MICROORGANISM

FIELD OF THE INVENTION

The present invention relates to a method for the fermentative production of ethylenediamme, by culturing a genetically modified microorganism in an appropriate culture medium. The microorganism is genetically modified in a way that it comprises an ethylenediamme biosynthesis pathway from serine.

Ethylenediamine is a strongly basic amine, colorless liquid with an ammonia-like odor. It is a widely used building block in chemical synthesis with an approximately worldwide production of 190kT/year. Ethylenediamine is manufactured industrially by chemical processes from 1,2-dichloroethane and ammonia under pressure at 180°C in an aqueous medium. Another industrial route to ethylenediamine involves the reaction of ethanolamine and ammonia. In these ways diethylenetriamine (DETA) and triethylenetetramine (TETA) are formed as by-products.

Ethylenediamine is used in large quantities for production of many industrial chemicals such as solvent, corrosion inhibitor in paints and coolants, source of iodine in animal feeds, chemicals for color photography developing, binders, adhesives, fabric softeners, curing agents for epoxys and dyes. Ethylenediamine is a well-known chelating ligand for coordination compounds. In particular, the most prominent derivative of ethylenediamine is EDTA (ethylenediaminetetraacetic acid). Ethylenediamine is a precursor or a component of pharmaceuticals like aminophylline or some antihistaminics and agrochemicals like some imidazoline-containing fungicides.

Further, the bleaching activator tetraacetylethylenediamine is generated from ethylenediamine. The derivative N,N-ethylenebis(stearamide) is a commercially significant mold-release agent and a surfactant in gasoline and motor oil.

Moreover, ethylenediamine, due to its two amine groups, is widely used as precursor to various polymers: it is widely used in the production of polyurethane fibers.

Thus there exists a need for alternative method for efficiently producing commercial quantities of ethylenediamine, without using chemical processes. In this context, the inventors have identified biosynthetic pathways to produce ethylenediamine by fermentation.

Fermentative production of ethylenediamine has never been described and there is no biosynthesis pathway described in the prior art to produce ethylenediamine from a simple source of carbon.

The biological production of ethylenediamine according to the invention requires the formation of serine as an intermediate. Serine is an amino acid that is used for the production of tryptophan, cysteine, glycine and one-carbon units (Umbarger et al, 1978 and Ravnikar et al., 1987).

From glucose or any simple sugar, the glycolytic intermediate 3-phosphoglycerate is converted to serine in three steps. 3-phosphoglycerate dehydrogenase (serA gene product) oxidizes 3-phosphoglycerate to 3-phosphohydroxypyruvate, the first committed step in the biosynthesis pathway. 3-phosphoserine aminotransferase (serC gene product) converts 3-phosphohydroxypyruvate to 3-phosphoserine, which is then dephosphorylated to L-serine by 3-phosphoserine phosphatase (serB gene product). Serine is converted to glycine and a CI unit by serine hydro xymethyltransferase (SHMT) (glyA gene product). Serine can also be converted to pyruvate by serine deaminases encoded by sdaA and sdaB. The flux in the serine pathway is regulated i) at the enzymatic level by feed back inhibition of the 3-phosphoglycerate dehydrogenase and ii) at the genetic level as serA is negatively regulated by the crp-cyclic AMP complex. SerA gene is also regulated by the leucine- responsive regulatory protein (Lrp) and leucine although Lrp might act indirectly on the serA promoter. On the other hand serB and serC expressions seem to be constitutive.

The problem to be solved by the present invention is the development of biosynthesis pathways for the production of ethylenediamine, to avoid the use of chemical processes and the use of non-renewable sources of carbon, such as crude oil. The inventors have found a method for the fermentative production of ethylenediamine from any sugar or simple source of carbon, with serine as intermediate, which is performed by a genetically modified microorganism on an appropriate culture medium comprising carbon and nitrogen sources. The genetically modified microorganism comprising at least one ethylenediamine biosynthesis pathway, able to convert a carbon substrate into serine and then convert serine into ethylenediamine, has been reduced to practice and efficiently solves the problem of the invention.

SUMMARY OF THE INVENTION

The invention relates to a method for the fermentative production of ethylenediamine from a simple source of carbon and a source of nitrogen, comprising culturing a microorganism in an appropriate culture medium comprising the sources of carbon and nitrogen, and recovering the ethylenediamine from the culture medium, wherein the microorganism comprises at least one biosynthesis pathway converting L- serine to ethylenediamine, that is composed of

i) at least two enzymes selected among the group of a decarboxylase, a transaminase and a dehydrogenase (pathway A, C or D); or composed of : ii) the successive actions of serine hydroxymethyl transferase, an aldehyde oxydase and a transaminase (pathway B); or composed of

iii) the successive actions of an amino acid N-acetyl transferase, an alcohol dehydrogenase, a transaminase , a deacetylase and an amino acid decarboxylase (pathway E).

In a specific embodiment of the invention, the microorganism is genetically modified to comprise at least one of the biosynthesis pathway A, B, C, D or E.

In a particular embodiment, the invention relates to a method for the fermentative production of ethylenediamine wherein the genetically modified microorganism further comprises one of the following modifications:

- Attenuation of at least one gene selected among: gpmA, gpmM, glyA, sdaA, sdaB, cysE, trpAB, potABCD, potFGHI, and/or,

Overexpression of at least one gene selected among: gdhA, cadBA, potE, serB, serC, and serA or serA allele encoding for an enzyme with reduced feed-back inhibition to serine {serA *).

BRIEF DESCRIPTION OF DRAWINGS.

The accompanying drawing which is incorporated in and constitute a part of this specification exemplifies the invention and together with the description serve to explain the principles of this invention.

Figure 1 : Five metabolic pathways (A, B, C, D and E) for biosynthesis of ethylenediamine from serine as intermediate. DETAILED DESCRIPTION OF THE INVENTION

Before describing the present invention in detail, it is to be understood that this invention is not limited to particularly exemplified methods and may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting, which will be limited only by the appended claims.

All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. However, publications mentioned herein are cited for the purpose of describing and disclosing the protocols, reagents and vectors that are reported in the publications and that might be used in connection with the invention.

Furthermore, the practice of the present invention employs, unless otherwise indicated, conventional microbiological and molecular biological techniques within the skill of the art. Such techniques are well known to the skilled worker, and are explained fully in the literature. See, for example, Prescott et al. (1999) and Sambrook et al. (1989) (2001).

It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to "a microorganism" includes a plurality of such microorganisms, and a reference to "an exogenous gene" is a reference to one or more exogenous genes, and so forth. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any materials and methods similar or equivalent to those described herein can be used to practice or test the present invention, the preferred materials and methods are now described.

In the claims that follow and in the consecutive description of the invention, except where the context requires otherwise due to express language or necessary implication, the word "comprise", "contain", "involve" or "include" or variations such as "comprises", "comprising", "containing", "involved", "includes", "including" are used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention. Definitions

The term "ethylenediamine" (IUPAC name 1,2-Diaminoethane, systematic name Ethane- 1,2-diamine, common synomym Edamine) designates the organic compound with the formula C ₂ H ₄ (NH ₂ )2 and with the CAS number 107-15-3.

The term "biosynthesis pathway" designates, in this application, the different steps catalysed by different enzymes that convert the intermediate L-serine into ethylenediamine in a microorganism.

The term "convert" or "conversion" designates the chemical step that transforms a product A into the product B. It may be catalysed by an enzyme or occurred spontaneously.

The term "serine" designates the polar amino-acid with chemical formula

H0 ₂ CCH(NH ₂ )CH ₂ OH.

The term "microorganism", as used herein, refers to a bacterium, archae or fungus which is not modified artificially. Preferentially, the microorganism of the invention is chosen among the Enterobacteriaceae, Clostridiaceae, Bacillaceae, Nitrosomonadaceae, Methanosarcinacea, Halobacteriaceae, Geobacteraceae, Carnobacteriaceae, Streptomycetaceae, Corymb acteriaceae, and Saccharomycetaceae families. More preferentially, the microorganism is a species of Escherichia, Klebsiella, Pantoa, Salmonella, Clostridium, Bacillus, Nitrosomonas, Methanosarcina, Halobacterium, Geoalkalibacter, Alkalibacterium, Bacillus okhensis or Bacillus alcalophilus, Pseudomonas, Corynebacterium, or Saccharomyces.

The term "genetically modified microorganism" or "recombinant microorganism", as used herein, refers to a microorganism genetically modified or genetically engineered. It means, according to the usual meaning of these terms, that the microorganism of the invention is not found in nature and is modified either by introduction, by deletion or by modification of genetic elements. It can also be transformed by forcing the development and evolution of new metabolic pathways in combining directed mutagenesis and evolution under specific selection pressure (see for instance WO 2004/076659).

The terms "overexpression", "enhanced expression" or "increased expression" and grammatical equivalents thereof, are used interchangeably in the text and have a similar meaning. These terms mean that the expression of a gene or an enzyme is increased compared to a non modified microorganism. Increased expression of an enzyme is obtained by increasing expression of the gene encoding said enzyme.

To increase the expression of a gene, the man skilled in the art knows different techniques:

- Increasing the number of copies of the gene in the microorganism. The gene is encoded chromosomally or extra-chromosomally. When the gene is located on the chromosome, several copies of the gene can be introduced on the chromosome by methods of recombination, known to the expert in the field, including gene replacement. When the gene is located extra-chromosomally, it may be carried by different types of plasmids that differ with respect to their origin of replication and thus their copy number in the cell. These plasmids are present in the microorganism in 1 to 5 copies, or about 20 copies, or up to 500 copies, depending on the nature of the plasmid : low copy number plasmids with tight replication (pSClOl, RK2), low copy number plasmids (pACYC, pRSFlOlO) or high copy number plasmids (pSK bluescript II).

- Using a promoter inducing a high level of expression of the gene. The man skilled in the art knows which promoters are the most convenient, for instance promoters Ftrc, Ftac, Viae, or the lambda promoter cl are widely used. These promoters can be "inducible" by a particular compound or by specific external condition like temperature or light. These promoters may be homologous or heterologous. - Attenuating the activity or the expression of a transcription repressor, specific or non-specific of the gene.

- Using elements stabilizing the corresponding messenger RNA (Carrier and Keasling, 1999) or elements stabilizing the protein (e.g., GST tags, GE Healthcare).

- Modifying Ribosome Binding Site (RBS) sequences and sequences surrounding them.

The terms "attenuation" or "expression attenuated" mean that the expression of a gene or an enzyme is decreased or suppressed compared to a non modified microorganism. Decrease or suppression of the expression of an enzyme is obtained by the attenuation of the expression of gene encoding said enzyme.

Attenuation of genes may be achieved by means and methods known to the man skilled in the art. Generally, attenuation of gene expression may be achieved by:

- Mutating the coding region or the promoter region or,

- Deleting of all or a part of the promoter region necessary for the gene expression or,

- Deleting the coding region of the gene by homologous recombination or,

- Inserting an external element into the coding region or into the promoter region or,

- Expressing the gene under control of a weak promoter or,

- Modifying RBS sequences and sequences surrounding them.

The man skilled in the art knows a variety of promoters which exhibit different strength and which promoter to use for a weak genetic expression.

Further to modulate the activity of an enzyme, the man skilled in the art can use evolved enzymes.

The term "evolved enzyme" designates enzymes that possess at least one mutation in their sequence, in comparison with the amino-acid sequence of the wild-type enzyme, said mutation leading to an increase of their activity, or a change of their specificity for a specific substrate. These enzymes have been based on function of their improved activity or specificity for the substrate. In particular, these enzymes can be specific for a substrate in their wild-type state, and become specific for another substrate after the mutation(s) occurs. The genes encoding for these selected enzymes could be heterologous or homologous genes.

