Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
FOODS AND BEVERAGES WITH INCREASED POLYUNSATURATED FATTY ACID CONTENT
Document Type and Number:
WIPO Patent Application WO/2009/080630
Kind Code:
A2
Abstract:
A foodstuff or beverage such as bread or beer containing polyunsaturated fatty acid (PUFA) is produced using use for fermentation in the preparation thereof of a microbial cell such as Saccharomyces cerevisiae comprising at least two desaturases and having an increased in vivo desaturase efficiency in said cell, whereby said PUFA is produced in situ in said foodstuff or beverage by said metabolic activity of said microbial cell. The desaturases may be selected from delta-9 desaturase, delta-6 desaturase, delta-12 desaturase, delta-5 desaturase, omega-3 desaturase, delta-4 desaturase and delta-8- desaturase.

Inventors:
PLATE, Iben (Rævehøjvej 8F, Kgs. Lyngby, DK-2800, DK)
GUNNARSSON, Nina Katarina (Schleppegrellsgade 6, 4 t.h, Copenhagen N, DK-2200, DK)
MØLLER, Per (Mjøsensgade 8, 4th, København S., DK-2300, DK)
GEOGIEVA, Tania Ivanova (Vangede Bygade 82, 1 th, Gentofte, DK-2820, DK)
STENHUUS, Bo (Præstøgade 11 4 tv, Copenhagen E, DK-2100, DK)
Application Number:
EP2008/067658
Publication Date:
July 02, 2009
Filing Date:
December 16, 2008
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
FLUXOME SCIENCES A/S (Diplomvej 378, Kgs. Lyngby, DK-2800, DK)
PLATE, Iben (Rævehøjvej 8F, Kgs. Lyngby, DK-2800, DK)
GUNNARSSON, Nina Katarina (Schleppegrellsgade 6, 4 t.h, Copenhagen N, DK-2200, DK)
MØLLER, Per (Mjøsensgade 8, 4th, København S., DK-2300, DK)
GEOGIEVA, Tania Ivanova (Vangede Bygade 82, 1 th, Gentofte, DK-2820, DK)
STENHUUS, Bo (Præstøgade 11 4 tv, Copenhagen E, DK-2100, DK)
International Classes:
A23L1/30; A23L1/03; A23L2/52
Attorney, Agent or Firm:
SMART, Peter (Beck Greener, Fulwood House12 Fulwood Place,London, London WC1V 6HR, GB)
Download PDF:
Claims:

CLAIMS

1. A method for the production of a foodstuff or beverage containing polyunsaturated fatty acid (PUFA) comprising the use for fermentation in the preparation thereof of a microbial cell comprising at least two desaturases and having an increased in vivo desaturase efficiency in said cell, whereby said PUFA is produced in situ in said foodstuff or beverage by said metabolic activity of said microbial cell.

2. A method as claimed in claim 1, wherein said microbial cell is a fungal cell.

3. A method as claimed in claim 2, wherein said fungal cell is a yeast.

4. A method as claimed in claim 3, wherein said yeast is of the genus Saccharomyces.

5. A method as claimed in claim 1, wherein said microbial cell is a bacterial cell.

6. A method according to any one of the preceding claims, wherein the at least two desaturases are selected from the group consisting of delta-9 desaturase, delta-6 desaturase, delta- 12 desaturase, delta-5 desaturase, omega-3 desaturase, delta-4 desaturase and delta-8- desaturase.

7. A method according to any one of the preceding claims, wherein the at least two desaturases are delta-9 desaturase and delta-12 desaturase.

8. A method according to any one of the preceding claims, wherein the at least two desaturases are delta-9 desaturase, delta-12 desaturase and delta-6 desaturase.

9. A method according to any one of the preceding claims, wherein the at least two desaturases are delta-9 desaturase, delta-12 desaturase, delta-5 desaturase and delta-6 desaturase.

10. A method according to any one of the preceding claims, wherein the at least two desaturases are delta-9 desaturase, delta-12 desaturase, delta-5 desaturase, delta-6 desaturase and omega-3 desaturase.

11. A method according to any of the preceding claims, wherein the rate of Fe3 + reduction and reoxidation is increased.

12. A method according to any one of the preceding claims, comprising over-expression of at least one of the genes selected from the group consisting of MCRl and CYB5.

