The invention described herein was made with government support under Contract No. DAMD 17-90-C-0107 awarded by the United States Army Medical Research Institute of Chemical Defense, Department of the Army. The U.S. Government has certain rights in this invention.

Background of the Invention

Various publications are referenced herein. These references, in their entireties, are hereby incorporated by reference into the subject application in order to more fully describe the state of the art to which the invention relates.

The field of cholinesterases has been recently reviewed by Taylor (J. Biol. Chem., £6j5: 025-4028 (1991)), which is hereby incorporated by reference into this application.

The classification of cholinesterases is based on the differential specificity of the enzyme for both substrate and inhibitors. Acetylcholinesterase (AChE, EC 3.1.1.7) is preferentially active with acetylcholine and is inhibited by B -284C51 (Koelle, G.B. (1955) J. Pharmacol. Exp. Ther. 114: 167-184; Hol stedt, B. (1957) Acta. Physiol. Scand..40: 322- 330; Holmstedt, B. (1959) Pharmacol. Rev. .11: 567-688; Silver, A. (1973) in Cholinesterases, Academic Press; and Austin, L and Berry, .K. (1953) Biochem. J. 5.: 695-700).

Studies aimed at elucidating the function of acetylcholinesterase made use of a variety of inhibitors such as physostigmine (eserine) . AChE inhibitors may be used to enhance the nicotinic and muscarinic actions of acetylcholine. Some cholinesterase inhibitors are the main

ingredient of insecticides used against house pests or in agriculture. Cholinesterases may have use as prophylactic or therapeutic agents in cases of organophosphate poisoning. Acetylcholinesterase (AChE) is primarily associated with nerve and muscle, typically localized at synaptic contacts. AChE, an enzyme which degrades the esters of choline, emerged as a key component in neurotransmission within the autonomic and somatic motor nervous system (Dale, H.H. (1914) J. Pharmacol. Exp. Ther. 6:147-190.1. Other cholinesterases e.g. butyrylcholineεterase (BuChE, EC 3.1.1.8) are located at other sites and have other physiological functions.

Molecular species and structure of cholinesterases

Cholinesterases exist in a variety of molecular forms which differ in size, level of oligomerization, lipid content, glycosylation, collagen content and hydrodynamic properties. The catalytic subunits may be associated with a collagen- like or lipid-linked subunit which forms distinct heteromeric species. The collagen-associated enzyme consists of tetra ers of catalytic subunits that are linked via disulfide bonds (Cartand, J. , Bon, S. and Massoulie, J. (1978) J. Cell. Biol.22: 315-322; Anglister, L. and Silman, I (1978) J. Mol. Biol. 125: 293-311; Rosenberry, T.L. and Richardson, J.M. (1978) Biochemistry _L6: 3550-3558; and Massoulie, J. (1991) Proceedings of the 3rd International Conference on Cholinesterase (Massoulie J. et. al eds) American Chemical Society Wash. D.C. in press) . The multiple collagen-like filamentous species are classified as asymmetric or A forms with a numerical subscript specifying the number of attached catalytic subunits.

The lipid containing form of AChE contains covalently attached fatty acids and is approximately 20kD in mass

(Inestrosa, N.C., Roberts, W.L., Mashal, T.L. and

Rosenberry, T.L. (1978) J. Biol. Chem. 262: 4441-4444). As

in the case of collagen linked subunits, the lipid moiety is attached to a tetra er of catalytic subunits.

Another species of AChE is a homomeric form that exists as dimers and tetramers of identical catalytic subunits. This form is referred to as the globular or G form. The globular form is subdivided into hydrophilic or hydrophobic G forms. These two forms differ in that a glycophospholipid is associated with hydrophobic G form (Silman, I. and Futerman, A.H. (1987) Eur. J. Biochem. 170: 11-22; Roberts, W.L. , Kim, B.H. and Rosenberry T.L. (1987) Proc. Natl. Acad. Sci. U.S.A. ___!: 7817-7821; and Toutant, J.P., Richards, M.K. Kroll, J.A. and Rosenberry T.L. (1990) Eur. J. Biochem. 187: 31-38) .

Primary structure of the cholinesterase σene family

Molecular cloning facilitated the isolation and sequence determination of cholinesterases in mammalian, lower vertebrate and invertebrate species. AChE and BuChE are both encoded by single genes, yet extensive polymorphism of the gene products has been observed (Schumacher, M. et. al. (1986) Nature 319: 407-409; Maulet, Y. et. al (1990) Neuron 4.: 289-301; Arpagaus, M. et. al. (1990) Biochemistry 29: 124-131; Prody, C. et. al. (1986) J. Neurosci 16: 25-35; Prody, C. et. al. (1987) Proc. Natl. Acad. Sci. USA 84: 3555-3559; and Prody, C. et. al. (1989) Proc. Natl. Acad. Sci. USA ____.: 690-694). This polymorphism is a result of alternative mRNA processing of the primary gene transcript (i.e. mRNA) and post-translational modification of the polypeptide product. Comparison of the primary amino acid sequence of AChE from different sources on one hand and comparison of sequences between AChE and BuChE on the other hand reveal a high degree of homology (Maulet, Y. et. al (1990) Neuron 4.: 289-301; Arpagaus, M. et. al. (1990) Biochemistry 29: 124-131; and Prody, C. et. al. (1989) Proc. Natl. Acad. Sci. USA jj_6: 690-694). A number of amino acid

stretches which are apparently associated with the catalytic property of the enzyme have been conserved to a high degree (Doctor, B.P., et. al. (1990) FEES Lett. __66 :123-127; Lockridge, 0., et. al. (1987) J. Biol. Chem. 262: 549-557; and Chatonmet, A. and Lockridge O. (1989) Biochem J. 260: 625-634).

Cholinesterases contain varying numbers of cysteine residues: eight were reported for mature Drosophila AChE (Hall, L.M.L. and Spierer, D. (1986) EMBO J. __± 2949-2954; and Toutant, J.P. (1989) Prog. Neurobiol. 32: 423-446) , seven for Torpedo AChE, eight for mammalian BuChE (Lockridge, O., et. al. (1987) J. Biol. Chem. 262: 549-557) ; and seven for human AChE (Soreq, H. et al. (1990) Proc. Natl. Acad. Sci. £2! 9688-9692) . These cysteinyl residues are involved in disulfide loop formation. The cysteine residue located near the C-terminus is involved in intersubunit disulfide bridge formation.

AChE and BuChE are glycosylated. The amino acid sequence that harbors the signal for glycosylation is Asn-x-Ser/Thr. The number of such sites on cholinesterase varies. For example, Torpedo AChE contains four, hBuChE contains nine (Hall, L.M.L. and Spierer, D. (1986) EMBO J. jj.2949-2954), and Drosophila AChE contains five potential sites (Toutant, J.P. (1989) Prog. Neurobiol. 32: 423-446). The importance of glycosylation for enzyme activity has not yet been elucidated.

Cholinesteraseprophylaxis aσainst orσanophosphatepoisoning

Organophosphate poisoning occurs most frequently among farmers upon exposure to pesticides such as althione and parathione due to improper handling. Treatment of such poisoning calls for administration of anti-muscarinics, anti-convulsants, and oxi e reactivator drugs (Gray, A.P. (1984) Drug Metab Rev. _L£__ 557-589).

The possibility of chemical warfare and poisoning of high density population centers by organophosphates such as soman emphasize the need to develop an effective prophylactic and therapeutic treatment.

Wolf et. al. (Wolfe, A.D. et. al. (1987) Fundam. Appl. Toxicol £: 266-270) have shown that administration of exogenous bovine BuChE to mice prior to organophosphate exposure conferred significant protection.

Raveh et. al. (Raveh, L. et. al. (1989) Biochem. Pharmacol 38: 529-534) showed that AChE from fetal bovine serum could protect mice from 3-8 times the LD ₅₀ concentration of MEPQ (7-methylethoxy-phosphinyloxy-l-methylquinolinium iodide) . Further studies by Ashani et. al (Ashani, Y. el. al. (1991) Biochem. Pharmacol 41: 37-41) disclose that hBuChE administered to mice before exposure to soman could protect mice from a lethal dose without additional supportive drugs. The protective effect corresponded directly to the blood level of exogenously administered cholinesterase.

More extensive evaluation of the clinical benefit of AChE has been hindered by its limited availability.

One of the major difficulties in producing enzymatically active AChE is due to the large size of the molecule, 62- 64kD, which makes refolding of the denatured and enzymatically inactive forms produced in E. coli very difficult to achieve. Rotundo (J. Biol. Chem, 263:19398- 19406, 1988) discloses that the in vivo biogenesis of AChE results in the production of a catalytically inactive precursor, of which only a small amount (20-30%) becomes activated and assembled in the rough endosplasmic reticulum. It is therefore seen that even in vivo, the vast majority of the AChE precursors (70-80%) are not refolded into enzymatically active protein, and are subsequently degraded.

Applicants have overcome the above dificulties, and have developed a method of producing a purified, enzymatically active recombinant analog of human acetylcholinesterase.

Soreq et al. Proc. Natl. Acad. Sci. USA £2:9688-9692 (1990) disclose the cloning of AChE cDNA into a transcription vector, production and isolation of mRNA and its translation in microinjected oocytes into acetylcholinesterase. Velan et al. Cellular and Molecular Neurobiology, 11:143-156 (1991) disclose the secretion of recombinant human acetylcholinesterase from transiently transfected 293 cells as a soluble globular enzyme.

There is no teaching in the prior art of a method for obtaining enzymatically active recombinant AChE from bacterial cells.

^RΛ m ^mn T "f the Invention

The subject invention provides an enzymatically active, nonglycosylated, recombinant, human acetylcholinesterase comprising at least one polypeptide characterized by an amino acid sequence which is substantially identical to the amino acid sequence of naturally-occurring human acetylcholinesterase. The subject invention additionally provides an enzymatically active recombinant monomeric human acetylcholinesterase comprising a polypeptide characterized by an amino acid sequence in which serine is substituted for cys 611 in the sequence of naturally-occurring human acetylcholinesterase (position 580 in the mature polypeptide) and an enzymatically active recombinant human acetylcholinesterase comprising at least one polypeptide characterized by the presence of a methionine of the N- terminus of the amino acid sequence of naturally-occurring human acetylcholinesterase.

The subject invention also provides therapeutic and diagnostic methods using the enzymatically active recombinant acetylcholinesterase.

Brief Description of the Figures

In some of the figures abbreviations have been used for the restriction enzyme sites as follows:

The term "r-met-AChE" is used herein to describe authentic AChE with an additional N-terminal methionine. The term "ser/r-met-AChE" is used herein to describe a mutant of AChE containing serine at position 611 instead of the naturally- occurring cysteine.

Figure l. construction of Plasmid pBR-AChE. The large fragment isolated from EcoRI digestion of plasmid pGEM- 7Z(f+) was further cleaved with Xhol. The 2650 bp fragment was isolated and ligated to the large fragment isolated from EcoRI-Sall digestion of plasmid pBR322. Since Sail and Xhol are complementary, they may be ligated without any difficulty. The resulting plasmid designated pBR-AChE contains the DNA sequence encoding authentic AChE, but does not express it since it lacks a promoter and ribosomal binding site.

Figure 2. Construction of Plasmid pAIF-04. Plasmid pAIF-2

produced as described in Example 1, was digested with Dral and Aatll. The DNA was further digested with the Klenow fragment of DNA polymerase to remove the 3' ends, and then digested with Ndel. The 1879 bp fragment was isolated and ligated to the large fragment isolated from Smal-Ndel digestion of plasmid pMLK-6891 which contains the deo promoter. The resulting expression plasmid designated pAIF- 04 contains authentic AChE DNA under control of the deo P promoter, and the deo ribosomal binding site. However as described in Example 1, it failed to express AChE.

Figure 3. Construction of Plasmid pAIF-11. The small fragment isolated from Sall-Ndel digestion of plasmid pAIF- 04 was ligated to the large fragment isolated from Sall-Ndel digestion of plasmid pMLK-100 (deposited in E.coli 4300 as ATCC Accession No. 68605) . The resulting expression plasmid designated pAIF-11 contained authentic AChE DNA under control of the λP _L promoter (and C _π ribosomal binding site) . However, as described in Example 1, it did not express AChE.

Figures 4A-E (SEQ ID NO:l) . Sequence of Naturally Occurring Unprocessed Human AChE DNA. This figure shows the nucleotide and corresponding amino acid sequence of AChE, as disclosed by Soreq, H. et al. (1990) Proc. Natl. Acad. Sci. 82:9688. The line below the amino acids shows the amino acid numbering. The nucleotide numbering is found under the second codon from the left of each row beginning with the initiator methionine. Transcription terminates at the transcription termination codon TGA immediately following the leucine residue at position 614.

Unprocessed acetylcholinesterase contains 614 amino acids. The first 31 amino acids constitute a leader (or signal) sequence subsequently cleaved to produce mature naturally- occurring AChE containing 583 amino acids and having as N- terminus Glu ³² encoded by the GAG codon.

Figure 5. Mutational Changes in AChE cDNA. This figure shows the GC to AT base substitutions in the two duplexes described in Example 2. The original G and C bases are in boxes in the upper row. The corresponding synthetic duplex containing the AT substitutions is recited in the lower row.