Evolved enzymes can be obtained according to all techniques well known by the man skilled in the art, in particular such as presented in patents EP 1597364 and EP 1704230. Screening of mutated enzymes can be performed from banks of mutated proteins generated by random mutagenesis. All evolved enzymes are tested for their activity and substrate specificity in a 'test' microorganism or in vitro; the enzymes showing an improved activity and/or a change in their specificity for the substrate are identified and isolated, and preferentially are sequenced to identify the existing mutations. The genes encoding these identified evolved enzymes are cloned into a vector and introduced into the microorganism according to the invention.

All techniques for transforming the microorganism, in particular to introduce expression vectors, and regulatory elements used for enhancing the production of ethylenediamine, are well known in the art and available in the literature, including the applicant's own patent applications on the modification of biosynthesis pathways in various microorganisms , including WO 2008/052973, WO 2008/052595, WO 2008/040387, WO 2007/144346, WO 2007/141316, WO 2007/077041, WO 2007/017710, WO 2006/082254, WO 2006/082252, WO 2005/111202, WO 2005/073364, WO 2005/047498, W O 2004/076659 , the content of which is incorporated herein by reference.

Expression vectors carrying genes encoding enzymes of the biosynthesis pathway allow the overexpression of said genes and corresponding encoded enzymes.

The terms "encoding" or "coding" refer to the process by which a polynucleotide, through the mechanisms of transcription and translation, produces an amino-acid sequence. The gene(s) encoding the enzyme(s) can be exogenous or endogenous.

The term "endogenous gene" means that the gene was present in the microorganism before any genetic modification, in the wild-type strain. Endogenous genes may be overexpressed by introducing heterologous sequences in addition to, or to replace endogenous regulatory elements, or by introducing one or more supplementary copies of the gene into the chromosome or a plasmid. Endogenous genes may also be modified to modulate their expression and/or activity. For example, mutations may be introduced into the coding sequence to modify the gene product. Modulation of an endogenous gene may result in the up-regulation and/or enhancement of the activity of the gene product, or alternatively, down regulate and/or lower the activity of the endogenous gene product.

Another way to modulate their expression is to exchange the endogenous promoter of a gene (e.g., wild type promoter) with a stronger or weaker promoter to up or down regulate expression of the endogenous gene. These promoters may be homologous or heterologous. It is well known within the ability of the person skilled in the art to select appropriate promoters.

Moreover, a microorganism may be modified to express exogenous genes if these genes are introduced into the microorganism with all the elements allowing their expression in the host microorganism.

The term "exogenous gene" or "exogenous nucleic acid sequence" means that a gene, from the same species or from a different species, was introduced into a microorganism, by means well known by the man skilled in the art whereas this gene is not naturally occurring in the microorganism. Exogenous genes may be integrated into the host chromosome, or be expressed extra-chromosomally by plasmids or vectors as described above. A variety of plasmids, which differ with respect to their origin of replication and their copy number in the cell, are well known in the art. These genes may be heterologous or homologous.

In the present application, all genes are referenced with their common names and with references that give access to their nucleotidic sequences on the websites http ://www.ncbi.nlm.nih. go v/gene or htt :/ ^' / www, ebi. ac.uk/embl/.

Using the references given in Genbank for known genes, those skilled in the art are able to determine the equivalent genes in other organisms, bacterial strains, yeast, fungi, mammals, plants, etc. This routine work is advantageously done using consensus sequences that can be determined by carrying out sequence alignments with genes derived from other microorganisms and designing degenerated probes to clone the corresponding gene in another organism. These routine methods of molecular biology are well known to those skilled in the art, and are claimed, for instance, in Sambrook et al, (1989) and (2001).

The term "activity" of an enzyme is used interchangeably with the term "function" and designates, in the context of the invention, the reaction that is catalyzed by the enzyme. The man skilled in the art knows how to measure the enzymatic activity of said enzyme.

The terms "attenuated activity" or "reduced activity" of an enzyme mean either a reduced specific catalytic activity of the protein or reduced specificity for its substrate obtained by mutation in the amino-acid sequence and/or a decrease of the concentration of the protein in the cell obtained by mutation of the nucleotidic sequence or by the deletion of the coding region of the gene.

The terms "enhanced activity" or "increased activity" of an enzyme designate either an increased specific catalytic activity of the enzyme or an increased specificity for the substrate, and/or an increased concentration/ availability of the enzyme in the cell, obtained for example by overexpressing the gene encoding the enzyme.

The term "specificity" designates affinity of an enzyme for a precise substrate. According to the invention, specificity of an enzyme means that this enzyme recognizes one substrate as preferred substrate among all other substrates. Affinity of an enzyme can be defined by the Michaelis constant value (Km). Enzymes that have a low Km value have high affinity to the substrate and act at maximal velocity at low substrate concentration whereas enzymes with a high Km value have low affinity to substrate and need high concentration of substrate to react.

The terms "feed-back inhibition" or "feed-back sensitivity" refer to a cellular mechanism control in which one or several enzymes that catalyse the production of a particular substance in the cell are inhibited or less active when this substance or its precursors have accumulated to a certain level. So the terms "reduced feed-back inhibition" or "reduced feed-back sensitivity" mean that the activity of such a mechanism is decreased or suppressed compared to a non modified microorganism. The man skilled in the art knows how to modify the enzyme to obtain this result. Such modifications have been described in patent application WO 2007/144346.

The terms "fermentative production" or "culture" or "fermentation" are used to denote the growth of microorganisms. This growth is generally conducted in fermenters with an appropriate culture medium adapted to the microorganism being used and containing at least one simple carbon source, and if necessary co-substrates.

An "appropriate culture medium" or "culture medium" designates a medium (e.g., a sterile, liquid media) comprising nutrients essential or beneficial to the maintenance and/or growth of the cell such as carbon sources or carbon substrates, nitrogen sources, phosphorus sources, for example, monopotassium phosphate or dipotassium phosphate; trace elements (e.g., metal salts), for instance magnesium salts, cobalt salts and/or manganese salts; as well as growth factors such as amino acids and vitamins. The appropriate medium for growth of a particular microorganism will be known by one skilled in the art of microbiology or fermentation science. Those skilled in the art are able to define the culture conditions for the microorganism according to the invention.

The term "source of carbon" or "carbon source" or "carbon substrate" according to the present invention denotes any source of carbon that can be used by those skilled in the art to support the normal growth of a microorganism, including monosaccharides (such as glucose, galactose, xylose, fructose or lactose), oligosaccharides, disaccharides (such as sucrose, cellobiose or maltose), molasses, starch or its derivatives, hemicelluloses and combinations thereof. The term "simple carbon source" designates a non-expensive, usual source of carbon. An especially preferred simple carbon source is glucose. Another preferred simple carbon source is sucrose. The carbon source can be derived from renewable feed-stock. Renewable feed-stock is defined as raw material required for certain industrial processes that can be regenerated within a brief delay and in sufficient amount to permit its transformation into the desired product. Vegetal biomass, treated or not, is an interesting renewable carbon source. Another interesting simple carbon source may be carbon monoxide (CO) containing gases, recovered from for instance industrial wastes, such as disclosed in patent applications WO2012026833 or WO2012087949. Hence it is contemplated that the source of carbon utilized in the present invention may encompass a wide variety of carbon containing substrates and will only be limited by the choice of organism. In a specific embodiment of the invention, the substrate may be an hydrolysate of second generation carbons sources such wheat straw, miscanthus plants, sugar cane bagasses, wood and others that are known to the man skilled in the art. The carbon source can be derived from renewable microbial biomass, too.

The term "renewable microbial biomass" is defined as raw microbial biomass issued from industrial processes that can be treated and/or refined (hydrolysis to obtain free amino-acids and oligosaccharides) within a brief delay and in a sufficient amount to permit its use in the culture medium.

The term "source of nitrogen" corresponds to an ammonium salt, for instance ammonium sulfate, ammonium chloride, ammonium nitrate, ammonium hydroxide and ammonium phosphate, or to ammoniac gas, corn steep liquor, peptone, yeast extract, meat extract, malt extract, or urea. The nitrogen source can be derived from renewable biomass from microbial (like beer yeast autolysate, waste yeast autolysate, baker's yeast, hydrolyzed waste cells, Algae biomass), vegetal (for instance Cotton seed meal, Soy peptone, soybean peptide, soy flour, soybean flour, soy molasses, Rapeseed meal, Peanut meal, Wheat bran hydro lysate, rice bran and defatted rice bran, malt sprout, red lentil flour, black gram, bengal gram, green gram, bean flour, flour of pigeon pea, Protamylasse) or animal (like fish waste hydrolysate, fish protein hydrolysate, chicken feather; feather hydrolysate, meat and bone meal, silk worm larvae, silk fibroin powder, shrimp wastes, beef extract) origin, or any other nitrogen containing waste.

Fermentations may be performed under aerobic or anaerobic conditions.

The terms "anaerobic conditions" refer to conditions under which the oxygen concentration in the culture medium is too low for the microorganism to be used as terminal electron acceptor.

"Aerobic conditions" refers to concentrations of oxygen in the culture medium that are sufficient for an aerobic or facultative anaerobic microorganism to use as a terminal electron acceptor.

Those skilled in the art are able to define the culture conditions for the microorganisms according to the invention. In particular the microorganisms should be fermented at suitable temperature and pH range.

The amount of product in the fermentation medium can be determined using a number of analytic methods known in the art, for instance, high performance liquid chromatography (HPLC) or gas chromatography (GC).

The present process may employ a batch method of fermentation. A classical batch fermentation is a closed system where the composition of the medium is set at the beginning of the fermentation and not subject to artificial alterations during the fermentation. Thus, at the beginning of the fermentation the medium is inoculated with the desired organism(s), and fermentation is permitted to occur without adding anything to the system. Typically, however, a "batch" fermentation is batch with respect to the addition of carbon source and attempts are often made at controlling factors such as pH and oxygen concentration. In batch systems the metabolite and biomass compositions of the system change constantly up to the time when the fermentation is stopped. Within batch cultures cells progress through a static lag phase to a high growth log phase and finally to a stationary phase where growth rate is diminished or halted. If untreated, cells in the stationary phase will eventually die. Cells in log phase generally are responsible for the bulk of production of end product or intermediate.

A Fed-Batch system may also be used in the present invention. A Fed-Batch system is similar to a typical batch system with the exception that the carbon source substrate is added in increments as the fermentation progresses. Fed-Batch systems are useful when catabolite repression (e.g. glucose repression) is apt to inhibit the metabolism of the cells and where it is desirable to have limited amounts of substrate in the media. Measurement of the actual substrate concentration in Fed-Batch systems is difficult and is therefore estimated on the basis of the changes of measurable factors such as pH, dissolved oxygen and the partial pressure of waste gases such as C0 ₂ .

Finally, continuous system may also be used in the present invention. Continuous fermentation is an open system where a defined fermentation medium is added continuously to a bioreactor and an equal amount of conditioned media is removed simultaneously for processing. Continuous fermentation generally maintains the cultures at a constant high density where cells are primarily in log phase growth.

Continuous fermentation allows for the modulation of one factor or any number of factors that affect cell growth or end product concentration. Methods of modulating nutrients and growth factors for continuous fermentation processes as well as techniques for maximizing the rate of product formation are well known in the art of industrial microbiology.

Fermentations are common and well known in the art and examples may be found in Weusthuis et al. (1994).

It is contemplated that the present invention may be practiced using any known mode of fermentation culture and in particular either batch, fed-batch or continuous processes and combinations thereof. Additionally, it is contemplated that cells may be immobilized on a substrate as whole cell catalysts or on inert support material generally selected among the group consisting of metal, glass, ceramic and polypropylene or on fibrous materials (porous particles, sponge or sponge-like materials, tangled fibres) and subjected to fermentation conditions for production.

