The invention relates to a therapeutic target for increasing γ-globin gene expression in patients suffering from a blood disorder, such as β-thalassemia or sickle cell anemia. Moreover, the invention provides a method for identifying such targets and identifying inhibitors of such targets which are useful therapeutically, as well as to such inhibitors per se.

The human a and β-globin gene loci produce haemoglobin tetramers which, together with haem, are responsible for the gas transport in the blood. The genes are

developmental^ regulated with one switch in the embryonic period for the a locus (from ζ to a) and β locus (from ε to γ) and a second switch in the β locus (from γ to β) around the time of birth. Conditions affecting the function of β-globin, including β-thalassemias and sickle cell disease, are among the most frequent inherited single gene disorders in the human population. The most common treatment for these diseases is blood transfusion and iron chelation therapy or treatment with small molecules such as hydroxyurea or short chain fatty acids, which affect either red cell volume and/or lead to an increase of foetal γ-globin gene expression. However these treatments are not very satisfactory and do not lead to a normal quality of life nor do they prevent a relatively early death. At present, bone marrow transplantation is the only effective cure, a risky procedure that is not available to the majority of patients. The severity of β-thalassemia and sickle cell disease are greatly ameliorated by expression of the γ-globin genes, which are normally expressed during the foetal stage of development. Since the large majority of patients have normal γ-globin genes, reactivation of γ-globin expression in adults would provide a very elegant and attractive treatment. In particular the treatment with short chain fatty acids or hydroxyurea aim to achieve such γ-globin gene activation, but are only partially successful.

Despite intense research efforts by many laboratories, it is not known how the human γ- globin genes are normally suppressed around the time of birth when expression switches to the adult β-globin gene. Association studies on persons with relatively high γ-globin gene expression during adult life have indicated that a number of non-globin loci are involved in the suppression of the γ-globin genes (Garner et al., 2004; Jiang et al., 2006; Lettre et al., 2008; Menzel et al., 2007; Thein et al., 2007; Uda et al., 2008). The most promising of these, BCL11A, was recently shown to lead to elevated γ-globin gene expression, when its activity is suppressed (Sankaran et al., 2008; Sankaran et al., 2009; Xu et al., 2010). Interestingly the promoter region of the γ-globin genes has previously been identified as the region responsible for its suppression (Yu et al., 2006); however, the BCL11 A gene binds to the region downstream of the γ-globin genes. It interacts with the Gata1/Fog1/NuRD repressor complex, but whether this interaction is involved in γ- globin gene suppression is as yet not clear (Sankaran et al., 2008). Genome-wide association studies indicate that common SNPs in the BCL11A, HSB1L-MYB and HBB loci account for <50% of the variation in HbF levels, suggesting that additional factors are involved (Lettre et al., 2008; Menzel et al., 2007; Thein et al., 2009; Thein et al., 2007; Uda et al., 2008).

The importance of the promoter sequences has been well documented by genetic studies in mice (Berry et al., 1992; Ronchi et al., 1996; Yu et al., 2006) and in a number of persons with point mutations in the γ-globin promoters leading to a condition known as hereditary persistence of foetal haemoglobin (HPFH), resulting in sustained elevated γ- globin levels through adult life. The strongest HPFH known is caused by a G to A mutation at position -117 in the promoter of the Αγ globin gene, resulting in γ-globin expression at therapeutic levels (Hardison et al., 2002; Stamatoyannopoulos and Grosveld, 2001 ).

A number of treatments have been proposed which seek to restore foetal γ-globin production in adult patients. For example, Bianchi ef al. have proposed the use of Angelicin, an isopsoralen derivative, as well as structural derivatives thereof (US 2006/01 11433) ; and Perrine has proposed the use of Butyrate to increase γ-globin gene expression (for instance, see US 2009/0082444, US 6,403,647 and (Perrine et al., 1993)). The use of agents which potentiate the hypoxia-inducible factor HIFa has been proposed (WO 2005/011696), whilst gene therapy approaches have included the use of siRNA to contemporaneously downregulate deficient β-globin genes and express γ- globin transgenes (Samakoglu et al., 2006). However, the mechanism of suppression of γ-globin genes after birth, and the nature of candidate suppressors, remains obscure.

We recently identified Friend of PRMT1 (FOP, also known as Small protein Rich in Arginine and Glycine (SRAG)), encoded by the human C1orf77 and mouse

2500003M10Rik genes, respectively (van Dijk et al., 2010; Zullo et al., 2009). We showed that FOP is tightly associated with chromatin, and that it is modified by both asymmetric- and symmetric arginine methylation in vivo. Furthermore, FOP plays an important role in the ligand-dependent activation of estrogen receptor target genes including TFF1 (pS2). FOP depletion results in an almost complete block of estradiol- induced promoter occupancy by the estrogen receptor. Data indicated that FOP recruitment to the promoter is an early critical event in activation of estradiol-dependent transcription. However, no association has previously been drawn between FOP and globin gene expression.

FOP has recently been assigned the official name Chromatin Target of PRMT1

(CHTOP). The human genome nomenclature committee (HGNC) identification number for the human gene is HGNC:24511. In the present application, references to FOP are references to CHTOP, HGNC:24511 .

Summary of The Invention

We have now shown that FOP is an important repressor of foetal globin gene expression. Knockdown of FOP in mouse and human cells increases the levels of foetal globin expression. In a first aspect, there is provided a method for modulating the expression of foetal haemoglobin in a cell, comprising modulating the activity of Friend of PRMT1 (FOP). Preferably, the foetal haemoglobin is human foetal haemoglobin.

Modulation of FOP activity can be achieved using a number of techniques. Modulation of the expression of the gene encoding FOP can be achieved, for instance at the mRNA level using RNAi approaches. FOP protein can be knocked down, using antibodies, including antibody fragments such as single chain antibodies and single domain antibodies, for example dAbs or VHH single domains, such as those produced by camelids. Other techniques include protein modification, or prevention of protein modification, of FOP, as well as interference in the modulation of gene transcription mediated by FOP.

Compounds, whether chemical or biological in origin, can be screened for an activity in modulating FOP. In a second aspect, therefore, there is provided a method for identifying one or more compounds which modulate the expression of foetal

haemoglobin in a cell, comprising the steps of (a) incubating FOP with one or more compounds to be assessed, and (b) identifying those compounds which influence the activity of FOP.

In one embodiment, FOP activity is assessed by measuring one or more modifications of FOP. A preferred modification is methylation, such as arginine methylation. In another embodiment, FOP activity is assessed by measuring the binding of a component to FOP. For example, the component can be selected from a cellular polypeptide and at least one of the one or more compounds tested. Cellular polypeptides which have been shown to bind to FOP include PRMT1 , PRMT5, Pelpl , Tex10, Lasl l, Senp3, Wdr18, Set, Uif/Fyttd, Pc2/Cbx4, Edr2, Ringl b and Bmi1 . The interactions with Pelpl , Tex10, Lasl l, Senp3, Wdr18 have been shown to be dependent on methylation of FOP. Binding can be detected in a number of ways, including mobility shift assays, mass spectrometry, BIAcore assays and biological assays, such as two-hybrid assays.

In a preferred embodiment, there is provided a method comprising the steps of (a) incubating one or more compounds to be tested and FOP, together with PRMT1 and/or PRMT5, under conditions which, but for the presence of the one or more compounds to be tested, PRMT1 and/or PRMT5 methylate FOP at a reference level; (b) determining the influence of the compound or compounds being tested on the methylation of FOP; and (c) selecting the compound or compounds which modulate the methylation of FOP by PRMT1 and/or PRMT5 with respect to the reference level.

In another embodiment, there is provided a method comprising the steps of (a) incubating one or more compounds to be tested and FOP, together with PRMT1 and/or PRMT5, under conditions which, but for the presence of the one or more compounds to be tested, PRMT1 and/or PRMT5 bind to FOP with a reference affinity; (b) determining the influence of the compound or compounds being tested on the binding of PRMT1 and/or PRMT5 to FOP; and (c) selecting the compound or compounds which modulate the binding of PRMT1 and/or PRMT5 to FOP with respect to the reference binding affinity.

In another embodiment, there is provided a method comprising the steps of (a) incubating one or more compounds to be tested in a cell in the presence of FOP and PRMT1 , under conditions which, but for the presence of the one or more compounds to be tested, PRMT1 participates in estrogen -receptor (ER) mediated gene transcription at a reference level; (b) determining the influence of the compound or compounds being tested on ER-mediated gene transcription; and (c) selecting the compound or compounds which modulate ER-mediated gene transcription with respect to the reference level. For example, FOP and PRMT1 can be transcribed from endogenous cell genes. ER-mediated gene transcription can be assessed by monitoring the expression of a gene responsive to estradiol (E2) induction, for example using a reporter gene under the control of an E2 responsive promoter.

For example, the gene can be selected from TFF1 (pS2), Lactoferrin, or TGFa.

Advantageously, the activity of PRMT1 in ER-mediated gene expression is not inhibited.

In a further aspect, there is provided a method for modulating the expression of foetal haemoglobin in a cell, wherein the activity of FOP is modulated using a compound or compounds selected according to the present invention. For instance, the compound or compounds can be selected from the group consisting of a an interfering ribonucleic acid specific for FOP, and antibody specific for FOP, and a chemical or biological regulator of FOP.

In a further aspect, the invention provides shRNA molecules which inhibit the expression of FOP, having the sequence GGAGCAGC TGG ACAACCAA,

GTTAGTCAACACATCTGTAAA, GATGGAGAATAGACCCTCTGT, or

GCACCACCAAGATGTCTCTAA.

Description of the Drawings

Figure 1. Biotinylation of PRMT1 in MEL cells. (A). Biotinylated PRMT1 (bio) is pulled down from cytoplasmic (CE) and nuclear extracts (NE) of MEL cells expressing the BirA biotin ligase. Since PRMT1 forms oligomers in vivo, endogenous (end) PRMT1 co- purifies with HA_bio_PRMT1 in streptavidin pulldowns. IN: input; FT: flow through; PD: pull down. (B). Size-fractionation profiles of PRMT1 ; the profile of tagged PRMT1 (bio) closely follows that of endogenous PRMT1 (end) in cytoplasmic (CE) and nuclear extracts (NE). Molecular mass markers are indicated on the top. Top panels indicate BirA control cells. (C). PRMT1 -interacting proteins identified by mass spectrometry. Gene ID (NCBI) and number of unique peptides identified are indicated. (D). Alignment of predicted full-length amino acid sequences of vertebrate FOP homologs (FOP_L). Transcripts lacking the first coding exon are found in human and mouse only and start at M26 (FOP_S). The GAR domain (light gray) and C-terminal duplication (dark gray) are indicated. Identified tryptic peptides are indicated in bold/italics. Figure 2. Intracellular localization and expression pattern of FOP. (A). A doublet of ~27 kDa and isoforms of -25 kDa and -23 kDa (indicated with '*' and '**', respectively) are recognized (A) and precipitated (B) by KT59, a monoclonal raised against the N-terminus of FOP (aa 1-90), and by KT64, raised against the C-terminus (aa 206-249). Detection of these proteins is sharply diminished in lysates from cells expressing an shRNA against FOP. (C). Confocal images showing that FOP localizes to DAPI-low regions in the nucleus and displays a granulated/speckle-like distribution in MEL cells. (D). Sagital paraffin sections of E16.5 mouse embryos were incubated with rat IgG control and T64, followed by peroxidase staining. B = brain, Br = brown fat, DRG = dorsal root ganglion, G = gut, H = heart, Li = liver, O = olfactory epithelium, S = submandibular gland, T = thymus, V = follicles of vibrissae.

Figure 3. FOP is a PRMT1 -associating protein. (A). 293T cells were co-transfected with HA_FOP and wild type Myc_PRMT1 (WT) or enzymatically inactive Myc_PRMT1_E171 Q (EQ). HA_FOP was precipitated and blots were stained for Myc, PRMT1 , HA, and an antibody recognizing asymmetrically methylated arginines (Asym24). PRMT1 binds and methylates HA_FOP. (B). Monoclonal antibodies specifically recognizing the N- and C-terminal domain of FOP confirm the interaction of endogenous FOP and PRMT1. The smaller isoform of FOP is indicated with *. (C). Upper panel: schematic representation of GST_FOP deletion constructs. Lower panels: GST constructs were incubated with MEL extracts as a source of PRMT1. Western blot analysis identified two regions in FOP that mediate binding to PRMT1 : the N-terminal 90aa (FOP_AC3) and R153 to A206 (compare FOP_AC2 and FOP_AN3). Total protein staining served as loading control (lower right panel). Arrowheads indicate full-length protein GST fusion proteins. FOP_L: full length FOP, FOP_S: isoform lacking first 25 aa, con: GST only, IN: input MEL cell extract.

Figure 4. FOP is a target for type I and type II PRMTs. (A). GST_FOP_L was used as a substrate in an in vitro methylation assay using three type I GST_PRMTs. Core histones were used a positive control. PRMT1 is the only type I enzyme that can methylate full- length (FL) protein. (B). GST_FOP_L was used as a substrate in an in vitro methylation assay using immunoprecipitated PRMT5. (C). MEL cells were infected with control lentivirus (Con) or lentivirus expressing an shRNA against PRMT1 (PRMT1 kd). Whole cell lysates (WCL; upper panel) were tested for PRMT1 , PRMT5, and FOP. Staining for actin served as a control for equal loading. FOP was precipitated (IP; lower panel) and tested for binding to PRMT1 and PRMT5, and for asymmetric DMA residues (Asym24) and symmetric DMA residues (Sym10). (D). HA_FOP constructs lacking GAR sequences were tested for methylation and PRMT1 and PRMT5 binding.

Figure 5. FOP stably interacts with chromatin. (A). Confocal slices indicate that HA_FOP (immunofluorescence; cytospins of MEL cells) and Gfp_FOP (living U20S cells; (C), upper panel) localize to DAPI-low regions in the nucleus and display a granulated/speckle-like distribution. Nuclear PRMT1 has a more diffuse distribution, but also localizes to DAPI-low / euchromatic regions. The distribution of HA_FOP is not changed in cells with reduced PRMT1 expression (PRMT1 kd). Scale bars indicate 5 μΐη. Image stacks were deconvolved and corrected for chromatic shift. (B). Cellular fractionation of control (Con) and PRMT1 knockdown (PRMT1 kd) MEL cells expressing HA_FOP. Cytoplasmic, nucleoplasms, chromatin, and nuclear matrix fractions were tested for PRMT1 and FOP. PRMT1 localizes to cytoplasm and nucleoplasm, while FOP (asymmetrically (aFop) and/or symmetrically methylated (sFop) is associated to chromatin. She, LSD1 , Histone H3, and Lamin B served as controls for individual fractions. (C). In vivo mobility of FOP and PRMT1 was determined by combined FRAP- FLIP. A new equilibrium in the distribution of Cherry_PRMT1 was reached within 30 seconds, consistent with the diffusion characteristics of a macromolecular complex of less than 1 MDa. Gfp_FOP is highly immobile with complete redistribution taking more than 25 minutes. Scale bars indicate 10 μπη. (D). The level of PRMT1 was determined in input (IN) and flow-through (FT) of FOP-depleted nuclear extracts of MEL cells (left panel). (E). Size-fractionation profiles of FOP and PRMT1 in MEL nuclear extracts. Histone H3 staining served as a control for chromatin-containing fractions. Molecular mass markers are indicated on the top.

Figure 6. HA_FOP colocalizes partially with H3K27me3. (A-D). Co-localization of HA_FOP was studied in cytospins of MEL cells labeled for immunofluorescence with anti-HA (green - lighter) and the antibodies indicated (red - darker). Histograms represent quantified intensity profiles over line a-b (Y-axis = pixel intensity). Partial co- localization is observed with H3K27me3, a mark for facultative heterochromatin. Scale bars indicate 5 μηι. Image stacks were deconvolved and corrected for chromatic shift.

Figure 7. FOP is critical for E2-dependent gene activation. (A-F). MCF7 cells were hormone-starved and treated with siRNA as indicated. (A). Whole cell lysates and IPs were stained by western blot with the indicated antibodies. (B-C). MCF7 cells were induced with E2 for the times indicated. Total RNA was analyzed by RT-QPCR using primers for pS2, lactoferrin, and TGFa. (D). MCF7 cells were treated for 0, 15, 30, and 60 minutes with E2. ChIP reactions was performed with indicated antibodies and examined by QPCR for the presence of proximal pS2 promoter fragments. (E). Whole cell lysates were analyzed by western blot with the indicated antibodies. (F). MCF7 cells were treated with siRNAs against Gfp or FOP for 48 hours, followed by E2 induction. Chi P-QPCR was performed as in (D).

Figure 8. FOP regulates embryonic globin genes in mouse and human erythroid cells. Lentiviral-mediated knockdown of FOP in (A) mouse erythroid progenitor cells containing a single copy of the human globin locus (PAC8) and (B) primary human erythroid progenitors (HE P) show the specific induction of mouse and human fetal β-like globin genes, as demonstrated by qualitative PCR analysis. Western blot analysis was used to validate FOP knockdown levels (bottom panels). (C) Quantitative S1 nuclease protection assay and Western blot analysis demonstrate significant γ-globin reactivation in HEP cells with reduced FOP expression. (D) Globin HPLC of transduced HEP cells after 11 days of culture. Peaks for HbA (α2β2), HbA2 (α2δ2), and HbF (α2γ2) are indicated. (E) The shRNA-mediated knockdown of FOP increases HbF levels on average ~3.7 times in cultured human erythroid progenitor cells. Cultures from three independent healthy donors were analyzed. Ns = not significant; ^* Significant difference (Mann-Whitney test, P<0.05).