These substitutions are all in the "wobble" base and do not generate changes in the amino acid encoded. The two duplexes were constructed, and joined by annealing at their complementary termini to produce a synthetic linker having a 5 ¹ Ndel site and a 3* Ncol site. Note that the mutations create several new restriction sites including an additional

Aatll site.

Figure 6. Expression plasmids for AChE. Two expression plasmids were constructed as described in Example 2 with the 5' terminus of the gene modified as described in Figure 5. Plasmid pAIF-34 expresses AChE under control of the λP _L promoter and C _n ribosomal binding site, and was deposited in E.coli A4255 in the ATCC under Accession No. 68638. Plasmid pAIF-51 expresses AChE under control of the deo P promoter and deo ribosomal binding site.

Figure 7. Expression Plasmids Encoding r-met-AChE and ser/r-met-AChE. Plasmid pAIF-51 was digested with Xhol, filled-in with Klenow and further digested with Bglll and Seal. The large fragment resulting was ligated to the large fragment produced by digestion of plasmid pMF5520 which had been digested with Bglll and Stul. (Plasmid pMF5520 is an SOD expression plasmid which harbors the Tet ^R gene sequence; the construction of this plasmid is fully described in applicant's copending patent application, EPO Publication No. 303,972.)

The resulting plasmid, designated pAIF-52 expresses r-met- AChE under control of the deo P promoter. It is similar to plasmid pAIF-51 (Figure 6) except that it is Tet ^R instead of

Amp ^R .

Plasmid pMLF-52ser was constructed from pAIF-52 as described in Example 4. It is identical to pAIF-52, except that the cysteine residue of position 611 (see Figures 4A-D and SEQ ID NO:l) was replaced by serine. Plasmid pMLF-52ser was introduced into E.coli Sø930 and deposited in the ATCC under Accession No. 68637. Plasmid pMLF-52ser is elsewhere designated also as pMFL-52ser.

Figure 8. Lineweaver-Burk Plot of ser/r-met-AChE. Enzyme kinetics were determined for the mutant rAChE using acetylthiocholine as substrate. The results were plotted on a Lineweaver-Burk plot and the K _m was calculated to be about 1.0X10' ⁴ M.

Figure 9. Beat Inactivation of ser/r-mβt-AChE. This figure shows the results of heat inactivation of ser/r-met-AChE by incubation at 50°C as described in Example 5. 50% of the activity was lost after 7 minutes, and 90% was lost after 25 minutes.

Figure 10. Gel Filtration Chromatography of r-met-AChE. Recombinant mutant AChE was subjected to gel filtration column chromatography as described in section 5 of Example 4. The chromatogram shows that most of the protein is in the form of inactive aggregates which eluted in the void volume of the column. The active enzyme peak eluted in fraction 7 with a specific activity of 10.6 U/mg.

Figure 11. Isolation and Purification of Inclusion Bodies. This figure is a flow chart showing the steps performed as described in Example 6 to obtain purified inclusion bodies of ser/r-met-AChE from the E. coli cells obtained by fermentation.

Figure 12. Solubilization of Inclusion Bodies and Refolding of ser/r-met-AChE. This figure is a flow chart showing the steps performed as described in Example 6 to

solubilize the inclusion bodies and then refold the ser/r- et-AChE to obtain an enzymatically active polypeptide.

Figure 13. Purification of Refolded and Enzymatically Active ser/r-met-AChE. This figure is a flow chart showing the steps performed as described in Example 6 to purify the refolded and enzymatically active ser/r-met-AChE.

Figure 14. Pharmacokinetics of ser/r-met-AChE in mice and rats. This figure shows the time course of the serum concentration of ser/r-met-AChE in mice and rats, determined as described in Example 7. The half life may be extrapolated from this data and is 39 and 33.6 minutes for mice and rats respectively.

Figure 15. Renaturation kinetics of ser/r-met-AChE. This figure shows the time course of refolding of ser/r-met-AChE as described in Example 6.

Detailed Description of the Invention

The plasmids pMLF-52ser and pAIF-34 were deposited in Escherichia coli pursuant to, and in satisfaction of, the requirements of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure with the American Type Culture Collection (ATCC) , 12301 Parklawn Drive, Rockville, Maryland 20852 under ATCC Accession Nos. 68637 and 68638, respectively.

The subject invention provides an enzymatically active, nonglycosylated, recombinant, human acetylcholinesterase or analog thereof comprising at least one polypeptide characterized by an amino acid sequence which is substantially identical to the amino acid sequence of naturally-occurring human acetylcholinesterase.

Enzymatically active recombinant acetylcholinesterase is defined herein as having the same substrate specificity as and reactivity with molecules as that of natural acetylcholinesterase.

Analog as defined herein encompasses a polypeptide comprising the sequence of human acetylcholinesterase to which one or more amino acids have been added to either the amino terminal end, the carboxy terminal end or both, and/or to which substitutions and/or deletions to the sequence have been made, and which has the enzymatic activity of human acetylcholinesterase.

Substantially identical as defined herein encompasses the addition of fewer than four amino acids at the N-terminus of the amino acid sequence of naturally-occurring human acetylcholinesterase. Furthermore, there may be substitutions and/or deletions in the sequence which do not eliminate the enzymatic activity of the polypeptide.

Substitutions may encompass up to 10 residues in accordance with the homology groups described in Needleman et al., J. Mol. Biol. 48:443 (1970).

The subject invention further provides enzymatically active, recombinant human acetylcholinesterase wherein serine is substituted for cys 611 in the sequence of naturally occurring human acetylcholinesterase (position 580 in the mature polypeptide) .

Human acetylycholinesterase consists of 583 amino acids preceded by a 32 amino acid leader sequence which in vivo is removed by cellular processing enzymes. Cys ⁶¹¹ refers to the numbering of the amino acids from the start of the leader sequence. Upon removal of the leader sequence, position 611 becomes position 580.

The subject invention provides an enzymatically active recombinant human acetylcholinesterase or analog thereof comprising at least one polypeptide characterized by an amino acid sequence in which serine is substituted for cys 611 in the sequence of naturally-occurring, human acetylcholinesterase (position 580 in the mature polypeptide) .

The subject invention also provides an enzymatically active recombinant human acetylcholinesterase or analog thereof comprising at least one polypeptide characterized by the presence of a methionine at the N-terminus of the amino acid sequence of naturally-occurring human acetylcholinesterase. This enzymatically active human acetylcholinesterase may comprise one polypeptide or more than one identical polypeptide. In a preferred embodiment, the enzymatically active human acetylcholinesterase comprises a monomer.

The subject invention further provides an expression vector encoding any of the recombinant acetylcholinesterases

described above as well as a host such as a recombinant host comprising the expression vector.

Examples of vectors that may be used to express the nucleic acid encoding the polypeptides are viruses such as bacterial viruses, e.g., bacteriophages (such as phage lambda), cosmids, plasmids, and other vectors. Genes encoding the relevant polypeptides are inserted into appropriate vectors by methods well known in the art. For example, using conventional restriction endonuclease enzyme sites, inserts and vector DNA can both be cleaved to create complementary ends which base pair with each other and are then ligated together with a DNA ligase. Alternatively, synthetic linkers harboring base sequences complementary to a restriction site in the vector DNA can be ligated to the insert DNA, which is then digested with the restriction enzyme which cuts at that site. Other means are also available.

Vectors comprising a sequence encoding the polypeptides may be adapted for expression in bacteria, yeast, or mammalian cells which additionally comprise the regulatory elements necessary for expression of the cloned gene in the bacteria, yeast, or mammalian cells so located relative to the nucleic acid encoding the polypeptide as to permit expression thereof. Regulatory elements required for expression include promoter sequences to bind RNA polymerase, operator sequences for binding represser molecules, and a ribosomal binding site for ribosome binding. For example, a bacterial expression vector may include a promoter-operator sequence such as λ P _L 0 _L or deo promoters. For initiation of translation, the λC _{π or} deo ribosomal binding sites may be used. Such vectors may be obtained commercially or assembled from the sequences described by methods well known in the art, for example the methods described above for constructing vectors in general.

In addition, the subject invention provides expression plasmids encoding any of the recombinant acetylcholinesterases described above. In one embodiment, these expression plasmids are plasmids pAIF-34 deposited under ATCC Accession No. 68638 and plasmid pMLF-52ser deposited under ATCC Accession No. 68637.

Those skilled in the art will understand that the plasmids deposited in connection with this application may be readily altered by known techniques (e.g. by site-directed mutagenesis or by insertion of linkers) to encode expression of related polypeptides. Such techniques are described for example in Sambrook, J. , Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press.

The expression plasmids of this invention further comprise suitable regulatory elements positioned within the plasmid relative to the DNA encoding the polypeptide so as.to effect expression of the polypeptide in a suitable host cell, such as promoter and operators, e.g. deo P _j P., and λ P _L 0 _L , ribosom¬ al binding sites, e.g. deo and C _π , and repressers.

The suitable regulatory elements are positioned within the plasmid relative to the DNA encoding the acetylcholinesterase so as to effect expression of the acetylcholinesterase in a suitable host cell. In preferred embodiments of the invention, the regulatory elements are positioned close to and upstream of the DNA encoding the acetylcholinesterase.

The expression plasmids of this invention may be introduced into suitable host cells, preferably bacterial host cells. However, those skilled in the art will understand that the expression plasmids of this invention may be suitably modified for introduction into fungi, yeast, or eukaryotic cell lines such as CHO, chicken embryo, fibroblast or other

known cell lines. Preferred bacterial host cells are Escherichia coli cells. Examples of suitable Escherichia coli cells are strains S 930 or A4255, but other Escherichia coli strains and other bacteria can also be used as hosts for the plasmids.

The bacteria used as hosts may be any strains including auxotrophic (such as A1645) , prototrophic (such as A4255) , and lytic strains; F* and F ^" strains; strains harboring the cl ⁸⁵⁷ repressor sequence of the λ prophage (such as A1645 and A4255) ; and strains devoid of the deo repressors and/or the deo gene (see European Patent Application Publication No. 0303972, published February 22, 1989). Escherichia coli strain A4255 has been deposited under ATCC Accession No. 53468, and Escherichia coli strain Sφ930 has been deposited under ATCC Accession No. 67706.

The invention provides a bacterial cell which comprises these expression plasmids. In one embodiment, the bacterial cell is an Escherichia coli cell. In preferred embodiments, the invention provides an Escherichia coli cell containing the plasmid designated pMLF-52ser, deposited in E. coli strain Sφ930 with the ATCC under ATCC Accession No. 68637 and pAIF-34, deposited in E. coli strain A4255 with the ATCC under ATCC Accession No. 68638.

All the E. coli host strains described above can be "cured" of the plasmids they harbor by methods well-known in the art, e.g. the ethidiuro bromide method described by R.P. Novick in Bacteriol. Review 33. 210 (1969) .

In addition, the subject invention provides a method of producing an enzymatically active recombinant human acetylcholinesterase or analog thereof not previously taught or suggested by the prior art which comprises culturing the recombinant hosts so as to obtain expression of the recombinant acetylcholinesterase or analog thereof in the

host, recovering the recombinant acetylcholinesterase or analog thereof so expressed from the host, and treating the recombinant acetylcholinesterase or analog thereof so recovered so as to obtain the enzymatically active, recombinant human acetylcholinesterase or analog thereof.

In an especially preferred embodiment, the invention provides a method of producing large amounts of purified, enzymatically active recombinant human acetylcholinesterase or analog thereof comprising isolation of inclusion bodies of the recombinant human acetylcholinesterase or analog thereof from the host cell in which they were produced, dissolving the inclusion bodies so isolated, refolding the enzymatically inactive recombinant human acetylcholinesterase or analog thereof to obtain an enzymatically active recombinant human acetylcholinesterase or analog thereof, and purifying the enzymatically active recombinant human acetylcholinesterase or analog thereof so obtained.

The subject invention also provides a method of hydrolyzing an ester of choline which comprises contacting the ester with an enzymatically active, nonglycosylated, recombinant human acetylcholinesterase under conditions such that the ester is hydrolyzed.

The subject invention further provides a method of preventing the toxic effects of an acetylcholinesterase inhibitor which comprises contacting the inhibitor with an amount of an enzymatically active, nonglycosylated, recombinant, human acetylcholinesterase bound to a solid support effective to prevent the toxic effects of the acetylcholinesterase inhibitor, wherein the acetylcholinesterase comprises at least one polypeptide characterized by an amino acid sequence which is substantially identical to the amino acid sequence of naturally-occurring human acetylcholinesterase.

The subject invention further provides a protective gas mask comprising an amount of an enzymatically active, recombinant, human acetylcholinesterase effective to prevent the toxic effects of an acetylcholinesterase inhibitor, wherein the acetylcholinesterase comprises at least one polypeptide characterized by an amino acid sequence which is substantially identical to the amino acid sequence of naturally-occurring human acetylcholinesterase. In one embodiment of the gas mask, the enzymatically active, recombinant, human acetylcholinesterase is nonglycosylated. In a further embodiment of the gas mask, the enzymatically active, recombinant, human acetylcholinesterase is bound to a solid support. Further, a methionine may be present at the N-terminus of the sequence. In another embodiment of the gas mask, a serine is substituted for cys 611 in the sequence of naturally-occurring human acetylcholinesterase. In further embodiments, the acetylcholinesterase inhibitor is an insecticide or a nerve gas.

