More specifically, this invention relates to novel fluorescent proteins, methods of identifying the DNA sequences encoding the proteins and uses thereof.

Description of the Related Art Fluorescence labeling is a particularly useful tool for marking a protein, cell, or organism of interest. Traditionally, a protein of interest is purified, then covalently conjugated to a fluorophore derivative. For in vivo studies, the protein-dye complex is then inserted into cells of interest using micropipetting or a method of reversible permeabilization. The dye attachment and insertion steps, however, make the process laborious and difficult to control. An alternative method of labeling proteins of interest is to concatenate or fuse the gene expressing the protein of interest to a gene expressing a marker, then express the fusion product. Typical markers for this method of protein labeling include P-galactosidase, firefly luciferase

and bacterial luciferase. These markers, however, require exogenous substrates or cofactors and are therefore of limited use for in vivo studies.

A marker that does not require an exogenous cofactor or substrate is the green fluorescent protein (GFP) of the jellyfish Aequorea victoria, a protein with an excitation maximum at 395 nm, a second excitation peak at 475 nm and an emission maximum at 510 nm. GFP is a 238-amino acid protein, with amino acids 65-67 involved in the formation of the chromophore.

Uses of GFP for the study of gene expression and protein localization are discussed in detail by Chalfie et al. in Science 2 6 3 (1994), 802-805, and Heim et al. in Proc. Nat. Acad. Sci. 91 (1994), 12501-12504. Additionally, Rizzuto et al. in Curr. Biology 5 (1995), 635-642, discuss the use of wild-type GFP as a tool for visualizing subcellular organelles in cells, while Kaether and Gerdes in Febs Letters 369 (1995), 267-271, report the visualization of protein transport along the secretory pathway using wild-type GFP. The expression of GFP in plant cells is discussed by Hu and Cheng in Febs Letters 369 (1995), 331-334, while GFP expression in Drosophila embryos is described by Davis et al. in Dev. Biology 170 (1995), 726-729.

Crystallographic structures of wild-type GFP and the mutant GFP S65T reveal that the GFP tertiary structure resembles a barrel (Ormo et al., Science 273 (1996), 1392-1395; Yang, et al., Nature Biotechnol 14 (1996), 1246-1251). The barrel consists of beta sheets in a compact structure, where, in the center, an alpha helix containing the chromophore is shielded by the barrel. The compact structure makes GFP very stable under diverse and/or harsh conditions such as protease treatment, making GFP an extremely useful reporter in

general. However, the stability of GFP makes it sub-optimal for determining short-term or repetitive events.

A great deal of research is being performed to improve the properties of GFP and to produce GFP reagents useful and optimized for a variety of research purposes. New versions of GFP have been developed, such as a"humanized"GFP DNA, the protein product of which has increased synthesis in mammalian cells (Haas, et al., Cu rren t Biology 6 (1996), 315-324; Yang, et al., Nucleic Acids Research 24 (1996), 4592-4593). One such humanized protein is"enhanced green fluorescent protein" (EGFP). Other mutations to GFP have resulted in blue-, cyan-and yellow-green light emitting versions. Despite the great utility of GFP, however, other fluorescent proteins with properties similar to or different from GFP would be useful in the art. Novel fluorescent proteins result in possible new colors, or produce pH- dependent fluorescence. Other benefits of novel fluorescent proteins include fluorescence resonance energy transfer (FRET) possibilities based on new spectra and better suitability for larger excitation.

The prior art is deficient in novel fluorescent proteins wherein the DNA coding sequences are known. The present invention fulfills this long-standing need in the art.

SUMMARY OF THE INVENTION The present invention is directed to an isolated and purified fluorescent protein selected from the group consisting of amFP486, cFP484, zFP506, zFP538, dsFP483, drFP583, asFP600, dgFP512 and dmFP592.

In one embodiment of the present invention, there is provided a method of identifying a DNA sequence encoding a fluorescent protein comprising the step of screening for an existence o f a nucleic acid sequence in a sample, wherein the nucleic acid sequence encodes a peptide having a sequence selected from the group consisting of SEQ ID Nos. 3,5,8,11,12 and 14. The existence of the nucleic acid sequence identifies the DNA sequence encoding the fluorescent protein.

