CATELLO, Sergio (Località la Fagianeria, Piana Di Monte Verna, I-81015, IT)
ESPOSITO, Adelaide (Località la Fagianeria, Piana Di Monte Verna, I-81015, IT)
RIVIECCIO, Vincenzo (Località la Fagianeria, Piana Di Monte Verna, I-81015, IT)
SASSANO, Marica (Località la Fagianeria, Piana Di Monte Verna, I-81015, IT)
CATELLO, Sergio (Località la Fagianeria, Piana Di Monte Verna, I-81015, IT)
ESPOSITO, Adelaide (Località la Fagianeria, Piana Di Monte Verna, I-81015, IT)
RIVIECCIO, Vincenzo (Località la Fagianeria, Piana Di Monte Verna, I-81015, IT)
CLAIMS
1-An eukaryotic expression vector comprising a nucleotide sequence encoding for the human long pentraxin PTX3 protein under the control of an effective promoter and a nucleotide sequence encoding for a selectable marker.
2-The vector according to claim 1 wherein the nucleotide sequence encoding for the human long pentraxin PTX3 protein has essentially the sequence from nt. 100 to nt. 1245 of SEQ ID 1.
3-The vector according to claim 2 having essentially the sequence of SEQ ID 1.
4-Use of the vector according to any of claims 1 to 3 for transforming a human cell.
5-Use of the vector according to claim 4 wherein the vector is linearized.
6-A recombinant human cell able to provide expression of proteins encoded by the vector according to any of claims 1 to 3.
7-The recombinant human cell according to claim 6 being the recombinant HEK293F cell line.
8-The recombinant human cell according to claim 7 being the recombinant HEK293F derived clone 2Fl 2 deposited according to the Budapest treaty under number 08011001.
9-Use of the recombinant human cell according to claim 6 o 8 for the production of human long pentraxin PTX3 protein.
10-A method for the production of the human long pentraxin PTX3 protein comprising: a) growing a recombinant human cell expressing a recombinant human long pentraxin PTX3 protein; b) purifying the human long pentraxin PTX3 protein from the culture medium of the recombinant human cell.
11 -The method according to claim 10 wherein the recombinant human cell expressing a recombinant human long pentraxin PTX3 protein is a recombinant HEK293F cell line. 12-The method according to claim 11 wherein the recombinant HEK293F cell line expressing a recombinant human long pentraxin PTX3 is the recombinant HEK293F derived clone 2Fl 2 deposited according to the Budapest treaty under number 08011001.
13 -The method of claims 10 to 12 wherein the purification step includes at least one of the following step: anionic-exchange chromatography, hydroxyapatite chromatography or size exclusion chromatography. |
Expression system and uses thereof for the production of human long pentraxin 3
FIELD OF THE INVENTION
The present invention relates to human derived cellular system able to express the human pentraxin 3 (hPTX3), methods and material used.
BACKGROUND TO THE INVENTION
PTX3 (GeneBank Accession Number BD 131701) is a multimeric glycoprotein composed of eight subunits linked by disulphide bridges. The protein is produced by different cellular types and by cells of innate immunity, following induction by inflammatory cytokine such as IL-I , TNFα, IL-IO.
A CHO (Chinese Hamster Ovary) cell line producing recombinant human PTX3 (hPTX3) has been described (Bottazzi B. et al. "Multimer formation and ligand recognition by the long pentraxin PTX3" J. Biol. Chem. 272:32817, 1997 and WO 99/32516 "Pharmaceutical compositions containing the long pentraxin PTX3"). The cell line CHO3.5 is derived upon a co- transfection with the plasmid pSG5, containing the cDNA of hPTX3, and the plasmid pSV2, carrying neomycin resistance to select stable transformants. It is characterized by elevated productivity levels (Rivieccio V. et al. "High level expression and efficient purification of recombinant human long pentraxin PTX3 in Chinese hamster ovary cells" Protein. Expr. Purif. 2007, Jan 51 ,1).
However, although CHO cell line is widely used to express recombinant protein, it has been found that it produces also endogenous PTX3, therefore leading to the production of both non- human and human PTX3 proteins. Moreover, due to the oligomeric structure of PTX3, another critical point to be avoided is the potential formation of a chimeric PTX3 as a mixture of human and hamster monomers, especially considering the high identity percentage between mouse and human PTX3 aminoacidic sequences (82%).
