FIELD OF THE INVENTION

The present invention relates to methods of producing a novel class of antimicrobial compounds and in particular to the enzymatic activities involved in the synthesis of these compounds.

BACKGROUND OF THE INVENTION

The evolution and spread of antibiotic resistance among bacteria is a major public health problem today, especially in the hospital setting with the emergence of multidrug resistant strains. Intensive research efforts have led to the development of new antibiotics effective against these resistant strains. Nevertheless, through use, mechanisms of resistance to these drugs emerge and limit their efficacy.

Infections caused by multidrug-resistant Gram-positive bacteria represent a major public health burden, not just in terms of morbidity and mortality, but also in terms of increased expenditure on patient management and implementation of infection control measures. In particular, Staphylococcus aureus is one of the most commonly identified pathogens in human medicine and is a major cause of nosocomial infections and community-acquired infections. Methicillin-resistant Staphylococcus aureus (MRSA) was reported for the first time in 1961 and is now widespread in hospitals all over the world. The increasing burden of Gram-positive infections is not limited to micro- organisms within the genus Staphylococcus, but also involves for example Enterococcus spp., in particular with the emergence of vancomycin-resistant enterococci (VRE) strains or Streptococcus spp. with reduced susceptibility to penicillins and macrolides. Due to this "bacterial-resistant crisis", discovery of novel lead structures and work towards potent antibiotics is more urgent than ever.

As described in International patent applications WO2017/001678 and

WO2017/001677, a novel class of antimicrobial compounds was identified from a culture of Microbacterium arborescens. The compounds produced by said bacterium are named microvionins (Figure 1). These compounds belong to the class of lanthipep tides, i.e., ribosomally synthesized and post-translationally modified peptides. A major feature of these compounds is their peptide backbone which contains two macrocycles obtained through the formation of a decarboxylated labionin moiety (termed avionin, Figure 2) through a cysteine residue and two serine residues.

Even though AviCys-lanthionin moieties are known as post-translational modifications in lanthipeptides, no avionin formation was previously reported. Therefore, a new mechanism of biosynthesis involving a new class of enzymes has to be elucidated to pave the way for industrial production of these compounds and derivatives thereof, in particular using recombinant host cells. SUMMARY OF THE INVENTION

In one aspect, the present invention relates to a method of producing a bicyclic compound of formula (I)

wherein Xi, X ₂ , X ₃ , X ₄ and Xs are independently selected and each represents an amino acid, and B is a peptide chain of a size comprised between 1 and 30 amino acid residues, preferably between 15 and 30 amino acid residues,

said method comprising

a ) providing a linear peptide comprising, or consisting of, the sequence B-Xi-Ser- X ₂ -X ₃ -Ser-X ₄ -X ₅ -Cys (SEQ ID NO: 1),

b) contacting said linear peptide with

(i) an enzyme (A) exhibiting a cysteine decarboxylase activity and comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 2 to 10, functional variants thereof and related enzymes exhibiting a cysteine decarboxylase activity, and (ii) an enzyme (B) exhibiting a Ser/Thr kinase cyclase activity and comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 11 to 19, functional variants thereof and related enzymes exhibiting a Ser/Thr kinase cyclase activity, and

c) optionally recovering the bicyclic compound of formula (I).

Steps a) and b) may be carried out in a microbial host cell, preferably in a microbial host cell of the invention, or step b) may be carried out by contacting in vitro the linear peptide with enzyme A and enzyme B. A further object of the invention relates to a microbial host cell comprising

- a heterologous nucleic acid sequence encoding an enzyme (A) exhibiting a cysteine decarboxylase activity and selected from the group consisting of SEQ ID NO: 2 to 10, functional variants thereof and related enzymes exhibiting a cysteine decarboxylase activity, and/or

- a heterologous nucleic acid sequence encoding an enzyme (B) exhibiting a Ser/Thr kinase cyclase activity and selected from the group consisting of SEQ ID NO: 11 to 19, functional variants thereof and related enzymes exhibiting the same enzymatic activity; and/or

- a heterologous nucleic acid sequence encoding a linear peptide comprising, or consisting of, a sequence B-Xi-Ser-X ₂ -X3-Ser-X ₄ -X5-Cys (SEQ ID NO: 1), wherein Xi, X ₂ , X3, X ₄ and X5 are independently selected and each represents an amino acid, and B is a peptide chain of a size comprised between 1 and 30 amino acid residues, preferably between 15 and 30 amino acid residues.

Enzymes related to enzyme A may be enzymes exhibiting a cysteine decarboxylase activity, having at least 30% amino acid sequence identity to any of SEQ ID NO: 2 to 10, and comprising at least one amino acid sequence selected from the group consisting of:

(i) [L/M]-[T/S]-(X) ₂ -A-(X) ₂ -F-V-[S/A]- (X) ₂ -[S/A]-[L/I/V]-X-[S/A]-[L/I]- [S/A/T]- (X) ₃ -V-(X) ₂ -[N/D]-X-W (SEQ ID NO: 51),

(ii) H- [T/V] -(X) ₄ -[D/G/S] -X-D-X-[L/I/V] - [L/I/V] - [ V/I] -X-P- A-[S/T] - [ V/L] (SEQ ID NO: 52) or H-[T/V]- (X) ₃ -[D/G/S]-X-D-X-[L/I/V]-[L/I/V]-[V/I]-X-P-A-[S/T]-

[V/L] (SEQ ID NO: 53),

(iii) [L/I/V]-[A/C/S]-P-[T/S/N]-[F/L]-P-P-(X) ₄ -[N/H]-P (SEQ ID NO: 54), (iv) a sequence comprising at least 10 consecutive amino acids of any of sequences (i) to (iii), and

(v) a sequence having at least 95% sequence identity to any of sequences (i) to

(iii),

X representing an amino acid independently selected at each occurrence.

Preferably, enzyme A comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 2 to 10, and functional variants thereof exhibiting a cysteine decarboxylase activity.

More preferably, enzyme A comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 2, 4 and 5, preferably SEQ ID NO: 2, and functional variants thereof exhibiting a cysteine decarboxylase activity and having at least 70%, preferably at least 80% and more preferably at least 90%, sequence identity, to SEQ ID NO: 2, 4 or 5, preferably SEQ ID NO: 2.

Even more preferably, enzyme A comprises, or consists of, SEQ ID NO: 2, 4 or 5, preferably SEQ ID NO: 2.

Enzymes related to enzyme B may be enzymes exhibiting a Ser/Thr kinase cyclase activity, having at least 30% amino acid sequence identity to any of SEQ ID NO: 11 to 19, and comprising at least one amino acid sequence selected from the group consisting of:

(i) K-X-A-X-R-(X) ₂ -[S/A]-G-K (SEQ ID NO: 66)

(ii) [V/I]-H-X-R-[Y/F]-G (SEQ ID NO: 67)

(iii) G-G-X-Y-X-A (SEQ ID NO: 68), preferably G-G-[V/T]-Y-X-A (SEQ ID NO: 69)

(iv) [V/I]-[V/I]-[L/I]-K-[E/R]-[A/G] (SEQ ID NO: 70)

(v) G-X-T-L-X-E-W-X-A (SEQ ID NO: 71)

(vi) a sequence comprising at least 5 consecutive amino acids of any of sequences (i) to (v), and

(vii) a sequence having at least 98%, preferably at least 99%, sequence identity to any of sequences (i) to (v),

X representing an amino acid independently selected at each occurrence.

Preferably, enzyme B comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 11 to 19 and functional variants thereof exhibiting a Ser/Thr kinase cyclase activity. More preferably, enzyme B comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 11, 13 and 14, preferably SEQ ID NO: 11, and functional variants thereof exhibiting a Ser/Thr kinase cyclase activity and having at least 70%, preferably at least 80% and more preferably at least 90%, sequence identity, to SEQ 5 ID NO: 11, 13 or 14, preferably SEQ ID NO: 11.

Even more preferably, enzyme B comprises, or consists of, SEQ ID NO: 11, 13 or 14, preferably SEQ ID NO: 11.

B may be a peptide chain comprising, or consisting of, the sequence Leu-(X)io- Glu (SEQ ID NO: 40), preferably the sequence (X) _n -Leu-(X)io-Glu-(X) ₂ (SEQ ID NO: 10 41), wherein X represents an amino acid independently selected at each occurrence, and n represents an integer selected from 4 to 10, preferably from 5 to 9.

Preferably, B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 30 to 39, and variants thereof having at least 50% identity to any sequence of SEQ ID NO: 30 to 39.

15 More preferably, B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 30, 32, 33 and 39, preferably SEQ ID NO: 30 and 39, and variants thereof, said variants having at least 50%, preferably at least 70%, 80%, or 90%, identity to SEQ ID NO: 30, 32, 33 or 39, preferably SEQ ID NO: 30 or 39, and comprising, or consisting of, SEQ ID NO: 40 or 41, wherein n represents an 0 integer selected from 4 to 10, preferably from 5 to 9.

Even more preferably, B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 30, 32, 33 and 39, preferably SEQ ID NO: 30 and 39.

In Formula I,

25 Xi may be an amino acid selected from the group consisting of A and G, preferably is A, and/or

X2 may be an amino acid selected from the group consisting of L, V, I, G, A, R, T and S preferably from the group consisting of L, V, I, G, A and T, and/or

X3 may be an amino acid selected from the group consisting of G, A, S and T, 30 preferably from the group consisting of G, A and S, and/or

X ₄ may be an amino acid selected from the group consisting of Q, N, I, S, E, D, W, H, P, T, preferably from the group consisting of Q, N, S, E and D and/or X5 may be an amino acid selected from the group consisting of G, A, S and T, preferably from the group consisting of G, S and T.

Preferably, in Formula I, Xi is A, X2 is T, X3 is A, X ₄ is D and X5 is G, or Xi is A, X2 is A, X3 is S, X ₄ is E and X5 is T, or Xi is A, X2 is T, X3 is S, X ₄ is D and X5 is G, or Xi is A, X2 is G, X3 is S, X ₄ is E and X5 is G, or Xi is A, X2 is L, X3 is G, X ₄ is Q and X5 is S, or Xi is A, X2 is V, X3 is S, X ₄ is S and X5 is G, or Xi is A, X2 is I, X3 is S, X ₄ is N and X ₅ is G.

The method of the invention may further comprise cleaving B.

Preferably, the microbial host is a bacterium, more preferably selected from Microbacterium, Nocardia, Tsukamurella, Streptomyces, Nocardiopsis and Nonomuraea genera and Escherichia coli.

The invention also provides a method for producing a lipolanthipeptide, preferably an antimicrobial lipolanthipeptide, comprising:

producing a bicyclic compound of formula (I) as defined above, and

replacing B with a lipophilic moiety.

Optionally, the bicyclic compound of formula (I) may be recovered (e.g. from the supernatant) before replacing B with a lipophilic moiety.

A further object of the invention relates to a bicyclic peptide obtainable by a method of the invention.

Another object of the invention relates to an antimicrobial compound obtainable by a method of the invention.

Another object of the invention resides in the use of a bicyclic peptide of the invention to produce an antimicrobial compound.

Another object of the invention resides in the use of a microbial host cell of the invention to produce an antimicrobial compound.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1: Schematic structure of microvionin with avionin motif.

Figure 2: Chemical structures of characteristic amino acids lanthionine, labionin and avionin moieties.

Figure 3: Biosynthesis gene cluster and precursor peptide transcribed from structural gene (micA) in Microbacterium arborescens. Figure 4: Purified Microbacterium arborescens MicKC-His6 used in in vitro assays.

Figure 5: Purified Microbacterium arborescens MicD-His6 used in in vitro assays.

5 Figure 6: HR-ESI-MS measurement of iodoacetamide (IAA) treated in vitro reactions. Successful reaction with thiol side chain of cysteine results in a mass shift of +57 Da. Spectra prior to derivatization in black. Iodoacetamide treated samples, unmodified MicA and enzymatic reaction products are indicated with arrows, a) Negative control containing MicA without any additional enzymes, b) MicA reaction with MicKC 10 and ATP. c) MicA reaction with MicKC, MicD and ATP.

Figure 7: Alignment of precursor peptides from lipolanthipeptide producers. Figure 8: Identity matrix displaying the relationship of different cysteine decarboxylases to each other in %. First four (MrsD, MutD, GdmD, EpiD) from previously reported enzymes responsible in AviCys-lanthionin formation. Other enzymes 15 from type I and type II lipolanthine biosynthesis gene clusters.

Figure 9: Cladogram representing the relationship of MicD to different homo- oligomeric flavin containing cysteine decarboxylases (HFCD's).

Figure 10: Identity matrix displaying the relationship of different lanthipeptide and lipolanthipeptide Ser/Thr kinase-cyclases to each other in %. Further five enzymes 20 from previously published studies are included for comparison.

Figure 11: Cladogram representing the relationship of MicKC to different Ser/Thr kinase-cyclases.

Figure 12: Determination of the NTP preference of the Ser/Thr kinase-cyclase MicKC. HR-ESI-MS spectra of in vitro reactions using MicKC and MicA: a) without any

25 NTP or in the presence of b) ATP c) CTP d) GTP e) UTP.

Figure 13: MS/MS spectra of in vitro reactions depicted in Figure 14. a) Reaction of MicA with MicKC and ATP, single dehydration (-18 Da), Parent ion: 1356.10 m/z (z=2). b) Reaction of MicA with MicKC, MicD and ATP, double dehydration and oxidative decarboxylation resulting in avionin formation (-36 Da, -46 Da), parent Ion:

30 1324.09 m/z (z=2). c) Reaction of MicA with MicD, oxidative cysteine decarboxylation (-46 Da), parent ion: 1342.10 m/z (z=2), limited intensity of parent ion due to non- enzymatic conversion (see Figure 14). Figure 14: HR-ESI-MS spectra of the in vitro assays investigating the installation of the avionin moiety in MicA through the kinase-cyclase MicKC and cysteine decarboxylase MicD. Installed modifications shown to the right correspond to the peaks labelled with an asterisk. Tandem MS spectra of these reactions can be found SI (figure 6). a) Negative control, containing MicA and buffer instead of the enzymes, b) Reaction of MicA with MicKC & ATP. c) Reaction of MicA with MicKC, MicD & ATP. d) Reaction of MicA with MicD.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to compositions, methods and recombinant cells for producing antimicrobial compounds comprising an avionin moiety as well as intermediate molecules thereof. More specifically, the invention provides compositions, methods and recombinant cells for producing antimicrobial compounds comprising a core polycyclic peptide and a fatty acid moiety. As illustrated in International patent applications WO2017/001678 and WO2017/001677, as well as in unpublished European patent application n°17 305005.5, such compounds exhibit potent antimicrobial activity, particularly against Gram positive bacteria, including vancomycin-resistant Enterococcus strains or methicillin-resistant Staphylococcus strains, as well as against mycobacteria and pathogenic fungi such as Candida strains.

In order to provide optimal product methods for such compounds, as well as to produce intermediates and derivatives thereof, the inventors have analyzed the biosynthesis gene pathway of different microorganisms. Such analysis has led to the identification, isolation and characterization of novel genes and enzymes which allow effective synthesis of these compounds and intermediates thereof, in vivo or in vitro.

More particularly, the whole genome of Microbacterium arborescens was sequenced and analyzed, and these investigations have allowed the inventors to identify an ORF encoding a precursor peptide (termed micA) of the antimicrobial compounds. This precursor peptide is composed of an 8 amino acid core peptide and a 19 amino acid leader peptide (Figure 3). Further analyses have allowed identification of an ABC transporter and twelve further genes, downstream of mica, forming an unusual mic- biosynthesis gene cluster. The cluster includes two genes, namely micD and micKC which, as shown in the experimental section, were found by the inventors to be responsible for cyclization of the core peptide into the avionin structure. Ten additional genes in this cluster encode enzymes involved in the synthesis and transfer of the fatty acid moiety.

