ENGINEERED PHOTOSYNTHETIC MICROBES AND RECOMBINANT SYNTHESIS OF CARBON-BASED PRODUCTS

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 62/015,624, filed June 23, 2014; the entire disclosure of which is hereby incorporated by reference, in its entirety, for all purposes.

SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on XXXX, 2015, is named XXXXPCT_CRF_sequencelisting.txt and is XXX bytes in size.

BACKGROUND

[0003] Many existing photoautotrophic organisms (i.e., plants, algae, and photosynthetic bacteria) are poorly suited for industrial bioprocessing and have therefore not demonstrated commercial viability. Recombinant photosynthetic microorganisms have been engineered to produce hydrocarbons and alcohols in amounts that exceed the levels produced naturally by the organism.

SUMMARY

[0004] Described herein is an engineered photosynthetic microorganism comprising one or more recombinant nucleotide sequences encoding at least one protein having P-ketoacyl- ACP synthase III activity. In some aspects, the microorganism further comprises one or more recombinant nucleotide sequences encoding one or more proteins capable of producing carbon-based product(s) of interest.

[0005] In some aspects, the protein having β-ketoacyl-ACP synthase III activity is a β- ketoacyl-ACP synthase III. In some aspects, the protein having β-ketoacyl-ACP synthase III activity has EC number 2.3.1.180. In some aspects, the protein having β-ketoacyl-ACP synthase III activity is FabH. In some aspects, the protein having β-ketoacyl-ACP synthase III activity is heterologous. In some aspects, the protein having β-ketoacyl-ACP synthase III activity is E. coli FabH.

[0006] In some aspects, the engineered microorganism has an increased rate of carbon- based product(s) of interest synthesis relative to an otherwise identical microorganism, cultured under identical conditions, but lacking the one or more recombinant nucleotide sequences encoding at least one protein having β-ketoacyl-ACP synthase III activity. In some aspects, the engineered microorganism produces an increased amount of carbon-based product(s) of interest that are shorter in length than those carbon-based product(s) of interest produced by an otherwise identical microorganism, cultured under identical conditions, but lacking the one or more recombinant nucleotide sequences encoding at least one protein having β-ketoacyl-ACP synthase III activity.

[0007] In some aspects, the carbon-based product(s) of interest is an alkane, an alcohol, an aldehyde, an alkene, an ester, or a fatty acid. In some aspects, the carbon-based product(s) of interest is a CI 1 carbon-based product of interest. In some aspects, the carbon-based product(s) of interest is a C 15 carbon-based product of interest. In some aspects, the carbon- based product(s) of interest is a C 17 carbon-based product of interest.

[0008] In some aspects, the one or more proteins capable of producing carbon-based product(s) of interest is alcohol dehydrogenase, pyruvate decarboxylase, acyl-ACP reductase, alkanal decarboxylative monooxygenase, wax synthase, NonA alkene synthase, long-chain fatty acid CoA-ligase, long-chain acyl-CoA reductase, carboxylic acid reductase,

phosphopantetheinyl transferase, and/or thioesterase.

[0009] In some aspects, the carbon-based product(s) of interest are fatty alcohol and/or fatty aldehyde, and wherein the one or more proteins capable of producing carbon-based product(s) of interest is carboxylic acid reductase, phosphopantetheinyl transferase, and thioesterase. In some aspects, the engineered microorganism produces an increased amount of C12 alcohol and/or fatty aldehyderelative to an otherwise identical microorganism, cultured under identical conditions, but lacking the one or more recombinant nucleotide sequences encoding at least one protein having β-ketoacyl-ACP synthase III activity.

[0010] In some aspects, the engineered microorganism further comprises alkanal decarboxylative monooxygenase. In some aspects, the carbon-based product(s) of interest is an alkane. In some aspects, the alkane is a CI 1 alkane.

[0011] In some aspects, the engineered microorganism produces are greater amount of carbon-based product(s) or interest relative to an otherwise identical microorganism but lacking the one or more recombinant nucleotide sequences encoding at least one protein having β-ketoacyl-ACP synthase III activity when culture under identical conditions. In some aspects, the engineered microorganism produces an about 2x greater amount of carbon- based product(s) or interest relative to an otherwise identical microorganism but lacking the one or more recombinant nucleotide sequences encoding at least one protein having β- ketoacyl-ACP synthase III activity when culture under identical conditions. [0012] In some aspects, at least one of the one or more recombinant nucleotide sequences is integrated into the genome of the microorganism. In some aspects, at least one of the one or more recombinant nucleotide sequences is extrachromosomal. In some aspects, expression of at least one of the one or more recombinant nucleotide sequences is controlled by a recombinant promoter, and wherein the promoter is constitutive or inducible. In some aspects, expression of at least one of the one or more recombinant nucleotide sequences is controlled by a native promoter.

[0013] In some aspects, the microorganism is a cyanobacterium. In some aspects, the microorganism is a thermotolerant cyanobacterium. In some aspects, the microorganism is a Synechococcus species.

[0014] In some aspects, at least one of the one or more recombinant nucleotide sequences are at least 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% identical to a sequence shown in Table 1.

[0015] Also disclosed herein is a cell culture comprising a culture medium and a microorganism disclosed herein.

[0016] Also disclosed herein is a method for producing carbon-based product(s) of interest, comprising: culturing an engineered microorganism disclosed herein in a culture medium, wherein the engineered microorganism produces increased amounts of carbon-based product(s) of interest relative to an otherwise identical microorganism, cultured under identical conditions, but lacking the one or more recombinant nucleotide sequences.

[0017] In some aspects, the method further includes allowing carbon-based product(s) of interest to accumulate in the culture medium or in the organism. In some aspects, the method further includes isolating at least a portion of the carbon-based product(s) of interest. In some aspects, the method further includes processing the isolated carbon-based product(s) of interest to produce a processed material.

[0018] Also disclosed herein is a composition comprising carbon-based product(s) of interest, wherein the carbon-based product(s) of interest are produced by a method disclosed herein. In some aspects, the composition comprises at least 5%, at least 10%>, at least 20%>, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%), or at least 99% carbon-based product(s) of interest.

[0019] Also disclosed herein is a method for producing hydrocarbons, comprising: (i) culturing an engineered microorganism disclosed herein in a culture medium; and (ii) exposing the engineered microorganism to light and inorganic carbon, wherein the exposure results in the conversion of the inorganic carbon by the microorganism into carbon-based product(s) of interest, wherein the carbon-based product(s) of interest are produced in an amount greater than that produced by an otherwise identical microorganism, cultured under identical conditions, but lacking the one or more recombinant nucleotide sequences.

[0020] In some aspects, the method further includes allowing carbon-based product(s) of interest to accumulate in the culture medium or in the organism. In some aspects, the method further includes isolating at least a portion of the carbon-based product(s) of interest. In some aspects, the method further includes processing the isolated carbon-based product(s) of interest to produce a processed material.

[0021] Also disclosed herein is a bio fuel composition comprising a mixture of carbon- based product(s) of interest, wherein at least 90% of the mixture is CI 1 or C12 carbon-based product(s) of interest, and wherein at least a portion of the carbon used as raw material of the carbon-based product(s) of interestis inorganic carbon or C0 ₂ .

[0022] In some aspects, the mixture comprises about 95% CI 1 or C12 and about 5% C9 or CIO. In some aspects, at least 95% of the mixture comprises predominantly CI 1 or C12 carbon-based product(s) of interest. In some aspects, the composition is a low-sulfur composition. In some aspects, the composition is a carbon-neutral composition. In some aspects, the composition has a higher δ _ρ than a comparable composition made from fixed atmospheric carbon or plant-derived biomass. In some aspects, the composition further comprises diesel. In some aspects, the carbon-based product(s) of interest are alkanes, aldehydes, or alcohols.

[0023] These and other embodiments are further described in the Figures, Description, Examples and Claims, herein.

BRIEF DESCRIPTION OF THE FIGURES

[0024] Throughout certain figures, the nomenclature "UX" refers to a urea concentration ofX mM. This is included because the thioesterase (fatB) and carboxylic acid reductase (carB) are under control of urea-repressible promoters. The addition of 15 mM urea is sufficient to maximally repress the P(nir07) and P(nir09) promoters in use here. Note, however, that even when fully "repressed" these promoters can allow some basal level of gene expression. Also, throughout the figures, error bars represent the "hi-low" span of two duplicate flasks.

[0025] Figure 1. Production of 1-alkanols and alkanals from fatty acid biosynthesis in JCC6628. Adh activity has been observed in Synechococcus sp. PCC7002 (JCC138) but the enzyme responsible for this activity is unknown. Adm and the pathway to n-undecane is illustrated in grey, highlighting the fact that the metabolic pathway to alkanals/alkanols shares enzymes with the pathway towards n-undecane, except for the terminal enzyme Adm used for alkane production.

[0026] Figure 2. Growth of test strains, measured by optical density (OD) at 730 nm. Note that JCC6628 is more efficient at diverting carbon from biomass accumulation to secreted product production than JCC138 and JCC6022. t, h means time in hours.

[0027] Figure 3. Production of alkanals/l-alkanols by JCC6022 and JCC6628, as measured by GC-FID. X axis is time in hours.

[0028] Figure 4. Chain length distribution of products (1 -alcohols and aldehydes) produced by parent JCC6022 and daughter strain JCC6628 which harbors the heterologous FabH.

[0029] Figure 5. Total cell-associated lipid, as measured by modified Bligh-Dyer method.

[0030] Figure 6. Total fatty acid biosynthetic flux, obtained by summing secreted product (alkanals/l-alkanols) and cell-associated lipids. Note that total fatty acid biosynthetic rate is higher for JCC6628 compared to JCC138 or JCC6022. The rate for JCC6628 is 2.4-fold higher than JCC138 between 45h and lOOh.

[0031] Figure 7. Alkane (C15 + C17) production from various recombinant

cyanobacterial strains. Culture volumes were 30 mL in 125 mL PETG flasks. Culture medium was JB 2.1 supplemented with 3 mM urea and cultures were inoculated to a starting OD730 of 0.5. Cumate (25 μΜ) was added to one set of flasks at 42h while one set was cultured without any cumate addition. Error bars represent hi-low values for conditions that were tested with biological duplicate flasks.

[0032] Figure 8. Linear growth rate versus strength of cumate-dependent induction of P(cum02) _: a¾H-kan in JCC4974. Linear growth rate of JCC4102 plotted in grey. JCC4102 was cultured in biological duplicate; error bars represent hi-low measurements. Culturing parameters identical to those in Figure 7 except 4 mM urea was added at Oh rather than 3 mM.

[0033] Figure 9. Alkane productivity of JCC4102 and JCC4974 versus strength of cumate-dependent induction of P(cum02) _: a¾H-kan in JCC4974. Culturing parameters identical to those in Figure 7 except 4 mM urea was added at Oh rather than 3 mM.

[0034] Figure 10. Addition of cumate did not lead to an increase in total alkane production when comparing to the uninduced control. However, an effect on chain length of produced alkane was observed.

[0035] Figure 11. Profile of chain length fatty acids comprising the cell-associated lipids (polar membrane lipids) at 190h post inoculation. [0036] Figure 12. Profile of alkane products generated from the strains at the 175h timepoint.

[0037] Figure 13. Culture growth as measured by OD 730nm.

[0038] Figure 14. Production of extracellular hydrocarbons, specifically 1-dodecanol and dodecanal, quantified by GC-FID directly in the tridecane organic overlay.

[0039] Figure 15. Total fatty acid biosynthesis (FAS) production, representing the sum of cell-associated lipids and extracellular hydrocarbon products of interest.

[0040] Figure 16. Production rates of a) total products (alcohols, aldehydes, and alkane) and b) CI 1 alkane from JCC8051 are illustrated.

DETAILED DESCRIPTION

[0041] Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular. Generally, nomenclatures used in connection with, and techniques of, biochemistry, enzymology, molecular and cellular biology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly used in the art.

[0042] The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992, and Supplements to 2002); Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1990); Taylor and Drickamer,

Introduction to Glycobiology, Oxford Univ. Press (2003); Worthington Enzyme Manual, Worthington Biochemical Corp., Freehold, N.J.; Handbook of Biochemistry: Section A Proteins, Vol I, CRC Press (1976); Handbook of Biochemistry : Section A Proteins, Vol II, CRC Press (1976); Essentials of Glycobiology, Cold Spring Harbor Laboratory Press (1999).

[0043] All publications, patents and other references mentioned herein are hereby incorporated by reference in their entireties.

[0044] The following terms, unless otherwise indicated, shall be understood to have the following meanings: [0045] The term "polynucleotide" or "nucleic acid molecule" refers to a polymeric form of nucleotides of at least 10 bases in length. The term includes DNA molecules (e.g., cDNA or genomic or synthetic DNA) and RNA molecules (e.g., mRNA or synthetic RNA), as well as analogs of DNA or RNA containing non-natural nucleotide analogs, non-native

intemucleoside bonds, or both. The nucleic acid can be in any topological conformation. For instance, the nucleic acid can be single-stranded, double-stranded, triple-stranded, quadruplexed, partially double-stranded, branched, hairpinned, circular, or in a padlocked conformation.

[0046] Unless otherwise indicated, and as an example for all sequences described herein under the general format "SEQ ID NO:", "nucleic acid comprising SEQ ID NO: l" refers to a nucleic acid, at least a portion of which has either (i) the sequence of SEQ ID NO: 1 , or (ii) a sequence complementary to SEQ ID NO: 1. The choice between the two is dictated by the context. For instance, if the nucleic acid is used as a probe, the choice between the two is dictated by the requirement that the probe be complementary to the desired target.

[0047] An "isolated" RNA, DNA or a mixed polymer is one which is substantially separated from other cellular components that naturally accompany the native polynucleotide in its natural host cell, e.g., ribosomes, polymerases and genomic sequences with which it is naturally associated.

[0048] As used herein, an "isolated" organic molecule (e.g., an alkane) is one which is substantially separated from the cellular components (membrane lipids, chromosomes, proteins) of the host cell from which it originated, or from the medium in which the host cell was cultured. The term does not require that the biomolecule has been separated from all other chemicals, although certain isolated biomolecules may be purified to near homogeneity.

[0049] The term "recombinant" refers to a biomolecule, e.g., a gene or protein, that (1) has been removed from its naturally occurring environment, (2) is not associated with all or a portion of a polynucleotide in which the gene is found in nature, (3) is operatively linked to a polynucleotide which it is not linked to in nature, or (4) does not occur in nature. The term "recombinant" can be used in reference to cloned DNA isolates, chemically synthesized polynucleotide analogs, or polynucleotide analogs that are biologically synthesized by heterologous systems, as well as proteins and/or mRNAs encoded by such nucleic acids.

[0050] As used herein, an endogenous nucleic acid sequence in the genome of an organism (or the encoded protein product of that sequence) is deemed "recombinant" herein if a heterologous sequence is placed adjacent to the endogenous nucleic acid sequence, such that the expression of this endogenous nucleic acid sequence is altered. In this context, a heterologous sequence is a sequence that is not naturally adjacent to the endogenous nucleic acid sequence, whether or not the heterologous sequence is itself endogenous (originating from the same host cell or progeny thereof) or exogenous (originating from a different host cell or progeny thereof). By way of example, a promoter sequence can be substituted (e.g., by homologous recombination) for the native promoter of a gene in the genome of a host cell, such that this gene has an altered expression pattern. This gene would now become

"recombinant" because it is separated from at least some of the sequences that naturally flank it.

[0051] A nucleic acid is also considered "recombinant" if it contains any modifications that do not naturally occur to the corresponding nucleic acid in a genome. For instance, an endogenous coding sequence is considered "recombinant" if it contains an insertion, deletion or a point mutation introduced artificially, e.g., by human intervention. A "recombinant nucleic acid" also includes a nucleic acid integrated into a host cell chromosome at a heterologous site and a nucleic acid construct present as an episome.

[0052] As used herein, the phrase "degenerate variant" of a reference nucleic acid sequence encompasses nucleic acid sequences that can be translated, according to the standard genetic code, to provide an amino acid sequence identical to that translated from the reference nucleic acid sequence. The term "degenerate oligonucleotide" or "degenerate primer" is used to signify an oligonucleotide capable of hybridizing with target nucleic acid sequences that are not necessarily identical in sequence but that are homologous to one another within one or more particular segments.

[0053] The term "percent sequence identity" or "identical" in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for maximum correspondence. The length of sequence identity comparison may be over a stretch of at least about nine nucleotides, usually at least about 20 nucleotides, more usually at least about 24 nucleotides, typically at least about 28 nucleotides, more typically at least about 32 nucleotides, and preferably at least about 36 or more nucleotides. There are a number of different algorithms known in the art which can be used to measure nucleotide sequence identity. For instance, polynucleotide sequences can be compared using FASTA, Gap or Bestfit, which are programs in Wisconsin Package Version 10.0, Genetics Computer Group (GCG), Madison, Wis. FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. Pearson, Methods Enzymol. 183:63-98 (1990) (hereby incorporated by reference in its entirety). For instance, percent sequence identity between nucleic acid sequences can be determined using FASTA with its default parameters (a word size of 6 and the NOP AM factor for the scoring matrix) or using Gap with its default parameters as provided in GCG Version 6.1, herein incorporated by reference. Alternatively, sequences can be compared using the computer program, BLAST (Altschul et al, J. Mol. Biol. 215:403-410 (1990); Gish and States, Nature Genet. 3:266-272 (1993); Madden et al, Meth. Enzymol. 266: 131-141 (1996); Altschul et al, Nucleic Acids Res. 25:3389-3402 (1997); Zhang and Madden, Genome Res. 7:649-656 (1997)), especially blastp or tblastn (Altschul et al, Nucleic Acids Res. 25:3389-3402 (1997)).