In another embodiment of the present invention, there is provided a method of identifying a DNA sequence encoding a fluorescent protein comprising the step of screening for an existence o f a nucleic acid sequence in a sample, wherein the nucleic acid sequence hybridizes to a primer selected from the group consisting of SEQ ID Nos. 4,6,7,9,10,13,15 and 16. The existence of the nucleic acid sequence identifies the DNA sequence encoding the fluorescent protein.

In still another embodiment of the present invention, there is provided a method of analyzing a fluorescent protein in a cell, comprising the steps of expressing a nucleic acid sequence encoding a fluorescent protein having an amino acid sequence selected from the group consisting of SEQ ID Nos. 55-63 in the cell; and measuring a fluorescence signal from the protein. This method further comprises a step of sorting the cell according to the signal. Preferably, the cell is sorted by fluorescence activated cell sorting. Still preferably, the nucleic acid sequence comprises a gene of interest encoding a protein of interest fused to the fluorescent protein, wherein the protein o f interest is distinct from the fluorescent protein. The detected fluorescence signal indicates the presence of the gene of interest and further the protein of interest in the cell. By identifying an

intracellular location of the fluorescent protein, an intracellular location of the protein of interest is also identified.

Other and further aspects, features, and advantages of the present invention will be apparent from the following description o f the presently preferred embodiments of the invention given for the purpose of disclosure.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the modified strategy of 3'-RACE used t o isolate the target fragments. Sequences of the oligonucleotides used are shown in Table 2. Dpl and Dp2 are the degenerate primers used in the first and second PCR, respectively (see Tables 3 and 4 for th e sequences of degenerate primers).

Figure 2A shows multiple alignment of novel fluorescent proteins. The numbering is based on Aequorea victoria green fluorescent protein (GFP). Two proteins from Zoanthus and four from Discosoma are compared between each other: residues identical to the corresponding ones in the first protein of the series are represented b y dashes. Introduced gaps are represented by dots. In the sequence of A. victoria GFP, the stretches forming beta-sheets are underlined; the residues whose side chains form the interior of the beta-can are shaded (according to Yang et al., Nature Biotechnol. 14,1246-1251 (1996).

Figure 2B shows the N-terminal part of cFP484, which has n o homology with the other proteins. The putative signal peptide i s underlined.

Figure 3 shows the excitation and emission spectrum o f the novel fluorescent protein from Anemonia majano, amFP486.

Figure 4 shows the excitation and emission spectrum o f the novel fluorescent protein from Clavularia, cFP484.

Figure 5 shows the excitation and emission spectrum o f the novel fluorescent protein from Zoanthus, zFP506.

Figure 6 shows the excitation and emission spectrum o f the novel fluorescent protein from Zoanthus, zFP538.

Figure 7 shows the excitation and emission spectrum o f the novel fluorescent protein from Discosoma striata, dsFP483.

Figure 8 shows the excitation and emission spectrum o f the novel fluorescent protein from Discosoma, drFP583.

Figure 9 shows the excitation and emission spectrum o f the novel fluorescent protein from Anemonia sulcata, asFP600.

Figure 10 shows the excitation and emission spectrum o f the novel fluorescent protein from Discosoma, dgFP512.

Figure 11 shows the excitation and emission spectrum of the novel fluorescent protein from Discosoma, dmFP592.

DETAILED DESCRIPTION OF THE INVENTION As used herein, the term"GFP"refers to the basic green fluorescent protein from Aequorea victoria, including prior art versions of GFP engineered to provide greater fluorescence or fluoresce in different colors. The sequence of Aequorea victoria GFP (SEQ ID No.

54) has been disclosed in Prasher et al., Gene 111 (1992), 229-33.

As used herein, the term"EGFP"refers to mutant variant of GFP having two amino acid substitutions: F64L and S65T (Heim et al., Nature 373 (1995), 663-664). The term"humanized"refers to changes made to the GFP nucleic acid sequence to optimize the codons for

expression of the protein in human cells (Yang et al., Nucleic Acids Research 24 (1996), 4592-4593).

In accordance with the present invention there may b e employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e. g., Maniatis, Fritsch &Sambrook,"Molecular Cloning: A Laboratory Manual (1982); "DNA Cloning: A Practical Approach,"Volumes I and II (D. N. Glover ed.