SUMMARY OF THE INVENTION
To overcome the above mentioned problems, a clone of human origin expressing human PTX3 was obtained using an experimental strategy, including the following steps: a) construction of a new plasmid expression cassettes carrying the human PTX3 and a neomycin resistance; b) transfection of a human cell line able to grow in suspension and in a protein/serum free medium such as the Human Embryonic Kidney HEK293F;
c) verifying the identity of the expressed recombinant proteins; d) biochemical characterization of the new recombinant hPTX3.
DESCRIPTION OF THE INVENTION It is an object of the invention an eukaryotic expression vector comprising a nucleotide sequence encoding for the human long pentraxin PTX3 protein under the control of an effective promoter and a nucleotide sequence encoding for a selectable marker.
Preferably the nucleotide sequence encoding for the human long pentraxin PTX3 protein has essentially the sequence from nt. 100 to nt. 1245 of SEQ ID 1. More preferably the vector has essentially the sequence of SEQ ID 1.
It is an object of the invention the use of the vector of the invention for transforming a human cell. Preferably the vector is linearized.
It is a further object of the invention a recombinant human cell able to provide expression of proteins encoded by the vector of the invention. Preferably the recombinant human cell is the recombinant HEK293F cell line. More preferably it is the recombinant HEK293F derived clone
2Fl 2 deposited according to the Budapest treaty under number 08011001.
It is another object of the invention the use of the recombinant human cell of the invention for the production of human long pentraxin PTX3 protein.
It is a further object of the invention a method for the production of the human long pentraxin PTX3 protein comprising: a) growing a recombinant human cell expressing a recombinant human long pentraxin PTX3 protein; b) purifying the human long pentraxin PTX3 protein from the culture medium of the recombinant human cell. Preferably the recombinant human cell expressing a recombinant human long pentraxin PTX3 protein is a recombinant HEK293F cell line. More preferably it is the recombinant HEK293F derived clone 2Fl 2 deposited according to the Budapest treaty under number 08011001. Even more preferably the purification step includes at least one of the following step: anionic- exchange chromatography, hydroxyapatite chromatography or size exclusion chromatography. The invention will be now illustrated by means of non limiting examples, referring in particular to the following figures:
Figure 1: pSCl-hPTX3 map and main features.
Figure 2: Comparison of growth and productivity in Spinner Flask among clones selected. Figure 3: endogenous PTX3 production in HEK293F stimulated with IL-lβ or LPS.
Figure 4: characterization by SDS-PAGE gradient 4-15%, Native PAGE and Size Exclusion
Chromatography of recombinant human PTX3 purified from 2F12 clone compared to recombinant human PTX3 purified from a CHO clone.
Figure 5: hPTX3/293 and hPTX3/CHO CIq binding capability.
EXAMPLES
Example 1
Construction of the Plasmid pSCl-PTX3
1. Construction of pSG/Ub 1.1 Preparation of the Human Ubiquitin C Promoter sequence
The human ubiquitin C promoter is taken from pUB/Bsd plasmid (Invtrogen, Cat. n. V512-20), by amplification with PCR. As part of the cloning strategy, recognition sequences for restriction endonucleases are introduced at both ends. A BsaAI site is built in the upstream amplification primer and an EcoRI site in the downstream primer. The amplified region corresponds to nucleotides 1941 to 3161 in the sequence of pUB/Bsd.