The subject invention further provides a method of determining whether a molecule is an inhibitor of acetylcholinesterase which comprises determining, in the presence of the molecule, the enzymatic activity of an enzymatically active, nonglycosylated, recombinant, human acetylcholinesterase comprising at least one polypeptide characterized by an amino acid sequence which is substantially identical to the amino acid sequence of naturally-occurringhumanacetylcholinesteraseand comparing the activity so determined with the activity determined in the absence of the molecule. In one embodiment of the method, a methionine may be present at the N-terminus of the sequence. In another embodiment of the method, a serine is substituted for cys 611 in the sequence of naturally- occurring human acetylcholinesterase.

The subject invention further provides a method of treating a subject exposed to an inhibitor of acetylcholinesterase

which comprises administering to the subject an amount of an enzymatically active, recombinant, human acetylcholinesterase effective to treat the subject, wherein the acetylcholinesterase comprises at least one polypeptide characterized by an amino acid sequence which is substantially identical to the amino acid sequence of naturally-occurring human acetylcholinesterase. In one embodiment of the method, the enzymatically active, recombinant, human acetylcholinesterase is nonglycosylated. In a further embodiment of the method, a methionine may be present at the N-terminus of the sequence. In another embodiment of the method, a serine is substituted for cys 611 in the sequence of naturally-occurring human acetylcholinesterase. In further embodiments of the method, the inhibitor of acetylcholinesterase is neostigmine or isofluorophate.

The subject invention further provides a method of treating post-surgery apnea which comprises administering to -the subject an effective amount of an enzymatically active, recombinant, human acetylcholinesterase comprising at least one polypeptide characterized by an amino acid sequence which is substantially identical to the amino acid sequence of naturally-occurring human acetylcholinesterase. In one embodiment of the method, the enzymatically active, recombinant, human acetylcholinesterase is nonglycosylated. In a further embodiment of the method, a methionine may be present at the N-terminus of the sequence. In another embodiment of the method, a serine is substituted for cys 611 in the sequence of naturally-occurring human acetylcho1inesterase.

The subject invention further provides a method of treating gastrointestinal disorders which comprises administering to the subject an effective amount of an enzymatically active, recombinant, human acetylcholinesterase comprising at least one polypeptide characterized by an amino acid sequence

which is substantially identical to the amino acid sequence of naturally-occurring human acetylcholinesterase. In one embodiment of the method, the enzymatically active, recombinant, human acetylcholinesterase is nonglycosylated. In a further embodiment of the method, a methionine may be present at the N-terminus of the sequence. In another embodiment of the method, a serine is substituted for cys 611 in the sequence of naturally-occurring human acetylcholinesterase.

The subject invention further provides a method of treating central nervous system disorders which comprises administering to the subject an effective amount of an enzymatically active, nonglycosylated, recombinant, human acetylcholinesterase comprising at least one polypeptide characterized by an amino acid sequence which is substantially identical to the amino acid sequence of naturally-occurring human acetylcholinesterase. In one embodiment of the method, a methionine may be present at the N-terminus of the sequence. In another embodiment of the method, a serine is substituted for cys 611 in the sequence of naturally-occurring human acetylcholinesterase. In these methods, the central nervous system disorder may be Parkinson's or Alzheimer's Disease.

The subject invention further provides a method of using as an aminopeptidase an enzymatically active, recombinant, human acetylcholinesterase comprising at least one polypeptide characterized by an amino acid sequence which is substantially identical to the amino acid sequence of naturally-occurring human acetylcholinesterase. In one embodiment of this use, the enzymatically active, recombinant, human acetylcholinesterase is nonglycosylated. In a further embodiment of this use, a methionine may be present at the N-terminus of the sequence. In another embodiment of this use, a serine is substituted for cys 611 in the sequence of naturally-occurring human

acetylcholinesterase.

The subject invention further provides a method of using in an enzyme immunoassay an enzymatically active, nonglycosylated, recombinant, human acetylcholinesterase comprising at least one polypeptide characterized by an amino acid sequence which is substantially identical to the amino acid sequence of naturally-occurring human acetylcholinesterase. In one embodiment of the method, a methionine may be present at the N-terminus of the sequence. In another embodiment of the method, a serine is substituted for cys 611 in the sequence of naturally-occurring human acetylcholinesterase.

The subject invention further provides a method of detecting cancer which comprises contacting DNA from a tissue sample with a DNA probe to which a marker is attached, wherein the DNA probe is obtained from a nucleic acid producing an enzymatically active, nonglycosylated, recombinant, human acetylcholinesterase comprising at least one polypeptide characterized by an amino acid sequence which is substantially identical to the amino acid sequence of naturally-occurring human acetylcholinesterase, detecting the amount of DNA probe hybridized to the DNA from the tissue sample by detecting the presence of the marker, wherein abnormally high levels of expression of acetylcholinesterase indicate the presence of cancer. In one embodiment of the method, a methionine may be present at the N-terminus of the sequence. In another embodiment of the method, a serine is substituted for cys 611 in the sequence of naturally-occurringhuman acetylcholinesterase.

EXAMPLES

The Examples which follow are set forth to aid in understanding the invention but are not intended to, and should not be construed to, limit its scope in any way. The Examples do not include detailed descriptions of conventional methods employed in the construction of vectors and plasmids, the insertion of genes encoding polypeptides into such vectors and plasmids or the introduction of plasmids into hosts. Such methods are well known to those of ordinary skill in the art and are described in numerous publications including by way of example the following:

Sambrook, J. , Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edition. Cold Spring Harbor Laboratory Press.

Example l: Construction __£ Expression Plasmids ≤__

Egression of Acetylcholinesterase

1. Introduction

cDNA coding for human acetylcholinesterase has been described by Prof. H. Soreq of the Hebrew University of Jerusalem (Soreq, H. et al. (1990) Proc. Natl. Acad. Sci. 87 9688-9692 and European Patent Publication No. 388,906). Plasmid pGEM-7Z(f) (Fig. 1), which was obtained from the U.S. Army, contains a 4kb cDNA fragment flanked by EcoRI restriction sites, and encompasses the entire coding sequence shown in Soreq et al. The sequence coding for native acetylcholinesterase (i.e. without the leader sequence) is 1743 bp and is located on the 3 * end of the 4kb fragment. Those skilled in the art may readily construct other plasmids using probes based on the sequence described by Soreq et al. Any such plasmid may serve as a useful starting point for construction of expression plasmids as hereinafter described.

2. Construction of plasmids

2.1. Plasmid pBR-AChE

The construction of plasmid pBR-AChE is shown in Figure 1. The 4kb cDNA sequence in plasmid pGEM-7Z(f*) was computer analyzed for the determination of restriction sites required to trim the 4kb fragment so that it contains the coding sequence for mature AChE only. A unique Xhol restriction site about 750 bp upstream to the Nael restriction site was mapped. Plasmid pGEM-7Z(f ⁺ ) was then digested with EcoRI and the resulting 4kb fragment was purified from an agarose electrophoresis gel and was digested with Xhol. The 2650 bp fragment isolated from Xhol digestion of the purified 4kb fragment was ligated to the large fragment isolated from

EcoRI-Sall digestion of plasmid pBR322. Sail and Xhol sites are complementary and can be ligated. After ligation, presence of the 2650bp sequence in the resulting plasmid designated pBR-AChE was verified by restriction mapping. Plasmid pBR-AChE was then introduced into E. coli MC1061 (ATCC Accession No. 53338) by transformation.

2.2. Plasmid PAIF-2

The cloning vector, plasmid pAIF-2 (Figure 2) was constructed as follows. Two synthetic oligomers, "A" and "B" were prepared, purified and annealed to generate the duplex shown below:

5' TATGGAGGGCCGGGAGGATGCAGAGCTGCTGGTGACGGTGCGTGGGGGCC 3' A 3 ^« ACCTCCCGGCCCTCCTACGTCTCGACGACCACTGCCACGCACCCCCGG 5' B

Plasmid pBR-AChE was digested with Ndel and Nael. The large fragment was isolated and ligated with the synthetic duplex shown above. After transformation into E. coli MC1061, colonies harboring the synthetic linker were identified by hybridization on nitrocellulose filters to the synthetic radioactively labeled oligonucleotide "B" at 60°C overnight. The filters were then washed at 60°C with lxSSC containing 0.1% SDS, dried, exposed to x-ray film for 3 hours, and developed. Several colonies yielding strong signals were picked and analyzed with restriction endonucleases Ndel and Nael. One of the candidates, designated pAIF-2, was used for further manipulation. This plasmid contains the initiation codon ATG at the 5' end of the AChE gene; however it does not express AChE since it lacks a promoter and ribosomal binding site.

2.3. Construction of Plasmids Incapable of Expression

Two plasmids, one harboring the λP _L promoter and the other the deo P promoters were constructed in an attempt to obtain expression of AChE. (Examples of plasmids harboring the deo

P1P2 promoters and deo ribosomal binding site are disclosed in coassigned EPO patent application publication No.303972, published February 22, 1989; these promotors are herein designated as the deo P promoters.)

Construction of the deo plasmid is shown in Figure 2 and was performed as follows. Plasmid pAIF-2 was first cleaved with Dral and Aatll and the resulting 3* overhanging ends were removed (blunt-ended) by digestion with E.coli DNA polymerase large fragment (Klenow fragment) . The plasmid was then digested with Ndel and a 1879 bp fragment was isolated and purified from an agarose electrophoresis gel. This fragment was then ligated to the large fragment isolated from Smal-Ndel digestion of plasmid pMLK-6891. The ligated mix was used to transform E.coli MC1061. Verification that the plasmid retained the Ndel site was done by extracting the plasmid according to the method described by Birnboim et al. (Nuc. Acid. Res.2, 1513, 1979) and cleaving with Ndel. This mini-prep plasmid extract ^* was used to transform E.coli strains Sφ732 and S 930 (ATCC Accession Nos. 67362 and 67703, respectively) which are appropriate hosts for optimal expression of plasmids under control of the deo P promoter. The resulting plasmid designated pAIF-04 contains the native, naturally occurring DNA sequence encoding AChE under control of the deo promoter.

Construction of a plasmid under control of the λP _L promoter is shown in Figure 3 and was performed as follows. The small fragment isolated from Ndel-Sall digestion of plasmid pAIF-04 was ligated with the large fragment isolated from Sall-Ndel digestion of the λP _L vector pMLKlOO (deposited in E.coli A4300 as ATCC Accession No. 68605) . The resulting plasmid which was designated pAIF-11 contains the native, naturally occurring DNA sequence encoding AChE under control of the λP _L promoter. This plasmid was introduced to E. coli A4255 (ATCC Accession No. 68456) and also to E. coli

A4300 (also known as AC4300) which both carry the temperature sensitive repressor λcl ⁸⁵⁷ on the bacterial chromosome.

However as will be described below, neither plasmid pAIF-04 nor plasmid pAIF-11 was able to express AChE.

3. Attempts at Expression of AChE in Plasmids PAIF-04 and PAIF-11

E. coli Sφ930 (ATCC Accession No. 67706) containing plasmid pAIF-04 was grown in 1 ml of LB + lOOμg/ml ampicillin at 37°c overnight. The culture was processed for SDS-PAGE by pelleting the cells, and suspending them in lysis buffer containing SDS. Electrophoresis was performed at room temperature for 3 hours on a 10% polyacrylamide gel to evaluate expression.

E. coli A4255 (ATCC Accession No. 68456) containing plasmid pAIF-11 was grown in LB + 100 μg/ml ampicillin additionally containing 0.2% glucose to a cell density of OD^ of 0.6-0.8 at 30°C and then induced at 42 ^β C for a period of 1_ - 3 hours. Expression was evaluated on SDS-PAGE as described above.

4. Results

The cloned acetylcholinesterase gene was expected to produce a polypeptide that consists of 584 amino acids. Taking into account that the average molecular weight of an amino acid is 110, the molecular weight of a monomer of AChE was predicted to be about 62-64kD. The electrophoretic pattern observed on 10% SDS-gels revealed a very faint band at a position corresponding to the expected molecular weight. However, this band co-migrated with a band obtained from lysates of control cultures which did not harbor an AChE insert. Although the intensity of the protein band was

higher in the lane containing the extract from the expressing clones than in the lane containing the control culture, we suspected that it was not related to the desired protein product.

To further confirm this observation, total cell extracts were subjected to Western blot analysis using antibody against human erythrocyte AChE, kindly provided by Prof. H. Soreq. The results of this analysis failed to reveal a cross reactive protein band on SDS-PAGE, indicating that AChE is not expressed.

Examole 2: Construction of Plasmids for Achievement of Expressjpn of hE

Example l disclosed the construction of plasmids for achievement of expression of AChE harboring the authentic sequence as found in natural sources. As disclosed in Example l, these plasmids were not able to express AChE.