1985);"Oligonucleotide Synthesis" (M. J. Gait ed. 1984);"Nucleic Acid Hybridization" (B. D. Hames & S. J. Higgins eds. (1985));"Transcription and Translation" (B. D. Hames & S. J. Higgins eds. (1984));"Animal Cell Culture" (R. I. Freshney, ed. (1986));"Immobilized Cells and Enzymes" (IRL Press, (1986)); B. Perbal,"A Practical Guide To Molecular Cloning" (1984).

A"vector"is a replicon, such as plasmid, phage or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment.

A"DNA molecule"refers to the polymeric form o f deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in either single stranded form or a double-stranded helix. This term refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear DNA molecules (e. g., restriction fragments), viruses, plasmids, and chromosomes.

A DNA"coding sequence"is a DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3'

(carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e. g., mammalian) DNA, and synthetic DNA sequences. A polyadenylation signal and transcription termination sequence may be located 3'to the coding sequence.

As used herein, the term"hybridization"refers to the process of association of two nucleic acid strands to form an antiparallel duplex stabilized by means of hydrogen bonding between residues of the opposite nucleic acid strands.

The term"oligonucleotide"refers to a short (under 100 bases in length) nucleic acid molecule.

"DNA regulatory sequences", as used herein, are transcriptional and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, and the like, that provide for and/or regulate expression of a coding sequence in a host cell.

A"promoter sequence"is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3'direction) coding sequence. For purposes of defining the present invention, the promoter sequence is bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site, as well as protein binding domains responsible for the binding of RNA polymerase. Eukaryotic promoters will often, but not always, contain"TATA"boxes and"CAT"boxes.

Various promoters, including inducible promoters, may be used t o drive the various vectors of the present invention.

As used herein, the terms"restriction endonucleases"and "restriction enzymes"refer to bacterial enzymes, each of which c u t double-stranded DNA at or near a specific nucleotide sequence.

A cell has been"transformed"or"transfected"by exogenous or heterologous DNA when such DNA has been introduced inside the cell. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In prokaryotes, yeast, and mammalian cells for example, the transforming DNA may b e maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell t o establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA. A"clone"is a population o f cells derived from a single cell or common ancestor by mitosis. A"cell line"is a clone of a primary cell that is capable of stable growth in vitro for many generations.

A"heterologous"region of the DNA construct is an identifiable segment of DNA within a larger DNA molecule that is not found in association with the larger molecule in nature. Thus, when the heterologous region encodes a mammalian gene, the gene will usually be flanked by DNA that does not flank the mammalian genomic DNA in the genome of the source organism. In another example, heterologous DNA includes coding sequence in a construct where portions of genes from two different sources have been brought together so as to produce a fusion protein product. Allelic variations or naturally-occurring mutational events do not give rise to a heterologous region of DNA as defined herein.

As used herein, the term"reporter gene"refers to a coding sequence attached to heterologous promoter or enhancer elements and whose product may be assayed easily and quantifiably when the construct is introduced into tissues or cells.

The amino acids described herein are preferred to be in the "L"isomeric form. The amino acid sequences are given in one-letter code (A: alanine; C: cysteine; D: aspartic acid; E: gluetamic acid; F : phenylalanine; G: glycine; H: histidine; I: isoleucine; K: lysine; L: leucine; M: metionine; N: asparagine; P: proline; Q: gluetamine; R: arginine; S: serine; T: threonine; V: valine; W: tryptophane; Y: tyrosine; X: any residue). NH2 refers to the free amino group present at the amino terminus of a polypeptide. COOH refers to the free carboxy group present at the carboxy terminus of a polypeptide. In keeping with standard polypeptide nomenclature, J Biol. Chem., 243 (1969), 3552- 59 is used.

The present invention is directed to an isolated and purified fluorescent protein selected from the group consisting of amFP486, cFP484, zFP506, zFP538, dsFP483, drFP583, asFP600, dgFP512 and dmFP592.

