Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
EXOSOMES AND DERIVED USES
Document Type and Number:
WIPO Patent Application WO/2019/087098
Kind Code:
A1
Abstract:
The present invention relates to exosomes negative for the expression of CD99, that is, CD99- exosomes, characterized by specific molecular markers. Moreover, the present invention relates to a pharmaceutical composition which comprises said exosomes and the derived medical uses of said exosomes and/or of the composition.

Inventors:
SCOTLANDI, Katia (Via del Cavicchio 30, Pianoro, 40065, IT)
CARE', Alessandra (Via Ruggero Fauro 4, Roma, 00197, IT)
Application Number:
IB2018/058541
Publication Date:
May 09, 2019
Filing Date:
October 31, 2018
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
ISTITUTO ORTOPEDICO RIZZOLI (Via di Barbiano 1/10, Bologna, 40136, IT)
ISTITUTO SUPERIORE DI SANITÀ (Viale Regina Elena 299, Roma, 00161, IT)
International Classes:
C12N15/11
Other References:
S. VENTURA ET AL.: "CD99 regulates neural differentiation of Ewing sarcoma cells through miR-34a-Notch-mediated control of NF-[kappa]B signaling", ONCOGENE, vol. 35, no. 30, 30 November 2015 (2015-11-30), London, pages 3944 - 3954, XP055488531, ISSN: 0950-9232, DOI: 10.1038/onc.2015.463
Attorney, Agent or Firm:
ERRICO, Michela et al. (Viale Lancetti 17, Milano, 20158, IT)
Download PDF:
Claims:
CLAIMS

1 . Exosomes characterized by 1 ) the absence of CD99 protein

(exosomes CD99") and 2) by the expression of at least one miRNA marker selected from: SEQ ID NO: 1 -56 and combinations thereof.

2. The exosomes according to claim 1 , wherein said at least one miRNA marker is selected from: SEQ ID NO: 1 , 2, 6, 10, 16, 17, 18, 28, 40, 53 and combination thereof, preferably is SEQ. ID NO: 16 and/or 17; and /or is selected from: SEQ ID NO: 3-5, 7-9, 1 1 -15, 19-27, 29-39, 41 -52, 54-56 and combination thereof.

3. The exosomes according to claim 1 or 2 obtained from samples comprising cells originally CD99+ and wherein the expression of CD99 protein has been inactivated and/or suppressed.

4. The exosomes according to claim 3, wherein said cells originally CD99+ are cancer cells, preferably sarcoma cells, preferably

Ewing/Ewing-like sarcoma cells.

5. The exosomes according to claim 3 or 4, wherein said inactivation and/or suppression of CD99 expression is achieved by transcriptional and/or translational silencing of CD99 at imRNA molecule level and/or by knock-out of CD99 gene.

6. The exosome according to anyone of claims 3-5, wherein said silencing is achieved by using single or double strand RNA molecules, preferably small RNA molecules, preferably selected from: imiRNAs, siRNAs, shRNAs and combination thereof.

7. The exosome according to claim 6, wherein said shRNA molecule is directed against at least one portion of CD99 coding messenger/cDNA, more preferably said shRNA is directed against at least one portion of SEQ ID NO: 57 e/o 59, still more preferably said shRNA is SEQ ID NO: 61 .

8. The exosome according to anyone of claims 1 -7, wherein said CD99 has a protein sequence comprising SEQ ID NO: 58 and/or SEQ ID NO: 60, wherein SEQ ID NO:58 corresponds to the protein sequence of human type I CD99, and SEQ ID NO: 60 corresponds to the protein sequence of human type II CD99, and/or a nucleotide sequence comprising SEQ ID NO: 57 and/or SEQ ID NO: 59, wherein SEQ ID NO: 57 corresponds to cDNA sequence of human type I CD99, and SEQ ID NO: 59 corresponds to cDNA sequence of human type II CD99.

9. The exosome according to anyone of claims 3-8, wherein the cells, wherein CD99 protein expression has been inactivated and/or suppressed, have been immortalized and/or stabilized.

10. A pharmaceutical composition comprising the exosomes CD99" according to anyone of claims 1 -9 and pharmaceutically acceptable excipients.

1 1 .The exosomes CD99" according to anyone of claims 1 -9 and/or the pharmaceutical composition according to claim 10 for use as a medicament.

12. The exosomes CD99" according to anyone of claims 1 -9 and/or the pharmaceutical composition according to claim 10 for use in the treatment of a pathology caused by or associated with a mis- expression (that is altered expression), preferably iper-expression (overexpression/upregulation of expression) of CD99.

13. The exosomes CD99" and/or the pharmaceutical composition for use according to claim 12, wherein said pathology is a tumor, more preferably a sarcoma, even more preferably an Ewing/Ewing-like sarcoma, preferably a classic Ewing sarcoma and/or a peripheral primary neuroectodermal peripheral tumor (PNET) and/or Askin tumor and/or neoplasms characterized by chromosomal translocation leading to oncogenic fusion EWSR1 -ETS.

14. The exosomes CD99" and /or the pharmaceutical composition for use according to claims 1 1 -13 in combination with other molecules, preferably anti-inflammatories, antibiotics, anticancer, and/or in combination with further non-pharmacological approaches, preferably radiotherapy or surgery.

15. The exosomes CD99" and/or the pharmacological composition for use according to anyone of claims 1 1 -1 3 administered systemically, preferably by multiple or repeated administration.

Description:
EXOSOMES AND DERIVED USES"

*******

DESCRIPTION

The present invention relates to exosomes negative for the expression of CD99, that is, CD99- exosomes, characterized by specific molecular markers. Moreover, the present invention relates to a pharmaceutical composition which comprises said exosomes and the derived medical uses of said exosomes and/or of the composition.

PRIOR ART

Ewing sarcoma is a prevalently pediatric tumor with characteristics of extreme aggressiveness.

The origin of Ewing sarcoma is by now amply attributed to the malignant transformation of mesenchymal stem cells and/or neural crest cells determined by the presence of a fusion oncogene deriving from a reciprocal chromosomal translocation that acts as an initiating event when it is expressed in the appropriate cellular context.

In 85-90% of the cases of Ewing sarcoma, there is the presence of a reciprocal t(1 1 ;22)(q24;q12) chromosomal translocation which fuses EWSR1 with a gene of the ETS family, FLU , and produces the fusion transcript EWSR1 -FLI. The chimeric oncoprotein EWS-FLI1 is an aberrant transcriptional factor which deregulates the expression of key genes involved in the oncogenesis of Ewing sarcoma. Ten to fifteen percent of cases show the presence of t(1 1 ;22)(q24;q12) translocation associated with EWS-ERG fusion. In rare cases the presence of gene fusions such as: EWS-ETV1 , EWS-ETV4 and EWS-FEV is observed.

Alongside classic Ewing sarcoma, a family of highly undifferentiated tumors, called "Ewing-like sarcoma", has recently been defined. These neoplasms include a group of tumors characterized different gene fusions. In some cases the FUS gene, which like EWS is a member of the FET family of RNA-binding proteins (FUS, EWS and TAF15), fuses with the ERG or FEV genes. Other members of the family are characterized by t(4;19)(q35;q13) translocation, which generates the fusion product CIC- DUX4 or recurrent fusion involving the BCOR and CCN3B genes.

Alongside the presence of a fusion product, the tumors of the Ewing family are characterized by the expression of the membrane glycoprotein CD99 at high levels. The molecule is always present in all cells of classic Ewing sarcoma and in the Ewing-like variants characterized by involvement of the FUS gene, whereas tumors exhibiting the CIC-DUX4 or BCOR-CCNB3 fusion have a variable reactivity to CD99 with the presence of a diffuse pattern in only 23% and 60% of cases, respectively. In classic Ewing sarcoma, the presence of CD99 is necessary to create the condition of permissibility in order for the fusion gene to exert its transforming effect. The constant expression of CD99 at high levels thus plays a role in the tumor's malignancy.

Despite their rarity, these neoplasms have a major social impact, since they mainly affect children/adolescents and young adults. In the absence of systemic treatment only a very low percentage of patients can be cured of the disease (less than 10%). The introduction of systemic treatment with conventional chemotherapeutics, administered also at high doses, has brought the percentage of patients cured to around 65-70%, when the tumor is localized at the time of diagnosis. Notwithstanding this progress, the therapy of patients affected by Ewing sarcoma has not undergone substantial changes in the past twenty years. Patients with metastasis at the time of diagnosis still today suffer from wholly inadequate treatment (survival rates of less than 40%). No new effective drugs are available for any patients who fail to undergo first-line therapy and develop metastases. Ewing sarcoma is characterized by few genetic alterations and a low rate of mutation and this has in fact made the drugs of the latest generation, which have so greatly changed the clinical history of other tumors, including pediatric ones, inapplicable. Treatment of patients with Ewing sarcoma is still tied to the use of conventional chemotherapeutic drugs with inevitable problems of high toxicity and severe side effects that seriously compromise the quality of life of patients who survive the disease.

In light of the above, there is a strongly felt need to be able to have new therapeutic approaches, possibly to supplement those of a traditional type, with the aim of treating tumors like Ewing sarcoma caused by a misexpression, in particular an overexpression, of CD99.

The authors of the present study have found, as a solution to the above- described demands, the use of exosomes, or microvesicles, produced/obtained from cells, such as the cells of Ewing sarcoma and/or Ewing-like sarcoma, in which the expression of CD99 has been suppressed, in particular by silencing.