[0054] The term "substantial homology" or "substantial similarity," when referring to a nucleic acid or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 76%, 80%, 85%>, preferably at least about 90%, and more preferably at least about 95%, 96%, 97%, 98% or 99% of the nucleotide bases, as measured by any well-known algorithm of sequence identity, such as FASTA, BLAST or Gap, as discussed above.

[0055] Alternatively, substantial homology or similarity exists when a nucleic acid or fragment thereof hybridizes to another nucleic acid, to a strand of another nucleic acid, or to the complementary strand thereof, under stringent hybridization conditions. "Stringent hybridization conditions" and "stringent wash conditions" in the context of nucleic acid hybridization experiments depend upon a number of different physical parameters. Nucleic acid hybridization will be affected by such conditions as salt concentration, temperature, solvents, the base composition of the hybridizing species, length of the complementary regions, and the number of nucleotide base mismatches between the hybridizing nucleic acids, as will be readily appreciated by those skilled in the art. One having ordinary skill in the art knows how to vary these parameters to achieve a particular stringency of

hybridization.

[0056] In general, "stringent hybridization" is performed at about 25°C below the thermal melting point (T _m ) for the specific DNA hybrid under a particular set of conditions.

"Stringent washing" is performed at temperatures about 5°C lower than the T _m for the specific DNA hybrid under a particular set of conditions. The T _m is the temperature at which 50%) of the target sequence hybridizes to a perfectly matched probe. See Sambrook et al, Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989), page 9.51, hereby incorporated by reference. For purposes herein, "stringent conditions" are defined for solution phase hybridization as aqueous hybridization {i.e., free of formamide) in 6xSSC (where 20xSSC contains 3.0 M NaCl and 0.3 M sodium citrate), 1% SDS at 65°C for 8-12 hours, followed by two washes in 0.2xSSC, 0.1% SDS at 65°C for 20 minutes. It will be appreciated by the skilled worker that hybridization at 65°C will occur at different rates depending on a number of factors including the length and percent identity of the sequences which are hybridizing.

[0057] The nucleic acids (also referred to as polynucleotides) of this present invention may include both sense and antisense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. They may be modified chemically or biochemically or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog,

intemucleotide modifications such as uncharged linkages (e.g. , methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g.,

phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.) Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule. Other modifications can include, for example, analogs in which the ribose ring contains a bridging moiety or other structure such as the modifications found in "locked" nucleic acids.

[0058] The term "mutated" when applied to nucleic acid sequences means that nucleotides in a nucleic acid sequence may be inserted, deleted or changed compared to a reference nucleic acid sequence. A single alteration may be made at a locus (a point mutation) or multiple nucleotides may be inserted, deleted or changed at a single locus. In addition, one or more alterations may be made at any number of loci within a nucleic acid sequence. A nucleic acid sequence may be mutated by any method known in the art including but not limited to mutagenesis techniques such as "error-prone PCR" (a process for performing PCR under conditions where the copying fidelity of the DNA polymerase is low, such that a high rate of point mutations is obtained along the entire length of the PCR product; see, e.g., Leung et al., Technique, 1 : 11-15 (1989) and Caldwell and Joyce, PCR Methods Applic. 2:28- 33 (1992)); and "oligonucleotide-directed mutagenesis" (a process which enables the generation of site-specific mutations in any cloned DNA segment of interest; see, e.g. , Reidhaar-Olson and Sauer, Science 241 :53-57 (1988)). [0059] The term "attenuate" as used herein generally refers to a functional deletion, including a mutation, partial or complete deletion, insertion, or other variation made to a gene sequence or a sequence controlling the transcription of a gene sequence, which reduces or inhibits production of the gene product, or renders the gene product non-functional. In some instances a functional deletion is described as a knockout mutation. Attenuation also includes amino acid sequence changes by altering the nucleic acid sequence, placing the gene under the control of a less active promoter, down-regulation, expressing interfering RNA, ribozymes or antisense sequences that target the gene of interest, or through any other technique known in the art. In one example, the sensitivity of a particular enzyme to feedback inhibition or inhibition caused by a composition that is not a product or a reactant (non-pathway specific feedback) is lessened such that the enzyme activity is not impacted by the presence of a compound. In other instances, an enzyme that has been altered to be less active can be referred to as attenuated.

[0060] Deletion: The removal of one or more nucleotides from a nucleic acid molecule or one or more amino acids from a protein, the regions on either side being joined together.

[0061] Knock-out: A gene whose level of expression or activity has been reduced to zero. In some examples, a gene is knocked-out via deletion of some or all of its coding sequence. In other examples, a gene is knocked-out via introduction of one or more nucleotides into its open reading frame, which results in translation of a non-sense or otherwise non- functional protein product.

[0062] The term "vector" as used herein is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid," which generally refers to a circular double stranded DNA loop into which additional DNA segments may be ligated, but also includes linear double-stranded molecules such as those resulting from amplification by the polymerase chain reaction (PCR) or from treatment of a circular plasmid with a restriction enzyme. Other vectors include cosmids, bacterial artificial chromosomes (BAC) and yeast artificial chromosomes (YAC). Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome (discussed in more detail below). Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., vectors having an origin of replication which functions in the host cell). Other vectors can be integrated into the genome of a host cell upon introduction into the host cell, and are thereby replicated along with the host genome. Moreover, certain preferred vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply "expression vectors").

[0063] "Operatively linked" or "operably linked" expression control sequences refers to a linkage in which the expression control sequence is contiguous with the gene of interest to control the gene of interest, as well as expression control sequences that act in trans or at a distance to control the gene of interest.

[0064] The term "expression control sequence" as used herein refers to polynucleotide sequences which are necessary to affect the expression of coding sequences to which they are operatively linked. Expression control sequences are sequences which control the transcription, post-transcriptional events and translation of nucleic acid sequences.

Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (e.g., ribosome binding sites); sequences that enhance protein stability; and when desired, sequences that enhance protein secretion. The nature of such control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence. The term "control sequences" is intended to include, at a minimum, all components whose presence is essential for expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences.

[0065] The term "recombinant host cell" (or simply "host cell"), as used herein, is intended to refer to a cell into which a recombinant vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein. A recombinant host cell may be an isolated cell or cell line grown in culture or may be a cell which resides in a living tissue or organism.

[0066] The term "peptide" as used herein refers to a short polypeptide, e.g., one that is typically less than about 50 amino acids long and more typically less than about 30 amino acids long. The term as used herein encompasses analogs and mimetics that mimic structural and thus biological function.

[0067] The term "polypeptide" encompasses both naturally-occurring and non-naturally- occurring proteins, and fragments, mutants, derivatives and analogs thereof. A polypeptide may be monomeric or polymeric. Further, a polypeptide may comprise a number of different domains each of which has one or more distinct activities.

[0068] The term "isolated protein" or "isolated polypeptide" is a protein or polypeptide that by virtue of its origin or source of derivation (1) is not associated with naturally associated components that accompany it in its native state, (2) exists in a purity not found in nature, where purity can be adjudged with respect to the presence of other cellular material (e.g., is free of other proteins from the same species) (3) is expressed by a cell from a different species, or (4) does not occur in nature (e.g., it is a fragment of a polypeptide found in nature or it includes amino acid analogs or derivatives not found in nature or linkages other than standard peptide bonds). Thus, a polypeptide that is chemically synthesized or synthesized in a cellular system different from the cell from which it naturally originates will be "isolated" from its naturally associated components. A polypeptide or protein may also be rendered substantially free of naturally associated components by isolation, using protein purification techniques well known in the art. As thus defined, "isolated" does not necessarily require that the protein, polypeptide, peptide or oligopeptide so described has been physically removed from its native environment.

[0069] The term "polypeptide fragment" as used herein refers to a polypeptide that has a deletion, e.g., an amino-terminal and/or carboxy-terminal deletion compared to a full-length polypeptide. In a preferred embodiment, the polypeptide fragment is a contiguous sequence in which the amino acid sequence of the fragment is identical to the corresponding positions in the naturally-occurring sequence. Fragments typically are at least 5, 6, 7, 8, 9 or 10 amino acids long, preferably at least 12, 14, 16 or 18 amino acids long, more preferably at least 20 amino acids long, more preferably at least 25, 30, 35, 40 or 45, amino acids, even more preferably at least 50 or 60 amino acids long, and even more preferably at least 70 amino acids long.

[0070] A "modified derivative" refers to polypeptides or fragments thereof that are substantially homologous in primary structural sequence but which include, e.g. , in vivo or in vitro chemical and biochemical modifications or which incorporate amino acids that are not found in the native polypeptide. Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquitination, labeling, e.g., with

radionuclides, and various enzymatic modifications, as will be readily appreciated by those skilled in the art. A variety of methods for labeling polypeptides and of substituents or labels useful for such purposes are well known in the art, and include radioactive isotopes such as

125 32 35 3

I, P, S, and H, ligands which bind to labeled antiligands (e.g., antibodies), fluorophores, chemiluminescent agents, enzymes, and antiligands which can serve as specific binding pair members for a labeled ligand. The choice of label depends on the sensitivity required, ease of conjugation with the primer, stability requirements, and available instrumentation. Methods for labeling polypeptides are well known in the art. See, e.g., Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992, and Supplements to 2002) (hereby incorporated by reference).

[0071] The term "fusion protein" refers to a polypeptide comprising a polypeptide or fragment coupled to heterologous amino acid sequences. Fusion proteins are useful because they can be constructed to contain two or more desired functional elements from two or more different proteins. A fusion protein comprises at least 10 contiguous amino acids from a polypeptide of interest, more preferably at least 20 or 30 amino acids, even more preferably at least 40, 50 or 60 amino acids, yet more preferably at least 75, 100 or 125 amino acids. Fusions that include the entirety of the proteins of the present invention have particular utility. The heterologous polypeptide included within the fusion protein of the present invention is at least 6 amino acids in length, often at least 8 amino acids in length, and usefully at least 15, 20, and 25 amino acids in length. Fusions that include larger

polypeptides, such as an IgG Fc region, and even entire proteins, such as the green fluorescent protein ("GFP") chromophore-containing proteins, have particular utility. Fusion proteins can be produced recombinantly by constructing a nucleic acid sequence which encodes the polypeptide or a fragment thereof in frame with a nucleic acid sequence encoding a different protein or peptide and then expressing the fusion protein. Alternatively, a fusion protein can be produced chemically by crosslinking the polypeptide or a fragment thereof to another protein.

[0072] The term "non-peptide analog" refers to a compound with properties that are analogous to those of a reference polypeptide. A non-peptide compound may also be termed a "peptide mimetic" or a "peptidomimetic." See, e.g., Jones, Amino Acid and Peptide Synthesis, Oxford University Press (1992); Jung, Combinatorial Peptide and Nonpeptide Libraries: A Handbook, John Wiley (1997); Bodanszky et al., Peptide Chemistry— A

Practical Textbook, Springer Verlag (1993); Synthetic Peptides: A Users Guide, (Grant, ed., W. H. Freeman and Co., 1992); Evans et al., J. Med. Chem. 30: 1229 (1987); Fauchere, J. Adv. Drug Res. 15:29 (1986); Veber and Freidinger, Trends Neurosci., 8:392-396 (1985); and references sited in each of the above, which are incorporated herein by reference. Such compounds are often developed with the aid of computerized molecular modeling. Peptide mimetics that are structurally similar to useful peptides of the present invention may be used to produce an equivalent effect and are therefore envisioned to be part of the present invention.

[0073] A "polypeptide mutant" or "mutein" refers to a polypeptide whose sequence contains an insertion, duplication, deletion, rearrangement or substitution of one or more amino acids compared to the amino acid sequence of a native or wild-type protein. A mutein may have one or more amino acid point substitutions, in which a single amino acid at a position has been changed to another amino acid, one or more insertions and/or deletions, in which one or more amino acids are inserted or deleted, respectively, in the sequence of the naturally-occurring protein, and/or truncations of the amino acid sequence at either or both the amino or carboxy termini. A mutein may have the same but preferably has a different biological activity compared to the naturally-occurring protein.

[0074] A mutein has at least 85% overall sequence homology to its wild-type counterpart. Even more preferred are muteins having at least 90% overall sequence homology to the wild- type protein.

[0075] In an even more preferred embodiment, a mutein exhibits at least 95% sequence identity, even more preferably 98%, even more preferably 99% and even more preferably 99.9%) overall sequence identity.

[0076] Sequence homology may be measured by any common sequence analysis algorithm, such as Gap or Bestfit.

[0077] Amino acid substitutions can include those which: (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter binding affinity or enzymatic activity, and (5) confer or modify other physicochemical or functional properties of such analogs.

[0078] As used herein, the twenty conventional amino acids and their abbreviations follow conventional usage. See Immunology-A Synthesis (Golub and Gren eds., Sinauer Associates, Sunderland, Mass., 2 ^nd ed. 1991), which is incorporated herein by reference. Stereoisomers (e.g. , D-amino acids) of the twenty conventional amino acids, unnatural amino acids such as α-, α-disubstituted amino acids, N-alkyl amino acids, and other unconventional amino acids may also be suitable components for polypeptides of the present invention. Examples of unconventional amino acids include: 4-hydroxyproline, γ-carboxyglutamate, ε-Ν,Ν,Ν- trimethyllysine, ε-Ν-acetyllysine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3- methylhistidine, 5-hydroxylysine, N-methylarginine, and other similar amino acids and imino acids (e.g., 4-hydroxyproline). In the polypeptide notation used herein, the left-hand end corresponds to the amino terminal end and the right-hand end corresponds to the carboxy- terminal end, in accordance with standard usage and convention.

[0079] A protein has "homology" or is "homologous" to a second protein if the nucleic acid sequence that encodes the protein has a similar sequence to the nucleic acid sequence that encodes the second protein. Alternatively, a protein has homology to a second protein if the two proteins have "similar" amino acid sequences. (Thus, the term "homologous proteins" is defined to mean that the two proteins have similar amino acid sequences.) As used herein, homology between two regions of amino acid sequence (especially with respect to predicted structural similarities) is interpreted as implying similarity in function.

[0080] When "homologous" is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions. A "conservative amino acid substitution" is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional properties of a protein. In cases where two or more amino acid sequences differ from each other by conservative

substitutions, the percent sequence identity or degree of homology may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art. See, e.g., Pearson, 1994, Methods Mol. Biol.

24:307-31 and 25:365-89 (herein incorporated by reference).

[0081] The following six groups each contain amino acids that are conservative substitutions for one another: 1) Serine (S), Threonine (T); 2) Aspartic Acid (D), Glutamic Acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Alanine (A), Valine (V), and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).

[0082] Sequence homology for polypeptides, which is also referred to as percent sequence identity, is typically measured using sequence analysis software. See, e.g., the Sequence Analysis Software Package of the Genetics Computer Group (GCG), University of Wisconsin Biotechnology Center, 910 University Avenue, Madison, Wis. 53705. Protein analysis software matches similar sequences using a measure of homology assigned to various substitutions, deletions and other modifications, including conservative amino acid substitutions. For instance, GCG contains programs such as "Gap" and "Bestfit" which can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species of organisms or between a wild-type protein and a mutein thereof. See, e.g., GCG Version 6.1.

[0083] A preferred algorithm when comparing a particular polypeptide sequence to a database containing a large number of sequences from different organisms is the computer program BLAST (Altschul et al., J. Mol. Biol. 215:403-410 (1990); Gish and States, Nature Genet. 3:266-272 (1993); Madden et al., Meth. Enzymol. 266: 131-141 (1996); Altschul et al, Nucleic Acids Res. 25:3389-3402 (1997); Zhang and Madden, Genome Res. 7:649-656 (1997)), especially blastp or tblastn (Altschul et al., Nucleic Acids Res. 25:3389-3402

(1997)).

[0084] Preferred parameters for BLASTp are: Expectation value: 10 (default); Filter: seg (default); Cost to open a gap: 11 (default); Cost to extend a gap: 1 (default); Max. alignments: 100 (default); Word size: 11 (default); No. of descriptions: 100 (default); Penalty Matrix: BLOWSUM62.

[0085] The length of polypeptide sequences compared for homology will generally be at least about 16 amino acid residues, usually at least about 20 residues, more usually at least about 24 residues, typically at least about 28 residues, and preferably more than about 35 residues. When searching a database containing sequences from a large number of different organisms, it is preferable to compare amino acid sequences. Database searching using amino acid sequences can be measured by algorithms other than blastp known in the art. For instance, polypeptide sequences can be compared using FASTA, a program in GCG Version 6.1. FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. Pearson, Methods Enzymol. 183:63-98 (1990) (incorporated by reference herein). For example, percent sequence identity between amino acid sequences can be determined using FASTA with its default parameters (a word size of 2 and the PAM250 scoring matrix), as provided in GCG Version 6.1, herein incorporated by reference.

[0086] "Specific binding" refers to the ability of two molecules to bind to each other in preference to binding to other molecules in the environment. Typically, "specific binding" discriminates over adventitious binding in a reaction by at least two-fold, more typically by at least 10-fold, often at least 100-fold. Typically, the affinity or avidity of a specific binding reaction, as quantified by a dissociation constant, is about 10 - ^" 7 M or stronger {e.g., about 10 - ^" 8 M, 10 ^"9 M or even stronger). [0087] The term "region" as used herein refers to a physically contiguous portion of the primary structure of a biomolecule. In the case of proteins, a region is defined by a contiguous portion of the amino acid sequence of that protein.

[0088] The term "domain" as used herein refers to a structure of a biomolecule that contributes to a known or suspected function of the biomolecule. Domains may be coextensive with regions or portions thereof; domains may also include distinct, non-contiguous regions of a biomolecule. Examples of protein domains include, but are not limited to, an Ig domain, an extracellular domain, a transmembrane domain, and a cytoplasmic domain.