Ethylenediamine biosynthesis pathways

The present invention is related to a method for the fermentative production of ethylenediamine from a simple source of carbon as precursor. The inventors have developed five biosynthesis pathways, all having serine as intermediate. The global biosynthesis pathway is represented in figure 1 ; each of these biosynthesis pathways is described extensively below.

The invention relates to a method for the fermentative production of ethylenediamine from a simple source of carbon and a source of nitrogen, comprising culturing a microorganism in an appropriate culture medium comprising the source of carbon and nitrogen, and recovering the ethylenediamine from the culture medium, wherein the microorganism comprises at least one biosynthesis pathway converting L-serine into ethylenediamine composed of:

- At least two enzymes selected among the group of a decarboxylase, a transaminase and a dehydrogenase (pathway A, C or D); or

The successive actions of a serine hydroxymethyl transferase, an aldehyde oxydase and a transaminase (pathway B); or

The successive actions of an amino acid N-acetyl transferase, an alcohol dehydrogenase, a transaminase, a deacetylase and an amino acid decarboxylase

(pathway E).

In a specific embodiment of the invention, the microorganism is genetically modified to comprise at least one of the biosynthesis pathways A, B, C, D or E. The invention is also related to wild-type microorganisms possessing in their wild-type state at least one the biosynthesis pathways A, B, C, D or E.

In a preferred embodiment of the invention, the ethylene biosynthesis pathway is composed of at least two enzymes selected among the group of a decarboxylase, a transaminase and a dehydrogenase. In this specific embodiment, the biosynthesis pathway is either pathway A, C or D.

Since ethylenediamine production increases the pH of the culture medium, it will be advantageous to use alkaliphile microorganisms in order to minimize the amount of acid to be added during the culture to regulate pH. Alkaliphile microorganisms are extremophile microorganisms that thrive in alkaline environments with a pH comprised from 9 to 11, such as playa lakes and carbonate-rich soils. Alkaliphile bacteria may be chosen among species of Nitrosomonadaceae, Methanosarcinacea, Halobacteriaceae, Geoalkalibacter, Alkalibacterium, Bacillus okhensis or Bacillus alcalophilus.

1 - Pathway C.

In this particular embodiment of the invention, the ethylenediamine biosynthesis pathway comprises the following successive steps:

Conversion of L-serine into 2-aminomalonate semialdehyde by an enzyme having serine dehydrogenase activity,

Conversion of 2-aminomalonate semialdehyde into amino acetaldehyde by a spontaneous reaction or by an enzyme having 2-aminomalonate semialdehyde decarboxylase activity.

Conversion of aminoacetaldehyde into ethylenediamine by an enzyme having an aminoacetaldehyde transaminase activity. According to this aspect of the invention, the genetically modified microorganism overexpresses at least one of the genes encoding enzymes exhibiting activity of serine dehydrogenase and aminoacetaldehyde transaminase. These genes may be endogenous genes or exogenous genes.

The first reaction of the conversion of L-serine into 2-aminomalonate semialdehyde is catalysed by a serine dehydrogenase enzyme. This enzyme belongs to the large enzyme family of alcohol dehydrogenases also called aldehyde reductases. Several enzymes are known to exhibit serine dehydrogenase activity. In one embodiment of the invention, these enzymes are encoded by genes chosen among a list of genes well known in the art (Chowdhury et ah, 1996, Yao et ah, 2010, Tchigvintsev et ah, 2012, Fujisawa et ah, 2003, Hawes et ah, 1996 and Lokanath et al., 2005), including but not limited to the genes listed below:

mmsB from Pseudomonas putida, from Synechococcus PCC6301 or from Bacillus cereus

- hibdh from Pseudomonas putida E23

PA0743 from Pseudomonas aeruginosa

- ydfG from Escherichia coli or from Bacillus brevis or from Bacillus subtilis sdh from Agrobacterium tumefaciens

hibadh from Rattus norvegicus or from Thermus thermophilus HB8 - yiaY from Escherichia coli.

In a preferred embodiment of the invention, the serine dehydrogenase is encoded by ydfG from Escherichia coli or mmsB from Pseudomonas putida, or yia Y from Escherichia coli.

Preferably, these enzymes are optimized by mutating the encoding genes in order to improve their catalytic efficiency of L-serine into 2-aminomalonate semialdehyde.

In another embodiment of the invention the serine dehydrogenase enzyme is obtained by evolving enzymes in order to modify their substrate specificity and/or their catalytic efficiency to obtain an enzyme which exhibits specificity for serine and activity of serine dehydrogenase. These enzymes are selected among the group of enzymes having the same type of catalytic activity on substrates chemically similar to L-serine. Preferably these enzymes may be chosen among 3-hydroxyisobutyrate dehydrogenases and serine dehydrogenases. More preferably they are encoded by genes chosen among a list of genes well known in the art, including but not limited to the genes listed below:

gldA from Escherichia coli or from Leuconostoc citreum or from Symbiobacterium thermophilum

- yqhE from Escherichia coli

- yafB from Escherichia coli

air from Leishmania donovani

sakRl from Synechococcus sp. - yhdN from Bacillus subtilis

- ytbE from Bacillus subtilis

AKR4C9 from Arabidopsis thaliana

- fucO from Escherichia coli.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used.

Evolution of these enzymes is carried out by means and methods well known by the man skilled in the art in order to obtain enzyme having improved specificity for the substrate L-serine and/or enabling to convert it into 2-aminomalonate semialdehyde with an improved activity. The selection of the evolved enzymes is performed by expressing the evolved enzymes in the microorganism of the invention or in vitro with L-serine as substrate and by detecting the product 2-aminomalonate semialdehyde.

The second reaction of the conversion o f 2-aminomalonate semialdehyde into aminoacetaldehyde is performed spontaneously in the cell (Fujisawa et ah, 2003).

In another embodiment of the invention, the second reaction of conversion of 2- aminomalonate semialdehyde into aminoacetaldehyde is catalysed by an enzyme having 2- aminomalonate semialdehyde decarboxylase activity.

This enzyme is not encountered naturally. Therefore it is obtained by evolution of known enzyme or by screening metagenomic libraries.

The 2-aminomalonate semialdehyde decarboxylase activity is performed with an evolved amino acid decarboxylase or an evolved keto-acid decarboxylase which catalyses the decarboxylation of amino acids or keto acids. Preferably an evolved amino acid decarboxylase is chosen. More preferably the evolved amino acid decarboxylase is chosen among histidine decarboxylase, serine decarboxylase, aspartate decarboxylase, diaminobutanoate decarboxylase, ornithine decarboxylase.

These enzymes are encoded by genes chosen among a list of genes well known in the art, including but not limited to the genes listed below:

sdc from Arabidopsis thaliana

- panD from Aquifex aeolicus or from Bacillus subtilis

- GAD or GAD2 or GAD3 or GAD4 or GAD5 from Arabidopsis thaliana

- GAD or GAD2 or OAZ1 or ODC1 from Bos Taurus

gadA or gadB or panD or speC or speF from Escherichia coli SCC 105.13 from Streptomyces coelicolor

gadB from Mannheimia succiniciproducens

- bdb from Haloferax volcanii.

odd from Lactobacillus sp.

kivD from Lactococcus lactis subsp. Lactis

kdcA from Lactococcus lactis OAZ1 or ODC1 from Bos taurus

speC or speF from Escherichia coli

SPE1 from Saccharomyces cerevisiae.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used.

Preferably, the sdc gene from Arabidopsis thaliana is used for obtaining the 2- aminomalonate semialdehyde decarboxylase activity.

Evolution of these enzymes is carried out by means and methods well known by the man skilled in the art in order to obtain enzymes having specificity for the substrate 2- aminomalonate semialdehyde and enabling to convert it into aminoacetaldehyde. The selection of the evolved enzyme is performed by expressing the evolved enzyme in the microorganism of the invention or in vitro with 2-aminomalonate semialdehyde as substrate and by quantifying the product aminoacetaldehyde.

The last reaction of the conversion of aminoacetaldehyde into ethylenediamine is catalysed by an aminoacetaldehyde transaminase.

This enzyme is not encountered naturally. Therefore it is obtained by evolution of a known enzyme or by screening metagenomic libraries.

In one embodiment of the invention, the aminoacetaldehyde transaminase activity is performed with an evolved transaminase or aminotransferase which catalyses the exchange of an amino group of one molecule with an oxo group on another molecule. Preferably, the evolved aminotransferase is chosen among phosphoserine aminotransferase or aspartate aminotransferase or glutamate aminotransferase. More preferably, the evolved aminotransferase is chosen among aminotransferases using glutamate as amino group donor.

These enzymes are encoded by genes chosen among a list of genes well known in the art, including but not limited to the genes listed below:

serC from Escherichia coli or from Bacillus subtilis or from Cory neb acterium glutamicum

GOT1 from Sus scrofa

- pat A from Escherichia coli

- ygjG from Brucella canis

rocD from Rhizobium NGR234 or from Streptomyces avermitilis

SCO 1284 from Streptomyces coelicolor

A GT or AGT2 or A GT3 or GGT1 from Arabidopsis thaliana - AGXT from Bos taurus.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used. Preferably, genes serC from Escherichia coli or GO Tl from Sus scrofa are used for obtaining the amino acetaldehyde transaminase activity.

Evolution of these enzymes is carried out by means and methods well known by the man skilled in the art in order to obtain enzymes having specificity for the substrate aminoacetaldehyde and enabling to convert it into ethylenedi amine. The selection of the evolved enzyme is done by expressing the evolved enzyme in the microorganism of the invention or in vitro with aminoacetaldehyde as substrate and by detecting the product ethylenediamme .

In another embodiment of the invention, aminoacetaldehyde transaminase enzymes can be isolated from strains growing on ethylenediamine as sole carbon and nitrogen source. For this purpose enrichment cultures from environmental samples on ethylenediamine are cultivated on minimal medium with ethylenediamine as sole nitrogen and carbon source. Metagenomic libraries are generated from these cultures and screened for the presence of aminoacetaldehyde transaminase enzymes. This approach allows isolating the gene corresponding to the enzymatic activity and is well-known to the expert in the field.

According to a specific aspect of the invention, the microorganism comprising the biosynthesis pathway (C) is genetically modified to overexpress at least one of the following genes:

- ydfG gene or mmsB gene or yiaY gene, encoding for the serine dehydrogenase ; and/or

an evolved serC gene or GOT1 gene, encoding for the aminoacetaldehyde transaminase activity. 2 - Pathway D.

In this aspect of the invention, the ethylenediamine biosynthesis pathway comprises the following successive steps:

Conversion of L-serine into 2-aminomalonate semialdehyde by an enzyme having serine dehydrogenase activity,

- Conversion of 2-aminomalonate semialdehyde into 2,3-diaminopropanoate by an enzyme having 2-aminomalonate semialdehyde transaminase activity, Conversion of 2,3-diaminopropanoate into ethylenediamine by an enzyme having 2,3-diaminopropanoate decarboxylase activity.

According to this aspect of the invention, the genetically modified microorganism overexpresses at least one of the genes encoding enzymes exhibiting activity of serine dehydrogenase, 2-aminomalonate semialdehyde transaminase and 2,3-diaminopropanoate decarboxylase. These genes may be endogenous genes or exogenous genes. The first reaction of conversion of L-serine into 2-aminomalonate semialdehyde is catalysed by a serine dehydrogenase enzyme. This enzyme belongs to the large enzyme family of alcohol dehydrogenases also called aldehyde reductases. Several enzymes are known to exhibit serine dehydrogenase activity.