In particular, the authors of the present study have demonstrated that exosomes negative for the expression of CD99, i.e. CD99 " or CD99- negative exosomes, deriving from Ewing/Ewing-like sarcoma cells that have been deprived of the expression of CD99 (that is, in which the expression of CD99 was silenced/suppressed), when administered, for example, in a subject affected by Ewing/Ewing-like sarcoma, i.e. a tumor characterized by the expression of CD99, are capable of inducing, in the receiving tumor cells, the same phenotype otherwise obtained with direct gene manipulation. In other words, CD99- exosomes derived/obtained from Ewing/Ewing-like sarcoma cells in which the expression of CD99 has been suppressed, preferably by silencing, are capable of inducing, in receiving tumor cells characterized by the expression (in particular hyperexpression) of CD99 as Ewing/Ewing-like sarcoma, the same reversion of malignancy that is obtained by silencing of the CD99 gene in said receiving tumor cells. Therefore, said CD99- exosomes are capable of producing important therapeutic effects in the preclinical stage and modifications of the tumor phenotype (i.e. tumor reversion) without passing through the difficult modification of DNA. The effects observed were obtained using various tumor lines characterized by misexpression (hyperexpression) of CD99 as an experimental model; it can thus be significantly affirmed that what was surprisingly found by the authors of the present study has general value with respect to the exemplified tumors, namely, Ewing/Ewing-like sarcomas.

As demonstrated in the example that follows, following administration of CD99- exosomes deriving from Ewing/Ewing-like sarcoma cells that have been deprived of the expression of CD99, Ewing/Ewing-like sarcoma tumor cells advantageously show a complete reversion of the malignant phenotype and, in particular: 1 ) less cell proliferation, 2) differentiation capacities and 3) inhibition of migration capacities.

Therefore, for the first time it is demonstrated that exosomes, in this case CD99- exosomes, are capable of determining a return of tumor cells such as those of Ewing/Ewing-like sarcoma to the condition of a normal, i.e. non-malignant, phenotype when they are obtained from tumor cells such as those of Ewing/Ewing-like sarcoma in which the expression of CD99 was suppressed, preferably by silencing.

The therapeutic effect is very specific, that is, it is exerted exclusively on tumor cells and not on normal (non-malignant) cells, which thus do not undergo any toxic effects and/or alterations in terms of proliferation- differentiation.

BRIEF DESCRIPTION OF THE FIGURES

The present invention is described below in detail and exemplified by way of non-limiting illustration, also with the aid of the appended figures, in which:

- Figure 1 shows an assessment of cell proliferation (using the known marker Ki-67) following homologous fusions, i.e. the TC-71 and lOR/CAR cell lines (overexpressing CD99) were treated with exosomes isolated from the same cell line in which the expression of CD99 was silenced (homologous CD99- exosomes) or was not silenced (CTR). *** p Value <0.001 ; ** p Value≤0.01 ; * p Value <0.05 Student's t test.

- Figure 2 shows an assessment of cell proliferation (using the known marker Ki-67) following heterologous fusions, i.e. the TC-71 , lOR/CAR, LAP-35 and 6647 cell lines (overexpressing CD99) were treated with exosomes isolated from a Ewing sarcoma cell line - in which the expression of CD99 was silenced - which are different from the receiving line (heterologous CD99- exosomes) and with exosomes obtained from a cell line of Ewing sarcoma in which the expression of CD99 was not silenced (CTR). *** p Value ≤0.001 ; ** p Value ≤0.01 ; * p Value <0.05 Student's t test.

- Figure 3 shows an assessment of incorporation with propidium iodide and viable Hoechst stain in TC-71 and lOR/CAR cells under basal conditions (CTR) and after fusion with exosomes isolated from the same cells in which the expression of CD99 was silenced (homologous CD99- exosomes).

- Figure 4 shows an assessment of apoptosis with the Annexin-V kit in TC- 71 , lOR/CAR and LAP-35 cells under basal conditions (CTR) and after fusion with exosomes isolated from the same cells and isolated from heterologous cells in which the expression of CD99 was silenced (homologous or heterologous CD99- exosomes).

- Figure 5 shows the results of a wound healing assay performed on TC- 71 , lOR/CAR and LAP-35 cell lines after treatment with exosomes isolated from the same cells and isolated from heterologous cells in which the expression of CD99 was silenced (homologous or heterologous CD99- exosomes).

- Figure 6 shows the results of a motility assay performed on untreated (CTR) TC-71 and 6647 cell lines after treatment with exosomes isolated from the same cells and isolated from heterologous cells in which the expression of CD99 was silenced (homologous or heterologous CD99- exosomes) *** pValue <0.001 Student's t test.

- Figure 7 shows a clustering analysis of imiRNAs differentially expressed in exosomes isolated from TC-71 cells not silenced for CD99 expression (parental) and exosomes isolated from the same cells in which the expression of CD99 was silenced (i.e. exosomes isolated from TC-CD99- shRNA#1 and # 2 cell clones in which shRNA#1 and # 2 were used to silence the expression of CD99).

- Figure 8 shows the expression of miR-199a-3p and miR-214-3p in exosomes isolated from TC-71 and lOR/CAR cell lines not silenced for CD99 expression (parental) and exosomes isolated from the same cell lines in which the expression of CD99 was silenced (i.e., exosomes isolated from TC-CD99-shRNA#1 , TC-CD99-shRNA#2, CAR-CD99- shRNA#1 and CAR-CD99-shRNA#2 cell clones in which shRNA#1 and # 2 were used to silence the expression of CD99).

- Figure 9 shows an assessment of miR-199b-3p and miR-214-3p expression performed on 45 samples drawn from patients affected by Ewing sarcoma, of which 35 primitive samples and 10 metastasis samples. The statistical significance of the differences between the means of the two groups was calculated using the Mann Whitney test - Mest. - Figure 10 shows A) the expression of β-ΙΙΙ tubulin after 24 hours and 6 and 1 1 days of neural differentiation. Mesenchymal cells (CTR) and cells treated with CD99- exosomes isolated from the TC-CD99-shRNA#2 clone (in which the expression of CD99 was silenced) were maintained in a normal medium and in a differentiating medium (MIX); B) Assessment of osteoblast differentiation in the primary culture of mesenchymal cells

(MES-1 ) after treatment with CD99- exosomes deriving from the TC- CD99-shRNA#2 clone by heterologous fusion. Mesenchymal cells (CTR) and cells treated with CD99- exosomes were maintained in a differentiating medium. Expression of alkaline phosphatase (ALP), Nikon microscope photos at TO, 7, 14 and 21 days; C) Photos of calcium deposits after ARS staining, optical microscope at TO, 7 and 14 days. D) Real-time PCR for evaluating the expression of 2 markers of osteoblast differentiation, COL1 A2 and ALP. The RNA was extracted at TO, 7 and 14 days.

- Figure 1 1 shows A) Western blot and B) Real-Time PCR for EWS-FLI1 in the TC-71 cell line not silenced for CD99 expression (positive control) and in human mesenchymal cells (MES-1 ), treated or not treated with CD99- exosomes isolated from TC-CD99-shRNA#2 cell clones in which the expression of CD99 was silenced (heterologous fusion).

DEFINITIONS

In the context of the present invention, the terms vesicles, microvesicles (or exosomal vesicles/microvesicles), microparticles and exosomes are used as synonyms and are intended to mean small vesicles of endosomal origin with a diameter of a few tens to a few hundreds of nanometers. Exosomes originate from the multi-vesicular body (MVB), which in turn represents one of the possible outcomes of the maturation of late endosomes. Exosomes are provided with a membrane characterized by the same orientation as the plasma membrane and made up of a phospholipid bilayer rich in cholesterol, sphingomyelin and ceramide. Their origin also justifies the presence of specific markers such as proteins of the ESCRT complex, Alix and TSG101 and the tetraspanins CD9, CD63, CD81 and CD82, transmembrane proteins characterized by two extracellular loops rich in amino acid residues conserved in numerous species.

In the past, exosomes were considered a means used by a cell to dispose of waste products and toxins. Recently, however, they have caught the attention of researchers and are studied in physiological and pathological contexts, as they are part of the endogenous intracellular communication system. Exosomes are produced by all types of cells and are found in nearly all bodily fluids.

In the context of the present invention, CD99 means the glycoprotein transcribed by the MIC2 gene (also known by the following alternative names: HBA71 ; MIC2X; MIC2Y; MSK5X) present in the pseudoautosomal region of the sex chromosome X. The gene, which extends for over 50 Kb, encodes for two different isoforms as a result of an alternative splicing that takes place in the primary transcript. The full-length isoform, known as

CD99 type-l, is characterized by 185 amino acid residues and a molecular weight of 32 kDa. The short isoform, known as CD99 type-ll, is composed of 161 amino acid residues and has a molecular weight of 28 kDa. Comparative sequence studies have shown that the short isoform differs from the full-length one in the presence of an insert between exon 8 and exon 9 of 18 base pairs (bp) which, by introducing an in-frame stop codon in the gene sequence, originates a truncated form.

Analyses performed on the cDNA and with spectroscopy have shown that this glycoprotein possesses the N-terminal domain at an extracellular level, a transmembrane domain of a hydrophobic nature and the C- terminal end, containing only 36 amino acids, with an intracellular localization.

The physiological functions that the glycoprotein CD99 performs in different regions still remain scarcely known, above all due to the failure to identify its endogenous ligand. In any case, the role of these two isoforms is closely dependent on the type of cell in which they are expressed.