[0089] As used herein, the term "molecule" means any compound, including, but not limited to, a small molecule, peptide, protein, sugar, nucleotide, nucleic acid, lipid, etc., and such a compound can be natural or synthetic.

[0090] "Carbon-based Products of Interest" include alcohols such as ethanol, propanol, isopropanol, butanol, fatty alcohols, fatty acid esters, wax esters; hydrocarbons and alkanes such as propane, octane, diesel, Jet Propellant 8 (JP8); polymers such as terephthalate, 1,3-propanediol, 1 ,4-butanediol, polyols, Polyhydroxyalkanoates (PHA), poly-beta- hydroxybutyrate (PHB), acrylate, adipic acid, ε-caprolactone, isoprene, caprolactam, rubber; commodity chemicals such as lactate, Docosahexaenoic acid (DHA), 3-hydroxypropionate, γ-valerolactone, lysine, serine, aspartate, aspartic acid, sorbitol, ascorbate, ascorbic acid, isopentenol, lanosterol, omega-3 DHA, lycopene, itaconate, 1,3 -butadiene, ethylene, propylene, succinate, citrate, citric acid, glutamate, malate, 3-hydroxypropionic acid (HP A), lactic acid, THF, gamma butyrolactone, pyrrolidones, hydroxybutyrate, glutamic acid, levulinic acid, acrylic acid, malonic acid; specialty chemicals such as carotenoids, isoprenoids, itaconic acid; pharmaceuticals and pharmaceutical intermediates such as 7- aminodeacetoxycephalosporanic acid (7-ADCA)/cephalosporin, erythromycin, polyketides, statins, paclitaxel, docetaxel, terpenes, peptides, steroids, omega fatty acids and other such suitable products of interest. Such products are useful in the context of bio fuels, industrial and specialty chemicals, as intermediates used to make additional products, such as nutritional supplements, neutraceuticals, polymers, paraffin replacements, personal care products and pharmaceuticals.

[0091] Biofuel: A biofuel refers to any fuel that derives from a biological source. Biofuel can refer to one or more hydrocarbons, one or more alcohols (such as ethanol), one or more fatty esters, or a mixture thereof.

[0092] Hydrocarbon: The term generally refers to a chemical compound that consists of the elements carbon (C), hydrogen (H) and optionally oxygen (O). There are essentially three types of hydrocarbons, e.g., aromatic hydrocarbons, saturated hydrocarbons and unsaturated hydrocarbons such as alkenes, alkynes, and dienes. The term also includes fuels, biofuels, plastics, waxes, solvents and oils. Hydrocarbons encompass biofuels, as well as plastics, waxes, solvents and oils.

[0093] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this present invention pertains. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice of the present invention and will be apparent to those of skill in the art. All publications and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. The materials, methods, and examples are illustrative only and not intended to be limiting.

[0094] Throughout this specification and claims, the word "comprise" or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

Nucleic Acid Sequences

[0095] The present invention provides isolated nucleic acid molecules for genes encoding enzymes, and variants thereof. Exemplary full-length nucleic acid sequences for genes encoding enzymes and the corresponding amino acid sequences are presented in Tables 1 and 2.

[0096] In one embodiment, the present invention provides an isolated nucleic acid molecule having a nucleic acid sequence comprising or consisting of a gene coding for an alkane deformylative monooxygenase, a thioesterase, a carboxylic acid reductase, a phosphopanthetheinyl transferase, a long-chain fatty acid CoA-ligase, and/or a long-chain acyl-CoA reductase and homologs, variants and derivatives thereof expressed in a host cell of interest. The present invention also provides a nucleic acid molecule comprising or consisting of a sequence which is a codon-optimized version of the alkane deformylative monooxygenase, a thioesterase, a carboxylic acid reductase, a phosphopanthetheinyl transferase, a long-chain fatty acid CoA-ligase, and/or a long-chain acyl-CoA reductase genes described herein. In a further embodiment, the present invention provides a nucleic acid molecule and homologs, variants and derivatives of the molecule comprising or consisting of a sequence which is a variant of the alkane deformylative monooxygenase, a thioesterase, a carboxylic acid reductase, a phosphopanthetheinyl transferase, a long-chain fatty acid CoA- ligase, and/or a long-chain acyl-CoA reductase gene having at least 80% identity to the wild- type gene. The nucleic acid sequence can be preferably greater than 80%>, 85%, 90%>, 95%, 98%), 99%), 99.9%) or even higher identity to the wild-type gene.

[0097] In another embodiment, the nucleic acid molecule of the present invention encodes a polypeptide having an amino acid sequence disclosed in Tables 1 and 2. Preferably, the nucleic acid molecule of the present invention encodes a polypeptide sequence of at least 50%, 60, 70%, 80%, 85%, 90% or 95% identity to the amino acid sequences shown in Tables 1 and 2 and the identity can even more preferably be 96%>, 97%, 98%>, 99%, 99.9% or even higher.

[0098] The present invention also provides nucleic acid molecules that hybridize under stringent conditions to the above-described nucleic acid molecules. As defined above, and as is well known in the art, stringent hybridizations are performed at about 25 °C below the thermal melting point (T _m ) for the specific DNA hybrid under a particular set of conditions, where the T _m is the temperature at which 50% of the target sequence hybridizes to a perfectly matched probe. Stringent washing is performed at temperatures about 5°C lower than the T _m for the specific DNA hybrid under a particular set of conditions.

[0099] Nucleic acid molecules comprising a fragment of any one of the above-described nucleic acid sequences are also provided. These fragments preferably contain at least 20 contiguous nucleotides. More preferably the fragments of the nucleic acid sequences contain at least 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or even more contiguous nucleotides.

[00100] The nucleic acid sequence fragments of the present invention display utility in a variety of systems and methods. For example, the fragments may be used as probes in various hybridization techniques. Depending on the method, the target nucleic acid sequences may be either DNA or RNA. The target nucleic acid sequences may be fractionated (e.g. , by gel electrophoresis) prior to the hybridization, or the hybridization may be performed on samples in situ. One of skill in the art will appreciate that nucleic acid probes of known sequence find utility in determining chromosomal structure (e.g., by Southern blotting) and in measuring gene expression (e.g., by Northern blotting). In such experiments, the sequence fragments are preferably detectably labeled, so that their specific hydridization to target sequences can be detected and optionally quantified. One of skill in the art will appreciate that the nucleic acid fragments of the present invention may be used in a wide variety of blotting techniques not specifically described herein.

[00101] It should also be appreciated that the nucleic acid sequence fragments disclosed herein also find utility as probes when immobilized on microarrays. Methods for creating microarrays by deposition and fixation of nucleic acids onto support substrates are well known in the art. Reviewed in DNA Microarrays: A Practical Approach (Practical Approach Series), Schena (ed.), Oxford University Press (1999) (ISBN: 0199637768); Nature Genet. 21(l)(suppl): l-60 (1999); Microarray Biochip: Tools and Technology, Schena (ed.), Eaton Publishing Company/BioTechniques Books Division (2000) (ISBN: 1881299376), the disclosures of which are incorporated herein by reference in their entireties. Analysis of, for example, gene expression using microarrays comprising nucleic acid sequence fragments, such as the nucleic acid sequence fragments disclosed herein, is a well-established utility for sequence fragments in the field of cell and molecular biology. Other uses for sequence fragments immobilized on microarrays are described in Gerhold et al., Trends Biochem. Sci. 24: 168-173 (1999) and Zweiger, Trends Biotechnol. 17:429-436 (1999); DNA Microarrays: A Practical Approach (Practical Approach Series), Schena (ed.), Oxford University Press (1999) (ISBN: 0199637768); Nature Genet. 21(l)(suppl): l-60 (1999); Microarray Biochip: Tools and Technology, Schena (ed.), Eaton Publishing Company/BioTechniques Books Division (2000) (ISBN: 1881299376), the disclosure of each of which is incorporated herein by reference in its entirety.

[00102] As is well known in the art, enzyme activities can be measured in various ways. For example, the pyrophosphorolysis of OMP may be followed spectroscopically

(Grubmeyer et al, (1993) J. Biol. Chem. 268:20299-20304). Alternatively, the activity of the enzyme can be followed using chromatographic techniques, such as by high performance liquid chromatography (Chung and Sloan, (1986) J. Chromatogr. 371 :71-81). As another alternative the activity can be indirectly measured by determining the levels of product made from the enzyme activity. These levels can be measured with techniques including aqueous chloroform/methanol extraction as known and described in the art (Cf. M. Kates (1986) Techniques ofLipidology; Isolation, analysis and identification of Lipids. Elsevier Science Publishers, New York (ISBN: 0444807322)). More modern techniques include using gas chromatography linked to mass spectrometry (Niessen, W. M. A. (2001). Current practice of gas chromatography— mass spectrometry. New York, NY: Marcel Dekker. (ISBN:

0824704738)). Additional modern techniques for identification of recombinant protein activity and products including liquid chromatography-mass spectrometry (LCMS), high performance liquid chromatography (HPLC), capillary electrophoresis, Matrix -Assisted Laser Desorption Ionization time of flight-mass spectrometry (MALDI-TOF MS), nuclear magnetic resonance (NMR), near-infrared (NIR) spectroscopy, viscometry (Knothe, G (1997) Am. Chem. Soc. Symp. Series, 666: 172-208), titration for determining free fatty acids (Komers (1997) Fett/Lipid, 99(2): 52-54), enzymatic methods (Bailer (1991) Fresenius J. Anal. Chem. 340(3): 186), physical property-based methods, wet chemical methods, etc. can be used to analyze the levels and the identity of the product produced by the organisms of the present invention. Other methods and techniques may also be suitable for the measurement of enzyme activity, as would be known by one of skill in the art.

Vectors

[00103] Also provided are vectors, including expression vectors, which comprise the above nucleic acid molecules of the present invention, as described further herein. In a first embodiment, the vectors include the isolated nucleic acid molecules described above. In an alternative embodiment, the vectors of the present invention include the above-described nucleic acid molecules operably linked to one or more expression control sequences. The vectors of the instant invention may thus be used to express a polypeptide contributing to alkane producing activity by a host cell.

[00104] Vectors useful for expression of nucleic acids in prokaryotes are well known in the art.

Isolated Polypeptides

[00105] According to another aspect of the present invention, isolated polypeptides (including muteins, allelic variants, fragments, derivatives, and analogs) encoded by the nucleic acid molecules of the present invention are provided. In one embodiment, the isolated polypeptide comprises the polypeptide sequence corresponding to a polypeptide sequence shown in Table 1 or 2. In an alternative embodiment of the present invention, the isolated polypeptide comprises a polypeptide sequence at least 85% identical to a polypeptide sequence shown in Table 1 or 2. Preferably the isolated polypeptide of the present invention has at least 50%, 60, 70%, 80%, 85%, 90%, 95%, 98%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%), 99.8%), 99.9%) or even higher identity to a polypeptide sequence shown in Table 1 or 2.

[00106] According to other embodiments of the present invention, isolated polypeptides comprising a fragment of the above-described polypeptide sequences are provided. These fragments preferably include at least 20 contiguous amino acids, more preferably at least 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or even more contiguous amino acids.

[00107] The polypeptides of the present invention also include fusions between the above- described polypeptide sequences and heterologous polypeptides. The heterologous sequences can, for example, include sequences designed to facilitate purification, e.g. histidine tags, and/or visualization of recombinantly-expressed proteins. Other non-limiting examples of protein fusions include those that permit display of the encoded protein on the surface of a phage or a cell, fusions to intrinsically fluorescent proteins, such as green fluorescent protein (GFP), and fusions to the IgG Fc region.

Host Cell Transformants

[00108] In another aspect of the present invention, host cells transformed with the nucleic acid molecules or vectors of the present invention, and descendants thereof, are provided. In some embodiments of the present invention, these cells carry the nucleic acid sequences of the present invention on vectors, which may but need not be freely replicating vectors. In other embodiments of the present invention, the nucleic acids have been integrated into the genome of the host cells.

[00109] In an alternative embodiment, the host cells of the present invention can be mutated by recombination with a disruption, deletion or mutation of the isolated nucleic acid of the present invention so that the activity of one or more enzyme(s) in the host cell is reduced or eliminated compared to a host cell lacking the mutation.

Selected or Engineered Microorganisms For the Production of Carbon-Based Products of Interest

[00110] Microorganism: Includes prokaryotic and eukaryotic microbial species from the Domains Archaea, Bacteria and Eucarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista. The terms "microbial cells" and "microbes" are used interchangeably with the term microorganism.

[00111] A variety of host organisms can be transformed to produce a product of interest. Photoautotrophic organisms include eukaryotic plants and algae, as well as prokaryotic cyanobacteria, green-sulfur bacteria, green non-sulfur bacteria, purple sulfur bacteria, and purple non-sulfur bacteria.

[00112] Extremophiles are also contemplated as suitable organisms. Such organisms withstand various environmental parameters such as temperature, radiation, pressure, gravity, vacuum, desiccation, salinity, pH, oxygen tension, and chemicals. They include

hyperthermophiles, which grow at or above 80°C such as Pyrolobus fumarii; thermophiles, which grow between 60-80°C such as Synechococcus lividis; mesophiles, which grow between 15-60°C and psychrophiles, which grow at or below 15°C such as Psychrobacter and some insects. Radiation tolerant organisms include Deinococcus radiodurans. Pressure- tolerant organisms include piezophiles, which tolerate pressure of 130 MPa. Weight-tolerant organisms include barophiles. Hypergravity (e.g.,, >lg) hypogravity (e.g., <lg) tolerant organisms are also contemplated. Vacuum tolerant organisms include tardigrades, insects, microbes and seeds. Dessicant tolerant and anhydrobiotic organisms include xerophiles such as Artemia salina; nematodes, microbes, fungi and lichens. Salt-tolerant organisms include halophiles (e.g., 2-5 M NaCl) Halobacteriacea and Dunaliella salina. pH-tolerant organisms include alkaliphiles such as Natronobacterium, Bacillus firmus OF4, Spirulina spp. (e.g. , pH > 9) and acidophiles such as Cyanidium caldarium, Ferroplasma sp. (e.g., low pH).

Anaerobes, which cannot tolerate 0 ₂ such as Methanococcus jannaschii; microaerophils, which tolerate some 0 ₂ such as Clostridium and aerobes, which require 0 ₂ are also contemplated. Gas-tolerant organisms, which tolerate pure C0 ₂ include Cyanidium caldarium and metal tolerant organisms include metalotolerants such as Ferroplasma acidarmanus (e.g., Cu, As, Cd, Zn), Ralstonia sp. CH34 (e.g., Zn, Co, Cd, Hg, Pb). Gross, Michael. Life on the Edge: Amazing Creatures Thriving in Extreme Environments. New York: Plenum (1998) and Seckbach, J. "Search for Life in the Universe with Terrestrial Microbes Which Thrive Under Extreme Conditions." In Cristiano Batalli Cosmo vici, Stuart Bowyer, and Dan Wertheimer, eds., Astronomical and Biochemical Origins and the Search or Life in the Universe, p. 511. Milan: Editrice Compositori (1997).

[00113] Plants include but are not limited to the following genera: Arabidopsis, Beta, Glycine, Jatropha, Miscanthus, Panicum, Phalaris, Populus, Saccharum, Salix, Simmondsia and Zea.