The oligonucleotides are designed as follow:
5'p UbC: length: 26mer (SEQ ID 2)
ATATCACGTG ATC TGG CCT CCG CGC C
3'p UbC: length: 23mer (SEQ ID 3) GGAATTC GGT CCG GTC TAA CAA A
The protocol for amplification is the following: 1 ng/μl of plasmid DNA, 2mM MgC12, 0,2 mM dNTPs, 40OnM of each primer, IX supplied buffer and 0,04 u/ml of Taq DNA polymerase
(Sigma Genosys); temperature profile: 3 min 94°C, 30 times (30 sec. 94°C, 30 sec. 46°C, 2 min
72 0 C), 5 min 72°C, cooling at 4 0 C until further use. The amplification product (1238 bp) is purified by silica membrane spin column ( NucleoSpin,
Machery-Nagel GmbH & Co.), ligated in pGEM-T-Easy vector (Promega Cat. n. A1360) and transformed into E.coli host strain HB2151 (Pharmacia Biotech). Transformants are selected by growth on LB medium supplemented with 50 mg/1 ampicillin
Plasmids DNA, isolated from ampicillin resistant colonies, are checked by restriction analysis with Stul plus Sad enzymes (expected ~ 3650 and 600 bp fragments)
Plasmids showing the correct restriction pattern are further checked by sequence analysis of the entire insert and subsequently digested with EcoRI (Sigma-Genosys) and BsaAI (New England
Bio labs) restriction enzymes.
Human Ubiquitin C promoter is purified via agarose gel separation and elution on silica membrane spin column.
1.2 Preparation of the vector fragment pSG5 Plasmid pSG5 (4076 bp, Stratagene) was cut with the restriction enzymes EcoRI (Sigma- Genosys) and BsaAI (New England Biolabs); the resulting fragments are 1432 and 2644 bp long. The 2644 bp fragment, containing the backbone of pSG5, was prepared and purified via agarose gel electrophoresis plus silica membrane spin column.
1.3 Preparation of pSG/Ub
DNA fragments prepared in steps 1.1 and 1.2 were ligated using T4 DNA ligase (Promega) and transformed in HB2151 E. coli cells. Transformants were selected by growth on LB medium supplemented with 50 mg/1 ampicillin.
Plasmid DNA, isolated from ampicillin resistant colonies, was checked by restriction analysis with EcoRI plus SacII enzymes (expected: 2670 and 1192 bp fragments). A plasmid DNA, with the expected restriction pattern, was designed as pSG/Ub.
2. Construction of pSCl
2.1 Preparation of the Neomycin Resistance Cassette (NeoR) The Neomycin Resistance Cassette (NeoR) was taken from pcDNA3 plasmid (5446 bp, Invitrogen), amplifying it by PCR. As part of the cloning strategy, recognition sequences for restriction endonuclease AfIIII were introduced at both ends. The amplified region corresponds to nucleotides 1788 to 3252 in the sequence of pcDNA3 and includes the SV40 promoter and origin of replication, the neomycin resistance ORF, and the SV40 poliA signal. The oligonucleotides are designed as follows: 5'NeoR (SEQ ID 4)
ATATACATG TCC CCA GGC AGG CAG AA 3'NeoR(SEQID5) ATATACAT GTAT ACA GAC ATG ATAAG Protocol for amplification was the following: 1 ng/μl of plasmid DNA, 2mM MgC12, 0,2 mM dNTPs, 40OnM of each primer, IX supplied buffer and 0,04 u/μl of Taq DNA polymerase (Sigma Genosys); temperature profile: 3 min 94°C, 30 times (30 sec. 94°C, 30 sec. 46°C, 2 min 72 0 C), 5 min 72 0 C, cooling at 4 0 C until further use.
The amplification product (1484 bp) was purified by silica membrane spin column, ligated in pGEM-T-Easy vector (Promega Cat. n. A1360) and transformed into E.coli host strain HB2151. Transformants are selected by growth on LB medium, supplemented with 50 mg/1 ampicillin Plasmids DNA, isolated from ampicillin resistant colonies, are checked by restriction analysis with Smal plus Sad enzymes (expected ~ 1200 and 3300 bp fragments).
Plasmids showing the correct restriction pattern were further checked by sequence analysis of the entire insert and subsequently digested with AfIIII (New England Biolabs) restriction enzymes. NeoR cassette (1471 bp) was purified via agarose gel separation and elution on silica membrane spin column.
2.2 Preparation of the vector fragment pSG/Ub
Plasmid pSG/Ub, prepared in step 1.3, was linearized by AfIIII digestion and purified on silica membrane spin column.