CD99 is ubiquitously distributed and expressed at high levels along the plasma membrane of endothelial cells, in hematopoietic progenitor cells and in the thymocytes, as well as on the surface of circulating leukocytes, even though to a lesser extent. Many other types of cells are also not exempt, including pancreatic islets, islets of Langerhans, Leydig and Sertoli cells and ependymal cells. Finally, CD99 is also expressed on the membrane of various tumors, such as Ewing sarcoma and primitive neuroectodermal tumors. The high expression of CD99 in Ewing sarcoma is by now a consolidated characteristic and today CD99 is routinely used as a diagnostic marker of this neoplasm. One of the first bodies of evidence regarding the role of CD99 in this pathology was in Cerisano et al. 2004, where it was demonstrated that CD99 interacts with the actin cytoskeleton, favoring phenomena of cell-cell adhesion, such as the formation of adherens junctions, and cell apoptosis. Studies in the therapeutic realm have investigated the cause-effect relationship existing between the expression of the glycoprotein and the triggering of apoptotic mechanisms and they have revealed that the activation of CD99 through monoclonal antibodies produces massive caspase-independent cell death. This effect is attributable to an impairment of the mitochondrial membrane as a consequence of the opening of the mitochondrial transition pores and hence a considerable reduction in the membrane potential. It should be noted that the stimulation of CD99 in differentiated Ewing cells does not produce this effect, probably because of the lower expression of the glycoprotein. Studies conducted in vivo and in vitro have demonstrated that the inhibition of CD99 significantly impairs the growth capacity of tumor cells, inducing apoptotic stimuli and reducing the metastatic potential. Furthermore, the use of anti-CD99 monoclonal antibodies has proven to be extremely advantageous in association with other conventional antitumor agents, such as doxorubicin and vincristine. Furthermore, CD99 plays a key role in preventing neural differentiation of Ewing sarcoma cells and its presence is correlated with a greater tumor aggressiveness. In fact, the silencing thereof produces a reduction in cell proliferation under conditions of anchorage-independence, a reduction in the cell migration capacity and consequently in the number of metastases produced in athymic mice. CD99 thus participates in the creation of the transforming phenotype, interfering with the neural differentiation of tumor cells. For this reason, its silencing produces an increase in neuronal extensions in cells and a greater expression of intermediate and terminal differentiation markers such as β-ΙΙΙ tubulin and heavy neurofilaments. Recent experimental evidence has clarified in what manner CD99 may interfere with differentiation mechanisms. Ventura et al. 2016 demonstrated that downstream of this glycoprotein there is an activation of the transcription factor NF-kB, a complex that is an agonist of proliferative processes and survival, and NF-kB prevents the differentiation of tumor cells. Furthermore, it has been proven that although on the one hand CD99 and EWS-FLI1 have equal importance in maintaining tumor aggressiveness high, on the other hand the latter assumes an opposite behavior vis-a-vis NF-kB. EWS-FLI1 interferes with the basal activity of NF-kB, whereas CD99 considerably increases its oncogenic potential. In the context of the present invention, Ewing sarcoma means a rare form of neoplasia that falls in the category of bone sarcomas, in second place in terms of incidence after osteosarcoma. Ewing sarcoma is an extremely aggressive, poorly differentiated tumor composed of small roundish cells. The current definition includes classic Ewing sarcoma, peripheral primitive neuroectodermal tumors (PNETs) and the Askin tumor. These neoplasms are considered a single entity since they share the presence of the chromosomal translocation that leads to the EWSR1 -ETS oncogenic fusion.

In the context of the present invention, overexpression (or hyperexpression) means an increased expression of a gene/protein compared to the normal physiological level.

In the context of the present invention, tumor cells overexpressing CD99 means tumor cells that express higher protein levels of CD99 compared to normal tissues. The high expression of CD99 has been shown in some neoplastic tissues, such as acute lymphoblastic leukemia, embryonal rhabdomyosarcoma and, sporadically, in synovial sarcoma and mesenchymal chondrosarcoma. However, Ewing sarcoma and primitive neuroectodermal tumors express the highest levels of CD99. The expression of this antigen is in fact used, together with evidence of the specific translocations, as a diagnostic marker for these neoplasms.

In the context of the present invention, oncogene or oncogenic functionality means a gene, or a series of nucleotides encoding a protein, which is potentially capable of orienting a cell towards the development of a neoplastic phenotype. Oncogenic functionality means the ability of an oncogene to increase the possibility that a cell's development (proliferation and differentiation) is oriented towards a tumor.

DETAILED DESCRIPTION OF THE INVENTION A first aspect of the present invention relates to exosomes, also called microvesicles, vesicles or cellular/endosomial microparticles, said exosomes being: 1 ) negative for the expression of the CD99 protein - that is, CD99- (CD99-negative) exosomes; and 2) characterized by the expression of at least one miRNA marker selected from: SEQ ID NO: 1 -56 and combinations thereof.

MicroRNAs (miRNAs) are small endogenous single-stranded non-coding RNA molecules generally about 20-22 nucleotides long and mainly active in regulating gene expression at a post-transcriptional level.

According to a preferred embodiment of the invention, said CD99- exosomes are characterized by the expression of at least one miRNA marker selected from: SEQ ID NO: 1 , 2, 6, 10, 16, 17, 18, 28, 40, 53 and combinations thereof; more preferably said CD99- exosomes are characterized by the expression of SEQ ID NO: 16 and/or 17.

According to a further preferred embodiment of the invention, said CD99- exosomes are characterized by the expression of at least one miRNA marker selected from: SEQ ID NO: 3-5, 7-9, 1 1 -15, 19-27, 29-39, 41 -52, 54-56 and combinations thereof.

Of said miRNAs, SEQ ID NO: 1 , 2, 6, 10, 16, 17, 18, 28, 40 and 53, are preferably upregulated, i.e. said miRNAs are expressed at higher levels, that is to say, in a larger amount, in CD99- exosomes than in CD99+ exosomes. In other words, said miRNA sequences are upregulated in CD99- exosomes obtained/isolated from cells in which the expression of CD99 was silenced/suppressed, as described below, compared to exosomes obtained/isolated from the original (parental) cells expressing CD99, said original cells preferably being Ewing/Ewing-like sarcoma cells overexpressing CD99.

Of said miRNAs, SEQ ID NO: 3-5, 7-9, 1 1 -15, 19-27, 29-39, 41 -52, 54-56 are preferably downregulated, i.e. said miRNAs are expressed at lower levels, that is to say, in a smaller amount, in CD99- exosomes than in CD99+ exosomes. In other words, said miRNA sequences are down regulated in CD99- exosomes obtained/isolated from cells in which the expression of CD99 was silenced/suppressed, as described below, compared to exosomes obtained/isolated from the original (parental) cells expressing CD99, said original cells preferably being Ewing/Ewing-like sarcoma cells overexpressing CD99.

According to a preferred embodiment of the invention, said exosomes express at least one marker of the tetraspanin family, more preferably selected from: CD9, CD63, CD81 , CD82 and combinations thereof.

Said exosomes preferably have an average diameter ranging from 30 to 150 nm.

In this context, CD99 means the molecule as earlier defined.

The protein sequence of CD99 preferably comprises SEQ ID NO: 58 and/or SEQ ID NO: 60, wherein SEQ ID NO: 58 corresponds to the human CD99 type I protein sequence, whilst SEQ ID NO: 60 corresponds to the human CD99 type II protein sequence.

CD99 is preferably encoded by a nucleotide sequence that comprises SEQ ID NO: 57 and/or SEQ ID NO: 59, wherein SEQ ID NO: 57 corresponds to the cDNA sequence of human CD99 type I, whilst SEQ ID NO: 59 corresponds to the cDNA of human CD99 type II.

As is well known in the art, cDNA or complementary DNA is a DNA molecule obtained/synthesized from a mature messenger RNA.

The exosomes of the present invention are produced by cells in which the CD99 protein is not expressed, that is, the exosomes are negative for the expression of CD99 following inactivation/suppression of its expression at the cellular level. Therefore, the exosomes of the present invention are also defined CD99- exosomes. The starting (original/parental) cells from which the CD99- exosomes of the present invention are obtained are CD99 positive (CD99 + ) - they preferably overexpress CD99 - and the expression of CD99 is inactivated/suppressed in them. In some embodiments of the invention, the inactivation and/or the suppression of the expression of CD99 can obtained with various techniques useful for this purpose, i.e. techniques for nullifying/silencing the expression of CD99. Inactivation is preferably obtained by silencing CD99 at a transcriptional and/or translational level at the level of the imRNA molecule and/or by knockout of the gene encoding CD99. Said silencing is preferably achieved using molecules that are preferably directed against the gene encoding CD99 and/or the corresponding imRNA and are thus capable of interfering with, or suppressing, the expression of CD99. Said molecules preferably have an RNA chemistry; they are preferably single- or double-stranded RNA molecules. More preferably, said molecules are small single- or double-stranded RNA molecules, preferably selected from: imiRNA, siRNA, shRNA and combinations thereof.

According to a particularly preferred embodiment of the invention, the silencing of CD99, that is, the obtainment of cells that no longer express CD99, is achieved using at least one short hairpin RNA (shRNA) molecule. Said shRNA molecule is preferably directed against at least one portion of the CD99 coding messenger/cDNA; more preferably, said shRNA is directed against at least one portion of SEQ ID NO: 57 and/or 59, even more preferably said molecule of shRNA is SEQ ID NO: 61 .

Alternatively, the silencing can be achieved by means of editing techniques, preferably based on the CRISPR-Cas9 method.

The CD99- exosomes of the present invention are preferably produced/secreted/generated by samples comprising cells, preferably in the medium in which said samples are maintained/cultured.

The original/parental cells from which the exosomes of the present invention are obtained are preferably of a tumor derivation/type, i.e. they are tumor cells. The tumor from which said cells derive is preferably Ewing sarcoma and/or Ewing-like sarcomas as defined earlier and/or peripheral primitive neuroectodermal tumors (PNETs) and/or the Askin tumor.