[00114] Algae and cyanobacteria include but are not limited to the following genera:

Acanthoceras, Acanthococcus, Acaryochloris, Achnanthes, Achnanthidium, Actinastrum, Actinochloris, Actinocyclus, Actinotaenium, Amphichrysis, Amphidinium, Amphikrikos, Amphipleura, Amphiprora, Amphithrix, Amphora, Anabaena, Anabaenopsis, Aneumastus, Ankistrodesmus, Ankyra, Anomoeoneis, Apatococcus, Aphanizomenon, Aphanocapsa, Aphanochaete, Aphanothece, Apiocystis, Apistonema, Arthrodesmus, Artherospira,

Ascochloris, Asterionella, Aster ococcus, Audouinella, Aulacoseira, Bacillaria, Balbiania, Bambusina, Bangia, Basichlamys, Batrachospermum, Binuclearia, Bitrichia, Blidingia, Botrdiopsis, Botrydium, Botryococcus, Botryosphaerella, Brachiomonas, Brachysira, Brachytrichia, Brebissonia, Bulbochaete, Bumilleria, Bumilleriopsis, Caloneis, Calothrix, Campylodiscus, Capsosiphon, Carteria, Catena, Cavinula, Centritr actus, Centronella, Ceratium, Chaetoceros, Chaetochloris, Chaetomorpha, Chaetonella, Chaetonema,

Chaetopeltis, Chaetophora, Chaetosphaeridium, Chamaesiphon, Chara, Characiochloris, Characiopsis, Characium, Charales, Chilomonas, Chlainomonas, Chlamydoblepharis, Chlamydocapsa, Chlamydomonas, Chlamydomonopsis, Chlamydomyxa, Chlamydonephris, Chlorangiella, Chlorangiopsis, Chlorella, Chlorobotrys, Chlorobrachis, Chlorochytrium, Chlorococcum, Chlorogloea, Chlorogloeopsis, Chlorogonium, Chlorolobion, Chloromonas, Chlorophysema, Chlorophyta, Chlorosaccus, Chlorosarcina, Choricystis, Chromophyton, Chromulina, Chroococcidiopsis, Chroococcus, Chroodactylon, Chroomonas, Chroothece, Chrysamoeba, Chrysapsis, Chrysidiastrum, Chrysocapsa, Chrysocapsella, Chrysochaete, Chrysochromulina, Chrysococcus, Chrysocrinus, Chrysolepidomonas, Chrysolykos,

Chrysonebula, Chrysophyta, Chrysopyxis, Chrysosaccus, Chrysophaerella,

Chrysostephanosphaera, Clodophora, Clastidium, Closteriopsis, Closterium, Coccomyxa, Cocconeis, Coelastrella, Coelastrum, Coelosphaerium, Coenochloris, Coenococcus,

Coenocystis, Colacium, Coleochaete, Collodictyon, Compsogonopsis, Compsopogon, Conjugatophyta, Conochaete, Coronastrum, Cosmarium, Cosmioneis, Cosmocladium, Crateriportula, Craticula, Crinalium, Crucigenia, Crucigeniella, Cryptoaulax, Cryptomonas, Cryptophyta, Ctenophora, Cyanodictyon, Cyanonephron, Cyanophora, Cyanophyta,

Cyanothece, Cyanothomonas, Cyclonexis, Cyclostephanos, Cyclotella, Cylindrocapsa, Cylindrocystis, Cylindrospermum, Cylindrotheca, Cymatopleura, Cymbella,

Cymbellonitzschia, Cystodinium Dactylococcopsis, Debarya, Denticula, Dermatochrysis, Dermocarpa, Dermocarpella, Desmatractum, Desmidium, Desmococcus, Desmonema, Desmosiphon, Diacanthos, Diacronema, Diadesmis, Diatoma, Diatomella, Dicellula, Dichothrix, Dichotomococcus, Dicranochaete, Dictyochloris, Dictyococcus,

Dictyosphaerium, Didymocystis, Didymogenes, Didymosphenia, Dilabifilum,

Dimorphococcus, Dinobryon, Dinococcus, Diplochloris, Diploneis, Diplostauron,

Distrionella, Docidium, Draparnaldia, Dunaliella, Dysmorphococcus, Ecballocystis, Elakatothrix, Ellerbeckia, Encyonema, Enteromorpha, Entocladia, Entomoneis,

Entophysalis, Epichrysis, Epipyxis, Epithemia, Eremosphaera, Euastropsis, Euastrum, Eucapsis, Eucocconeis, Eudorina, Euglena, Euglenophyta, Eunotia, Eustigmatophyta, Eutreptia, Fallacia, Fischerella, Fragilaria, Fragilariforma, Franceia, Frustulia, Curcilla, Geminella, Genicularia, Glaucocystis, Glaucophyta, Glenodiniopsis, Glenodinium,

Gloeocapsa, Gloeochaete, Gloeochrysis, Gloeococcus, Gloeocystis, Gloeodendron,

Gloeomonas, Gloeoplax, Gloeothece, Gloeotila, Gloeotrichia, Gloiodictyon, Golenkinia, Golenkiniopsis, Gomontia, Gomphocymbella, Gomphonema, Gomphosphaeria,

Gonatozygon, Gongrosia, Gongrosira, Goniochloris, Gonium, Gonyostomum,

Granulochloris, Granulocystopsis, Groenbladia, Gymnodinium, Gymnozyga, Gyrosigma, Haematococcus, Hafniomonas, Hallassia, Hammatoidea, Hannaea, Hantzschia, Hapalosiphon, Haplotaenium, Haptophyta, Haslea, Hemidinium, Hemitonia, Heribaudiella, Heteromastix, Heterothrix, Hibberdia, Hildenbrandia, Hillea, Holopedium, Homoeothrix, Hormanthonema, Hormotila, Hyalobrachion, Hyalocardium, Hyalodiscus, Hyalogonium, Hyalotheca, Hydrianum, Hydrococcus, Hydrocoleum, Hydrocoryne, Hydrodictyon,

Hydrosera, Hydrurus, Hyella, Hymenomonas, Isthmochloron, Johannesbaptistia,

Juranyiella, Karayevia, Kathablepharis, Katodinium, Kephyrion, Keratococcus,

Kirchneriella, Klebsormidium, Kolbesia, Koliella, Komarekia, Korshikoviella, Kraskella, Lagerheimia, Lagynion, Lamprothamnium, Lemanea, Lepocinclis, Leptosira, Lobococcus, Lobocystis, Lobomonas, Luticola, Lyngbya, Malleochloris, Mallomonas, Mantoniella, Marssoniella, Martyana, Mastigocoleus, Gastogloia, Melosira, Merismopedia, Mesostigma, Mesotaenium, Micractinium, Micrasterias, Microchaete, Microcoleus, Microcystis,

Microglena, Micromonas, Microspora, Microthamnion, Mischococcus, Monochrysis, Monodus, Monomastix, Monoraphidium, Monostroma, Mougeotia, Mougeotiopsis,

Myochloris, Myromecia, Myxosarcina, Naegeliella, Nannochloris, Nautococcus, Navicula, Neglectella, Neidium, Nephroclamys, Nephrocytium, Nephrodiella, Nephroselmis, Netrium, Nitella, Nitellopsis, Nitzschia, Nodularia, Nostoc, Ochromonas, Oedogonium,

Oligochaetophora, Onychonema, Oocardium, Oocystis, Opephora, Ophiocytium, Orthoseira, Oscillatoria, Oxyneis, Pachycladella, Palmella, Palmodictyon, Pnadorina, Pannus, Paralia, Pascherina, Paulschulzia, Pediastrum, Pedinella, Pedinomonas, Pedinopera, Pelagodictyon, Penium, Peranema, Peridiniopsis, Peridinium, Peronia, Petroneis, Phacotus, Phacus, Phaeaster, Phaeodermatium, Phaeophyta, Phaeosphaera, Phaeothamnion, Phormidium, Phycopeltis, Phyllariochloris, Phyllocardium, Phyllomitas, Pinnularia, Pitophora, Placoneis, Planctonema, Planktosphaeria, Planothidium, Plectonema, Pleodorina, Pleurastrum, Pleurocapsa, Pleurocladia, Pleurodiscus, Pleurosigma, Pleurosira, Pleurotaenium,

Pocillomonas, Podohedra, Polyblepharides, Polychaetophora, Polyedriella, Polyedriopsis, Polygoniochloris, Polyepidomonas, Polytaenia, Polytoma, Polytomella, Porphyridium, Posteriochromonas, Prasinochloris, Prasinocladus, Prasinophyta, Prasiola, Prochlorphyta, Prochlorothrix, Protoderma, Protosiphon, Provasoliella, Prymnesium, Psammodictyon, Psammothidium, Pseudanabaena, Pseudenoclonium, Psuedocarteria, Pseudochate,

Pseudocharacium, Pseudococcomyxa, Pseudodictyosphaerium, Pseudokephyrion,

Pseudoncobyrsa, Pseudoquadrigula, Pseudosphaerocystis, Pseudostaurastrum,

Pseudostaurosira, Pseudotetrastrum, Pteromonas, Punctastruata, Pyramichlamys,

Pyramimonas, Pyrrophyta, Quadrichloris, Quadricoccus, Quadrigula, Radiococcus, Radiofilum, Raphidiopsis, Raphidocelis, Raphidonema, Raphidophyta, Peimeria, Rhabdoderma, Rhabdomonas, Rhizoclonium, Rhodomonas, Rhodophyta, Rhoicosphenia, Rhopalodia, Rivularia, Rosenvingiella, Rossithidium, Roya, Scenedesmus, Scherffelia, Schizochlamydella, Schizochlamys, Schizomeris, Schizothrix, Schroederia, Scolioneis, Scotiella, Scotiellopsis, Scourfieldia, Scytonema, Selenastrum, Selenochloris, Sellaphora, Semiorbis, Siderocelis, Diderocystopsis, Dimonsenia, Siphononema, Sirocladium,

Sirogonium, Skeletonema, Sorastrum, Spermatozopsis, Sphaerellocystis, Sphaerellopsis, Sphaerodinium, Sphaeroplea, Sphaerozosma, Spiniferomonas, Spirogyra, Spirotaenia, Spirulina, Spondylomorum, Spondylosium, Sporotetras, Spumella, Staurastrum,

Stauerodesmus, Stauroneis, Staurosira, Staurosirella, Stenopterobia, Stephanocostis, Stephanodiscus, Stephanoporos, Stephanosphaera, Stichococcus, Stichogloea, Stigeoclonium, Stigonema, Stipitococcus, Stokesiella, Strombomonas, Stylochrysalis, Stylodinium, Styloyxis, Stylosphaeridium, Surirella, Sykidion, Symploca, Synechococcus, Synechocystis, Synedra, Synochromonas, Synura, Tabellaria, Tabularia, Teilingia, Temnogametum, Tetmemorus, Tetrachlorella, Tetracyclus, Tetradesmus, Tetraedriella, Tetraedron, Tetraselmis,

Tetraspora, Tetrastrum, Thalassiosira, Thamniochaete, Thorakochloris, Thorea, Tolypella, Tolypothrix, Trachelomonas, Trachydiscus, Trebouxia, Trentepholia, Treubaria, Tribonema, Trichodesmium, Trichodiscus, Trochiscia, Tryblionella, Ulothrix, Uroglena, Uronema, Urosolenia, Urospora, Uva, Vacuolaria, Vaucheria, Volvox, Volvulina, Westella,

Woloszynskia, Xanthidium, Xanthophyta, Xenococcus, Zygnema, Zygnemopsis, and

Zygonium. Cyanobacteria include members of the genus Chamaesiphon, Chroococcus, Cyanobacterium, Cyanobium, Cyanothece, Dactylococcopsis, Gloeobacter, Gloeocapsa, Gloeothece, Microcystis, Prochlorococcus, Prochloron, Synechococcus, Synechocystis, Cyanocystis, Dermocarpella, Stanieria, Xenococcus, Chroococcidiopsis, Myxosarcina, Arthrospira, Borzia, Crinalium, Geitlerinemia, Leptolyngbya, Limnothrix, Lyngbya,

Microcoleus, Oscillatoria, Planktothrix, Prochiorothrix, Pseudanabaena, Spirulina, Starria, Symploca, Trichodesmium, Tychonema, Anabaena, Anabaenopsis, Aphanizomenon,

Cyanospira, Cylindrospermopsis, Cylindrospermum, Nodularia, Nostoc, Scylonema,

Calothrix, Rivularia, Tolypothrix, Chlorogloeopsis, Fischerella, Geitieria, Iyengariella, Nostochopsis, Stigonema and Thermosynechococcus .

[00115] Green non-sulfur bacteria include but are not limited to the following genera:

Chloroflexus, Chloronema, Oscillochloris, Heliothrix, Herpetosiphon, Roseiflexus, and

Thermomicrobium.

[00116] Green sulfur bacteria include but are not limited to the following genera: [00117] Chlorobium, Clathrochloris, and Prosthecochloris .

[00118] Purple sulfur bacteria include but are not limited to the following genera:

AUochromatium, Chromatium, Halochromatium, Isochromatium, Marichromatium,

Rhodovulum, Thermochromatium, Thiocapsa, Thiorhodococcus, and Thiocystis,

[00119] Purple non-sulfur bacteria include but are not limited to the following genera: Phaeospirillum, Rhodobaca, Rhodobacter, Rhodomicrobium, Rhodopila,

Rhodopseudomonas, Rhodothalassium, Rhodospirillum, Rodovibrio, and Roseospira.

[00120] Aerobic chemolithotrophic bacteria include but are not limited to nitrifying bacteria such as Nitrobacteraceae sp., Nitrobacter sp., Nitrospina sp., Nitrococcus sp., Nitrospira sp., Nitrosomonas sp., Nitrosococcus sp., Nitrosospira sp., Nitrosolobus sp., Nitrosovibrio sp.; colorless sulfur bacteria such as, Thiovulum sp., Thiobacillus sp., Thiomicrospira sp., Thiosphaera sp., Thermothrix sp.; obligately chemolithotrophic hydrogen bacteria such as Hydrogenobacter sp., iron and manganese-oxidizing and/or depositing bacteria such as Siderococcus sp., and magnetotactic bacteria such as Aquaspirillum sp.

[00121] Archaeobacteria include but are not limited to methanogenic archaeobacteria such as Methanobacterium sp., Methanobrevibacter sp., Methanothermus sp., Methanococcus sp., Methanomicrobium sp., Methanospirillum sp., Methanogenium sp., Methanosarcina sp., Methanolobus sp., Methanothrix sp., Methanococcoides sp., Methanoplanus sp.; extremely thermophilic S-Metabolizers such as Thermoproteus sp., Pyrodictium sp., Sulfolobus sp., Acidianus sp. and other microorganisms such as, Bacillus subtilis, Saccharomyces cerevisiae, Streptomyces sp., Ralstonia sp., Rhodococcus sp., Corynebacteria sp., Brevibacteria sp., Mycobacteria sp., and oleaginous yeast.

[00122] Preferred organisms for the manufacture of alkanes according to the methods discloused herein include: Arabidopsis thaliana, Panicum virgatum, Miscanthus giganteus, and Zea mays (plants); Botryococcus braunii, Chlamydomonas reinhardtii and Dunaliela salina (algae); Synechococcus sp PCC 7002, Synechococcus sp. PCC 7942, Synechocystis sp. PCC 6803, Thermosynechococcus elongatus BP-1 (cyanobacteria); Chlorobium tepidum (green sulfur bacteria), Chloroflexus auranticus (green non-sulfur bacteria); Chromatium tepidum and Chromatium vinosum (purple sulfur bacteria); Rhodospirillum rubrum,

Rhodobacter capsulatus, and Rhodopseudomonas palusris (purple non-sulfur bacteria).

[00123] Yet other suitable organisms include synthetic cells or cells produced by synthetic genomes as described in Venter et al. US Pat. Pub. No. 2007/0264688, and cell-like systems or synthetic cells as described in Glass et al. US Pat. Pub. No. 2007/0269862. [00124] Still, other suitable organisms include microorganisms that can be engineered to fix carbon dioxide bacteria such as Escherichia coli, Acetobacter aceti, Bacillus subtilis, yeast and fungi such as Clostridium ljungdahlii, Clostridium thermocellum, Penicillium

chrysogenum, Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pseudomonas fluorescens, or Zymomonas mobilis.

[00125] A suitable organism for selecting or engineering is capable of autotrophic fixation of C0 ₂ to products. This would cover photosynthesis and methanogenesis. Acetogenesis, encompassing the three types of C0 ₂ fixation; Calvin cycle, acetyl-CoA pathway and reductive TCA pathway is also covered. The capability to use carbon dioxide as the sole source of cell carbon (autotrophy) is found in almost all major groups of prokaryotes. The C0 ₂ fixation pathways differ between groups, and there is no clear distribution pattern of the four presently-known autotrophic pathways. See, e.g., Fuchs, G. 1989. Alternative pathways of autotrophic CO ₂ fixation, p. 365-382. In H. G. Schlegel, and B. Bowien (ed.), Autotrophic bacteria. Springer-Verlag, Berlin, Germany. The reductive pentose phosphate cycle

(Calvin-Bassham-Benson cycle) represents the C0 ₂ fixation pathway in almost all aerobic autotrophic bacteria, for example, the cyanobacteria.

[00126] Alkane production via engineered cyanobacteria, e.g., a Synechococcus or

Thermosynechococcus species, is preferred. Other preferred organisms include

Synechocystis, Klebsiella oxytoca, Escherichia coli or Saccharomyces cerevisiae. Other prokaryotic, archaea and eukaryotic host cells are also encompassed within the scope of the present invention.

[00127] In some aspects, alkane production via a photosynthetic organism can be carried out using the compositions, materials, and methods described in: PCT/US2009/035937 (filed March 3, 2009); and PCT/US2009/055949 (filed September 3, 2009); each of which is herein incorporated by reference in its entirety, for all purposes.

Carbon-Based Products of Interest: Hydrocarbons & Alcohols

[00128] In various embodiments of the invention, desired hydrocarbons and/or alcohols of certain chain length or a mixture thereof can be produced. In certain aspects, the host cell produces at least one of the following carbon-based products of interest: alkanes such as heptane, nonane, tridecane, pentadecane, and/or undecane. In other aspects, the carbon chain length ranges from C ₂ to C ₂ o, e.g., C ₂ , C ₃ , C ₄ , C ₅ , C ₆ , C ₇ _ C ₈ _ C ₉ , Ci _0j Cn Ci _2j C _i3 C _i4 C ₁₅₎ Ci _6j Ci ₇ Ci _{8 ,} Ci ₉ or C ₂ o. Accordingly, the invention provides production of various chain lengths of carbon based product(s) or interest suitable for use as fuels & chemicals. [00129] In preferred aspects, the methods provide culturing host cells for direct product secretion for easy recovery without the need to extract biomass. These carbon-based products of interest are secreted directly into the medium. Since the invention enables production of various defined chain length of hydrocarbons and alcohols, the secreted products are easily recovered or separated. The products of the invention, therefore, can be used directly or used with minimal processing.

Fuel Compositions

[00130] In various embodiments, compositions produced by the methods of the invention are used as fuels. Such fuels comply with ASTM standards, for instance, standard specifications for diesel fuel oils D 975-09b, and Jet A, Jet A-l and Jet B as specified in ASTM Specification D. 1655-68. Fuel compositions may require blending of several products to produce a uniform product. The blending process is relatively straightforward, but the determination of the amount of each component to include in a blend is much more difficult. Fuel compositions may, therefore, include aromatic and/or branched hydrocarbons, for instance, 75% saturated and 25% aromatic, wherein some of the saturated hydrocarbons are branched and some are cyclic. Preferably, the methods of the invention produce an array of hydrocarbons, such as C ₂ -C17 or C ₁₀ -C ₁₅ to alter cloud point. Furthermore, the

compositions may comprise fuel additives, which are used to enhance the performance of a fuel or engine. For example, fuel additives can be used to alter the freezing/gelling point, cloud point, lubricity, viscosity, oxidative stability, ignition quality, octane level, and flash point. Fuels compositions may also comprise, among others, antioxidants, static dissipater, corrosion inhibitor, icing inhibitor, biocide, metal deactivator and thermal stability improver.