In one embodiment of the present invention, there i s provided a method of identifying a DNA sequence encoding a fluorescent protein comprising the step of screening for an existence o f a nucleic acid sequence in a sample, wherein the nucleic acid sequence encodes a peptide having a sequence selected from the group consisting of SEQ ID Nos. 3,5,8,11,12 and 14. The existence of the nucleic acid sequence identifies the DNA sequence encoding the fluorescent protein.

In another embodiment of the present invention, there is provided a method of identifying a DNA sequence encoding a

fluorescent protein comprising the step of screening for an existence o f a nucleic acid sequence in a sample, wherein the nucleic acid sequence hybridizes to a primer selected from the group consisting of SEQ ID Nos. 4,6,7,9,10,13,15 and 16. The existence of the nucleic acid sequence identifies the DNA sequence encoding the fluorescent protein.

In still another embodiment of the present invention, there is provided a method of analyzing a fluorescent protein in a cell, comprising the steps of expressing a nucleic acid sequence encoding a fluorescent protein having an amino acid sequence selected from the group consisting of SEQ ID Nos. 55-63 in the cell; and measuring a fluorescence signal from the protein. This method further comprises a step of sorting the cell according to the signal. Preferably, the cell i s sorted by fluorescence activated cell sorting. Still preferably, the nucleic acid sequence comprises a gene of interest encoding a protein of interest fused to the fluorescent protein, wherein the protein o f interest is distinct from the fluorescent protein. The detected fluorescence signal indicates the presence of the gene of interest and further the protein of interest in the cell. By identifying an intracellular location of the fluorescent protein, an intracellular location of the protein of interest is also identified.

The following examples are given for the purpose o f illustrating various embodiments of the invention and are not meant t o limit the present invention in any fashion.

EXAMPLE 1 Riolgcal Material Novel fluorescent proteins were identified from several genera of Anthozoa which do not exhibit any bioluminescence but have fluorescent color as observed under usual white light or ultraviolet light. Six species were chosen (see Table 1).

TABLE 1 Anthozoa Species Used in This Study Species Area of Origination Fluorescent Color Anemonia Western Pacific bright green tentacle tips majano Clavularia sp. Western Pacific bright green tentacles and oral disk Zoanthus sp. Western Pacific green-yellow tentacles and oral disk Discosoma sp. Western Pacific orange-red spots oral disk "red" Discosoma Western Pacific blue-green stripes on oral striata disk Discosoma sp. Western Pacific faintly purple oral disk "magenta" Discosoma sp. Western Pacific green spots on oral disk "green" Anemonia Mediterranean purple tentacle tips sulcata

EXAMPTE2 cTDNA Preparat » n Total RNA was isolated from the species of interest according to the protocol of Chomczynski and Sacchi (Chomczynski P., et al., Anal. Biochem. 162 (1987), 156-159). First-strand cDNA was synthetized starting with 1-3 ug of total RNA using SMART PCR cDNA synthesis kit (CLONTECH) according to the provided protocol with the only alteration being that the"cDNA synthesis primer"provided in the kit was replaced by the primer TN3 (5'-CGCAGTCGACCG (T) 13, SEQ ID No. 1) (Table 2). Amplified cDNA samples were then prepared as described in the protocol provided except the two primers used for PCR were the TS primer (5'-AAGCAGTGGTATCAACGCAGAGT, SEQ ID No. 2) (Table 2) and the TN3 primer (Table 2), both in 0.1 uM concentration.

Twenty to twenty-five PCR cycles were performed to amplify a cDNA sample. The amplified cDNA was diluted 20-fold in water and 1, ul of this dilution was used in subsequent procedures.

TABLE Ol1gos Used in DNA Syntheses and RAC TN3: 5'-CGCAGTCGACCG (T) 3 (SEQ ID No. 1) T7-TN3: 5'-GTAATACGACTCACTATAGGGCCGCAGTCGACCG (T), 3 (SEQ ID No. 17) T S-p r i m e r: 5'-AAGCAGTGGTATCAACGCAGAGT (SEQ ID No. 2) T7-TS: 5'-GTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT (SEQ ID No. 18) T7: 5'-GTAATACGACTCACTATAGGGC (SEQ ID No. 19) TS-oligo 5'-AAGCAGTGGTATCAACGCAGAGTACGCrGrGrG (SEQ ID No. 53)

EXAMPLE3 Oo Design To isolate fragments of novel fluorescent protein cDNAs, PCR using degenerate primers was performed. Degenerate primers were designed to match the sequence of the mRNAs in regions that were predicted to be the most invariant in the family of fluorescent proteins. Four such stretches were chosen (Table 3) and variants o f degenerate primers were designed. All such primers were directed to the 3'-end of mRNA. All oligos were gel-purified before use. Table 2 shows the oligos used in cDNA synthesis and RACE.