In one embodiment of the invention, the serine dehydrogenase is chosen among these known enzymes. These enzymes are encoded by genes chosen among a list of genes well known in the art (Chowdhury et al, 1996, Yao et al, 2010, Tchigvintsev et al, 2012, Fujisawa et al, 2003, Hawes et al, 1996 and Lokanath et al, 2005), including but not limited to the genes listed below:

- mmsB from Pseudomonas putida, from Synechococcus PCC6301 or from

Bacillus cereus

hibdh from Pseudomonas putida E23

PA0743 from Pseudomonas aeruginosa

- ydfG from Escherichia coli or from Bacillus brevis or from Bacillus subtilis - sdh from Agrobacterium tumefaciens

hibadh from Rattus norvegicus or from Thermus thermophilus HB8

- yia Y from Escherichia coli.

In a preferred embodiment of the invention, the serine dehydrogenase is encoded by ydfG from Escherichia coli or mmsB from Pseudomonas putida or yiaY from Escherichia coli.

Preferably, these enzymes are optimized by mutating the encoding genes in order to improve their catalytic efficiency of L-serine into 2-aminomalonate semialdehyde.

In another embodiment of the invention the serine dehydrogenase enzyme is obtained by evolving enzymes in order to modify their substrate specificity and/or their catalytic efficiency to obtain an enzyme which exhibits specificity for serine and activity of serine dehydrogenase. These enzymes are selected among the group of enzymes having the same type of catalytic activity on substrates chemically similar to L-serine. Preferably these enzymes may be chosen among 3-hydroxyisobutyrate dehydrogenase and serine dehydrogenase. More preferably they are encoded by genes chosen among a list of genes well known in the art, including but not limited to the genes listed below:

- gldA from Escherichia coli or from Leuconostoc citreum or from

Symbiobacterium thermophilum

- yqhE from Escherichia coli

- yafB from Escherichia coli

air from Leishmania donovani

- sakRl from Synechococcus sp.

- yhdN from Bacillus subtilis

- ytbE from Bacillus subtilis

- AKR4C9 from Arabidopsis thaliana or - fucO from Escherichia coli.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used.

Evolution of these enzymes is carried out by means and methods well known by the man skilled in the art in order to obtain enzymes having improved specificity for the substrate L-serine and/or enabling to convert it into 2-aminomalonate semialdehyde with an improved activity. The selection of the evolved enzyme is performed by expressing the evolved enzyme in the microorganism of the invention or in vitro with L-serine as substrate and by quantifying the product 2-aminomalonate semialdehyde.

The second reaction of conversion of 2-aminomalonate semialdehyde into 2,3- diaminopropanoate is catalysed by a 2-aminomalonate semialdehyde transaminase.

This enzyme is not encountered naturally. Therefore it is obtained by evolution of a known enzyme or by screening metagenomic libraries.

The 2-aminomalonate semialdehyde transaminase activity is performed with an evolved transaminase or aminotransferase which catalyses the exchange of an amino group of one molecule with an oxo group of another molecule. Preferably the evolved aminotransferase is chosen among phosphoserine aminotransferase or aspartate aminotransferase or glutamate aminotransferase. More preferably, the evolved aminotransferase is chosen among aminotransferase using glutamate as amino group donor.

These enzymes are encoded by genes chosen among a list of genes well known in the art, including but not limited to the genes listed below:

serC from Escherichia coli or from Bacillus subtilis or from Cory neb acterium glutamicum

- GO Tl from Sus scrofa

- patA from Escherichia coli

- ygjG from Brucella canis

rocD from Rhizobium NGR234 or from Streptomyces avermitilis

SCO 1284 from Streptomyces coelicolor

- AGT or AGT2 or AGT3 or GGT1 from Arabidopsis thaliana

- A GXT from Bos taurus.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used.

Preferably, genes serC from E. coli or GO Tl from Sus scrofa are used for obtaining the 2-aminomalonate semialdehyde transaminase activity.

Evolution of these enzymes is carried out by means and methods well known by the man skilled in the art in order to obtain enzymes having improved specificity for the substrate 2-aminomalonate semialdehyde and/or enabling to convert it into 2,3- diaminopropanoate with an improved activity. The selection of the evolved enzyme is done by expressing the evolved enzyme in the microorganism of the invention or in vitro with 2- aminomalonate semialdehyde as substrate and by quantifying the product 2,3- diaminopropanoate.

The third reaction of conversion of 2,3-diaminopropanoate into ethylenediamine is catalysed by an enzyme having 2,3-diaminopropanoate decarboxylase activity.

This enzyme is not encountered naturally. Therefore it is obtained by evolution of known enzyme or by screening metagenomic libraries.

The 2,3-diaminopropanoate decarboxylase activity is performed with an evolved amino acid decarboxylase or an evolved keto-acid decarboxylase which catalyses the decarboxylation of amino acids or keto-acids. Preferably an evolved amino acid decarboxylase is chosen. More preferably the evolved amino acid decarboxylase is chosen among histidine decarboxylase, serine decarboxylase, aspartate decarboxylase, diaminobutanoate decarboxylase, ornithine decarboxylase.

These enzymes are encoded by genes chosen among a list of genes well known in the art, including but not limited to the genes listed below:

sdc from Arabidopsis thaliana

- padC or yclB from Bacillus subtilis

ubiD from Campylobacter jejuni or from Escherichia coli

- PAD1 or GAD1 or SPE1 from Saccharomyces cerevisiae

- panD from Aquifex aeolicus or from Bacillus subtilis

GAD or GAD2 or GAD3 or GAD4 or GAD5 from Arabidopsis thaliana

- GAD or GAD2 or OAZ1 or ODC1 from Bos Taurus

gadA or gadB or panD or speC or speF from Escherichia coli - SCC 105.13 from Streptomyces coelicolor

gadB from Mannheimia succiniciproducens

bdb from Haloferax volcanii

odd from Lactobacillus sp.

kivD from Lactococcus lactis subsp. Lactis

- kdcA from Lactococcus lactis

OAZ1 or ODC1 from Bos taurus

speC or speF from Escherichia coli

SPE1 from Saccharomyces cerevisiae.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used.

Preferably, the sdc gene from Arabidopsis thaliana is used for obtaining the 2,3- diaminopropanoate decarboxylase activity. Evolution of these enzymes is carried out by means and methods well known by the man skilled in the art in order to obtain enzymes having improved specificity for the substrate 2,3-diaminopropanoate and/or enabling to convert it into ethylenediamine with an improved activity. The selection of the evolved enzyme is performed by expressing the evolved enzyme in the microorganism of the invention or in vitro with 2,3- diaminopropanoate as substrate and by quantifying the product ethylenediamine.

According to a specific aspect of the invention, the microorganism comprising the biosynthesis pathway (D) is genetically modified to overexpress:

- ydfG gene, yiaY gene or mmsB gene, encoding for the serine dehydrogenase ; and/or

evolved serC gene or GOT1 gene, encoding for 2-aminomalonate semialdehyde transaminase activity; and/or

evolved sdc gene from Arabidopsis thaliana, coding for the 2 , 3- diaminopropanoate decarboxylase.

3 - Pathway A.

In this embodiment of the invention, the ethylenediamine biosynthesis pathway comprises the following successive steps:

Conversion of L-serine into ethanolamine by an enzyme having serine decarboxylase activity,

Conversion of ethanolamine into aminoacetaldehyde by an enzyme having ethanolamine dehydrogenase activity,

Conversion of aminoacetaldehyde into ethylenediamine by an enzyme having aminoacetaldehyde transaminase activity.

According to this aspect of the invention, the genetically modified microorganism overexpresses at least one of the genes encoding enzymes exhibiting activity of serine decarboxylase, ethanolamine dehydrogenase and aminoacetaldehyde transaminase.

These genes may be endogenous genes or exogenous genes.

The first reaction of conversion of L-serine into ethanolamine is catalysed by an enzyme having serine decarboxylase activity. This group of enzymes catalyses the decarboxylation of L-serine into ethanolamine.

In a preferred embodiment of the invention, the serine decarboxylase is encoded by sdc from Arabidopsis thaliana (Rontein et al., 2001, WO2007/144346). The conversion of L-serine into ethanolamine by the serine decarboxylase, encoded by sdc from Arabidopsis thaliana, is disclosed in particular in patent application WO2007/144364 which is incorporated by reference herein.

Preferably, these enzymes are optimized by mutating the encoding genes in order to improve their conversion efficiency of L-serine into ethanolamine. In one embodiment of the invention, the serine decarboxylase activity is obtained by evolving enzymes in order to modify their substrate specificity and/or their catalytic efficiency to obtain an enzyme which exhibits specificity for serine and improved activity of serine decarboxylase. These enzymes are selected among the group of enzymes having the same type of catalytic activity on substrates chemically similar to ethanolamine.

These enzymes are encoded by genes chosen among a list of genes well known in the art, including but not limited to the genes listed below:

GAD1 or SPE1 from Saccharomyces cerevisiae

- panD from Aquifex aeolicus or from Bacillus subtilis

GAD or GAD2 or GAD3 or GAD4 or GAD5 from Arabidopsis thaliana

- GAD or GAD2 or OAZ1 or ODC1 from Bos Taurus

gadA or gadB or panD or speC or speF from Escherichia coli SCC 105.13 from Streptomyces coelicolor

gadB from Mannheimia succiniciproducens

bdb from Haloferax volcanii

odd from Lactobacillus sp.

OAZ1 or ODC1 from Bos taurus

speC or speF from Escherichia coli

SPE1 from Saccharomyces cerevisiae.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used.

Evolution of these enzymes is carried out by means and methods well known by the man skilled in the art in order to obtain enzymes having improved specificity for the substrate L-serine and enabling to convert it into ethanolamine with an improved activity. The selection of the evolved enzyme is performed by expressing the evolved enzyme in the microorganism of the invention or in vitro with L-serine as substrate and by quantifying the product ethanolamine.

The second reaction of conversion of ethanolamine into amino acetaldehyde is catalysed by an ethanolamine dehydrogenase enzyme.

Natural enzymes having this activity are not disclosed in prior art; however some enzymes have low catalytic activity. Therefore it is advantageous to evolve these enzymes with low catalytic activity towards evolved enzymes with improved activity. Useful enzymes can also be obtained by screening metagenomic libraries.

In one embodiment of the invention, the ethanolamine dehydrogenase activity is obtained by evolving enzymes in order to modify their substrate specificity and/or their catalytic efficiency to obtain an enzyme which exhibits specificity for ethanolamine and activity of ethanolamine dehydrogenase. These enzymes are selected among the group of enzymes having the same type of catalytic activity on substrates chemically similar to ethanolamine.

These enzymes are encoded by genes chosen among a list of genes well known in the art, including but not limited to the genes listed below:

mmsB from Pseudomonas putida or from Synechococcus PCC6301, or from Bacillus cereus

hibdh from Pseudomonas putida E23

PA0743 from Pseudomonas aeruginosa

ydfG from Escherichia coli or from Bacillus brevis or from Bacillus subtilis sdh from Agrobacterium tumefaciens

hibadh from Rattus norvegicus or from Thermus thermophilus HB8 gldA from Escherichia coli or from Leuconostoc citreum or from

Symbiobacterium thermophilum

yqhE from Escherichia coli

yafB from Escherichia coli

aladh from Enterobacter aerogenes

air from Leishmania donovani

sakRl from Synechococcus sp.

yhdN from Bacillus subtilis

ytbE from Bacillus subtilis

yia Y from Escherichia coli

AKR4C9 from Arabidopsis thaliana or

fucO from Escherichia coli.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used.

Preferably genes fucO from Escherichia coli or yiaY from Escherichia coli are used for obtaining the ethanolamine dehydrogenase activity.

Evolution of these enzymes is carried out by means and methods well known by the man skilled in the art in order to obtain enzymes having improved specificity for the substrate ethanolamine and/or enabling to convert it into aminoacetaldehyde with an improved activity. The selection of evolved enzymes is done by expressing the evolved enzymes in the microorganism of the invention or in vitro with ethanolamine as substrate and by quantifying the product aminoacetaldehyde.