2.3 Preparation of pSCl
DNA fragments prepared as in steps 2.1 and 2.2 were ligated using T4 DNA ligase (Promega) and transformed in JM109 E. coli strain (New England Biolabs). Transformants were selected by growth on LB medium, supplemented with 50 mg/1 ampicillin. Antibiotic resistant colonies were preliminarliy analyzed by PCR amplification with 5 'NeoR and 3 'NeoR oligonucleotides, as previously described, and subsequently, purified plasmids were checked by restriction analysis. For this purpose, Smal (position 602, inside NeoR sequence) and SacII (position 4142, inside UbC sequence) enzymes were used. A plasmid DNA, with the expected restriction pattern (3540 and 1793 bp fragments), was designed as pSCl .
3. Construction of pSC 1 -PTX3
3.1 Preparation of the hPTX3 coding sequence
The hPTX3 (GeneBank Accession Number BD 131701) sequence was taken from pSG5-PTX3 (WO 99/32516 "Pharmaceutical compositions containing the long pentraxin PTX3 ) by BamHI (Roche Applied Science) digestion. Human PTX3 fragment (1463 bp) was purified by agarose gel electrophoresis and silica membrane spin column.
3.2 Preparation of the vector fragment pSCl
The pSCl vector was linearized by BamHI digestion and purified on silica membrane spin column.
3.3 Construction and verification on pSCl-PTX3
DNA fragments prepared in steps 3.2 and 3.3 were ligated using T4 DNA ligase (Roche Applied
Science) and transformed in JM 109 E. coli strain. Transformants were selected by growth on LB medium, supplemented with 50 mg/1 ampicillin and preliminarily screened by PCR with two oligonucleotides complementary to PTX3 sequence.
The oligonucleotides sequences are:
5'PTX (SEQ ID 6)
GTGAGAACTCGGATGATTATGAT 3'PTX (SEQ ID 7)
TGAAACATACTGAGCTCCTCCAT
In a final volume of 10 μl, reagents for amplification were: 1 μl of boiled colony (1 colony in
50ml of water), 2mM MgC12, 0,2 mM dNTPs, 32OnM of each primer, 0,06% Formamide, IX supplied buffer and 0,08 u/μl of Taq DNA polymerase (Sigma Genosys); temperature profile: 3 min 96°C, 30 times (30 sec. 94°C, 30 sec. 58°C, 2 min 72°C), 5 min 72°C, cooling at 4°C until further use.
Plasmid purified from colonies positive to PCR screening, were digested with Sail restriction enzyme (Roche Applied Science) to check the orientation of hPTX3 insert. A plasmid with the expected restriction pattern (6619 and 177 bp) was sequenced in the regions coding for UbC promoter, NeoR cassette and hPTX3 and identified as pSCl-PTX3.
The new plasmid (pSCl-PTX3) was then constructed with PTX3 cDNA sequence located under ubiquitin promoter control and neomycin resistance gene under SV40 promoter control; all other features and plasmid map are represented in figure 1.
The complete sequence of pSCl-PTX3 is as follows (SEQ ID 1). The pSCl-hPTX3 sequence is represented starting from the first EcoRI site (figure 1). The sequence deriving from pSG5 containing PTX3 cDNA is underlined. The starting codon (ATG) and termination codon are in bold.