As defined earlier, these tumors are characterized by an overexpression of CD99 and the exosomes of the present invention derive from cells or also biological samples or tissues containing cells obtained/isolated from said tumors in which the expression of the CD99 was suppressed/nullified/silenced, preferably with the above-described method of suppression of the expression or silencing of CD99. According to one embodiment of the invention, it is preferable to use said CD99- exosomes following procedures of isolation and/or purification from the cell sample or cell culture medium using the techniques available for this purpose and well known to a person skilled in this technical field. The isolation/purification techniques used preferably comprise at least one ultracentrifugation step and/or at least one extraction with common kits used for that purpose, such as, for example, Exoquick-TC.

Therefore, in one embodiment the CD99- exosomes of the invention are isolated, or purified.

Said cell samples preferably comprise immortalized and/or stabilized cells (or cell lines), that is, the cells have a practically unlimited proliferative potential. The cell line can be immortalized/stabilized starting from primary cells, preferably from cells isolated from an individual, preferably an individual affected by a tumor selected from: Ewing/Ewing-like sarcoma as defined above, peripheral primitive neuroectodermal tumors (PNETs) and the Askin tumor; said tumor is preferably characterized by an overexpression of CD99. The immortalized and/or stabilized cells are subjected to silencing/suppression of the expression of CD99, as previously described, in order to be able to obtain the CD99- exosomes of the invention. The immortalized and/or stabilized cells are the parental/original cells as previously described.

The cells from which the CD99- exosomes derive are preferably synchronized before being expanded. Furthermore, they are cultured in a culture/growth/proliferation medium that is preferably supplemented with serum, preferably human and/or animal, depleted of microvesicles.

According to a preferred aspect of the invention, said CD99- exosomes are obtained from cells (the parental/original ones) of Ewing/Ewing-like sarcoma in which the expression of CD99 is suppressed by silencing using an interfering molecule, preferably a small interfering RNA molecule, more preferably an shRNA, even more preferably SEQ ID NO: 61 .

The CD99- exosomes of the present invention are preferably obtained/isolated from the Ewing sarcoma cell line CAR-CD99-shRNA#1 deposited with the DSMZ on October 26, 2017, with the accession number DSM ACC3334. This cell line was obtained by silencing (suppressing/nullifying) the expression of CD99 using SEQ ID NO:61 , i.e. an shRNA molecule directed against SEQ ID NO: 62, i.e. a 3'UTR sequence of the CD99 gene, with the formation of 270 base pairs after the end of the stop codon.

The Ewing sarcoma cell line was obtained from the Ewing sarcoma lOR/CAR line (i.e. the parental line of CD99 + overexpressing CD99) deposited with the DSMZ on October 26, 2017, with the accession number DSM ACC3333.

A further aspect of the present invention relates to a method for obtaining CD99- exosomes which comprises at least the following steps:

(i) obtaining a biological sample comprising cells expressing CD99, preferably overexpressing CD99, said cells preferably being tumor cells, preferably of a tumor selected from: Ewing/Ewing-like sarcoma as defined above, peripheral primitive neuroectodermal tumors (PNETs) and the

Askin tumor; said tumor is preferably characterized by an overexpression of CD99; and

(ii) nullifying/suppressing the expression of CD99 in said cells expressing CD99, preferably by transcriptional and/or translational silencing of CD99 at the level of the imRNA molecule and/or by knockout of the gene encoding CD99.

The method for obtaining CD99- exosomes of the invention preferably comprises a further step (iii) of isolating and/or purifying the CD99- exosomes produced/generated by the cells in which the expression of CD99 was suppressed/nullified according to step (ii); the exosomes are preferably isolated and/or purified from the culture medium of said cells. Any technique available for this purpose and well known to a person skilled in this technical field can be used; the technique of isolation/purification used preferably comprises at least one step of ultracentrifugation and/or at least one extraction step with the common kits used for this purpose, such as, for example, Exoquick-TC.

The silencing of step (ii) is preferably achieved using molecules which, preferably, are directed against the gene encoding CD99 and/or the corresponding mRNA and which are thus capable of interfering with, or suppressing, the expression of CD99. Said molecules preferably have an RNA chemistry; they are preferably single- or double-stranded RNA molecules. More preferably, said molecules are small single- or double- stranded RNAs, preferably selected from: imiRNA, siRNA, shRNA and combinations thereof.

According to a particularly preferred embodiment of the invention, the silencing of CD99 according to the step (ii), that is, the obtainment of cells that no longer express CD99, is achieved using at least one molecule of short harpin RNA (shRNA). Preferably, said shRNA molecule is directed against at least one portion of the CD99 coding messenger/cDNA; more preferably, said shRNA is directed against at least one portion of SEQ ID NO: 57 and/or 59, even more preferably said shRNA molecule is SEQ ID NO: 61 .

A further aspect of the present invention relates to CD99- exosomes, i.e. exosomes negative for the expression of CD99 obtainable/obtained with the above-described method, said CD99- exosomes being also characterized by the expression of at least one mi RNA marker selected from: SEQ ID NO: 1 -56 and combinations thereof. Said CD99- exosomes are preferably characterized by the expression of at least one mi RNA marker selected from: SEQ ID NO: 1 , 2, 6, 10, 16, 17, 18, 28, 40, 53 and combinations thereof, more preferably said CD99- exosomes are characterized by the expression of SEQ ID NO: 16 and/or 17. Said CD99- exosomes are preferably characterized by the expression of at least one miRNA marker selected from: SEQ ID NO: 3-5, 7-9, 1 1 -15, 19-27, 29-39, 41 -52, 54-56 and combinations thereof. Said miRNAs, SEQ ID NO: 1 , 2, 6, 10, 16, 17, 18, 28, 40 and 53 are upregulated, i.e. said miRNAs are expressed at higher levels, that is to say, in a larger amount, in CD99- exosomes than in CD99+ exosomes. In other words, said miRNA sequences are upregulated in the CD99- exosomes obtained/isolated from cells in which the expression of CD99 was silenced/suppressed as described below compared to exosomes obtained/isolated from the original cells expressing CD99, said cells preferably being Ewing/Ewing- like sarcoma cells overexpressing CD99. Of said miRNAs, SEQ ID NO: 3- 5, 7-9, 1 1 -15, 19-27, 29-39, 41 -52, 54-56 are preferably down regulated, i.e. said miRNAs are expressed at lower levels, that is to say, in a smaller amount, in CD99- exosomes than in CD99+ exosomes. In other words, said miRNA sequences are downregulated in CD99- exosomes obtained/isolated from cells in which the expression of CD99 was silenced/suppressed as described below compared to exosomes obtained/isolated from the original cells expressing CD99, said cells preferably being Ewing/Ewing-like sarcoma cells overexpressing CD99. According to a preferred embodiment of the invention, said exosomes express at least one marker of the tetraspanin family, more preferably selected from: CD9, CD63, CD81 , CD82 and combinations thereof. Said exosomes preferably have an average diameter ranging from 30 to 150 nm.

A further aspect of the present invention relates to a pharmaceutical composition comprising the CD99- exosomes as described above and pharmaceutically accepted excipients.

According to one embodiment of the invention, said composition further comprises a carrier, a delivery agent or an adjuvant.

A further aspect of the present invention relates to the CD99- exosomes and/or the pharmaceutical composition comprising said CD99- exosomes for use as a medicament, preferably for the treatment of a pathology caused by or associated with a misexpression (or altered expression), preferably hyperexpression (overexpression/upregulation of the expression) of CD99.

Said pathology is preferably a tumor, more preferably a sarcoma, even more preferably a Ewing/Ewing-like sarcoma, preferably understood as classic Ewing sarcoma and/or peripheral primitive neuroectodermal tumors (PNETs) and/or the Askin tumor and/or neoplasms characterized by the chromosome translocation leading to the EWSR1 -ETS oncogenic fusion. According to a preferred embodiment of the invention, the CD99- exosomes and/or the pharmaceutical composition comprising said CD99- exosomes are used as antitumor agents, possibly in combination with other molecules, for example anti-inflammatories, antibiotics, antitumor agents, and/or further approaches of a non-pharmacological type, for example radiotherapy and/or surgery.

The CD99- exosomes and/or the pharmaceutical composition comprising said CD99- exosomes are preferably administered systemically, preferably with multiple or repeated administrations.

A further aspect of the present invention relates to the use of CD99- exosomes and/or a composition comprising CD99- exosomes to block cell proliferation and/or migration, preferably the proliferation of tumor cells, preferably sarcoma cells, preferably Ewing/Ewing-like sarcoma cells as defined above.

Said blocking of cell proliferation is preferably not accompanied by cell death, i.e. the cells cease proliferating but do not die.

A further aspect of the present invention relates to the use of CD99- exosomes and/or a composition comprising CD99- exosomes to induce the differentiation of cells, preferably tumor cells, preferably sarcoma cells, preferably Ewing/Ewing-like sarcoma cells. Said differentiation is preferably a neural differentiation.

A further aspect of the present invention relates to a method for treating a pathology, preferably a tumor, more preferably a sarcoma, even more preferably Ewing/Ewing-like sarcoma as defined above, caused by or associated with a misexpression (or altered expression), preferably hyperexpression (overexpression/upregulation of the expression) of CD99, said method comprising the steps of administering to an individual affected by said pathology/tumor/sarcoma a therapeutically effective amount of CD99- exosomes and/or a pharmaceutical composition comprising CD99- exosomes.

Said CD99- exosomes are preferably produced/secreted/generated by samples comprising cells, preferably in the medium in which said samples are maintained/cultured. Said cells are preferably of a tumor derivation/type. The tumor from which said cells derive is preferably Ewing sarcoma or Ewing-like sarcomas as previously defined, i.e. sarcomas characterized by an overexpression of CD99. In particular, the CD99- exosomes derive from Ewing/Ewing-like sarcoma cells/tissues in which the expression of the CD99 was suppressed/nullified/silenced, preferably using a method of suppressing the expression of and/or silencing CD99 described above.