1. Construction of Plasmids having a Modified Base Composition in the AChE DNA Gene Seouence

Two synthetic DNA duplexes were prepared such that 24 base pair substitutions of GC to AT were introduced along a stretch of 130 base pairs as shown in Figure 5. These duplexes were joined to produce a synthetic linker flanked by Ndel-Ncol restriction sites which are compatible with sites on plasmids pAIF-11 and pAIF-04. The same procedure was used in order to modify both plasmids. The synthetic linker was ligated to the large fragment isolated from Ndel-Ncol digestion of plasmids pAIF-11 or pAIF-04. The ligation of the synthetic linker with plasmid pAIF-11 resulted in plasmid pAIF-34 which expresses AChE under control of the λP _L promoter. Ligation of the linker with plasmid pAIF-04 resulted in plasmid pAIF-51 which expresses AChE under control of the deo P promoter. Plasmids pAIF-34 and pAIF-51 (shown in Figure 6) were introduced into host cells E. coli A4255 (ATCC Accession No. 68456) and E. coli Sφ930 (ATCC Accession No. 67703) respectively. E.coli A4255 harboring plasmid pAIF-34 was deposited in the ATCC under Accession No. 68638.

To confirm that plasmids pAIF-34 and pAIF-5l do in fact contain the modified DNA fragment between the Ndel-Ncol restriction sites, an 800 bp Scal-SphI fragment spanning a few nucleotides upstream of the ATG initiation codon from plasmid pAIF-34 was inserted into the appropriate M13 phage and then sequenced by the Sanger dideoxy DNA sequencing

method. The sequencing data confirmed that no changes other than those intended are present.

In a similar manner, plasmid pAIF-52 was cleaved with Ncol, blunt-ended with Klenow enzyme, and then cleaved with Bglll. This cleavage generated a 700 bp fragment introduced into appropriate M13 DNA that was previously cleaved with BamHI and Smal to generate compatible ends for ligation. Dideoxy DNA sequencing data obtained was identical to that obtained for pAIF-34.

Additionally, a plasmid under control of the deo P promoter was constructed containing the gene for tetracycline resistance (Tet ^R ) instead of ampicillin resistance (Amp ^R ) . The resulting plasmid designated pAIF-52 contains the gene for tetracycline resistance (Tet ^R ) and modified DNA encoding authentic AChE under control of the deo P promoter (see Figure 7) . The advantage of this plasmid is its improved stability as described in section 4 below. Note that plasmids pAIF-34, pAIF-51 and pAIF-52 all encode the same authentic AChE amino acid sequence with the additional N- ter inal methionine (hereinafter "r-met-AChE") .

2. Expression of r-met-AChE bv Plasmids having a Modified Base Composition in the AChE DNA Gene Seguence

E. coli A4255 harboring the λP _L expression plasmid pAIF-34 was grown at 30 ^β C to an OD^ of 0.7 in LB medium supplemented with 100 μg/ml ampicillin and 0.2% glucose. To induce r-met-AChE synthesis, the temperature was elevated to 42°C and the culture was grown for an additional 2-3 hours. Samples were removed at 1 hour intervals and adjusted to contain the same cell density. Total cell lysate prepared in SDS-NaOH was applied to SDS-PAGE.

E. coli Sφ930 harboring the deo P expression plasmid pAIF-51 was grown overnight at 37°C in LB buffered with M9 salts

medium (Miller, 1972) and supplemented with 0.1% glucose and 100 μg/ml ampicillin. The culture was harvested and processed as described above.

3. Results

Samples of the cultures were analyzed by electrophoresis on SDS polyacrylamide gels. These gels were then stained with Coomassie blue.' The results showed that an intense protein band corresponding to 62kD was produced by both the λP _L and the deo AChE expression plasmids. This protein band comprised about 10% of total bacterial proteins and was not seen in an uninduced control culture consisting of a host which does not harbor an AChE plasmid. It is reasonable to conclude that this band is r-met-AChE produced by the plasmid.

To confirm that the protein expressed is indeed r-met-AChE, total cell lysates and fractionated material were electrophoresed on both 10% and 15% SDS-polyacrylamide gels, transferred onto nitrocellulose paper, and reacted with anti-erythrocyte AChE antiserum kindly provided by Prof. M. Soreq.

The 62kD protein of rAChE reacted with anti-AChE antiserum prepared with AChE purified from human erythrocytes, thus confirming that the plasmids are producing rAChE, immunologically similar to naturally occurring AChE.

4. Plasmid stability

Stability of plasmids expressing high levels of any protein depend on a number of parameters characteristic to the host and plasmid. Plasmid stability was determined for E. coli Sφ930 containing plasmid pAIF-51 by inoculating 200ml buffered LB medium containing 100 μg/ml ampicillin to contain 20 cell/ml. The culture was grown at 37 ^β C for 16-18

hours and reached an OD^ of 4-5. Assuming that 1 OD ₆₆₀ represents about 5xl0 ⁸ cells/ml the number of generations from seeding to harvest is 22-25. A sample from the first culture was diluted appropriately and a new flask with 200 ml was seeded as described for the first culture. Four such successive transfers account for 100 generations. When each flask was harvested, a sample was diluted and plated on LB agar with and without ampicillin, grown overnight and colonies counted-. A second fraction was saved for SDS-PAGE. A similar experiment was performed with E. coli A4255 containing plasmid pAIF-34.

The results of this plasmid stability study as assessed by plating and SDS-PAGE show that E. coli Sφ930 containing plasmid pAIF-5l maintains the plasmid for up to 45-50 generations. Samples representing generations 50-75 show a marked drop in expression that is accompanied with loss of antibiotic resistance.

No such loss was observed with hosts harboring the λP _L expression plasmid grown at 30°C. The lower plasmid stability of E. coli Sφ930 containing the deo constitutive expression plasmid pAIF-51 is attributed to the high r-met- AChE expression which interferes with plasmid replication and segregation. Furthermore, r-met-AChE is accumulated in the form of inclusion bodies which can be seen as bright blue particles within the cell during microscopic examination. Inclusion bodies tend to trap resident plasmids and thus contribute to plasmid loss. None of these factors are relevant in an inducible system such as the λP _L expression plasmid pAIF-34.

Similar experiments were performed with E. coli Sφ930 harboring plasmid pAIF-52 which contains the Tet ^R gene. The cells were grown in LB medium containing 10-12.5 μg/ml tetracycline and plasmid stability was monitored as described above. These cells showed plasmid stability of at

least 90 generations and high level r-met-AChE production. This is in contrast to plasmid stability of less than 50

D generations for plasmid pAIF-5l, which contains the Amp^ gene. The rationale for these differences in plasmid stability appears to be based on the biochemical properties of the two antibiotics. The jS-lactamase gene confers a picillin-resistance by producing a protein that is able to degrade ampicillin. This rapidly reduces the ampicillin concentration in the medium thus enabling plasmid-less cells to increase. The gene conferring tetracycline resistance produces a protein that prevents the antibiotic from entering the cell. Since tetracycline is not destroyed it remains active during the process and those cells that lose the plasmid become tetracycline sensitive and cannot multiply.

5. Distribution of AChE in the Host Cell

To determine if r-met-AChE is exclusively located in inclusion bodies or whether some of it is soluble, E.coli cells (S093O/AIF-51 or S0930/pAIF-52) were resuspended in 20mM Tris-HCl pH 8.0 containing lOmM EDTA, sonicated and then centrifuged. The insoluble pellet was dissolved in SDS and processed for SDS-PAGE. The electrophoretic pattern reveals that most of the r-met-AChE is indeed in the pellet which is composed of inclusion bodies. A minor fraction is apparently soluble and was noted in the supernatant of cell extracts.

SUBSTITUTESHEET

__________________.: Isolation and Partial Purification of r-met- AChE

1. Fermentation of r-met-AChE

To obtain the larger amounts of r-met-AChE necessary for purification experiments, the two E. coli strains described in Example 2 (i.e. Sφ930/pAIF-51 and A4255/pAIF-34) were grown in 2 liter fermentation vessels in medium composed of 10 g/1 yeast extract, 20 g/1 N-Z amine (casein hydrolysate) and 10-15 g/1 glucose, and additionally containing 100 mg/L ampicillin or 12.5 mg/L tetracycline, depending on the strain used.

Strain Sφ930/pAIF-51 was grown at 37 ^β C for 10 hours and harvested at OD _g ^-^12-15. Strain A4255/pAIF-34 was grown in the same medium at 30 ^β C until OD ₆₆₀ =10- 12 and then the temperature was raised to 42°C for 3 hours.

2. Solubilization and Purification of Inclusion Bodies

Inclusion bodies were isolated by resuspending 5-10g packed cells in 50 ml of 25% sucrose, 50 mM Tris-HCl pH 8.0, 10 πM EDTA and 10 μg/ml lysozyme. The cells were allowed to lyse by incubation on ice for 1-2 hours. The highly viscous extract was then sonicated intermittently for 5 minutes or until more than 90% of the cells were disrupted. The sonicated extract was centrifύged at 17K for 30 minutes at 4 ^β C and the pellet resuspended in the same buffer. The pellet was washed in 4M urea containing 20mM Tris-HCl pH 8.0 for 30 minutes and spun at 17K. The last wash was in H ₂ 0 for 10 minutes. The final pellet was kept frozen and aliquots taken for further studies.

An aliquot of inclusion bodies in 20mM Tris-HCl pH 8.0, 2.5mM EDTA was adjusted to OD ₆₆₀ of 40-60 and solubilized by adding 8 grams of solid urea per 10 ml suspension (final

_S UBSTITUTESHEET

concentration 8M urea) or in 6M guanidine thiocyanate. The suspension was stirred for 1 hour at room temperature, centrifuged to remove undissolved particles and diluted 1:1 in 20mM Tris-HCl pH 8.0 containing 25mM EDTA. The clear supernatant was applied to Q-Sepharose equilibrated with 20mM Tris-HCl pH 8.0, 2.5mM EDTA and 4M urea. Under these conditions many proteins bind to the resin while r-met-AChE washed through. SDS-PAGE analysis revealed that the major protein band is that of AChE. The purity of the r-met-AChE is estimated by visual judgment to be about 60-70%. The wash-through containing the r-met-AChE was then concentrated and dialyzed against 20mM Tris-HCl pH 8.0, 2.5mM EDTA and 10% glycerol at 4°C. The dialyzed material remained clear and was injected into a rabbit to produce anti-r-met-AChE. To substantiate the data, erythrocyte hAChE (purchased from Sigma) was also used to produce rabbit anti-AChE antiserum and confirmed the results obtained using anti-r-met-AChE antiserum.

3. Biochemical Characterization of r-met-AChE.

3.1 FPLC analysis

The partially purified r-met-AChE was subjected to gel- filtration chromatography on FPLC (Pharmacia) using Superose-12 (Pharmacia) both with and without 8M urea. The chromatographic data suggest that most of the r-met-AChE in 8M urea is in a form of monomer-dimer while after dialysis only multimeric forms are observed.

3.2 Solubility

Dilution of r-met-AChE in 8M urea into 20 mM Tris-HCl pH8 buffer to a concentration greater than 500 μg/ml resulted in appreciable precipitation. Massive precipitation was also noted when r-met-AChE in 6M guanidine was diluted in a similar manner. Incorporation of Triton X-100 or NP-40 into

the denaturing solution did not prevent precipitation upon dilution.

3.3 r-met-AChE enzyme activity

Following dilution of the r-met-AChE in 8M urea or 6M guanidine thiocyanate, the diluted material was kept at room temperature for 2-3 hours, and then centrifuged to remove precipitates. The clear supernatant was then assayed for enzyme activity.

Enzymatic activity was determined according to Ellman (Biochem. Pharmacol. 2 88 1961) . Alternatively, a radioactive assay using ³ H-acetylcholine iodide as substrate was implemented (Johnson, C. and Russel, R.L. Analytical Chemistry (1975) j54.: 229-238) . We were unable to detect enzyme activity in either case. The lack of activity could be attributed to incorrect folding of the protein or to the impurities in the partially purified material.

Example 4: Production of Enzvmaticallv Active r-met-AChEs

As described in Example 3, the r-met-AChE initially produced had no measurable enzymatic activity. We believed that this was due to faulty refolding/oxidation of the molecule. The development of a refolding/oxidation procedure was very arduous. The standard refolding procedures did not produce active enzyme, e.g. use of guanidine produced precipitation of the enzyme. Eventually the refolding procedure described below (in section 3) was developed which produced enzymatically active AChE; however the enzymatic activity was low.

The hAChE catalytic subunit contains 7 cysteine (Cys) residues (see Figures 4A-D and SEQ ID NO:l), six of which are involved in intrasubunit disulfide linkages. We considered that exchange of the C-terminal cysteine residue

(position 611 of Figures 4A-D and SEQ ID NO:l) by an amino acid that is structurally similar to cysteine such as serine may increase the chance of proper refolding. To investigate this possibility, a plasmid was constructed that expresses a mutant of r-met-AChE containing serine at position 611

(position 580 of the mature polypeptide) instead of the naturally-occurringcysteine (hereinafter"ser/r-met-AChE") .