Figure 9. Reduced FOP expression induces HbF expression in adult human erythroid cells. (A) IHC for γ-globin shows that >90% of FOP knockdown cells contribute to elevated HbF levels. (B) Peripheral blood (P B) HEP cells express FOP at -2.5 times higher level than fetal liver cells (FL). Depicted is the level of FOP protein relative to Actin; three FL and three PB donors were analyzed; * Significant difference (Mann- Whitney test, P<0.05). (C) Reduced levels of FOP lower the expression of SOX6 but do not change the expression of BCL11A. (D) Quantitative S1 nuclease protection assay demonstrates ~50% increase of γ-globin expression in erythroid progenitors from β- thalassemic patients when FOP levels are reduced. Figure 10. FOP-interacting proteins. Tagged FOP (bio_FOP) was generated by fusing a short (23 aa) bio-tag to its N-terminus and stably transfected in BirA expressing MEL cells. Bio_FOP was expressed at endogenous levels to reduce the likelihood that non- physiological interactions would be identified. Bio_FOP was purified from control cells and from cells that had been depleted for PRMT1 (shPRMTI ) to obtain hypomethylated FOP. (A) FOP-associating proteins were identified by streptavidin pull down followed by nanoflow liquid chromatography-tandem mass spectrometry (nanoLC -MS/MS) and compared to samples from cells expressing BirA alone. Lasl L, Pelpl , Senp3, Tex10, and Wdr18 are not detected or detected with a reduced score when FOP becomes hypomethylated upon PRMT1 knockdown. (B) Confirmation of interactions by immunoprecipitation/Western blot analysis. The upper panel (controls) shows the reduction of PRMT1 and subsequent hy pome thy lation (faster migration and reduced Asym24 staining) of FOP in PRMT1 knockdown cells (shPRMTI ). The middle panel shows that Lasl L, Pelpl , Senp3, Tex10, and Wdr18 preferentially bind hypermethylated FOP. The lower panel confirms the methylation-independent FOP interaction with Set and components of the Prc1 complex, such as Cbx4/Pc2 and Ringl B.

Figure 1 1. (A) Rescue of wild type phenotype. Expression of isocoding but unmatched FOP (HA_Res) rescues the wild type phenotype. FOP shRNA and the resistant FOP mRNA were transcribed from the same lentiviral construct. Overexpressed , HA-tagged FOP appears as a doublet, representing hyper- and hypomethylated FOP. The level of γ- globin relative to Actin is indicated. (B) FOP expression in FL- and PB-derived erythroid progenitors. Western blot analysis for FOP and Actin shows reduced FOP levels in FL cells. The level of FOP relative to Actin is indicated. Quantification was performed using the Odyssey Infrared Imaging System.

Detailed Description of the Invention

Unless otherwise stated, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. Methods, devices, and materials suitable for such uses are now described. All publications cited herein are incorporated herein by reference in their entirety for the purpose of describing and disclosing the methodologies, reagents, and tools reported in the publications that might be used in connection with the invention.

The practice of the present invention employs, unless otherwise indicated, conventional methods of chemistry, biochemistry, molecular biology, cell biology, genetics, immunology and pharmacology, known to those of skill of the art. Such techniques are explained fully in the literature. See, e. g. , Gennaro, A. R., ed. (1990) Remington's

Pharmaceutical Sciences, 18th ed., Mack Publishing Co.; Hardman, J. G., Limbird, L. E., and Gilman, A. G., eds. (2001) The Pharmacological Basis of Therapeutics, 10th ed., McGraw-Hill Co.; Colowick, S. et al., eds., Methods In Enzymology, Academic Press, Inc.; Weir, D. M. , and Blackwell, C. C, eds. (1986) Handbook of Experimental

Immunology, Vols. I-IV, Blackwell Scientific Publications; Maniatis, T. et al., eds. (1989) Molecular Cloning: A Laboratory Manual, 2nd edition, Vols. I-III, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al., eds. (1999) Short Protocols in Molecular Biology, 4th edition, John Wiley & Sons; Ream et al., eds. (1998) Molecular Biology Techniques: An Intensive Laboratory Course, Academic Press; Newton, C. R., and Graham, A., eds. (1997) PCR (Introduction to Biotechniques Series), 2nd ed., Springer Verlag.

In the context of the present invention, administration is performed by standard techniques of cell culture, depending on the reagent, compound or gene construct to be administered. For instance, administration may take place by addition to a cell culture medium, introduction into cells by precipitation with calcium phosphate, by

electroporation, by viral transduction or by other means. If the method of the invention employs a non-human mammal as the test system, the mammal may be transgenic and express the necessary reagents in its endogenous cells.

The term "operably linked" refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner. A control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.

A "candidate", as in "candidate modulator", is a compound which is believed to have a certain function or activity and which is subjected or can be subjected to an assay, for example as described herein, to identify the presence or absence of that function or activity. This may also be referred to as a test compound, compound to be assayed or a compound to be assessed.

"Modulating" or "modulation" refers to changing, such as by increasing or decreasing, the activity of an entity. For example, it refers to increasing the expression of a protein, decreasing the ex pression of a protein, increasing or decreasing the activity of a protein once expressed, or a combination of such features. Preferably, in the context of FOP, modulation refers to the relieving the repression of foetal haemoglobin expression which is mediated by FOP. "Measuring", as used herein, refers to the assessmen of at least one feature associated with a biological or chemical phenomenon. For example, measurement of the activity of a protein can be done by measuring the readout of an assay which is configured such that it is influenced by the protein to be tested. Such assays are well known in the art, and are described further herein. Alternatively, measurement can take the form of assessing the degree of modification to a protein, for instance by assessment of its molecular weight. Moreover, measurement can be the assessment of a direct biological readout, such as the expression of foetal haemoglobin.

An "influence" is an effect which one entity has on another, which is usually measurable in an assay as above. An "erythroid" cell is a cell of the erythroid lineage which expresses globin genes and, preferably, makes haemoglobin. Preferably, it is a human cell. It is not an enucleated red blood cell, which does not produce haemoglobin.

In assays according to the invention, it is advantageous to use cells in which the expression of γ-globin has been reduced, for example as a result of a switch to the production of β-globin as occurs in humans at around birth.

A "component" is the component of a reaction, including a binding reaction. Thus, components can be chemical or biological entities of any kind. In particular, components can be chemicals derived from chemical libraries, synthetic polypeptides or nucleic acids, or cellular polypeptides, lipids or nucleic acids. In the context of the present invention, Friend of PRMT1 (FOP) is the polypeptide defined by van Dijk et al., (van Dijk et al., 2010) and is preferably the polypeptide endogenously expressed by a cell in a test system used in the invention. 1. Nucleic acids for modulating FOP expression

The invention involves modulation of the expression of FOP, and as such nucleic acids which are complementary to the gene or mRNA encoding FOP are useful. Such nucleic acids can be fully complementary, or may comprise one or more mismatches or other differences, consistent with retaining the ability to modulate the expression of FOP. Molecules according to the invention can take the form of antisense nucleic acids, which inhibit the expression of FOP. Advantageously, the nucleic acid molecules comprise ribonucleic acid and are provided in double stranded form, and are useful as interfering RNA. The molecules can be in the form of siRNA, shRNA, miRNA or other RNAi structures. The optimal lengths and structures of such molecules are well known in the art.

In certain embodiments, nucleic acids can be modified either in the backbone, in internucleoside linkages, or at the level of the base.

Specific examples of nucleic acid modifications include oligonucleotides or

polynucleotides containing modified backbones or non-natural internucleoside linkages. Examples of oligonucleotides or polynucleotides having modified backbones include those that retain a phosphorus atom in the backbone, for instance phosphorothioates; chiral phosphorothioates; phosphorodithioates; phosphotriesters; aminoalkyl

phosphotriesters; methyl and other alkyl phosphonates, including 3'-alkylene

phosphonates and chiral phosphonates; phosphinates; phospho ramidates, including 3 '- amino phosphoramidate and arninoalkylphosphoramidat.es; thionophosphoramidates; thionoalkylphosphonates ; thionoalkylphosphotriesters; and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogues of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'.

Alternatively, modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short-chain alkyl or cycloalkyi internucleoside linkages, mixed heteroatom and alkyl or cycloalkyi internucleoside linkages, or one or more short-chain heteroatomic or heterocyclic internucleoside linkages . These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide, and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene- containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; and amide backbones. Other nucleic acids which may be used according to the present invention are those modified in both sugar and the internucleoside linkage, i.e., the backbone of the nucleotide units is replaced with one or more novel groups. The base units are maintained for

complementation with the appropriate polynucleotide target. An example of such an oligonucleotide mimetic includes a peptide nucleic acid (PNA). A PNA oligonucleotide refers to an oligonucleotide where the sugar-backbone is replaced with an amide- containing backbone , in particular an aminoethylglycine backbone. The bases are retained and are bound directly or indirectly to aza-nitrogen atoms of the amide portion of the backbone.

Nucleic acids may also include base modifications or substitutions. As used herein, "unmodified" or "natural" bases include the purine bases adenine (A) and guanine (G) and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). "Modified" bases include but are not limited to other synthetic and natural bases, such as: 5- methylcytosine (5-me-C); 5-hydroxymethyl cytosine; xanthine; hypoxanthine; 2- aminoadenine; 6-methyl and other alkyl derivatives of adenine and guanine; 2-propyl and other alkyl derivatives of adenine and guanine; 2-thiouracil, 2-thiothymine, and 2- thiocytosine; 5-halouracil and cytosine; 5-propynyl uracil and cytosine; 6-azo uracil, cytosine, and thymine; 5-uracil (pseudouracil); 4-thiouracil; 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines; 5-halo, particularly 5- bromo, 5-trifluoromethyl, and other 5-substituted uracils and cytosines; 7- methylguanine and 7-methyladenine; 8-azaguanine and 8-azaadenine; 7-deazaguanine and 7-deazaadenine; and 3-deazaguanine and 3-deazaadenine. Additional modified bases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6- azapyrimidines, and N-2, N-6, and O-6-substituted purines, including 2- aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine.

The nucleic acid agents of the present invention are of at least 5, at least 10, at least 15, or at least 17 bases specifically hybridizable with FOP mRNA. Oligonucleotides of the invention are preferably no more than about 1000 bases in length, more preferably no more than about 100 bases in length. In other preferable embodiments, the

oligonucleotides are no more than 30 nucleotides (or base pairs) in length. The terms "oligonucleotide" and "oligonucleic acid" are used interchangeably and refer to an oligomer or polymer of ribonucleic acid (ribo-oligonucleotide or ribo- oligonucleoside) or deoxyribonucleic acid. These terms include nucleic acid strands composed of naturally occurring nucleobases, sugars and covalent intersugar linkages as well as oligonucleotides having non-naturally occurring portions which function similarly. Such modified or substituted oligonucleotides may be preferred over native forms because of the valuable characteristics including, for example, increased stability in the presence of plasma nucleases and enhanced cellular upta ke.

A "silencing" nucleic acid, as used herein, denotes an oligonucleic acid capable of specifically reducing the level or expression of the gene product, i.e. the level of FOP mRNA, below the level that is observed in the absence of the oligonucleic acid. In some embodiments gene expression is down-regulated by at least 25%, preferably at least 50%, at least 70%, 80% or at least 90%. Expression-inhibiting (down -regulating or silencing) oligonucleic acids include, for example, RNA interfering molecules (RNAi) as detailed herein.

A small interfering RNA (siRNA) molecule is an example of a nucleic acid capable of silencing FOP mRNA. RNA interference is a two-step process. During the first step, which is termed the initiation step, input dsRNA is digested into 21 -23 nucleotide (nt) small interfering RNAs (siRNA), by the action of Dicer, a member of the RNase III family of dsRNA-specific ribonucleases, which cleaves dsRNA (introduced directly or via an expressing vector, cassette or virus) in an ATP-dependent manner. Successive cleavage events degrade the RNA to 19-21 bp duplexes (siRNA), each strand with 2-nucleotide 3' overhangs.

In the effector step, the siRNA duplexes bind to a nuclease complex to form the RNA- induced silencing complex (RISC). An ATP-dependent unwinding of the siRNA duplex is required for activation of the RISC. The active RISC then targets the homologous transcript by base pairing interactions and cleaves the mRNA into 12 nucleotide fragments from the 3' terminus of the siRNA. For more information on RNAi see Tuschl, Chembiochem. 2001 Apr 2;2(4):239-45; Cullen, Nat Immunol. 2002 Jul;3(7):597-9; and Brantl, Biochim Biophys Acta. 2002 May 3;1575(l-3):15-25.

Synthesis of RNAi molecules suitable for use with the present invention can be effected as follows. First, the nucleic acid encoding FOP is optionally scanned downstream for AA dinucleotide sequences . Occurrence of each AA and the 3' adjacent 19 nucleotides is recorded as potential siRNA target sites.

Second, potential target sites are compared to an appropriate genomic database (e.g., human, mouse, rat etc.) using any sequence alignment software, such as the BLAST software available from the NCBI server (www.ncbi.nlm.nih. gov/BLAST/). Putative target sites that exhibit significant homology to other coding sequences are filtered out.

Qualifying target sequences are selected as template for siRNA synthesis. Preferred sequences are those including low G/C content as these have proven to be more effective in mediating gene silencing as compared' to those with G/C content higher than 55 %. Several target sites are preferably selected along the length of the target gene for evaluation. For better evaluation of the selected siRNAs, a negative control is preferably used in conjunction. Negative control siRNA preferably include the same nucleotide composition as the siRNAs but lack significant homology to the genome. Thus, a scrambled nucleotide sequence of the siRNA is preferably used, provided it does not display any significant homology to any other gene.

The siRNA molecules of the invention comprise sense and antisense strands having nucleic acid sequence complementarity, wherein each strand is typically about 18-30 nucleotides in length. For example, each strand of the double stranded region may be e.g. 19- 28, 19-26, 20-25 or 21 -23 nucleotides in length.

In some embodiments, the sense and antisense strands of the present siRNA can comprise two complementary, single-stranded RNA molecules or can comprise a single molecule in which two complementary portions are base-paired and are covalently linked by a single-stranded "hairpin" area (shRNA).

Preferably, one or both strands of the siRNA of the invention can also comprise a 3' overhang. As used herein, a "3' overhang" refers to at least one unpaired nucleotide extending from the 3 '-end of an RNA strand. Thus in one embodiment, the siRNA of the invention comprises at least one 3' overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxy nucleotides) in length, from 1 to about 5 nucleotides in length, from 1 to about 4 nucleotides in length, or from about 2 to about 4 nucleotides in length. In the embodiment in which both strands of the siRNA molecule comprise a 3' overhang, the length of the overhangs can be the same or different for each strand. In a most preferred embodiment, the 3' overhang is present on both strands of the siRNA, and is 2 nucleotides in length. For example, each strand of the siRNA of the invention can comprise 3' overhangs of dithymidylic acid ("TT") or diuridylic acid ("UU"). The invention encompasses interfering nucleic acid molecules which are chemically modified natural and synthetic nucleotide derivatives of silencing nucleic acids. Also encompassed are substitutions, additions or deletions within the nucleotide sequence of the silencing nucleic acid, as long as the required function is sufficiently maintained. Oligonucleotides may share at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity (homology).

Given the guidance provided herein, the nucleic acids of the invention are obtainable according to methods well known in the art. For example, a DNA of the invention is obtainable by chemical synthesis, using polymerase chain reaction (PCR) or by screening a genomic library or a suitable cDNA library prepared from a source believed to possess FOP and to express it at a detectable level.

Chemical methods for synthesis of a nucleic acid of interest are known in the art and include triester, phosphite, phosphoramidite and H-phosphonate methods, PCR and other autoprimer methods as well as oligonucleotide synthesis on solid supports. These methods may be used if the entire nucleic acid sequence of the nucleic acid is known, or the sequence of the nucleic acid complementary to the coding strand is available.

An alternative means to isolate the gene encoding FOP is to use PCR technology as described e. g. in section 14 of Sambrook et al., 1989. This method requires the use of oligonucleotide probes that will hybridize to FOP nucleic acid.

2. FOP as a drug development target According to the present invention, a FOP molecule or a nucleic acid encoding FOP is used as a target to identify compounds, for example lead compounds for

pharmaceuticals, which are capable of modulating the activity of foetal globin genes by modulating the interaction between FOP and its cellular partners. Accordingly, the invention relates to an assay and provides a method for identifying a compound or compounds capable, directly or indirectly, of modulating the activity of FOP, comprising the steps of:

(a) incubating FOP with the compound or compounds to be assessed; and

(b) identifying those compounds which influence the activity of FOP.

According to one embodiment of this aspect of the invention, the assay is configured to detect polypeptides which bind to the FOP molecule.

The invention therefore provides a method for identifying a modulator of foetal globin gene activity, comprising the steps of:

(a) incubating FOP with the compound or compounds to be assessed; and

(b) identifying those compounds which bind to FOP.