According to a preferred embodiment of the invention, said CD99- exosomes are isolated and/or purified from said cell sample or from the culture medium of said sample using the techniques available for this purpose and well known to a person skilled in this technical field. They are preferably isolated by ultracentrifugation or extraction with the common kits used for this purpose, for example Exoquick-TC. The cells are preferably immortalized and/or stabilized, preferably starting from primary cells, more preferably from cells isolated from an individual. Said individual is preferably an individual affected by Ewing/Ewing-like sarcoma, more preferably a Ewing/Ewing-like sarcoma characterized by an overexpression of CD99.

Said immortalized and/or stabilized cells are subject to a silencing/suppression of the expression of CD99 as previously described for the purpose of being able to obtain the CD99- exosomes of the invention.

The cells from which the CD99- exosomes derive are preferably synchronized before being expanded. Furthermore, they are cultured in a culture/growth/proliferation medium that is preferably supplemented with serum, preferably human and/or animal, depleted of microvesicles.

As mentioned previously, a particularly preferred embodiment of the invention envisages that said CD99- exosomes are obtained from Ewing/Ewing-like sarcoma cells in which the expression of CD99 was suppressed by silencing using an interfering molecule, preferably a small molecule of interfering RNA, more preferably an shRNA, even more preferably SEQ ID NO: 61 .

As mentioned previously, said CD99- exosomes are characterized by the expression of at least one miRNA marker selected from: SEQ ID NO: 1 -56 and combinations thereof. In one embodiment of the invention, said CD99- exosomes are characterized by the expression of at least one miRNA marker selected from: SEQ ID NO: 1 , 2, 6, 10, 16, 17, 18, 28, 40, 53 and combinations thereof, more preferably said CD99- exosomes are characterized by the expression of SEQ ID NO: 16 and/or 17. In a further embodiment of the invention, said CD99- exosomes are characterized by the expression of at least one miRNA marker selected from: SEQ ID NO: 3-5, 7-9, 1 1 -15, 19-27, 29-39, 41 -52, 54-56 and combinations thereof. According to a preferred embodiment of the invention, said imiRNAs SEQ ID NO: 1 , 2, 6, 10, 16, 17, 18, 28, 40 and 53 are upregulated, i.e. they are expressed at higher levels, that is to say, in a larger amount, in CD99- exosomes than in CD99+ exosomes. In other words, said miRNA sequences are upregulated in CD99- exosomes obtained from cells in which the expression of CD99 was silenced/suppressed as described below compared to exosomes produced/obtained from the original cells expressing CD99, preferably Ewing/Ewing-like sarcoma cells overexpressing CD99. According to a further preferred embodiment of the invention, said miRNAs SEQ ID NO: 3-5, 7-9, 1 1 -15, 19-27, 29-39, 41 -52, 54-56 are downregulated, i.e. they are expressed at lower levels, that is to say, in a smaller amount, in CD99- exosomes than in CD99+ exosomes. In other words, said imiRNA sequences are downregulated in CD99- exosomes obtained from cells in which the expression of CD99 was silenced/suppressed as described below compared to exosomes produced/obtained from the original cells expressing CD99, preferably Ewing/Ewing-like sarcoma cells overexpressing CD99.

In a preferred embodiment of the invention, the CD99- exosomes obtained from the original CD99+ cells, preferably Ewing/Ewing-like sarcoma cells overexpressing CD99, in which the expression of CD99 was suppressed/nullified, preferably as described above, and characterized by the overexpression of SEQ ID NO: 16 and/or 17 compared to the exosomes produced/obtained from the original CD99 + cells, preferably Ewing/Ewing-like sarcoma cells overexpressing CD99, have demonstrated to be particularly effective in the treatment of aggressive tumor cells, preferably in the treatment of Ewing/Ewing-like sarcoma in the metastatic stage.

A further aspect of the present invention relates to at least one imiRNA, preferably a combination of miRNAs, selected from: SEQ ID NO: 1 -56 and the use of said imiRNA(s) as a marker(s), preferably of tumor cells, more preferably of sarcoma, preferably of Ewing/Ewing-like sarcoma. The combinations of miRNAs to be used as markers are also defined as panels or signatures.

The combinations preferably comprise: SEQ ID NO: 1 , 2, 6, 10, 16, 17, 18, 28, 40 and 53, more preferably SEQ ID NO: 16 and/or 17 and/or SEQ ID NO: 3-5, 7-9, 1 1 -15, 19-27, 29-39, 41 -52, 54-56.

A further aspect of the present invention relates to at least one imiRNA, preferably a combination of miRNAs, selected from: SEQ ID NO: 1 -56 and the use of said miRNAs as a diagnostic agent, preferably to diagnose a tumor, more preferably a sarcoma, preferably Ewing/Ewing-like sarcoma. The combinations of miRNAs to be used as markers are also defined as panels or signatures.

The combinations preferably comprise: SEQ ID NO: 1 , 2, 6, 10, 16, 17, 18, 28, 40 and 53, more preferably SEQ ID NO: 16 and/or 17 and/or SEQ ID NO: 3-5, 7-9, 1 1 -15, 19-27, 29-39, 41 -52, 54-56.

Table I below shows all the sequences mentioned in the present application. However, sequences characterized by 80-99% identity relative to the sequences shown here should be considered part of the present description.

The same are also appended to the present application as a sequence listing.