TABLE 3 Key Amino Acid Stretches and Corresponding Degenerate Primers Used for Isolation of Fluorescent Proteins Stretch Position Amino Acid according to Sequence of Degenerated Primer Name A. victoria GFP (7) the Key Stretch and Sequence 20-25 GXVNGH NGH: 5'-GA (C, T) GGC TGC (SEQ ID No. 3) GT (A, T, G, C) AA (T, C) GG (A, T, G) CA (SEQ ID No. 4) 31-35 GEGEG GEGa: 5'-GTT ACA GGT GA (A, G) (SEQ ID No. 5) GG (A, C) GA (A, G) GG (SEQ ID No. 6) GEGb: 5'-GTT ACA GGT GA (A, G) GG (T, G) GA (A, G) GG (SEQ ID No. 7) GEGNG GNGa: 5'-GTT ACA GGT GA (A, G) (SEQ ID No. 8) GG (A, C) AA (C, T) GG (SEQ ID No. 9) GNGb: 5'-GTT ACA GGT GA (A, G) GG (T, G) AA (C, T) GG (SEQ ID No. 10) 127-131 GMNFP NFP: 5'TTC CA (C, T) GGT (SEQ ID No. 11) (G, A) TG AA (C, T) TT (C, T) CC GVNFP (SEQ ID NO. 13) (SEQ ID No. 12) 134-137 GPVM PVMa: 5'CCT GCC (G, A) A (C, T) (SEQ ID No. 14) GGT CC (A, T, G, C) GT (A, C) ATG (SEQ ID NO. 15) PVMb: 5'CCT GCC (G, A) A (C, T) GGT CC (A, T, G, C) GT (G, T) ATG (SEQ ID NO. 16)

EXAMPT E 4 Tsolation of 3'-cDNA Fragments of nFPs The modified strategy of 3'-RACE was used to isolate the target fragments (see Figure 1). The RACE strategy involved two consecutive PCR steps. The first PCR step involved a first degenerate primer (Table 4) and the T7-TN3 primer (SEQ ID No. 17) which has a 3' portion identical to the TN3 primer used for cDNA synthesis (for sequence of T7-TN3, Table 2). The reason for substituting the longer T7-TN3 primer in this PCR step was that background amplification which occurred when using the shorter TN3 primer was suppressed effectively, particularly when the T7-TN3 primer was used at a low concentration (0.1M) (Frohman et al., (1998) PNAS USA, 85,8998- 9002). The second PCR step involved the TN3 primer (SEQ ID No. 1, Table 2) and a second degenerate primer (Table 4).

TABLE 4 Combinations of Degenerate Primers for First and Second PCR Resulting in Specific Amplification of 3'-Fragments of nFP cDNA

Species First Second Degenerate Primer Degenerate Primer Anemonia majano NGH GNGb (SEQ ID No. 4) (SEQ ID No. 10) Clavularia sp. NGH GEGa (SEQ ID No. 4) (SEQ ID No. 6) Zoanthus sp. NGH GEGa (SEQ ID No. 4) (SEQ ID No. 6) Discosoma sp."red"NGH GEGa (SEQ ID No. 6), (SEQ ID No. 4) NFP (SEQ ID No. 13) or PVMb (SEQ ID No. 16) Discosoma striata NGH NFP (SEQ ID No. 4) (SEQ ID No. 13) Anemonia sulcata NGH GEGa (SEQ ID No. 6) (SEQ ID No. 4) or NFP (SEQ ID No. 13) The first PCR reaction was performed as follows: 1 gel of 20-fold dilution of the amplified cDNA sample was added into the reaction mixture containing 1X Advantage KlenTaq Polymerase Mix with provided buffer (CLONTECH), 200 uM dNTPs, 0.3, uM of first degenerate