The last reaction of conversion of aminoacetaldehyde into ethylenediamine is catalysed by an aminoacetaldehyde transaminase.

This enzyme is not encountered naturally. Therefore it is obtained by evolution of known enzyme or by screening metagenomic libraries. In one embodiment of the invention, the aminoacetaldehyde transaminase activity is performed with an evolved transaminase or aminotransferase which catalyses the exchange of an amino group of one molecule with an oxo group on another molecule. Preferably, the evolved aminotransferase is chosen among phosphoserine aminotransferase or aspartate aminotransferase or glutamate aminotransferase. More preferably the evolved aminotransferase is chosen among aminotransferase using glutamate as amino group donor.

These enzymes are encoded by genes chosen among a list of genes well known in the art, including but not limited to the genes listed below:

- serC from Escherichia coli or from Bacillus subtilis or from

Corymb acterium glutamicum

GOT1 from Sus scrofa

- patA from Escherichia coli

- ygjG from Brucella canis

- rocD from Rhizobium NGR234 or from Streptomyces avermitilis

SCO 1284 from Streptomyces coelicolor

A GT or AGT2 or A GT3 or GGT1 from Arabidopsis thaliana

- A GXT from Bos taurus.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used.

Preferably, genes serC from E. coli or GO Tl from Sus scrofa are used.

Evolution of these enzymes is carried out by means and methods well known by the man skilled in the art in order to obtain enzymes having improved specificity for the substrate aminoacetaldehyde and/or enabling to convert it into ethylenediamme with an improved activity. The selection of the evolved enzyme is done by expressing the evolved enzyme in the microorganism of the invention or in vitro with aminoacetaldehyde as substrate and by detecting the product ethylenediamme.

In another embodiment of the invention, aminoacetaldehyde transaminase enzymes can be isolated from strains growing on ethylenediamine as sole carbon and nitrogen source . For this purpose enrichment cultures from environmental samples on ethylenediamine are cultivated on minimal medium with ethylenediamine as sole nitrogen and carbon source. Metagenomic libraries are generated from these cultures and screened for the presence of aminoacetaldehyde transaminase enzymes. This approach allows isolating the gene corresponding to the enzymatic activity and is well-known to the expert in the field.

According to a specific aspect of the invention, the microorganism comprising the biosynthesis pathway (A) is genetically modified to overexpress: - An sdc gene from Arabidopsis thaliana, encoding a serine decarboxylase; and/or

- fucO or yiaY genes from Escherichia coli, encoding for the ethanolamine dehydrogenase activity; and/or

- An evolved serC gene or GOT1 gene, encoding for aminoacetaldehyde transaminase activity.

4 - Pathway B.

In this embodiment of the invention, the ethylenediamine biosynthesis pathway comprises the following successive steps:

Conversion L-serine into glycine by an enzyme activity having a serine hydroxymethyltransferase activity. Preferably gene glyA from Escherichia coli is used for obtaining the serine hydroxymethyltransferase activity.

Conversion of glycine into aminoacetaldehyde by an enzyme having aldehyde oxydase activity. This enzyme is obtained by evolving enzymes in order to modify their substrate specificity and/or their catalytic efficiency to obtain an enzyme which exhibits specificity for glycine and activity of aldehyde oxydase. These enzymes are selected among the group of enzymes having the same type of catalytic activity on substrates chemically similar to glycine These enzymes are encoded by genes chosen among a list of genes well known in the art, including but not limited to the genes listed below:

aldHl from Aquifex aeolicus

dhaS from Anoxybacillus flavithermus

Aldh from Apis .mellifera

aldX, aldY, dhaS, ycbD, yfmT or ywdH from Bacillus subtilis - prr from Escherichia coli

ALD2, ALD3, ALD4, ALD5, ALD6 from Saccharomyces cerevisiae betB from Roseobacter .denitrificans

AAur_0650 from Arthrobacter aurescens.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used.

Conversion of aminoacetaldehyde into ethylenediamine by an enzyme having aminoacetaldehyde transaminase activity. This enzyme is obtained by evolving enzymes in order to modify their substrate specificity and/or their catalytic efficiency to obtain an enzyme whi ch exhibits sp e ci ficity for aminoacetaldehyde and activity of transaminase. These enzymes are selected among the group of enzymes having the same type of catalytic activity on substrates chemically similar to aminoacetaldehyde. These enzymes are encoded by genes chosen among a list of genes well known in the art, including but not limited to the genes listed below:

serC from Escherichia coli or from Bacillus subtilis or from

Corymb acterium glutamicum

- GO Tl from Sus scrofa

- patA from Escherichia coli

- ygj ^' G from Brucella canis

rocD from Rhizobium NGR234 or from Streptomyces avermitilis SCO 1284 from Streptomyces coelicolor

- A GT or AGT2 or A GT3 or GGT1 or from Arabidopsis thaliana

AGXT from Bos Taurus.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used.

According to a specific aspect of the invention, the microorganism comprising the biosynthesis pathway (B) is genetically modified to overexpress an evolved serC gene or GOT1 gene, encoding for aminoacetaldehyde transaminase activity.

5 - Pathway E.

In this embodiment of the invention, the ethylenediamine biosynthesis pathway comprises the following successive steps:

Conversion of L-serine into N-acetylserine by an enzyme having amino acid N- acetyl transferase activity ( o r O-acetyl transferase activity, since the transformation of O to N is spontaneous). Preferably gene argA from Escherichia coli is used for obtaining the amino acid N-acetyl transferase activity.

Conversion of N-acetylserine into N-acetylmalonate semialdehyde by an enzyme having N-acetylserine dehydrogenase activity. This enzyme is obtained by evolving enzymes in order to modify their substrate specificity and/or their catalytic efficiency to obtain an enzyme which exhibits specificity for N- acetylserine and activity of N-acetylserine dehydrogenase. These enzymes are selected among the group of enzymes having the same type of catalytic activity on substrates chemically similar to N-acetylserine. These enzymes are encoded by genes chosen among a list of genes well known in the art, including but not limited to the genes listed below:

- mmsB from Pseudomonas putida, from Synechococcus PCC6301 or from Bacillus cereus

hibdh from Pseudomonas putida E23

PA0743 from Pseudomonas aeruginosa - ydfG from Escherichia coli or from Bacillus brevis or from Bacillus subtilis

sdh from Agrobacterium tumefaciens

hibadh Rattus norvegicus or from Thermus thermophilus HB8 gldA from Escherichia coli or from Leuconostoc citreum or from

Symbiobacterium thermophilum

- yqhE from Escherichia coli

- yafB from Escherichia coli

aladh from Enterobacter aerogenes

air from Leishmania donovani

sakRl from Synechococcus sp

- yhdN from Bacillus subtilis

- ytbE from Bacillus subtilis

- yia Y from Escherichia coli

- AKR4C9 from Arabidopsis thaliana or

- fucO from Escherichia coli.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used.

Conversion of N-acetylmalonate semialdehyde into acetylammopropanoate by an enzyme having transaminase activity. This enzyme is obtained by evolving enzymes in order to modify their substrate specificity and/or their catalytic efficiency to obtain an enzyme which exhibits specificity for N-acetylmalonate semialdehyde and activity of N-acetylmalonate semialdehyde transaminase. These enzymes are selected among the group of enzymes having the same type of catalytic activity on substrates chemically similar to N-acetylmalonate semialdehyde. These enzymes are encoded by genes chosen among a list of genes well known in the art, including but not limited to the genes listed below:

serC from Escherichia coli or from Bacillus subtilis or from Cory neb acterium glutamicum

GOT1 from Sus scrofa

- patA from Escherichia coli

- ygj ^' G from Brucella canis

rocD from Rhizobium NGR234 or from Streptomyces avermitilis

2SCG18.31c from Streptomyces coelicolor

A GT or A GT2 or A GT3 or GGT1 from Arabidopsis thaliana

- A GXT from Bos taurus.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used. Conversion of acetylaminopropanoate into 2,3-diaminopropanoate by an enzyme having deacetylase activity. Preferably gene argE from Escherichia coli is used for obtaining the deacetylase activity.

Conversion of 2,3-diaminopropanoate into ethylenediamine by an enzyme having amino-acid decarboxylase activity or keto acid decarboxylase activity. This enzyme is obtained by evolving enzymes in order to modify their substrate specificity and/or their catalytic efficiency to obtain an enzyme which exhibits specificity for 2,3-diaminopropanoate and activity of amino acid decarboxylase or keto acid decarboxylase. These enzymes are selected among the group of enzymes having the same type of catalytic activity on substrates chemically similar to 2,3-diaminopropanoate. These enzymes are encoded by gene chosen among a list of genes well known in the art, including but not limited to the genes listed below:

- sdc from Arabidopsis thaliana

- padC or yclB from Bacillus subtilis

- ubiD from Campylobacter jejuni or from Escherichia coli

- PAD1 or GAD1 or SPE1 from Saccharomyces cerevisiae

- panD from Aquifex aeolicus or from Bacillus subtilis

- GAD or GAD2 or GAD3, GAD4 or GAD5 from Arabidopsis thaliana

- GAD or GAD2 or OAZ1 or ODC1 from Bos Taurus

- gadA or gadB or panD or speC or speF from Escherichia coli

- SCC105.13 from Streptomyces coelicolor

- gadB from Mannheimia succiniciproducens

- bdb from Haloferax volcanii

- odd from Lactobacillus sp.

- kivd from Lactococcus lactis subsp. Lactis

- kdcA from Lactococcus lactis

- OAZ1 or ODC1 from Bos taurus

- speC or speF from Escherichia coli

- SPE1 from Saccharomyces cerevisiae.

Any polypeptide having at least 90% sequence identity to any of the polypeptides encoded by those genes may be used.

In a further embodiment of the invention, the method is performed with a microorganism wherein serine biosynthesis is optimized. This optimization is disclosed in particular in patent application WO 2007/144346 which is incorporated by reference herein. Serine biosynthesis is improved by increasing the availability of the intermediate product 3-phosphoglycerate. Preferably, it is achieved by attenuating the level of expression of genes coding for phosphoglycerate mutases, in particular one of gpmA and gpmM genes. The invention is also related to the microorganism used in this particular embodiment of the invention.

In another preferred embodiment of the invention, increased flux into the serine biosynthesis is achieved by increasing the level of expression of at least one of the following enzyme activities: 3-Phosphoglycerate dehydrogenase, phosphoserine phosphatase, phosphoserine aminotransferase, encoded by the serA, serB and serC genes, respectively. The expression of the serA gene can also be increased by replacing the wild type lrp gene (encoding the leucine-responsive regulatory protein) by an lrp mutated allele (such as the lrp-\ allele corresponding to a GLU114ASP substitution in the lrp protein) leading to the constitutive activation of the transcription of the gene serA. The overexpression of serA, serB and serC genes has been already described in patent applications WO2007/077041, WO2007/144346 and in WO2009/043803; the content of which is incorporated herein by reference. The invention is also related to the microorganism used in this particular embodiment of the invention.

In a particular embodiment of the invention mutations can be introduced into the serA gene that reduce its sensitivity to the feed-back inhibitor serine (feed-back desensitized alleles) and thus permit an increased activity in the presence of serine. Examples of desensitized alleles, i.e. feed-back insensitive alleles, have been described in EP 0 931 833 or EP 0 620 853. The invention is also related to the microorganism used in this particular embodiment of the invention.