Preferably, the method further comprises the step of:

(c) assessing the compounds which bind to FOP for the ability to modulate foetal globin activity in a cell-based assay.

Binding to FOP may be assessed by any technique known to those skilled in the art. Examples of suitable assays include the two hybrid assay system, which measures interactions in vivo, affinity chromatography assays, for example involving binding to polypeptides immobilized on a column, fluorescence assays in which binding of the compound(s) and FOP is associated with a change in fluorescence of one or both partners in a binding pair, and the like. Preferred are assays performed in vivo in cells, such as the two-hybrid assay.

Preferably, the assay according to the invention is calibrated in absence of the compound or compounds to be tested, or in the presence of a reference compound whose activity in binding to FOP is known or is otherwise desirable as a reference value. For example, in a two-hybrid system, a reference value may be obtained in the absence of any compound. Addition of a compound or compounds which modulate the binding affinity of FOP for , for example, PRMT1 or PRMT5, increases the readout from the assay above the reference level, whilst addition of a compound or compounds which decrease this affinity results in a decrease of the assay readout below the reference level. 2b. Compounds which modulate the functional interaction between FOP and PRMT1 or PRMT5

In a second embodiment, the invention may be configured to detect functional interactions between a compound or compounds and FOP. Such interactions will occur either at the level of the regulation of FOP, such that this molecule is itself activated or inactivated in response to the compound or compounds to be tested, or at the level of the modulation of the biological interaction between FOP and PRMT1 or PRMT5. As used herein, "activation" and "inactivation" include modulation of the activity, enzymatic or otherwise, of a compound, as well as the modulation of the rate of production thereof, for example by the activation or repression of expression of a polypeptide in a cell. The terms include direct action on gene transcription in order to modulate the expression of a gene product. Assays which detect modulation of the functional interaction between FOP and PRMT1 or PRMT5 are preferably cell-based assays. For example, they may be based on an assessment of the degree of methylation of FOP, which is indicative of the interaction between FOP and PRMT1/PRMT5. In preferred embodiments, a nucleic acid encoding a FOP molecule is ligated into a vector, and introduced into suitable host cells to produce transformed cell lines that express the FOP molecule. The resulting cell lines can then be produced for

reproducible qualitativ e and/or quantitative analysis of the effect (s) of potential compounds affecting FOP function. Thus FOP expressing cells may be employed for the identification of compounds, particularly low molecular weight compounds, which modulate the function of FOP. Thus host cells expressing FOP, or cells which naturally express endogenous FOP, are useful for drug screening and it is a further object of the present invention to provide a method for identifying compounds which modulate the activity of FOP, said method comprising exposing cells containing heterologous DNA encoding FOP, wherein said cells produce functional FOP, to at least one compound or mixture of compounds or signal whose ability to modulate the activity of said FOP is sought to be determined, and thereafter monitoring said cells for changes caused by said modulation. Such an assay enables the identification of modulators, such as agonists, antagonists and allosteric modulators, of FOP. As used herein, a compound or signal that modulates the activity of FOP refers to a compound that alters the activity of FOP in such a way that the activity of FOP is different in the presence of the compound or signal (as compared to the absence of said compound or signal). For example, FOP may be methylated differently as a result of the activity of the compound or signal. Alternatively, the effect of FOP on gene transcription, such as transcription from E2-dependent promoters, may be influenced.

Cell-based screening assays can be designed by constructing cell lines in which the level of expression of a reporter protein, i. e. an easily assayable protein, such as beta- galactosidase, chloramphenicol acetyltransferase (CAT) or luciferase, is dependent on the regulation of gene transcription by FOP. For example, a reporter gene encoding one of the above polypeptides may be placed under the control of an E2-responsive element which is susceptible to modulation by FOP. It is observed that FOP decreases expression from E2-dependent genes. Such an assay enables the detection of compounds that directly modulate FOP function, such as compounds that antagonize methylation of FOP by PRMT1/PRMT5, or compounds that inhibit or potentiate cellular functions mediated by FOP.

Alternative assay formats include assays which directly assess globin gene expression in a biological system. Such systems preferably use an erythroid cell in which foetal globin gene expression has already been inhibited, and either monitor the expression of globin genes directly, or monitor the expression of a transgene under the control of foetal globin gene sequences.

In a preferred aspect of this embodiment of the invention, there is provided a method for identifying a lead compound for a pharmaceutical useful in the treatment of disease involving aberrant globi n gene expression , comprising:

incubating a compound or compounds to be tested with a FOP molecule and PRMT1 or PRMT5, under conditions in which, but for the presence of the compound or compounds to be tested, PRMT1 or PRMT5 directly or indirectly causes the methylation of FOP with a reference methylation efficiency;

determining the ability of PRMT1 or PRMT5 to methylate, directly or indirectly, FOP in the presence of the compound or compounds to be tested ; and selecting those compounds which modulate the ability of PRMT1 or PRMT5 to methylate FOP with respect to the reference methylation efficiency. In a further preferred aspect, the invention relates to a method for identifying a lead compound for a pharmaceutical, comprising the steps of:

providing a purified FOP molecule;

incubating the FOP molecule with an enzyme known to methylate FOP and a test compound or compounds; and identifying the test compound or compounds capable of modulating the methylation of FOP.

2c. Compounds which modulate FOP activity.

As used herein," FOP activity" may refer to any activity of FOP, including its binding activity, but in particular refers to the activity of FOP in modulating gene expression, particularly repressing gene expression. Accordingly, the invention may be configured to detect the repression of target genes by FOP, and the modulation of this activity by potential therapeutic agents.

Examples of compounds which modulate the gene repression activity of FOP include dominant negative mutants of FOP itself. Such compounds are able to compete for the target of FOP, thus reducing the activity of FOP in a biological or artificial system. Thus, the invention moreover relates to compounds capable of modulating the gene repression activity of FOP.

3. Compounds

In a still further aspect, the invention relates to a compound or compounds identifiable by an assay method as defined in the previous aspect of the invention.

Accordingly, there is provided the use of a compound identifiable by an assay as described herein, for the modulation of the activity of FOP.

Compounds which influence the FOP/PR T interaction, or the interaction of FOP with the transcription machinery of the cell, may be of almost any general description, including low molecular weight compounds, including organic compounds which may be linear, cyclic, polycyclic or a combination thereof, peptides, polypeptides including antibodies, or proteins. In general, as used herein, "peptides", polypeptides" and

"proteins" are considered equivalent.

3a. Antibodies References herein to anti-FOP antibodies, FOP-binding antibodies and antibodies specific for FOP are coterminous and refer to antibodies, or binding fragments derived from antibodies, which bind to FOP in a specific manner and substantially do not cross- react with other molecules present in the circulation or the tissues.

An "antibody" as used herein includes but is not limited to, polyclonal, monoclonal, recombinant, chimeric, complementarity determining region (CDR)-grafted, single chain, bi-specific, Fab fragments and fragments produced by a Fab expression library. Such fragments include fragments of whole anti-FOP antibodies which retain their binding activity for FOP, Fv, F(ab'), F(ab')2 fragments, and F(v) or VH antibody fragments as well as fusion proteins and other synthetic proteins which comprise the antigen-binding site of the anti-FOP antibody. Furthermore, the antibodies and fragments thereof may be human or humanized antibodies, as described in further detail below.

The anti-FOP antibodies and fragments also encompass variants of the anti-FOP antibodies and fragments thereof. Variants include peptides and polypeptides comprising one or more amino acid sequence substitutions, deletions, and/or additions that have the same or substantially the same affinity and specificity of epitope binding as the anti-FOP antibody or fragments thereof.

The deletions, insertions or substitutions of amino acid residues may produce a silent change and result in a functionally equivalent substance. Deliberate amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; and amino acids with uncharged polar head groups having similar hydrophilicity values include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine. Conservative substitutions may be made, for example according to the Table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:

Homologous substitution (substitution and replacement are both used herein to mean the interchange of an existing amino acid residue, with an alternative residue) may occur i.e. like-for-like substitution such as basic for basic, acidic for acidic, polar for polar etc. Nonhomologous substitution may also occur i.e. from one class of residue to anothec or alternatively involving the inclusion of unnatural amino acids - such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine and phen ylglycine.

Thus, variants may include peptides and polypeptides comprising one or more amino acid sequence substitutions, deletions, and/or additions to the anti-FOP antibodies and fragments thereof wherein such substitutions, deletions and/or additions do not cause substantial changes in affinity and specificity of epitope binding. Variants of the anti-FOP antibodies or fragments thereof may have changes in light and/or heavy chain amino acid sequences that are naturally occurring or are introduced by in vitro engineering of native sequences using recombinant DNA techniques. Naturally occurring variants include "somatic" variants which are generated in vivo in the corresponding germ line nucleotide sequences during the generation of an antibody response to a foreign antigen.

Variants of FOP binding antibodies and binding fragments may also be prepared by mutagenesis techniques. For example, amino acid changes may be introduced at random throughout an antibody coding region and the resulting variants may be screened for binding affinity for FOP or for another property. Alternatively, amino acid changes may be introduced into selected regions of the anti-FOP antibody, such as in the light and/or heavy chain CDRs, and/or in the framework regions, and the resulting antibodies may be screened for binding to FOP or some other activity. Amino acid changes encompass one or more amino acid substitutions in a CDR, ranging from a single amino acid difference to the introduction of multiple permutations of amino acids within a given CDR. Also encompassed are variants generated by insertion of amino acids to increase the size of a CDR.

The FOP binding antibodies and fragments thereof may be humanized or human engineered antibodies. As used herein, "a humanized antibody", or antigen binding fragment thereof, is a recombinant polypeptide that comprises a portion of an antigen binding site from a non-human antibody and a portion of the framework and/or constant regions of a human antibody. A human engineered antibody or antibody fragment is a non-human (e.g., mouse) antibody that has been engineered by modifying (e.g., deleting, inserting, or substituting) amino acids at specific positions so as to reduce or eliminate any detectable immunogenicity of the modified antibody in a human.

Humanized antibodies include chimeric antibodies and CDR-grafted antibodies. Chimeric antibodies are antibodies that include a non-human antibody variable region linked to a human constant region. Thus, in chimeric antibodies, the variable region is mostly non-human, and the constant region is human. Chimeric antibodies and method s for making them are described in, for example, Proc. Natl. Acad. Sci. USA, 81 : 6841 - 6855 (1984). Although, they can be less immunogenic than a mouse monoclonal antibody, administrations of chimeric antibodies have been associated with human immune responses (HAMA) to the non-human portion of the antibodies.

CDR-grafted antibodies are antibodies that include the CDRs from a non-human "donor" antibody linked to the framework region from a human "recipient" antibody. Methods that can be used to produce humanized antibodies also are described in, for example, US 5,721 ,367 and 6,180,377.

"Veneered antibodies" are non-human or humanized (e.g., chimeric or CDR-grafted antibodies) antibodies that have been engineered to replace certain solvent-exposed amino acid residues so as to reduce their immunogenicity or enhance their function. Veneering of a chimeric antibody may comprise identifying solvent-exposed residues in the non-human framework region of a chimeric antibody and replacing at least one of them with the corresponding surface residues from a human framework region. Veneering can be accomplished by any suitable engineeri ng technique. Further details on antibodies, humanized antibodies, human engineered antibodies, and methods for their preparation can be found in Antibody Engineering, Springer, New York, NY, 2001.

Examples of humanized or human engineered antibodies are IgG, IgM, IgE, IgA, and IgD antibodies. The antibodies may be of any class (IgG, IgA, IgM, IgE, IgD, etc.) or isotype and can comprise a kappa or lambda light chain. For example, a human antibody may comprise an IgG heavy chain or defined fragment, such as at least one of isotypes, lgG1 , lgG2, lgG3 or lgG4. As a further example, the antibodies or fragments thereof can comprise an lgG1 heavy chain and a kappa or lambda light chain. The anti-FOP antibodies and fragments thereof may be human antibodies - such as antibodies which bind the FOP polypeptides and are encoded by nucleic acid sequences which may be naturally occurring somatic variants of human germline immunoglobulin nucleic acid sequence, and fragments, synthetic variants, derivatives and fusions thereof. Such antibodies may be produced by any method known in the art, such as through the use of transgenic mammals (such as transgenic mice) in which the native immunoglobulins have been replaced with human V-genes in the mammal chromosome.

Human antibodies to target FOP can also be produced using transgenic animals that have no endogenous immunoglobulin production and are engineered to contain human immunoglobulin loci, as described in WO 98/24893 and WO 91/00906. Human antibodies may also be generated through the in vitro screening of antibody display libraries (J. Mol. Biol. (1991 ) 227: 381 ). Various antibody-containing phage display libraries have been described and may be readily prepared. Libraries may contain a diversity of human antibody sequences, such as human Fab, Fv, and scFv fragments, that may be screened against an appropriate target. Phage display libraries may comprise peptides or proteins other than antibodies which may be screened to identify agents capable of selective binding to FOP.

Phage-display processes mimic immune selection through the display of antibody repertoires on the surface of filamentous bacteriophage, and subsequent selection of phage by their binding to an antigen of choice. One such method is described in WO 99/10494. Anti-FOP antibodies can be isolated by screening of a recombinant combinatorial antibody library, preferably a scFv phage display library, prepared using human V _L and V _H cQNAs prepared from mRNA derived from human lymphocytes. Methodologies for preparing and screening such libraries are known in the art. There are commercially available kits for generating phage display libraries.

As used herein, the term "antibody fragments" refers to portions of an intact full length antibody - such as an antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab') ₂ , and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); multispecific antibody fragments such as bispecific, trispecific, and multispecific antibodies (e.g., diabodies, triabodies, tetrabodies); binding-domain immunoglobulin fusion proteins; camelized antibodies; minibodies; chelating recombinant antibodies; tribodies or bibodies; intrabodies; nanobodies; small modular immunopharmaceuticals (SMIP), V _H H containing antibodies; and any other polypeptides formed from antibody fragments.

In the context of the present invention, the terms anti-FOP antibody and FOP binding antibody encompass FOP binding antibody fragments comprising any part of the heavy or light chain sequences of the full length antibodies, and which bind FOP.

The FOP binding antibodies and fragments encompass single-chain antibody fragments (scFv) that bind to FOP. An scFv comprises an antibody heavy chain variable region (V _H ) operably linked to an antibody light chain variable region (V _L ) wherein the heavy chain variable region and the light chain variable region, together or individually, form a binding site that binds FOP. An scFv may comprise a V _H region at the amino-terminal end and a V _L region at the carboxy-terminal end. Alternatively, scFv may comprise a V _L region at the amino-terminal end and a V _H region at the carboxy-terminal end. Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv). An scFv may optionally further comprise a polypeptide linker between the heavy chain variable region and the light chain variable region.

The FOP binding antibodies and fragments thereof also encompass immunoadhesins. One or more CDRs may be incorporated into a molecule either covalently or noncovalently to make it an immunoadhesin. An immunoadhesin may incorporate the CDR(s) as part of a larger polypeptide chain, may covalently link the CDR(s) to another polypeptide chain, or may incorporate the CDR(s) noncovalently. The CDRs permit the immunoadhesin to specifically bind to FOP. The FOP binding antibodies and fragments thereof also encompass antibody mimics comprising one or more FOP binding portions built on an organic or molecular scaffold (such as a protein or carbohydrate scaffold). Proteins having relatively defined three- dimensional structures, commonly referred to as protein scaffolds, may be used as reagents for the design of antibody mimics. These scaffolds typically contain one or more regions which are amenable to specific or random sequence variation, and such sequence randomization is often carried out to produce libraries of proteins from which desired products may be selected. For example, an antibody mimic can comprise a chimeric non-immunoglobulin binding polypeptide having an immunoglobu lin-like domain containing scaffold having two or more solvent exposed loops containing a different CDR from a parent antibody inserted into each of the loops and exhibiting selective binding activity toward a ligand bound by the parent antibody. Non-immunoglobulin protein scaffolds have been proposed for obtaining proteins with novel binding properties.

Anti-FOP antibodies or antibody fragments thereof typically bind to human FOP with high affinity (e.g., as determined with BIAcore), such as for example with an equilibrium binding dissociation constant (K _D ) for FOP of about 15nM or less, 10 nM or less, about 5 nM or less, about 1 nM or less, about 500 pM or less, about 250 pM or less, about 100 pM or less, about 50 pM or less, or about 25 pM or less, about 10 pM or less, about 5 pM or less, about 3 pM or less about 1 pM or less, about 0.75 pM or less, or about 0.5 pM or less.

Methods for generating intracellular antibodies are known in the art. For a review, see Lo et al., Handb Exp Pharmacol. 2008;(181 ):343-73. The introduction of intracellular antibodies (intrabodies) into the cell typically requires the expression of the antibody within the target cell, which can be accomplished by gene therapy. As a result, intrabodies are modified for intracellular localization. Intrabodies are useful for several types of protein targeting: the antibody may remain in the cytoplasm, or it may have a nuclear localization signal, or it may undergo cotranslational translocation across the membrane into the lumen of the endoplasmic reticulum, provided that it is retained in that compartment through a DEL sequence.