[00131] In some aspects, a fuel composition comprises a mixture of one or more carbon- based product(s) of interest and the ratio of a shorter chain length carbon-based product(s) of interest present in the mixture to a longer chain length carbon-based product(s) of interest present in the mixture is about 3:2, 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1, or 9: 1, optionally wherein a shorter chain length carbon-based product(s) of interest present in the mixture is present in an amount that is greater than the amount of a longer chain length carbon-based product(s) of interest present in the mixture, and, optionally, wherein at least a portion of the carbon of the carbon-based product(s) of interest is inorganic carbon.

[00132] In some aspects, a fuel composition comprises a mixture of one or more carbon- based product(s) of interest and at least one or C ₇ Cg C , Cio_ Cn Ci _2j C ₁₃₎ C ₁₄₎ C ₁₅₎ Ci _6j and Ci ₇ Ci ₈ are the predominant carbon-based product(s) of interest in the mixture, optionally wherein at least 90% of the mixture is CI 1 or C12 carbon-based product(s) of interest, and, optionally, wherein the mixture comprises about 95% CI 1 or C12 and about 5% C9 or CIO. In some aspects, at least 95% of a mixture comprises CI 1 or C12 carbon-based product(s) of interest.

[00133] In some aspects, at least 50-75, 55, 60, 65, 70, or 75% of a mixture comprises C16, optionally wherein the mixture comprises 15-45, 15, 20, 25, 30, 35, 40, or 45% C18, optionally wherein the mixture comprises 0-5, 0, 1, 2, 3, 4, or 5% C14, and optionally wherein the mixture comprises 0-10, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10% C12.

[00134] In some aspects, a mixture comprises at least 10-30, 13-25, 10, 15, 20, 25, or 30% C13, optionally wherein the mixture comprises at least 50-95, 75-87, 55, 60, 65, 70, 75, 80, 85, 90, or 95% C15, optionally wherein the mixture comprises 0-5, 0-1, 0, 1, 2, 3, 4, or 5% Cl l .

[00135] In some aspects, at least a portion of the carbon of the carbon-based product(s) of interest is inorganic carbon. In some aspects, inorganic carbon is derived from C0 ₂ . In some aspects, at least a portion of the carbon used as raw material of a carbon-based product(s) of interest is inorganic carbon or C0 ₂ .

[00136] In some aspects, a fuel composition is a low-sulfur composition. In some aspects, a fuel composition is a carbon-neutral composition. In some aspects, a fuel composition has a higher δ _ρ than a comparable composition made from fixed atmospheric carbon or plant- derived biomass. In some aspects, a fuel composition can include one or more various components or impurities that are not present in traditional fossil fuels. In certain aspects, the one or more various components can be components resulting from a cell, a cell culture, a culture medium, or isolation of a fuel composition from cell culture.

[00137] In some aspects, a fuel composition further comprises at least one of diesel (e.g., summer or winter diesel), gasoline, and jet fuel, e.g., via blending. In some aspects, diesel, gasoline, or jet fuel can be fossil fuels. In some aspects, the percentage of diesel can be 1-99, 20-50, 20-65, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 99%. In some aspects, the percentage of jet fuel can be 1-99, 20-50, 20-65, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 99%. In some aspects, the percentage of gasoline can be 1-99, 20-50, 20-65, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 99%.

[00138] In some aspects, a carbon-based product(s) of interest is at least one of alkanes, aldehydes, and alcohols. [00139] In addition to many environmental advantages of the invention such as C0 ₂ conversion and renewable source, other advantages of the fuel compositions disclosed herein include low sulfur content, low emissions, being free or substantially free of alcohol and having high cetane number.

Example 1: Increased fatty acid biosynthetic rate in JCC138-derived strain applied to the production of 1-dodecanol and dodecanal from CO2.

[00140] Materials and Methods

[00141] Plasmid & strain generation

[00142] To generate JCC6628, a recombinant cyanobacterial strain displaying increased fatty acid flux, the following three plasmids were assembled and used to transform JCC138 (Synechococcus sp. PCC7002):

[00143] pJB3772

[00144] This construct targets carboxylic acid reductase (carB) and a phosphopantetheinyl transferase (entD) to the chromosome of JCC138 (the A0358 locus) under control of a urea- repressible promoter. carB is from Mycobacterium smegmatis (MSMEG_5739) and was codon-optimized for E. coli and synthesized by DNA2.0 along with entD (from Escherichia coli K-12). Restriction enzyme digestion and ligations were used to subclone these genes into an existing plasmid backbone. The complete genotype of the plasmid is as follows:

|<kan|T[rmB]>|UHR_A0358|P(nir0 )>|cαrS-e«ίLl>|T[adhII] |kan>|A0358_DHR|T[bla]>|T[ oC]>|<pUC_ori|

[00145] This plasmid was introduced to JCC138 via natural transformation to yield JCC5617.

[00146] pJB4033

[00147] This construct targets the thioesterase fatB (from Umbellularia californica) to the highest copy number plasmid in JCC138 (i.e. pAQl). It is controlled by a urea-repressible promoter. fatB was N-terminally truncated to remove the chloroplast-targeting peptide, codon optimized for E. coli, and synthesized from DNA2.0. Restriction digestion and ligation were used to subclone this gene into an existing vector backbone. The genotype of the plasmid is as follows:

|<bla|T[rrn]|pAQl_UHR|P(nir07)> aiS_mat_C/c>|T[adhII] |specR>|pAQl_DHR|pUC_ori| [00148] This plasmid was introduced to JCC5617 via natural transformation to yield JCC6022.

[00149] pJB4319

[00150] This construct targets the homologous fabH gene from E. coli MG 1655 (fabH_Ec) to the A0525 locus in JCC138 (replacing the native fabH gene at said locus) under control of the native promoter P(A0525).fabH_Ec was PCR amplified from E. coli MG1655 gDNA, A0525 homology regions were PCR amplified from JCC138 gDNA, and the gentamycin resistance cassette (aminoglycoside N(3')-acetyltransferase I (aacCl) was PCR amplified from an in-house cloning vector. These fragments were assembled into a plasmid by Gibson assembly, yielding the following genotype:

|fabH_UHR|T[BBa_B 1006] |gentR>||T[BBa_B0015] |<fabH_Ec|<P(fabH)|fabH_DHR|T[rrnB 1] |bla>|pUC_ori|T[rpn] |T[bla] |

[00151] This plasmid was introduced to JCC6022 via natural transformation and segregated with gentamycin to yield JCC6628. Figure 1 shows the pathway for production of 1-alkanols and alkanals from fatty acid biosynthesis in JCC6628. The relevant sequences used are shown in Table 1. The relevant EC numbers are shown in Table 2.

[00152] In vivo testing by shake flask study

[00153] Strains JCC138, JCC6022, and JCC6628 were inoculated into 30 mL JB 3.0 media (Table A) supplemented with urea (either 3 or 15 mM) and 100 mg/L spectinomycin (for JCC6022 and JCC6628 only). Cultures were inoculated to an initial OD730 of 0.25 and

-2 -1

incubated in an Infers HT photoincubator at 37C with 2% C0 ₂ , -100 μΕ m ^" s ^" constant illumination, and 250 rpm shaking. 125 mL PETG flasks were used for the experiment. 5 mL hexadecane (with 25 mg/L octadecane as internal standard and 25 mg/L butylated

hydroxytoluene as antioxidant) was supplied to the culture at t = 17h as an organic overlay to trap the products. After 95h, another 5 ml of this organic overlay was added to make the total overlay volume 10 ml.

ΚΗ ₂ Ρ0 ₄ 200

CaCl ₂ 133

H ₃ BO ₃ 34

EDTA (Disodium, dihydrate) 29.4

EDTA Iron(III) (a.k.a. ferric EDTA) 21

MnCl ₂ .4H ₂ 0 4.32

ZnCl 0.315

M0O ₃ 0.03

CoCl ₂ .6H ₂ 0 0.01215

CuS0 ₄ .5H ₂ 0 0.003

Vitamin B 12 0.004

Tris/THAM buffer 1300

[00154] At each timepoint, flasks were sampled for OD730 and an aliquot of the overlay was taken and analyzed by GC-FID using an Agilent 7890A GC-FID to quantify alkanals and alkanols produced by the strain. To accomplish this, a DB-1301 column (30 m x 250 μιη x 1.0 μιη) with helium as the carrier gas was used for separation. Run conditions were as follows: 350C inlet temperature, 40: 1 split ratio, injection volume of 1 μί, initial column flow of 1.8 ml/min (approximately 45 cm/sec linear velocity), increasing stepwise to 2.5 ml/min at 12 minutes. Initial oven temperature was 170C, held for 5.0 minutes, then increased at a rate of 3C/min to 180C, followed by an increase of 50C/min to a final temperature of 260C, holding for a final time of 5.0 min. Total run time was 14.9 minutes. The FID was kept at 300C with 400 ml/min air, 40 ml/min hydrogen, and 25 ml/min helium as makeup gas. Samples were quantified using in house generated standards in hexadecane from pure chemicals bought from Sigma- Aldrich.

[00155] To quantify cell-associated lipids, a method similar to that described by Bligh & Dyer was implemented (Canadian Journal of Biochemistry and Physiology, 1959, 37(8): 911- 917, 10.1139/o59-099). Briefly, at each timepoint, 500 μΙ_, of aqueous culture was taken and spun down in a microcentrifuge for 4 minutes at 12,000 rpm. The spent media was discarded and the cell pellets frozen at -80C until the flask study was complete. To extract lipids, 400 μΐ _^ of a 1 :2 chloroform:methanol solution (which also contained 100 mg/L butylated hydroxytoluene as antioxidant and 400 mg/L behenic acid as internal standard) was added to each pellet and each was vortexed for 15 seconds. After this period, samples were centrifuged at 15,000 rpm for 4 minutes and the supernatant of each sample transferred to a new tube. To this, 130 μΙ_, chloroform and 150 μΙ_, 0.88% KC1 in water was added. Samples were vortexed for 15 seconds and again spun in a microcentrifuge for 2 minutes at 15,000 rpm. 200 of the organic phase from each sample was transferred to a Kimble-Chase 8 mL glass vial with PTFE-lined screw cap. Uncapped samples were allowed to dry overnight in a chemical fume hood. Appropriate samples were included to account for extraction efficiency.

[00156] Dry samples were resuspended in 1 ml boron trifluoride (10% solution in methanol, Supelco #3-3356). The esterification reaction was allowed to proceed for 30 minutes at 60C. After this time, tubes were cooled and 1 ml H20 was added to quench the reaction. 2 ml isooctane was then added and samples were vortexed for 15 seconds. After phase separation, approx. 1 ml of the isooctane phase was transferred to Agilent autosampler vials and analyzed by GC-FID using an Agilent 7890A GC. The GC method for fatty acid methyl ester analysis consisted of the following: 290C inlet temperature, 8: 1 split ratio, injection volume of 1 μί, column flow of 0.72 ml/min (approximately 31 cm/sec linear velocity). Initial oven temperature was 80C, held for 0.3 minutes, then increased at a rate of 17.6C/min to 290C, holding for a final time of 6.0 min. Total run time was 18.2 minutes. The FID was kept at 300C with 400 ml/min air, 40 ml/min hydrogen, and 25 ml/min helium as makeup gas. An Agilent HP-5ms-UI column was used for separations (20m x 180 μιη x 0.18 μιη). Samples were quantified using in house generated standards in isooctane from pure chemicals bought from Sigma- Aldrich.

[00157] Results

[00158] Figure 2 illustrates growth of wild type JCC138 over 220h along with various derivative strains. JCC6022 has the native cyanobacterial fabH gene and includes

recombinant fatB & carB. When cultured in JB3.0 media with a starting concentration of 3 mM urea, the strain starts producing alcohols and aldehydes around OD of 4. At this point (approx 45 h), growth of JCC6022 slows compared to that of JCC138, but does continue at a modest rate. JCC6628 is a strain identical to JCC6022 though with the native fabH replaced by the heterologous fabH (from E. coli). JCC6628 grows at a slower rate than JCC138 over the entire course of the experiment, consistent with the strain diverting increased carbon to extracellular products. For both traces corresponding to JCC6628, growth almost completely stops, indicating near absolute partitioning of carbon from lipid biosynthesis to secreted carbon-based product. For the JCC6628/U15 case, the P(nir07) promoter should be as repressed as possible, which would lead to no extracellular products being produced (as is the case with JCC6022/U15, data not shown). Instead, it appears the basal level of P(nir07) promoter expression leads to enough fatB protein to sustain a maximal alkanol/alkanal production rate of 4.2 mg L ^"1 h ^"1 , Figure 3. This supports the hypothesis that the heterologous (E. coli) fabH is significantly more active than the native fabH, either due to increased catalytic efficiency or lack of allosteric regulation that the native fabH would be susceptible to. This increased activity likely manifests itself by sequestering free malonyl-ACP in the cell. This malonyl-ACP is a substrate for both fabH (the initiation ketosynthase) and fabF (the elongation ketosynthase). By limiting malonyl-ACP from the elongating ketosynthase fabF, it is likely that the intracellular pools of acyl-ACP (i.e. CIO-ACP, C12-ACP, etc.) increase in concentration. As the C12-ACP pool size increases, the fatB thioesterase is better able to act upon this substrate (in other words, the C12-ACP pool size becomes closer to or higher than the Km of FatB for C12-ACP). In JCC6628, therefore, significantly less thioesterase is required to sustain complete diversion of carbon to product, and for this strain, the amount of FatB obtained with 15 mM urea is superior to the amount obtained with 3 mM urea.

[00159] Figure 3 illustrates the production of secreted 1-alkanols and alkanals. JCC6022 (with native fabH) produces maximally at 1.4 mg L ^"1 h ^"1 . JCC6628 produces at a rate over 2x higher than that of JCC6022, regardless of urea concentration supplied. Note that the two urea concentration traces produce at the same rate for the initial app. 50 hours, after which point the 15 mM urea case outperforms. This is consistent with the explanation above, that this new strains uses much less thioesterase for optimal production. The 3 mM urea case appears to yield higher levels of thioesterase, which is possibly detrimental to the culture and causes the rate to decline over time.

[00160] Figure 4 illustrates the percentage of product generated by the two strains comprising chain lengths of 10, 12, and 14 carbons after 80 hours of incubation. While the parent strain JCC6022 exhibits approximately 2% of secreted product as C14 with undetectable levels of CIO product, this CIO fraction is enriched in JCC6628 to

approximately 2%, with the C14 family decreasing to undetectable levels. This is also consistent with the mechanism outlined above, where the shorter chain acyl-ACP pools (specifically the CIO-ACP pool in this case) is increased enough in JCC6628 such that the thioestase (FatB) exhibits some activity towards it. And conversely, due to malonyl-ACP limitation to FabF by increased FabH activity, the C14-ACP pool is decreased such that FatB no longer has appreciable activity towards it.

[00161] Figure 5 illustrates the total cell-associated membrane lipids (produced via fatty acid biosynthesis) for the various test strains. Note that JCC138 produces the lipids via FAS at a linear rate of 2.1 mg L ^"1 h ^"1 . Both JCC6022 and JCC6628 produce lipids at a lower rate once the thioesterase is induced (as this triggers the diversion of carbon from lipid synthesis to secreted product synthesis). The diversion of carbon (evidenced by the cessation of cell- associated lipid synthesis) is more pronounced in JCC6628 compared to JCC6022.

[00162] Figure 6 illustrates the summation of cell-associated lipids and secreted alkanals/1- alkanols. The rate obtained from these plots indicates total flux through the fatty acid biosynthesis machinery. A few things are of note: First, the total FAS flux for JCC6022 is identical to that of JCC138. Another way to say this is that all the carbon diverted from cell- associated lipids is accounted for in secreted product. The presence of the thioesterase to "drain" product from fatty acid biosynthesis doesn't appear to increase overall FAS flux in this strain. On the other hand, JCC6628 shows a significantly increased overall FAS flux compared to JCC138. The increase is maximally 2.4x (over about 50h) and minimally 2.2x (over the entire 220h).

Example 2: Native fabH overexpression in long-chain alkanogen JCC4102.

[00163] To determine the effect of overexpression of the native fabH in JCC138, an additional copy of fabH was inserted into the chromosome at the neutral locus A0206 under control of a cumate-inducible promoter. This modification was made in a long-chain alkanogen JCC4102 which produces 75% pentadecane and 25% heptadecane when the terminal AAR-ADM pathway(s) are induced. The strain generated was JCC4974. The relevant sequences used are shown in Table 1. The relevant EC numbers are shown in Table 2.

[00164] Results from flask studies wherein the native fabH was overexpressed (by fully inducing the cumate-responsive promoter with 25 μΜ cumate) illustrated that the organism is sensitive to overexpression of this enzyme and that fine-tuning expression levels of this enzyme will be helpful for optimizing flux through fatty acid biosynthesis. In Figure 7, note that at about 20h, when the alkane pathway becomes induced, JCC4102 and JCC4974 (without cumate addition) produce alkanes linearly at the same rates. For JCC4974 where 25 μΜ cumate was added at 42h (indicated by arrow), alkane productivity tracks JCC4102 until cumate triggers fabH overexpression; after this, alkane synthesis halts (as does overall culture growth, data not shown). [00165] However, inducing JCC4974 with lesser concentrations of cumate can benefit the flux through fatty acid synthase. For example, linear growth rate (Figure 8) and alkane productivity (Figure 9) are plotted, illustrating that controlled overexpression of FabH can indeed be tolerated by the cell, and in some cases (e.g., when induced with ~1 μΜ cumate) lead to an increase in total flux through fatty acid biosynthesis, and accordingly, flux through Aar and Adm to alkane. This result highlights that increasing fabH activity simply by overexpression of this gene is not necessarily adequate to attain an increase in fatty acid biosynthetic flux. The amount to which fabH is expressed (or overexpressed) should generally be empirically determined to manifest as an increase in fatty acid flux.