Furthermore, extensive genome mining was conducted by the inventors, leading to the discovery of nine actinobacteria comprising homologs to MicA, MicD and MicKC in their genomes, namely Tsukamurella sp. 1543, Streptomyces aureus, Streptomyces flavochromogenes, Streptomyces natalensis, Streptomyces chromogenes, Nocardiopsis chromatogenes, Nonomuraea Candida, Nocardia terpenica and Nocardia altamirensis .

By conducting additional experiments, the inventors have further demonstrated that MicD and MicKC interact together to effectively cyclize MicA, leading to the production of a bicyclic peptide which is a precursor (or intermediate) of lipolanthipeptides. Such enzymes and genes can thus be used to produce, in vitro or in vivo (e.g., in recombinant cells), the precursor peptide, the cyclized core peptide, as well as various antimicrobial compounds based on such structures. Definitions

As used herein, the terms "peptide", "oligopeptide", "polypeptide" and "protein" refer to a chain of amino acids linked by peptide bonds, regardless of the number of amino acids forming said chain. Generally, a peptide contains less than 30 amino acids in length, while such limit is not absolute.

As used herein, the term "amino acid" or "amino acid residue" refers to any of the naturally occurring amino acids, including rare amino acids, as well as non-natural amino acid analogues. In preferred embodiments, the term "amino acid" refers to any of the 20 naturally occurring amino acids, preferably alpha amino acids, which may be represented by their one-letter or three-letter code according to the following nomenclature: A: alanine (Ala); C: cysteine (Cys); D: aspartic acid (Asp); E: glutamic acid (Glu); F: phenylalanine (Phe); G: glycine (Gly); H: histidine (His); I: isoleucine (He); K: lysine (Lys); L: leucine (Leu); M: methionine (Met); N: asparagine (Asn); P: proline (Pro); Q: glutamine (Gin); R: arginine (Arg); S: serine (Ser); T: threonine (Thr); V: valine (Val); W: tryptophan (Trp ) and Y: tyrosine (Tyr). As used herein, the term "X" represents any amino acid as defined herein and each occurrence is independently selected. For example, the term "(XV refers to sequence X-X-X wherein each occurrence is independently selected. On the other side, the term "X _n ", such as '¾", refers to an amino acid as defined herein.

In some embodiments, the side chains of these amino acid residues may be chemically modified, for example by glycosylation, amidation, acylation, acetylation or 5 methylation. In preferred embodiments, the side chains of these amino acid residues are not chemically modified

The amino acids may be in the L or D configuration, or a combination of both. In preferred embodiments, amino acids are in the L configuration.

The amino acid residues may be linked to the adjacent components through

10 "classical" CONH peptide bonds or through pseudo-peptide bonds. In particular, in some embodiments, one or several CONH peptide bonds may be replaced by pseudo-peptide bonds. In preferred embodiments, amino acid residues are linked to the adjacent components through "classical" CONH peptide bonds.

As used herein, the term "sequence identity" or "identity" refers to the number

15 (%) of matches (identical amino acid residues) in positions from an alignment of two polypeptide sequences. The sequence identity is determined by comparing the sequences when aligned so as to maximize overlap and identity while minimizing sequence gaps. In particular, sequence identity may be determined using any of a number of mathematical global or local alignment algorithms, depending on the length of the two sequences.

20 Sequences of similar lengths are preferably aligned using a global alignment algorithms (e.g. Needleman and Wunsch algorithm; Needleman and Wunsch, 1970) which aligns the sequences optimally over the entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g. Smith and Waterman algorithm (Smith and Waterman, 1981) or Altschul algorithm (Altschul et al.,

25 1997; Altschul et al., 2005)). Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software available on internet web sites such as http://blast.ncbi.nlm.nih.gov/ or http://www.ebi.ac.uk/Tools/emboss/). Those skilled in the art can determine appropriate parameters for measuring alignment, including any

30 algorithms needed to achieve maximal alignment over the full length of the sequences being compared. Preferably, for purposes herein, % amino acid sequence identity values refers to values generated using the pair wise sequence alignment program EMBOSS Needle that creates an optimal global alignment of two sequences using the Needleman- Wunsch algorithm, wherein all search parameters are set to default values, i.e. Scoring matrix = BLOSUM62, Gap open = 10, Gap extend = 0.5, End gap penalty = false, End gap open = 10 and End gap extend = 0.5. In some embodiments, all percentages of sequence identity specified herein can be set to at least 80%, 85%, 90% or 95% identity.

As used herein, the term "amino acid modification" or "amino acid change" refers to a change in the amino acid sequence of a polypeptide and includes amino acid substitution, insertion, and/or deletion in a polypeptide sequence. By "amino acid substitution" or "substitution" is meant the replacement of an amino acid at a particular position in a reference polypeptide sequence with another amino acid. By "amino acid insertion" or "insertion" is meant the addition of an amino acid at a particular position in a reference polypeptide sequence. By "amino acid deletion" or "deletion" is meant the removal of an amino acid at a particular position in a reference polypeptide sequence.

As used herein, the term "variant" refers to a polypeptide sequence that differs from a parent or reference polypeptide sequence by virtue of at least one amino acid modification. The variant may have at least 50%, 60%, 70%, 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to the reference polypeptide. Preferably the variant has at least 80%, more preferably at least 90%, sequence identity to the reference polypeptide. In some embodiments, all percentages of sequence identity specified for variants can be set to at least 80%, 85%, 90% or 95% identity. Typically, a variant comprises from 1 to 50 amino acid modifications, preferably from 1 to 40, 1 to 30, 1 to 25, 1 to 20, 1 to 15, 1 to 10, or 1 to 5 amino acid modifications as compared to the reference polypeptide. In particular, the variant may have from 1 to 20 amino acid changes, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid modifications as compared to the reference polypeptide. The sequence of a variant may comprise one or several amino acid substitutions, and/or, one or several amino acid insertions, and/or one or several amino acid deletions as compared to the sequence of the reference polypeptide. In some embodiments, the amino acid modifications are conservative, preferably conservative substitutions. In other words, the amino acid modifications present in the variant do not significantly change its properties as compared to the reference polypeptide. Conservative substitutions and the corresponding rules are well-described in the state of the art. Examples of conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R.L. Hill (1979, In, The Proteins, Academic Press, New York). Common substitutions are the followings Ala/Ser, Val/lle, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/lle, LeuA al, Ala/Glu, and Asp/Gly. Alternatively, the amino acid modifications are of such a nature that the physico-chemical properties of the polypeptides are altered. For example, amino acid modifications may improve the thermal stability of the polypeptide, alter or modify the substrate specificity, change the pH optimum, and the like. Essential amino acids in a polypeptide can be identified according to procedures known in the art, such as site -directed mutagenesis or alanine-scanning mutagenesis. The active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. The identity of essential amino acids can also be inferred from an alignment with a related polypeptide. Single or multiple amino acid substitutions, deletions, and/or insertions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure. Other methods that can be used include error-prone PCR, phage display, and region-directed mutagenesis.

As used herein, the term "functional variant" refers to a variant as defined above which retains an activity of the reference polypeptide. Where the reference polypeptide is an enzyme, the functional variant shall retain one enzymatic activity of the reference polypeptide, in particular a cysteine decarboxylase activity or a Ser/Thr kinase cyclase activity. Preferably, the functional variant exhibits at least 10%, more preferably at least 25% and even more preferably at least 50%, of an enzymatic activity, in particular a cysteine decarboxylase activity or a Ser/Thr kinase cyclase activity, of the reference polypeptide.

As used herein, the term "related enzyme" refers to enzymes exhibiting an enzymatic activity of the reference polypeptide, having at least 30% sequence identity to said reference polypeptide and comprising at least one specific sequence motif. Preferably, related enzymes have at least 40%, more preferably at least 50%, 60% or 70%, sequence identity to said reference polypeptide.

As used herein, the term "endogenous", with respect to a microorganism, refers to a genetic element or a protein naturally present in said microorganism. In the context of a host cell, a vector or a nucleic acid construct, it designates a genetic element naturally present, and preferably in its natural environment, in said host cell, vector or nucleic acid construct.

The term "heterologous", with respect to a microorganism, refers to a genetic element or a protein that is not naturally present in said microorganism. In the context of a host cell, a vector or a nucleic acid construct, it designates a genetic element introduced into the host cell, the vector or the nucleic acid construct by genetic engineering. In the context of a host cell, it can mean that the genetic element originates from a source different from the cell in which it is introduced. Alternatively, it can also mean that the genetic element comes from the same species as the cell in which it is introduced but it is considered heterologous due to its environment which is not natural, for example because it is under the control of a promoter which is not its natural promoter, or is introduced at a location which differs from its natural location.

The term "isolated" means a substance in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include (1) any non- naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., multiple copies of a gene encoding the substance; use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).

The term "expression cassette" denotes a nucleic acid construct, preferably a DNA molecule, comprising a coding region, i.e. one or several genes, and a regulatory region, i.e. comprising one or more control sequences, operably linked. Optionally, the expression cassette may comprise several coding regions operably linked to several regulatory regions. The term "control sequences" means nucleic acid sequences necessary for expression of a coding region. Control sequences may be endogenous or heterologous. Well-known control sequences and currently used by the person skilled in the art will be preferred. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. Preferably, the control sequences include a promoter and a transcription terminator.

The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to a coding sequence, in such a way that the control sequence directs expression of the coding region.

As used herein, the term "expression vector" means a DNA or RNA molecule, preferably a DNA molecule, that comprises an expression cassette. Preferably, the expression vector is a linear or circular double stranded DNA molecule.

As used herein, the term "host celF refers to a microbial host cell, i.e. a microorganism, in particular a bacterium or a fungus. The term "host cell" also encompasses any progeny of a parent host cell that is not identical to the parent host cell due to mutations that occur during replication. Preferably, the host cell is a bacterium. In some embodiments, the host cell belongs to Microbacterium, Nocardia, Tsukamurella, Streptomyces, Nocardiopsis or Nonomuraea genus, preferably Microbacterium or Nocardia genus. In some particular embodiments, the host cell is selected from the group consisting of Microbacterium arborescens, Nocardia terpenica, Nocardia altamirensis, Tsukamurella sp. 1534, Streptomyces aureus, Streptomyces flavochromogenes, Streptomyces natalensis, Nocardiopsis chromatogenes and Nonomuraea Candida, preferably from the group consisting of Microbacterium arborescens, Nocardia terpenica and Nocardia altamirensis. In some other embodiments, the host cell is Escherichia coli.

As used herein, the term "heteroatom" refers to any atom that is not carbon or hydrogen. In preferred embodiments, this term refers to N, S, or O.

The term "heterocycle", as used herein, refers to 5- or 6-membered heterocyclic ring systems comprising one or more heteroatoms, preferably 1 or 2 endocyclic heteroatoms. Preferably, they are monocyclic systems. They may be aromatic or not. Examples of 5- or 6-membered-ring heterocycles include furan, pyrrole, thiophene, oxazole, isoxazole, thiazole, isothiazole, imidazole, pyrazole, triazole, pyridine, pyrane, piperidine, dioxane, pyrazine and pyrimidine. As used herein, the term "basic group" refers to an organic group which is a proton acceptor. Illustrative basic groups are primary, secondary, tertiary acyclic or cyclic amines, amidines, guanidines. In a first aspect, the present invention relates to a method of producing a bicyclic compound of formula (I)

wherein

Xi, X ₂ , X3, X ₄ and X5 are independently selected and each represents an amino acid, and B is a peptide chain of a size comprised between 1 and 30 amino acid residues.

The method of the invention typically comprises contacting a linear peptide comprising, or consisting of, the sequence B-Xi-Ser-X ₂ -X3-Ser-X ₄ -X5-Cys (SEQ ID NO: 1) with :

(i) an enzyme A exhibiting a cysteine decarboxylase activity and comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 2 to 10, functional variants thereof and related enzymes exhibiting a cysteine decarboxylase activity, and

(ii) an enzyme B exhibiting a Ser/Thr kinase cyclase activity and comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 11 to 19, functional variants thereof and related enzymes exhibiting a Ser/Thr kinase cyclase activity. The method may be performed in vitro (e.g., by incubating the enzymes and peptide in the absence of a host cell), or in a recombinant cell (e.g., by expressing one, two, or all of the three components in a cell).

Typically, the method comprises:

a) providing the linear peptide;

b) contacting the peptide with enzymes (A) and (B); and

c) optionally recovering the compound.

The linear peptide

The linear peptide used comprises, or consists of, the sequence B-Xi-Ser-X2-X ₃ -

Ser-X ₄ -X5-Cys (SEQ ID NO: 1), wherein Xi, X ₂ , X ₃ , X ₄ and X ₅ are independently selected and each represents an amino acid, and B is a peptide chain of a size comprised between 1 and 30 amino acid residues.

In a preferred embodiment, B is or comprises a leader sequence or a variant thereof.

B is a peptide chain of a size comprising from 1 to 30 amino acid residues, preferably a size comprised between 10 and 30 amino acid residues, more preferably between 15 and 30 amino acid residues, and even more preferably between 15 and 28 or 15 to 25 amino acid residues. In some preferred embodiments, B is a peptide chain of a size comprising from 19 to 23 amino acid residues.

In an embodiment, B is a peptide chain comprising, or consisting of, the sequence L-(X)io-E (SEQ ID NO: 40) wherein X represents an amino acid independently selected at each occurrence. Preferably, B is a peptide chain comprising, or consisting of, the sequence (X) _n -L-(X)io-E-(X) ₂ (SEQ ID NO: 41), wherein n represents an integer selected from 4 to 10, preferably from 5 to 9. In particular, n may be an integer selected from 5, 8 and 9.

In a particular embodiment, B is a peptide chain comprising, or consisting of, the sequence [L/I/V]-(X)2-L-(X) ₃ -[D/E]-(X)2-[S/A]-(X) ₃ -E-[L/M] (SEQ ID NO: 42), preferably the sequence [L/I/V]-X-[E/D/S/Q]-L-[H/Q/E]-(X) ₂ -[D/E]-(X) ₂ -[S/A]-(X) ₃ -E- [L/M] (SEQ ID NO: 43).

In another particular embodiment, B is a peptide chain comprising, or consisting of, the sequence D-(X) ₆ -L-(X)io-E-L (SEQ ID NO: 44), preferably the sequence [M/I]- D-[V/L]-[A/T]-[N/D]-[I/V]-(X) ₂ -L-[H/Q]- (X) ₂ -[D/E]- (X) ₂ -[S/A]- (X) ₃ -E-L (SEQ ID NO: 45), more preferably the sequence [M/I]-D-[V/L]-[A/T]-[N/D]-[I/V]-X-[E/D/S]-L- [HQ]-(X) ₂ -[D/E]- (X) ₂ -[S/A]- (X) ₃ -E-L (SEQ ID NO: 46).

In another particular embodiment, B is a peptide chain comprising, or consisting 5 of, the sequence M-I-D-V-T-X-I-(X) ₂ -L-(X)6-S-(X) ₃ -E-L (SEQ ID NO: 47), preferably the sequence M-I-D-V-T-[D/N] -I-(X) ₂ -L-[H/Q] -X- [L/I] - [D/E] - [ A/S ] -X-S -X- [T/A/S ] - [A/SJ-E-L (SEQ ID NO: 48).

In a further particular embodiment, B is a peptide chain comprising, or consisting of, the sequence M-D-(X) ₃ -V-(X) ₂ -L-Q-G-X-E-X-V-A-D-G-X-E-L-P (SEQ ID NO: 49), 10 preferably the sequence M-D-[L/I]-[T/A]-[N/D]-V-[I/M]-[D/E]-L-Q-G-X-E-[I/V]-V-A- D-G-[V/I]-E-L-P (SEQ ID NO: 50).