Because antibodies ordinarily are designed to be secreted from the cell, intrabodies require special alterations, including the use of single-chain antibodies (scFvs), modification of immunoglobulin VL domains for hyperstability, selection of antibodies resistant to the more reducing intracellular environment, or expression as a fusion protein with maltose binding protein or other stable intracellular proteins. Such optimizations have improved the stability and structure of intrabodies. 3b. Peptides Peptides according to the present invention are usefully derived from FOP,

PR T1/PRMT5 or another polypeptide involved in the functional FOP pathway.

Preferably, the peptides are derived from the domains in FOP or PRMT1/PRMT5 which are responsible for FOP methylation or transcription repression. For example,

Thornberry et al., (1994) Biochemistry 33: 39343940 and Milligan et al., (1995) Neuron 15: 385-393 describe the use of modified tetrapeptides to inhibit ICE protease. In an analogous fashion, peptides derived from FOP, PRMT1/PRMT5 or an interacting protein may be modified, for example with an aldehyde group, chloromethylketone, (acyloxy) methyl ketone or CH20C (0) -DCB group to inhibit the FOP/PRMT interaction.

In order to facilitate delivery of peptide compounds to cells, peptides may be modified in order to improve their ability to cross a cell membrane. For example, US 5,149,782 discloses the use of fusogenic peptides, ion-channel forming peptides, membrane peptides, long-chain fatty acids and other membrane blending agents to increase protein transport across the cell membrane. These and other methods are also described in WO 97/37016 and US 5, 108, 921 , incorporated herein by reference.

Many compounds according to the present invention may be lead compounds useful for drug development. Useful lead compounds are especially antibodies and peptides, and particularly intracellular antibodies expressed within the cell in a gene therapy context, which may be used as models for the development of peptide or low molecular weight therapeutics. In a preferred aspect of the invention, lead compounds and FOP or other target peptides may be co-crystallized in order to facilitate the design of suitable low molecular weight compounds which mimic the interaction observed with the lead compound.

Crystallization involves the preparation of a crystallization buffer, for example by mixing a solution of the peptide or peptide complex with a "reservoir buffer", preferably in a 1 :1 ratio, with a lower concentration of the precipitating agent necessary for crystal formation. For crystal formation, the concentration of the precipitating agent is increased, for example by addition of precipitating agent, for example by titration, or by allowing the concentration of precipitating agent to balance by diffusion between the crystallization buffer and a reservoir buffer. Under suitable conditions such diffusion of precipitating agent occurs along the gradient of precipitating agent, for example from the reservoir buffer having a higher concentration of precipitating agent into the crystallization buffer having a lower concentration of precipitating agent. Diffusion may be achieved for example by vapor diffusion techniques allowing diffusion in the common gas phase. Known techniques are, for example, vapor diffusion methods, such as the "hanging drop" or the "sitting drop" method. In the vapor diffusion method a drop of crystallization buffer containing the protein is hanging above or sitting beside a much larger pool of reservoir buffer. Alternatively, the balancing of the precipitating agent can be achieved through a semipermeable membrane that separates the crystallization buffer from the reservoir buffer and prevents dilution of the protein into the reservoir buffer. In the crystallization buffer the peptide or peptide/binding partner complex preferably has a concentration of up to 30 mg/ml, preferably from about 2 mg/ml to about 4 mg/ml.

Formation of crystals can be achieved under various conditions which are essentially determined by the following parameters: pH, presence of salts and additives, precipitating agent, protein concentration and temperature. The pH may range from about 4.0 to 9.0. The concentration and type of buffer is rather unimportant, and therefore variable, e. g. in dependence wit h the desired pH. Suitable buffer systems include phosphate, acetate, citrate, Tris, MES and HEPES buffers. Useful salts and additives include e. g. chlorides, sulphates and other salts known to those skilled in the art. The buffer contains a precipitating agent selected from the group consisting of a water miscible organic solvent, preferably polyethylene glycol having a molecular weight of between 100 and 20000, preferentially between 4000 and 10000, or a suitable salt, such as a sulphates, particularly ammonium sulphate, a chloride, a citrate or a tartrate. A crystal of a peptide or peptide/binding partner complex according to the invention may be chemically modified, e. g. by heavy atom derivatization. Briefly, such derivatization is achievable by soaking a crystal in a solution containing heavy metal atom salts, or a organometallic compounds, e. g. lead chloride, gold thiomalate, thimerosal or uranyl acetate, which is capable of diffusing through the crystal and binding to the surface of the protein. The location (s) of the bound heavy metal atom (s) can be determined by X-ray diffraction analysis of the soaked crystal, which information may be used e. g. to construct a three-dimensional model of the peptide.

A three-dimensional model is obtainable, for example, from a heavy atom derivative of a crystal and/or from all or part of the structural data provided by the crystallization.

Preferably building of such model involves homology modelling and/or molecular replacement.

Computational software may also be used to predict the secondary structure of the peptide or peptide complex. The peptide sequence may be incorporated into the FOP structure. Structural incoherences, e. g. structural fragments around insertions/deletions can be modelled by screening a structural library for peptides of the desired length and with a suitable conformation. For prediction of the side chain conformation, a side chain rotamer library may be employed. The final homology model is used to solve the crystal structure of the peptide by molecular replacement using suitable computer software. The homology model is positioned according to the results of molecular replacement, and subjected to further refinement comprising molecular dynamics calculations and modelling of the inhibitor used for crystallization into the electron density.

3c. Other Compounds

In a preferred embodiment, the above assay is used to identify peptide but also non- peptide-based test compounds that can modulate FOP activity, such as its activity on gene expression, target polypeptide interactions, or signalling activity. The test compounds of the present invention can be obtained using any of the numerous approaches involving combinatorial library methods known in the art, including: biological libraries, spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution ; the' one-bead one-compound' library method; and synthetic library methods using affinity chromatography selection. These

approaches are applicable to peptide, non-peptide oligomer, or small molecule libraries of compounds (Lam, K. S. (1997) Anticancer Drug Des. 12: 145).

Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. U. S. A. 90: 6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91 : 11422; Zuckermann et al. (1994) . J. Med. Chem. 37: 2678; Cho et al. (1993) Science 261 : 1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2061 ; and in Gallop et al. (1994) J. Med. Chem. 37: 1233. Libraries of compounds may be presented in solution (e. g., Houghten (1992) Biotechniques 13: 412-421 ), or on beads (Lam (1991 ) Nature 354:82-84), chips (Fodor (1993) Nature 364: 555-556), bacteria (Ladner US 5,223,409), spores (Ladner US 5,223,409), plasmids (Cull et al. (1992) Proc Natl Acad Sci USA 89: 1865-1869) or on phage (Scott and Smith (1990) Science 249: 386-390); (Devlin (1990) Science 249: 404-406); (Cwirla et al. ( 1990) Proc. Natl. Acad. Sci. 87: 6378-6382); (Felici (1991 ) J. Mol. Biol. 222:301 -310); (Ladner supra.). If desired, any of the compound libraries described herein may be divided into pre-selected libraries comprising compounds having, e. g., a given chemical structure, or a given activity, e. g., kinase inhibitory activity. Pre-selecting a compound library may further involve performing any art recognized molecular modelling in order to identify particular compounds or groups or combinations of compounds as likely to have a given activity, reactive site, or other desired chemical functionality. Preferably, a computer modelling program, or software, is used to select one or more moieties which can interact with a particular domain. Suitable computer modelling programs include QUANTA (Molecular Simulations, Inc., Burlington, MA (1992) ), SYBYL (Tripos Associates, Inc. , St. Louis, MO (1992)) , AMBER (Weiner et al. , J. Am. Chem. Soc. 106: 765-784 (1984) ) and CHARMM (Brooks et al., J. Comp. Chem. 4: 187-217 (1983)). Other programs which can be used to select interacting moieties include GRI D (Oxford University, U.K.; Goodford et al. , J. Mod. Chem. 28: 849-857 (1985)); MCSS (Molecular Simulations, Inc. ,

Burlington, MA; Miranker, A. and M. Karplus, Proteins: Structure, Function and Genetics 1 1 : 29-34 (1991 )); AUTODOCK (Scripps Research Institute, La Jolla, CA; Goodsell et al., Proteins: Structure, Function and Genetics: 195-202 (1990)); and DOCK (University of California, San Francisco, CA; Kuntz et al. , J. Mol. Biol. 161 : 269-288 (1982). After potential interacting moieties have been selected, they can be attached to a scaffold which can present them in a suitable manner for interaction with the selected domains. Suitable scaffolds and the spatial distribution of interacting moieties thereon can be determined visually, for example, using a physical or computer-generated three dimensional model, or by using a suitable computer program, such as CAVEAT

(University of California, Berkeley, CA; Bartlett et al., in "Molecular Recognition of in

Chemical and Biological Problems", Special Pub. , Royal Chemical Society 78: 182-196 (1989)); three-dimensional database systems, such as MACCS-3D (MDL Information Systems, San Leandro, CA (Martin, Y. C, J. Mod. Chem. 35: 2145-2154 (1992)); and HOOK (Molecular Simulations, Inc.). Other computer programs which can be used in the design and/or evaluation of potential FOP inhibitors include LUDI (Biosym Technologies, San Diego, CA; Bohm, H. J., J. Comp. Aid. Molec. Design: 61 -78 (1992)), LEGEND (Molecular Simulations, Inc. ; Nishibata et al., Tetrahedron 47 : 8985 8990 (1991 )), and LeapFrog (Tripos Associates, Inc.). In addition , a variety of techniques for modeling protein-drug interactions are known in the art and can be used in the present method (Cohen et al. , J. Med. Chem. 33: 883-894 (1994); Navia et al. Current Opinions in Structural Biology 2: 202-210 (1992) ; Baldwin et al. , J. Mod. Chem. 32: 2510-2513

(1989) ; Appelt et al.; J. Mod. Chem. 34: 1925-1934 (1991 ); Ealick et al., Proc. Nat. Acad. Sci. USA 88: 1 1540-1 1544 (1991 )).

Thus, a library of compounds, e. g., compounds that are protein based, carbohydrate based, lipid based, nucleic acid based, natural organic based, synthetically derived organic based, or antibody based compounds can be assembled and subjected, if desired, to a further preselection step involving any of the aforementioned modelling techniques. Suitable candidate compounds determined to be FOP modulators using these modelling techniques may then be selected from art recognized sources, e. g., commercial sources, or, alternatively, synthesized using art recognized techniques to contain the desired moiety predicted by the molecular modelling to have an activity, e. g., FOP inhibitor activity. These compounds may then be used to form e. g., a smaller or more targeted test library of compounds for screening using the assays described herein. In one embodiment, an assay is a cell-based or cell-free assay in which either a cell that expresses, e. g., a FOP polypeptide or cell lysate/or purified protein comprising FOP is contacted with a test compound and the ability of the test compound to alter FOP activity, e. g., it influence on gene expression, or target polypeptide interactions.

Any of the cell-based assays can employ, for example, a cell of eukaryotic or prokaryotic origin. Determining the ability of the test compound to bind to FOP or a FOP target polypeptide can be accomplished, for example, by coupling the test compound with a radioisotope or enzymatic label such that binding of the test compound to the

polypeptide can be determined by detecting the labelled compound in a complex. For example, test compounds can be labelled with ¹²⁵ l, ³⁵ S, ¹⁴ C, ³³ Pn, ³² P, or ³ H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting. Alternatively, test compounds can be enzymatically labeled with, for example, horseradish peroxidase, al kaline phosphata se, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product. It is also within the scope of this invention to determine the ability of a test compound to interact with a target polypeptide without the labelling of any of the interactants. For example, a microphysiometer can be used to detect the interaction of a test compound with FOP or a target polypeptide without the labelling of either the test compound, FOP, or the target polypeptide (McConnell, H. M. et al. (1992) Science 257: 1906-1912). In yet another embodiment, an assay of the present invention is a cell-free assay in which, e.g., FOP and a target polypeptide are contacted with a test compound and the ability of the test compound to alter the interaction is determined.

This interaction may or may not further include the methylation of FOP. Binding of the test compound to the target polypeptide can be determined either directly or indirectly. Determining the ability of the candidate compound to bind to either polypeptide can also be accomplished using a technology such as real-time Biomolecular Interaction Analysis (BIA) (Sjolander, S. and Urbaniczky, C. (1991 ) Anal. Chem. 63: 2338-2345 and Szabo et al. (1995) Curr. Opin. Struct. Biol. 5: 699-705). As used herein, "BIA" is a technology for studying bispecific interactions in real time, without labelling any of the interactants (e.g., BIAcore). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules. In many drug screening programs which test libraries of compounds and natural extracts, high throughput assays are desirable in orde r to maximize the number of compounds surveyed in a given period of time. Assays which are performed in cell-free systems, such as may be performed using purified or semi-purified proteins, are often preferred as "primary" screens in that they can be generated to permit rapid development and relatively easy detection of an alteration in a molecular target which is mediated by a test compound. Moreover, the effects of cellular toxicity and/or bioavailability of the test compound can be generally ignored in the in vitro system, the assay instead being focused primarily on the effect of the drug on the molecular target as may be manifest in an alteration of binding affinity with upstream or downstream elements. Accordingly, in an exemplary screening assay of the present invention, the compound of interest is contacted with the FOP polypeptide with or without a FOP target or a peptide which modifies FOP, and detection and quantification of methylation of FOP is determined by assessing a compound's efficacy at inhibiting the formation of methylated FOP using, for example, a radioisotope. The efficacy of the test compound can be assessed by generating dose response curves from data obtained using various concentrations of the test compound. Moreover, a control assay can also be performed to provide a baseline for comparison. In another embodiment, various candidate compounds are tested and compared to a control compound with a known activity, e. g., an inhibitor having a known generic activity, or, alternatively, a specific activity, such that the specificity of the test compound may be determined.

In more than one embodiment of the above assay methods of the present invention, it may be desirable to immobilize the target polypeptide to facilitate separation of complexed from uncomplexed forms or accommodate automation of the assay.

Methylation or binding of FOP and a target polypeptide in the presence or absence of a test compound can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein can be provided which adds a domain that allows one or both of the proteins to be bound to a matrix. For example, glutathione-S- transferase/polypeptide fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtitre plates, which are then combined with the test compound and incubated under conditions conducive to phosphorylation or complex formation (e. g., at physiological conditions for salt and pH). Following incubation, the beads or microtitre plate wells are washed to remove any unbound components, the matrix immobilized in the case of beads, and the complex is measured either directly or indirectly, for example, as described above. Alternatively, the complexes can be dissociated from the matrix, and the level of target polypeptide binding or phosphorylation activity can be determined using standard techniques. Other techniques for immobilizing proteins on matrices can also be used in the screening assays of the invention In yet another aspect of the invention, FOP and a target polypeptide can be used as "bait proteins "in a two-hybrid assay or three-hybrid assay (see, e. g., U. S. Patent No. 5,.283, 317; Zervos et al. (1993) Cell 72: 223-232; Madura et al. (1993) J. Biol. Chem. 268: 12046-12054; Bartel et al. (1993)

Biotechniques 14: 920-924; Iwabuchi et al. (1993) Oncogene 8: 1693-1696; and Brent W094/10300), to identify other proteins or compounds, which bind to or interact with FOP and/or a FOP target polypeptide. Moreover, GFP fusions with FOP can be used to assay for protein interactions, as shown in van Dijk et al (2010).

This invention further pertains to novel agents identified by the above-described screening assays and to processes for producing such agents by use of these assays. Accordingly, in one embodiment, the present invention includes a compound or agent obtainable by a method comprising the steps of any one of the aforementioned screening assays (e. g., cell-based assays or cell-free assays). For example, in one embodiment, the invention includes a compound or agent obtainable by any of the methods described herein.

Accordingly, it is within the scope of this invention to further use an agent, e. g., a FOP modulator or compound identified as described herein in an appropriate animal model. For example, an agent identified as described herein can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent.

Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. In addition, such an agent if deemed appropriate, may be administered to a human subject, preferably a subject at risk for a haemoglobin disorder.

The present invention also pertains to uses of novel agents identified by the above- described screening assays for diagnoses, prognoses, and treatments of any of the disorders described herein. Accordingly, it is within the scope of the present invention to use such agents in the design, formulation, synthesis, manufacture, and/or production of a drug or pharmaceutical composition for use in diagnosis, prognosis, or treatment of any of the disorders described herein.

4. Pharmaceutical Compositions In a preferred embodiment, there is provided a pharmaceutical composition comprising a compound or compounds identifiable by an assay method as defined in the previous aspect of the invention.

A pharmaceutical composition according to the invention is a composition of matter comprising a compound or compounds capable of modulating the activity of FOP as an active ingredient. Typically, the compound is in the form of any pharmaceutically acceptable salt, or e. g., where appropriate, an analog, free base form, tautomer, enantiomer racemate, or combination thereof. The active ingredients of a pharmaceutical composition comprising the active ingredient according to the invention are contemplated to exhibit excellent therapeutic activity, for example, in the treatment of globinopathies or other diseases associated with aberrant haemoglobin expression, when administered in amount which depends on the particular case. For example, the invention encompasses any compound that can alter FOP gene regulation. In one embodiment, the compound can inhibit FOP activity which results in the activation of genes involved in foetal globin expression, or in the repression of genes involved in foetal globin repression. For example, a compound which inhibits FOP activity and thereby increases foetal globin gene expression is a preferred compound for treating, e. g., sickle cell anaemia.