Example 3: Moderate overexpression of native fabH in long-chain alkanogen enriches for shorter chain-length alkane product.

[00166] Because beneficial effects on flux through fatty acid biosynthesis were observed from JCC4974 compared to JCC4102 when the fabH overexpression construct was induced with low levels of cumate, a similar strain was constructed with an attenuated cumate- inducible promoter driving expression of fabH. P(cum05) was used for this purpose, as this promoter is predicted to be only -20% as strong as P(cum02). This attenuated promoter was attained by increasing the spacing between the ribosomal binding site and the start codon from 10 nucleotides to 18 nucleotides:

[00167] The genotypes of the created strains were:

[00168] The relevant sequences used are shown in Table 1. The relevant EC numbers are shown in Table 2.

[00169] A shake flask study was completed, where JCC5263 (JCC4102 A0206::P(cum05)- fabH) was cultured in 30 mL of JB3.0 media in PETG flasks, with an initial urea

concentration of 3 mM. One set of flasks did not receive cumate, while the other received 25 μΜ cumate at time zero. As shown in Figure 10, the addition of cumate (and therefore the induction of fabH overexpression) did not lead to an increase in total alkane production when comparing to the uninduced control. However, an effect on chain length of produced alkane was observed. While JCC4102 (and JCC5263 without fabH induction) yields approximately 75% pentadecane, 20%> heptadecane, and 5% nonadecene (a product produced by the wild type strain JCC138 which is derived from fatty acid biosynthesis though not via the AAR- ADM alkane pathway), the ratios shift in JCC5263 (with fabH induction) to approximately 90%) pentadecane, 8% heptadecane, and only 2 % nonadecene.

[00170] This shift in product-chain length downwards is consistent with the description provided in the earlier examples, where increased fabH activity would lead to increased utilization of malonyl-ACP and thereby limit malonyl-ACP from fabF, the elongating ketosynthase.

[00171] This method of increasing fabH activity, therefore, either by moderately overexpressing the native fabH, or by substituting the native copy with a heterologous copy (e.g. fabH from E. coli), can be used to shift the chain-length of terminal carbon-based products of interest downward. For AAR-ADM, this manifests as a shift from C17/C15 to mainly C15. For the fatB thioesterase, this manifests as a shift from mainly C12 with <5% C14 to a profile of mainly C12 with <5% CIO. And for the thioesterase fatB2, we anticipate this manifesting as a shift from C8/C10 to mainly C8 product.

Example 4: Production of Carbon-Based Product(s) of Interest.

[00172] One or more recombinant genes encoding one or more enzymes having enzyme activities which catalyze the production of carbon-based product(s) of interest are identified and selected. Such genes and enzymes can be those described in Table 3. Various carbon- based product(s) of interest are also shown in Table 3. Certain relevant sequences are shown in Table 1 and certain relevant EC numbers are shown in Table 2.

Table 3

ENGINEERED MICROBIAL SYSTEMS FOR PRODUCING CARBON-BASED PRODUCT(S) OF INTEREST

CI 1 ALKANE PRODUCTION (FatB, CarB, EntD, ADM)

C7/C9 ALKANE PRODUCTION (FatB2, CarB, EntD, ADM)

C15/C17 ALKANE PRODUCTION (AAR, ADM)

C12 ALKANOL PRODUCTION (FatB, CarB, EntD, YjgB)

C12 ALKANOL/ALKANAL PRODUCTION (FatB, CarB, EntD) C8/C10 ALKANOL PRODUCTION (FatB2, CarB, EntD, YjgB) C8/C10 ALKANOL/ALKANAL PRODUCTION (FatB2, CarB,

EntD)

C12 FATTY ACID PRODUCTION (FatB, AAas)

C8/C10 FATTY ACID PRODUCTION (FatB2, AAas)

C12 FATTY ACID PRODUCTION (carB, entD, fatB)

C13 ALKANE PRODUCTION (TesA, CarB, EntD, ADM)

C14/C16 ALKANOL PRODUCTION (TesA, CarB, EntD, YjgB) C14/C16 ALKANOL/ALKANAL PRODUCTION (TesA, CarB,

EntD)

BUTYL DODECANOATE PRODUCTION (FatB, Wxs, FadD)

BUTYL PALMITATE PRODUCTION (TesA, Wxs, FadD)

C7/C9/C11 ALKANE PRODUCTION (FatB, FatB2, CarB, EntD,

ADM)

C8/C10/C12 ALKANOL PRODUCTION (FatB, FatB2, CarB,

EntD, YjgB)

C8/C10/C12 ALKANOL/ALKANAL PRODUCTION (FatB,

FatB2, CarB, EntD)

[00173] One or more recombinant genes encoding one or more FabH enzymes are identified and selected. Such genes and enzymes can be those described in Table 4.

relevant sequences are shown in Table 1 and certain relevant EC numbers are shown in Table 2.

Table 4

FabH

1. Long-chain acyl-ACP feedback insensitive allele of native FabH:

FabH N287D

2. Long-chain acyl-ACP feedback insensitive allele of E. coli FabH:

FabH Ec N274D

3. FabH from Nostoc punctiforme sp. PCC73102

4. FabH from Arthrospira maxima

5. FabH from Cuphea wrightii

6. FabH from Arabidopsis thaliana

7. FabH from Streptomyces glaucescens

8. FabH from E. coli (described above)

9. FabH from Synechococcus sp. PCC 7002 (described above)

[00174] The selected genes are cloned into one or more expression vectors. The genes can be under inducible control (such as the urea-repressible nir07 or nir09 promoters or the cumate-inducible cum02 promoter). Example promoter sequences are shown in Table 1. The genes may or may not be expressed operonically; and one or more of the genes can be placed under constitutive control such that when the other gene(s) are induced, the genes under constitutive control are already expressed.

[00175] One or more vectors are selected and transformed into a microorganism (e.g., cyanobacteria or a photo synthetic microbe). The cells are grown to a suitable optical density. In some instances cells are grown to a suitable optical density in an uninduced state, and then an induction signal is applied to commence production of carbon-based product of interest.

[00176] Carbon-based product(s) of interest are produced by the transformed cells. In some instances, carbon-based product(s) of interest are detected. In some instances, carbon-based product(s) of interest are quantified. In some instances, carbon-based product(s) of interest are collected.

Example 5: Enrichment of shorter chain length fatty acids in cell-associated lipids due to increased FabH activity.

[00177] Plasmid pJB4319, designed to replace the native copy of fabH on the chromosome of JCC138 with the heterologous fabH_Ec from E. coli, was naturally transformed into JCC138 and fully segregated, yielding strain JCC6778. The full description of this plasmid is described in Example 1. The relevant sequences used are shown in Table 1. The relevant EC numbers are shown in Table 2.

[00178] The above two strains were compared in a side -by- side shake flask experiment as outlined above. Briefly, 30 mL cultures were inoculated to a starting OD ₇₃₀ of 0.1. PETG flasks were utilized, the media was JB 3.0 with 15 mM urea, and the growth conditions were

-2 -1

constant light at -125 μΕ m ^" s ^" , 37C, 2% C0 ₂ headspace, and 150 rpm shaking. At each timepoint (approximately 1 per day), growth was measured by OD730 and a 500 aliquot of the culture was taken, the cells separated from the media, and frozen at -80 °C for later Bligh-Dyer cell lipid extractions. Figure 11 indicates the profile of fatty acid chain lengths present in the cell-associated lipids at the 190h timepoint. Table 5 shows the chain lengths at each timepoint. Note that JCC6778 lipids are enriched for CI 2, C14, and C16 fatty acids but depleted of C18 fatty acids, relative to the parent strain JCC138. This observation is in agreement with the shift in product(s) to those of lower chain length(s) that we demonstrate in the earlier examples.

Example 6: Increased tridecane production from long-chain alkane pathway due to increased FabH activity.

[00179] Plasmid pJB1331, designed to integrate on the extrachromosomal plasmid pAQ3, a urea-repressible construct expressing adm-aar (both enyzmes from Cyanothece sp.

ATCC51142, codon-optimized for E. coli), was naturally transformed into the

aforementioned strain JCC6778 and fully segregated. The full genotype of the plasmid pJB1331 is as follows:

|pUC_ori>|T^n] |T[bla] |UHR_pAQ3|P(nir07)>|cce0778_opt>|ccel430_opt>|T[adh II] |aadA>|DHR_pAQ3|T[rrnBl]>|<bla|

[00180] The resulting strain was JCC7037, described further below. JCC2055 is an analog of this strain, identical to JCC7037 except that it lacks the fabH modification that JCC7037 carries. The relevant sequences used are shown in Table 1. The relevant EC numbers are shown in Table 2.

[00181] Strains JCC2055 and JCC7037 were compared in shake flask studies as outlined above. Briefly, 30 mL cultures were inoculated to a starting OD730 of 0.5 in JB 3.0 media with 3 mM urea. The cultures were in PETG flasks and grown under constant light (-125 μΕ

-2 -1

m ^" s ^" ), 37C, 2% C0 ₂ in headspace, and 150 rpm shaking. 5 mL of a long chain organic overlay (hexadecane in this experiment) was included to trap secreted carbon products. Undecane (Cn) was quantified in the hexadecane phase by GC-FID, whereas tridecane (C ₁₃ ) and pentadecane (C ₁₅ ) were first extracted from the pelleted cells by acetone, and

subsequently quantified in that acetone extract by GC-FID. Figure 12 shows the portfolio of alkane products generated from the two strains at approximately 175 hours post inoculation. Where JCC2055 generates predominately C ₁₅ (98%, with the remaining 2% being C ₁₃ , and this ratio maintained at all timepoints), JCC7037 produces C ₁₃ as 25% of its total products, with low (1%)) amounts of Cn detected, and a decreased percentage of C ₁₅ (74%), also described in Table 6a. Table 6b shows each the amount of each alkane at each timpoint measured. This example further illustrates that the increased activity of FabH in JCC7037 manifests itself as a shift of products to those of lower chain lengths. Table 6a. Profile of alkane products generated from the

strains at the 175h timepoint.

JCC2055 JCC7037

mg/L % mg/L %

Cll 0.0 0% 0.5 1%

C13 1.5 2% 17 25%

C15 65.0 98% 51 74%

TOTAL 67 100% 69 100%

Example 7: Increased fatty acid biosynthetic rate by controlled overexpression of native FabH.

[00182] To test whether overexpression of the native fabH in JCC138 (A0525) could yield the same increase in total fatty acid biosynthesis, the following construct was generated:

[00183] pJB4630

[00184] This construct targets an additional copy of the native fabH gene from JCC138 (Synechococcus sp. PCC7002) to the A0206 neutral locus in JCC138 under control of the urea-repressible promoter P(nir07). a¾H_PCC7002 was PCR amplified from Synechococcus sp. PCC7002 genomic DNA and an A0206-targeting vector backbone was PCR amplified from an in house construct. The amplification oligos were designed such that they changed the rare start codon for methionine of FabH from "TTG" to "ATG". These fragments were assembled into a circular plasmid by Gibson assembly, yielding the following genotype:

|A0206_UHR|P(nir07)>|fabH_PCC7002>|T[BBa_B0015] |<gentR|A0206_DHR|T[rmBl] |bla>|pUC_ori|T[ n] |T[bla]

[00185] This plasmid (pJB4630) was introduced into JCC5426 via natural transformation and segregated with gentamycin pressure to yield JCC7389. The parent strain, JCC5426, possesses a construct on its extrachromosomal plasmid pAQ7 behind a urea-repressible promoter that expresses the Ci ₂ -specific thioesterase fatB from U. californica (N-terminally truncated and codon optimized) as well as the broad-specificity carboxylic acid reductase carB from smegmatis. Its genotype, as well as the daughter strain JCC7389, are listed in the table below. The relevant sequences used are shown in Table 1. The relevant EC numbers are shown in Table 2.

[00186] The above three strains were compared in a side-by- side shake flask study to assess their rates of growth, cell-associated lipid accumulation, and fatty alcohol/fatty aldehyde production. Cultures were inoculated to an initial OD730 of 0.5 in 30 mL cultures with JB 3.0 media and 3 mM urea. PETG flasks were utilized, and a tridecane organic overlay (5 mL) was added above each culture to trap secreted products. Flasks were incubated at 37 °C under

-2 -1

constant light (-125 μΕ m ^" s ^" ) with a 2% C0 ₂ headspace and shaken at 150 rpm. Culture growth is shown in Figure 13 below, demonstrating that JCC5426 and JCC7389 reach slightly lower terminal ODs, due to diverting carbon away from biomass and into

extracellular products. Figure 14 illustrates the rate of production of extracellular products of interest. In this configuration, these products are 1-dodecanol and dodecanal. Whereas JCC5426 generates these carbon products at a very low production rate (0.05 mg L ^"1 h ^"1 ), JCC7389 generates these products at 2.12 mg L ^"1 h ^"1 , a rate that is 40X larger than the parent JCC5426. At each timepoint, a 500 aliquot of each culture was taken and the cells were separated from the spent culture media and frozen for future Bligh-Dyer lipid extractions. Total cell-associated lipids were quantified, and those concentrations were summed with the extracellular products of interest to yield the total products of fatty acid biosynthesis. This data is plotted in figure 15. Observe that after 47h, once the production pathway and fabH overexpression cassettes are fully induced (via urea depletion), the total fatty acid

biosynthetic rate for JCC7389 is 1.5X that of the parent JCC5426 which does not have its fabH overexpressed.

Example 8: Increased alkane production by controlled overexpression of native FabH.

[00187] To test whether overexpression of the native fabH in JCC138 (A0525) could yield the same increase in total fatty acid biosynthesis, the following construct was generated:

[00188] pJB4609

[00189] This construct targets an additional copy of the native fabH gene from JCC138 (Synechococcus sp. PCC7002) to the A0206 neutral locus in JCC138 under control of an inducible promoter that responds to the herbicide ethametsulfuron methyl (trade name Muster®). fabH_FCC7002 was PCR amplified from Synechococcus sp. PCC7002 genomic DNA and an A0206-targeting vector backbone was PCR amplified from an in house construct. The amplification oligos were designed such that they changed the rare start codon for methionine of FabH from "TTG" to "ATG". These fragments were assembled into a circular plasmid by Gibson assembly, yielding the following genotype:

|A0206_UHR| |<etnR_L13-

23 |<P(kan)|P(cro_entO)>|fabH_PCC7002>|T[BBa_B0015] |<gentR|A0206_DHR|T[rrnBl] |bla>|pUC_ori|T[rpn] |T[bla] |

[00190] This plasmid (pJB4609) was introduced into JCC7561 via natural transformation and segregated with gentamycin pressure to yield JCC8051. The parent strain JCC7561 possesses a constitutively expressed copy of an alkanal decarboxylative monooxygenase on its extrachromosomal plasmid pAQ4. This host strain was previously constructed from JCC5753, which possesses a construct on its extrachromosomal plasmid pAQ3 behind a urea- repressible promoter that expresses the Ci2-specific thioesterase fatB from U. californica (N- terminally truncated and codon optimized) as well as, on the extrachromosomal plasmid pAQ7, also behind a urea-repressible promoter, the broad-specificity carboxylic acid reductase carB from M smegmatis. Its genotype, as well as the daughter strain JCC8051, are listed in the table below. The relevant sequences used are shown in Table 1. The relevant EC numbers are shown in Table 2.

[00191] JCC8051 was compared in a side -by-side shake flask study with different levels of P(etn) induction to assess its rates of growth, fatty alcohol/fatty aldehyde production, and alkane production. Cultures were inoculated to an initial OD730 of 0.5 in 30 mL cultures with JB 3.0 media and 3 mM urea. PETG flasks were utilized, and a tridecane organic overlay (5 mL) was added above each culture to trap secreted products. Flasks were incubated at 37 °C

-2 -1

under constant light (-125 μΕ m ^" s ^" ) with a 2% C0 ₂ headspace and shaken at 150 rpm. Figure 16 and Table 7 illustrate the rate of production of extracellular products of interest, both as total products (alcohol, aldehyde, and alkane) and as specifically Cn alkane. Observe that both production rates increase when fabH_7002 is overexpressed via the P(etn)-inducible promoter. Table 7. Production rates of a) total products

(alcohols, aldehydes, and alkane) and b)

specifically CI 1 alkane from JCC8051 are

indicated.

-1 -1

mg L h

TOTAL RATE Cll RATE

JCC8051 (0) 0.50 0.29

JCC8051 (5) 0.47 0.29

JCC8051 (10) 0.75 0.36

[00192] A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. All publications, patents and other references mentioned herein are hereby incorporated by reference in their entirety, for all purposes.