AATTCGGATCCCCCGGGCTGCAGGAATTCCGGCTCAAACTCAGCTCACTTGAGAGTC TCCTCCCGCCAGCTGTGGAA
3AGACCGGA ^GGAGCTCA 2CAGTTGGG AAGGTCTGAAAACTCAGTGCATAATAGGAACACTTGAGACTAATGAAAGAGAGAGTTGAG ACCAATCTTTATTTGTA
CCCGGGGATCCAGATCTTATTAAAGCAGAACTTGTTTATTGCAGCTTATAATGGTTA CAAATAAAGCAATAGCATCA
ATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAA
GAACATGTCCCCAGGCA
ATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACA AGATGGATTGCACGCAGGTT
TCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCT GGACGAAGAGCATCAGGGGC
ACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTAT AAAGATACCAGGCGTTTCCC
AGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATAC CGCGCCACATAGCAGAACTT
CTAGGGCACTGGTTTTCTTTCCAGAGAGCGGAACAGGCGAGGAAAAGTAGTCCCTTC TCGGCGATTCTGCGGAGGGA
TTTCGTGGCCGCCGGGCCGCTCGGTGGGACGGAAGCGTGTGGAGAGACCGCCAAGGGCTG
TAGTCTGGGTCCGCGAG
TTGGGAGCGCGCGCCCTCGTCGTGTCGTGACGTCACCCGTTCTGTTGGCTTATAATG CAGGGTGGGGCCACCTGCCG GCCGGACCTCTGGTGAGGGGAGGGATAAGTGAGGCGTCAGTTTCTTTGGTCGGTTTTATG TACCTATCTTCTTAAGT
TTTTTTGTTAGACCGGACCG -6796
Example 2
A human cell line (HEK293F) has been chosen for its ability to grow in suspension and in a serum and protein free medium (Florian M Wurm "Production of recombinant protein therapeutics in cultivated mammalian cells" Nature Biotechnology 22(11): 1393-1398, 2004, Yan SC et al. "Characterization and novel purification of recombinant human protein C from three mammalian cell lines" Biotechnology (N.Y.) 1990 JuI 8 (7): 655-61. "Use of cell lines for the production of influenza virus vaccines: an appraisal of technical, manufacturing, and regulatory considerations" Initiative for Vaccine Research, World Health Organization, Geneva, Switzerland (10 Aprile 2007). At the same time, the capability of HEK293F cell line to produce, under IL-lβ or LPS stimulation, endogenous PTX3, was evaluated (Figure 3). Then the cell line was selected as trasnfection recipient. To transfect HEK293F, pSCl-PTX3 plasmid was used either in a linear (Pvul digested) or in a circular form. The best transfection yield was obtained with linearized plasmid; clones selection was done on a productivity base and growth capability. After several rounds of subcloning the 2F12 clone was selected (Figure 2). Moreover PTX3 cDNA from HEK293F was cloned and sequenced, showing a complete identity with hPTX3 cDNA cloned in pSCl-PTX3. Recombinant hPTX3 was purified from HEK293/PTX3 cellular clone (2Fl 2) using a combination of anionic-exchange, hydroxyapatite and size exclusion chromatographies, with a yield of about 60%. Purified hPTX3 was characterized by SDS-PAGE, native PAGE, Size Exclusion Chromatography (Figure 4) and CIq binding (Figure 5) and compared with hPTX3 from CHO 3.5. The expression of recombinant hPTX3 is very effectively induced in 2F12 clone. The human clone 2F12, expressing hPTX3, has been deposited at ECACC (European Collection of Cell Cultures, Health Protection Agency, Porton Down, Wiltshire SP4 OJG, UK) on January
10, 2008, pursuant to Budapest Treaty condition under deposit number 08011001. The experimental details are described below. Recombinant 293F-cells generated from pSCl-PTX3
1. Transfection and subcloning 10 6 cells/ml 293F (Invitrogen cat n° R790-07) were seeded in a 125 ml spinner flask in a final Freestyle medium volume of 28 ml the day of transfection. The pSCl/PTX3 plasmid was then allowed to adsorb to the 293fectin reagent (GIBCO/Invitrogen) according to the manufacturer's protocol. In brief, in two separate tube, 30 μg of pSCl-PTX3 circular or Pvul linearized were diluted in 1 ml of Optimem (GIBCO/Invitrogen, Carlsbad, CA, USA) and 40 μl of 293fectin (Invitrogen) diluted to 1 ml with Optimem. Both solution were incubated for 5 minutes at room temperature then mixed (final volume 2 ml) and incubated for 30 minutes in the same conditions. DNA/lipid cocktail was added to cells and incubated at 37°C, 5% CO2 with agitation (120 rpm). After cultivation for 36 hours, the medium was changed into selection medium (200 ml Freestyle medium+ 500 μg/ml of G418) and the transfected cells were plated in ten 96wells plates, 200μl/well. After 15 days highest producers cell-pools were determined by ELISA and amplified in 24wells, όwells and T25flask.
Recombinant cell-pools obtained were subcloned with 1 cells per well in 96wells plates, in 50% fresh medium and 50% conditioned medium.