In a more particular embodiment, B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NOs: 30 to 39, or variants thereof. Preferably, said variants have at least 50%, 60%, 70%, 80% or 90% sequence 15 identity to the reference sequence, more preferably have at least 80% or 90% sequence identity to the reference sequence.

In particular embodiments, said variants exhibit 1, 2, 3, 4 or 5 amino acid changes, preferably 1, 2 or 3 amino acid changes, to the reference sequence.

In preferred embodiments, said variants have at least 50%, 60%, 70%, 80% or 20 90% sequence identity to the reference sequence and comprise, or consist of, the sequence L-(X)io-E (SEQ ID NO: 40), and more preferably comprises, or consists of, the sequence (X) _n -L-(X)io-E-(X) ₂ (SEQ ID NO: 41), wherein n represents an integer selected from 4 to 10, preferably from 5 to 9.

Thus, in a particular embodiment, B is a peptide chain comprising, or consisting 25 of, a sequence selected from the group consisting of SEQ ID NOs: 30 to 39, preferably from the group consisting of SEQ ID NO: 30, 32, 33 and 39, and variants thereof having at least 50%, preferably at least 70%, 80%, or 90%, identity to any of these sequences and comprising, or consisting of, SEQ ID NO: 40 or 41, wherein n represents an integer selected from 4 to 10, preferably from 5 to 9.

30 In a more particular embodiment, B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NOs: 30 to 39.

In some particular embodiments, peptide chain B is as defined above but does not comprise, or consist of, SEQ ID NO: 30, 32 or 33. Optionally, peptide chain B may further contain a tag suitable for purification at its N-terminal end.

The linear peptide comprises, or consists of, the sequence B-Xi-Ser-X2-X ₃ -Ser- X ₄ -X5-Cys (SEQ ID NO: 1), wherein Xi, X ₂ , X ₃ , X ₄ and Xs are independently selected and each represents an amino acid.

Preferably, the linear peptide has one or several of the following features:

a) Xi is an amino acid selected from the group consisting of A and G, preferably is A, and/or

b) X2 is an amino acid selected from the group consisting of L, V, I, G, A, R, T and S, preferably from the group consisting of L, V, I, G, A and T, more preferably from the group consisting of L, V, I, G and A, and even more preferably from the group consisting of L or I, and/or

c) X ₃ is an amino acid selected from the group consisting of G, A, S and T, preferably from the group consisting of G, A and S, and more preferably from the group consisting of G and S, and/or

d) X ₄ is an amino acid selected from the group consisting of Q, N, I, S, E, D, W, H, P, T, preferably from the group consisting of Q, N, S, E and D, more preferably from the group consisting of Q and N, and/or

e) X5 is an amino acid selected from the group consisting of G, A, S and T, preferably from the group consisting of G, S and T, more preferably from the group consisting of G and S.

Alternatively, the linear peptide has one or several of the following features: Xi is an amino acid selected from the group consisting of A and G, preferably is

A, and/or

X2 is an amino acid selected from the group consisting of L, V, I, G, A, R, T and S, preferably from the group consisting of V, T, A and G, and/or

X ₃ is an amino acid selected from the group consisting of G, A, S and T, preferably from the group consisting of A and S, and/or

X4 is an amino acid selected from the group consisting of Q, N, I, S, E, D, W, H, P and T, preferably from the group consisting of S, E and D, and/or X5 is an amino acid selected from the group consisting of G, A, S and T, preferably from the group consisting of G and T.

Alternatively, the linear peptide has one or several of the following features: Xi is an amino acid selected from the group consisting of A and G, preferably is

A, and/or

X2 is an amino acid selected from the group consisting V, T, A and G, and/or X3 is an amino acid selected from the group consisting of A and S, and/or X4 is an amino acid selected from the group consisting of S, E and D, and/or X5 is an amino acid selected from the group consisting of G and T.

Alternatively, the linear peptide has one or several of the following features: a) Xi is an amino acid selected from the group consisting of A or G, preferably is A; and/or

b) X2 is an amino acid selected from the group consisting of L, V, I, G and A, preferably an amino acid selected from the group consisting of L, V, I and A, more preferably is selected from the group consisting of L and I, and even more preferably is I; and/or

c) X3 is an amino acid selected from the group consisting of G, A, S and T, preferably an amino acid selected from the group consisting of G and S, and more preferably is S; and/or

d) X ₄ is an amino acid selected from the group consisting of Q and N, preferably is N; and/or

e) X5 is an amino acid selected from the group consisting of G, A, S and T, preferably is an amino acid selected from the group consisting of G and S, and more preferably is G.

In particular, the linear peptide may meet one feature, two features [for instance a) and b); a) and c); a) and d); a) and e); b) and c); b) and d); b) and e); c) and d); c) and e); d) and e)], three features [for instance a), b) and c); a), b) and d); a), b) and e); a), c) and d); a), c) and e); a), d) and e); b), c) and d); b), c) and e); c), d) and e)], four features [a), b), c) and d); a), b), c) and e); a), b), d) and e); a), c), d) and e); b), c), d) and e)], or five features [i.e. a), b), c), d) and e)] as described above. In a particular embodiment,

Xi is an amino acid selected from the group consisting of A and G, preferably is

X2 is an amino acid selected from the group consisting of L, V, I, G, T and A, X3 is an amino acid selected from the group consisting of G, A and S,

X ₄ is an amino acid selected from the group consisting of Q, N, S, E and D, and X5 is an amino acid selected from the group consisting of G, S and T. In a particular embodiment,

Xi is an amino acid selected from the group consisting of A and G, preferably is

A,

X2 is an amino acid selected from the group consisting of V, G, T and A, X3 is an amino acid selected from the group consisting of A and S,

X4 is an amino acid selected from the group consisting of S, E and D, and

X5 is an amino acid selected from the group consisting of G and T.

In another particular embodiment,

Xi is an amino acid selected from the group consisting of A and G, preferably is A,

X3 is an amino acid selected from the group consisting of S and G, and

X5 is an amino acid selected from the group consisting of S and G.

Optionally, X2 is an amino acid selected from the group consisting of L, V, I, G, T and A, and/or X ₄ is an amino acid selected from the group consisting of Q, N, S, E and D.

In another particular embodiment,

Xi is an amino acid selected from the group consisting of A and G, preferably

X2 is an amino acid selected from the group consisting of L, V, I, G and A, X3 is an amino acid selected from the group consisting of G, A, S and T, X4 is an amino acid selected from the group consisting of Q and N, and

X5 is an amino acid selected from the group consisting of G, A, S and T. In a more particular embodiment,

Xi is an amino acid selected from the group consisting of A and G, preferably is

A,

X2 is an amino acid selected from the group consisting of L, V and I, preferably selected from the group consisting of L and I, more preferably is I,

X3 is an amino acid selected from the group consisting of G and S, preferably is

S,

X4 is an amino acid selected from the group consisting of Q and N, preferably is N, and

X5 is an amino acid selected from the group consisting of G and S, preferably is

G.

In a further particular embodiment, X2 is L and X3 is G.

In another particular embodiment, X3 is G and X ₄ is Q.

In a further particular embodiment, X ₄ is Q and X5 is S.

In another particular embodiment, X2 is L, X3 is G and X ₄ is Q.

In another particular embodiment, Xi is A, X2 is L and, X3 is G.

In another particular embodiment, Xi is A, X3 is G and X ₄ is Q.

In another particular embodiment, Xi is A, X2 is T, X ₄ is D and X5 is G.

In another particular embodiment, Xi is A and X3 is S.

In another particular embodiment, Xi is A and X5 is G.

In a more particular embodiment,

Xi is A,

X3 is S, and

Xs G.

Optionally, X2 is an amino acid selected from the group consisting of L, V, I, G, T and A, and/or X ₄ is an amino acid selected from the group consisting of Q, N, S, E and D.

Preferably, in this embodiment, B is a peptide chain comprising, or consisting of, the sequence of SEQ ID NO: 47 or 48. In particular, B may be a peptide chain comprising, or consisting of, the sequence of SEQ ID NO: 31, 32 or 33.

In another particular embodiment, Xi is A,

X2 is an amino acid selected from the group consisting of G, T and A, preferably G and T,

X3 is an amino acid selected from the group consisting of S and A, preferably is A,

X4 is an amino acid selected from the group consisting of D and E, and

X5 is an amino acid selected from the group consisting of T and G, preferably is

T.

Preferably, in this embodiment, B is a peptide chain comprising, or consisting of, the sequence of SEQ ID NO: 49 or 50. In particular, B may be a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 34 to 38.

In a further particular embodiment,

Xi is A, X2 is T, X3 is A, X ₄ is D and X5 is G, or

Xi is A, X2 is A, X3 is S, X ₄ is E and X5 is T, or

Xi is A, X2 is T, X3 is S, X ₄ is D and X5 is G, or

Xi is A, X2 is G, X3 is S, X ₄ is E and X5 is G, or

Xi is A, X2 is L, X3 is G, X ₄ is Q and X5 is S, or

Xi is A, X2 is V, X3 is S, X ₄ is S and X5 is G, or

Xi is A, X2 is I, X3 is S, X ₄ is N and X5 is G.

In another particular embodiment, the linear peptide used comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 20 to 29, i.e. selected from linear peptides found in Microbacterium arborescens (MicA, SEQ ID NO: 20), Tsukamurella sp. 1534 (TsuA, SEQ ID NO: 21), Nocardia altamirensis (NoaA, SEQ ID NO: 22), Nocardia terpenica (NocA, SEQ ID NO: 23), Nocardiopsis chromatogenes (ChrA, SEQ ID NO: 24), Streptomyces natalensis (NatA, SEQ ID NO: 25), Nonomuraea Candida (CanA, SEQ ID NO: 26), Streptomyces flavochromogenes (FlaA, SEQ ID NO: 27), Streptomyces aureus (AurA, SEQ ID NO: 28) and Microbacterium arborescens ND21 or Microbacterium sp. TS-l(ArbA, SEQ ID NO: 29).

In some particular embodiments, the linear peptide does not comprise, or consist of, SEQ ID NO: 20, 22, 23, 98, 99, 100 or 101. The linear peptide used may be obtained by any method known by the skilled person including classical chemical synthesis (in solid phase or homogeneous liquid phase), enzymatic synthesis, recombinant expression, biological sources, or combinations thereof. In embodiments wherein the method of the invention is carried out in vivo, e.g. in a host cell, the linear peptide is preferably directly synthetized by said host cell from an endogenous or heterologous gene.

Through their investigation, the inventors found that the bicyclic compound of formula (I) can be obtained by the sequential action of two enzymes on the linear peptide:

(i) an enzyme (A) exhibiting a cysteine decarboxylase activity and

(ii) an enzyme (B) exhibiting a Ser/Thr kinase cyclase activity.

Without being bounded by this theory, the inventors assume that firstly, enzyme B dehydrates a serine residue of the linear peptide. This dehydration is followed by a decarboxylation through the action of enzyme A prior to the second dehydration and subsequent cyclization with enzyme B.

Thus, the method of the invention comprises contacting the linear peptide as defined above with

(i) an enzyme (A) exhibiting a cysteine decarboxylase activity and

(ii) an enzyme (B) exhibiting a Ser/Thr kinase cyclase activity.

The enzymes A and B used in the present invention may be wild-type enzymes, e.g. isolated naturally-occurring enzymes, variants of wild-type enzymes, or hybrid polypeptides.

In some embodiments, the enzymes used in the present invention are wild- type enzymes, preferably isolated wild-type enzymes, from a microorganism, especially from a bacterium. For instance, the enzymes used in the present invention may be from a bacterium selected from the group consisting of Microbacterium, Nocardia, Tsukamurella, Streptomyces, Nocardiopsis and Nonomuraea genera. Appropriate bacterial species of interest encompass, without being limited to, Microbacterium arborescens (e.g. CIP 55.81T, Collection Institut Pasteur), Nocardia terpenica (e.g. DSM 44935), Nocardia altamirensis (e.g. DSM 44997), Tsukamurella sp. 1534 (Oulmi et al. J Bacteriol. 2012 Oct; 194(19): 5482-5483), Streptomyces aureus (e.g. DSM 41785), Streptomyces flavochromogenes (e.g. DSM 40541), Streptomyces natalensis (e.g. DSM 40357), Nocardiopsis chromatogenes (e.g. DSM 44844) and Nonomuraea Candida (e.g. DSM 45086).

The enzymes used in the present invention may also be hybrid polypeptides, enzymes comprising a first polypeptide having a cysteine decarboxylase or Ser/Thr kinase cyclase activity as described below which is fused or conjugated to another chemical or biochemical entity. The chemical or biochemical entity can be fused or conjugated to the N- or C-terminus region of the first polypeptide. In some embodiments, the hybrid polypeptide comprises a first polypeptide having the enzymatic activity of interest which is fused to an additional polypeptide. Said additional polypeptide can be selected in order to enhance the stability of the enzyme, to promote the secretion (such as a N-terminal hydrophobic signal peptide) of the hybrid enzyme from a cell (such as a bacterial cell), or to assist in the purification of the hybrid enzyme. More particularly, the additional region can be a tag useful for purification or immobilization of the hybrid enzyme. Such a tag is well-known by the person skilled in the art, for instance a His tag (His ₆ ), a FLAG tag, a HA tag (epitope derived from the Human influenza protein haemagglutinin), a maltose-binding protein (MPB), a MYC tag (epitope derived from the human proto-oncoprotein MYC), streptavidin or avidin, or a GST tag (small glutathione - S-transferase). A conjugated polypeptide refers to a polypeptide wherein the amino acid sequence has been conjugated by chemical means to at least one chemical or biochemical entity. Techniques for conjugating an amino acid sequence to another chemical or biochemical entity are well-known in the art. The additional entity and the polypeptide having the enzymatic activity of interest may be covalently linked to each other directly or via a spacer. The spacer can be any standard linker commonly used for the preparation of polypeptide constructs. In some embodiments, the linker is a polypeptide comprising from 1 to 50 amino acid residues. Some preferred examples are Gly-Ser linkers such as tetraglycyl-seryl-triglycyl-serine peptide or polyalanine linkers. The additional chemical or biochemical entities may be of any type. For instance, the additional or biochemical entities may be a mean useful for immobilizing the enzyme, e.g. a biotin or a reactive functional group, a mean for detecting the enzyme, a label and the like.

Enzyme A: cysteine decarboxylase Enzyme (A) exhibits a cysteine decarboxylase activity and comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 2 to 10, functional variants thereof and related enzymes exhibiting a cysteine decarboxylase activity.