1. Construction of a Plasmid Expressing ser/r-met-AChE

The following synthetic oligonucleotide was prepared:

5' CCTACATGGTGCACTGGAAGAACCAGTTCGACCACTACAGCAAGCAGGATC- 3'TCGAGGATGTACCACGTGACCTTCTTGCTCAAGCTGGTGATGTCGTTCGTCCTAG- SacI ser -GCTCATCAGACCTGTGAT 3'

-CGAGTAGTCTGGACACTAGATC 5'

Xbal

This synthetic linker containing a serine codon (TCA) instead of the naturally occurring cysteine codon (TGC) was

prepared such that it is flanked by a Sad site at the 5' end and an Xbal site at the 3' end. The linker was ligated to the large fragment isolated from Sacl-Xbal digestion of plasmid pAIF-52 (Figure 7) . The resulting plasmid encodes serine instead of cysteine at position 611 and was designated pMLF-52ser (Figure 7) . Plasmid pMLF-52ser expresses the ser/r-met-AChE polypeptide under control of the deo P promoter with a selection marker of tetracycline resistance. This plasmid was introduced to E. coli host Sφ930 by transformation and deposited in the ATCC under ATCC Accession No. 68637. It expresses ser/r-met-AChE protein at a level of about 10% of total bacterial protein.

2. Fermentation and Crude Processing

E. coli Sφ930 harboring plasmid pAIF-52 and E. coli Sφ930 harboring plasmid pMLF-52ser were each grown in a 50L fermentation vessel to a cell density of OD ₆₆₀ =26-28. Both cultures were treated identically. The culture -was harvested and cells disrupted in a Dyno-Mill bead mill cell disrupter. Inclusion bodies containing the r-met-AChE or ser/r-met-AChE were prepared by successive washing with 50mM Tris-HCl pH 8.0, 1% Triton X-100, and finally with 4M urea. Inclusion bodies were then dissolved in 8M urea or 6M guanidine thiocyanate containing 20mM Tris HCl pH 8.8 for several hours and centrifuged to remove undissolved matter. The denatured AChE thus produced has no enzymatic activity. In order to obtain an enzymatically active polypeptide, the denatured enzyme must be properly refolded.

3. Refolding of rAChEs

Crude denatured r-met-AChE or ser/r-met-AChE dissolved in 8M urea or guanidine thiocyanate was diluted in 0.6M arginine pH 10 containing 0.3mM GSSG to a protein concentration of 50-200 μg/ml. (We found that the arginine could be in the range 0.1M to 1M, pH 8.3 to 11, and the GSSG could be in the

range O.lmM to 0.5mM.) This solution was stirred for 4 hours (or more) at 4°C and then dialyzed against lOmM HEPES pH 8.0 containing 2.5mM EDTA or lOmM arginine pH 10 for 16-18 hours. The dialyzed material was centrifuged at 15K for 15 minutes and AChE activity was then assayed on the clear supernatant.

AChE activity was assayed by the spectrophotometric method of Ell an using acetylthiocholine as substrate (Ellman, G.L. et al. (1961) Biochem. Pharm.2'- 88-95)). Acetylthiocholine hydrolysis generates free thiocholine which reacts with Ellman reagent (DTNB) to produce a yellow chromophore. The concentration of the yellow chromophore is determined by the absorption at 412nm and is proportional to the amount of AChE present. One enzyme unit (U) is the amount of enzyme which hydrolyses l μmole of substrate per minute. The extinction coefficient of 1M chromophore is 13.6X10 ⁴ . Specific activity is expressed as U/mg protein. The assay solution contained 0.1M HEPES pH 8.0 instead of 0.1M NaP, because we found that spontaneous non-enzymatic degradation of acetylthiocholine in HEPES is much slower than in phosphate buffer.

4. Results

4.1 Comparison of recombinant AChEs

Table 1 is an example showing the recovery of active r-met- AChE and ser/r-met-AChE following in vitro refolding. Refolding of both r-met-AChE and ser/r-met-AChE was performed under identical conditions and at similar protein concentrations. It is clear that GSSG enhances the recovery of active enzyme. These preliminary results suggest that activity of the ser/r-met-AChE is quantitatively many fold higher than that of the r-met-AChE having the authentic sequence. It is surprising that the activity of the mutant enzyme should be so much higher than the enzyme having the

authentic sequence.

Table 1: AChE Activity Following In Vitro Refolding

5. Improved Method of Folding and Oxidation of rAChE

As seen in Table 1, the protein obtained by the method of folding described above had a specific activity of up to 1.3 U/mg. The following procedure enables recovery of protein having much higher specific activity.

Washed inclusion bodies of ser/r-met-AChE obtained as described above were dissolved in 6M guanidine thiocyanate, lOmM Tris HC1 pH 8.3 to a protein concentration of 3-5 mg/mL. Monomers and dimers were then separated from multimers by gel filtratation on Sephacryl-400 (Pharmacia) . 20-35 mg protein were loaded on the Sephacryl-400 column which had been previously equilibrated with 8M urea, lOmM Tris HC1 pH 8.3. Protein fractions corresponding to monomers and dimers were pooled and diluted into refolding

chloride) to a final protein concentration of 25-50 μg/ml. After incubation at 4°C for 24-96 hours, the solution was dialyzed against lOmM arginine pH 10.0 for 24 hours and assayed for enzyme activity as described above. The protein concentration of the dialyzed material as determined by the Bradford protein assay was 0.026 mg/mL and had enzyme activity of 1.2 U/mL, which is specific activity of 46.2 U/mg protein. As may be seen by comparison with Table 1, this method of folding and oxidation provides protein having a much higher specific activity than was previously obtained.

6. Partial purification of ser/r-met-AChE

One liter of refolded ser/r-met-AChE, obtained as described above, containing 1260 units was concentrated and dialyzed using a Pellicon® dialysis concentrator equipped with a 30kD cut-off membrane. The volume was reduced to 600ml in 20mM HEPES pH 8.0 and applied to a Q-Sepharose chromatography column. AChE binds to the column and may be eluted with an NaCl gradient.

AChE activity was eluted from Q-Sepharose in an NaCl gradient at about 0.275-0.375mM NaCl and the fractions pooled. Calculations of yield showed that 64% of the activity was recovered with a specific activity of 117u/mg. After concentration by precipitation with ammonium sulfate at 45% saturation, and dialysis against 20mM HEPES pH 8.0 for 24h, a total of 805 units was obtained. Successive 180- unit aliquots were applied to a MAC-Sepharose 4-B affinity column (1ml bed volume) until the entire 805 unit batch was processed. The ^" active fractions were pooled, concentrated by ammonium sulfate precipitation (45% saturation) , resuspended in ImL 20mM HEPES pH 8.0, 2.5mM EDTA, and dialyzed against 4 liters of the same buffer. A total of 0.29 mg protein containing 661 units of active ser/r-met- AChE was obtained. The affinity chromatography step improved

purity by 19 fold with an overall recovery of about 84%.

SDS-PAGE analysis of the purified ser/r-met-AChE revealed a single protein band on a Coomassie Blue stained gel and indicates that the ser/r-met-AChE was purified to apparent homogeneity.

Examole 5: Characterization of the Refolded rAChE Enzvmes

1. ___ Determination

The K _m of the refolded ser/r-met-AChE as determined from a Lineweaver-Burk plot is 1.0xl0 ^"4 M (Figure 8) which is in good agreement with the value of 1.4xl0 ^"4 M reported in the literature for naturally ocurring acetylcholinesterase (Ellman, 1961) . -

Similar results were obtained for r-met-AChE.

2. Demonstration of activity by means of activity gel

It is possible to visualize AChE activity on a polyacrylamide gel. 0.04 units measured as described above of r-met-AChE and ser/r-met-AChE were applied to a 7% native polyacrylamide gel (in the absence of SDS and β- mercaptoethanol) and electrophoresed for 4 hours at room temperature at 120V and 6-10mA. The gel was stained according to the procedure described by Karnovsky and Roots (J. Histochem. Cytochem 1_: 219-221, 1964).

Both r-met-AChE and ser/r-met-AChE, derived from Sφ930/pAIF-52 and Sφ930/pMLF-52ser respectively, generated a major activity band on the gel. However, although equal amounts of protein, as determined spectrophotometrically, were applied to the gel, the intensity of the ser/r-met-AChE band was considerably greater than that of the r-met-AChE band. The positions of the activity bands on the gel are not identical: ser/r-met-AChE migrates more slowly than r-met- AChE.

3. Heat Inactivation

Experiments were performed to determine the heat lability of ser/r-met-AChE. A solution containing the enzyme was heated

to 50°C and samples removed at 5 min intervals to determine the remaining enzyme activity. Figure 9 shows the heat inactivation profile of ser/r-met-AChE. The plot shows that 50% of the activity is lost after 7 min and 90% of activity is lost after 25 min. This experiment confirms that the acetylcholinesterase activity being measured is due to a protein.

4. Substrate and Inhibitor Specificity of r-met-AChE and ser/r-met-AChE

The authenticity of the activity of the refolded r-met-AChE and ser/r-met-AChE was verified by testing the refolded protein with two different substrates and a specific inhibitor. Acetylthiocholine (the specific substrate) , and butyrylthiocholine (the BuChE substrate) , and a specific inhibitor BW-284C51 (see Background of the Invention) were tested to see whether the recombinant enzyme retained the specific characteristics of the naturally-occurring enzyme. The enzyme was assayed with each of the two substrates, or first reacted for five minutes with the specific inhibitor BW-284C51 and then the specific substrate was added to the reaction mix. The results are shown in Table 2. The refolded ser/r-met-AChE showed nearly 10 times the activity towards 0.5mM acetylthiocholine, (i.e. 0.047 U/mL) as towards lOmM butyrylthiocholine, (i.e. 0.0044 U/mL) at the same protein concentration (0.15 mg/mL) . Since the butyrylthiocholine was present at a 20-fold higher concentration than acetylthiocholine it is seen that the enzymatic activity towards the butyrylthiocholine is 200- fold less than towards the specific substrate. No activity at all was detected towards the 0.05mM butyrylthiocholine.

Additionally, the specific inhibitor showed a strong and dose-dependent effect on the activity of the refolded ser/r- met-AChE towards the specific substrate, progressing from

57%-l00% inhibition with increasing dosages from 0.8 x 10 ^* ^

to 0.8 x 10 ^* ^.

Table 2: Substrate Specificity of ser/r-met-AChE

These results show conclusively that the refolded ser/r-met- AChE polypeptide retains the same specificities and activity as the naturally-occurring enzyme. The values presented in Tables 1 and 2 were obtained with non-purified enzyme, and may be expected to improve following purification of the

enzyme.

Similar results were obtained for r-met-AChE having the authentic sequence.

5. Effect of Detergents on Enzvme Activity of Refolded ser/r-met-AChE

The effect of several detergents on enzyme activity was also tested. 1% Triton X-100 reduced enzyme activity approximately 50%, while lauryl acid sodium salt and quaternary ammonium salts at 0.1% inhibited enzyme activity completely. This is in contrast to erythrocyte AChE, which requires Triton-X 100 for solubilization and maximum activity.

6. Partial purification of ser/r-met-AChE

A 100 ml batch of ser/r-met-AChE, refolded as described in Example 4, was concentrated to 10ml and applied to a gel filtration chromatography column of Sephacryl-200 (Pharmacia) equilibrated with lOmM HEPES pH 8.0, and 2.5mM EDTA. The column bed volume was 140ml (in a 16mm by 650mm column) . The flow rate was 30ml/hr and 8ml fractions were collected.

Figure 10 shows the gel filtration profile. A large amount of highly aggregated material devoid of enzyme activity was recovered in the void volume. AChE activity began to be detected in fraction 4 and increased to its highest point in fraction 7. The specific activity in fraction 7 was 10.6 U/mg. SDS-PAGE analysis of fractions 6 and 7 revealed considerable levels of impurities, which may be removed by other methods such as ion-exchange chromatography. Preliminary experiments indicate that the refolded AChE binds to anion exchange columns. Note that prior to refolding, the urea-solubilized inclusion bodies which

contain the AChE did not bind to ion-exchange resin.

7. Amino acid seguencing

r-met-AChE obtained from Sφ930/pAIF-52 electrophoresed on SDS-PAGE was blotted onto PVDF paper and the protein band corresponding to r-met-AChE was isolated. N-terminal amino acid sequencing was carried out by the method of automated Edman degradation for the first 11 amino acids and the sequence obtained (shown below) was found to be correct. The second row contains the single-letter amino acid notation corresponding to the sequence shown in Figures 4A- D (SEQ ID NO:l) from position 32 et seq (not including the initiator methionine) .

Met-Glu-Gly-Arg-Glu-Asp-Ala-Glu-Leu-Leu-Val. E - G - R - E - D - A - E - L - L - V

This is the expected sequence (see description of Figures 4A-D and SEQ ID NO:l). r-met-AChE expressed by plasmids pAIF-34 and pAIF-51 and ser/r-met-AChE expressed by plasmid pMLF-52ser all have the identical N-terminal sequence.