primer (Table 4) and 0.1 RM of T7-TN3 (SEQ ID No. 17) primer in a total volume of 20 u. l. The cycling profile was (Hybaid OmniGene Thermocycler, tube control mode): 1 cycle for 95°C, 10 sec.; 55°C, 1 min.; 72°C, 40 sec; 24 cycles for 95°C, 10 sec.; 62°C, 30 sec.; 72°C, 40 sec. The reaction was then diluted 20-fold in water and 1 il of thi s dilution was added to a second PCR reaction, which contained 1X Advantage KlenTaq Polymerase Mix with the buffer provided by the manufacturer (CLONTECH), 200, uM dNTPs, 0.3, uM of the second degenerate primer (Table 4) and 0.1 u. M of TN3 primer. The cycling profile was (Hybaid OmniGene Thermocycler, tube control mode): 1 cycle for 95°C, 10 sec.; 55°C (for GEG/GNG or PVM) or 52°C (for NFP), 1 min.; 72°C, 40 sec; 13 cycles for 95°C, 10sec.; 62°C (for GEG/GNG or PVM) or 58°C (for NFP), 30 sec.; 72°C, 40 sec. The product of PCR was cloned into PCR-Script vector (Stratagene) according to th e manufacturer's protocol.

Different combinations of degenerate primers were tried i n the first and second PCR reactions on the DNA from each species until a combination of primers was found that resulted in specific amplification--meaning that a pronounced band of expected size (about 650-800 bp for NGH and GEG/GNG and 350-500 bp for NFP and PVM--sometimes accompanied by a few minor bands) was detected on agarose gel after two PCR reactions. The primer combinations of choice for different species of the Class Anthozoa are listed in Table 4.

Some other primer combinations also resulted in amplification o f fragments of correct size, but the sequence of these fragments showed no homology to the other fluorescent proteins identified or t o Aequorea victoria GFP.

EXAMPLE5 Qbtaimng Fu-I. ength cDNA Copies Upon sequencing the obtained 3'-fragments of novel fluorescent protein cDNAs, two nested 5'-directed primers were synthesized for cDNA (Table 5), and the 5'ends of the cDNAs were then amplified using two consecutive PCRs. In the next PCR reaction, the novel approach of"step-out PCR"was used to suppress background amplification. The step-out reaction mixture contained lx Advantage KlenTaq Polymerase Mix using buffer provided by the manufacturer (CLONTECH), 200 tM dNTPs, 0.2 RM of the first gene-specific primer (see Table 5), 0.02 RM of the T7-TS primer (SEQ ID No. 18), 0.1, uM of T7 primer (SEQ ID No. 19) and 1 1 of the 20-fold dilution of t h e amplified cDNA sample in a total volume of 20 gel. The cycling profile was (Hybaid OmniGene Thermocycler, tube control mode): 23-27 cycles for 95°C, 10 sec.; 60°C, 30 sec.; 72°C, 40 sec. The product of amplification was diluted 50-fold in water and onze gel of this dilution was added to the second (nested) PCR. The reaction contained 1X Advantage KlenTaq Polymerase Mix with provided buffer (CLONTECH), 200 u. M dNTPs, 0.2 u, M of the second gene-specific primer and 0.1, uM of TS primer (SEQ ID No. 2) in a total volume of 20 gel. The cycling profile was (Hybaid OmniGene Thermocycler, tube control mode): 12 cycles for 95°C, 10 sec.; 60°C, 30 sec.; 72°C, 40 sec. The product of amplification was then cloned into pAtlas vector (CLONTECH) according to the manufacturer's protocol. TARI, F 5 Gene-Specific Primers 5'-RACEfor Species First Primer Second (Nested) Primer A n e m o n i a 5'-GAAATAGTCAGGCATACTGGT 5'-GTCAGGCATAC majano (SEQ ID No. 20) TGGTAGGAT (SEQ ID No. 21) Clavularia 5'-CTTGAAATAGTCTGCTATATC 5'-TCTGCTATATC sp. (SEQ ID No. 22) GTCTGGGT (SEQ ID No. 23) Z o a n th u s 5'5'-GTCTACTATGTCTT sp. GTTCTTGAAATAGTCTACTATGT GAGGAT (SEQ ID No. 24) (SEQ ID No. 25) Discoso m a 5'-CAAGCAAATGGCAAAGGTC 5'-CGGTATTGTGGCC sp."red" (SEQ ID No. 26) TTCGTA (SEQ ID No. 27) Discoso m a 5'-TTGTCTTCTTCTGCACAAC 5'-CTGCACAACGG striata (SEQ ID No. 28) GTCCAT (SEQ ID No. 29) A n e m o n i a 5'-CCTCTATCTTCATTTCCTGC 5'-TATCTTCATTTCCT sulcata (SEQ ID No. 30) GCGTAC (SEQ ID No. 31) Discoso m a 5'-TTCAGCACCCCATCACGAG 5'-ACGCTCAGAGCTG sp. (SEQ ID No. 32) GGTTCC "magenta" (SEQ ID No. 33) Discoso m a 5'-CCCTCAGCAATCCATCACGTTC 5'-ATTATCTCAGTGGA sp."green" (SEQ ID No. 34) TGGTTC (SEQ ID No. 35)