Table I

SEQ ID NO 1 hsa-let-7c-5p UGAGGUAGUAGGUUGUAUGGUU

SEQ ID NO 2 hsa-let-7g-5p UGAGGUAGUAGUUUGUACAGUU

SEQ ID NO 3 hsa-mir-1 182 GGGACUUGUCACUGCCUGUCUCCUCCCUCU

CCAGCAGCGACUGGAUUCUGGAGUCCAUCU AGAGGGUCUUGGGAGGGAUGUGACUGUUGG GAAGCCC

SEQ ID NO 4 hsa-miR-1249- AGGAGGGAGGAGAUGGGCCAAGUU

5p

SEQ ID NO 5 hsa-miR-125a- ACAGGUGAGGUUCUUGGGAGCC

3p

SEQ ID NO 6 hsa-miR-1273g- ACCACUGCACUCCAGCCUGAG

3p

SEQ ID NO 7 hsa-miR-1295b- AAUAGGCCACGGAUCUGGGCAA

3p

SEQ ID NO 8 hsa-miR-134-5p UGUGACUGGUUGACCAGAGGGG

SEQ ID NO 9 hsa-miR-1343- UGGGGAGCGGCCCCCGGGUGGG

5p

SEQ ID NO 1 0 hsa-miR-15b-5p UAGCAGCACAUCAUGGUUUACA

SEQ ID NO 1 1 hsa-miR-186-3p GCCCAAAGGUGAAUUUUUUGGG

SEQ ID NO 12 hsa-miR-1910- CCAGUCCUGUGCCUGCCGCCU 5p

SEQ ID NO 13 hsa-miR-191 1 - UGAGUACCGCCAUGUCUGUUGGG

5p

SEQ ID NO 14 hsa-miR-196a- UAGGUAGUUUCAUGUUGUUGGG

5p

SEQ ID NO 1 5 hsa-miR-196b- UAGGUAGUUUCCUGUUGUUGGG

5p

SEQ ID NO 1 6 hsa-miR-199a- ACAGUAGUCUGCACAUUGGUUA

3p

SEQ ID NO 1 7 hsa-miR-214-3p ACAGCAGGCACAGACAGGCAGU

SEQ ID NO 1 8 hsa-miR-29a-3p UAGCACCAUCUGAAAUCGGUUA

SEQ ID NO 1 9 hsa-miR-345-3p GCCCUGAACGAGGGGUCUGGAG

SEQ ID NO 20 hsa-miR-3617- AAAGACAUAGUUGCAAGAUGGG

5p

SEQ ID NO 21 hsa-miR-3682- UGAUGAUACAGGUGGAGGUAG

3p

SEQ ID NO 22 hsa-mir-3917 GGCGCUUUUGUGCGCGCCCGGGUCUGUUG

GUGCUCAGAGUGUGGUCAGGCGGCUCGGAC UGAGCAGGUGGGUGCGGGGCUCGGAGGAG GCGGC

SEQ ID NO 23 hsa-mir-3923 GGUAGAGUGAGCUCUAAUCCAAUAUUACUAG

CUUCUUUAUAAGAAGAGGAAACUAGUAAUGU UGGAUUAGGGCUCACUCUACU

SEQ ID NO 24 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU

SEQ ID NO 25 hsa-mir-4271 AAAUCUCUCUCCAUAUCUUUCCUGCAGCCCC

CAGGUGGGGGGGAAGAAAAGGUGGGGAAUU AGAUUC

SEQ ID NO 26 hsa-mir-4294 CCGAUGCCUCGGGAGUCUACAGCAGGGCCA

UGUCUGUGAGGGCCCAAGGGUGCAUGUGUC UCCCAGGUUUCGGUGC

SEQ ID NO 27 hsa-mir-4429 AGGGAGAAAAGCUGGGCUGAGAGGCGACUG

GUGUCUAAUUUGUUUGUCUCUCCAACUCAGA

CUGCCUGGCCCA

SEQ ID NO 28 hsa-mir-4443 GGUGGGGGUUGGAGGCGUGGGUUUUAGAAC

CUAUCCCUUUCUAGCCCUGAGCA

SEQ ID NO 29 hsa-mir-4499 AAGACUGAGAGGAGGGAACUGGUGAGUUGU ACAUAGAAAUGCUUUCUAACUCCUUGUCUCA

GUCUGUUU

SEQ ID NO 30 hsa-miR-4640- UGGGCCAGGGAGCAGCUGGUGGG

5p

SEQ ID NO 31 hsa-miR-4646- ACUGGGAAGAGGAGCUGAGGGA

5p

SEQ ID NO 32 hsa-mir-4688 GUCUACUCCCAGGGUGCCAAGCUGUUUCGU

GUUCCCUCCCUAGGGGAUCCCAGGUAGGGG CAGCAGAGGACCUGGGCCUGGAC

SEQ ID NO 33 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG

SEQ ID NO 34 hsa-miR-5003- UACUUUUCUAGGUUGUUGGGG

3p

SEQ ID NO 35 hsa-mir-5685 CUCUACAUCACAGCCCAGCAGUUAUCACGGG

CCCCUCCCCUCAAUGGGCCCGUGAUAACUG

CAGGGCUGUGAUGUAGAG

SEQ ID NO 36 hsa-mir-6073 UAGAUGUUGGUCCAAACUGAAAGUUGAUGAG

UCACUGUGCCUCUCGGGGUAGUGAGUUAUC

AGCUACAGUGAGAGAGCAGUGUUUGGCC

SEQ ID NO 37 hsa-mir-6076 AGCAUGACAGAGGAGAGGUGGAGGUAGGCG

AGAGUAAUAUAAUUUCUCCAGGAGAACAUCU GAGAGGGGAAGUUGCUUUCCUGCCCUGGCC CUUUCACCCUCCUGAGUUUGGG

SEQ ID NO 38 hsa-mir-6083 G U AAAAAG AG UCCAG AG UCUGGG AAGG UGG

AAAGGGAGCAGGAGCAUCGUCUUUAAGAGG GUCAGGUACCUUUGCUCUUAUAUCAGAGGC UGUGGGCUUCCUACAG

SEQ ID NO 39 hsa-mir-623 GUACACAGUAGAAGCAUCCCUUGCAGGGGC

UGUUGGGUUGCAUCCUAAGCUGUGCUGGAG CUUCCCGAUGUACUCUGUAGAUGUCUUUGC ACCUUCUG

SEQ ID NO 40 hsa-mir-638 GUGAGCGGGCGCGGCAGGGAUCGCGGGCG

GGUGGCGGCCUAGGGCGCGGAGGGCGGAC CGGGAAUGGCGCGCCGUGCGCCGCCGGCGU AACUGCGGCGCU

SEQ ID NO 41 hsa-miR-642b- AGACACAUUUGGAGAGGGACCC

3p SEQ ID NO 42 hsa-miR-6510- CAGCAGGGGAGAGAGAGGAGUC

5p

SEQ ID NO 43 hsa-miR-652-5p CAACCCUAGGAGAGGGUGCCAUUCA

SEQ ID NO 44 hsa-miR-6728- UUGGGAUGGUAGGACCAGAGGGG

5p

SEQ ID NO 45 hsa-miR-6730- AGAAAGGUGGAGGGGUUGUCAGA

5p

SEQ ID NO 46 hsa-miR-6738- CGAGGGGUAGAAGAGCACAGGGG

5p

SEQ ID NO 47 hsa-miR-6740- AGUUUGGGAUGGAGAGAGGAGA

5p

SEQ ID NO 48 hsa-miR-6741 - GUGGGUGCUGGUGGGAGCCGUG

5p

SEQ ID NO 49 hsa-miR-6793- UGUGGGUUCUGGGUUGGGGUGA

5p

SEQ ID NO 50 hsa-miR-6820- UGCGGCAGAGCUGGGGUCA

5p

SEQ ID NO 51 hsa-miR-6870- UGGGGGAGAUGGGGGUUGA

5p

SEQ ID NO 52 hsa-miR-708-5p AAGGAGCUUACAAUCUAGCUGGG

SEQ ID NO 53 hsa-mir-718 GGCCGCGGCGCGCAAGAUGGCGGCGGGCCC

GGGCACCGCCCCUUCCGCCCCGCCGGGCGU CGCACGAGGC

SEQ ID NO 54 hsa-miR-7847- CGUGGAGGACGAGGAGGAGGC

3p

SEQ ID NO 55 hsa-mir-7975 GUGCAAAGAGCAGGAGGACAGGGGAUUUAU

CUCCCAAGGGAGGUCCCCUGAUCCUAGUCA CGGCACCA

SEQ ID NO 56 hsa-mir-8087 UCUAAGAAGUGAAGACUUCUUGGAUUACAGG

GGCCCUACUUUAAGGGCCCUUUCAGUUGGA

AGUUUUCCUUUCUGCCU

SEQ ID NO 57 cDNA sequence Atggcccgcggggctgcgctggcgctgctgctcttcggcctgctgg

CD99 type I gtgttctggtcgccgccccggatggtggtttcgatttatccgatgccctt cctgacaatgaaaacaagaaacccactgcaatccccaagaaac ccagtgctggggatgactttgacttaggagatgctgttgttgatggag aaaatg acg acccacg accaccg aacccacccaaaccg atgcc aaatccaaaccccaaccaccctagttcctccggtagcttttcagatg ctgaccttgcggatggcgtttcaggtggagaaggaaaaggaggc agtgatggtggaggcagccacaggaaagaaggggaagaggcc gacgccccaggcgtgatccccgggattgtgggggctgtcgtggtcg ccgtggctggagccatctctagcttcattgcttaccagaaaaagaa gctatgcttcaaagaaaatgcagaacaaggggaggtggacatgg agagccaccggaatgccaacgcagagccagctgttcagcgtact cttttagagaaatag

SEQ ID NO 58 CD99 protein MARGAALALL LFGLLGVLVA APDGGFDLSD type I sequence ALPDNENKKP TAIPKKPSAG DDFDLGDAVV

DGENDDPRPP NPPKPMPNPN PNHPSSSGSF SDADLADGVS GGEGKGGSDG GGSHRKEGEE ADAPGVIPGI VGAVVVAVAG AISSFIAYQK KKLCFKENAE QGEVDMESHR NANAEPAVQR TLLEK

SEQ ID NO 59 cDNA sequence atggcccgcggggctgccctggcgctgctgctcttcggcctgctgg

CD99 type II gtgttctggtcgccgccccggatggtggtttcgatttatctgatgccctt cctgacaatgaaaacaagaaacccactgcaatccccaagaaac ccagtgctggggatgactttgacttaggagatgctgttgttgatggag aaaatg acg acccacg accaccg aacccacccaaaccg atgcc aaatccaaaccccaaccaccctagttcctccggtagcttttcagatg ctgaccttgcggatggcgtttcaggtggagaaggaaaaggaggc agtgatggtggaggcagccacaggaaagaaggggaagaggcc gacgccccaggcgtgatccccgggattgtgggggctgtcgtggtcg ccgtggctggagccatctctagcttcattgcttaccagaaaaagaa gctatgcttcaaagaaaatgatggctgaagacctagggaacaag gggaggtggacatggagagccaccggaatgccaacgcagagc cagctgttcagcgtactcttttagagaaatag

SEQ ID NO 60 CD99 protein MARGAALALL LFGLLGVLVA APDGGFDLSD type II ALPGDDFDLG DAVVDGENDD PRPPNPPKPM

PNPNPNHPSS SGSFSDADLA DGVSGGEGKG GSDGGGSHRK EGEEADAPGV IPGIVGAVVV AVAGAISSFI AYQKKKLCFK ENAEQGEVDM ESHRNANAEP AVQRTLLEK

SEQ ID NO: short hairpin GATCCGGCTGGCCATTATTAAGTCTTCAAGAG 61 (sh) RNA AGACTTAATAATGGCCAGCCTTTTTGGAAA molecule specific for the

gene

MIC2/CD99

SEQ ID NO: 3'UTR of the (995)-GGCTGGCCATTATTAAGTC-(1014) 62 CD99 gene

target of SEQ ID

NO: 61

SEQ ID NO: miRNA 328-5p GGGGGGGCAGGAGGGGCUCAGGG

63

EXAMPLE

THE CELL LINES

The cell lines representative of the various types of conventional Ewing sarcoma used by way of example are shown in Table I below, which, in addition to the name of the line, specifies the histological origin and fusion transcript characterizing them.

Table I

The Ewing sarcoma cell lines (lOR/CAR and LAP-35) were obtained from the Laboratory of Experimental Oncology - Cancer Research Center (Rizzoli Orthopedic Institute, Bologna). The Ewing sarcoma line SK-N-MC was supplied by the American Type Collection (Rockville, MD). The Ewing sarcoma lines TC-71 and 6647 were provided by Dr T.J.Triche (Children's Hospital, Los Angeles, CA). The Ewing sarcoma cell line A673 was supplied by Dr H. Kovar (St. Anna Kinderkrebsforschung, Vienna AT). The cells were cultured in Iscove's Modified Dulbecco's Medium (IMDM; EuroClone) enriched with 10% inactivated fetal bovine serum (FBS; EuroClone), supplemented with 100U/ml penicillin and 100mg/ml streptomycin, at a temperature of 37°C in a humidified atmosphere containing 5% CO2.

The TC-CD99-shRNA#1 and TC-CD99-shRNA#2 clones were obtained by transfection of the TC-71 parental line with the plasmid pSilencer™4.1 - CMV neo (Ambion) in which the sequence encoding the short hairpin (sh) RNA molecule specific for the gene MIC2 5'- GATCCGGCTGGCCATTATTAAGTCTTCAAGAGAGACTTAATAATGGCC AGCCTTTTTGGAAA-3' was inserted (we note that MIC2 is an alternative name of CD99).

The sequence of the short hairpin RNA is directed against SEQ ID NO: 62, that is, against the 3'UTR of the CD99 target gene, with the formation of 270 base pairs after the end of the stop codon .

