 1.

A greater number of mature, filled grains were found to be correlated with a greater grain yield, indicating that there were less‘empty’ grains associated with the yield- inducing Cladosporium strains. In both trials, not all grains filled and matured thus accounting for the overall low number of grains per head (1 1.36). This may have been due to a pathogen infection such as Fusarium graminearum which resulted in failed kernel development and a reduced number of filled grains, though there were no clear symptoms of Fusarium head blight on the heads. If this was the case, then the yield- inducing Cladosporium strains may even have a protective effect against the pathogen.

The two yield-beneficial strains were more closely related to each other than the other Cladosporium strains used in this experiment, suggesting a coevolved symbiosis with the host, related to the environmental conditions and history of the source site (undisturbed, zero detectable soil moisture and high soil salinity). However, when compared with other Cladosporium accessions found in GenBank, they were not that closely related to each other (as revealed by the reconstructed phylogeny of Figure 2). They were recovered from seeds on different plants (although at the same site) so are probably strains of the same species, and both are related to C. herbarum.

The endophytes were recovered from seeds and roots of wall barley ( Hordeum murinum), but they were still yield-beneficial when applied to the seedling rooting zone. This would suggest that both root and seed endophytes can be used individually or in combination as a beneficial seed dressing for barley crops. If these positive results translate to field grown barley, then there is great potential for these endophyte strains to help reduce chemical crop inputs and to enhance sustainable farming practices. Similar increases in field grown barley over two seasons have been shown when using endophyte strains from the same site and host as the two yield-beneficial Cladosporium strains in this experiment (Murphy et al. 2017b). In all significant barley yield increases from the field trials, the increases were positively correlated with a relatively low rainfall during the growing season, which resulted in a dry environment similar to the endophyte source site. The plants can be considered to have been nutrient-stressed, as they received no extra fertiliser other than that initially available in the compost (J.l. No. 2). Previous work has demonstrated that fungal root endophytes can increase yield in nutrient-stressed barley (Murphy et at. 2015a). The barley plants can also be considered as somewhat moisture-stressed at times as they were only watered when the growing compost reached a moisture level of 15%, and similarly, previous work has also shown endophyte-associated benefits for moisture-stressed barley (Murphy et al. 2015b).

It has previously been demonstrated that the fungal spores in the seed dressing penetrate the seed within the first two weeks and have a growth boosting effect during early growth and establishment (Murphy et at. 2017a). However, neither of the strains which induced a yield increase were recovered from the seeds or roots at the end of the experiment, suggesting an early‘priming’ effect by the endophytes.

Singh and Kapoor (1999) studied the effect of inoculation with the AMF Glomus sp.88 and two phosphate (P043-)-solubilizing microorganisms (PSM), Bacillus circulans and Cladosporium herbarum, in the presence or absence of rock phosphate in a natural P- deficient sandy soil on wheat crops. The significant increase in grain and straw yields due to inoculation with the consortia could be attributed to a high absorption of nutrients.

The Applicant has previously demonstrated that beneficial results from controlled environment experiments can be translated from‘pot to plot’ (Murphy et al. 2017b), and there is every reason to expect that the endophyte strains from the current study will also prove useful for field-grown barley crops. In the specification the terms "comprise, comprises, comprised and comprising" or any variation thereof and the terms “include, includes, included and including" or any variation thereof are considered to be totally interchangeable and they should all be afforded the widest possible interpretation and vice versa.

The invention is not limited to the embodiments hereinbefore described but may be varied in both construction and detail.

References

Kumar, S., Stecher, G., and Tamura, K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.2 for bigger datasets. Molecular Biology and Evolution 33: 1870-1874.

Murphy, B. R., Doohan, F. M., and Hodkinson, T. R. 2014a. Persistent fungal root endophytes isolated from a wild barley species suppress seed- borne infections in a barley cultivar. Symbiosis 60:281-292.

Murphy, B. R., Doohan, F. M., and Hodkinson, T. R. 2014b. Fungal endophytes of barley roots. The Journal of Agricultural Science 152:602-615.

Murphy, B. R., Doohan, F. M., and Hodkinson, T. R. 2015a. Fungal root endophytes of a wild barley species increase yield in a nutrient-stressed barley cultivar. Symbiosis 65: 1-7.

Murphy, B. R., Martin Nieto, L, Doohan, F. M., and Hodkinson, T. R. 2015b. Fungal Endophytes Enhance Agronomically Important Traits in Severely Drought-Stressed Barley. Journal of Agronomy and Crop Science 201 (6): 419-427.

Murphy, B. R., Doohan, F. M., and Hodkinson, T. R. 2016. A seed dressing combining fungal endophyte spores and fungicides improves seedling survival and early growth in barley and oat. Symbiosis 71 (1 ):69-76.

Murphy, B. R., Hodkinson, T. R., and Doohan, F. M. 2017. A fungal endophyte consortium counterbalances the negative effects of reduced nitrogen input on the yield of field-grown spring barley. The Journal of Agricultural Science 155(08): 1324-1331 . Murphy, B. R., Martin Nieto, L., Doohan, F. M., and Hodkinson, T. R. 2015b. Profundae diversitas: the uncharted genetic diversity in a newly studied group of fungal root endophytes. Mycology 6:139-150.

Zadoks, J. C., Chang, T. T., and Konzak, C. F. 1974. A Decimal Code for the Growth Stages of Cereals. Weed Research 14:415-421.