TABLE 1 - SEQUENCES

ATGGAGTGGAAACCAAAACCGAAACTGCCTCAGCTGCTGGATGACCACTTCGGTCTGCAC GGCC TGGTTTTCCGTCGTACCTTCGCTATCCGTTCTTACGAAGTCGGCCCTGATCGCTCCACCT CCAT CCTGGCGGTAATGAACCACATGCAGGAAGCAACTCTGAACCATGCGAAAAGCGTAGGTAT CCTG GGCGATGGTTTCGGCACTACTCTGGAGATGTCCAAACGTGATCTGATGTGGGTTGTTCGC CGTA CCCATGTCGCGGTTGAACGCTACCCGACCTGGGGCGATACGGTTGAAGTGGAATGCTGGA TAGG CGCGTCCGGCAACAACGGCATGCGTCGCGATTTCCTGGTTCGCGATTGTAAGACGGGCGA GATT CTGACCCGTTGCACGTCCCTGAGCGTTCTGATGAATACCCGTACCCGTCGTCTGAGCACC ATCC CGGACGAAGTTCGCGGTGAAATTGGCCCGGCATTCATCGATAACGTTGCAGTAAAAGACG ATGA AATCAAGAAACTGCAGAAACTGAATGACTCTACCGCGGACTACATCCAGGGTGGTCTGAC CCCG CGCTGGAACGACCTGGACGTGAACCAGCACGTCAACAACCTGAAATACGTAGCTTGGGTA TTCG AAACGGTCCCGGATTCTATCTTCGAATCTCACCACATCAGCTCCTTCACCCTGGAATACC GTCG TGAGTGTACCCGTGACTCCGTTCTGCGCTCTCTGACCACGGTATCCGGCGGTAGCTCTGA AGCC GGTCTGGTTTGCGATCACCTGCTGCAGCTGGAAGGCGGCAGCGAGGTTCTGCGTGCTCGT ACTG AGTGGCGTCCGAAGCTGACTGACTCTTTCCGCGGCATCTCTGTTATCCCGGCAGAGCCTC GTGT GTAA

>fatB2 (from Cuphea hookeriana, N-terminally truncated and codon-optimized for E. coli)

ATGGACCGTAAAAGCAAGCGTCCGGACATGCTGGTTGATTCCTTTGGTCTGGAAAGCACC GTGC AGGACGGTCTGGTTTTCCGTCAGTCTTTCTCCATTCGTAGCTATGAGATTGGTACTGATC GTAC CGCCTCTATCGAAACCCTGATGAATCACCTGCAAGAAACCTCTCTGAACCATTGTAAGTC TACT GGCATCCTGCTGGACGGTTTCGGTCGTACCCTGGAGATGTGCAAACGCGACCTGATTTGG GTAG TGATCAAAATGCAGATCAAAGTTAACCGTTATCCGGCATGGGGTGATACCGTTGAAATCA ACAC CCGCTTTTCTCGTCTGGGCAAAATCGGTATGGGCCGTGACTGGCTGATCTCTGACTGTAA CACT GGTGAAATTCTGGTTCGTGCTACTAGCGCATACGCGATGATGAACCAGAAAACCCGTCGC CTGA GCAAGCTGCCGTACGAGGTCCACCAGGAGATTGTTCCGCTGTTTGTAGACAGCCCAGTGA TTGA GGATTCTGACCTGAAAGTGCATAAATTCAAAGTGAAGACCGGTGACAGCATCCAAAAAGG CCTG ACCCCAGGTTGGAACGATCTGGACGTTAACCAGCACGTTTCCAACGTGAAGTATATCGGT TGGA TTCTGGAGAGCATGCCGACCGAGGTCCTGGAAACCCAGGAGCTGTGTTCCCTGGCGCTGG AGTA CCGCCGTGAGTGCGGCCGTGACAGCGTGCTGGAGTCTGTGACCGCTATGGACCCAAGCAA AGTT GGTGTTCGTAGCCAGTACCAGCACCTGCTGCGTCTGGAAGACGGTACTGCTATCGTGAAC GGTG CAACTGAATGGCGTCCTAAAAACGCGGGTGCAAACGGTGCTATCAGCACCGGTAAAACCT CTAA CGGTAACTCCGTGAGCTAA

>tesA (from E. coli, N-terminally truncated and codon optimized for E. coli)

ATGGCGGATACTCTGCTGATTCTGGGTGATTCTCTGTCTGCAGGCTACCGTATGTCCGCC TCCG CGGCCTGGCCAGCTCTGCTGAATGATAAGTGGCAGTCTAAGACGTCCGTTGTGAACGCAT CCAT CTCTGGCGACACGAGCCAGCAGGGCCTGGCCCGTCTGCCTGCACTGCTGAAACAGCACCA ACCG CGCTGGGTCCTGGTGGAGCTGGGCGGTAACGACGGTCTGCGCGGCTTCCAGCCGCAGCAG ACCG AACAGACTCTGCGTCAGATTCTGCAGGACGTGAAAGCTGCTAACGCGGAACCGCTGCTGA TGCA GATTCGTCTGCCAGCGAACTATGGCCGCCGTTACAACGAAGCGTTCTCTGCAATCTACCC AAAA CTGGCGAAAGAGTTTGACGTCCCGCTGCTGCCGTTCTTCATGGAGGAAGTATACCTGAAA CCGC AGTGGATGCAAGATGACGGCATCCACCCGAACCGTGATGCGCAGCCGTTCATCGCTGACT GGAT GGCGAAGCAACTGCAGCCGCTGGTAAACCACGATTCCTAA

>carB (from Mycobacterium smegmatis, codon optimized for E. coli)

atgaccagcgatgttcacgacgccacagacggcgtcaccgaaaccgcactcgacgac gagcagt cgacccgccgcatcgccgagctgtacgccaccgatcccgagttcgccgccgccgcaccgt tgcc cgccgtggtcgacgcggcgcacaaacccgggctgcggctggcagagatcctgcagaccct gttc accggctacggtgaccgcccggcgctgggataccgcgcccgtgaactggccaccgacgag ggcg ggcgcaccgtgacgcgtctgctgccgcggttcgacaccctcacctacgcccaggtgtggt cgcg cgtgcaagcggtcgccgcggccctgcgccacaacttcgcgcagccgatctaccccggcga cgcc gtcgcgacgatcggtttcgcgagtcccgattacctgacgctggatctcgtatgcgcctac ctgg gcctcgtgagtgttccgctgcagcacaacgcaccggtcagccggctcgccccgatcctgg ccga ggtcgaaccgcggatcctcaccgtgagcgccgaatacctcgacctcgcagtcgaatccgt gcgg gacgtcaactcggtgtcgcagctcgtggtgttcgaccatcaccccgaggtcgacgaccac cgcg acgcactggcccgcgcgcgtgaacaactcgccggcaagggcatcgccgtcaccaccctgg acgc gatcgccgacgagggcgccgggctgccggccgaaccgatctacaccgccgaccatgatca gcgc ctcgcgatgatcctgtacacctcgggttccaccggcgcacccaagggtgcgatgtacacc gagg cgatggtggcgcggctgtggaccatgtcgttcatcacgggtgaccccacgccggtcatca acgt caacttcatgccgctcaaccacctgggcgggcgcatccccatttccaccgccgtgcagaa cggt ggaaccagttacttcgtaccggaatccgacatgtccacgctgttcgaggatctcgcgctg gtgc gcccgaccgaactcggcctggttccgcgcgtcgccgacatgctctaccagcaccacctcg ccac cgtcgaccgcctggtcacgcagggcgccgacgaactgaccgccgagaagcaggccggtgc cgaa ctgcgtgagcaggtgctcggcggacgcgtgatcaccggattcgtcagcaccgcaccgctg gccg cggagatgagggcgttcctcgacatcaccctgggcgcacacatcgtcgacggctacgggc tcac cgagaccggcgccgtgacacgcgacggtgtgatcgtgcggccaccggtgatcgactacaa gctg atcgacgttcccgaactcggctacttcagcaccgacaagccctacccgcgtggcgaactg ctgg tcaggtcgcaaacgctgactcccgggtactacaagcgccccgaggtcaccgcgagcgtct tcga ccgggacggctactaccacaccggcgacgtcatggccgagaccgcacccgaccacctggt gtac gtggaccgtcgcaacaacgtcctcaaactcgcgcagggcgagttcgtggcggtcgccaac ctgg aggcggtgttctccggcgcggcgctggtgcgccagatcttcgtgtacggcaacagcgagc gcag tttccttctggccgtggtggtcccgacgccggaggcgctcgagcagtacgatccggccgc gctc aaggccgcgctggccgactcgctgcagcgcaccgcacgcgacgccgaactgcaatcctac gagg tgccggccgatttcatcgtcgagaccgagccgttcagcgccgccaacgggctgctgtcgg gtgt cggaaaactgctgcggcccaacctcaaagaccgctacgggcagcgcctggagcagatgta cgcc gatatcgcggccacgcaggccaaccagttgcgcgaactgcggcgcgcggccgccacacaa ccgg tgatcgacaccctcacccaggccgctgccacgatcctcggcaccgggagcgaggtggcat ccga cgcccacttcaccgacctgggcggggattccctgtcggcgctgacactttcgaacctgct gagc gatttcttcggtttcgaagttcccgtcggcaccatcgtgaacccggccaccaacctcgcc caac tcgcccagcacatcgaggcgcagcgcaccgcgggtgaccgcaggccgagtttcaccaccg tgca cggcgcggacgccaccgagatccgggcgagtgagctgaccctggacaagttcatcgacgc cgaa acgctccgggccgcaccgggtctgcccaaggtcaccaccgagccacggacggtgttgctc tcgg gcgccaacggctggctgggccggttcctcacgttgcagtggctggaacgcctggcacctg tcgg cggcaccctcatcacgatcgtgcggggccgcgacgacgccgcggcccgcgcacggctgac ccag gcctacgacaccgatcccgagttgtcccgccgcttcgccgagctggccgaccgccacctg cggg tggtcgccggtgacatcggcgacccgaatctgggcctcacacccgagatctggcaccggc tcgc cgccgaggtcgacctggtggtgcatccggcagcgctggtcaaccacgtgctcccctaccg gcag ctgttcggccccaacgtcgtgggcacggccgaggtgatcaagctggccctcaccgaacgg atca agcccgtcacgtacctgtccaccgtgtcggtggccatggggatccccgacttcgaggagg acgg cgacatccggaccgtgagcccggtgcgcccgctcgacggcggatacgccaacggctacgg caac agcaagtgggccggcgaggtgctgctgcgggaggcccacgatctgtgcgggctgcccgtg gcga cgttccgctcggacatgatcctggcgcatccgcgctaccgcggtcaggtcaacgtgccag acat gttcacgcgactcctgttgagcctcttgatcaccggcgtcgcgccgcggtcgttctacat cgga gacggtgagcgcccgcgggcgcactaccccggcctgacggtcgatttcgtggccgaggcg gtca cgacgctcggcgcgcagcagcgcgagggatacgtgtcctacgacgtgatgaacccgcacg acga cgggatctccctggatgtgttcgtggactggctgatccgggcgggccatccgatcgaccg ggtc gacgactacgacgactgggtgcgtcggttcgagaccgcgttgaccgcgcttcccgagaag cgcc gcgcacagaccgtactgccgctgctgcacgcgttccgcgctccgcaggcaccgttgcgcg gcgc acccgaacccacggaggtgttccacgccgcggtgcgcaccgcgaaggtgggcccgggaga catc ccgcacctcgacgaggcgctgatcgacaagtacatacgcgatctgcgtgagttcggtctg atcT CGAGCTCGtga

>entD (from E. coli, codon optimized)

ATGAAAACGACCCACACCAGCTTACCATTTGCCGGCCACACGTTACATTTCGTCGAATTT GATC CGGCGAACTTTTGTGAACAAGACCTGTTGTGGCTGCCGCATTATGCCCAGCTGCAGCACG CAGG CCGTAAGCGTAAAACTGAACATCTGGCCGGTCGCATTGCGGCAGTGTATGCCCTGCGCGA GTAC GGCTACAAATGCGTGCCGGCCATTGGTGAACTGCGTCAACCGGTTTGGCCGGCAGAAGTT TACG GTTCCATCTCCCACTGCGGTACTACCGCGTTGGCGGTTGTGTCTCGCCAGCCGATCGGTA TTGA TATTGAAGAGATATTCTCTGTCCAGACGGCACGCGAGCTGACGGACAACATCATTACCCC GGCA GAGCACGAGCGTCTGGCGGACTGTGGTCTGGCGTTCAGCCTGGCGCTGACCCTGGCATTC AGCG CAAAAGAGAGCGCGTTCAAGGCTTCCGAGATCCAAACCGATGCGGGCTTCCTGGATTATC AAAT CATCAGCTGGAACAAGCAACAGGTTATCATTCACCGTGAGAATGAGATGTTTGCCGTCCA TTGG CAGATTAAAGAGAAAATCGTTATCACCCTGTGCCAGCACGACTGA

>AAR (from Cyanothece sp. ATCC51142, codon optimized for E. coli)

ATGTTCGGCTTGATTGGCCACCTGACTAGCCTGGAGCACGCGCACAGCGTGGCGGATGCG TTTG GCTACGGCCCGTACGCAACCCAGGGTTTAGACCTGTGGTGTAGCGCACCGCCACAGTTTG TTGA GCACTTTCATGTCACGAGCATTACGGGCCAAACGATTGAGGGTAAATACATTGAGAGCGC GTTT TTGCCGGAGATGTTGATTAAACGTCGTATCAAAGCAGCGATCCGTAAGATTCTGAACGCG ATGG CATTTGCGCAGAAGAACAATTTGAACATTACCGCGCTGGGTGGCTTCAGCAGCATTATCT TTGA GGAGTTTAATCTGAAGGAGAATCGTCAGGTTCGCAATGTGAGCTTGGAGTTTGACCGCTT CACC ACCGGTAACACCCATACTGCTTACATTATCTGCCGTCAAGTCGAACAGGCGAGCGCGAAA CTGG GTATCGACCTGTCCCAAGCGACCGTGGCGATTTGCGGTGCCACGGGTGATATTGGCAGCG CAGT TTGTCGCTGGCTGGATCGCAAAACCGACACCCAAGAGCTGTTCCTGATTGCGCGCAATAA GGAA CGCTTGCAACGTCTGCAAGATGAACTGGGTCGCGGCAAGATCATGGGCCTGGAAGAGGCA CTGC CGGAAGCAGACATTATTGTGTGGGTTGCCTCCATGCCGAAGGGCGTGGAGATTAATGCGG AAAC CCTGAAGAAGCCGTGTCTGATCATTGACGGTGGCTACCCGAAGAATCTGGACACGAAAAT CAAG CATCCGGACGTGCACATTTTGAAGGGTGGTATTGTAGAGCATTCGTTGGACATTGATTGG AAAA TCATGGAAACCGTGAACATGGACGTTCCGAGCCGTCAAATGTTTGCGTGCTTCGCAGAGG CGAT CTTGCTGGAGTTCGAGCAATGGCACACGAACTTCTCGTGGGGTCGCAATCAAATCACGGT GACG AAGATGGAACAGATTGGTGAGGCGAGCGTGAAGCATGGTCTGCAACCGCTGCTGTCCTGG TAA

>ADM (from Cyanothece sp. ATCC51142, codon optimized for E.

coli)

ATGCAAGAACTGGCCCTGAGAAGCGAGCTGGACTTCAATAGCGAAACCTATAAAGATGCG TATA GCCGTATTAACGCCATTGTGATCGAAGGCGAGCAAGAAGCATACCAAAACTACCTGGACA TGGC GCAACTGCTGCCGGAGGACGAGGCTGAGCTGATTCGTTTGAGCAAGATGGAGAACCGTCA CAAA AAGGGTTTTCAAGCGTGCGGCAAGAACCTCAATGTGACTCCGGATATGGATTATGCACAG CAGT TCTTTGCGGAGCTGCACGGCAATTTTCAGAAGGCTAAAGCCGAGGGTAAGATTGTTACCT GCCT GCTCATCCAAAGCCTGATCATCGAGGCGTTTGCGATTGCAGCCTACAACATTTACATTCC AGTG GCTGATCCGTTTGCACGTAAAATCACCGAGGGTGTCGTCAAGGATGAGTATACCCACCTG AATT TCGGCGAAGTTTGGTTGAAGGAACATTTTGAAGCAAGCAAGGCGGAGTTGGAGGACGCCA ACAA AGAGAACTTACCGCTGGTCTGGCAGATGTTGAACCAGGTCGAAAAGGATGCCGAAGTGCT GGGT ATGGAGAAAGAGGCTCTGGTGGAGGACTTTATGATTAGCTATGGTGAGGCACTGAGCAAC ATCG GCTTTTCTACGAGAGAAATCATGAAGATGAGCGCGTACGGTCTGCGTGCAGCATAA

>AAR (from Prochlorococcus marinus, codon optimized for E. coli)

ATGTTTGGTCTGATTGGTCATAGCACCAGCTTTGAGGACGCAAAGCGCAAGGCGAGC CTGCTGG GTTTCGACCACATCGCGGATGGCGATCTGGATGTGTGGTGTACCGCACCGCCGCAACTGG TTGA AAACGTGGAAGTCAAAAGCGCGACGGGTATCAGCATTGAAGGTAGCTATATCGATAGCTG CTTC GTGCCGGAGATGCTGAGCCGCTTCAAGACCGCGCGTCGTAAAGTTCTGAATGCAATGGAG CTGG CGCAGAAAAAGGGTATCAATATCACTGCCCTGGGTGGCTTTACCTCCATTATCTTTGAGA ACTT CAACCTGTTGCAGCACAAGCAAATCCGTAATACCAGCCTGGAGTGGGAGCGTTTCACCAC GGGT AACACGCACACGGCATGGGTGATTTGTCGTCAGCTGGAGATCAACGCACCGCGCATTGGC ATCG ACCTGAAAACTGCAACGGTCGCTGTTATCGGCGCGACCGGCGATATTGGTAGCGCGGTGT GTCG CTGGCTGGTCAATAAGACCGGCATTAGCGAACTGCTGATGGTCGCTCGCCAACAACAGCC ACTG ACCCTGCTGCAAAAAGAACTGGACGGTGGCACCATCAAGAGCCTGGATGAAGCCCTGCCG CAGG CGGATATTGTCGTGTGGGTTGCTTCGATGCCTAAGACGATCGAAATTGAGATTGAAAACC TGAA AAAGCCGTGCCTGATGATCGACGGTGGCTACCCGAAGAATCTGGACGAGAAATTCAAAGG CAAA AACATTCACGTGTTGAAGGGTGGTATCGTCGAGTTTTTCAACGACATTGGCTGGAACATG ATGG AGTTGGCGGAGATGCAAAACCCGCAGCGTGAGATGTTTGCGTGCTTCGCCGAAGCTATGA TTCT GGAGTTTGAGAAATGCCATACCAACTTTAGCTGGGGCCGTAACAATATCAGCTTGGAGAA GATG GAGTTCATCGGTGCTGCATCTCTGAAGCACGGTTTCAGCGCGATCGGTCTGGATAAACAG CCGA AAGTCTTGACCGTTTGA