The method employed for transfection was that of the Calcium Phosphate Transfection System Kit (Invitrogen) and the selection took place with the addition of 500 μg/ml of neomycin (Sigma-Aldrich) to the culture medium (Rocchi A. J.Clin Invest, 2010).

The lOR/CAR cell line was also subjected to the same procedure and in particular the clones CAR-CD99-shRNA#1 and CAR-CD99-shRNA#2 were obtained. In this case as well, the selection took place with the addition of 1000 μg/ml of neomycin.

ISOLATION OF THE EXOSOMES

For the purpose of isolating the exosomes, 2x10 6 cells were seeded in T75 flasks (75 cm 2 ) in Iscove's Modified Dulbecco's Medium (IMDM; EuroClone) with the addition of 10% inactivated fetal bovine serum (FBS; EuroClone), supplemented with 100 U/ml penicillin and 100 mg/ml streptomycin, at a temperature of 37°C in a humidified atmosphere containing 5% CO 2 .

The serum used in these experiments was previously depleted of bovine exosomes (FBS-NO EXO) by ultracentrifugation for 6 hours at 100000 x g and subsequent filtration with a 0.22 μιη filter. Twenty-four hours after seeding, the cells were synchronized for 5 hours with IMDM enriched with 1 .5% FBS NO-EXO and thereafter left to grow in IMDM enriched with 10% FBS NO-EXO, in a final volume of 25 ml. Forty- eight hours after seeding, the cell supernatant was collected and processed with a first centrifugation at 1200 rpm for 9' and then 3000 x g for 15' for the purpose of eliminating cells in suspension and debris. The supernatant was then transferred into a new sterile tube (falcon) and Exoquick-TC exosome precipitation solution (System Biosciences, Mountain View) was added in a ratio of 1 :5. The solution was gently mixed and kept overnight, and in any case for at least 12 hours, at +4°C. The next day the solution was centrifuged at 1500 x g for 30' at room temperature; then the supernatant was removed, with care being taken not to touch the pellet of exosomes on the bottom of the tube. It was again centrifuged at 1500 x g for 5' to eliminate the last traces of supernatant that may have remained.

In this context, the exosomes obtained from the Ewing sarcoma cells and silenced for the expression of CD99 are referred to as CD99 " exosomes or EXO-CD99 " , i.e. CD99-negative exosomes.

Based on the subsequent purpose it was to be used for, the exosome pellet was resuspended in:

i) IMDM 0% for in vitro functional studies;

ii) TRIzol for RNA extraction;

iii) RIPA buffer for Western blot analysis.

Simultaneously with the isolation of the exosomes from the supernatant, the producer cells were counted with trypan blue and the cell pellet was stored at -80°C for subsequent Western blot analysis and RNA extraction. Marking of exosomes with acridine orange (AO)

450 μg of exosomes (EXO-CD99 ) were resuspended in 500 μΙ of IMDM 0% and 100 μg/ml of acridine orange (AO) (Sigma) (final concentration of the solution ^g/ml) and incubated for 10' at 37°C. There then followed another precipitation of the exosomes with 100 μΙ of ExoQuick-TC for 30' in ice, centrifugation at 14000 rpm for 3' at +4°C and resuspension of the marked exosome pellet with 100 μΙ of PBS.

Scratch test - wound healing assay

The TC-71 , lOR/CAR and LAP-35 cell lines were seeded in 24-well plates pretreated with fibronectin. When confluence was reached, a scratch was made on the surface. There was subsequently a change of medium using IMDM enriched with 10% FBS NO-EXO, and amounts equal to 200 μg of EXO-CD99 " exosomes obtained as previously described were added. The plates were thus monitored and photographed at different time points between TO and 24 hours for the purpose of assessing cell migration and the closure of the previously made scratch.

Transwell migration assay

An assessment of the migration capacity of the TC-71 and 6647 cell lines after treatment with exosomes produced from TC-CD99-shRNA#2 cells was made using specific 24-well plates (Costar Cambridge, MA). The latter have a polycarbonate membrane with 8 μιη diameter pores separating the compartment containing the cells from the portion below it. A cell suspension containing 100,000 cells pretreated with 150 μg of EXO- CD99 " for 30' in IMDM 0% FBS was seeded in each chamber. In the lower chamber 600μΙ of IMDM 10% FBS no EXO were added, both for the controls and treated samples. The chambers were incubated for about 18 hours at 37°C in a humidified atmosphere containing 5% CO2. The cells that crossed the porous membrane and reached the well below were fixed with methanol for 15' at room temperature and subsequently stained with Giemsa (Riedel-De Haen) diluted 1 :10 in water. A count of the migrating cells was made by observation under a microscope, 10X objective.

Assessment of cell proliferative activity with Ki-67

5000 cells per well of Ewing sarcoma TC-71 , lOR/CAR, LAP-35 and 6647 cell lines in IMDM enriched with 10% FBS were seeded in culture slides, 0.69cm2/well. After 24 hours there was a change of medium with 200 μΙ of IMDM 0% FBS per well and the cells were incubated with ^g of EXO- CD99 " exosomes. 72 hours after seeding (48 hours after treatment with exosomes) the cells were fixed with methanol for 7' at -20°C. After 3 washes the cells were incubated for 1 hour at room temperature with a PBS-BSA 4% solution (Sigma-Aldrich) in order to block the nonspecific sites. The cells were then incubated overnight in a humid chamber at +4°C with the anti-Ki67 primary antibody (Mib1 - Sigma-Aldrich) diluted 1 :50 in PBS. The next day the cells were incubated for 1 hour at room temperature with the FITC anti-Mouse secondary antibody (Thermo Fisher Scientific Inc) diluted 1 :100 in PBS. Finally, the nuclei were marked with Hoechst 33258 0.5 g/ml (Sigma-Aldrich) and samples were acquired with a Nikon ECLIPSE 90i epifluorescence microscope, objective 40X.

Analysis of cell death by marking with propidium iodide

5000 cells of the Ewing sarcoma TC-71 and lOR/CAR cell lines in IMDM enriched with 10% FBS were seeded in culture slides, 0.69cm2/well. After 24 hours there was a change of medium with 200 μΙ of IMDM 0% FBS/well and the cells were incubated with ^g of EXO-CD99 " exosomes. 72 hours after seeding (48 hours after treatment with exosomes), 40 μΙ of a solution of propidium iodide (PI) (stock solution 100 μg/ml) and viable Hoechst 33342 solution (Thermo Fischer Scientific Inc, MA, USA) were added (in a 1 :50 ratio with the total volume) and the cells underwent 15' incubation at 37°C. Propidium iodide is used to mark apoptotic or necrotic cells, as it is capable of permeating only cells that have undergone an alteration in the integrity of the plasma membrane; whereas the viable Hoechst solution has the purpose of marking all cell nuclei. The samples were acquired live with an inverted epifluorescence microscope, objective 20X.

Analysis of cell death by means of the Annexin-V assay

300,000 cells of the Ewing sarcoma TC-71 , lOR/CAR and LAP-35 cell lines in IMDM enriched with 10% FBS were seeded in a 6-well plate. After 24 hours there was a change of medium with 2 ml of IMDM 0% FBS/well and the cells were incubated with 100μg of EXO-CD99 " exosomes. 72 hours after seeding (48 hours after treatment with exosomes) the cells were transplanted and counted. Samples of about 300,000-500,000 cells were incubated for 15' in the dark at room temperature with 2.5μΙ of Annexin V FITC and 5μΙ of propidium iodide (P.I) (MEBCYTO Apoptosis Kit, Annexin-V FITC kit, MBL Life Science). Annexin is a calcium- dependent membrane protein capable of binding phosphatidylserine with high affinity; under basal conditions, the latter is situated on the inner side of the plasma membrane, but is already exposed on the outer side in the early stages of the apoptotic process. Simultaneous marking with propidium iodide (PI) enables apoptotic cells to be discerned from necrotic ones: the former will be marked only by annexin, whereas in necrotic cells there will also be the PI signal, given the damage of the cell membrane, which permits it to enter and bind to DNA. The samples are then analyzed with flow cytofluorimetry.

Agilent miRNA microarrav

We used Agilent miRNA microarray technology to investigate the imiRNAs differentially expressed in the exosomes of parental origin and the EXO- CD99 " exosomes. In particular, the exosomal RNA was purified using Qiagen extraction columns following the instructions provided with the kit (QIAGEN imiRNeasy Mini Kit (50)). The processed samples were TC-71 analyzed in duplicate as a technical replicate, and the two CD99-shRNA#1 and CD99-shRNA#2 clones as technical replicates of each other. Furthermore, the analysis was carried out as a biological replicate on another series of samples. The 8 slides were analyzed exploiting the single-stain technique, hybridizing the individual sample on each slide ("non-competitive" analysis). The data obtained were normalized by quantile normalization and transformed to a logarithmic base using GeneSpring GX 1 1 software (Agilent Technologies). Probes of poor quality (absent or marginal flag) were excluded from the subsequent analyses. Real-Time quantitative PCR

The qRT-PCR analysis of miR-199a-3p and miR-214-3p was carried out using the miRCURY LNA Universal RT microRNA PCR system (EXIQON, Woburn, MA, USA). The data analysis was performed using the threshold cycle (CT) comparative method. The relative expression of miR-199a-3p and miR-214-3p was calculated using, for normalization, an imiRNA whose expression does not change between the original cells and cells in which CD99 expression has been nullified/silenced. For example, miR328-5p (SEQ ID NO: 63) was used.

Selection of patients

The study presented here was carried out on a series of 45 tumor samples (35 primitive and 10 metastases) of patients affected by Ewing sarcoma and treated at the Rizzoli Orthopedic Institute.