EXAMPT E 6 Expression of nFPs in F. col To prepare a DNA construct for novel fluorescent protein expression, two primers were synthesized for each cDNA: a 5'-directed "downstream"primer with the annealing site located in the 3'-UTR of the cDNA and a 3'-directed"upstream"primer corresponding to the site of translation start site (not including the first ATG codon) (Table 6). Both primers had 5'-heels coding for a site for a restriction endonuclease; in addition, the upstream primer was designed so as t o allow the cloning of the PCR product into the pQE30 vector (Qiagen) in such a way that resulted in the fusion of reading frames of the vector- encoded 6xHis-tag and nFP. The PCR was performed as follows: 1 u. l of the 20-fold dilution of the amplified cDNA sample was added to a mixture containing lx Advantage KlenTaq Polymerase Mix with buffer provided by the manufacturer (CLONTECH), 200, uM dNTPs, 0.2 FM of upstream primer and 0.2 RM of downstream primer, in a final total volume of 20 , 1. The cycling profile was (Hybaid OmniGene Thermocycler, tube control mode): 23-27 cycles for 95°C, 10 sec.; 60°C, 30 sec.; 72°C, 40 sec. The product of this amplification step was purified by phenol-chlorophorm extraction and ethanol precipitation and then cloned into pQE30 vector using restriction endonucleases corresponding to the primers'sequence according to standard protocols.

All plasmids were amplified in XL-1 blue E. coli and purified by plasmid DNA miniprep kits (CLONTECH). The recombinant clones were selected by colony color, and grown in 3 ml of LB medium (supplemented with 100 llg/ml of ampicillin) at 37°C overnight. 100 1

of the overnight culture was transferred into 200 ml of fresh LB medium containing 100, ug/ml of ampicillin and grown at 37°C, 200 rpm up to OD600 0.6-0.7.1 mM IPTG was then added to the culture and incubation was allowed to proceed at 37°C for another 16 hours. The cells were harvested and recombinant protein, which incorporated 6 x His tags on the N-terminus, was purified using TALON metal-affinity resin according to the manufacturer's protocol (CLONTECH).

TABLE6 Primers ObtainFullCOdingRegionofnPFsforCloninginto Expresston Construct Species Upstream Primer Downstream Primer Anemonia 5'-acatggatccgctctttcaaaca 5'-tagtactcgagcttattcgta majano agtttatc (SEQ ID No. 36) tttcagtgaaatc BamHI (SEQ ID No. 37) XhoI L: 5'-acatggatccaacatttttttga gaaacg (SEQ ID No. 38) 5'-tagtactegagcaacacaa Clavularia BamHI accctcagacaa sp. S: 5'-acatggatccaaagctctaacc (SEQ ID No. 40) accatg (SEQ ID No. 39) XhoI BamHI Zoanthus 5'-acatggatccgctcagtcaaag 5'-tagtactcga. ggttggaactacat sp. cacggt (SEQ ID No. 41) tcttatca (SEQ ID No. 42) B amHI XhoI Discosoma 5'-acatggatccaggtcttccaagaat 5'-tagtactcgaggagccaagttc sp."red"gttatc (SEQ ID No. 43) agcctta (SEQ ID No. 44) BamHIXhoI Discosoma acatggatccagttggtccaagagtgtg 5'-tagcgagctctatcatgcctc striata (SEQ ID No. 45) gtcacct (SEQ ID No. 46) BamHI SacI Anemonia 5'-acatggatccgcttcctttttaaagaagact 5'-tagtactegagtccttgggagc sulcata (SEQ ID No. 47) ggcttg (SEQ ID No. 48) B amHI XhoI acatggatccagttgttccaagaatgtgat5'-tagtactcgaggccattacgDiscoso ma5'- sp. (SEQ ID No. 49) ctaatc (SEQ ID No. 50) "magenta"BamHI XhoI Discosoma 5'-acatggatccagtgcacttaaagaagaaat 5'-tagtactcgagattcggtttaat sp."green" (SEQ ID No. 51) gccttg (SEQ ID No. 52)