In a further embodiment of the invention, the microorganism is modified to present an attenuated level of serine conversion into other pathways than the ethylenediamine biosynthesis pathway; this result may be achieved by attenuating the level of serine consuming enzymes like serine deaminases (encoded by sdaA and sdaB), serine transacetylase (encoded by cysE), tryptophan synthase (encoded by tprAB) or serine hydro xymethyltransferase (encoded by glyA). Attenuation of these genes can be done by replacing the natural promoter by a lower strength promoter or by modifying the RBS sequence or its surrounded sequence or by elements destabilizing the corresponding messenger RNA or the protein or other means well known by the man skilled in the art. If needed, complete attenuation of the gene can also be achieved by a deletion of the corresponding gene. The invention is also related to the microorganism used in this particular embodiment of the invention.

In a further embodiment of the invention, the microorganism is modified to have an optimal nitrogen assimilation pathway by increasing the glutamate pool and by favoring the GDH system versus the GS/GOGAT system which is ATP dependant. Preferably this result is achieved by attenuating the level of the gltB gene coding for an enzyme having glutamine synthase activity and by increasing the level of gdhA gene expression coding for an enzyme having glutamate dehydrogenase activity.

In another embodiment of the invention, the ethylenediamine export out of the cell is increased by overexpressing diamine transporters and more preferably ethylenediamine transporters. Preferably, this result is achieved by increasing the level of expression of at least one of the following genes encoding diamine or polyamine exporters: cadB (putrescine or cadaverine transporter) or potE (spermidine transporter). Furthermore this result is achieved by attenuating the level of expression of at least one of the following genes encoding diamine or ATP dependent polyamine importers: potABCD and potFGHI.

In a further embodiment of the invention the microorganism is modified to improve the carbon source assimilation pathway. In a specific embodiment the genetically modified microorganism described above is further modified to increase the expression of the ptsG gene that encodes the PTS enzyme IICB ^Glc as described in patent application EP11305829.

The fermentative production of ethylenediamine comprises a step of isolation of the ethylenediamine from the culture medium, followed by recovery of the ethylenediamine product from the culture medium. It may be achieved by a number of techniques well known in the art including but not limited to crystallization, distillation, liquid extraction, gas-stripping, pervaporation, cation exchange or liquid extraction. The expert in the field knows how to adapt parameters of each technique depending on the characteristics of the material to be separated.

In a specific embodiment of the invention, these techniques are combined in order to increase ethylenediamine recovery. Preferably ethylenediamine is recovered by a step of liquid extraction following by a step of distillation.

In a specific aspect of the method for fermentative production of ethylenediamine, the microorganism is genetically modified by overexpressing:

• ydfG gene or mmsB gene or yiaY gene, encoding for the serine dehydrogenase involved in pathways C and D; and/or

• an evolved serC gene or GOT1 gene, encoding for 2-aminomalonate semialdehyde transaminase activity involved in pathway D; and/or

• an evolved sdc gene from Arabidopsis thaliana, encoding for the 2,3- diaminopropanoate decarboxylase activity involved in pathway D; and/or

• an evolved serC gene or GOT1 gene, encoding for the aminoacetaldehyde transaminase activity involved in pathways A, B and C; and/or

• a sdc gene from Arabidopsis thaliana, encoding for the serine decarboxylase activity involved in pathway A;

• fucO or yiaY genes from Escherichia coli, encoding for the ethanolamine dehydrogenase activity involved in pathway A. In particular, the overexpressed genes are mutated to improve enzymatic activity of their translated product. Preferentially, said mutation is obtained by evolution as previously described.

As previously described, the genetically modified microorganism further comprises at least one of the following modifications:

- Attenuation of at least one gene selected among: gpmA, gpmM, glyA, sdaA, sdaB, cysE, trpAB, gltB, potABCD, pot FGHI, and/or,

Overexpression of at least one gene selected among: gdhA, cadB, potE, ptsG, serB, serC, and serA or serA allele encoding for an enzyme with reduced feed- back inhibition to serine {serA *),

to obtain an optimized serine biosynthesis pathway.

A genetically modified microorganism for the fermentative production of ethylenediamine as defined above is also an object of the invention. EXAMPLES

The present invention is further defined in the following examples. It should be understood that these examples, while indicating preferred embodiments of the invention, are given by way of illustration only. From above disclosure and these examples, the man skilled in the art can make various changes of the invention to adapt it to various uses and conditions without modifying the essentials means of the invention.

Exemplary genes and enzymes required for constructing microorganisms with these capabilities are described as well as methods for cloning and transformation, monitoring product formation and using the engineered microorganisms for production.

In particular, examples show modified Escherichia coli (E. coli) strains, but these modifications can easily be performed in other microorganisms of the same family.

Escherichia coli belongs to the Enterobacteriaceae family, which comprises members that are Gram-negative, rod-shaped, non-spore forming and are typically 1-5 μιη in length. Most members have flagella used to move about, but a few genera are non- motile. Many members of this family are a normal part of the gut flora found in the intestines of humans and other animals, while others are found in water or soil, or are parasites on a variety of different animals and plants. E. coli is one of the most important model organism, but other important members of the Enterobacteriaceae family include Klebsiella, in particular Klebsiella terrigena, Klebsiella planticola or Klebsiella oxytoca, Pantoea and Salmonella. Example 1: Calculation of maximum yields for ethylenediamine production from L- serine on glucose.

Simulations were performed with the METEX proprietary software METOPT™ based on flux balance analysis methods (Varma and Palsson, 1994). A simplified metabolic network of E. coli was used including a central metabolic network, metabolic pathways for all biomass precursors and specific production pathways as described above and presented in Figure 1. A classical biomass composition for E. coli was used (Pramanik and Keasling, 1997). Simulations were performed using glucose carbon source uptake by the phosphotransferase system (Escalante et al., 2012) and nitrogen assimilation by glutamate dehydrogenase enzyme.

Calculation of a theoretical maximum yield was performed, taking into account neither cell growth nor maintenance energy requirement. Results of simulations:

a. Pathway A. C and D

The biochemical balance equation is identical for pathways A, C and D and gives 2 ethylenediamine for 1 glucose:

D-Glucose + 4 NH3 + 3 H20 + 2 NAD(P)+ + 3 ATP => 2 ethylenediamine + 2 C02 + 3 Pi + 2 NAD(P)H + 3 ADP

Accounting aerobic glucose oxidation for ATP, the theoretical yield of these pathways is 1.80 mol /mol.

b. Pathway B

For pathway B, assuming that tetrahydro folate recycling is mediated by formate production (Nagy et al, 1995), the biochemical balance equation is :

D-Glucose + 4 NH3 + 3 H20 + 3 ATP <=>2 ethylenediamine + 2 Formate + 3 Pi + 3 ADP Accounting aerobic glucose oxidation for ATP production, the theoretical yield of this pathway is 1.82 mol / mol. Interestingly, this pathway is redox balanced.

c. Pathway E

For pathway E, the biochemical balance equation is the same as for pathways A, C and D, but with a higher energy cost due to acetylation and deacetylation. The biochemical equation for this pathway is :

D-Glucose + 4 NH3 + 7 H20 + 2 NAD(P)+ + 7 ATP <=> 2 ethylenediamine + 2 C02+ 7 Pi + 2 NAD(P)H + 7 ADP

Accounting aerobic glucose oxidation for ATP production and reductive cofactor recycling, the theoretical yield of this pathway is 1,66 mol/mol. Example 2: Demonstration of the amino acid decarboxylase activity encoded by the sdc gene of Arabidopsis thaliana (pathways A and D)

2.1 Construction of strain for SDC characterisation: BL21 (pPAL7-SDCat)

To characterise the SDC protein, the corresponding gene was expressed from the expression vector pPAL7 (Biorad).

For this purpose, the sdc gene from Lactococcus lactis was optimized for Escherichia coli and amplified by us ing the o li gonuc l e oti d e s sdc-pPALVBOl-F (CCCAAGCTTTGACTTCTATGGTGGGCAGCCTGGAATCTGATC: SEQ ID N°01) containing a Hindlll restriction site and sdc-pPALVBOl-R (TAGAGGATCCTTATTTGTGTGCAGGACAAATGC : SEQ ID N°02) containing a BamRl restriction site. The PCR product whose sequence is given in SEQ ID N° 03 was restricted by Hindlll I Bamtll enzymes and cloned into the vector pPAL7 restricted by the same restriction enzymes. The resulting vector was called pPAL7VB01 -SDCat.

PCR product for SDCat cloning (SEQ ID N°03):

CCCAAGCTTTGACTTCTATGGTGGGCAGCCTGGAATCTGATCAGACCCTGAGT ATGGCGACGCTGATTGAGAAACTGGACATCCTGTCAGATGACTTTGATCCGAC TGCCGTGGTTACAGAACCACTGCCTCCGCCAGTCACCAATGGTATTGGGGCAG ACAAAGGGGGCGGTGGGGGAGAGCGTGAAATGGTACTGGGCCGCAACATCCA TACGACTTCCCTGGCTGTGACAGAACCTGAGGTTAATGATGAGTTCACCGGTG ATAAAGAGGCGTATATGGCCTCGGTCCTGGCACGTTACCGCAAAACGCTGGTA GAACGTACCAAAAACCACCTGGGCTATCCGTACAATCTGGACTTTGATTATGG TGCTCTGGGGCAACTGCAGCATTTCAGCATTAACAATCTGGGAGACCCGTTTAT CGAATCTAACTACGGCGTGCACAGTCGCCCATTCGAGGTTGGTGTCCTGGATT GGTTTGCGCGTCTGTGGGAAATTGAGCGCGACGATTATTGGGGCTACATCACT AATTGCGGTACAGAAGGGAACCTGCATGGAATCCTGGTGGGCCGTGAAATGTT CCCTGATGGTATCCTGTATGCCTCACGCGAGTCCCACTATTCGGTATTTAAAGC AGCTCGTATGTACCGCATGGAATGTGAGAAAGTTGACACGCTGATGAGCGGGG AAATTGATTGCGACGATCTGCGTAAAAAACTGCTGGCGAATAAAGATAAACCG GCCATCCTGAACGTGAATATTGGCACCACTGTCAAAGGTGCAGTTGACGATCT GGACCTGGTAATCAAAACACTGGAAGAGTGTGGATTCTCTCATGATCGCTTTT ATATTCACTGCGACGGCGCTCTGTTTGGTCTGATGATGCCGTTCGTGAAACGTG CGCCAAAAGTCACCTTTAACAAACCTATCGGGAGTGTTTCAGTGTCCGGCCAT AAATTCGTAGGTTGTCCGATGCCATGCGGAGTCCAAATTACGCGCATGGAACA CATTAAAGTTCTGTCGAGCAATGTGGAATACCTGGCCTCTCGTGATGCAACCAT CATGGGCAGTCGCAACGGTCATGCGCCGCTGTTTCTGTGGTATACTCTGAATCG TAAAGGGTACAAAGGATTCCAGAAAGAGGTACAGAAATGTCTGCGCAACGCT CACTATCTGAAAGATCGTCTGCGCGAAGCCGGCATTTCAGCAATGCTGAATGA GCTGTCCAGCACAGTTGTGTTTGAACGTCCTAAAGACGAAGAGTTCGTCCGCC GTTGGCAACTGGCGTGCCAGGGTGATATCGCTCATGTTGTGGTAATGCCGTCG GTCACGATTGAAAAACTGGACAACTTTCTGAAAGATCTGGTTAAACATCGCCT GATCTGGTACGAGGATGGGTCTCAACCACCGTGTCTGGCCAGTGAAGTGGGCA CCAATAACTGCATTTGTCCTGCACACAAATAAGGATCCTCTA

The pPALWBOl -SDCat plasmid was then introduced into the strain BL21 (DE3) competent cells (Invitrogen). 2.2 Overproduction of the protein SDCat

The overproduction of the protein SDCat was done in a 2 1 Erlenmeyer flask, using LB broth (Bertani, 1951) that was supplemented with 2,5 g/1 glucose and 100 mg/1 of ampicillin. An overnight preculture was used to inoculate a 500 ml culture to an OD ₆ oon _m of about 0,15. This preculture was carried out in a 500 ml Erlenmeyer flask filled with 50 ml of LB broth that was supplemented with 2,5 g/1 glucose and 100 mg/1 of ampicillin. The culture was first kept on a shaker at 37°C and 200 rpm until OD ₆ oo nm was about 0,5 and then the culture was moved on a second shaker at 25 °C and 200rpm until OD ₆ oo nm was 0,6 - 0,8 (about one hour), before induction with 500 μΜ IPTG. The culture was kept at 25°C and 200 rpm until OD ₆ oo nm was around 4, and then it was stopped. Cells were centrifuged at 7000 rpm, 5 minutes at 4°C, and then stored at -20°C.