The cysteine decarboxylase activity of the enzyme may be assessed by any method known by the skilled person. In particular, this activity may be assessed as described in the experimental section. Briefly, a linear peptide as defined above, for example a linear peptide of SEQ ID NO: 20, is mixed with the enzyme to be tested in an assay buffer (e.g. 20 mM Tris-HCl, pH 8.5, 10 mM MgCk, 1% glycerol, lOOmM NaCl, 1 mM DTT). The mixture is incubated, e.g. at 28°C for 4h to 14h, and afterwards quenched, e.g. by addition of acetonitrile. The reaction mixture is then centrifuged to remove precipitated protein and the supernatant is analyzed, e.g. by LC-ESI-MS. The detection of a product corresponding to the decarboxylated linear peptide indicates that the tested enzyme exhibits a cysteine decarboxylase activity. Alternatively, or in addition, a linear peptide as defined above, for example a linear peptide of SEQ ID NO: 20, may be mixed with the enzyme to be tested and an enzyme B known to exhibit a Ser/Thr kinase cyclase activity as defined herein, e.g. MicKC (SEQ ID NO: 11), in an assay buffer (e.g. 20 mM Tris- HCl, pH 8.5, 10 mM MgCk, 1% glycerol, lOOmM NaCl, 1 mM DTT) and preferably in the presence of ATP. The mixture is incubated, e.g. at 28 °C for 14h, and afterwards quenched, e.g. by addition of acetonitrile. The reaction mixture is then centrifuged to remove precipitated protein and the supernatant is analyzed by LC-ESI-MS, tandem experiments and derivatized with iodoacetamide to confirm formation of the avionin ring structure. The detection of the avionin ring structure indicates that the tested enzyme exhibits a cysteine decarboxylase activity. In an embodiment, the cysteine decarboxylase enzyme (enzyme A) comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 2 to 10, i.e. selected from cysteine decarboxylase enzymes found in Microbacterium arborescens (MicD, SEQ ID NO: 2, NCBI accession number: WP_023951653.1), Tsukamurella sp. 1534 (TsuD, SEQ ID NO: 3, NCBI accession number: WP_019202638.1), Nocardia altamirensis (NoaD, SEQ ID NO: 4, NCBI accession number: WP_069160306.1), Nocardia terpenica (NocD, SEQ ID NO: 5, NCBI accession number: WP_067581327.1), Nocardiopsis chromatogenes (ChrD, SEQ ID NO: 6, NCBI accession number: WP_017622804.1), Streptomyces natalensis (NatD, SEQ ID NO: 7, NCBI accession number: WP_044362958.1), Nonomuraea Candida (CanD, SEQ ID NO: 8, NCBI accession number: WP_043635863.1), Streptomyces flavochromogenes (FlaD, SEQ ID NO: 9, NCBI accession number: WP_051820261.1) and Streptomyces aureus (AurD, SEQ ID NO: 10, NCBI accession number: WP_055599455.1). Preferably, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 2, 4 or 5.

In another embodiment, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from functional variants of SEQ ID NO: 2 to 10.

Preferably, a functional variant exhibits at least 70%, more preferably at least 80% and even more preferably at least 90% sequence identity, to any sequence of SEQ ID NO: 2 to 10, preferably of SEQ ID NO: 2, 4 or 5, and retains a detectable cysteine decarboxylase activity as defined above.

In another embodiment, the cysteine decarboxylase is an enzyme related to enzymes of SEQ ID NO: 2 to 10.

Preferably, said related enzymes exhibit a cysteine decarboxylase activity, have at least 30%, preferably at least 40%, 45% or 50%, amino acid sequence identity to any of SEQ ID NO: 2 to 10, and comprise at least one amino acid sequence selected from the group consisting of:

(i) [L/M] - [TVS] -(X) ₂ -A-(X) ₂ -F- V- [S/A] -(X) ₂ -[S/A] -[L/I/V] -X-[S/A] -[L/I] - [S/A/T]- (X) ₃ -V-(X) ₂ -[N/D]-X-W (SEQ ID NO: 51),

(ii) H- [T/V] -(X) ₄ -[D/G/S] -X-D-X-[L/I/V] - [L/I/V] - [ V/I] -X-P- A-[S/T] - [ V/L] (SEQ ID NO: 52) or H-[T/V]- (X) ₃ -[D/G/S]-X-D-X-[L/I/V]-[L/I/V]-[V/I]-X-P-A-[S/T]- [V/L] (SEQ ID NO: 53),

(iii) [L/I/V]-[A/C/S]-P-[T/S/N]-[F/L]-P-P-(X) ₄ -[N/H]-P (SEQ ID NO: 54), (iv) a sequence comprising at least 10, preferably at least 15, 20 or 25, consecutive amino acids of any of sequences (i) to (iii), and

(v) a sequence having at least 95%, preferably at least 98% or 99%, sequence identity to any of sequences (i) to (iii),

X representing an amino acid independently selected at each occurrence.

In a particular embodiment, the cysteine decarboxylase is an enzyme having at least 30%, preferably at least 40%, 45% or 50%, amino acid sequence identity to any of SEQ ID NO: 3 to 10, and comprising at least one amino acid sequence selected from the group consisting of: (i) [L/M]-[T/S]-(X) ₂ -A-(X) ₂ -F-V-[S/A] -(X) ₂ -[S/A] -[L/I/V] -X-A-[L/I] -[S/T] - (X) ₃ -V-[A/V]-X-[N/D]-X-W (SEQ ID NO: 55),

(ii) H-T-(X) ₄ -[D/G]-X-D-X-[L/I/V]-[L/I/V]-[V/I]-X-P-A-[S/T]-[V/L] (SEQ ID NO: 56) or H-T-(X) ₃ -[D/G]-X-D-X-[L/I/V]-[L/I/V]-[V/I]-X-P-A-[S/T]-[V/L] (SEQ ID NO: 57),

(iii) [L/I/V]-[A/S]-P-[T/S/N]-[F/L]-P-P-X-[A/V]-(X) ₂ -N-P-X-V (SEQ ID NO:

58),

(iv) a sequence comprising at least 10, preferably at least 15, 20 or 25, consecutive amino acids of any of sequences (i) to (iii), and

(v) a sequence having at least 95%, preferably at least 98% or 99%, sequence identity to any of sequences (i) to (iii),

X representing an amino acid independently selected at each occurrence.

Preferably, in this embodiment, B is a peptide chain comprising, or consisting of, the sequence D-(X) ₆ -L-(X)io-E-L (SEQ ID NO: 44), preferably the sequence [M/I]-D- [V/L]-[A/T]-[N/D]-[I/V]-(X) ₂ -L-[H/Q]- (X) ₂ -[D/E]- (X) ₂ -[S/A]- (X) ₃ -E-L (SEQ ID NO: 45), more preferably the sequence [M/I]-D-[V/L]-[A/T]-[N/D]-[I/V]-X-[E/D/S]-L-[HQ]- (X) ₂ -[D/E]- (X) ₂ -[S/A]- (X) ₃ -E-L (SEQ ID NO: 46).

In another particular embodiment, the cysteine decarboxylase is an enzyme having at least 30%, preferably at least 40%, 45% or 50%, amino acid sequence identity to any of SEQ ID NO: 3 to 5, and comprising at least one amino acid sequence selected from the group consisting of:

(i) L-S-X-[H/Q] -A-T-[E/R/K] -F-V-[A/S] - (X) ₂ -[A/S] -[L/I/V] -X-A-L-[T/S]-G- (X) ₂ -V-A-I-D-X-W-D-D-P (SEQ ID NO: 59),

(ii) P-H-T-(X) ₂ -L- A-[G/D] -X-D-[ V/A] - [L/V/I] -L- [ V/I] -X-P- A-T-L-N-T-L- [G/S]-R-[L/I]-A-X-[L/V/I]-D-A-[S/A]-T-P-M-L-[N/S]-A-[V/L]-[Q /H]-[C/S]-T-X-A

(SEQ ID NO: 60), or P-H-T-X-L-A-[G/D]-X-D-[V/A] -[L/V/I] -L-[V/I] -X-P- A-T-L-N-T- L-[G/S]-R-[L/I]-A-X-[L/V/I]-D-A-[S/A]-T-P-M-L-[N/S]-A-[V/L]- [Q/H]-[C/S]-T-X-A (SEQ ID NO: 61),

(iii) [L/V]-[A/S]-P-N-L-P-P-G-A-[D/E]-R-N-P-A-V (SEQ ID NO: 62), and (iv) a sequence comprising at least 10, preferably at least 15, 20 or 25, consecutive amino acids of any of sequences (i) to (iii), and

(v) a sequence having at least 95%, preferably at least 98% or 99%, sequence identity to any of sequences (i) to (iii), X representing an amino acid independently selected at each occurrence.

Preferably, in this embodiment, B is a peptide chain comprising, or consisting of, the sequence M-I-D-V-T-X-I-(X) ₂ -L-(X)6-S-(X) ₃ -E-L (SEQ ID NO: 47), preferably the sequence M-I-D-V-T-[D/N]-I-(X) ₂ -L-[H Q]-X-[I/I]-[D E]-[A/S]-X-S-X-[T/A/S]-[A/S]- E-L (SEQ ID NO: 48).

In a further particular embodiment, the cysteine decarboxylase is an enzyme having at least 30%, preferably at least 40%, 45% or 50%, amino acid sequence identity to any of SEQ ID NO: 6 to 10, and comprising at least one amino acid sequence selected from the group consisting of:

(i) T-G-T-L-S-T-A-H-L-P-F-W-L-N-W-L-[A/S]-[S/T/A]-N-R-P-X-Y-X-V- T-X-

G-[L/M]-T-[S/D]-S-A-(X) ₂ -F-V-S-(X) ₂ -A-L-X-A-[I/L]-T-X-[S/T]-P-V-V-X-N-[T/S]- W (SEQ ID NO: 63),

(ii) L-X-P-V-H-T-X-I-A-X-[D/G] -[H/Y] -D-G-[L/I] -[L/I/V] -V-[Y/F] -P-A-S-V- A-F-X-S-[G/A]-L-A-[A/S]-[A/G]-S-G-(X) ₂ -P-F-X-L-A-A-L-G (SEQ ID NO: 64), (iii) P-V-V-[L/I]-A-P-[S/T]-[F/L]-P-P-X-V-A-X-N-P-[I/L]-V (SEQ ID NO: 65), and

(iv) a sequence comprising at least 10, preferably at least 15, 20 or 25, consecutive amino acids of any of sequences (i) to (iii), and

(v) a sequence having at least 95%, preferably at least 98% or 99%, sequence identity to any of sequences (i) to (iii),

X representing an amino acid independently selected at each occurrence.

Preferably, in this embodiment, B is a peptide chain comprising, or consisting of, the sequence M-D-(X) ₃ -V-(X) ₂ -L-Q-G-X-E-X-V-A-D-G-X-E-L-P (SEQ ID NO: 49), preferably the sequence M-D-[L/I]-[T/A]-[N/D]-V-[I/M]-[D/E]-L-Q-G-X-E-[I/V]-V-A- D-G-[V/I]-E-L-P (SEQ ID NO: 50).

Preferably, in each embodiment described above regarding cysteine decarboxylase related enzymes, the related enzymes have at least 50% amino acid sequence identity to the reference cysteine decarboxylase(s).

Preferably, in each embodiment described above regarding cysteine decarboxylase related enzymes, the amino acid sequence iv) is a sequence comprising at least 15 consecutive amino acids of any of sequences (i) to (iii). Preferably, in each embodiment described above regarding cysteine decarboxylase related enzymes, the amino acid sequence v) is a sequence having at least 99% sequence identity to any of sequences (i) to (iii).

Preferably, in each embodiment described above regarding cysteine decarboxylase related enzymes, the related enzymes comprise at least two amino acid sequences selected from i), ii) and iii). In particular, the related enzymes may comprise amino acid sequences i) and ii), i) and iii) or ii) and iii). More preferably, the related enzymes comprises amino acid sequences i), ii) and iii). In a particular embodiment, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 2, functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 30 and 39 and variants thereof. Preferably, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 2 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 30 and 39 and variants thereof. More preferably, the cysteine decarboxylase enzyme comprises, or consists of, SEQ ID NO: 2 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 30 or 39.

In a particular embodiment, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 3 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 31 and variants thereof. Preferably, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 3 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 31 and variants thereof. More preferably, the cysteine decarboxylase enzyme comprises, or consists of, SEQ ID NO: 3 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 31.

In a particular embodiment, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 4 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 32 and variants thereof. Preferably, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 4 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 32 and variants thereof. More preferably, the cysteine decarboxylase enzyme comprises, or consists of, SEQ ID NO: 4 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 32.

In a particular embodiment, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 5 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 33 and variants thereof. Preferably, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 5 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 33 and variants thereof. More preferably, the cysteine decarboxylase enzyme comprises, or consists of, SEQ ID NO: 5 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 33.

In a particular embodiment, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 6 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 34 and variants thereof. Preferably, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 6 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 34 and variants thereof. More preferably, the cysteine decarboxylase enzyme comprises, or consists of, SEQ ID NO: 6 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 34.

In a particular embodiment, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 7 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 35 and variants thereof. Preferably, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 7 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 35 and variants thereof. More preferably, the cysteine decarboxylase enzyme comprises, or consists of, SEQ ID NO: 7 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 35.

In a particular embodiment, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 8 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 36 and variants thereof. Preferably, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 8 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 36 and variants thereof. More preferably, the cysteine decarboxylase enzyme comprises, or consists of, SEQ ID NO: 8 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 36.

In a particular embodiment, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 9 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 37 and variants thereof. Preferably, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 9 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 37 and variants thereof. More preferably, the cysteine decarboxylase enzyme comprises, or consists of, SEQ ID NO: 9 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 37.

In a particular embodiment, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 10 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 38 and variants thereof. Preferably, the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 10 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 38 and variants thereof. More preferably, the cysteine decarboxylase enzyme comprises, or consists of, SEQ ID NO: 10 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 38. Enzyme B: Ser/Thr kinase cyclase

Enzyme (B) exhibits a Ser/Thr kinase cyclase activity and comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 11 to 19, functional 5 variants thereof and related enzymes exhibiting a Ser/Thr kinase cyclase activity.

The Ser/Thr kinase cyclase activity of the enzyme may be assessed by any method known by the skilled person. In particular, this activity may be assessed as described in the experimental section. Briefly, a linear peptide as defined above, for example a linear peptide of SEQ ID NO: 20, is mixed with the enzyme to be tested in an assay buffer (e.g.

10 20 mM Tris-HCl, pH 8.5, 10 mM MgCk, 1% glycerol, lOOmM NaCl, 1 mM DTT, and preferably ATP). The mixture is incubated, e.g. at 28°C for 4h to 14h, and afterwards quenched, e.g. by addition of acetonitrile. The reaction mixture is then centrifuged to remove precipitated protein and the supernatant is analyzed, e.g. by LC-ESI-MS. The detection of a product corresponding to the dehydrated linear peptide indicates that the

15 tested enzyme exhibits a Ser/Thr kinase cyclase activity. Alternatively, or in addition, a linear peptide as defined above, for example a linear peptide of SEQ ID NO: 20, may be mixed with the enzyme to be tested and an enzyme A known to exhibit a cysteine decarboxylase activity as defined herein, e.g. MicD (SEQ ID NO: 2), in an assay buffer (e.g. 20 mM Tris-HCl, pH 8.5, 10 mM MgCk, 1% glycerol, lOOmM NaCl, 1 mM DTT

20 and preferably ATP). The mixture is incubated, e.g. at 28°C for 4h to 14h, and afterwards quenched, e.g. by addition of acetonitrile. The reaction mixture is then centrifuged to remove precipitated protein and the supernatant is analyzed by LC-ESI-MS, tandem experiments and derivatized with iodoacetamide to confirm formation of the avionin ring structure. The detection of the avionin ring structure indicates that the tested enzyme

25 exhibits a Ser/Thr kinase cyclase activity.

Alternatively, or in addition, a linear peptide as defined above, for example a linear peptide of SEQ ID NO: 20, may be mixed with the enzyme to be tested in an assay buffer (e.g. 20 mM Tris-HCl, pH 8.5, 10 mM MgCk, 1% glycerol, lOOmM NaCl, 1 mM DTT and preferably ATP). The mixture is incubated, e.g. at 28°C for 4h to 14h, and Dha

30 residues are derivatized with beta-mercaptoethanol before determination of dehydrated Ser residue via MS-MS. Such method is further detailed in Nathanie et al. Chem Sci. 2013 Jul 29; 4(9): 3455-3458 or Morrison et al. Chem Commun (Camb). 2015 Sep 11; 51(70): 13470-13473.