>ADM (from Prochlorococcus marinus, codon optimized for E. coli)

ATGCACAATGAATTGAAAATCACGGATATGCAAACGCTGGAAACCAACACCAAGACG ACCGAAG AGTCTATTGACACCAATAGCCTGAACCTGCCGGACTTTACTACCGACAGCTACAAGGATG CCTA TTCTCGCATTAACGCCATCGTTATTGAGGGCGAACAGGAAGCTCATGACAATTACATCTC CATC GCAACGCTGATCCCGAATGAGCTGGAAGAGCTGACGAAGCTGGCACGTATGGAGCTGAAA CACA AGAAAGGTTTTACTGCGTGCGGTCGTAATCTGGGTGTGGACGCAGACATGGTTTTCGCGA AAAA GTTCTTCAGCAAACTGCACGGCAATTTCCAAATCGCGCTGGAAAAAGGTAACCTGACCAC CTGC TTGCTGATCCAAGCGATTCTGATCGAAGCATTTGCGATTTCCGCGTACAATGTTTACATC CGTG TGGCCGACCCATTTGCCAAAAAGATTACCGAGGGTGTTGTCAAAGACGAGTATCTGCATC TGAA CTATGGTCAGGAGTGGCTGAAAAAGAATCTGTCCACGTGTAAAGAAGAGCTGATGGAGGC CAAC AAGGTCAATCTGCCGCTGATTAAGAAAATGCTGGACGAAGTGGCAGAAGATGCGAGCGTT TTGG CGATGGATCGTGAAGAGTTGATGGAAGAGTTCATGATTGCGTACCAGGATACCCTGTTGG AGAT TGGCCTGGATAATCGCGAAATTGCCCGTATGGCGATGGCGGCCATTGTTTAG

>yjgB (from E. coli)

atgtcgatgataaaaagctatgccgcaaaagaagcgggcggcgaactggaagtttat gagtacg atcccggtgagctgaggccacaagatgttgaagtgcaggtggattactgcgggatctgcc attc cgatctgtcgatgatcgataacgaatggggattttcacaatatccgctggttgccgggca tgag gtgattgggcgcgtggtggcactcgggagcgccgcgcaggataaaggtttgcaggtcggt cagc gtgtcgggattggctggacggcgcgtagctgtggtcactgcgacgcctgtattagcggta atca gatcaactgcgagcaaggtgcggtgccgacgattatgaatcgcggtggctttgccgagaa gttg cgtgcggactggcaatgggtgattccactgccagaaaatattgatatcgagtccgccggg ccgc tgttgtgcggcggtatcacggtctttaaaccactgttgatgcaccatatcactgctacca gccg cgttggggtaattggtattggcgggctggggcatatcgctataaaacttctgcacgcaat ggga tgcgaggtgacagcctttagttctaatccggcgaaagagcaggaagtgctggcgatgggt gccg ataaagtggtgaatagccgcgatccgcaggcactgaaagcactggcggggcagtttgatc tcat tatcaacaccgtcaacgtcagcctcgactggcagccctattttgaggcgctgacctatgg cggt aatttccatacggtcggtgcggttctcacgccgctgtctgttccggcctttacgttaatt gcgg gcgatcgcagcgtctctggttctgctaccggcacgccttatgagctgcgtaagctgatgc gttt tgccgcccgcagcaaggttgcgccgaccaccgaactgttcccgatgtcgaaaattaacga cgcc atccagcatgtgcgcgacggtaaggcgcgttaccgcgtggtgttgaaagccgatttttaa

>fadD (from E. coli, codon optimized)

ATGAAGAAAGTTTGGCTGAACCGTTATCCGGCAGATGTACCGACTGAAATTAACCCAGAT CGTT ACCAGTCCCTGGTTGACATGTTCGAACAGTCCGTGGCTCGCTACGCCGATCAGCCTGCTT TCGT CAACATGGGTGAGGTAATGACCTTTCGCAAACTGGAGGAGCGTTCCCGTGCTTTCGCGGC ATAC CTGCAGCAGGGTCTGGGCCTGAAGAAAGGCGACCGCGTGGCCCTGATGATGCCGAACCTG CTGC AATATCCTGTGGCGCTGTTCGGTATCCTGCGTGCTGGTATGATCGTTGTCAATGTTAACC CTCT GTATACCCCTCGTGAACTGGAGCACCAGCTGAATGACTCTGGTGCGTCTGCTATCGTTAT CGTT TCCAATTTCGCACATACGCTGGAGAAAGTGGTTGATAAAACCGCAGTGCAGCATGTCATT CTGA CTCGCATGGGTGACCAGCTGTCCACCGCTAAAGGTACTGTAGTCAACTTCGTTGTGAAAT ACAT TAAGCGCCTGGTTCCGAAATACCACCTGCCAGATGCAATTAGCTTTCGCTCTGCACTGCA TAAC GGTTACCGTATGCAGTACGTAAAACCAGAGCTGGTGCCGGAAGACCTGGCCTTTCTGCAG TATA CCGGCGGCACCACCGGCGTGGCAAAGGGCGCGATGCTGACCCATCGTAACATGCTGGCGA ACCT GGAGCAGGTTAACGCAACGTACGGCCCGCTGCTGCACCCGGGTAAAGAACTGGTAGTTAC GGCA CTGCCTCTGTATCACATCTTTGCACTGACGATCAACTGTCTGCTGTTCATTGAACTGGGT GGTC AGAACCTGCTGATCACCAACCCGCGTGACATTCCGGGCCTGGTAAAAGAGCTGGCTAAGT ACCC GTTCACCGCCATTACTGGCGTAAACACTCTGTTTAACGCGCTGCTGAACAACAAAGAGTT TCAG CAGCTGGACTTCTCTAGCCTGCACCTGAGCGCTGGCGGTGGCATGCCGGTTCAGCAGGTT GTGG CAGAGCGTTGGGTGAAACTGACCGGCCAGTATCTGCTGGAGGGTTATGGTCTGACCGAGT GTGC ACCGCTGGTCAGCGTTAACCCGTATGATATTGATTACCACTCTGGTTCTATTGGTCTGCC GGTT CCGTCCACGGAAGCCAAACTGGTGGACGATGACGACAACGAAGTACCTCCGGGCCAGCCG GGTG AGCTGTGTGTCAAGGGTCCGCAGGTTATGCTGGGCTACTGGCAGCGCCCGGACGCCACCG ACGA AATCATTAAAAACGGTTGGCTGCATACCGGTGATATCGCTGTAATGGACGAAGAAGGTTT CCTG CGTATCGTGGACCGTAAGAAAGATATGATTCTGGTGAGCGGTTTCAACGTGTACCCGAAC GAAA TTGAGGACGTAGTTATGCAACACCCTGGCGTGCAGGAGGTGGCAGCCGTGGGCGTGCCGT CCGG TTCTTCTGGTGAGGCTGTGAAAATCTTTGTCGTTAAAAAGGACCCGTCCCTGACCGAAGA ATCT CTGGTGACGTTTTGCCGCCGTCAACTGACTGGCTACAAAGTGCCGAAACTGGTCGAGTTC CGCG ATGAGCTGCCAAAATCTAACGTGGGTAAGATCCTGCGCCGCGAGCTGCGTGACGAGGCAC GTGG CAAAGTTGACAATAAAGCATAA

>wxs (from Acinetobacter sp. ADP1, codon optimized for E. coli)

ATGCGCCCACTTCATCCGATCGATTTCATTTTCCTGTCCCTGGAGAAACGCCAGCAG CCGATGC ACGTAGGTGGTCTGTTCCTGTTCCAGATCCCGGATAACGCTCCGGACACCTTTATTCAGG ACCT GGTGAACGATATCCGTATCTCCAAGTCTATTCCGGTTCCGCCGTTCAACAACAAGCTGAA CGGT CTGTTCTGGGACGAAGACGAGGAGTTCGATCTGGATCACCATTTCCGTCATATTGCGCTG CCGC ACCCGGGTCGCATCCGTGAGCTGCTGATTTACATCTCTCAGGAACACAGCACTCTCCTCG ATCG CGCTAAACCTCTGTGGACTTGCAACATCATTGAAGGTATCGAGGGTAACCGTTTCGCCAT GTAC TTCAAGATTCATCATGCGATGGTGGATGGTGTGGCGGGTATGCGTCTGATTGAGAAAAGC CTGT CCCATGATGTTACTGAAAAGAGCATCGTACCGCCGTGGTGCGTTGAGGGCAAACGTGCTA AACG CCTGCGTGAACCGAAGACCGGCAAAATTAAGAAAATCATGTCTGGTATTAAATCTCAGCT CCAG GCCACCCCGACCGTTATTCAAGAACTGTCTCAGACGGTCTTCAAAGACATCGGCCGTAAT CCGG ACCACGTTTCCTCTTTCCAGGCGCCGTGCTCCATCCTCAACCAGCGTGTGTCTTCTTCTC GTCG TTTCGCAGCACAGAGCTTTGACCTGGACCGTTTCCGCAACATCGCCAAATCTCTGAACGT GACC ATTAACGACGTTGTCCTGGCTGTGTGTAGCGGTGCTCTGCGCGCTTATCTGATGTCTCAT AACT CTCTGCCATCCAAACCGCTGATCGCTATGGTCCCAGCAAGCATCCGCAACGATGATTCTG ATGT GTCCAACCGTATTACTATGATTCTGGCCAACCTCGCTACTCACAAAGACGACCCTCTGCA GCGT CTGGAAATCATCCGCCGCTCCGTCCAGAACTCTAAACAGCGTTTTAAACGCATGACTTCC GACC AGATTCTGAACTATTCTGCGGTTGTATACGGCCCGGCTGGTCTGAACATTATCAGCGGTA TGAT GCCGAAACGTCAGGCTTTTAACCTGGTAATCAGCAACGTTCCTGGCCCGCGTGAGCCGCT GTAC TGGAACGGCGCAAAACTGGACGCACTGTACCCGGCTTCCATCGTTCTGGATGGCCAGGCT CTGA ACATCACTATGACCTCTTACCTGGACAAACTGGAAGTAGGTCTGATCGCGTGTCGCAATG CACT GCCGCGCATGCAGAACCTGCTGACCCACCTGGAGGAGGAAATCCAGCTGTTTGAGGGCGT TATC GCCAAACAGGAAGATATCAAAACGGCGAACTAA

PROMOTERS: The ATG start codon for the gene controlled by the gctactgttattaaagcgttggctacaaaagagcctgacgaggcgattcagtcacctcaa cccc gaccagtataacggcgcctgtctgttaggattgcgcggcacggtgataaaaagtcatggt gcag ccaatcagcgagcttttgcggtcgcgattgaacaggcagtgcaggcggtgcagcgacaag ttcc tcagcgaattgccgctcgcctggaatctgtatacccagctggttttgagctgctggacgg tggc aaaagcggaactctgcggtagcaggacgctgccagcgaactcgcagtttgcaagtgacgg tata taaccgaaaagtgactgagcgtacatg

>P (aphll)

ACTAGTTTTTAATTAAGGGGGAAAGCCACGTTGTGTCTCAAAATCTCTGATGTTACATTG CACA AGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAG GGGT CATatg

>P (tsr2142)

GCGGCCGCccaaggtggctacttcaacgatagcttaaacttcgctgctccagcgagggga tttc actggtttgaatgcttcaatgcttgccaaaagagtgctactggaacttacaagagtgacc ctgc gtcaggggagctagcactcaaaaaagactcctcctgtacatatg

>P (psaA)

GCGGCCGCGCCCCTATATTATGCATTTATACCCCCACAATCATGTCAAGAATTCAAGCAT CTTA AATAATGTTAATTATCGGCAAAGTCTGTGCTCCCCTTCTATAATGCTGAATTGAGCATTC GCCT CCTGAACGGTCTTTATTCTTCCATTGTGGGTCTTTAGATTCACGATTCTTCACAATCATT GATC TAAAGATCTTTCTAGATTCTCGAGGCATatg

>P(etn) promoter (used to control expression of fabH 1002 in JCC7561 and derivatives)

TTAAGACCCACTTTCACATTTAAGTTGTTTTTCTAATCCGCATATGATCAATTCAAGGCC GAAT AAGAAGGCTGGCTCTGCACCTTGGTGATCTTTTAATTCATAAGCTTGTCGCACTAATGGC GGCA TACTATCAGTAGTAGGTGTTTCCCTTTCTTCTTTAGCGACTTGCAGCTCTTGATCGAGCA ATAC GCAACCTAAAGTGTAAATCCCCACAGCTTGAAATGCATATAATGCATTCTCTAGTGAAAA ACCT TGTTGGGTTAAAAAGGCTAAACAATTTTCGGCAGTTTCATACTGTTGTTCTGTAAAACCT GTAC CTAAGGCTACTTTTGCTCCATCGCGATGACTTAGTAAAGCATTTCTCATACTTTTAGCTT TATT ACGTAAAAAATCTTGCCAGCTTTCCCCTTCTAAAGGGCAATAGTGAGTGGCGTGCCTATC AAAC ATCTCAATGGCCATGGCGTCGAGCAAAGCCCGCTTATTTTTTACATGCCAATACAATGTA GGCT GCTCTACACCTAGCTTCTGGGCGAGTTTACGGGTTGTTAAACCTTCGATTCCGACCTCAT TAAG CAGCTCTAATGCGCTGTTAATCACTTTACTTTTATCTAATCTACTACCCATCTTGCGAAA CGAT CCTCATCCTGTCTCTTGATCAGATCTTGATCCCCTGCGCCATCAGATCCTTGGCGGCAAG AAAG CCATCCAGTTTACTTTGCAGGGCTTCCCAACCTTACCAGAGGGCGCCCCAGCTGGCAATT CCGG GCCGCAAAAAACCCCGCTTCGGCGGGGTTTTTTCGCATTAACACCGTGCGTGTTGACTAT TTTA CCTCTGGCGGTGATAATGGTTGCATCCCTATCAGTGATAGAGACTTTTTACGCTTGAAGG AGGA AAATTATatg

> adm003 (ADM from Cyanothece sp. ATCC51142 with N-terminal his tag)

ATGCACCATCACCACCATCATGGAGGCGGACAAGAACTGGCCCTGAGAAGCGAGCTGGAC TTCA ATAGCGAAACCTATAAAGATGCGTATAGCCGTATTAACGCCATTGTGATCGAAGGCGAGC AAGA AGCATACCAAAACTACCTGGACATGGCGCAACTGCTGCCGGAGGACGAGGCTGAGCTGAT TCGT TTGAGCAAGATGGAGAACCGTCACAAAAAGGGTTTTCAAGCGTGCGGCAAGAACCTCAAT GTGA CTCCGGATATGGATTATGCACAGCAGTTCTTTGCGGAGCTGCACGGCAATTTTCAGAAGG CTAA AGCCGAGGGTAAGATTGTTACCTGCCTGCTCATCCAAAGCCTGATCATCGAGGCGTTTGC GATT GCAGCCTACAACATTTACATTCCAGTGGCTGATCCGTTTGCACGTAAAATCACCGAGGGT GTCG TCAAGGATGAGTATACCCACCTGAATTTCGGCGAAGTTTGGTTGAAGGAACATTTTGAAG CAAG CAAGGCGGAGTTGGAGGACGCCAACAAAGAGAACTTACCGCTGGTCTGGCAGATGTTGAA CCAG GTCGAAAAGGATGCCGAAGTGCTGGGTATGGAGAAAGAGGCTCTGGTGGAGGACTTTATG ATTA GCTATGGTGAGGCACTGAGCAACATCGGCTTTTCTACGAGAGAAATCATGAAGATGAGCG CGTA CGGTCTGCGTGCAGCATAA

Table 2 - EC NUMBERS

FabH: beta-ketoacyl-[acyl-carrier-protein] synthase III, EC: 2.3.1.180

FatB & FatB2: oleoyl-[acyl-carrier-protein] hydrolase, EC: 3.1.2.14

TesA: palmitoyl-CoA hydrolase, EC: 3.1.2.2

CarB: carboxylate reductase, EC: 1.2.99.6

EntD: 4'-phosphopantetheinyl transferase (holo-ACP synthase), EC: 2.7.8.7

AAR: long-chain acyl-[acyl-carrier-protein] reductase, EC: 1.2.1.80

ADM: aldehyde oxygenase (deformylating), EC: 4.1.99.5

YjgB: aldehyde reductase, EC: 1.1.1.2

FadD: Long-chain-fatty-acid— CoA ligase, EC: 6.2.1.3

Wxs: long-chain-alcohol O-fatty-acyltransferase, EC: 2.3.1.75