2.3 Purification of the protein SDCat

2.3.1 Step 1 : Preparation of cell- free extracts.

About 400 mg of E. coli biomass was suspended in 70 ml of 100 mM potassium phosphate pH 7.6, 0.1 mM PLP, and a protease inhibitor cocktail. The cell suspension (15 ml per conical tube) was sonicated on ice (Bandelin sonoplus, 70 W) in a 50 ml conical tube during 8 cycles of 30 sec with 30 sec intervals. After sonication, cells were incubated for 30 min at room temperature with 5 mM MgC12 and lUI/ml of DNasel. Cells debris were removed by centrifugation at 12000g for 30 min at 4°C.

2.3.2 Step 2: Affinity purification

The protein was purified from crude cell-extract by affinity on a Profinity column (BIORAD, Bio-Scale Mini Profinity exact cartridge 5 ml) according to the protocol recommended by the manufacturer. Crude extract was loaded on a 5 ml Profinity exact cartridge equilibrated with 100 mM potassium phosphate pH 7.6, O.lmM PLP. The column was washed with 10 column volumes of the same buffer and incubated overnight with 100 mM potassium phosphate pH 7.6, 100 mM fluoride at 4°C. The protein was eluted from the column with 2 column volumes of 100 mM potassium phosphate pH 7.6, O.lmM PLP. The tag remained tightly bound to the resin and the purified protein was released. The fractions containing the protein were pooled and dialyzed against 100 mM potassium phosphate, 150 mM NaCl, 0.1 mM PLP and 10% glycerol pH 7.2.

Protein concentration was measured using the Bradford protein assay. 2.4 L-serine decarboxylase assay

The decarboxylation of serine was measured at 37°C using a coupled enzymatic assay with two enzymes. The serine decarboxylase activity assay was carried out with 50 mM potassium phosphate buffer pH 7, 0.2 mM NADH, 0.015 mM Coenzyme B 12, 0.1 mM PLP, 5 mM DTT, 4μg/ml Ethanolamine ammonia lyase (EAL), 34 units/ml alcohol dehydrogenase from Saccharomyces cerevisiae, 10 mM Serine and about 3 μg of purified SDCat in a total volume of 1 ml. The consumption of NADH was monitored at 340 nm on a spectrophotometer. The activity detected in control assay, lacking the substrate, was subtracted from the activity detected in the assay with substrate. A unit of serine decarboxylase activity is the amount of enzyme required to catalyze the decarboxylation of 1 μιηοΐ of serine per min at 37°C. (Epsilon 340 nm = 6290 M-l cm-1).

For the enzymatic assay, a construct was made to overexpress and purify the protein Ethanolamine amonia lyase (EAL) as described by Akita et al, 2010.

2.5 Characterization of SDCat

Serine decarboxylase kinetic constants (Km, Vm, kcat) for the purified enzyme SDCat was determined in the same manner as was used for the enzymatic assay except that the concentration of serine was varied. The reaction blank contained all components of the reaction mixture except the substrate. For all kinetics measurements, each data point (initial velocity) was determined in triplicate and substrate concentrations were examined between 1 mM and 50 mM.

Kinetic constants (Km and Vmax) of SDCat were determined with the enzyme kinetics module from the Sigma Plot software by fitting to the Michaelis-Menten equation.

These results demonstrate that the enzyme SDC hova_Arabidopsis thaliana acts as decarboxylase on the substrate serine to obtain ethanolamine. EXAMPLE 3

Demonstration of the serine dehydrogenase activity encoded by the ydfG gene of Escherichia coli and the ethanolamine dehydrogenase activity encoded by the fucO or yiaY genes from Escherichia coli (Pathways A; C; D).

3.1 Construction of strains for the serine dehydrogenase activity characterisation (BL21 (pPAL 7-ydfG)) and for the ethanolamine dehydrogenase activity characterisation (BL21 (pPAL7-fucO) or (BL21 (pPAL7-yiaY)).

To characterise the dehydrogenase activities, the corresponding gene was expressed from the expression vector pPAL7 (Biorad).

For this purpose, the ydfG gene from Escherichia coli was PCR amplified from genomic DNA ( gb _U00096) by using the oligonucleotides pPAL7VB01-ydfG F (CCAAGCTTTGACTTCTATGATCGTTTTAGTAACTGG: SEQ ID N°04) containing a Hindlll restriction site and pPAL7VB01-ydfG R (CGGAATTCTTACTGACGGTGGACATTC: SEQ ID N°05) containing a EcoRI restriction site. The fucO gene from Escherichia coli was PCR amplified from genomic DNA ( gb _U00096) by using the oligonucleotides pPAL7VB01-fucO F (CCCAAGCTTTGATGATGGCTAACAGAATGATTC: SEQ ID N°06) containing a Hindlll restriction site and pPAL7VB01-f u c O R (CGGGAATTCTTACCAGGCGGTATGGTAAAGC: SEQ ID N°07) containing a EcoRI restriction site. The yiaY gene from Escherichia coli was PCR amplified from genomic D N A ( gb_U00096) by using the oligonucleotides pP AL7VB01 -y i a Y F (CCC AAGCTTTGATGGC AGCTTC AACGTTCT : SEQ ID N°08) containing a Hindlll restriction site and pPAL7VB01-y i a Y R (CCGG AATTCTT AC ATCGCTGCGCG AT AAATC : SEQ ID N°09) containing a EcoRI restriction site.

The PCR products were restricted by Hindlll I EcoRI and cloned into the vector pPAL7 restricted by the same restriction enzymes. The resulting vectors were called pPAL7VB01- ydfG, pPAL7VB01- wcO and pPAL7VB01 -jz ^' a Y respectively. Each of these plasmids was then introduced into the strain BL21 (DE3) competent cells.

3.2 Overproduction of the protein YdfG

The overproduction of the protein YdfG was done in a 2 1 Erlenmeyer flask, using LB broth (Bertani, 1951 ) that was supplemented with 2,5 g/1 glucose and 100 mg/1 of ampicillin. An overnight preculture was used to inoculate a 500 ml culture to an OD ₆ oon _m of about 0,15. This preculture was carried out in a 500 ml Erlenmeyer flask filled with 50 ml of LB broth that was supplemented with 2,5 g/1 glucose and 100 mg/1 of ampicillin. The culture was first kept on a shaker at 37°C and 200 rpm until OD ₆ oo nm was about 0,5 and then the culture was moved on a second shaker at 25°C and 200rpm until OD ₆ oo nm was 0,6 - 0,8 (about one hour), before induction with 500μΜ IPTG. The culture was kept at 25°C and 200 rpm until OD ₆ oo nm was around 4, and then it was stopped. Cells were centrifuged at 7000 rpm, 5 minutes at 4°C, and then stored at -20°C.

3.3 Purification of the protein YdfG

3.3.1 Step 1 : Preparation of cell- free extracts.

About 200 mg of E. coli biomass was suspended in 30 ml of 100 mM potassium phosphate pH 7.6, and a protease inhibitor cocktail. The cell suspension (15 ml per conical tube) was sonicated on ice (Bandelin sonoplus, 70 W) in a 50 ml conical tube during 8 cycles of 30 sec with 30 sec intervals. After sonication, cells were incubated for 30 min at room temperature with 5 mM MgC12 and lUI/ml of DNasel. Cells debris were removed by centrifugation at 12000g for 30 min at 4°C.

3.3.2 Step 2: Affinity purification

The protein was purified from crude cell-extract by affinity on a Profinity column (BIORAD, Bio-Scale Mini Profinity exact cartridge 5 ml) according to the protocol recommended by the manufacturer. Crude extract was loaded on a 5 ml Profinity exact cartridge equilibrated with 100 mM potassium phosphate pH 7.6. The column was washed with 10 column volumes of the same buffer and incubated 30 min with 100 mM potassium phosphate pH 7.6, 100 mM fluoride at 4°C. The protein was not eluted from the column in standard conditions with 2 column volumes of 100 mM potassium phosphate pH 7.6. The protein was eluted from the column with the affinity tag by washing with 1 column volume of lOOmM Acid phosphoric. The fractions containing the protein were immediately pooled and dialyzed against 100 mM potassium phosphate pH 7.6.

Protein concentration was measured using the Bradford protein assay.

The steps of overproduction and purification of proteins FucO and YiaY were performed in the same manner as for the protein YdfG.

3.4 Ethanolamine dehydrogenase assay

Ethanolamine dehydrogenase activity was assayed by measuring the initial rate of NADP reduction with a spectrophotometer at a wavelength of 340 nm and at a constant temperature of 30°C. The activity assay was carried out with 200 mM CAPS buffer pH 10, 4 mM NADP, 20 mM Ethanolamine and about 1.5 μg of purified enzyme in a final volume of lml. The reduction of NADP was monitored at 340 nm on a spectrophotometer. The activity detected in control assay, lacking the enzyme, was subtracted from the activity detected in the assay with enzyme. One unit of enzyme activity was defined as the amount of enzyme that consumed 1 μιηοΐ substrate per minute under the conditions of the assay. (Epsilon 340 nm = 6290 M-l cm-1). 3.5 Serine dehydrogenase assay

Serine dehydrogenase activity was assayed by measuring the initial rate of NADP reduction with a spectrophotometer at a wavelength of 340 nm and at a constant temperature of 30°C. The activity assay was carried out with 200 mM CAPS buffer pH 10, 4 mM NADP, 20 mM Serine and about 1.5 μg of purified enzyme in a final volume of lml. The reduction of NADP was monitored at 340 nm on a spectrophotometer. The activity detected in control assay, lacking the enzyme, was subtracted from the activity detected in the assay with enzyme. One unit of enzyme activity was defined as the amount of enzyme that consumed 1 μιηοΐ substrate per minute under the conditions of the assay. (Epsilon 340 nm = 6290 M-l cm-1).

3.6 Activity of purified enzymes

The purified proteins YdfG, YiaY and FucO were used to measure the ethanolamine and serine dehydrogenase activities.

Sign - means that there is no enzymatic activity detected, sign + means that the enzymatic activity is comprised between 50 mUI/mg and 1000 mUI/mg, sign ++ means that the enzymatic activity is up to 1000 mUI/mg.

These results demonstrate that proteins YdfG and YiaY can be used for the serine dehydrogenase activity and that proteins YiaY and FucO can be used for the ethanolamine dehydrogenase activity.

3.7 Characterization of YdfG

Serine dehydrogenase kinetic constants (Km, Vm, kcat) for the purified enzyme YdfG was determined in the same manner as was used for the enzymatic assay except that the concentration of serine was varied. The reaction blank contained all components of the reaction mixture except the enzyme. For all kinetics, each data point (initial velocity) was determined in triplicate and substrate concentrations were examined between 1 mM and 60 mM.

Kinetic constants (Km and Vmax) of YdfG for serine were determined with the enzyme kinetics module from the Sigma Plot software by fitting to the Michaelis-Menten equation.