In an embodiment, the Ser/Thr kinase cyclase enzyme (enzyme B) comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 11 to 19, i.e. selected from Ser/Thr kinase cyclase enzymes found in Microbacterium arborescens (MicKC, SEQ ID NO: 11, NCBI accession number: WP_064956879.1), Tsukamurella sp. 1534 (TsuKC, SEQ ID NO: 12, NCBI accession number: WP_019202639.1), Nocardia altamirensis (NoaKC, SEQ ID NO: 13, NCBI accession number: WP_069160307.1), Nocardia terpenica (NocKC, SEQ ID NO: 14, NCBI accession number: WP_067581329.1), Nocardiopsis chromatogenes (ChrKC, SEQ ID NO: 15, NCBI accession number: WP_017622803.1), Streptomyces natalensis (NatKC, SEQ ID NO: 16, NCBI accession number: WP_030066275.1), Nonomuraea Candida (CanKC, SEQ ID NO: 17, NCBI accession number: WP_043635860.1), Streptomyces flavochromogenes (FlaKC, SEQ ID NO: 18, NCBI accession number: WP_030318172.1) and Streptomyces aureus (AurKC, SEQ ID NO: 19). Preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 11, 13 and 14.

In another embodiment, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from functional variants of SEQ ID NO: 11 to 19.

Preferably, a functional variant exhibits at least 70%, more preferably at least 80% and even more preferably at least 90% sequence identity, to any sequence of SEQ ID NO: 11 to 19, preferably of SEQ ID NO: 11, 13 or 14, and retains a detectable Ser/Thr kinase cyclase activity as defined above.

In another embodiment, the Ser/Thr kinase is an enzyme related to enzymes of SEQ ID NO: 11 to 19.

Preferably, said related enzymes exhibit a Ser/Thr kinase cyclase activity, have at least 30%, preferably at least 40%, 45% or 50%, amino acid sequence identity to any of SEQ ID NO: 11 to 19, and comprising at least one amino acid sequence selected from the group consisting of:

(i) K-X-A-X-R-(X) ₂ -[S/A]-G-K (SEQ ID NO: 66)

(ii) [V/I]-H-X-R-[Y/F]-G (SEQ ID NO: 67)

(iii) G-G-X-Y-X-A (SEQ ID NO: 68), preferably G-G-[V/T]-Y-X-A (SEQ ID NO: 69) (iv) [V/I]-[V/I]-[L/I]-K-[E/R]-[A/G] (SEQ ID NO: 70)

(v) G-X-T-L-X-E-W-X-A (SEQ ID NO: 71)

(vi) a sequence comprising at least 5 consecutive amino acids of any of sequences (i) to (v), and

(vii) a sequence having at least 98%, preferably at least 99%, sequence identity to any of sequences (i) to (v),

X representing an amino acid independently selected at each occurrence.

In a particular embodiment, the Ser/Thr kinase cyclase is an enzyme having at least 30%, preferably at least 40%, 45% or 50%, amino acid sequence identity to any of SEQ ID NO: 12 to 19, and comprising at least one amino acid sequence selected from the group consisting of:

(i) K-Y-A-X-R-(X) ₂ -S-G-K (SEQ ID NO: 72)

(ii) [I/V]-V-H-X-R-Y-G-X-[Y/F] (SEQ ID NO: 73), preferably [I/VJ-V-H-X-R- Y-G-[A/G]-[Y/F] (SEQ ID NO: 74)

(iii) L-H-X-S-N-X-G-G-V-Y-X-A (SEQ ID NO: 75),

(iv) [I/V]-[V/I]-L-K-E-A-R (SEQ ID NO: 76)

(v) G-[S/T/A]-T-L-X-E-W-X-A-A (SEQ ID NO: 77), preferably G-[S/T/A]-T-L- X-E-W-[S/C/A]-A-A (SEQ ID NO: 78),

(vi) a sequence comprising at least 5 consecutive amino acids of any of sequences (i) to (v), and

(vii) a sequence having at least 98%, preferably at least 99%, sequence identity to any of sequences (i) to (v),

X representing an amino acid independently selected at each occurrence.

Preferably, in this embodiment, B is a peptide chain comprising, or consisting of, the sequence D-(X) ₆ -L-(X)io-E-L (SEQ ID NO: 44), preferably the sequence [M/I]-D- [V/L]-[A/T]-[N/D]-[I/V]-(X) ₂ -L-[H/Q]- (X) ₂ -[D/E]- (X) ₂ -[S/A]- (X) ₃ -E-L (SEQ ID NO: 45), more preferably the sequence [M/I]-D-[V/L]-[A/T]-[N/D]-[I/V]-X-[E/D/S]-L-[HQ]- (X) ₂ -[D/E]- (X) ₂ -[S/A]- (X) ₃ -E-L (SEQ ID NO: 46).

In another particular embodiment, the Ser/Thr kinase cyclase is an enzyme having at least 30%, preferably at least 40%, 45% or 50%, amino acid sequence identity to any of SEQ ID NO: 12 to 14, and comprising at least one amino acid sequence selected from the group consisting of:

(i) W-A-L-N-G-K-Y-A-P-R-X-[A/S]-S-G-K (SEQ ID NO: 79) (ii) S-I-V-H-X-R-Y-G-[A/G]-F (SEQ ID NO: 80)

(iii) S-N-T-G-G-V-Y-R-A (SEQ ID NO: 81)

(iv) V-[V/I]-L-K-E-A-R-H (SEQ ID NO: 82)

(v) G-S-T-L-Q-E-W-[A/S]-A-A (SEQ ID NO: 83)

(vi) a sequence comprising at least 5 consecutive amino acids of any of sequences

(i) to (v), and

(vii) a sequence having at least 98%, preferably at least 99%, sequence identity to any of sequences (i) to (v),

X representing an amino acid independently selected at each occurrence.

Preferably, in this embodiment, B is a peptide chain comprising, or consisting of, the sequence M-I-D-V-T-X-I-(X) ₂ -L-(X) ₆ -S-(X)3-E-L (SEQ ID NO: 47), preferably the sequence M-I-D-V-T-[D/N]-I-(X) ₂ -L-[H/Q]-X-[L/I]-[D/E]-[A/S]-X-S-X-[T/A/S]-[A/S]- E-L (SEQ ID NO: 48).

In a further particular embodiment, the Ser/Thr kinase cyclase is an enzyme having at least 30%, preferably at least 40%, 45% or 50%, amino acid sequence identity to any of SEQ ID NO: 15 to 19, and comprising at least one amino acid sequence selected from the group consisting of:

(i) N-A-K-Y-A-X-R-(X) ₂ -S-G-K-G (SEQ ID NO: 84)

(ii) V-H-[V/A]-R-Y-G-A (SEQ ID NO: 85)

(iii) L-H-F-S-N-X-G-G-V-Y-L-A (SEQ ID NO: 86), preferably L-H-F-S-N-

[G/SJ-G-G-V-Y-L-A (SEQ ID NO: 87)

(iv) [V/IJ-V-L-K-E-A-R-P (SEQ ID NO: 88)

(v) G-[A/T]-T-L-X-E-W-X-A-A (SEQ ID NO: 89), preferably G-[A/T]-T-L-X- E-W-[C/S]-A-A (SEQ ID NO: 90)

(vi) a sequence comprising at least 5 consecutive amino acids of any of sequences

(i) to (v), and

(vii) a sequence having at least 98%, preferably at least 99%, sequence identity to any of sequences (i) to (v),

X representing an amino acid independently selected at each occurrence.

Preferably, in this embodiment, B is a peptide chain comprising, or consisting of, the sequence M-D-(X) ₃ -V-(X) ₂ -L-Q-G-X-E-X-V-A-D-G-X-E-L-P (SEQ ID NO: 49), preferably the sequence M-D-[L/I]-[T/A]-[N/D]-V-[I/M]-[D/E]-L-Q-G-X-E-[I/V]-V-A- D-G-[V/I]-E-L-P (SEQ ID NO: 50). Preferably, in each embodiment described above regarding Ser/Thr kinase cyclase related enzymes, the related enzymes have at least 50% amino acid sequence identity to the reference Ser/Thr kinase cyclase(s).

Preferably, in each embodiment described above regarding Ser/Thr kinase cyclase related enzymes, the amino acid sequence vii) is a sequence having at least 99% sequence identity to any of sequences (i) to (v).

Preferably, in each embodiment described above regarding Ser/Thr kinase cyclase related enzymes, the related enzymes comprise at least two amino acid sequences selected from i), ii), iii), iv) and v). In particular, the related enzymes may comprise amino acid sequences i) and ii), i) and iii), i) and iv), i) and v), ii) and iii), ii) and iv), ii) and v), iii) and iv), iii) and v), or iv) and v). More preferably, the related enzymes comprises at least three amino acid sequences selected from i), ii), iii), iv) and v). In particular, the related enzymes may comprise amino acid sequences i), ii) and iii) - i), ii) and iv) - i), ii) and v) - i), iii) and iv) - i), iii) and v) - i), iv) and v) - ii), iii) and iv) - ii), iii) and v) - ii), iv) and v) - or iii), iv) and v). More preferably, the related enzymes comprises at least four amino acid sequences selected from i), ii), iii), iv) and v). In particular, the related enzymes may comprise amino acid sequences i), ii), iii) and iv) - i), ii) iii) and v) - i), ii) iv), and v) - i), iii), iv) and v) - or ii), iii), iv) and v). In particularly preferred embodiments, the related enzymes comprises amino acid sequences of i), ii), iii), iv) and v).

In a particular embodiment, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 11 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 30 and 39 and variants thereof. Preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 11 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 30 and 39 and variants thereof. More preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, SEQ ID NO: 11 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 30 or 39.

In a particular embodiment, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 12 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 31 and variants thereof. Preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 12 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 31 and variants thereof. More preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, SEQ ID NO: 12 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 31.

In a particular embodiment, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 13 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 32 and variants thereof. Preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 13 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 32 and variants thereof. More preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, SEQ ID NO: 13 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 32.

In a particular embodiment, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 14 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 33 and variants thereof. Preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 14 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 33 and variants thereof. More preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, SEQ ID NO: 14 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 33.

In a particular embodiment, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 15 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 34 and variants thereof. Preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 15 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 34 and variants thereof. More preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, SEQ ID NO: 15 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 34.

In a particular embodiment, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 16 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 35 and variants thereof. Preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 16 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 35 and variants thereof. More preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, SEQ ID NO: 16 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 35.

In a particular embodiment, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 17 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 36 and variants thereof. Preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 17 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 36 and variants thereof. More preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, SEQ ID NO: 17 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 36.

In a particular embodiment, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 18 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 37 and variants thereof. Preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 18 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 37 and variants thereof. More preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, SEQ ID NO: 18 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 37.

In a particular embodiment, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 19 and functional variants and related enzymes thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 38 and variants thereof. Preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: 19 and functional variants thereof, and B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: 38 and variants thereof. More preferably, the Ser/Thr kinase cyclase enzyme comprises, or consists of, SEQ ID NO: 19 and B is a peptide chain comprising, or consisting of, SEQ ID NO: 38.

In some particular embodiments,

the cysteine decarboxylase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: X, functional variants and related enzymes thereof, preferably selected from the group consisting of SEQ ID NO: X and functional variants thereof,

the Ser/Thr kinase cyclase enzyme comprises, or consists of, a sequence selected from the group consisting of SEQ ID NO: Y, functional variants and related enzymes thereof, preferably selected from the group consisting of SEQ ID NO: Y and functional variants thereof, and

B is a peptide chain comprising, or consisting of, a sequence selected from the group consisting of SEQ ID NO: Z and variants thereof.

wherein for each particular embodiments X, Y and Z are as defined in the Table below:

Embodiments SEQ ID NO: X SEQ ID NO: Y SEQ ID NO: Z

(enzyme A) (enzyme B) (peptide chain B)

1 SEQ ID NO: 2 SEQ ID NO: 11 SEQ ID NO: 30 or 39

2 SEQ ID NO: 3 SEQ ID NO: 12 SEQ ID NO: 31

3 SEQ ID NO: 4 SEQ ID NO: 13 SEQ ID NO: 32

4 SEQ ID NO: 5 SEQ ID NO: 14 SEQ ID NO: 33 5 SEQ ID NO: 6 SEQ ID NO 15 SEQ ID NO: 34

6 SEQ ID NO: 7 SEQ ID NO 16 SEQ ID NO: 35

7 SEQ ID NO: 8 SEQ ID NO 17 SEQ ID NO: 36

8 SEQ ID NO: 9 SEQ ID NO 18 SEQ ID NO: 37

9 SEQ ID NO: 10 SEQ ID NO 19 SEQ ID NO: 38

Preferably, the cysteine decarboxylase enzyme comprises, or consists of, SEQ ID NO: X, the Ser/Thr kinase cyclase enzyme comprises, or consists of, SEQ ID NO: Y and B is a peptide chain comprising, or consisting of, SEQ ID NO: Z, wherein for each particular embodiments X, Y and Z are as defined in the Table above.

In some embodiments, steps a) and b) of the method of the invention are carried out in vivo in a microbial cell, preferably in a microbial host cell of the invention as described below. Preferably, the microbial cell expresses a gene encoding the linear peptide as defined above, a gene encoding a cysteine decarboxylase as defined above and a gene encoding a Ser/Thr kinase cyclase as defined above. These genes may be endogenous or heterologous. Preferably, at least one of these genes is a heterologous gene. More preferably, the microbial host cell expresses at least a heterologous gene encoding a cysteine decarboxylase or a Ser/Thr kinase cyclase as defined above. Even more preferably, the host cell expresses a heterologous gene encoding a cysteine decarboxylase as defined above and a heterologous gene encoding a Ser/Thr kinase cyclase as defined above. The specific combinations of cysteine decarboxylase- Ser/Thr kinase cyclase, and optionally of sequence B, as described above, may be taken into account to choose the cysteine decarboxylase, the Ser/Thr kinase cyclase and/or the sequence of the linear peptide produced by the host cell.

In some other embodiments, step b) is carried out by contacting in vitro the linear peptide with a cysteine decarboxylase and a Ser/Thr kinase cyclase as defined above.

Each enzyme can be added in the reaction medium in a purified form or in an isolated form. As used herein, the term "isolated enzyme" refers to an enzyme that has been separated from a component of the cell in which it was originally present. In particular, an isolated enzyme may be an enzyme in a cell-free extract, e.g. a cell lysate, a supernatant or a supernatant extract recovered from a culture medium. As used herein, the term "purified enzyme" refers to an enzyme in a composition comprising less about 10%, preferably less than about 5%, and most preferably less than about 1% by weight of any other proteins, excluding proteins added as stabilizers, carriers, excipients.

Each enzyme may be present in a free state or immobilized on appropriate support.

Preferably, the enzymes are immobilized on one or several appropriate supports. After being isolated and purified, the enzymes of interest can be immobilized on a support by any appropriate method described in the state in the art, for instance, by covalent binding, adsorption, entrapment or membrane confinement. A wide variety of supports may be used for immobilizing the enzymes. Convenient supports encompass, without being limited to, plastic, metal, inorganic support such as glass, silica, alumina, bentonite, hydroxyapatite, nickel/nickel oxide, titanium, zirconia, polymeric supports and the like. The support may be in the form of a surface, a powder, micro- or nanobeads, a gel, a solvent-swelling or water-swelling gel or matrix, a reticulated matrix or gel, a membrane, a fibrous support, a porous support and the like. In a particular embodiment, the support is selected among inorganic matrices and polymeric matrices. For instance, supports useful for the invention encompass resins or matrices comprising or consisting in polyoside such as cellulose, carboxymethylcellulose, diethylaminocellulose (DEAE), dextran, cross-linked dextran such as Sephadex®, agarose, cross-linked agarose such as Sepharose®, starches, alginate, chitosan, a synthetic polymer such as polyaminoacids, polyacrylamides, polymers and copolymers based on acrylic acid and derivatives thereof, polyamides, polystyrene, organopolysiloxanes, polyacrylate, polyvinyls polyacrilin, inorganic compounds such as hydroxyapatite, silica or bentonite, and the like. Such supports are commercially available.