1.2 ELISA detection of recombinant hPTX3
Purified PTX3 or PTX3 secreted in the culture supernatant were titrated using a sandwich ELISA. To detect PTX3, 96-well Nunc Maxisorb microtiter plates (Nunc, Roskilde, Denmark) were coated overnight, at 4°C, with 700 ng/ml of the rat monoclonal antibody MNB4 anti-human PTX3 (Alexis™ Biochemicals, Lausen, Switzerland) in 15mM sodium carbonate buffer, pH 9.6. Wells were washed with PBS plus 0.05% Tween-20 (PBS-Tw, washing solution) and blocked with 300μl of PBS-Tw containing 5% dry milk, for 2 hours at room temperature. Cell supernatants or purified recombinant human PTX3 were added to the wells, diluted in washing solution plus 1% BSA. A standard curve, made with purified recombinant human PTX3 from CHO cells, ranging from 0 to 100 ng/ml, was done for quantification. After 1 hour of incubation at 37 0 C, bound PTX3 was detected using biotin-conjugated polyclonal rabbit anti- PTX3 antibody, followed by incubation with streptavidin conjugated to horseradish peroxidase (Sigma-Aldrich, USA). Finally 2.2'-azino-bis 3-ethylbenxthiazoline-6-sulfonic acid (Sigma
Chemical Co. USA) was added for color development and optical density at 405 nm was assessed using a Microplate Reader Model 3550 EIA (Bio-Rad, Hercules, CA, USA).
Example 3 Comparison of the recombinant clones selected
After several rounds of subcloning at 0.3 cells/well, the capability to grow and to produce recombinant hPTX3 was confirmed. The best performers were compared in a Spinner Flasks system.
Cells from 4 selected clones were seeded at a density of 600.000 cells/ml (viability >90%) in a 500 ml of FreeStyle 293 medium in Spinner flasks. The growing, the viability and the productivity were monitored for about 1 week until cells start dying.
Figure 2 shows the growth and productivity of the 4 selected clones. As shown in the figure, among the clones compared, clone 2Fl 2 is the best performer, in fact, a good growth capability is associated to a good productivity (25 μg/mL) .
Example 4
Purification of recombinant human PTX3 from 2Fl 2 clone
One litre of culture supernatant from 2F12 clone, grown in spinner flask, was loaded onto a Q-
SepharoseTM Fast Flow (GE Healthcare, UK) packed column. Retained material was eluted using a nonlinear gradient. The PTX3 -containing fraction was directly applied to a 100 ml ceramic Hydroxyapatite (BioRad, Hercules, CA, USA) packed column. The retained material was eluted by increasing phosphate concentration in a nonlinear fashion. The PTX3 -containing fraction was concentrated on an ultra- filtration membrane (Pellicon-Biomax 100, Millipore) and subjected to gel filtration on a 510 ml SuperoseTM 6 (GE Healthcare, UK) column. The elution of PTX3 was performed at a constant linear flow rate (Figure 4).
Example 5
Binding of PTX3 to CIq
The binding of purified recombinant hPTX3 to CIq was assessed in an ELISA system (Figure 5). A 96-wells plate (Nunc Maxisorp) was coated with 500ng/ml of CIq (Calbiochem) in PBS and incubated overnight at 4°C. Wells were washed with PBS plus 0.1% Triton X-100 (PBS-Tr, washing solution) and blocked with 250 μl of PBS-Tr containing 1% BSA (PBS-B blocking and diluent solution) for 2 hours at room temperature. After washing, binding was performed adding 100 μl of samples, diluted in PBS-B at PTX3 concentrations ranging from 0 to 30 ng/ml, and
incubating the plate at 37 0 C for 1 hr. After wash, plates were incubated with 100 μl/well of 50 ng/ml rabbit anti-PTX3 polyclonal antibody (1 hr at 37°C), washed again and incubated with 100 μl of horseradish peroxidase-labeled goat anti-rabbit IgG (1 : 1000 in PBS-B; 1 hr at 37°C). After washing, 100 μl of chromogenic substrate 3,3',5,5'-tetramethylbenzidine (TMB) (sigma- Aldrich) were added and after 10-15 min, the reaction was stopped adding 100 μl of HCl IM and absorbance determined using a Microplate Reader Model 3550 EIA (Bio-Rad, Hercules, CA, USA).