In another embodiment, one or more compounds of the invention may be used in combination with any art recognized compound known to be suitable for treating the particular indication in treating any of the aforementioned conditions. Accordingly, one or more compounds of the invention may be combined with one or more art recognized compounds known to be suitable for treating the foregoing indications such that a convenient, single composition can be administered to the subject. Dosage regimens may be adjusted to provide the optimum therapeutic response.

For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.

The active ingredient may be administered in a convenient manner such as by the oral, intravenous (where water soluble), intramuscular, subcutaneous, intranasal, intradermal or suppository routes or implanting (e. g. using slow release molecules).

Depending on the route of administration, the active ingredient may be required to be coated in a material to protect said ingredients from the action of enzymes, acids and other natural conditions which may inactivate said ingredient.

In order to administer the active ingredient by other than parenteral administration, it will be coated by, or administered with, a material to prevent its inactivation. For example, the active ingredient may be administered in an adjuvant, co administered with enzyme inhibitors or in liposomes. Adjuvants contemplated herein include resorcinols, non-ionic surfactants such as polyoxyethylene oleyl ether and nhexadecyl polyethylene ether.

Liposomes include water-in-oil-in-water CGF emulsions as well as conventional liposomes.

The active ingredient may also be administered parenterally or intraperitoneally. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of superfactants.

The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thirmerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the active ingredient in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the sterilized active ingredient into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof. When the active ingredient is suitably protected as described above, it may be orally administered, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in hard or soft shell gelatin capsules, or it may be compressed into tablets, or it may be incorporated directly with the food of the diet. For oral therapeutic administration, the active ingredient may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. The amount of active ingredient in such therapeutically useful compositions in such that a suitable dosage will be obtained.

The tablets, troches, pills, capsules and the like may also contain the following: a binder such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin may be added or a flavouring agent such as peppermint, oil of wintergreen , or cherry flavouring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier.

Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both. A syrup or elixir may contain the active ingredient, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavouring such as cherry or orange flavour. Of course, any material used in preparing any dosage unit form should be pharmaceutically pure and substantially non-toxic in the amounts employed. In addition, the active ingredient may be incorporated into sustained-release preparations and formulations. As used herein "pharmaceutically acceptable carrier and/or diluent" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the mammalian subjects to be treated; each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the novel dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active material and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding such as active material for the treatment of disease in living subjects having a diseased condition in which bodily health is impaired.

The principal active ingredients are compounded for convenient and effective administration in effective amounts with a suitable pharmaceutically acceptable carrier in dosage unit form. In the case of compositions containing supplementary active ingredients, the dosages are determined by reference to the usual dose and manner of administration of the said ingredients.

In a further aspect there is provided the active ingredient of the invention as hereinbefore defined for use in the treatment of disease either alone or in combination with art recognized compounds known to be suitable for treating the particular indication.

Consequently there is provided the use of an active ingredient of the invention for the manufacture of a medicament for the treatment of disease associated with aberrant globin expression.

Moreover, there is provided a method for treating a condition associated with aberrant globin expression, comprising administering to a subject a therapeutically effective amount of a compound or compounds identifiable using an assay method as described above.

The invention is further described, for the purpose of illustration only, in the following examples.

Examples

Section 1 : Identification of FOP Arginine methylation is a widespread posttranslational modification in eukaryotic cells that is catalyzed by a family of enzymes called protein arginine methyltransferases (PRMTs). PRMTs use S-adenosyl-L-methionine (SAM) as a donor to transfer methyl groups to the side chain nitrogens of arginine residues. To date, nine PRMTs have been identified in humans and they have been subdivided in two major classes. Type I enzymes (PRMT1 , PRMT3, PRMT4, PRMT6, and PRMT8) promote the formation of asymmetrical ω-Ν°, N ^G -dimethylated arginines (aDMA), and type II enzymes (PRMT5 and PRMT7) form symmetrical co-N ^G , N' ^G -dimethylated arginines (sDMA). co-N ^G - monomethylarginine (MMA) is thought to be an intermediate formed by both enzyme types. So far, methyltransferase activity of PRMT2 and PRMT9 has not been formally demonstrated (Bedford and Clarke, 2009; Pal and Sif, 2007). Although methylation does not change the overall charge of an arginine residue, it modulates intermolecular interactions by increasing steric hindrance and hydrophobicity and decreasing hydrogen bonding capacity. Furthermore, methylation protects the reactive guanidino groups of arginine residues against inappropriate modification by dicarbonyl reagents

(Fackelmayer, 2005).

PRMT1 is ubiquitously expressed and is the predominant PRMT activity in mammalian cells. Although PRMT1 -deficient embryonic stem cell lines are viable, PRMT1 knockout mice die around the onset of gastrulation, consistent with a fundamental and non- redundant function (Pawlak et al., 2000). The majority of previously identified PRMT1 substrates are nucleic acid binding proteins that play a role in RNA processing, DNA repair, signal transduction, and transcription (Bedford and Clarke, 2009; Pahlich et al., 2006). How PRMT1 recognizes its specific substrates and to what degree this is regulated by additional factors is only partially understood. PRMT1 has a high affinity for glycine-arginine-rich (GAR) regions and the majority of identified methylated arginines are located within such domains (Bedford and Clarke, 2009). The crystal structure of PRMT1 in complex with a GAR peptide reveals three different binding channels for these motifs (Zhang and Cheng, 2003). GAR regions are a common feature of many RNA- binding proteins (RBPs), including the heterogeneous ribonucleoproteins (hnRNPs). These proteins play roles in mRNA processing and transport and contain up to 65% of total nuclear DMA (Boffa et al., 1977; Liu and Dreyfuss, 1995). Although the arginines in these regions have been recognized as key residues in RNA-protein interactions, it remains to be determined whether methylation has a profound effect on protein-RNA interactions. In contrast, a role for arginine methylation in regulating protein-protein interactions is well documented. Methylation of the yeast hnRNPs Npl3p and Hrpl p and the RBPs Sam68 and RNA helicase A is critical for their proper cellular localization (Shen et al., 1998; Yu et al., 2004). Methylation of Sam68 regulates binding to SH3 domain-containing proteins, while binding to WW domains is unaffected (Bedford et al., 2000). Other interactions controlled by DMA include transcription factor complexes, such as the binding of Nip45 to Nfat and the binding of Cbp/p300 to Creb (Mowen et al., 2004; Xu et al. , 2001 ).

Another mechanism of substrate recognition is regulated via controlled recruitment. For example, PRMTs are recruited to promoters and other regulatory elements to control gene expression by methylation of histones and components of the transcription machinery (Pal and Sif, 2007). Recruitment of PRMT1 by nuclear hormone receptors and the transcription factors p53, YY1/Drbp76, and Upstream stimulatory factor 1 (Usf1 ) results in local methylation of histone H4 at R3 (An et al., 2004; Huang et al., 2007; Rezai-Zadeh et al., 2003; Wang et al., 2001 ). This modification is critical for subsequent histone acetylation and further activation events (Huang et al., 2005).

Little is known about the regulation of the enzymatic activity of PRMT1. As most target proteins appear to be entirely methylated at any given time, PRMT1 is considered to be a constitutively active enzyme. PRMT1 activity is abolished when dimerization is prevented and it has been suggested that PRMT1 is catalytically active only in the form of oligomers (Lim et al., 2005; Zhang and Cheng , 2003). In all cell lines tested, PRMT1 is a component of a 250-400 kDa complex, both in the cytoplasm and in the nucleus. It is unclear whether additional proteins are a constitutive component of this complex or whether it reflects a large PRMT1 polymer. Furthermore, only a limited number of PRMT1 -interacting proteins have been described to affect PRMT1 activity under certain conditions. CCR4-associated factor 1 (Caf1) and the related proteins B-cell translocation gene 1 (Btg1 ) and Btg2/Tis21 bind PRMT1 and stimulate its activity toward selected substrates, while Protein phosphatase 2A (Pp2a) has an inhibitory effect (Duong et al., 2005; Lin et al., 1996; Robin-Lespinasse et al., 2007).

The identification and characterization of PRMT1 -interacting proteins is critical for further understanding the role of PRMT1 in different cellular processes, and may answer questions regarding the regulation of PRMT1 activity and specificity. Thus far, PRMT1 substrates and PRMT1 -interacting proteins have been identified through candidate approaches, serendipitous discovery, in vitro substrate screens, and proteomic strategies that identify proteins with methylated arginines (Boisvert et al. , 2003; Ong et al., 2004; Wada et al., 2002). Here we describe single step isolation of PRMT1 - associating proteins using a biotinylation-proteomics approach , and the characterization of a novel PRMT1 -interacting protein, which we termed Friend of PRMT1 (FOP). Materials and methods

Constructs and cells

The coding sequence of PRMT1 (isoform 1 ) was amplified from mouse erythroblast cDNA by PCR using Expand (Roche), cloned into pMT2_HA and pMT2_myc (Kaufman et al., 1989) using Sail and A/of/, and verified by sequencing. After introduction of the 23- aa biotinylation tag, HA_bio_PRMT1 was subcloned into the erythroid expression vector pEV-neo (Needham et al., 1992), and electropo rated into mouse erythroleukemic (MEL) cells expressing the BirA biotin ligase (de Boer et al., 2003). The cDNA of FOP was obtained from RZPD/imaGenes (Berlin, Germany), clone IRAKp961 L04114Q2. The first 25-aa were introduced using Sall/Hindlll, after subcloning the 930 bp HindllllEcoRV fragment into pBluescript (Stratagene). Full-length FOP was cloned into pMT2_HA using Sail and EcoRI sites. GST-FOP fusion constructs were generated by cloning PCR fragments into pGEX3X (Pharmacia). Gfp and Cherry were cloned in frame at the N- terminus of FOP and PRMT1 , respectively. MEL, 293T, U20S, and MCF7 cells were grown in Dulbecco modified Eagle medium (DMEM; Life Technologies) supplemented with 10% FCS. Before hormone treatment, MCF7 cells were grown for 3-4 days in phenol red -free DMEM supplemented with 5% charcoal-dextran -stripped fetal calf serum following addition of 200 nM 17 -estradiol (E2; Sigma) for the indicated times.

Size fractionation Size fractionation of protein complexes was carried out on an AKTA FPLC apparatus with a Superose 6 10/30 column (Amersham Biosciences). Fractions were precipitated with trichloroacetic acid and analyzed by Western blotting.

Transient transfection, immunoprecipitation, and Western blot analysis

Transfection of 293T cells, immunoprecipitation, GST pull downs, and Western blot analysis were performed as described previously (van Dijk et al., 2000). Membranes were blocked in 0.6% bovine serum albumin (BSA), incubated with appropriate antibodies, and developed with the use of enhanced chemoluminescence (ECL; NEN), or by using the Odyssey Infrared Imaging System (Li-Cor Biosciences). The following primary antibodies were used: PRMT1 (07-404), PRMT5 (07-405), H4R3me2 (07-213), AcH4 (06-598), H3K27me3 (07-449), Asym24 (07-414), and Sym10 (07-412) from

Upstate; HA (monoclonal F7, sc-7392), HA (polyclonal Y1 1 , sc-805), Myc (sc-40), Actin (sc-1616), She (sc-967), and Lamin B (sc-6216) from Santa Cruz; LSD (ab18036), H3K9me2 (ab1220), and H3 (ab1791 ) from Abeam. Rat monoclonal antibodies against the N- and C-terminus of FOP (KT59 recognizing aa 1 -90 and KT64 recognizing aa 206- 249, respectively) were generated by Absea Biotechnology Ltd (Beijing, China).

Additionally, polyclonal antibodies were raised in rabbits using the same epitopes.

Cellular fractionation was performed as described previously (Pasqualini et al., 2001 ). Subcellular fractionation (cytoplasm, nucleoplasm, chromatin, and nuclear matrix) was performed as described (Nair et al., 2004) .

Cellular extracts and mass spectrometry

Procedures involving biotinylated proteins were performed as described previously with minor modifications (de Boer et al., 2003). Cytoplasmic and nuclear extracts were generated using the method of Andrews and Faller from 5 x 10 ⁸ MEL cells (Andrews and Faller, 1991 ). Tryptic digestion was performed on paramagnetic streptavidin beads. Mass spectrometry was performed as described previously (Bajpe et al., 2007).

Nanoflow LC-MS/MS was performed on an 1 100 series capillary LC system (Agilent Technologies) coupled to an LTQ-Orbitrap mass spectrometer (Thermo) operating in positive mode and equipped with a nanospray source. Peptide mixtures were trapped on a ReproSil C18 reversed phase column (Dr Maisch GmbH; column dimensions 1.5 cm * 100 pm, packed in-house) at a flow rate of 8 μΙ/min. Peptide separation was performed on ReproS il C18 reversed phase column (Dr Maisch GmbH; column dimensions 15 cm 50 μητι, packed in-house) using a linear gradient from 0 to 80% B (A = 0.1 % formic acid; B = 80% (v/v) acetonitrile, 0.1 % formic acid) in 70 min and at a constant flow rate of 200 nl/min using a splitter. The column eluent was directly sprayed into the ESI source of the mass spectrometer. Mass spectra were acquired in continuum mode; fragmentation of the peptides was performed in data-dependent mode. Peak lists were automatically created from raw data files using the Mascot Distiller software (version 2.1 ;

MatrixScience). The Mascot search algorithm (version 2.2, MatrixScience) was used for searching against the NCBInr database (release 20090430; total number of sequences: 8,483,808). The peptide tolerance was typically set to 10 ppm and the fragment ion tolerance to 0.8 Da. A maximum number of 2 missed cleavages by trypsin were allowed and carbamidomethylated cysteine and oxidized methionine were set as fixed and variable modifications, respectively. The Mascot score cut-off value for a positive protein hit was set to 75. Typical contaminants, also present in purifications using BirA-only MEL cell extracts, were omitted from the table (de Boer et al., 2003) . Lentiviral mediated knockdown and siRNAs

After subcloning into pSuper (Brummelkamp et al., 2002), the H1 promoter and shRNA coding sequences against PRMT1 (GATTGTCAAAGCCAACAAG) and FOP

(GGAGC AGC TGGAC AACCAA) were cloned into a modified

pRRLsin.sPPT.CMV.GFP.Wpre lentiviral vector (Follenzi et al., 2002). Lentivirus was produced by transient transfection of 293T cells according to standard protocols

(Zufferey et al., 1997). Knockdowns in MCF7 were performed using siRNA transfection as described previously (Wagner et al., 2006). The sequences of siFOP are: 5'- GGAGCAGCUGGACAACCAA-3', S'-GUUAGUCAACACAUCUGUAAA-S', and 5'- GACUCUUGUUAGUCAACACAU-3' (sense strand indicated; Genepharma, Shanghai).

Confocal imaging

Cells were spotted on poly-prep slides (Sigma), fixed with 4% paraformaldehyde in PBS, permeabilized with 0.1 % Triton X-100, and blocked in 1% BSA / 0.05% Tween 20 in PBS. Primary antibody incubation was performed in blocking solution for 16 hrs at 4°C. Cells were imaged using the meta 510 confocal laser scanning microscope (meta

LSM510, Zeiss) using AIM software provided. Images were recorded as an 8bit image stack of 512x512 with a voxel size of 47x47x250nm of a 4x line average. The point spread function was determined by scanning green fluorescent beads with a diameter of 100nm (Duke Scientific). The chromatic shift was determined by scanning multi-colored fluorescent beads with a diameter of 500nm (500nm TetraSpeck beads, Invitrogen). The empirically obtained PSF was used for deconvolving the image stacks with the classic maximum of likelihood (CMLE) algorithm that is implemented in the Huygens

deconvolution, visualization, analysis and archiving software package 3.0 for linux (Scientific Volume Imaging). After deconvolution, the image stack was corrected for chromatic shift. FRAP/FLIP experiments were performed as described (Essers et al., 2006).

Reverse transcription, ChIP and QPCR

Reverse transcription (RT) and ChI P were performed as previously described (Wagner et al., 2006). For RT-QPCR, GAPDH gene transcription was used as a reference for normalization. The following primers were used: GAPDH, 5'-

AGCCACATCGCTCAGACAC-3' (forward), S'-GCCCAATACGACCAAATCC-S' (reverse); pS2, 5'-GCCTTTGGAGCAGAGAGGA-3' (forward), 5'-TAAAACAGTGGCTCCTGGCG-3' (reverse); Lactoferrin, 5'-TAAGGTGGAACGCCTGAAAC-3' (forward), 5'- CCATTTCTCCCAAATTTAGCC-3' (reverse); TGFa, 5'-TGCTGCCACTCAGAAACAGT-3' (forward), 5'-ATCTGCCACAGTCCACCTG-3' (reverse). For ChlP-QPCR

immunoprecipitated chromatin was amplified using the following primers: pS2 gene promoter 5'-GTTGTCACGGCCAAGCCTTTT-3' (forward), 5'- AGGATTTGCTGATAGACAGAGACGAC-3' (reverse); GAPDH: gene promoter 5'-

CCATCTCAGTCGTTCCCAAAGTCC-3' (forward); 5'-GATGGGAGGTGATCGGTGCT-3' (reverse). The ChIP results were quantified as recently described (Hyllus et al., 2007).