EXAMPLE7 Novel Fluorescent Proteins and cDNAs Encoding the Proteins Seven cDNA full-length cDNAs encoding fluorescent proteins were obtained (SEQ ID Nos. 45-51), and seven novel fluorescent proteins were produced (SEQ ID Nos. 53-59). The spectral properties of the isolated novel fluorescent proteins are shown in Table 7, and the emission and excitation spectra for the novel proteins are shown in Figures 3-11. TABLE 7 SnPctral Properties of the Isolated NFPs. Species NFP Abs. Emission Maximum Relative Relative Name Max. Maximum Extinction Quantum Brightness n m n m Coeff. Yield* ** Anemonia amFP486 458 486 40, 000 0. 3 0. 43 majano Clavularia cFP484 456 484 35, 300 0. 6 0. 77 sp. Zoanthus zFP506 496 506 35, 600 0. 79 1. 02 sp. Zoanthus zFP538 528 538 20, 200 0. 52 0. 38 sp. Discosoma drFP583 558 583 22, 500 0. 29 0. 24 sp."red" Discosoma dsFP483 443 483 23, 900 0. 57 0. 50 striata Anemonia asFP600 572 596 56, 200 <0. 001- sulcata Discosoma dgFP512 502 512 20, 360 0. 3 0. 21 sp"green" Discosoma sp. dmFP592 573 593 21,800 0.11 0.09 "magenta"

*relative quantum yield was determined as compared to the quantum yield of A. victoria GFP.

**relative brightness is extinction coefficient multiplied by quantum yield divided by the same value for A. victoria GFP.

Multiple alignment of fluorescent proteins is shown i n Figure 2A. The numbering is based on Aequorea victoria green fluorescent protein (GFP, SEQ ID No. 54). The amino acid sequences of the novel fluorescent proteins are labeled as SEQ ID Nos. 55-63. Two proteins from Zoanthus and four from Discosoma are compared between each other: residues identical to the corresponding ones in the first protein of the series are represented by dashes. Introduced gaps are represented by dots. In the sequence of A. victoria GFP, the stretches forming ß-sheets are underlined; the residues whose side chains form the interior of the ß-can are shaded. Figure 2B shows the N-terminal part of cFP484, which has no homology with the other proteins. The putative signal peptide is underlined.

The following references were cited herein.

1. Ormo et al., (1996) Science 273: 1392-1395.

2. Yang, F., et al., (1996) Nature Biotech 14: 1246-1251.

3. Cormack, et al., (1996) Gene 173,33-38.

4. Haas, et al., (1996) Current Biology 6,315-324.

5. Yang, et al., (1996) Nucleic Acids Research 24,4592-4593.

6. Ghoda, et al.. (1990) J. Biol. Chem. 265: 11823-11826.

7. Prasher D. C. et al. (1992) Gene 111: 229-33.

8. Kain et al. (1995) Biotechniques 19 (4): 650-55.

9. Chomczynski P., et al., (1987) Anal. Biochem. 162,156-159.

10. Frohman et al., (1998) PNAS USA, 85,8998-9002.

Any patents or publications mentioned in this specification are indicative of the levels of those skilled in the art to which the invention pertains. These patents and publications are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to b e incorporated by reference.

One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The present examples along with the methods, procedures, treatments, molecules, and specific compounds described herein are presently representative of preferred embodiments, are exemplary, and are n o t intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention as defined by the scope of the claims.