8. Molecular Weight of ser/r-met-AChE

The molecular weight of the purified enzymatically active mutant rAChE, ser/r-met-AChE was determined by gel permeation chromatography on Sephacryl 300. The column was equilibrated with lOmM L-arginine pH 10.0 and 50mM NaCl. Bovine serum albumin containing the 67kD monomer and 135kD dimer was used as an internal control. About 50 units of the highly purified recombinant ser/r-met-AChE were mixed with BSA and applied to the column. The 135kD BSA dimer peaked at fraction 45 and the 67kD monomer peaked at fraction 50. The AChE activity of ser/r-met-AChE peaked in fraction 53. Similar analysis by HPLC with a Superose 12

colu n consistently resulted in elution of the 67kD BSA monomer prior to the elution of active ser/r-met-AChE. There was no evidence in either of the two methods to substantiate the presence of dimers or multimers of recombinant ser/r-met-AChE.

These results indicate that the enzymatically active ser/r- met-AChE is monomeric.

9. Conclusions

The data presented in this Example indicate that recombinant AChE expressed in E.coli and made enzymatically active by means of in vitro manipulation possesses properties similar to those of erythrocyte AChE. More specifically, the K_, substrate specificity and inhibition by BW-284C51 of the r- met-AChE are in good agreement with those reported for the naturally-occurring enzyme. ^" Additionally, the specific activity of ser/r-met-AChE is much higher than that of r- met-AChE having the authentic sequence. Finally, it was conclusively demonstrated that enzymatically active ser/r- met-AChE is monomeric.

Recombinant AChE is not glycosylated due to the lack of glycosylating enzymes in E. coli. Although glycosylation is not essential for catalytic activity, it may have a role in stabilization of the enzyme in vivo or in vitro.

Expression of enzymatically active AChE in bacteria as disclosed herein will facilitate the preparation of large amounts of the enzyme for its possible prophylactic and therapeutic use against organophosphate poisoning in human subjects. Moreover, this technology may be used to prepare modified analogs containing a strong binding site for the organophosphate poisons but devoid of the catalytic ability to hydrolyze acetylcholine.

Example 6: Scale-up of refolding and urification processes of ser/r-met-AChE

This example describes methods used to scale up the refolding and purification of recombinant AChE.

The scale-up consisted of two phases. The first phase focused on the development of membrane filtration technology and the recovery of active ser/r-met-AChE after each step. This phase was aimed at obtaining 8-12 mg of highly purified ser/r-met-AChE. The second phase focused on development of a 25 fold scale-up of the first phase and enabled the obtaining of 169 mg of purified enzymatically active ser/r- met-AChE from 560 g dry cell weight of E. coli. The overall yield of ser/r-met-AChE was 60% of the initial activity obtained following in-vitro refolding. Assumptions and calculations leading to above figures are presented in the following description.

Scale-up of refolding and purification of ser/r-met-AChE

The step by step purification procedure is shown schematically in the flow charts of Figures 11-13. The procedure consists essentially of solubilization of purified inclusion bodies in guanidinethiocyanate (GTC) followed by exchange of the GTC with urea, further dilution into refolding buffer (0.5M arginine pH 10.0, 0.3mM GSSG, 0.3% PEG 4000 (polyethylene glycol) , and 0.2M tetramethylammonium chloride) , separation of the active ser/r-met-AChE from inactive or contaminating proteins by DEAE column chromatography followed by affinity chromatography on MAC- Sepharose-4B.

For the first phase, 21 grams dry cell weight (obtained from 150g of cell slurry collected from cell culture fermentation broth) were processed. 1266 mg crude protein containing

66240 units of crude enzyme in refolding buffer representing

-so¬

li mg active enzyme (assuming specific activity of 6000 units/mg) were obtained. 40412 units were recovered following completion of purification which is a yield of 60%.

SDS-PAGE of the purified ser/r-met-AChE stained with Coomassie Blue showed no apparent contaminating protein bands.

For the second phase, 560 g dry cell weight (obtained from 4 kg of bacterial slurry) were processed. 39 g dry weight inclusion bodies (207 gram wet weight) obtained by the process shown in Figure 11 were dissolved in 1500 ml 6M GTC. Following dilution into 40L of 8M urea, the solution was further diluted 1:10 into 405 liters of refolding buffer. This volume was reduced to 95L by ultrafiltration using a 10k membrane filter. The 95L was dialyzed by diafiltration in a constant volume against 1000L of lOmM L-arginine pH 10. Refolding was continued for 4-5 days at room temperature. The time course of refolding is shown in Figure 15. A total of 1.7 x 10 ⁶ units was measured upon completion of refolding which is equivalent to 283 mg of protein (assuming 6000 units/mg specific activity) . The refolded enzyme was then concentrated by ultrafiltration and loaded onto a DEAE column consisting of 2.5L of packed resin in a 15cm x 45cm column. The flow rate of the column was 100-150ml per min. The 1.7 x 10 ⁶ units measured above were eluted from the DEAE column in 1856 mg protein which were then loaded onto a MAC- Sepharose 4B column having a bed volume of 80ml packed in a 2.6 x 40cm column. 1560 mg protein comprising mainly impurities did not bind to the resin and washed through. The bound protein amounted to 296mg and was further washed with 20mM HEPES pH 8.0 containing 0.275M NaCl to remove additional impurities. This wash step eluted 133mg of protein containing impurities and additionally containing 0.4xl0 ⁶ units of activity. The ser/r-met-AChE was then eluted with 0.2 M L-arginine pH 10.0, containing 2.5mM EDTA.

169mg active protein were thus obtained. According to our calculations, the expected amount of protein retained on the column is 163mg (296-133mg) , and therefore the observed value of 169mg is in good agreement with the expected number. The overall recovery of active ser/r-met-AChE was 1.01 x 10 ⁶ units which constitutes a yield of about 60%.

SDS-PAGE of the purified ser/r-met-AChE stained with Coomassie Blue showed no apparent contaminating protein bands.

Table 3 shows the amino acid composition of purified ser/r- met-AChE. This data was deduced from amino acid analysis, based either on the average protein content, or on the protein content obtained by adding up the mass of measured amino acids. Excellent agreement with the theoretical composition is obtained by both methods for 16 of the 18 measured amino acids (16 Trp and 6 Cys residues are not recovered, i.e. the total theoretical number of residues is 562) . In the case of Ser, extensive loss (about -16%) noted and was therefore not taken into account when the average protein content was determined. The value for Leu is also about -10% lower than the theoretical value. For all the other amino acids the deviations are in the range of about ± 6%.

TABLE 3: AChE COMPOSITION FROM AMINO ACID ANALYSIS

^a : nmol amino acid/average nmol of protein : nmol amino acid/∑nmol of 18 amino acids

Western blot analysis of purified ser/r-met-AChE was performed. Following SDS-PAGE, the protein was blotted onto

nitrocellulose paper and reacted with anti- acetylcholinesterase antibody produced in rabbits. The Western blot result shows that the ser/r-met AChE reacts strongly with the anti-AChE antibody.

The flow charts shown in Figures 11-13 are described in more detail in the following sections:

Isolation and Purification of Inclusion Bodies

E. coli cells were resuspended (1:10 w/v) in: 50mM Tris-HCl pH 8.0; lOmM EDTA; 10 micrograms/ml lysozyme, and incubated at 4°C for 16-18 hours. The cells were disrupted using a Dyno-Mill and centrifuged. The pellet containing the inclusion bodies was collected, resuspended in water of the same volume as initially used to resuspend the cells, and stirred for one hour. The suspension was centrifuged, the pellet was resuspended in one half the initial volume of 4M urea containing lOmM Tris-HCl pH 8.0, and stirred for 2 hours. The solution was centrifuged, the pellet was resuspended in lOmM acetate buffer pH 5.2-5.4, and incubated while stirring at 4°C for 16-18 hours. The suspension was centrifuged and the weight of the resulting pellet determined.

Solubilization and Refolding

The solubilization and refolding experiments were performed by initially solubilizing the pellet of inclusion bodies in 6M guanidinethiocynate solution (GTC) , adding 7-10 ml of GTC per gram of pellet. Following solubilization, the pH of the solution was adjusted to 10.0 with 10M NaOH. After stirring the solution for 2 hours, the pH was readjusted to 5.4 with acetic acid. DTT was then added to a final concentration of 5mM, and the solution was stirred for 10-16 hours at room temperature. The solution was diluted 1:20 into 8.5M urea containing lOmM Tris-HCl pH 8.6, and left at room

SUBSTITUTESHEET

temperature for 48 hours with occasional stirring. The 8.5M urea solution was diluted into cold refolding buffer (6- 10°C) by slow pumping and stirring, then incubated for 48 hours at 6-10°C. The volume of the solution was reduced by 75% by ultrafiltration on a 10K membrane, then dialyzed against 5-10mM L-Arginine pH 10.0. The solution was left at room temperature for 3-5 days, and the activity increase followed daily according to Ellman. The solution was then concentrated to 20L on a 10K membrane.

Purification

The pH of the concentrate resulting from the steps described above was adjusted to 8-8.2 and the concentrate was loaded onto DEAE equilibrated with 20mM Tris-HCl pH 8.0, 2mM EDTA. The DEAE was washed with the same buffer to reach a base line at 280 nm, and further washed with 20 mM Tris-HCl pH 8.0, containing 0.2M NaCl. Ser/r-met-AchE was eluted from the DEAE with 20mM Tris-HCl, pH 8.0, containing 0.4M NaCl. rhAChE was eluted from the DEAE with 20mM Tris-HCl pH 8.0, containing 0.4M NaCl. The eluant was concentrated/dialyzed on a 10K membrane with lOmM Tris-HCl pH 8.0, (or HEPES), 2.5mM EDTA, and applied to a MAC-Sepharose affinity column equilibrated with the above buffer. The column was washed with starting buffer, then with buffer containing 0.25M NaCl. rAChE was eluted with 0.2M L-Arginine pH 10.0, 2.5mM EDTA, then concentrated and dialyzed against 20mM HEPES, pH 8.0, 2.5mM EDTA, 50mM NaCl.

^S UBSTITUTESHE

-54-

Exa ple 7. Pharmacokinetics of Recombinant Ache

To determine the half-life of recombinant AChE in vivo. 80 and 1000 units of ser/r-met-AChE were injected i.v. into the tail vein of mice and rats respectively. At the time points indicated in Figure 14, blood samples were withdrawn from the animals; each time point represents three animals The plasma was diluted 1:10 in 20mM HEPES pH 8 containing 10'M iso-OMPA (tetraisopropylpyrophosphoramide) and incubated 10 minutes at room temperature. lOμl of the diluted plasma were assayed for AChE activity according to Ellman. The residual BuChE (butyrylcholinesterase) activity determined in serum of control animals (0.2 u/mL) was subtracted. The calculated half-life of rAChE in mice and rats was 39 and 33.6 minutes respectively.

-55-

Example 8: Uses of Recombinant Acetylcholinesterase

Recombinant acetylcholinesterase (r-met AChE or ser/r-met- AChE or similar polypeptides) produced as described in the previous Examples, may be used for many different purposes. Some of the potential uses are described below. The investigation of these uses of AChE has heretofore been limited or non-existent due to the limited availability of naturally occurring AChE.

A) ANTI-CHOLINERGIC USES

1. Prophylaxis and Treatment of Organophosphorous Intoxication

Organophosphorous Compounds (OP compounds) are highly toxic agents utilized as insecticides and war nerve gases. As insecticides, OP compounds comprise a significant portion of the $6 billion worldwide insecticide industry and have replaced organochlorine compounds as the predominant insecticidal agents (Bull, David, The Growing Problem: Pesticides and the Third World Poor, Oxford, U.K.,: OXFAM, 38-45 (1982)). Accidental worker-related OP poisoning accounts for a large number of the 500,000 to 1,000,000 annual pesticide-associated poisonings (Bull, David, The Growing Problem: Pesticides and the Third World Poor, Oxford, U.K.,: OXFAM, 38-45 (1982)). As nerve gases, OP compounds are the most important lethal agents currently available for military application (Kirk-Othmer Encyclopedia of CHEMICAL Technology, Wiley Corporation, Volume 5, (1984)) and have been used as recently as the Iran-Iraq War (Jane's NBC (Nuclear, Biological, Chemical) Protection Equipment, Forecast International, 1988-89) . Consequently, the market potential for both pre-exposure and post-exposure defense against organophosphorous compounds is quite significant.

-56-

The severe clinical complications resulting from organophosphorous intoxication are generally attributed to the OP's irreversible inhibition of AChE which occurs in two steps: 1) reversible phosphorylation or phosphonylation of the active site serine residue of AChE upon release of a leaving group from the OP compound 2) irreversible binding upon release of an alkyl group from the phosphorous moiety (Clement, J.G., Importance of aliesterase as a detoxification mechanism for soman in mice. Biochem. Pharmacol. 3_3: 3807-3811(1984); Aldridge, W.N., and Reiner, E. , Enzyme Inhibitors as Substrates, North Holland, Amsterdam (1972)) .