Example 1 Identification of PRMT1 -associated proteins by biotinylation tagging and mass spectrometry

Tagged PRMT1 (HA_bio_PRMT1) was generated by fusing an HA epitope and a short (23 aa) Bio-tag to its N-terminus. The Bio-tag is efficiently biotinylated by the bacterial BirA biotin ligase, which is coexpressed in stably transfected mouse erythroleukemia (MEL) cells (de Boer et al., 2003). HA_bio_PRMT1 was expressed below endogenous levels to reduce the likelihood that non-physiological interactions would be identified. Biotinylated PRMT1 was efficiently recovered from MEL extracts with magnetic streptavidin beads, and associated with endogenous PRMT1 in both the cytoplasm and the nucleus (Fig. 1A). Size fractionation experiments showed that HA_bio_PRMT1 behaved similar to endogenous PRMT1 , eluting in fractions with a molecular mass range of 250-400 kDa (Tang et al., 1998) (Fig. 1 B). Complexes with a molecular mass of more than 1 MDa were detected exclusively in the nuclear fraction. In contrast, PRMT1 with a C-terminal HA_bio-tag appeared to be monomeric (42 kDa; not shown). These experiments show that HA_bio_PRMT1 is faithfully incorporated into oligomeric complexes. PRMT1 -associating proteins were identified by streptavidin pull down followed by nanoflow liquid chromatography-tandem mass spectrometry (nanoLC- MS/MS) and compared to samples from cells expressing BirA alone. Putative PRMT1- interacting proteins identified in two independent HA_bio_PRMT1 pull downs are listed in Fig. 1C. The candidates are predominantly RNA-binding proteins involved in RNA processing (Rbmxrt/hnRNPG, hnRNPU, and Lsm14a), RNA stability (Serbpl ), RNA export (Refbp2), translation (Msy4), and ribosome synthesis (Nol5a). All proteins contain GAR domains, suggesting that these proteins are direct targets for PRMT activity.

Indeed, methylation of hnRNPs, including Rbmxrt/hnRNPG and hnRNPU, is well documented, while members of the SM/LSm family are previously identified targets of PRMT5 (Boisvert et al., 2002; Liu and Dreyfuss, 1995). Multiple known PRMT1 targets/- interacting proteins, including additiona l hnRNPs, U5 snRNP components, Sam68, and fibrillarin were also detected, but these abundant proteins were also found in the BirA- only control samples as observed previously (de Boer et al., 2003). A newly identified putative PRMT1 -interacting protein is encoded by the homolog of the human C1orf77 gene. The protein has not been characterized previously, and as it interacts with PRMT1 (see also Fig. 3), we named it Friend of PRMT1 (FOP). FOP has an expected molecular weight of 27 kDa and is highly conserved in all vertebrates (Fig. 1 D), while no orthologs could be identified in yeast, worms, and flies. The protein has no known conserved domains, but its central sequence cons ists of a GAR domain that contains 26 RG/GR repeats, while the C-terminus harbors a duplication of the sequence LDXXLDAYM (where "X" is any amino acid). Furthermore, we note that the sequence of the GAR domain shows more variation (70 % conservation) when compared to the N- and C-termini (both 80% conservation). Example 2

Characterisation of FOP

Intracellular localization and expression pattern of FOP

For further characterization of the protein, monoclonal antibodies were raised against the N- and C-terminus of FOP. Both clone KT59 (specific for the N-terminus) and KT64 (specific for the C-terminus) recognized a protein running at the expected molecular weight of 27 kDa (Fig. 2A) and additional proteins of 23 and 25 kDa. These proteins were not detected in cells expressing an shRNA agai nst FOP, suggesting that they represent full length FOP and smaller isoforms, respectively. It is possible that the 23 or 25 kDa isoform represent FOP_S, an isoform lacking the first 25 amino acids at the N- terminus (see also Fig. 1 D). In immunoprecipitation (IP) experiments, the different isoforms of FOP were purified by both KT59 and KT64, although the 25 kDa isoform is masked by the IgG light chain of KT59 (Fig. 2B). Full-length FOP appeared as a doublet, indicating that it might be a target for posttranslational modifications. Analysis by confocal microscopy showed that FOP is a nuclear protein localized to DAPI-low regions with a punctuate/speckle-like distribution (Fig. 2C, see also Fig. 5). Next, we determined the expression of FOP in E16.5 mouse embryos. We find that FOP has a wide, but not ubiquitous expression pattern (Fig. 2D). Tissues expressing FOP include the heart (H), lungs (Lu), gut (G), kidney (K), submandibular gland (S), thymus (T), follicles of the vibrissae (V), muscle, brown fat (Br), and neuronal cells, including brain (B), olfactory epithelium (O), and dorsal root ganglia (DRG) (F ig. 2D). Identical results were obtained with KT59 (not shown).

FOP is a novel Prm1 -interacting protein To validate the interaction between PRMT1 and FOP, we transiently co-transfected HA_FOP with wild type Myc_PRMT1 or the enzymatic inactive mutant

Myc_PRMT1_E171 Q in 293T cells. Wild type and mutant Myc_PR T1 , as well as endogenous PRMT1 are efficiently recovered in HA_FOP IPs, confirming the interaction between PRMT1 and the FOP protein (Fig. 3A). Cotransfection with wild type PRMT1 resulted in a slightly slower migration of HA_FOP, suggesting that FOP is modified by PRMT1 (Fig. 3A). Incubation with an antibody that specifically recognizes asymmetrically methylated arginines (Asym24) shows that FOP is indeed an aDMA-containing protein. Next, the interaction between endogenous proteins was studied using monoclonal antibodies KT59 and KT64. Fig. 3B shows that PRMT1 is detected in FOP purifications (left panel) and that FOP co- immunoprecipitates with PRMT1 (right panel), confirming that the endogenous proteins interact.

To identify the region of FOP that interacts with PRMT1 , we generated a panel of FOP deletion mutants fused to the C-terminus of GST. The deletion series included two potential isoforms (FOP_L and FOP_S that lacks the first 25 amino acids, Fig. 1 D) and progressive N- and C-terminal deletions (Fig. 3C). The GST_FOP fusions were incubated with whole cell extracts from MEL cells as a source of PRMT1. These results were obtained under stringent washing conditions (Ripa buffer containing 0.1 % SDS, 0.5 % DOC, 1% NP40), indicating that the observed interactions are specific. The C-terminal half of the central GAR domain (from R153 to G205) was identified as the major interaction site, in line with previous observations that PRMT1 has a high affinity for GAR sequences (Bedford and Clarke, 2009; Pahlich et al., 2006). A second, weaker binding domain was found within the first 90 amino acids in the N-terminus (Fig. 3C; see also Fig. 4D). FOP is methylated by PRMT1 and PRMT5 in vitro and in vivo

To investigate whether FOP is a target of PRMT activity, we performed in vitro methylation assays using purified GST_PRMT1 , GST_PRMT4, GST_PRMT6, and immuno precipitated PRMT5, in the presence of methyl- ¹⁴ C-labeled SAM. Core histones served as a positive control (Fig. 4A and B, upper panels). We find that PRMT1 is the only type I enzyme tested that is able to methylate FOP (Fig. 4A, lower panel). In addition, PRMT5 can use FOP as a substrate (Fig. 4B, lower panel), opening the possibility that FOP contains symmetrically methylated arginines in vivo. To investigate this further, we performed lentiviral-mediated knockdown of PRMT1 and PRMT5 in MEL cells. Reduction of the protein level of PRMT1 resulted in a dramatic shift of the migration pattern of FOP (Fig. 4C, upper panel), suggesting that FOP is heavily modified by PRMT1. To test this directly, endogenous FOP was immunoprecipitated from control cells and PRMT1 knockdown cells, and stained with the Asym24 antibody. This revealed that asymmetrical arginine methylation of FOP is severely reduced in the absence of PRMT1 (Fig. 4C, lower panel). This shows that: (1 ) target arginines of PRMT1 in FOP are methylated in vivo, (2) PRMT1 is the major type 1 enzyme that methylates FOP in vivo, and (3) the reduced mobility of FOP on SDS-PAGE correlates with the presence of aDMA residues.

Since PRMT5 can methylate FOP in vitro, we stained similar blots with antibodies specific for PRMT5 and symmetrically methylated arginines (Sym10). In control cells the interaction between FOP and PRMT5 can be detected (Fig. 4C). However, much more PRMT5 is co-immunoprecipitated with HA-FOP in the absence of PRMT1 , indicating that PRMT1 and PRMT5 compete for binding to FOP. In line with the binding of PRMT5 and the in vitro methylation experiments, sDMA residues are detected in FOP, both in the presence and absence of PRMT1 (Fig. 4C). Interestingly, the increased binding of PRMT5 to FOP in the absence of PRMT1 does not result in elevated symmetrical methylation of FOP. In contrast, the Sym10 staining is less in the PRMT1 knockdown, suggesting that PRMT1 positively affects symmetric dimethylation of FOP. Partially knocking down PRMT5 did not reduce Sym 10 staining of FOP, although this did reduce the expression level of FOP to ~75% of that observed in control cells. It is unclear whether this is the result of incomplete PRMT5 depletion or that other type II PRMT enzymes can methylate FOP in vivo. This could not be tested, as a complete knockdown of PRMT5 resulted in cell death, as has been previously shown for transformed B cells (Pal et al., 2007). We conclude that FOP contains asymmetric and symmetric DMA residues in vivo, and that symmetric methylation partially depends on the presence of PRMT1.

To map the arginines that are methylated within the GAR, we generated internal deletion constructs that lacked either the N-terminal or the C-terminal half of the GAR, or the entire GAR (AGR1 , Δ GR2, and Δ GR3, respectively; Fig. 4D). Binding of PRMT1 and PR T5 (Fig. 4D, right panels) as well as methylation status (Fig. 4D, left panels) are not reduced when the N-terminal half is deleted, indicating that the majority of methylated arginines is not in this region. In contrast, methylation and PRMT binding of FOPAGR2 is undetectable (PRMT5) or greatly reduced (PRMT1). Hence, the major PRMT-interaction surface and methylation sites appear to overlap. Consistent with the interaction mapping, FOPAGR2 and FOPAGR3 are still able to recruit reduced levels of PRMT1 via the N- terminal domain (FOPAC3, Fig. 3C).

FOP is a chromatin-associated protein We next examined FOP and PRMT1 co-localization by confocal microscopy and fractionation experiments. Fig. 5A shows that HA_FOP is a nuclear protein exclusively localized to DAPI-low regions with a punctuate/speckle-like distribution (Fig. 5A; green signal), identical to endogenous FOP (Fig. 2C). Staining for endogenous PRMT1 revealed that, within the nucleus, PRMT1 also localizes to DAPI-low regions, resulting in a high degree of co-localization with FOP (Fig. 5A; red signal). Compared to FOP, the distribution of PRMT1 is more diffuse. The distribution and pattern of FOP localization did not change in PRMT1 -depleted cells (Fig. 5A, lower panel). Next, control MEL cells and PRMT1 knockdown cells were fractionated in cytoplasmic,

cytoskeletal/nucleoplasmic, chromatin-associated, and nuclear matrix-associated proteins. An antibody directed against the C-terminus of PRMT1 showed that PRMT1 localized to the cytoplasm and the soluble nuclear fraction (Fig. 5A). In contrast, FOP was found exclusively in the nucleus, with the majority of the protein tightly associated to chromatin. Reducing the level of PRMT1 resulted in hypomethylated FOP but did not change its distribution pattern. This is consistent with the confocal data and shows that the association of FOP to chromatin does not depend on its asymmetrical methylation (Fig. 5A).

In light of their co-purification (Figs. 1 , 3, and 4) and co-localization (Fig. 5A), it is surprising that PRMT1 and FOP localize to different cellular compartments after biochemical fractionation (Fig. 5B). To investigate this further we performed live-imaging of FOP and PRMT1 , N-terminally tagged with Green Fluorescent Protein (Gfp) and

Cherry, respectively. We first confirmed that Gfp_FOP and Cherry_PRMT1 still interact by co-immunoprecipitation experiments (not shown). We then co-expressed the proteins stably in U20S cells. We selected clones with low expression levels of both proteins. Western blot analysis showed that Cherry_PRMT1 was expressed at approximately 25% of the endogenous PRMT1 level (not shown). In fractionation experiments, Gfp_FOP was distributed similarly to that seen with HA_FOP in MEL cells (not shown). The localization of Gfp_FOP was strictly nuclear with a punctuate/speckle-like distribution in DAPI-low areas similar to endogenous and HA-tagged FOP in MEL cells (Figs. 2C and 5A, respectively). Time-lapse imaging shows that Gfp_FOP is completely released from condensed chromosomes during mitosis and relocates in ~1 hour after cell division (not shown). To determine the mobility of FOP and PRMT1 in vivo, we combined

fluorescence recovery after p_hotobleaching (FRAP) and fluorescence ]oss in

pjiotobleaching (FL IP) experiments. One half of a nucleus was bleached, and the recovery of fluorescence was subsequently monitored in the bleached part of the nucleus during 1800 seconds. At the same time, the fluorescence loss in the unbleached part of the nucleus was monitored until a new equilibrium in fluorescence distribution was reached between the bleached and the unbleach ed regions. This experiment revealed that Cherry_PRMT1 behaves as a soluble protein with diffusion characteristics of an oligomeric complex (Fig. 5C), consistent with previous data on Gfp_PRMT1 (Herrmann et al., 2005). In contrast, Gfp_FOP is a highly immobile protein with a diffusion rate more than 50 times slower than PRMT1 (Fig. 5C). Although the N-terminal tags may influence the behavior of both fusion proteins, these experiments indicate that FOP is not a component of a stable PRMT1 -holoenzyme complex in vivo (Goulet et al., 2007). To determine the fraction of PRMT1 that is associated to FOP, nuclear extracts were immuno-depleted for endogenous FOP. Fig. 5D shows that complete depletion of FOP has a marginal effect on the amount of PRMT1 in the supernatant, indicating that only a small fraction of PRMT1 is bound to FOP. This is further demonstrated by size fractionation experiments: the majority of FOP and PRMT1 do not elute in the same fractions (Fig. 5E).

FOP co-localizes with facultative heterochromatin

The localization of FOP was further characterized by co-immunostaining with antibodies against different histone modifications. First, we used an antibody that was raised against asymmetrically dimethylated R3 of histone H4 (H4R3me2as). This methylation is performed by PRMT1 and is a critical step in subsequent transcription activation events, including histone acetylation (Huang et al., 2005; Strahl et al., 2001 ). Staining for H4R3me2as, as well as for acetylated H4 (acH4), a mark for active genes, revealed distinctive fluorescent spots (Fig. 6A, B). Although these spots resided within

euchromatic (DAPI-low) regions of the nucleus, they showed only minor co-localization with FOP. H3K9me2 has been implicated in heterochromatin formation and gene silencing (Bannister et al. , 2001) and marks condensed DNA. As expected, H3K9me2 staining showed an almost complete overlap with these heterochromatic regions (intense DAPI staining, Fig. 6C). FOP was excluded from those regions that are positive for H3K9me2 staining, showing that FOP is not localizing to condensed DNA , in line with the observation that Gfp_FOP detaches from mitotic chromosomes. Methylation of K27 of histone H3 (H3K27me3) creates binding sites for the Polycomb repressive complex 1 (Min et al., 2003) and is therefore a mark for facultative heterochromatin. Staining with an antibody that specifically recognized H3K27me3 identified bright spots and a more diffuse staining throughout the ΌΑΡΙ-low" regions (Fig. 6D). The diffuse signal showed a striking co-localization with FOP, while only a minority of the bright spots was found to be double positive fo r FOP and H3K27me3. We conclude that at this level of resolution FOP is mainly associated with facultative heterochromatin in vivo.