Treatment of normal cells with EXO CD99-shRNA-uptake exosomes marked with acridine orange

Human mesenchymal stem cells (HSSC-244 and HSSC-249) were seeded in supports of 0.69 cm2/well at a density of 10,000 cells/well in IMDM enriched with 20% FBS. After 48 hours the seeding medium was changed with IMDM 0% FBS and after another 24 hours an amount of about 20 μg (5μΙ) and 45 μg (1 ΟμΙ) of EXO-CD99 " exosomes previously marked with acridine orange was added. The nuclei were marked with viable Hoechst 33342 (Thermo Fischer Scientific Inc) used in ratio of 1 :50 to the total volume. The samples were acquired live with an inverted epifluorescence microscope, objective 40X.

Neural differentiation

Human mesenchymal stem cells (MES-1 ) were seeded in supports of 0.69 cm2/well at a density of 2,500 cells/well in IMDM enriched with 20% FBS. 24 hours prior to the induction of neural differentiation, the cells were treated with ^ 0μg of EXO-CD99 " exosomes in IMDM 0% FBS for about 8 hours. The medium was subsequently replaced with DMEM enriched with 20% FBS and 5ng/ml bFGF. The cells were then induced to differentiate by replacing the medium with DMEM + 0% FBS supplemented with 100 μΜ BHA, 10 μΜ forskolin, 5 μg/ml insulin, 2% DMSO, 2mM valproic acid, 5nM K252a, 10mM KCI (all Sigma-Aldrich reagents); the untreated controls continued to be maintained in DMEM + 0% FBS.

24 hours, 6 and 1 1 days after the start of the replacement of the medium

(CT) with differentiating medium the cells were fixed for immunofluorescence analysis of β-ΙΙΙ Tubulin. The differentiating medium and treatment with exosomes were renewed every 3 days.

Osteoblast differentiation

Human mesenchymal stem cells (MES-1 ) were seeded in 6-well plates at a density of 100,000 cells/well in IMDM enriched with 20% FBS. After 24 hours the cells were placed in an osteogenic medium (IMDM 2% FBS supplemented with 50 μg/ml ascorbic acid and 5mM β-glycerophosphate) and were treated with 100 μg of EXO-CD99 " exosomes. The differentiating medium was renewed every 3 days, whereas the treatment with exosomes was repeated every 7 days. The cells were fixed at different times (day 0, 7, 14 and day 21 ) for the assessment of alkaline phosphatase (ALP) and matrix deposition (ARS) through staining assays. For the time points of 7 and 14 days, RNA was extracted and the expression of COL1 A2 and ALP was assessed by real-time PCR.

Real-Time PCR and Western blot for EWS-FLI1 after treatment with exosomes/-CD99

Human mesenchymal stem cells (MES-1 ) were seeded in 6-well plates at a density of 125,000 cells/well in IMDM enriched with 20% FBS. After 24 hours, the cells were placed in IMDM 0% FBS and treated with 145 μg of EXO-CD99 " exosomes. After about 7 h, the cells were lysed in TriZol and the RNA was processed for the evaluation of EWS-FLI1 by real-time PCR. The expression of the EWS-FLI1 protein was evaluated by Western blot analysis 24 hours after treatment with the exosomes.

RESULTS

CD99-shRNA EXOSOMES INDUCE A BLOCK OF PROLIFERATION

After the treatment of Ewing sarcoma cells with the EXO-CD99 " exosomes a significant reduction in the proliferation capacity is observed, as may be inferred from the assessment of the expression of the Ki-67 marker (Figures 1 and 2), a nuclear protein present when the cell is at the interphase stage and therefore closely connected to growth capacity. In fact, the control cells (CTR) are significantly more proliferative than the cells treated with EXO-CD99 " exosomes.

The slowing of proliferation was demonstrated after both homologous and heterologous fusions, that is, after treating the same cells that produce EXO-CD99 " exosomes or different Ewing sarcoma cells.

Furthermore, it was demonstrated that the blocking of cell proliferation is not accompanied by an induction of cell death as a result of apoptotic processes. In the receiving cells, an assessment was made both of the incorporation of propidium iodide, (3,8-diamino-5-[3- (diethylmethylammonio)propyl]-6-phenyl-, diiodide) (PI), a synthetic stain characterized by low fluorescence (red-orange), capable of binding stoichiometrically to nucleic acids and emitting red fluorescence in the event that the cell membrane is not intact (dead cells), and positivity for fluorescent annexin. This assay exploits the capacity of annexin, a calcium-dependent protein with strong anticoagulant properties, to bind to phosphatidylserine, a phospholipid that is normally found on the inner side of the cell membrane and is exposed outside the cell during apoptosis. In this regard, Figures 3 and 4 show that there do not exist any significant differences in mortality between the control cells and the cells that received the EXO-CD99 " exosomes.

CD99-shRNA EXOSOMES INHIBIT MIGRATION CAPACITY

It was also demonstrated that the treatment with EXO-CD99 " exosomes is capable of modulating the mechanisms associated with tumor aggressiveness, such as growth in the absence of anchorage (soft agar) and migration.

Figure 5 shows the results of a wound healing assay on three Ewing sarcoma cell lines following a fusion with EXO-CD99 exosomes. As may be observed, the migration front of the cells that received EXO-CD99 " exosomes was slowed. Migration was further assessed by means of the transwell migration assay and it was demonstrated that after treatment with EXO-CD99 " exosomes, the Ewing sarcoma cells show a statistically significant reduction in cell migration.

ASSESSMENT OF THE miRNAs CONTAINED IN EXOSOMES IN THE PRESENCE OR ABSENCE OF CD99

For the purpose of characterizing the molecular composition of the exosomal cargo we relied on imiRNA microarray technology. The aim was to discriminate any existing differences in the expression of the small RNAs contained in the exosomes secreted by the TC-71 cell line and by the clones silenced for CD99.

The clustering analysis reported in Figure 6 brought to light the presence of 56 miRNAs differentially expressed in the EXO-CD99 ' exosomes compared to the exosomes produced by the parental line. In particular, the following 10 miRNAs were upregulated: miR-638, miR-1273g-3p, miR- 4443, let-7c-5p, miR-214-3p, let-7q-5p, miR-199a-3p, miR-718, miR-15b- 5p, miR-29a. In general, the upregulated and downregulated (over- /underexpressed) miRNAs are shown in Table II with the respective p value and fold change (FC).

Table II

The analyses of functional annotation demonstrated that the miRNAs misregulated specifically in the EXO-CD99 " exosomes are involved in key processes in the pathogenesis of Ewing sarcoma, such as, for example: organization of the cytoskeleton and membrane, regulation of vesicular transport, development and neural differentiation and cancer modulation. Some of the microRNAs that showed to be upregulated in the microarray experiment (miR-214-3p and miR-199a-3p) were subjected to validation. New extractions of exosomes produced from both the TC-71 and lOR/CAR experimental models and respective EXO-CD99 " exosomes were thus prepared. Real-time PCR experiments confirmed that the EXO- CD99 " exosomes have an upregulation of these imiRNAs (miR-214-3p and miR-199a-3p) compared to exosomes obtained from the parental cells expressing CD99 (Figure 7). Validation was further performed by verifying the expression of these two microRNAs within a group of patients affected by Ewing sarcoma (35 primitive and 10 metastases). The results are summarized in Figure 8, where it may be observed that miR-214 and 199 are underexpressed to a significant degree in the metastasis samples compared to localized primitive tumor samples.

CD99-shRNA EXOSOMES DO NOT MODIFY THE PHENOTYPE OF NORMAL CELLS (hMSCs)

With the aim of evaluating the specificity of the treatment, an assessment was made of possible toxic effects, or effects of modulating proliferation and differentiation after fusion with EXO-CD99 " exosomes. For this purpose, use was made of human mesenchymal stem cells (hMSC), totipotent cells capable of differentiating into various lineages. The results demonstrate that the treatment with EXO-CD99 " exosomes displayed no toxic effect on normal cells, nor were any effects observed on the normal cell proliferation and differentiation capacity.

UPTAKE OF EXO-CD99 ' IN NORMAL CELLS AND MODULATION OF DIFFERENTIATION

Human MSCs were considered as a cellular model. It was demonstrated that the EXO-CD99 " exosomes are capable of fusing with the plasma membrane of mesenchymal cells and entering the cells themselves, releasing their cargo. Fusion was documented by marking the exosomes with acridine orange and samples were acquired live with an epifluorescence microscope. The signal is clearly visible within 30 minutes after the treatment and tends to decay after a few hours.

For the purpose of assessing the effect of the EXO-CD99 " exosomes on the differentiation capacity of normal cells, neural and osteoblastic differentiation of human mesenchymal stem cells (MES-1 ) was induced after exposure with EXO-CD99 " exosomes. The results obtained, shown in Figure 9, demonstrate that there is no difference between the cells that received the EXO-CD99- exosomes and the controls (CTR) and the mesenchymal cells maintain the capacity to differentiate both neurally and osteoblastically according to the experimental conditions used.

THE TREATMENT WITH CD99-shRNA EXOSOMES DOES NOT TRANSFER ANY DETECTABLE EXPRESSION OF EWS-FLI INTO HUMAN MESENCHYMAL CELLS

Since the exosomes obtained from Ewing sarcoma cells may also internally have the gene fusion product deriving from the specific chromosome translocation (EWS-FLI), which is the primary oncogenic event in this neoplasm, the possible presence of EWS-FLI in normal cells after exposure to the EXO-CD99 " exosomes was assessed. The presence of the fusion transcript was assessed by Western blot and real-time PCR. The results demonstrate that after fusion, no presence of the protein or of the messenger RNA of EWS-FLI1 is observable with the techniques used. In any case, the literature is very clear in this respect that the transforming power of this transcript requires a very specific cellular context (in the wrong contexts, the fusion transcript leads to cell death and no transformation).