This second reaction is termed "aging" because it transforms the inhibited cholinesterase into a form that can no longer be reversed by the commonly used "reactivators," quaternary oximes such as pralidoxime mesylate which ordinarily dephosphorylate AChE. (Fortunately, aging only occurs after the administration of certain OP agents such as soman, one of the three OP war gases.) The inhibition of AChE leads to an accumulation of acetylcholine which causes convulsions and uncontrolled depolarization of cholinergic neurons

(Jane's NBC (Nuclear, Biological, Chemical) Protection

Equipment, Forecast International, 1988-89; United States Environmental Protection Agency, The Pesticide Fact

Handbook, Noyes Data Corporation, (1988)).

Conventional post-exposure therapy for OP poisoning has consisted of the intravenous or intramuscular administration of antidotal preparations containing a reactivator oxime to restore the function of phosphorylated but nonaged acetylcholinesterase and an antimuscarinic agent such as atropine, which blocks acetylcholine receptors. Pre- exposure treatment with carbamate compounds which temporarily sequester endangered cholinesterase has also been successful provided adequate post-exposure treatment is also given (Oxford Textbook of Medicine, Volume I, Oxford

-57-

University Press, (1987)).

a) Pre- and post- exposure treatment with acetylcho1inesterase.

In 1987, Wolfe et al. reported that AChE from fetal bovine serum (FBS) protected mice from subsequent multiple LD ₅₀ doses of OP nerve agents when followed by the post-exposure drugs atropine and an oxime (Wolfe, A.D., et al., Acetylcholinesterase Prophylaxis Against Organophosphate

Toxicity, Fundamental and Applied Toxicology <_.: 266-270

(1987)). In 1990, Ashani et al. reported that AChE from fetal bovine serum and human butyrylcholinesterase (BuChE) were prophylactically successful in mice against soman poisoning even without post-exposure therapy (Ashani, Y., et al. , Butyrylcholinesterase and Acetylcholinesterase Prophylaxis Against Soman Poisoning in Mice, Biochem. Pharmacol. ___L: No. 1, 37-41 (1991)). No human studies have been performed using AChE but purified BuChE from human serum has been shown to improve the symptoms of OP- intoxicated patients (Klose, R. , and Gustensohn, G., Treatment of Alkyl Phosphate Poisoning with Purified Serum Cholinesterase, Prakt. Anasth. _L_L: 1-7 (1976)).

The conventional therapy of antimuscarinics and oxi es has two significant drawbacks: 1) serious side effects are the norm rather than the exception and 2) oxime reactivation therapy is thwarted by the "aging" reaction. Acetylcholinesterase is preferable to current OP antidotes a) because it hydrolyzes acetylcholine directly and thus operates irrespective of the aging reaction, b) because it presents no apparent side effects, and c) because it eliminates the need for multiple drug therapy.

As a prophylactic in war, AChE could be administered to soldiers or civilians before an imminent OP attack. In cases of OP intoxication, AChE would replace the current atropine

-58-

injection provided to soldiers and civilians as an OP antidote. The efficacy of AChE as both a prophylactic and therapeutic agent against OP intoxication makes it a very likely replacement of current OP-intoxication therapy.

b) Exogenous defense against OP poisoning.

(i) . Detection: Acetylcholinesterase may be utilized in an enzyme-inhibition detection device for the presence of OP compounds on the battlefield (Goodman, A., and Martens, H. , Studies on the Use of Electric Eel Acetylcholinesterase for Anticholinesterase Agent Detection, Edgewood Arsenal Report No. Ed-TR-74096, Feb. 1975; Goodson, L.H. , Feasibility Studies on Enzyme System for Detector Kits, Edgewood Arsenal Report No. Ed-CR-77019, Dec. 1976; Levin, H.W. , and Erenrich, E.S., Enzyme Immobilization Alternatives for the Enzyme Alarm, Edgewood Arsenal Report No. Ed-CR-76005, Aug. 1975; Wolfe, A.D., et al., Acetylcholinesterase Prophylaxis Against Organophosphate Toxicity, Fundamental and Applied Toxicology 9: 266-270 (1987)). More research is needed as to whether this detection system is as effective as other detection devices which use a wide range of operational principles.

(ii) . Decontamination: External use of AChE on affected skin might be contemplated to neutralize the contaminating OP compounds. Heavy irrigation with soap and water is often insufficient and OP's can cause serious damage after subcutaneal penetration.

2. Relief of Post-Surgerv Apnea (European Patent Office Publication No. 388,906 assigned to Yissum Research Development Company of the Hebrew University of Jerusalem, published September 26, 1990)

Succinylcholine, which acts as a competitive analog of acetylcholine by binding with the same cholinergic receptors

-59-

of the motor end-plate, is often used as an adjunct to general anaesthesia as a skeletal muscle relaxant. Since succinylcholine is hydrolyzed by the cholinesterase BuChE, patients carrying abnormal variants of the BuChE enzyme often experience prolonged apnea following surgery as the succinylcholine continues to block ACh receptors (Thompson, J.C., and Whittaker, M. , Acta Genet. 16.: 206-215 (1966)). The current treatment of post-surgery prolonged apnea is with anticholmesterase drugs such as neostigmine or physostigmine which effectively increase the concentration of acetylcholine at the sites of cholinergic transmission, thus reversing the apnea. Acetylcholinesterase presents a possibly more effective mode of treatment because although it will temporarily lower acetylcholine concentration, it can directly hydrolyze the succinylcholine and thus more quickly restore normal respiratory activity.

3. Treatment of Gastrointestinal Disorders

Anticholinergic drugs are often utilized in the treatment of gastric and duodenal ulcers and irritable bowel syndrome (irritable colon, spastic colon and mucous colitis) . Oral administration of antimuscarinic agents and quaternary oximes blocks the action of acetylcholine and thus reverses the effects caused by oversecretion of gastric acid by the vagus nerve. Although no researcher has utilized AChE in anti-ulcer therapy, it is reasonable to speculate that AChE would be at least as effective (if not more so) than the antimuscarinic and oxime drugs because AChE interacts directly with acetylcholine rather than-indirectly blocking acetylcholine activity. Moreover, because human AChE is an authentic human protein, it is likely that under normal circumstances it would not induce toxic or immunologic complications as do the other anticholinergic drugs.

4. Antidote to Overdose of Acetylcholinesterase Drugs

-60-

Acetylcholinesterase drugs such as neostigmine and isofluorophate which block the effects of AChE and BuChE by competing with acetylcholine for attachment to the enzyme active sites, are utilized in the treatment of myasthenia gravis (a neuromuscular disease) and glaucoma. The current therapy for overdose or accidental misuse of these agents is atropine alone or atropine with an oxime (Jane's NBC (Nuclear, Biological, Chemical) Protection Equipment, Forecast International, 1988-89) . As mentioned above, because of the limitations and disadvantages of atropine/oxime therapy, it appears that administration of exogenous AChE would be preferable to these drugs in this context as well.

B) NON-CHOLINERG C USES

1. Treatment of Central Nervous System Disorders

Recent reports in the literature have suggested that a number of distinct isoenzymes of human acetylcholinesterase have non-cholinergic functions which may have important ramifications (Grelogical Action of Acetylcholinesterase Independent of its Catalytic Site, Exp. Brain Res. Jj_2: 123- 129 (1987); Greenfield, S.A. , and Smith, A.D., The Influence of Electrical Stimulation of Certain Brain Areas on the Concentration of Acetylcholinesterase in Rabbit Cerebrospinal Fluid, Brain Res. 177: 445-459 (1979) ; Greenfield, S.A., et al.. In Vivo Release of Acetylcholinesterase in Cat Substantia Nigra and Caudate Nucleus, Nature 284: 355-357) : l) that AChE may have neuromodulatory activity which prevents neuronal degeneration and consequently, 2) replacement of lost AChE in important AChE-containing systems in Alzheimer's patients may compensate for the loss of neurons (European Patent Office Publication No. 288,243, assigned to E.R. Squibb & Sons, published October 26, 1988).

-61-

2. N-Terminal Amino Acid Peptidase Activity of AChE

In September 1990, Small et al. reported that acetylcholinesterase could act as a zymogen precursor of a 25 kDa polypeptide that exhibited N-terminal aminopeptidase activity (Small, D.H., Trends in Biochemical Sciences, 15: 213-216) . The catalytic esteratic subunit of AChE is a 75 kDa polypeptide but it is tightly bound to this smaller subunit capable- of proteolytic activity. Researchers have debated whether the smaller subunit is a unique gene product or whether it is simply a fragment from the C-terminus of the AChE catalytic subunit. The recombinant AChE protein of the instant invention could be tested for aminopeptidase activity; if present, this might be an additional potential use of the recombinant protein.

C. DIAGNOSTIC USES OF AChE OR DNA SEQUENCES ENCODING FOR

AChE

1. Enzyme Immunoassay

Enzyme immunoassays using acetylcholinesterase have been utilized as simplified replacements of radioimmunoassays. Sensitivity and specificity have been shown to be comparable (Morel, A., Dar on, M. , amd Delaage, M., An Immunoenzymoassay for Histamine, Agents Actions, ____;: 291-293 (1990)) .

2. Diagnosis of Hemocvtopoietic Disorders (European Patent Office Publication No. 388,906 assigned to Yissum Research Development Company of the Hebrew University of Jerusalem, published September 26, 1990)

In addition to its presence in the membrane of mature erythrocytes, AChE is intensively produced in developing blood cells and its activity serves as an accepted marker for developing mouse megakaryocytes (European Patent Office

-62-

Publication No. 388,906 assigned to Yissum Research Development Company of the Hebrew University of Jerusalem, published September 26, 1990; Burstein, S.A., et al.. Journal Cell Physiol. 122: 159-165 (1985)). In addition, a number of other reports in the literature point to a strong correlation between abnormal megakaryocytopoiesis and certain leukemias and the human genes coding for the cholinesterases (Soreq, H., et al., Human Genet.22: 325-328 (1987); Bernstein, R. , et al.. Blood, j__>: 613-617 (1982); Turchini, M.F., et al.. Cancer Genet. Cytogenet. 2J): 1-4 (1986); Pintado, T. , et al.. Cancer 55: 535-541 (1985); Bishop, J.M., Science 235: 305-311 (1987)). DNA probes from human cholinesterase genes can be used to detect and identify defective genes which may be responsible for the aforementioned diseases.

3. Diagnosis of Progress-Snef i-wor Tissues (European Patent Office Publication No. 388,906 assigned to Yissum Research Development Company of the Hebrew University of Jerusalem, published September 26, 1990)

In 1990, Soreq and Zakut suggested that amplification of the human genes encoding the cholinesterases was responsible for the abnormally high level of expression of AChE and BuChE in tumor tissues including progressing ovarian carcinomas (European Patent Office Publication No. 388,906 assigned to Yissum Research Development Company of the Hebrew University of Jerusalem, published September 26, 1990) . Detection of altered cholinesterase genes by hybridization with the probes for cholinesterase genes can be a very valuable tool for diagnosis of tumor tissues.

4. Diagnosis of Altered ChE Genes by Immunoassay (European Patent Office Publication No. 388,906 assigned to Yissum Research Development Company of the Hebrew University of Jerusalem, published September 26, 1990)

-63-

In several neurological or genetic disorders such as Alzheimer's Disease or Down's Syndrome, modification in both the level (Spokes, E.G.S., Brain 103: 179-183 (1980)) and the composition of molecular forms of human brain acetylcholinesterase have been reported (Atack, J.R. , et al., Neurosci. Lett. 40: 199-204 (1983)). Detection of altered level of type of AChE may be achieved by radioimmunoassay using antibodies elicited against human AChE.

-64-

SEQUENCE LISTING (1) GENERAL INFORMATION:

(i) APPLICANT: Fischer, Meir

(ii) TITLE OF INVENTION: EXPRESSION OF ENZYMATICALLY ACTIVE RECOMBINANT HUMAN ACETYLCHOLINESTERASE AND USES THEREOF

(iii) NUMBER OF SEQUENCES: 2

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: John P. White, Esq.

(B) STREET: 30 Rockefeller Plaza

(C) CITY: New York

(D) STATE: New York

(E) COUNTRY: USA

(F) ZIP: 10112

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: Patentln Release #1.0, Version #1.25

(Vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION:

(Viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: White, John P.