For illustration, the enzyme may be entrapped in a polymeric matrix, for instance a matrix of alginate or chitosan. As an alternative, the enzyme may be covalently linked to the support. Typically, the support may contain functional groups able to react directly, or after activation, with an amino acid present in the enzyme so as to create a covalent bound. As another alternative, the enzyme may be absorbed on the support. The interactions between the support and the enzyme may be then stabilized by cross-linking with a bifunctional agent such as glutaraldehyde.

Once prepared, the support comprising the immobilized enzyme having the enzymatic activity of interest can be directly used in the reaction medium. In other words, the support with the immobilized enzyme may be merely added in the reaction medium. When the support is solvent-swelling, the solvent of the reaction may be selected so as to provide an appropriate swelling of the support to render accessible the immobilized enzyme without impairing the catalytic activity of the enzyme.

The suitable reaction medium may be easily chosen by the skilled person based on his general knowledge and the present description. Preferably, this reaction medium comprises ATP.

The linear peptide is contacted with the cysteine decarboxylase and the Ser/thr kinase cyclase of the invention until obtaining the bicyclic compound of formula (I). The cyclization may be monitored by any analytical method known by the skilled person such as RMN, LC-UV and/or LC-MS analysis. The incubation time may be easily chose by the skilled person and may be, for example, from 2h to 20h, preferably from 4h to 14h.

In some embodiments, the method of the invention comprises

a) providing a linear peptide comprising, or consisting of, the sequence B-Xi-Ser-

X ₂ -X ₃ -Ser-X ₄ -X5-Cys (SEQ ID NO: 1),

b) contacting said linear peptide with

- i) a composition comprising Enzyme A, ii) a support on which Enzyme A is immobilized or iii) a wild-type cell or a recombinant host cell able to express Enzyme A, or a cell-free extract thereof; and

- i) a composition comprising Enzyme B, ii) a support on which Enzyme B is immobilized or iii) a wild-type cell or a recombinant host cell able to express Enzyme B, or a cell-free extract thereof, and

c) optionally recovering the bicyclic compound of formula (I).

The linear peptide, enzymes A and B are as defined above.

The composition or support comprising Enzyme A as well as the cell expressing Enzyme A may also comprise or express Enzyme B.

The linear peptide is contacted with the cysteine decarboxylase and the Ser/thr kinase cyclase of the invention until obtaining the bicyclic compound of formula (I). The cyclization may be monitored by any analytical method known by the skilled person such as RMN, LC-UV and/or LC-MS analysis. The bicyclic compound of formula (I) may optionally be recovered, e.g., from the culture supernatant. Extraction of said compound from the culture, and in particular from the supernatant, may be performed by any method known by the skilled person, for example by solid phase extraction, e.g. on XAD resins.

The method may further comprise isolating or purifying said bicyclic peptide. The bicyclic peptide may be purified by any method known by the skilled person, for example using HPLC, ion exchange chromatography, gel electrophoresis, affinity chromatography and the like. In some embodiments, the method of the invention may further comprise cleaving

B. This cleavage may be performed by any method known by the skilled person such as enzymatic digestion. In a particular embodiment, the cleavage may be performed using cyanogen bromide. Cyanogen bromide can cleave a peptide after Met residue. Thus, in this embodiment, the sequence B has to comprise a Met residue at its C-terminal extremity. In particular, the sequence B may comprise, or consist of, the sequence (X) _n - Leu-(X)io-Glu-X-Met (SEQ ID NO: 102), wherein X represents an amino acid independently selected at each occurrence, and n represents an integer selected from 4 to 10, preferably from 5 to 9. All embodiments described above for sequence B and applicable to this generic sequence are also encompassed.

Optionally, the method of the invention may further comprise isolating or purifying the bicyclic peptide without sequence B, i.e. the core peptide. This core peptide may be purified by any method known by the skilled person, for example using HPLC, ion exchange chromatography, gel electrophoresis, affinity chromatography and the like.

In another aspect, the present invention relates to an expression cassette comprising a coding region operably linked to one or more control sequences that direct the expression of said coding region in a suitable host cell under conditions compatible with the control sequences.

The coding region of the expression cassette may comprise

i) a nucleic acid encoding a cysteine decarboxylase (enzyme A),

ii) a nucleic acid encoding a Ser/Thr kinase cyclase (enzyme B), or iii) a nucleic acid encoding a cysteine decarboxylase (enzyme A) and a nucleic acid encoding a Ser/Thr kinase cyclase (enzyme B),

Optionally, the coding region may further comprise a nucleic acid encoding a linear peptide comprising, or consisting of, the sequence B-Xi-Ser-X2-X3-Ser-X4-Xs-Cys (SEQ ID NO: 1).

The cysteine decarboxylase (enzyme A), the Ser/Thr kinase cyclase (enzyme B) and the linear peptide may be selected as defined above for the method of the invention for producing a bicyclic compound of formula (I).

The control sequence may include a promoter that is recognized by a host cell for expression of the coding region. The promoter contains transcriptional control sequences that mediate the expression of the polypeptide. The promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be an endogenous or heterologous promoter. The promoter may be a strong, weak, constitutive or inducible promoter.

Optionally, the expression cassette may also comprise a selectable marker that permits easy selection of recombinant host cells. Typically, the selectable marker is a gene encoding antibiotic resistance or conferring autotrophy.

The expression cassette of the invention may be used directly to transform a host cell and enable the expression of the coding region. Preferably, the expression cassette, or a part thereof comprising the coding region, is inserted in the genome of the host cell.

In a particular embodiment, the expression cassette is integrated in the genome of the host cell.

The present invention also relates to an expression vector comprising an expression cassette according to the invention. The expression vector of the invention may comprise one or several expression cassette of the invention.

In particular, the expression vector may comprise an expression cassette comprising a coding region comprising a nucleic acid encoding a cysteine decarboxylase (enzyme A) and an expression cassette comprising a coding region comprising a nucleic acid encoding a Ser/Thr kinase cyclase (enzyme B).

Optionally, in addition to an expression cassette of the invention, the expression vector may comprise an expression cassette comprising a coding region comprising a nucleic acid encoding a linear peptide comprising, or consisting of, the sequence B-Xi- Ser-X ₂ -X ₃ -Ser-X ₄ -X5-Cys (SEQ ID NO: 1).

The expression vector of the invention may be used to transform a host cell and enable the expression of the coding region in said cell. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be an autonomously replicating vector, i.e., a vector that exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extra-chromosomal element, a mini- chromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Preferably, the vector, or a part thereof comprising the coding region, e.g. the expression cassette of the invention, is inserted in the genome of the host cell.

The vector preferably comprises one or more selectable markers that permit easy selection of host cells comprising the vector. A selectable marker is a gene the product of which provides for antibiotic resistance, resistance to heavy metals, prototrophy to auxotrophy, and the like.

The vector preferably comprises an element that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome. When integration into the host cell genome occurs, integration of the sequences into the genome may rely on homologous or non-homologous recombination. In one hand, the vector may contain additional polynucleotides for directing integration by homologous recombination at a precise location into the genome of the host cell. These additional polynucleotides may be any sequence that is homologous with the target sequence in the genome of the host cell. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.

For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell.

The methods for selecting these elements according to the host cell in which expression is desired, are well known to one of skill in the art. The vectors may be constructed by the classical techniques of molecular biology, well known to one of skill in the art.

The present invention further relates to the use of an expression cassette or an expression vector according to the invention to transform, transfect or transduce a host cell. The present invention also relates to a host cell comprising an expression cassette or an expression vector according to the invention.

The host cell may be transformed, transfected or transduced in a transient or stable manner. An expression cassette or vector of the invention is introduced into a host cell so that the cassette or vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier.

The expression cassette or expression vector according to the invention may be introduced into the host cell by any method known by the skilled person, such as electroporation, conjugation, transduction, competent cell transformation, protoplast transformation, protoplast fusion, biolistic "gene gun" transformation, PEG-mediated transformation, lipid-assisted transformation or transfection, chemically mediated transfection, lithium acetate-mediated transformation or liposome-mediated transformation.

Optionally, more than one copy of a cassette or vector of the present invention may be inserted into the host cell.

The host cell may comprise one or several cassettes or vectors of the present invention. For instance, the host cell may comprise a cassette or vector comprising a nucleic acid encoding a cysteine decarboxylase (enzyme A) as defined above, and a cassette or vector comprising a nucleic acid encoding a Ser/Thr kinase cyclase (enzyme B) as defined above. Optionally, the host cell may further comprise a cassette or vector comprising a nucleic acid encoding a linear peptide comprising, or consisting of, the sequence B-Xi-Ser-X ₂ -X3-Ser-X ₄ -X5-Cys (SEQ ID NO: 1) as defined above. Alternatively, the host cell may comprise a cassette or vector comprising a nucleic acid encoding a cysteine decarboxylase (enzyme A) as defined above and a nucleic acid encoding a Ser/Thr kinase cyclase (enzyme B) as defined above, and a cassette or vector comprising a nucleic acid encoding a linear peptide comprising, or consisting of, the sequence B-Xi-Ser-X ₂ -X ₃ -Ser-X ₄ -X ₅ -Cys (SEQ ID NO: 1) as defined above. The present invention also relates to the use of said host cell comprising an expression cassette or an expression vector according to the invention to produce a bicyclic compound of formula (I).

In particular, the host cell of the invention may be used in the method of the invention to produce a bicyclic compound of formula (I). Thus, the present invention relates to a method of producing a bicyclic compound of formula (I) comprising

- culturing a host cell of the invention expressing a cysteine decarboxylase (enzyme A) as defined above, a Ser/Thr kinase cyclase (enzyme B) as defined above and a linear peptide comprising, or consisting of, the sequence B-Xi-Ser-X2-X ₃ -Ser-X ₄ -X5- Cys (SEQ ID NO: 1) as defined above,

- and optionally recovering said bicyclic compound of formula (I).

Preferably, said host cell comprises a cassette or vector comprising a nucleic acid encoding a cysteine decarboxylase (enzyme A) as defined above, and/or a cassette or vector comprising a nucleic acid encoding a Ser/Thr kinase cyclase (enzyme B).

Thus, in a particular embodiment, the host cell comprises

- a heterologous nucleic acid sequence, cassette or vector, encoding an enzyme

(A) exhibiting a cysteine decarboxylase activity and as defined above, and/or

- a heterologous nucleic acid sequence, cassette or vector, encoding an enzyme

(B) exhibiting a Ser/Thr kinase cyclase activity and as defined above.

The specific combinations of cysteine decarboxylase- Ser/Thr kinase cyclase, and optionally of sequence B, as described above, may be taken into account to choose the cysteine decarboxylase, the Ser/Thr kinase cyclase and/or the sequence of the linear peptide produced by the host cell. In particular, the cysteine decarboxylase enzyme may comprise, or consist of, SEQ ID NO: X, the Ser/Thr kinase cyclase enzyme may comprise, or consist of, SEQ ID NO: Y and B may be a peptide chain comprising, or consisting of, SEQ ID NO: Z, wherein for each particular embodiments X, Y and Z are as defined in the Table above.

In another specific aspect, the present invention relates to a host cell genetically modified to express a heterologous gene encoding a linear peptide as defined above, i.e. a linear peptide comprising, or consisting of, the sequence B-Xi-Ser-X2-X ₃ -Ser-X ₄ -X5- Cys (SEQ ID NO: 1), wherein Xi, X ₂ , X ₃ , X ₄ and X ₅ are independently selected and each represents an amino acid, and B is a peptide chain of a size comprised between 1 and 30 amino acid residues, preferably between 15 and 30 amino acid residues.

Said host cell is preferably selected from microorganisms expressing, or comprising a nucleic acid sequence encoding, an enzyme A as defined above and/or an enzyme B as defined above, preferably an enzyme A and an enzyme B.

Alternatively, said host cell comprises a cassette or vector comprising a nucleic acid encoding a cysteine decarboxylase (enzyme A) as defined above, and/or a cassette or vector comprising a nucleic acid encoding a Ser/Thr kinase cyclase (enzyme B). The specific combinations of cysteine decarboxylase- Ser/Thr kinase cyclase, and optionally of sequence B, as described above, may be taken into account to choose the cysteine decarboxylase, the Ser/Thr kinase cyclase and/or the sequence of the linear peptide produced by the host cell. In particular, the cysteine decarboxylase enzyme may comprise, or consist of, SEQ ID NO: X, the Ser/Thr kinase cyclase enzyme may comprise, or consist of, SEQ ID NO: Y and B may be a peptide chain comprising, or consisting of, SEQ ID NO: Z, wherein for each particular embodiments X, Y and Z are as defined in the Table above.

Preferably, the host cell is a bacterium. In some embodiments, the host cell belongs to Microbacterium, Nocardia, Tsukamurella, Streptomyces, Nocardiopsis or Nonomuraea genus, preferably Microbacterium or Nocardia genus. In some particular embodiments, the host cell is selected from the group consisting of Microbacterium arborescens, Nocardia terpenica, Nocardia altamirensis, Tsukamurella sp. 1534, Streptomyces aureus, Streptomyces flavochromogenes, Streptomyces natalensis, Nocardiopsis chromatogenes and Nonomuraea Candida, preferably from the group consisting of Microbacterium arborescens, Nocardia terpenica and Nocardia altamirensis. In some other embodiments, the host cell is Escherichia coli.

In some particular embodiments,

- the host cell belongs to Microbacterium genus, preferably is Microbacterium arborescens, and B comprises, or consists of, a sequence selected from SEQ ID NO: 30 and 39, and variants thereof, preferably comprises or consists of, SEQ ID NO: 30 or 39; or

- the host cell belongs to Nocardia genus, preferably is Nocardia terpenica or Nocardia altamirensis, and B comprises, or consists of, a sequence selected from SEQ ID NO: 32 and 33, and variants thereof, preferably comprises or consists of, SEQ ID NO: 32 or 33; or

- the host cell belongs to Tsukamurella genus, preferably is Tsukamurella sp. 1534, and B comprises, or consists of, a sequence selected from SEQ ID NO: 31, and variants thereof, preferably comprises or consists of, SEQ ID NO: 31 ; or

- the host cell belongs to Streptomyces genus, preferably is selected from Streptomyces aureus, Streptomyces flavochromogenes and Streptomyces natalensis, and B comprises, or consists of, a sequence selected from SEQ ID NO: 35, 37 and 38, and variants thereof, preferably comprises or consists of, SEQ ID NO: 35, 37 or 38, or

- the host cell belongs to Nocardiopsis genus, preferably is Nocardiopsis chromato genes, and B comprises, or consists of, a sequence selected from SEQ ID NO: 34, and variants thereof, preferably comprises or consists of, SEQ ID NO: 34, or

- the host cell belongs to Nonomuraea genus, preferably is Nonomuraea Candida, and B comprises, or consists of, a sequence selected from SEQ ID NO: 36, and variants thereof, preferably comprises or consists of, SEQ ID NO: 36.

The present invention also relates to the use of said host cell to produce a bicyclic compound of formula (I).

The host cell can be cultivated continuously or discontinuously in the batch process or in the fed batch or repeated fed batch process. The culture medium is selected so as to satisfy the requirements of the particular strain used in the method of the invention. The culture medium that can be used according to the invention generally comprises one or more sources of carbon, sources of nitrogen, inorganic salts, vitamins and/or trace elements. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection).