FOP is critical for estrogen-dependent gene activation

The observations that FOP is tightly bound to chromatin after biochemical fractionation and co-localizes with facultative heterochromatin in vivo suggest that it might be involved in transcriptional regulation. The significance of PRMT1 in transcriptional regulation has been most vividly demonstrated in the model of nuclear hormone signaling. Recruitment of PRMT1 and the subsequent methylation of H4R3 are critical events in estrogen receptor (ER)-regulated activation of the pS2 gene, (TFF1 , encoding trefoil factor 1 ). Since the molecular events leading to activation of this gene have been described in detail (Metivier et al., 2003; Metivier et al., 2006), we studied the functional importance of FOP in estradiol (E2) induction of pS2 expression in MCF7 cells, a human E2-responsive breast cancer cell line. Cells were seeded in hormone-free medium and subsequently transfected with siRNAs against Gfp (siGfp), PRMT1 (siPRMTI ), and FOP (siFOP), respectively. Western blot analysis showed suppression of endogenou s PRMT1 and FOP 48 hours after siRNA treatment (Fig. 7A). Furthermore, reduction of PRMT1 expression resulted in partial hypomethylation of FOP, as demonstrated by the appearance of a faster migrating species of FOP and reduced staining for Asym24 (Fig. 7A). To analyze ER-regulated transcription, cells were induced with E2 for various times and RNA was isolated. As described previously (Wagner et al., 2006), real-time quantitative PCR (RT-QPCR) revealed that the E2-induced transcriptional activity of endogenous pS 2 was reduced upon siPRMTI transfection compared with siGfp transfection (Fig. 7B). Interestingly, reduction of the endogenous FOP level had a more dramatic inhibitory effect on pS2 induction. Similar results were obtained with two siRNAs which target different regions of the FOP mRNA (not shown). Next, we tested the effect of reduced FOP levels on the E2-induced transcription of Lactoferrin and TGFD , two other PRMT1 -dependent E2-inducible genes. Consistent with the observations for the pS2 gene, E2-induced transcriptional activity of these genes was diminished upon siPRMTI transfection and almost absent after siFOP transfection (Fig. 7C). Furthermore, reduced FOP levels resulted in lower pre-induction transcript levels of these genes. To investigate whether the transcriptional effect of FOP correlates with binding of FOP to the pS2 promoter, we performed ChIP analysis following E2 induction. Chromatin was precipitated with antibodies against FOP, ERa, and control IgG, and analyzed by PCR for the presence of pS2 promoter fragments including the ERE (estrogen response element). Promoter occupancy by FOP was not detected in uninduced cells, but in E2-treated cells a transient interaction was observed with a peak at 15 minutes post-induction (Fig. 7D, left panel). Promoter occupancy of ERa also increased 15 minutes after E2 addition and remained constant over the measured period (Fig. 7D, right panel). Next, we tested whether FOP depletion affected the binding of ERa to the pS2 promoter. MCF7 cells were transfected with siGFP and siFOP. Two days later, cells were induced with E2 for 20 minutes and analyzed by ChIP using antibodies against FOP, ERa, and control IgG. As expected, reduced FOP levels (Fig. 7E) resulted in reduced FOP binding to the pS2 promoter (Fig. 7F. left panel). Although transfection with siFOP did not change the protein level of ERa (Fig. 7E), a dramatic reduction in promoter occupancy by ERa was observed (Fig. 7F, right panel). Together these data show that FOP is required for E2-inducible expression of the ERa target genes investigated, and for binding of ERa to the pS2 promoter region.

Section 2: FOP represses foetal globin expression

In humans, the composition of the hemoglobin tetramer changes several times during development. The final 'switch' occurs around birth, when fetal hemoglobin (HbF), containing 2 a-globin and 2 γ-globin polypeptides, is replaced by adult hemoglobin (HbA), containing 2 a-globin and 2 β-globin polypeptides (Schechter, 2008). In the large majority of healthy adults, HbF contributes ~1 % to total Hb. In contrast, higher levels of HbF are observed in subpopulations of β-thalassemia and sickle cell anemia patients, significantly alleviating the disease phenotype (Bank, 2006). The molecular mechanism of globin switching and the variation in adult γ-globin repression are not well understood, but most likely involve developmental stage-specific changes in transcription factors and/or chromatin remodeling complexes. I ndeed, fetal- and adult-specific splice variants of the repressor BCL1 1 A have recently been shown to have a crucial role in proper γ- globin regulation (Sankaran et al., 2008). Genome-wide association studies indicate that common SNPs in the BCL11A, HSB1L-MYB and HBB loci account for <50% of the variation in HbF levels, suggesting that additional factors are involved (Lettre et al., 2008; Menzel et al., 2007; Thein et al., 2009; Thein et al., 2007; Uda et al., 2008). Here, we show that the recently identified chromatin factor Friend of PRMT1 (FOP) plays a critical role in fetal globin expression.

Methods

Cells

Mouse erythroid progenitor cultures were derived from fetal livers of E12.5 PAC8 embryos (de Krom et al., 2002) and expanded as described previously (von Lindern et al., 2001 ). Human erythroid progenitors were cultured from buffy coats in serum free medium as described previously (Leberbauer et al., 2005). Beta-thalassemia patients were transfusion-dependent, non-responders to hydroxyurea treatment, and negative for the Xmnl polymorphism. Patient #4 was positive for beta globin gene defect IVSI-5/IVSI- 5; patient #9 was positive for C39/C39.

RNA analysis

PCR analysis was performed with Platinum Taq (Invitrogen). Primers used are listed in Table 1. Quantitative S1 nuclease protection assays were performed as described (Wijgerde et al., 1996).

Table 1. Sequences of primers used for PCR analysis

Name PCR primer sequence 5'-3'

mouse. _8V_F GTTTTGGCTAGTCACTTCGG

mouse_ ey R CAAGGAACAGCTCAGTATTC

mouse_ ^" βΗ1 F TTGCCAAGGAATTCACCCCA

mouse. _βΗ1_ R C T C AATG C AGT C C C C ATGGA

mouse. F TTSAGGCTCCTGGGCAATAT

mouse_ pmaj _R TGCCAACAACTGACAGATGC

mouse_ ^" a F ^" TTGGCTAGCCACCACCCT

mouse_ _a_R CCAAGAGGTACAGGTGCA

mouse_ _actin_ F GATTACTGCTCTGGCTCCT

mouse_ actin _R TGGAAGGTGGACAGTGAG

human. ^" ε F TGGAGATGCTATTAAAAACATGGAC

human. ε R AGAATAATCACCATCACGTTACCC

human _Y_F GACCGTTTTGGCAATCCATTTC

human _y_R TTGTATTGCTTGCAGAATAAAGCC humanJ3_F ACAACTGTGTTCACTAGCAACC

humanJ3_R GTTGCCCATAACAGCATCAGG

human_a_F GGTCAACTTCAAGCTCCTAAGC

human_a_R GCTCACAGAAGCCAGGAACTTG

humanj!;_F TGAGCGAGCTGCACGCCTAC

humanj;_R GTACTTCTCGGTCAGGACAGA

human_GAPDH_F AGCCACATCGCTCAGACAC

human GAPDH R CATTGATGGCAACAATATCCAC

Lentivirus-mediated knockdown and FOP expression

Clones from The RNAi Consortium (TRC; (Root et al., 2006)) were used for knockdown experiments in mouse cells, including control (SHC002) and FOP (TRCN0000182232). For knockdown experiments in human cells, a short hairpin against FOP

(GGAGC AGC TGGAC AACC AA) and a control sequence (GACTCCAGTGGTAATCTAC) were cloned into a modified pRRLsin.sPPT.CMV.GFP.Wpre lentiviral vector (Follenzi et al., 2002). Efficient knockdown of FOP could also achieved with clones from the TRC collection (Moffat et al., 2006): GTTAGTCAACACATCTGTAAA (TRCN0000121881 ), GATGGAGAATAGACCCTCTGT (TRCN0000140444), and

GCACCACCAAGATGTCTCTAA (TRCN00001 40477), which were obtained from Sigma. For PRMT1 knockdown, the H1 promoter and shRNA coding sequences agai nst PRMT1 (GATTGTCAAAGCCAACAAG) were cloned into a modified

pRRLsin.sPPT.CMV.GFP.Wpre lentiviral vector (Follenzi et al., 2002). Lentivirus was produced by transient transfection of 293T cells according to standard protocols

(Zufferey et al., 1997). For rescue experiments, an isocoding FOP cDNA replaced the GFP in the pRRLsin. sPPT.CMV.GFP.Wpre lentiviral vector containing the short hairpin against FOP (GGAGCAGC TGGAC AACCAA) . Introduction of three base changes (indicated in bold and underlined: GGAGCAACTAGATAACCAA) in the FOP cDNA rendered the resulting FOP mRNA resistant to degradation by said FOP short hairpin.

Identification of FOP-interacting proteins

Tagged FOP (bio_FOP) was generated by fusing a short (23 aa) bio-tag to its N- terminus and stably transfected in BirA expressing MEL cells. Bio_FOP was purified from control cells and from cells that had been depleted for PRMT1 (shPRMTI ) to obtain hypomethylated FOP. FOP-associating proteins were identified by streptavidin pull down followed by nanoflow liquid chromatography-tandem mass spectrometry (nanoLC- MS/MS) and compared to samples from cells expressing BirA alone as described (Van Dijk et al 2010). Western blotting and Immunohistochemistry

Immunoprecipitations and Western blot analysis were performed as described (van Dijk et al., 2000). Nitrocellulose membranes were blocked in 1 % bovine serum albumin (BSA), incubated with appropriate antibodies, and analyzed by using the Odyssey Infrared Imaging System (Li-Cor Biosciences). The following primary antibodies were used: FOP (KT64) from Absea Biotechnology, Sox6 (NBP1 -19537) and Tafl a/ΐ β (B100- 56353) from Novus, Prmtl (07-404), Asym24 (07-414), Cbx4 (09-029), H3K27me3 (07- 449), and H4 (07 -108) from Millipore, Pelpl (A300-876A) from Bethyl, Tex10 ( 17372), LasI L (16010), Senp3 (17659), and Wdr18 (15165) from Protein Tech Group, and Actin (sc-1616), BCL11A (sc-56013), and Hemoglobin-γ (sc-21756) from Santa Cruz. For immunohistochemistry, cells were spotted on poly-prep slides (Sigma), fixed with 4% paraformaldehyde, permeabilized in 10 m citric acid (pH 6.0), and blocked with 5% BSA. Primary antibody incubation was performed in blocking solution for 16 hrs at 4°C, followed by peroxidase staining.

Example 3

The Role of FOP in Globin Expression

To study whether FOP had a role in the expression of globin genes, we used growth factor-dependent, differentiation competent cultures of mouse fetal liver cells containing a transgenic single-copy integration of the entire human β-globin locus. This allowed a study of the expression of both mouse and human globin genes. Lent iviral-mediated knockdown of FOP expression resulted in >80% reduction of FOP protein 7 days after transduction (Figure 8A). PCR analysis shows the specific up regulation of the mouse sy and βΗ1 genes, as well as the human γ-globin gene in FOP-depleted cells (Figure 8A). No changes were observed in the levels of β-actin, a-globin and fima} ^' transcripts, indicating that overall differentiation was not affected.

Next, we studied the role of FOP on globin expression in human erythroid progenitor (HEP) cells cultured from adult peripheral blood. To deplete FOP in human cells, we used a second lentiviral construct expressing a different shRNA sequence and green fluorescent protein (GFP) as a marker. Eight days after transduction, >97% of the cells were positive for GFP (not shown), and the FOP protein level was reduced by >80% (Figure 8 B). Cells were grown for 3 more days in medium supporting differentiation, and analyzed. We observed a marked increase in the ε- and γ-globin transcripts, while the level of β-globin mRNA declined, suggesting a competitive advantage for the expression of the embryonic/fetal β-like globin genes when FOP expression is reduced (Figure 8B). Furthermore, ζ-globin, the embryonic gene within the a-globin cluster, was also reactivated in these experiments (Figure 8B). Although the embryonic ζ- and ε-globins were clearly induced in the FOP-depleted cells, their contribution to total globin mRNA output was <1 %, as calculated by quantitative PCR (not shown). We therefore focused on γ- and β-globin regulation. To directly measure the ratio of γ- and β-globin transcripts, we used quantitative S1 nuclease protection assays. This revealed a dose-dependent induction of γ-globin, varying from 15% of total β-like globin in cells with a partial knockdown of FOP, to 31 % in cells in which FOP was almost completely depleted (Figure 8C). In cells transduced with lentivirus expressing no or a non-targeting shRNA, the γ-globin level did not change compared to non-transduced cells (Figure 8C).

Lentiviral knockdown of p53 had no influence on γ-globin expression, further

demonstrating that elevated γ-globin levels are not the result of activating the RNAi machinery per se (not shown).

Next, we tested whether the induction of γ-globin mRNA was accompanied by elevated levels of HbF using high performance liquid chromatography (HPLC). In the FOP knockdown cells, HbF contributed significantly to the amount of total Hb (Figures 8D-E). Immunohistochemistry (IHC) showed that, although to a varying degree, all cells express γ-globin, indicating that the elevated HbF level is not the result of a minor responsive cell population (Figure 9A).

It is possible that the elevated γ globin expression by the FOP knockdown is effectuated via BCL11A, the only known potent repressor of the γ-globin genes. We therefore tested whether the FOP knockdown changes the expression of BCL11A. The results show that BCL11A levels are unaffected when γ-globin is induced in FOP-depleted cells (Figure 9C). Furthermore, purification experiments did not reveal a FOP-BCL11A interaction, suggesting that BCL1 1A is not involved in the elevated γ-globin expression. Interestingly, the level of the putative γ-globin regulator Sox6 (Xu et al., 2010) was decreased upon FOP knockdown (Figure 9C), indicating that depletion of FOP might modulate SOX6- dependent silencing of γ-globin in adult HEP cells. Next, we tested whether reduction of FOP expression resulted in elevated γ-globin expression in erythroid progenitors from β-thalassemic patients. Although these cells already expressed relatively high levels of HbF, γ-globin expression was doubled after FOP depletion in both β-thalassemic samples tested (Figure 9D). This indicates that interference with FOP activity could be an effective approach to increase HbF in β- hemoglobinopathy patients. I ntriguingly, FOP is a target of methylation by the PRMT1 and PRMT5 arginine methyltransferases (van Dijk et al., 2010). These enzymes are thought to regulate globin expression by dictating histone modifications (Huang et al. , 2005; Li et al.; Zhao et al., 2009). Although it is currently unclear how FOP regulates γ- globin expression, we suggest that -in addition to histones- it is a crucial PRMT target for globin gene regulation. To investigate this further, we set out to identify FOP-interacting proteins. Tagged FOP ( bio_FOP) was generated by fusing a short (23 aa) bio-tag to its N-terminus and stably transfected in BirA expressing MEL cells. Bio_FOP was expressed at endogenou s levels to reduce the likelihood that non-physiological interactions would be identified. Bio_FOP was purified from control cells and from cells that had been depleted for PRMT1 (shPRMTI ) to obtain hypomethylated FOP. FOP- associating proteins were identified by streptavidin pull down followed by nanoflow liquid chromatography-tandem mass spectrometry (nanoLC-MS/MS) and compared to samples from cells expressing BirA alone. LasI L, Pelpl , Senp3, Tex10, and Wdr18 were not detected or detected with a reduced score when FOP became hypomethylated upon PRMT1 knockdown (Figure 10A). Binding of PRMT1 , PRMT5, Set, Histone H4 and H3K27me3 and components of the Prc1 complex, such as Cbx4/Pc2 and RingI B, was not methylation-dependent. These results were confirmed by immunoprecipitation of Bio_FOP (Figure 10B). Furthermore, the phenotype of FOP knockdown, i.e. increased γ-globin

expression, was rescued by co-expression of an isocoding but unmatched FOP mRNA (Figure 11 A). We also examined the level of FOP protein in FL and PB- derived HEP cells in multiple samples (Figures 9B and 1 1 B). FL cells express -2.5 times less FOP than PB cells, suggesting that modulation of FOP

expression might be involved in globin switching during development.

Collectively, the results reported here identify FOP and FOP-interacting proteins as novel potential therapeutic targets in β-globin related disorders. References

An, W., Kim, J., and Roeder, R.G. (2004). Ordered cooperative functions of PRMT1 , p300, and CARM 1 in transcriptional activation by p53. Cell 117, 735-748.

Andrews, N.C., and Faller, D.V. (1991 ). A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19, 2499.

Bajpe, P.K., van der Knaap, J.A., Demmers, J.A., Bezstarosti, K., Bassett, A., van Beusekom, H.M., Travers, A.A., and Verrijzer, CP. (2007). Deubiquitylating Enzyme UBP64 Controls Cell Fate Through Stabilization of the Transcriptional Repressor Tramtrack. Mol Cell Biol.

Bank, A. (2006). Regulation of human fetal hemoglobin: new players, new complexities. Blood 107, 435-443.

Bannister, A.J., Zegerman, P., Partridge, J.F., Miska, E.A., Thomas, J.O., Allshire, R.C., and Kouzarides, T. (2001). Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature 410, 120-124.

Bedford, M.T., and Clarke, S.G. (2009). Protein arginine methylation in mammals: who, what, and why. Mol Cell 33, 1-13.

Bedford, M.T., Frankel, A., Yaffe, M.B., Clarke, S., Leder, P., and Richard, S. (2000). Arginine methylation inhibits the binding of proline-rich ligands to Src homology 3, but not WW, domains. J Biol Chem 275, 16030-16036.

Berry, M., Grosveld, F., and Dillon, N. (1992). A single point mutation is the cause of the Greek form of hereditary persistence of fetal haemoglobin. Nature 358, 499-502.

Boffa, L.C., Karn, J., Vidali, G., and Allfrey, V.G. (1977). Distribution of NG, NG,- dimethylarginine in nuclear protein fractions. Biochem Biophys Res Commun 74, 969- 976.

Boisvert, F.M., Cote, J., Boulanger, M.C., Cleroux, P., Bachand, F., Autexier, C, and Richard, S. (2002). Symmetrical dimethylarginine methylation is required for the localization of SMN in Cajal bodies and pre-mRNA splicing. J Cell Biol 159, 957-969. Boisvert, F.M., Cote, J., Boulanger, M.C., and Richard, S. (2003). A proteomic analysis of arginine-methylated protein complexes. Mol Cell Proteomics 2, 1319-1330.