(B) REGISTRATION NUMBER: 28,678

(C) REFERENCE/DOCKET NUMBER: 39304-B-PCT/JPW/EAB

(ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (212) 977-9550

(B) TELEFAX: (212) 664-0525

-65-

(C) TELEX: 422523 COOP Ul

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1845 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic)

(ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..1842

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

ATG AGG CCC CCG CAG TGT CTG CTG CAC ACG CCT TCC CTG GCT TCC CCA

48 Met Arg Pro Pro Gin Cys Leu Leu His Thr Pro Ser Leu Ala Ser Pro 1 5 10 15

CTC CTT CTC CTC CTC CTC TGG CTC CTG GGT GGA GGA GTG GGG GCT GAG

96 Leu Leu Leu Leu Leu Leu Trp Leu Leu Gly Gly Gly Val Gly Ala Glu 20 25 30

GGC CGG GAG GAT GCA GAG CTG CTG GTG ACG GTG CGT GGG GGC CGG CTG

144 Gly Arg Glu Asp Ala Glu Leu Leu Val Thr Val Arg Gly Gly Arg Leu 35 40 45

CGG GGC ATT CGC CTG AAG ACC CCC GGG GGC CCT GTC TCT GCT TTC CTG

192 Arg Gly He Arg Leu Lys Thr Pro Gly Gly Pro Val Ser Ala Phe Leu 50 55 60

GGC ATC CCC TTT GCG GAG CCA CCC ATG GGA CCC CGT CGC TTT CTG CCA

240 Gly He Pro Phe Ala Glu Pro Pro Met Gly Pro Arg Arg Phe Leu Pro 65 70 75 80

-66-

CCG GAG CCC AAG CAG CCT TGG TCA GGG GTG GTA GAC GCT ACA ACC TTC

288 Pro Glu Pro Lys Gin Pro Trp Ser Gly Val Val Asp Ala Thr Thr Phe 85 90 95

CAG AGT GTC TGC TAC CAA TAT GTG GAC ACC CTA TAC CCA GGT TTT GAG

336 Gin Ser Val Cys Tyr Gin Tyr Val Asp Thr Leu Tyr Pro Gly Phe Glu 100 105 110

GGC ACC GAG ATG TGG AAC CCC AAC CGT GAG CTG AGC GAG GAC TGC CTG

384 Gly Thr Glu Met Trp Asn Pro Asn Arg Glu Leu Ser Glu Asp Cys Leu 115 120 125

TAC CTC AAC GTG TGG ACA CCA TAC CCC CGG CCT ACA TCC CCC ACC CCT

432 Tyr Leu Asn Val Trp Thr Pro Tyr Pro Arg Pro Thr Ser Pro Thr Pro 130 135 140

GTC CTC GTC TGG ATC TAT GGG GGT GGC TTC TAC AGT GGG GCC TCC TCC

480 Val Leu Val Trp He Tyr Gly Gly Gly Phe Tyr Ser Gly Ala Ser Ser 145 150 155 160

TTG GAC GTG TAC GAT GGC CGC TTC TTG GTA CAG GCC GAG AGG ACT GTG

528 Leu Asp Val Tyr Asp Gly Arg Phe Leu Val Gin Ala Glu Arg Thr Val 165 170 175

CTG GTG TCC ATG AAC TAC CGG GTG GGA GCC TTT GGC TTC CTG GCC CTG

576 Leu Val Ser Met Asn Tyr Arg Val Gly Ala Phe Gly Phe Leu Ala Leu 180 185 190

CCG GGG AGC CGA GAG GCC CCG GGC AAT GTG GGT CTC CTG GAT CAG AGG

624 Pro Gly Ser Arg Glu Ala Pro Gly Asn Val Gly Leu Leu Asp Gin Arg 195 200 205

CTG GCC CTG CAG TGG GTG CAG GAG AAC GTG GCA GCC TTC GGG GGT GAC

672 Leu Ala Leu Gin Trp Val Gin Glu Asn Val Ala Ala Phe Gly Gly Asp 210 215 220

CCG ACA TCA GTG ACG CTG TTT GGG GAG AGC GCG GGA GCC GCC TCG GTG

720 Pro Thr Ser Val Thr Leu Phe Gly Glu Ser Ala Gly Ala Ala Ser Val 225 230 235 240

GGC ATG CAC CTG CTG TCC CCG CCC AGC CGG GGC CTG TTC CAC AGG GCC

768 Gly Met His Leu Leu Ser Pro Pro Ser Arg Gly Leu Phe His Arg Ala 245 250 255

-67-

GTG CTG CAG AGC GGT GCC CCC AAT GGA CCC TGG GCC ACG GTG GGC ATG

816 Val Leu Gin Ser Gly Ala Pro Asn Gly Pro Trp Ala Thr Val Gly Met 260 265 270

GGA GAG GCC CGT CGC AGG GCC ACG CAG CTG GCC CAC CTT GTG GGC TGT

864 Gly Glu Ala Arg Arg Arg Ala Thr Gin Leu Ala His Leu Val Gly Cys 275 280 285

CCT CCA GGC GGC ACT GGT GGG AAT GAC ACA GAG CTG GTA GCC TGC CTT

912 Pro Pro Gly Gly Thr Gly. Gly Asn Asp Thr Glu Leu Val Ala Cys Leu 290 295 300

CGG ACA CGA CCA GCG CAG GTC CTG GTG AAC CAC GAA TGG CAC GTG CTG

960 Arg Thr Arg Pro Ala Gin Val Leu Val Asn His Glu Trp His Val Leu 305 310 315 320

CCT CAA GAA AGC GTC TTC CGG TTC TCC TTC GTG CCT GTG GTA GAT GGA

1008 Pro Gin Glu Ser Val Phe Arg Phe Ser Phe Val Pro Val Val Asp Gly

325 330 335

GAC TTC CTC AGT GAC ACC CCA GAG GCC CTC ATC AAC GCG GGA GAC TTC

1056 Asp Phe Leu Ser Asp Thr Pro Glu Ala Leu He Asn Ala Gly Asp Phe 340 345 350

CAC GGC CTG CAG GTG CTG GTG GGT GTG GTG AAG GAT GAG GGC TCG TAT

1104 His Gly Leu Gin Val Leu Val Gly Val Val Lys Asp Glu Gly Ser Tyr 355 360 365

TTT CTG GTT TAC GGG GCC CCA GGC TTC AGC AAA GAC AAC GAG TCT CTC

1152 Phe Leu Val Tyr Gly Ala Pro Gly Phe Ser Lys Asp Asn Glu Ser Leu 370 375 380

ATC AGC CGG GCC GAG TTC CTG GCC GGG GTG CGG GTC GGG GTT CCC CAG

1200 He Ser Arg Ala Glu Phe Leu Ala Gly Val Arg Val Gly Val Pro Gin 385 390 395 400

GTA AGT GAC CTG GCA GCC GAG GCT GTG GTC CTG CAT TAC ACA GAC TGG

1248 Val Ser Asp Leu Ala Ala Glu Ala Val Val Leu His Tyr Thr Asp Trp

405 410 415

CTG CAT CCC GAG GAC CCG GCA CGC CTG AGG GAG GCC CTG AGC GAT GTG

1296 Leu His Pro Glu Asp Pro Ala Arg Leu Arg Glu Ala Leu Ser Asp Val 420 425 430

-68-

GTG GGC GAC CAC AAT GTC GTG TGC CCC GTG GCC CAG CTG GCT GGG CGA

1344 Val Gly Asp His Asn Val Val Cys Pro Val Ala Gin Leu Ala Gly Arg 435 440 445

CTG GCT GCC CAG GGT GCC CGG GTC TAC GCC TAC GTC TTT GAA CAC CGT

1392 Leu Ala Ala Gin Gly Ala Arg Val Tyr Ala Tyr Val Phe Glu His Arg 450 455 460

GCT TCC ACG CTC TCC TGG CCC CTG TGG ATG GGG GTG CCC CAC GGC TAC

1440 Ala Ser Thr Leu Ser Trp Pro Leu Trp Met Gly Val Pro His Gly Tyr 465 470 475 480

GAG ATC GAG TTC ATC TTT GGG ATC CCC CTG GAC CCC TCT CGA AAC TAC

1488 Glu He Glu Phe He Phe Gly He Pro Leu Asp Pro Ser Arg Asn Tyr

485 490 495

ACG GCA GAG GAG AAA ATC TTC GCC CAG CGA CTG ATG CGA TAC TGG GCC

1536 Thr Ala Glu Glu Lys He Phe Ala Gin Arg Leu Met Arg Tyr Trp Ala 500 505 510

AAC TTT GCC CGC ACA GGG GAT CCC AAT GAG CCC CGA GAC CCC AAG GCC

1584 Asn Phe Ala Arg Thr Gly Asp Pro Asn Glu Pro Arg Asp Pro Lys Ala 515 520 525

CCA CAA TGG CCC CCG TAC ACG GCG GGG GCT CAG CAG TAC GTT AGT CTG

1632 Pro Gin Trp Pro Pro Tyr Thr Ala Gly Ala Gin Gin Tyr Val Ser Leu 530 535 540

GAC CTG CGG CCG CTG GAG GTG CGG CGG GGG CTG CGC GCC CAG GCC TGC

1680 Asp Leu Arg Pro Leu Glu Val Arg Arg Gly Leu Arg Ala Gin Ala Cys 545 550 555 560

GCC TTC TGG AAC CGC TTC CTC CCC AAA TTG CTC AGC GCC ACC GAC ACG

1728 Ala Phe Trp Asn Arg Phe Leu Pro Lys Leu Leu Ser Ala Thr Asp Thr

565 570 575

CTC GAC GAG GCG GAG CGC CAG TGG AAG GCC GAG TTC CAC CGC TGG AGC

1776 Leu Asp Glu Ala Glu Arg Gin Trp Lys Ala Glu Phe His Arg Trp Ser 580 585 590

TCC TAC ATG GTG CAC TGG AAG AAC CAG TTC GAC CAC TAC AGC AAG CAG

1824 Ser Tyr Met Val His Trp Lys Asn Gin Phe Asp His Tyr Ser Lys Gin 595 600 605

-69-

GAT CGC TGC TCA GAC CTG TGA

1845 Asp Arg Cys Ser Asp Leu 610

-70-

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 614 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Met Arg Pro Pro Gin Cys Leu Leu His Thr Pro Ser Leu Ala Ser Pro 1 5 10 15

Leu Leu Leu Leu Leu Leu Trp Leu Leu Gly Gly Gly Val Gly Ala Glu 20 25 30

Gly Arg Glu Asp Ala Glu Leu Leu Val Thr Val Arg Gly Gly Arg Leu 35 40 45

Arg Gly He Arg Leu Lys Thr Pro Gly Gly Pro Val Ser Ala Phe Leu 50 55 60

Gly He Pro Phe Ala Glu Pro Pro Met Gly Pro Arg Arg Phe Leu Pro 65 70 75 80

Pro Glu Pro Lys Gin Pro Trp Ser Gly Val Val Asp Ala Thr Thr Phe

85 90 95

Gin Ser Val Cys Tyr Gin Tyr Val Asp Thr Leu Tyr Pro Gly Phe Glu 100 105 110

Gly Thr Glu Met Trp Asn Pro Asn Arg Glu Leu Ser Glu Asp Cys Leu 115 120 125

Tyr Leu Asn Val Trp Thr Pro Tyr Pro Arg Pro Thr Ser Pro Thr Pro 130 135 140

Val Leu Val Trp He Tyr Gly Gly Gly Phe Tyr Ser Gly Ala Ser Ser 145 150 155 160

Leu Asp Val Tyr Asp Gly Arg Phe Leu Val Gin Ala Glu Arg Thr Val

165 170 175

Leu Val Ser Met Asn Tyr Arg Val Gly Ala Phe Gly Phe Leu Ala Leu 180 185 190

Pro Gly Ser Arg Glu Ala Pro Gly Asn Val Gly Leu Leu Asp Gin Arg 195 200 205

-71-

Leu Ala Leu Gin Trp Val Gin Glu Asn Val Ala Ala Phe Gly Gly Asp 210 215 220

Pro Thr Ser Val Thr Leu Phe Gly Glu Ser Ala Gly Ala Ala Ser Val 225 230 235 240

Gly Met His Leu Leu Ser Pro Pro Ser Arg Gly Leu Phe His Arg Ala

245 250 255

Val Leu Gin Ser Gly Ala Pro Asn Gly Pro Trp Ala Thr Val Gly Met 260 265 270

Gly Glu Ala Arg Arg Arg Ala Thr Gin Leu Ala His Leu Val Gly Cys 275 280 285

Pro Pro Gly Gly Thr Gly Gly Asn Asp Thr Glu Leu Val Ala Cys Leu 290 295 300

Arg Thr Arg Pro Ala Gin Val Leu Val Asn His Glu Trp His Val Leu 305 310 315 320

Pro Gin Glu Ser Val Phe Arg Phe Ser Phe Val Pro Val Val Asp Gly

325 330 335

Asp Phe Leu Ser Asp Thr Pro Glu Ala Leu He Asn Ala Gly Asp Phe 340 345 350

His Gly Leu Gin Val Leu Val Gly Val Val Lys Asp Glu Gly Ser Tyr 355 360 365

Phe Leu Val Tyr Gly Ala Pro Gly Phe Ser Lys Asp Asn Glu Ser Leu 370 375 380

He Ser Arg Ala Glu Phe Leu Ala Gly Val Arg Val Gly Val Pro Gin 385 390 395 400

Val Ser Asp Leu Ala Ala Glu Ala Val Val Leu His Tyr Thr Asp Trp

405 410 415

Leu His Pro Glu Asp Pro Ala Arg Leu Arg Glu Ala Leu Ser Asp Val 420 425 430

Val Gly Asp His Asn Val Val Cys Pro Val Ala Gin Leu Ala Gly Arg 435 440 445

Leu Ala Ala Gin Gly Ala Arg Val Tyr Ala Tyr Val Phe Glu His Arg 450 455 460

Ala Ser Thr Leu Ser Trp Pro Leu Trp Met Gly Val Pro His Gly Tyr 465 470 475 480

Glu He Glu Phe He Phe Gly He Pro Leu Asp Pro Ser Arg Asn Tyr

485 490 495

-72-