The present invention also relates to methods for producing a cysteine decarboxylase (enzyme A) and/or a Ser/Thr kinase cyclase (enzyme B) as described herein by using a cell which naturally expresses said enzyme(s) or by using a recombinant host cell according to the invention. In a particular embodiment, the host cell may be a recombinant Escherichia coli expression a cysteine decarboxylase (enzyme A) and/or a Ser/Thr kinase cyclase (enzyme B) as defined above.

All embodiments described above for Enzymes A and B, the method of the invention of producing a bicyclic compound of formula (I) and the host cell of the invention are also encompassed in this aspect.

The method may comprise cultivating a cell, which in its wild-type form is capable of producing the enzyme(s), or a recombinant host cell of the invention, in conditions conducive for production of the enzyme(s), and recovering and/or purifying the enzyme(s).

The cell is cultivated in a nutrient medium suitable for production of the enzymes of the invention using methods known in the art. For example, the cell may be cultivated by shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed- batch, or solid state fermentations) in laboratory or industrial fermenters performed in a suitable medium and under conditions allowing the enzyme to be expressed and/or isolated. The cultivation may take place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the enzyme is secreted into the nutrient medium, the enzyme can be recovered directly from the medium. If the enzyme is not secreted, it can be recovered from cell lysates. The enzyme may be detected using methods known in the art that are specific for the enzyme. These detection methods include, but are not limited to, use of specific antibodies, detection of tag, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the enzyme.

The enzyme may be recovered using methods known in the art. For example, the enzyme may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray- drying, evaporation, and/or precipitation.

The enzyme may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction to obtain substantially pure enzyme. In an alternative aspect, the enzyme is not recovered, but rather a host cell of the present invention expressing the enzyme, or a lysate thereof, is used as a source of the enzyme.

In a further aspect, the present invention also relates to the use of an enzyme A exhibiting a cysteine decarboxylase activity and selected from the group consisting of SEQ ID NO: 2 to 10, functional variants thereof and related enzymes thereof exhibiting a cysteine decarboxylase activity, to produce a bicyclic compound of formula (I).

It also relates to the use of an enzyme B exhibiting a Ser/Thr kinase cyclase activity and selected from the group consisting of SEQ ID NO: 11 to 19, functional variants thereof and related enzymes thereof exhibiting the same enzymatic activity, to produce a bicyclic compound of formula (I).

All embodiments described above regarding these enzymes are also contemplated in this aspect.

In a further aspect, the present invention also relates to a method of producing a lipolanthipeptide, preferably an antimicrobial lipolanthipeptide, comprising

a) producing a bicyclic compound of formula (I) according to the method of the invention and

b) replacing B with a lipophilic moiety.

All embodiments described above for the method of the invention of producing a bicyclic compound of formula (I) are also encompassed in this aspect.

Preferably, step b) comprises removing/cleaving B and adding a lipophilic moiety. The removal of B may be carried out using any method described above.

Optionally, after removal of B, the core peptide may be recovered, isolated or purified, before adding the lipophilic moiety.

The addition of a lipophilic moiety may be performed e.g. chemically or enzymatically. Preferably, this addition is an acylation, more preferably a chemical acylation. In particular, a halogenated lipophilic moiety, preferably a chlorinated lipophilic moiety, may be added to the bicyclic peptide, in the presence of an acylation catalyst, preferably selected from pyridine or 4-dialkylaminopyridines such as 4- dimethylaminopyridine. The lipophilic moiety may be a naturally occurring moiety, a modified naturally occurring moiety or a synthetic one.

In a particular embodiment, the lipophilic moiety is represented as R4-W-L- wherein

L is a bifunctional linker, preferably selected from the group consisting of -C(=0)- , -SO2-, -C(=S)-, -OC(=S)-, -PO-, -OPO-, -OC(=0)-, -NHC(=0)- and -NHC(=S),

W is a saturated or unsaturated linear hydrocarbon chain, optionally substituted and/or interrupted, and

P4 is selected from the group consisting of hydrogen and a basic group.

The bicyclic peptide and the lipophilic moiety are linked via a bifunctional linker. As used herein, the term "bifunctional linker" refers to any chemical group being able to connect two chemical groups, and in particular being able to covalently connect at the same time (i) a hydrocarbon chain and (ii) an amino group.

Typically, L comprises 1 to 25 atoms, preferably 1 to 10 atoms, and at least one heteroatom selected from O, S and P.

Preferably, L is selected from the group consisting of -C(=0)-, -SO2-, -C(=S)-, - 0-C(=S)-, -NH-C(=S)-, -PO-, -OPO-, -OC(=0)- and -NHC(=0)-, more preferably from the group consisting of -C(=0)-, -SO2-, -C(=S)-, -OC(=0)- and -NHC(=0)-.

In preferred embodiments, L is -C(=0)-.

W may be a saturated or unsaturated linear hydrocarbon chain, optionally substituted and/or interrupted, preferably a C6-C20 saturated or unsaturated linear hydrocarbon chain, said chain being optionally (i) interrupted by one or several heteroatoms independently selected from N, S and O, and/or (ii) interrupted by one or several groups independently selected from a phenyl group and a 5 or 6-membered-ring heterocycle, said phenyl group or heterocycle being optionally substituted, for example, by one or several groups independently selected from C1-C3 alkyl groups, -OH and C1-C3 alkoxy groups, and/or (iii) substituted by one or several groups independently selected from C1-C3 alkyl groups, halogens, -OH, methoxy or acetoxy.

In particular embodiments, W is selected from saturated or unsaturated linear hydrocarbon chains as defined above for Y. Furthermore, W may be substituted by one or several groups independently selected from C1-C3 alkyl groups, halogens, -OH, methoxy and acetoxy.

As used herein, C1-C3 alkyl groups encompass methyl, ethyl, propyl and isopropyl. Halogens may be selected from F, CI and Br.

In a particular, the saturated or unsaturated linear hydrocarbon chain may be substituted by one group selected from C1-C3 alkyl groups, halogens, -OH, methoxy and acetoxy, preferably -OH.

In further embodiments, W is a saturated or unsaturated linear hydrocarbon chain, in particular Y as described above, interrupted by one or several heteroatoms independently selected, preferably from N, S and O, and/or by one or several groups independently selected from a phenyl group and a 5 or 6-membered-ring heterocycle, said phenyl group or heterocycle being optionally substituted, for example, by one or several groups independently selected from C1-C3 alkyl groups, -OH and C1-C3 alkoxy groups.

In a particular embodiment, the hydrocarbon chain as described above is interrupted by one or several heterocycles, preferably by one, two or three heterocycles. In such embodiment, the heterocycle(s) may be inserted in the chain in one of the followi

wherein X, Y, W and Z are independently selected from carbon and nitrogen, and

wherein X, W and Z are independently selected from carbon, nitrogen, sulfur and oxygen, and V and Y are independently selected from carbon and nitrogen,

with the proviso that the 5-membered heterocycle is inserted in the chain in one of the following configurations:

when V is nitrogen.

In embodiments wherein the chain is interrupted by several heterocycles, the configuration of each heterocycle may be independently selected from these configurations.

In another particular embodiment, the hydrocarbon chain as described above is interrupted by one or several phenyl groups, preferably by one, two or three phenyl groups. In such embodiment, phenyl groups may be inserted in the chain in one of the follow

In embodiments wherein the chain is interrupted by several phenyl groups, the configuration of each phenyl group may be independently selected from these configurations.

In another embodiment, the chain is interrupted by one or two phenyl groups and one or two heterocycles.

The phenyl groups and/or heterocycles may be jointed, so as to form for example naphthalene, benzofuran, indole and/or quinoline groups, or separated by one or several carbons of the hydrocarbon chain.

The interrupted saturated or unsaturated linear hydrocarbon chain may be any saturated or unsaturated linear hydrocarbon chain Y or W as described above, including substituted and unsubstitued saturated or unsaturated linear hydrocarbon chain. selected from the group consisting of hydrogen and a basic group. In an embodiment, R4 is selected from the group consisting of hydrogen and a

with R5 and R ₆ being independently selected from hydrogen, C1-C3 alkyl groups and -C(=0)R7, and R7 being a C1-C3 alkyl group.

In a specific embodiment, R4 is Ri as defined above.

Further aspects and advantages of the present invention will be described following examples, which should be regarded as illustrative and not limiting. EXAMPLES

Fermentation of Lipolanthipeptides

A 100 ml pre -culture of Microbacterium arborescens in YPG medium (table 1) was grown at 30°C for 24 h and following used to inoculate the main culture in the same growth medium by a ratio of 1 : 10, yielding a starting optical density(OD) of 0.1- 0.3. The main culture was set up in a total volume of 1000 ml and incubated at 30°C for 96 h. Bacterial cells were pelleted by centrifugation (10,000 g, 45 min), the supernatant removed and following stored at 4°C. Table 1: Composition of bacterial growth media. MOPS = 3-(N- morpholino )propanesulfonic acid

Genome Sequencing

Genomic DNA (gDNA) from Microbacterium arborescens (MA) was obtained using standard methods and whole genome sequencing (WGS) was carried out by Genostar sequencing (Montbonnot Saint Martin, France) and by the University of Birmingham (Birmingham, United Kingdom) from which assembled contigs and scaffolds were obtained.

Annotation of the Microvionin Structural Gene and the Microvionin Gene Cluster The assembled genome of MA was analyzed using CloneManager Professional 9

(Sci-Ed Software, Denver, CO, USA), as well as by using the online tools AntiSMASH and PRISM. Automatic annotation using the latter programs however failed to reveal the structural gene or give any indication towards the location of the corresponding gene cluster. The structure of microvionin strongly suggested the cognate amino acid sequence ASLGSQSC (SEQ ID NO: 91). Since we believed microvionin to be of ribosomal origin, the precursor peptide encoded by its structural gene should have this corresponding C- terminal sequence as well as an unknown leader peptide. After initial annotations failed, the genome was manually investigated (in all possible frames) for a gene encoding these eight amino acids followed by a stop codon. This yielded a potential candidate gene (micA) encoding a 27 amino acid peptide matching these predictions. The genome 20,000 bp up- and downstream of micA was again analyzed using the online tools mentioned before, as well as by comparison of all ORF to known proteins using protein BLAST (Basic Local Alignment Search Tool, https://blast.ncbi.nlm.nih.gov/). Potential gene products were further analyzed for structural homology using SwissModel.

Synthesis of the MicA Precursor Peptide

The synthesis of the peptide substrates was performed with automated solid phase peptide synthesis on a Prelude Peptide Synthesizer (Protein Technologies, Tucson, AZ, USA) with a 2-chlorotrityl resin, using a reliable method as previously described (Jungmann et al., ACS Chem. Biol. 2016, 11, 69-76; Reyna-Gonzalez et al., Angew. Chemie Int. Ed. 2016). The synthesized peptide was dissolved in a 1 : 1 mixture of 100 mM Tris-HCl (pH 6.8) and acetonitrile (ACN) and following purified on a preparative HPLC system (HPLC 1100 series, Agilent Technologies, Ratingen Germany) equipped with a Grom™ Sil 120 ODS-4 column with hydrophilic end capping (particle size: 10 μιη, dimensions: 250x20 mm; Grace, Deerfield, IL, USA). MilliQ water was used as solvent A and ACN as solvent B ; both solvents were acidified with 0.1 % [v/v] of formic acid. Separation was achieved with a linear gradient from 10% to 50% solvent B in 25 min, followed by an increase to 95% B in 0.1 min and isocratic conditions for 4 min. The peptide could be retrieved from fractions eluting at a RT of -19-20 min. Fractions containing the peptide were combined, and evaporated to the water phase using a SpeedVac (GeneVac EZ-2 series, SP scientific, Garbsen Germany), frozen and further dried by lyophilisation. Cloning of micKC-Hise and micD-Hise

The micKC and micD genes were PCR amplified from gDNA using Q5 polymerase (New England Biolabs, Frankfurt a.M.), the primers listed in table 2 and standard PCR protocols. Expression vectors were created through Gibson assembly, as previously described (Gibson et al., Nat. Methods 2009, 6, 343-345). Gibson assembly was performed using the vector pET28a+ (Novagen, Darmstadt, Germany), linearized with the restriction enzymes Ndel and Notl (Thermo Fisher Scientific, Dreieich, Germany) and the PCR amplified genes containing overhangs complementary to the vector insert site. The constructed expression vectors were transformed into E.coli DH5a by electroporation. Cells were selected for successful transformation on LB agar containing kanamycin and the vectors were further investigated by plasmid purification (GeneJEt Plasmid Miniprep Kit, Thermo Scientific) and restriction analysis, as well as DNA sequencing (Sequlab, Gottingen, Germany) of inserted genes using commercial primers (table 2). The vectors were consequently transformed into E. coli BL21 LOBSTR (Kerafast, Boston, MA, USA) (Andersen et al., Proteins Struct. Funct. Bioinforma. 2013, 81, 1857-1861) for heterologous gene overexpression.

Table 2: Primer pairs used to amplify the microvionin biosynthesis genes micD and micKC and commercial primers used for sequencing of constructed vectors. Nucleotide sequences homologous to vector backbone underlined. Base pair exchange introduced from primers in bold.

Target Vector,

Name Sequence Used for

digest micD_fwd CTTGTATTTCCAGGGCCAC- Gibson pET28a+ (TEV),

ATGCGCGTGACCATGATCG (SEQ ID NO: 92) assembly Ndel, Notl micD_rev TGGTGGTGGTGCTCGAGTGC- Gibson pET28a+ (TEV),

TCACGGCTGAGTCACCATTC (SEQ ID NO: 93) assembly Ndel, Notl micKC_fwd CTTGTATTTCCAGGGCCAC- Gibson pET28a+ (TEV),

ATGACGTATCTCGACGACCTCTCAG (SEQ ID assembly Ndel, Notl

NO: 94)

micKC_rev TGGTGGTGGTGCTCGAGTGC- Gibson pET28a+ (TEV),

TCAGCGGACAGTGACAGGGGCATAG (SEQ ID assembly Ndel, Notl

NO:95 )

T7_fwd TAATACGACTCACTATAGGG (SEQ ID NO: 96) Sequencing

T7_term GCTAGTTATTGCTCAGCGG (SEQ ID NO: 97) Sequencing Expression of MicKC-Hise

For overexpression of MicKC, E. coli BL21 (DE3) LOBSTR cells, carrying the pET28a_ra ^' cK ^' C-His6 vector, were grown in TB-1 medium (table 1) supplemented with 50 μg/ml kanamycin at 37°C until an OD of -0.3 was reached. To increase the amount of soluble MicKC-His6 produced, ethanol was added to a final concentration of 2 % (v/v) to induce molecular chaperones as previously reported (Sugiki et al. Expert Opin. Drug Discov. 2014, 441, 1-16). The culture was further grown at 37°C until an OD of -0.6 was reached, heterologous gene expression was induced by addition of 0.1 mM Isopropyl-β- D-thiogalactoside (IPTG), after which the cultures were cooled on ice for 30 min. Following induction, the cooled cultures were grown for additional 24 h at 18°C, after which cells were harvested by centrifugation and either processed directly or stored at - 80°C. The cells were resuspended in lysis buffer (50 mM NaH ₂ P04, pH 8.0, 300 mM NaCl, 10 mM imidazole, 1% glycerol, 1 mM DTT, 10 mM MgCl ₂ ), disrupted by a french press (Sim-Aminco, Rochester, USA) at 20,000 p.s.i. and centrifuged for 40 min at 40,000 g to remove cell debris. All steps of the purification were performed at 4°C. The cell lysate was following incubated shaking with Ni-NTA agarose beads for 60 min and transferred to a fretted column. The resin was washed once with 20 ml lysis buffer and subsequently with 10 ml wash buffer 1 (same composition as the lysis buffer, yet containing 20 mM imidazole) and 5 ml wash buffer 2 (40 mM imidazole) and finally eluted twice with 1 ml elution buffer (250 mM imidazole). Elution fractions were checked for the eluted protein by SDS-PAGE gel electrophoresis after which a buffer exchange into assay buffer (20 mM Tris-HCl, pH 8.5, 1 mM DTT, 1% glycerol, 10 mM MgCh, 100 mM NaCl) and subsequent concentration was conducted using Amicon Ultra centrifugal filters (Sigma Aldrich). The protein concentration was measured photometrically at a wavelength of 280 nm using a "Nanophotometer P330" (IMPLEN, Munich Germany). The molar extinction coefficient of MicKC -His6 (100,270 M ¹ cm ¹ ) was calculated using the ExPASy "ProtPram" online tool (http://web.expasy.org/cgi- bin/protparam/protparam). Purified MicKC-His6 is shown in Figure 4. Expression of MicD-Hise