Brummelkamp, T.R., Bernards, R., and Agami, R. (2002). A system for stable expression of short interfering RNAs in mammalian cells. Science 296, 550-553. de Boer, E., Rodriguez, P., Bonte, E., Krijgsveld, J., Katsantoni, E., Heck, A., Grosveld, F., and Strouboulis, J. (2003). Efficient biotinylation and single-step purification of tagged transcription factors in mammalian cells and transgenic mice. Proc Natl Acad Sci U S A 100, 7480-7485. de Krom, M., van de Corput, M., von Lindern, M., Grosveld, F., and Strouboulis, J. (2002). Stochastic patterns in globin gene expression are established prior to transcriptional activation and are clonally inherited. Mol Cell 9, 1319-1326.

Duong, F.H., Christen, V., Berke, J.M., Penna, S.H., Moradpour, D., and Heim, M.H. (2005). Upregulation of protein phosphatase 2Ac by hepatitis C virus modulates NS3 helicase activity through inhibition of protein arginine methyltransferase 1. J Virol 79, 15342-15350.

Essers, J., Houtsmuller, A.B., and Kanaar, R. (2006). Analysis of DNA recombination and repair proteins in living cells by photobleaching microscopy. Methods Enzymol 408, 463-485.

Fackelmayer, F.O. (2005). Protein arginine methyltransferases: guardians of the Arg? Trends Biochem Sci 30, 666-671.

Follenzi, A., Sabatino, G., Lombardo, A., Boccaccio, C, and Naldini, L. (2002). Efficient gene delivery and targeted expression to hepatocytes in vivo by improved lentiviral vectors. Hum Gene Ther 13, 243-260.

Garner, C, Silver, N., Best, S., Menzel, S., Martin, C, Spector, T.D., and Thein, S.L. (2004). Quantitative trait locus on chromosome 8q influences the switch from fetal to adult hemoglobin. Blood 104, 2184-2186.

Goulet, I., Gauvin, G., Boisvenue, S., and Cote, J. (2007). Alternative splicing yields protein arginine methyltransferase 1 isoforms with distinct activity, substrate specificity, and subcellular localization. J Biol Chem 282, 33009-33021. Hardison, R.C., Chui, D.H., Giardine, B., Riemer, C, Patrinos, G.P., Anagnou, N., Miller, W., and Wajcman, H. (2002). HbVar: A relational database of human hemoglobin variants and thalassemia mutations at the globin gene server. Hum Mutat 19, 225-233.

Herrmann, F., Lee, J., Bedford, M.T., and Fackelmayer, F.O. (2005). Dynamics of human protein arginine methyltransferase 1(PRMT1) in vivo. J Biol Chem 280, 38005-38010.

Huang, S., Li, X., Yusufzai, T.M., Qiu, Y., and Felsenfeld, G. (2007). USF1 recruits histone modification complexes and is critical for maintenance of a chromatin barrier. Mol Cell Biol 27, 7991 -8002.

Huang, S., Litt, M., and Felsenfeld, G. (2005). Methylation of histone H4 by arginine methyltransferase PRMT1 is essential in vivo for many subsequent histone

modifications. Genes Dev 19, 1885-1893.

Hyllus, D., Stein, C, Schnabel, K., Schiltz, E., Imhof, A., Dou, Y., Hsieh, J., and Bauer, U.M. (2007). PRMT6-mediated methylation of R2 in histone H3 antagonizes H3 K4 trimethylation. Genes Dev 21 , 3369-3380. Jiang, J., Best, S., Menzel, S., Silver, N., Lai, M.I., Surdulescu, G.L., Spector, T.D. , and Thein, S.L. (2006). cMYB is involved in the regulation of fetal hemoglobin production in adults. Blood 108, 1077-1083.

Kaufman, R.J., Davies, M.V., Pathak, V.K., and Hershey, J.W. (1989). The

phosphorylation state of eucaryotic initiation factor 2 alters translational efficiency of specific mRNAs. Mol Cell Biol 9, 946-958.

Leberbauer, C, Boulme, F., Unfried, G., Huber, J., Beug, H., and Mullner, E.W. (2005). Different steroids co-regulate long-term expansion versus terminal differentiation in primary human erythroid progenitors . Blood 105, 85-94.

Lettre, G., Sankaran, V.G., Bezerra, M.A., Araujo, A.S., Uda, M., Sanna, S., Cao, A., Schlessinger, D., Costa, F.F., Hirschhorn, J.N., et al. (2008). DNA polymorphisms at the BCL11A, HBS1 L-MYB, and beta-globin loci associate with fetal hemoglobin levels and pain crises in sickle cell disease. Proc Natl Acad Sci U S A 105, 11869-11874.

Li, X., Hu, X., Patel, B., Zhou, Z., Liang, S., Ybarra, R., Qiu, Y., Felsenfeld, G., Bungert, J., and Huang , S. H4R3 methylation facilitates {beta}-globin transcription by regulating histone acetyltransferase binding and H3 acetylation. Blood. Lim, Y., Kwon, Y.H., Won, N.H., Min, B.H., Park, I.S., Paik, W.K., and Kim, S. (2005). Multimerization of expressed protein-arginine methyltransferases during the growth and differentiation of rat liver. Biochim Biophys Acta 1723, 240-247.

Lin, W.J., Gary, J.D., Yang, M.C., Clarke, S., and Herschman, H.R. (1996). The mammalian immediate-early TIS21 protein and the leukemia-associated BTG1 protein interact with a protein-arginine N-methyltransferase. J Biol Chem 271 , 15034-15044.

Liu, Q., and Dreyfuss, G. (1995). In vivo and in vitro arginine methylation of RNA -binding proteins. Mol Cell Biol 15, 2800-2808.

Menzel, S., Garner, C, Gut, I., Matsuda, F., Yamaguchi, M., Heath, S., Foglio, M., Zelenika, D. , Boland, A., Rooks, H., et al. (2007). A QTL influencing F cell production maps to a gene encoding a zinc-finger protein on chromosome 2p15. Nat Genet 39, 1197-1 199.

Metivier, R., Penot, G., Hubner, M.R., Reid, G., Brand, H., Kos, M., and Gannon, F. (2003). Estrogen receptor-alpha directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115, 751-763.

Metivier, R., Reid, G., and Gannon, F. (2006). Transcription in four dimensions: nuclear receptor-directed initiation of gene expression. EMBO Rep 7, 161 -167.

Min, J., Zhang, Y., and Xu, R.M. (2003). Structural basis for specific binding of Polycomb chromodomain to histone H3 methylated at Lys 27. Genes Dev 17, 1823-1828. Moffat, J., Grueneberg, D.A., Yang, X., Kim, S.Y., Kloepfer, A.M., Hinkle, G., Piqani, B., Eisenhaure, T.M., Luo, B., Grenier, J.K., et al. (2006). A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 124, 1283-1298.

Mowen, K.A., Schurter, B.T., Fathman, J.W., David, M., and Glimcher, L.H. (2004). Arginine methylation of NIP45 modulates cytokine gene expression in effector T lymphocytes. Mol Cell 15, 559-571.

Nair, S.S., Mishra, S.K., Yang, Z., Balasenthil, S., Kumar, R., and Vadlamudi, R.K. (2004). Potential role of a novel transcriptional coactivator PELP1 in histone H1 displacement in cancer cells. Cancer Res 64, 6416-6423. Needham, M., Gooding, C, Hudson, K., Antoniou, M., Grosveld, F., and Hollis, M.

(1992). LCR/ EL: a versatile system for high-level expression of heterologous proteins in erythroid cells. Nucleic Acids Res 20, 997-1003.

Ong, S.E., Mittler, G., and Mann, M. (2004). Identifying and quantifying in vivo methylation sites by heavy methyl SILAC. Nat Methods 1 , 119-126.

Pahlich, S., Zakaryan, R.P., and Gehring, H. (2006). Protein arginine methylation:

Cellular functions and methods of analysis. Biochim Biophys Acta 1764, 1890-1903.

Pal, S., Baiocchi, R.A., Byrd, J.C., Grever, M.R., Jacob, ST., and Sif, S. (2007). Low levels of miR-92b/96 induce PRMT5 translation and H3R8/H4R3 methylation in mantle cell lymphoma. Embo J 26, 3558-3569.

Pal, S., and Sif, S. (2007). Interplay between chromatin remodelers and protein arginine methyltransferases. J Cell Physiol 213, 306-315.

Pasqualini, C, Guivarc'h, D., Bamier, J.V., Guibert, B., Vincent, J.D., and Vernier, P. (2001). Differential subcellular distribution and transcriptional activity of sigmaE3, sigmaE4, and sigmaE3-4 isoforms of the rat estrogen receptor-alpha. Mol Endocrinol 15, 894-908.

Pawlak, M.R., Scherer, C.A., Chen, J., Roshon, M.J., and Ruley, H.E. (2000). Arginine N-methyltransferase 1 is required for early postimplantation mouse development, but cells deficient in the enzyme are viable. Mol Cell Biol 20, 4859-4869. Perrine, S.P., Ginder, G.D., Faller, D.V., Dover, G.H., Ikuta, T., Witkowska, H.E., Cai, S.P., Vichinsky, E.P., and Olivieri, N.F. (1993). A short-term trial of butyrate to stimulate fetal-globin-gene expression in the beta-globin disorders. N Engl J Med 328, 81-86.

Rezai-Zadeh, N., Zhang, X., Namour, F., Fejer, G., Wen, Y.D., Yao, Y.L., Gyory, I., Wright, K., and Seto, E. (2003). Targeted recruitment of a histone H4-specific methyltransferase by the transcription factor YY1. Genes Dev 17, 1019-1029.

Robin-Lespinasse, Y., Sentis, S., Kolytcheff, C, Rostan, M.C., Corbo, L, and Le Romancer, M. (2007). hCAF1 , a new regulator of PRMT1 -dependent arginine methylation. J Cell Sci 120, 638-647. Ronchi, A., Berry, M., Raguz, S., Imam, A., Yannoutsos, N., Ottolenghi, S., Grosveld, F., and Dillon, N. (1996). Role of the duplicated CCAAT box region in gamma-globin gene regulation and hereditary persistence of fetal haemoglobin. EMBO J 15, 143-149.

Root, D.E., Hacohen, N., Hahn, W.C., Lander, E.S., and Sabatini, D.M. (2006). Genome- scale loss-of-function screening with a lentiviral RNAi library. Nat Methods 3, 715-719.

Samakoglu, S., Lisowski, L, Budak-Alpdogan, T., Usachenko, Y., Acuto, S., Di Marzo, R., Maggio, A., Zhu, P., Tisdale, J.F., Riviere, I., et al. (2006). A genetic strategy to treat sickle cell anemia by coregulating globin transgene expression and RNA interference. Nat Biotechnol 24, 89-94. Sankaran, V.G., Menne, T.F., Xu, J., Akie, T.E., Lettre, G., Van Handel, B., Mikkola, H.K., Hirschhorn, J.N., Cantor, A.B., and Orkin, S.H. (2008). Human fetal hemoglobin expression is regulated by the developmental stage-specific repressor BCL11A. Science 322, 1839-1842.

Sankaran, V.G., Xu, J., Ragoczy, T., Ippolito, G.C., Walkley, C.R., Maika, S.D., Fujiwara, Y., Ito, M., Groudine, M., Bender, M.A., et al. (2009). Developmental and species- divergent globin switching are driven by BCL11A. Nature 460, 1093-1097.

Schechter, A.N. (2008). Hemoglobin research and the origins of molecular medicine. Blood 112, 3927-3938.

Shen, E.C., Henry, M.F., Weiss, V.H., Valentini, S.R., Silver, P.A., and Lee, M.S. (1998). Arginine methylation facilitates the nuclear export of hnRNP proteins. Genes Dev 12, 679-691.

Stamatoyannopoulos, G., and Grosveld, F. (2001 ). The Molecular Basis of Blood Diseases. In, G. Stamatoyannopoulos, P.W. Majerus, R.M. Perlmutter, and H. Varmus, eds. ( Philadelphia PA, WB Saunders Company), pp. 135-182. Strahl, B.D., Briggs, S.D., Brame, C.J., Caldwell, J.A., Koh, S.S., Ma, H., Cook, R.G., Shabanowitz, J., Hunt, D.F., Stallcup, M.R., et al. (2001 ). Methylation of histone H4 at arginine 3 occurs in vivo and is mediated by the nuclear receptor coactivator PRMT1. Curr Biol 11 , 996-1000.

Tang, J., Gary, J.D., Clarke, S., and Herschman, H.R. (1998). PRMT 3, a type I protein arginine N-methy transferase that differs from PRMT1 in its oligomerization, subcellular localization, substrate specificity, and regulation. J Biol Chem 273, 16935-16945. Thein, S.L., Menzel, S., Lathrop, M., and Garner, C. (2009). Control of fetal hemoglobin: new insights emerging from genomics and clinical implications. Hum Mol Genet 18, R216-223.

Thein, S.L., Menzel, S., Peng, X., Best, S., Jiang, J., Close, J., Silver, N. , Gerovasilli, A., Ping, C, Yamaguchi, M., et al. (2007). Intergenic variants of HBS1 L-MYB are responsible for a major quantitative trait locus on chromosome 6q23 influencing fetal hemoglobin levels in adults. Proc Natl Acad Sci U S A 104, 11346-11351 .

Uda, M., Galanello, R., Sanna, S., Lettre, G., Sankaran, V.G., Chen, W., Usala, G., Busonero, F., Maschio, A., Albai, G., et al. (2008). Genome-wide association study shows BCL11 A associated with persistent fetal hemoglobin and amelioration of the phenotype of beta-thalassemia. Proc Natl Acad Sci U S A 105, 1620-1625. van Dijk, T.B., Gillemans, N., Stein, C, Fanis, P., Demmers, J., van de Corput, M., Essers, J., Grosveld, F., Bauer, U.M., and Philipsen, S. (2010). Friend of Prmtl , a novel chromatin target of protein arginine methyltransferases. Mol Cell Biol 30, 260-272. van Dijk, T.B., van Den Akker, E., Amelsvoort, M.P., Mano, H., Lowenberg, B., and von Lindern, M. (2000). Stem cell factor induces phosphatidylinositol 3'-kinase-dependent Lyn/Tec/Dok-1 complex formation in hematopoietic cells. Blood 96, 3406-3413. von Lindern, M., Deiner, E.M., Dolznig, H., Parren-Van Amelsvoort, M., Hayman, M.J., Mullner, E.W., and Beug, H. (2001). Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c- Kit in stress erythropoiesis. Oncogene 20, 3651-3664.

Wada, K., Inoue, K., and Hagiwara, M. (2002). Identification of methylated proteins by protein arginine N-methyltransferase 1 , PRMT1 , with a new expression cloning strategy. Biochim Biophys Acta 1591 , 1-10. Wagner, S., Weber, S., Kleinschmidt, M.A., Nagata, K., and Bauer, U.M. (2006). SET- mediated promoter hypoacetylation is a prerequisite for coactivation of the estrogen- responsive pS2 gene by PRMT1. J Biol Chem 281 , 27242-27250.

Wang, H., Huang, Z.Q., Xia, L., Feng, Q., Erdjument-Bromage, H., Strahl, B.D., Briggs, S.D., Allis, CD., Wong, J., Tempst, P., et al. (2001). Methylation of histone H4 at arginine 3 facilitating transcriptional activation by nuclear hormone receptor. Science 293, 853-857. Wijgerde, M., Gribnau, J. , Trimborn, T., Nuez, B., Philipsen, S., Grosveld, F., and Fraser, P. (1996). The role of EKLF in human beta-globin gene competition. Genes Dev 10, 2894-2902.

Xu, J., Sankaran, V.G., Ni, M., Menne, T.F., Puram, R.V., Kim, W., and Orkin, S.H. (2010). Transcriptional silencing of {gamma}-globin by BCL11 A involves long-range interactions and cooperation with SOX6. Genes Dev 24, 783-798.

Xu, W., Chen, H., Du, K., Asahara, H., Tini, M., Emerson, B.M., Montminy, M., and Evans, R.M. (2001 ). A transcriptional switch mediated by cofactor methylation. Science 294, 2507-2511. Yu, M., Han, H., Xiang, P., Li, Q., and Stamatoyannopoulos, G. (2006). Autonomous silencing as well as competition controls gamma-globin gene expression during development. Mol Cell Biol 26, 4775-4781.

Yu, M.C., Bachand, F., McBride, A.E., Komili, S., Casolari, J.M., and Silver, P.A. (2004). Arginine methyltransferase affects interactions and recruitment of mRNA processing and export factors. Genes Dev 18, 2024-2035.

Zhang, X., and Cheng, X. (2003). Structure of the predominant protein arginine methyltransferase PRMT1 and analysis of its binding to substrate peptides. Structure 11 , 509-520.

Zhao, Q., Rank, G., Tan, Y.T., Li, H., Moritz, R.L., Simpson, R.J., Cerruti, L., Curtis, D.J., Patel, D.J., Allis, CD., et al. (2009) . PRMT5-mediated methylation of histone H4R3 recruits DNMT3A, coupling histone and DNA methylation in gene silencing. Nat Struct Mol Biol 16, 304-311.

Zufferey, R., Nagy, D., Mandel, R.J., Naldini, L, and Trono, D. (1997). Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 15, 871 -875.

Zullo, A.J., Michaud, M., Zhang, W., and Grusby, M.J. (2009). Identification of the small protein rich in arginine and glycine (SRAG): a newly identified nucleolar protein that can regulate cell proliferation. J Biol Chem 284, 12504-1251 1.