These results demonstrate that the enzyme YdfG from Escherichia Coli acts as dehydrogenase on the substrate serine to obtain 2-Aminomalonate semialdehyde. 3.8 Product identification after serine dehydrogenase assay with the enzyme YdfG

The product of the serine dehydrogenase assay catalysed by the enzyme YdfG was analysed by UHPLC/MS. For this determination, about 16 μg of purified YdfG was added to a buffer containing 200 mM CAPS buffer pH 10, 4 mM NADP, 20 mM Serine in a total volume of 1000 μΐ. The reaction was incubated during 30 min at 30°C. The reaction product was analysed by UHPLC/MS after specific aldehyde derivatization with MBTH (Paz et al., 1965).

T h e 2-aminomalonate semialdehyde pro duct wasn ' t detected, only the product Amino acetaldehyde was detected. This indicates that the decarboxylation of the 2- aminomalonate semialdehyde can occur spontaneously.

The product of the ethanolamine dehydrogenase assay (aminoacetaldehyde) catalysed by the enzyme YiaY or FucO is obtained by the same methods as were used for the enzyme YdfG except that ethanolamine is used as substrate. EXAMPLE 4

Construction of a strain having a pathway converting L-serine to ethylenediamine via 2-aminomalonate semialdehyde (pathway C)

The E. coli strain engineered to produce ethylenediamine is generated using procedures described in patent application WO2010/076324. The gene disruption in the specified chromosomal locus is carried out by homologous recombination as described by Datsenko and Wanner (2000). The antibiotic resistant cassette can be amplified on pKD3, pKD4, pKD 13 or any other plasmid containing another antibiotic resistant gene surrounded by FRT sites. Chromosomal modifications are transferred to a given E. coli recipient strain by PI transduction.

To produce ethylenediamine, the strain MG1655 DsdaA DgpmA DgltB DpotABCD DpotFGHI (pME 101 -ydfG-ΎΎΟΊ) (pCClBAC-gdhA-TTOl-serB-serA-ser is constructed. The sdaA gene, which encodes a serine deaminase, is deleted by using the oligonucleotides DsdaAF (SEQ ID N°10):

GTCAGGAGTATTATCGTGATTAGTCTATTCGACATGTTTAAGGTGGGGATTGGT CCCTCATCTTCCCATACCGTAGGGCCTGTAGGCTGGAGCTGCTTCG and DsdaAR (SEQ ID N°l 1) :

GGGCGAGTAAGAAGTATTAGTCACACTGGACTTTGATTGCCAGACCACCGCGT GAGGTTTCGCGGTATTTGGCGTTCATGTCCCATATGAATATCCTCCTAAG

The gpmA gene, which encodes a phosphoglycerate mutase, is deleted by using the oligonucleotides DgpmAF (SEQ ID N°12) :

TAATGAGAATTATTATCATTAAAAGATGATTTGAGGAGTAAGTATATGGCTGT AACTAAGCTGGTTCTGGTTCGTCATGGCATATGAATATCCTCCTAAG and DgpmAR (SEQ ID N°13) :

CCATTGTTAGCAACAAAAAAGCCGACTCACTTGCAGTCGGCTTTCTCATTTTAA ACGAATGACGTTTACTTCGCTTTACCCTGGTGTAGGCTGGAGCTGCTTCG

The gltB gene, which encodes the large subunit of the glutamate synthase, is deleted by using the oligonucleotides DgltBF (SEQ ID N°14) :

CCGTATTAACCGATGCGAAAAGGACAACAAGGGGGCGAATGCGAGGCGCGCG TATGACACGCAAACCCCGTCGCCACGCCATATGAATATCCTCCTAAG and DgltBR (SEQ ID N°15) :

GGCGGATCAACGCGCTGCAGGTCGATAAATTGATAAACATTCTGACTCATTGT TGCTACCCCTTACTGCGCCTGCACGCGCAATGTAGGCTGGAGCTGCTTCG The potABCD operon, which encodes a putrescine transporter, is deleted by using the oligonucleotides DpotAF (SEQ ID N°16):

CCAAGGTGGTTAACCACAAACCCCGCATCGGTAAGCCATCCGTTGCGTTTACA TGGGACAGAGTAAAAAATTGAATAAACAACATATGAATATCCTCCTAAG and DpotDR (SEQ ID N°17) :

CATTAGCCACATCCTTGCTAACTAAAAAACGGGCGGTAATACCACCGCCCGCT TGCTGAATTAACGTCCTGCTTTCAGCTTTGTAGGCTGGAGCTGCTTCG

The potFGHI operon, which encodes a putrescine transporter, is deleted by using the oligonucleotides DpotFF (SEQ ID N°18) :

GTGTGACAACTTTTGTTCGTTTGTTAACGAACTTTCAGAAGGAAAGAGATATG ACCGCCTTAAATAAAAAATGGCTATCGCATATGAATATCCTCCTAAG and DpotIR (SEQ ID N°19) : GAAAACAATGCCGCGACATGCGCGGCATTATGTAGCCAGGTTGGCAAATTTTA GTGTCTTCAGCCACGTCTTGCACGCTGTGTAGGCTGGAGCTGCTTCG

All these deletions are introduced into MG1655 using the well known method to disrupt chromosomal genes in Escherichia coli described by Datsenko and Wanner (2000). This method allows the combination of multiple genetic modifications using different resistance genes which can be removed. The resulting strain is called MG1655 DsdaA DgpmA DgltB DpotABCD DpotFGHI. For the serine dehydrogenase activity, the ydfG gene from Escherichia coli is cloned into the pMElOl plasmid described in patent application WO 2007/077041 under the Ptrc/lacO promoter. The primer ydfG F (SEQ ID N°20) :

ATGCTCATGATCGTTTTAGTAACTGGAGC containing a Bsplll site and the primer ydfG R: (SEQ ID N°21):

GCATTCTAGAGC AGAAAGGCCCACCCGAAGGTGAGCC AGTTACTGACGGTGG ACATTCAGTCCGGC containing a Xbal site are used to amplify the ydfG gene from Escherichia coli. The PCR product is restricted by Bsplll I Xbal and cloned into the vector pME l O l restricted by the same restriction enzymes. The resulting vector is called pME101-^ G-TT07.

The pME101-j¾? ^" (j-TT07 plasmid is then introduced into the strain MG1655 DsdaA DgpmA DgltB DpotABCD DpotFGHI.

To increase the glutamate pool necessary for the transaminase activity, the gdhA gene from Escherichia coli is cloned into the pCClBAC-serB-serA-serC plasmid described in patent ap p li c ation WO 2009 /043 3 72 . T he p rimer g dhA F (SEQ ID N°22): GCGGCGCCTTATGAGATTACTCTCGTTATTAATTTGC containing a Sfol site and the primer gdhA R (SEQ ID N°23):

ATCCCGGGGCAGAAAGGCCCACCCGAAGGTGAGCCAGCTGAAATTTTGCCGG GGGCGC containing a Smal site are used to amplify the gdhA region from Escherichia coli genomic DNA. The PCR product is restricted by Sfol I Smal and cloned into the vector pCClBAC-serB-serA-serC restricted by Sfol. The resulting vector where the gdhA, serB, serA and serC genes are in the same orientation is called pCCl AC-gdhA-TTOT-serB- serA-serC.

The pCClBAC-gdhA-TTOT-serB-serA-serC plasmid is then introduced into the strain MG1655 DsdaA DgpmA DgltB DpotABCD DpotFGHI (pME101-j¾//G-TT07).

This strain grown in appropriate conditions produces ethylenediamine in amount higher than 0,1 mg/L. EXAMPLE 5

Construction of a strain having a pathway converting L-serine to ethylenediamine via 2.3-diaminopropanoate (pathway D) To produce ethylenediamine via 2.3-diaminopropanoate, the strain MG1655 DsdaA DgpmA DgltB DpotABCD DpotFGHI

TT07) (pCClBAC-gdhA-TT07-serB-serA-serC) is constructed.

The construction of the strain MG1655 DsdaA DgpmA DgltB DpotABCD DpotFGHI is described in example 4.

For the amino acid decarboxylase activity, the sdc optimized sequence (SEQ ID N°03) from Arabidopsis thaliana is cloned under the Ptrc/lacO promoter into the pME l O l plasmid u s i n g t h e p r i m e r S D C a t F (SEQ ID N°24): CAGACCATGGTGGGCAGCCTGGAATC containing a Ncol site and SDCat R (SEQ ID N°25): TAGAGGATCCTTATTTGTGTGCAGGACAAATGC containing a BamHl site. The PCR product is restricted by BamHl I Ncol and cloned into the vector pME l O l described in patent application WO 2007/077041 , restricted by the same restriction enzymes. The resulting vector is called pMEl Ol-SDCat. The ydfG gene from Escherichia coli encoding the serine dehydrogenase activity is cloned downstream the sdc gene under the PtrcO l /lac O promoter The primer ydfG F2 (SEQ ID N°26): ATGCGGATCCGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAA TTGTGAGCGGATAACAATTTCATAAGGAGGTTATAAATGATCGTTTTAGTAACT GGAGC containing a BamHl site and the primer ydfG R (SEQ ID N°21) containing a Xbal site are used to amplify the ydfG gene from Escherichia coli. The PCR product is restricted by BamHl I Xbal and cloned into the vector pMElOl-SDCat described in example 4, restricted by the same restriction enzymes. The resulting vector is called pME 101 -SDCat-PtrcO 1/OPO 1/RBSO 1 *2-ydfG-TT07.

The pME101- _l SDCai-Ptrc01/OP01/RBS01 ^!i: 2-3 G-TT07 and the previously described pCCl AC-gdhA-TTOT-serB-serA-serC plasmids are then introduced into the strain MG1655 DsdaA DgpmA DgltB DpotABCD DpotFGHI.

This strain grown in appropriate conditions produces ethylenediamine in amount higher than 0,1 mg/L. REFERENCES

- Akita et al, 2010. JBiochem. 147 (1): 83-93.

- Bertani et al, 1951. J Bacteriol. 62: 293-300.

- Carrier TA and Keasling JD., 1999. Biotechnol. Prog. 15(1): 58-64.

- Chowdhury et al, 1996. Bioscience, Biotechnology, and Biochemistry. 60 (12): 2043- 2047

- Datsenko and Wanner, 2000, Proc Natl Acad Sci US A. 97: 6640-6645.

- Escalante et al, 2012. Appl Microbiol Biotechnol. 94 (6): 1483-1494.

- Fujisawa et al, 2003. Biochimica and biophysica acta. 1645 (1): 89-94.

- Hawes et al, 1996. FEBS Lett. 389 (3): 263-267.

- Lokanath et al, 2005. JMol Biol. 352 (4): 905-917.

- Nagy et al, 1995. J Bacteriol. Ill (5): 1292-1298.

- Paz et al, 1965. Arch Biochem Biophys. 109: 548-559.

- Pramanik J and Keasling JD., 1997. Biotech. Bioeng. 56 (4): 399-421.

- Pr escott et al , 1999, "Microbiology " 4th Edition, WCB Mc Graw-Hill.

- Ravnikar et al, 1987, Journal of Bacteriology. 169: 261 1-2617.

- Rontein et al, 2001. J. Biol. Chem. 276: 35523-35529.

- Sambrook et al, 1989 and 2001, "Molecular Cloning: A Laboratory Manual" 2nd & 3rd Editions, Cold Spring Harbor Laboratory Press.

- Tchigvintsev et al, 2012. J. Biol. Chem., 287 (3): 1874-1883.

- Umbarger et al, 1978, Annual review of Biochemistry. 47: 532-606

- Varma and Palsson, 1994. Appl Environ Microbiol 60 (10): 3724-3731

- Weusthuis et al, 1994, Microbiologial reviews. 58: 616-630.

- Yao et al, 2010. Appl Biochem Biotechnol. 160 (3): 694-703.