Overexpression of MicD-His6 was conducted using E. coli BL21 (DE3) LOBSTR cell carrying the expression vector pET28a+_ra ^' cD-His6 in TB-1 medium (see above). The cultures were grown at 37 °C until an OD of ~ 0.6 was reached after which gene expression was induced with 0.1 mM IPTG. The cultures were grown at 37°C for additional 4 h after which the temperature was lowered to 18°C. The cultures were grown for additional 20 h at this temperature and following harvested as described above. The protein purification followed the same procedure as described for MicKC-His6 with the following exception. Initial test-experiments using MicD showed only minimal enzymatic activity, indicating only limited binding of the corresponding flavin cofactor (FAD or FMN, data not shown) during heterologous expression in E. coli. It was furthermore reported, that the stability of heterologously expressed enzymes can increase drastically when the corresponding cofactor is present. Therefore, the lysis buffer (see above) was supplemented with 0.1 mM of FAD and FMN to ensure that all MicD is able to bind the corresponding cofactor during lysis to increase the stability. All following buffers (wash buffers 1 & 2, elution buffer and assay buffer) did not contain any additional FAD or FMN to ensure removal of excess, unbound FAD/ FMN during purification. All other steps corresponded the ones described above. The calculated molar extinction coefficient calculated for MicD-His6 for photometrical concentration determination was 30,940 M ¹ cm ¹ . Purified MicD-His6 is shown in Figure 5.

MicKC and MicD in vitro Functional Assays

For the MicKC (SEQ ID NO: 11) and MicD (SEQ ID NO: 2) functional assays, the lyophilized, synthetic precursor peptide was weighed in and dissolved in assay buffer (20 mM Tris-HCl, pH 8.5, 10 mM MgCh, 1% Glycerol, 100 mM NaCl, ImM DTT) to a concentration of 200 μΜ (ΙΟχ). All assays were conducted in a total volume of 100 μΐ in assay buffer. The MicKC assay mixtures additionally contained 20 μΜ MicA, 2.1 μΜ MicKC-His6 and 5 mM ATP (or alternatively CTP, GTP, UTP or no NTP), whereas the reactions with MicD contained 50 μΜ MicA, 27.2 μΜ MicD-His6. The MicD + MicKC reactions contained 20 μΜ MicA, 7.2 μΜ MicKC-His6, 6.5 μΜ MicD-His6 and 5 mM ATP. All reactions were incubated at 28°C for 14h and afterwards quenched by addition of 100 μΐ acetonitrile (ACN). The reaction mixtures were centrifuged at 12000 g for 15 min to remove precipitated protein and the supernatant analysed by LC-ESI-MS, tandem MS experiments and derivatized with iodoacetamide (IAA) to confirm formation of the avionin ring structure.

5 Acetylation of Free Thiol Groups with IAA

Reaction of IAA with cysteines

To determine if the cysteine thiol group formed an avionin moiety with the Dha 10 moieties, the quenched reactions were treated with IAA. A free thiol group (hence no ring formation) should result in a positive mass shift of 56 Da. Therefore, 20 μΐ of the quenched reaction was taken aside and 2 μΐ of a freshly prepared 500mM IAA solution in MQ water was added, as well as 1 μΐ of 50 mM TCEP and 27 μΐ of 100 mM Tris-HCl buffer (pH 8.6). The reaction was incubated at room temperature in the dark for 3h, after 15 which the reaction was quenched by addition of 2 μΐ of 1 M DTT ,to eliminate excess IAA and prevent further side reactions. The reactions were further analysed by LC-ESI- MS (results see figure 6).

HPLC-ESI-MS and HPLC-ESI-MS/MS Experiments

All standard HPLS-MS analyses were conducted using an Exactive ESI-Orbitrap- 20 MS (Thermo Fisher Scientific, Bremen, Germany) coupled to an analytical Agilent 1200 HPLC system (Agilent, Waldbronn, Germany) equipped with a GRACE Grom-Sil 120 ODS-4 HE column (dimensions: 50.0x2.0 mm; Grace, Deerfield, IL, USA). The mobile phase consisted of water as solvent A and acetonitrile as solvent B, both supplemented with 0.1% formic acid. The gradient was set to increase linear form 5 - 100 solvent B in 25 17 min. Measurements were conducted in positive ionization mode. All tandem MS (MS/MS) experiment were conducted using a Agilent 1200 HPLC System (Agilent Technologies) coupled to a LTQ-Orbitrap XL mass spectrometer equipped with a GRACE Grom-Sil 120 ODS-5ST column (dimensions: 100x2 mm; Grace). Solvents A and B were the same as described above, with a linear gradient from 5-100% solvent B in 16 min. All ESI-MS/MS experiments were conducted in FTMS mode with a resolution of R = 15,000. Collision induced fragmentation (CID) with a normalized collision energy of 35% was performed for fragmentation of the respective peptide ions. Collected Data of all MS and tandem MS experiments was analyzed using the Thermo Xcalibur 2.2.software.

In silico Investigation of Lipolanthine Gene Clusters

Genome Mining for Potential Lipolanthine Producers

Genome mining for further lipolanthine gene cluster was performed using

BLASTp with MicD (SEQ ID NO: 2) and MicKC (SEQ ID NO: 11) as query sequences. Hits were analyzed manually for genomes containing putative genes for both modifying enzymes. Putative gene clusters were analyzed by AntiSMASH and PRISM and manual annotation of all potential ORF's using BLAST. Alignments of amino acid sequences was conducted using Clustal omega (http://www.ebi.ac.uk/Tools/msa/clustalo/). Structural genes were determined by manually searching for small ORF' s coding for the C-terminal sequence SxxSxxC. This resulted in discovery of over 15 putative strains capable of avionin formation of which only 5 (M. arborescens ND21, Microbacterium TS-1, Nocardia terpenica (NT), Nocardia altamirensis (NA) and Tsukamurella sp. 1534 (TS)) further contained homologous genes for potential MGFA (Methyl guanidino fatty acid) addition and 5 contained a type I PKS and a matching potential precursor peptide (Streptomyces aureus (SA), Streptomyces flavochromogenes (SF), Streptomyces natalensis (SN), Streptomyces chromogenes (SC) and Nonomuraea Candida (NC)) (Table 3). Analysis of the two gene clusters from Microbacterium strains ND21 and TS-1 showed an overall homology of the respective genes of 93-98% compared to Microbacterium arborescens (MA) and only one amino acid substitution in the precursor peptide (figure 7, Arb).

Table 3: Genome sequences investigated for lipolanthine gene clusters.

accession number or

Strain Abbreviation Cluster

identifier Microbacterium arborescens MA Mic CIP 55.81T

NCBI BioSample:

Microbacterium arborescens ND21 - Arb

SAMN05211039

Uniprot taxon identifier :

Microbacterium sp. TS-1 - Arb

1344956

Nocardia terpenica NT Noc DSM 44935

Nocardia altamirensis NA Noa DSM 44997

Tsukamurella sp. 1534 TS Tsu -

Streptomyces aureus SA Aur DSM 41785

Streptomyces flavochromogenes SF Fla DSM 40541

Nocardiopsis chromato genes NC Chr DSM 44844

Nonomuraea Candida NO Can DSM 45086

Streptomyces natalensis SN Nat DSM 40357

Phylogenetic Relationship of Cysteine Decarboxylases and Ser/Thr Kinase- Cyclases

The novel amino acid moiety avionin present in microvionin was predicted to be installed by the action of the homo oligomeric cysteine decarboxylase (HFCD) MicD and the Ser/Thr kinase-cyclase MicKC. Aminovinyl-cysteine (AviCys)- lanthionin structures are well known PTM (Post-translational modification) in lanthipeptides, and the corresponding HFCD's were investigated on multiple occasions (Blaesse et al., EMBO J. 2000, 19, 6299-6310; Steinbacher et al., J. Mol. Biol. 2003, 327, 193-202; Blaesse et al., Acta Crystallogr. - Sect. D Biol. Crystallogr. 2003, 59, 1414-1421 ; Sit et al., Acc. Chem. Res. 2011, 44, 261-268). including crystal structures of the enzymes as well as analysis of the occurring reaction via NMR and MS measurements. The generally accepted reaction mechanism is the oxidation of the C-terminal cysteine involving the flavin cofactor and the subsequent decarboxylation yielding a reactive thio-enol intermediate, which can undergo multiple non-enzymatic side reactions, if the Dha/Dhb residue for formation of the lanthionin is not present. Previous reports describe varying substrate promiscuity towards to the amino acid sequence preceding the C-terminus (Sit et al., Acc. Chem. Res. 2011, 44, 261-268). However, only C-terminal cysteine with a free thiol group was found to be accepted, hence suggesting a mechanism in which the decarboxylation takes place prior to cyclization. Based on crystal structures (of EpiD and MrsD) and multiple sequence alignments, Blaesse and coworkers found multiple highly conserved residues making up the active site, as well as two conserved motifs involved in cofactor and substrate binding, termed the PASANT- and PXMNXXMW- motifs. We therefore wondered how conserved these residues were in the presently discovered HFCD's involved in avionin formation as well as how conserved these enzymes were between different groups (lipolanthines type I, lipolanthines type II, AviCys- lanthionines). All amino acid sequences were aligned using Clustal omega and the corresponding alignment used to calculate cladograms and similarity matrixes using the online tool "simple phylogeny" (http://www.ebi.ac.uk/Tools/phylogeny/simple_phylogeny/). This however showed that the motifs previously shown to be highly conserved in HFCD's are not as conserved in the lipolanthine HFCD's. While multiple amino acids from the PASANT motifs are also rather conserved, the PXMNXXMW motif showed no conservation in the present enzymes.

The obtained similarity matrix calculated from these alignments, as well as the cladogram show a significantly similarity of the enzymes from the type II cluster between each other compared to all other enzymes (figures 8 and 9). The same can be said for three enzymes from type I clusters, namely TsuD, NocD and NoaD, surprisingly however not MicD. This enzyme from the microvionin cluster exhibits nearly the same similarity towards sequences from both type I and type II clusters.

We performed the same analysis for MicKC (Figures 10 and 11). As a comparison other Ser/Thr kinase-cyclases from previous reports were chosen, installing labionin (CurKC, LabKC, AciKC, EryKC) and lanthionin (RamC) structures (table 4). This resulted in the same relationships observed before for the HFCD's. The corresponding enzymes from type I and II cluster show a closer relationship, again excluding MicKC, which only has limited identity (22-27%) to all other sequences.

Table 4: Sources of the protein sequences used for alignments of the cysteine decarboxylases and Ser/Thr kinase-cyclases, as well as the bacterial origin and the natural product biosynthesis in which they are involved in with corresponding references.

NCBI accession

Protein Bacterial strain Biosynthesis of

number

TsuKC WP_019202639.1 Tsukamurella sp. 1534 - TsuD WP_019202638.1

NoaKC WP_069160307.1 Nocardia altamirensis -

NoaD WP_069160306.1

NocKC WP_067581329.1

Nocardia terpenica Nocavionin

NocD WP_067581327.1

ChrD WP_017622804.1

Nocardiopsis chromatogenes -

ChrKC WP_017622803.1

NatD WP_044362958.1

Streptomyces natalensis -

NatKC WP_030066275.1

CanD WP_043635863.1

Nonomuraea Candida -

CanKC WP_043635860.1

FlaD WP_051820261.1

Streptomyces flavochromogenes -

FlaKC WP_030318172.1

AurD WP_055599455.1 Streptomyces aureus -

MrsD WP_032863857.1 Bacillus sp. strain HIL Y-85, 54728 Mersacidin

MutD AAG48568.1 Streptococcus mutans Mutacin

GdmD ABC94905.1 Staphylococcus gallinarum Τϋ 3928 Gallidermin

EpiD P30197.1 Staphylococcus epidermidis Epidermin

AciKC WP_015792832.1 Catenulispora acidiphila Catenulipeptin

CurKC WP_012853928.1 Thermomonospora curvata Curvopeptin

RamC WP_01 1031 100.1 Streptomyces coelicolor A3 SapB

EryKC WP_0099491 10.1 Saccharopolyspora erythraea Erythreapeptin

LabKC CAX48971.1 Actinomadura namibiensis Labyrinthopeptin

Conclusion

MicD and micKC genes were cloned into individual expression vectors and investigated in vitro, using synthetic precursor peptides as substrates. Lanthipeptide cyclases dehydrate Ser/ Thr residues by phosphorylation using a nucleotide triphosphate and subsequent elimination yielding the Dha/ Dhb moiety. This class of enzymes was shown to have varying co-substrate preferences.

To determine the NTP preference of MicKC, its enzymatic activity was investigated in the presence of either ATP, GTP, CTP, or UTP. This revealed a clear preference for ATP, which resulted in a single dehydrated main product, whereas no significant reaction was observed with any other NTP (Figure 12). Through tandem MS experiments the site of the dehydration was determined to Ser ⁵ of the core peptide (figure 13). We therefore wondered if the second dehydration and subsequent cyclization required the prior decarboxylation through MicD. The incubation of MicA together with both enzymes in the presence of ATP resulted in a main product with a mass reduction of 82 Da corresponding to two dehydrations (-36 Da) and oxidative decarboxylation (-46 Da, Figure 14). To confirm the formation of the avionin ring, the reactions were derivatized with iodoacetamide (IAA), which alkylates thiol residues resulting in a +57 Da mass shift. A significant derivatization was observed with unmodified MicA and the MicKC dehydration product. The product formed through the reaction with MicKC and MicD did not significantly react with the reagent, hence suggesting that the majority of the reaction indeed formed the avionin ring structure (figure 6).

Investigation of MicD in the absence of MicKC was rather difficult due to multiple reactions occurring besides the expected oxidative decarboxylation. This was to be expected, since this reaction yields a reactive thio-enol intermediate, which can undergo multiple non-enzymatic side-reactions. These results suggest a mechanism in which MicKC dehydrates Ser ⁵ but requires the decarboxylation through MicD prior to the second dehydration and subsequent cyclization. This mechanism might be employed to prevent a cyclization of the thio-enol with the incorrect Dha residue. In the same respect, the oxidative decarboxylation by MicD needs the prior dehydration by MicKC to prevent non-enzymatic side reactions as observed in Figure 14. Taken together, our observations show that lipolanthines represent a new class of lipidated lanthipeptides in which, to our current understanding, an avionin moiety is installed through the cooperative actions of the cysteine decarboxylase MicD and the Ser/ Thr kinase-cyclase MicKC. The biosynthetic mechanism is different to the one exhibited by related enzymes as LabKC or CurKC, since MicKC is unable to cyclize MicA in the absence of MicD.