13. A method according to any one of the preceding claims, comprising over-expression of at least one of the genes selected from the group consisting of FAS2, INO2, INO4 and LROl.

14. A method according to any one of the preceding claims, further comprising deletion of OPIl.

15. A method according to claim 2 or any preceding claim directly or indirectly dependent on claim 2, wherein said foodstuff is a leavened bakery product and said fungal cell is used for the leavening thereof or wherein said beverage is a fermented beverage and said fungal cell is used in the fermentation thereof.

16. A method according to claim 5 or any preceding claim directly or indirectly dependent on claim 5, wherein said foodstuff is a is a fermented meat, vegetable, or milk product and said cell is used in the fermentation thereof.

17. A foodstuff or beverage containing a microbial cell, whether living or killed, comprising at least two desaturases and having an increased in vivo desaturase efficiency in said cell when live.

18. A foodstuff or beverage containing a Saccharomyces cerevisiae which produces EPA and ARA in the ratio of at least 1 : 1 in the course of the making of said foodstuff or beverage.

19. A foodstuff or beverage as claimed in claim 18, wherein said

Saccharomyces cerevisiae, is one which produces at least 0.4 mg EPA per gram dry weight cell.

20. A foodstuff or beverage according to claim 18 or claim 19, wherein said Saccharomyces cerevisiae is one which produces at least 1,5 mg ARA pr. gram dry weight cell.

21. A foodstuff or beverage according to any one of claims 18 to 20, wherein said Saccharomyces cerevisiae is one which produces at least 8.0 mg GLA pr. gram dry weight cell.

22. A foodstuff or beverage according to any one of claims 18 to 21, wherein said Saccharomyces cerevisiae is one which produces at least 24 mg. PUFA pr. gram dry weight cell.

23. A baked foodstuff according to claim 17, containing EPA produced in situ and having an EPA content of at least 0.03 mg/g on a dry weight basis pg.

Description:

FOODS AND BEVERAGES WITH INCREASED POLYUNSATURATED FATTY ACID CONTENT

CROSS-REFERENCE TO RELATED APPLICATIONS

Each application, patent, and each document cited in this text, and each of the documents cited in each of these applications, patents, and documents

("application cited documents"), and each document referenced or cited in the application cited documents, either in the text or during the prosecution of the applications and patents thereof, as well as all arguments in support of patentability advanced during prosecution thereof, are hereby incorporated herein by reference in their entirety.

FIELD OF THE INVENTION

This invention relates to the production of foodstuffs or beverages involving fermentation using a genetically engineered fungal cell producing increased amounts of beneficial fatty acids and particularly the polyunsaturated fatty acids (PUFAs) gamma-linolenic acid (GLA), arachidonic acid (ARA) and eicosapentaenoic acid (EPA), and in particular to the use therein of metabolically engineered Saccharomyces cerevisiae cells with increased content of GLA, ARA and EPA.

BACKGROUND OF THE INVENTION PUFAs are polyunsaturated fatty acids with a long hydrocarbon chain composed of 18 or more carbon atoms having two or more double bonds and a terminal carboxylate group.

The properties of polyunsaturated fatty acids are highly influenced by the position of the double bond, and one differentiates omega-3 PUFAs, which have the first double bond at the third position counting from the methyl end of the carbon chain, and omega-6 PUFAs, which have the first double bond at the sixth position counting from the methyl end of the carbon chain. Eicosapentaenoic acid (EPA; 5, 8, 11, 4, 17-20: 5) belongs to the former group, while, arachidonic acid

(ARA; 5, 8, 11, 14-20:4) and gamma-linolenic acid (GLA, 6, 9, 12-18: 3) belong to the latter group.

PUFAs are essential for humans, and it has been proven that they have many beneficial effects on human health, including proper development of brain and visual functions and prevention of disease, such as cardiovascular disease and cancer.

Natural dietary sources of GLA and ARA include animal meats, egg yolks, and shellfish, while the main dietary source of EPA is fish oil. Commercial ARA- containing oils are produced by Martek Biosciences Corporation (Columbia, Md.), while EPA is available commercially as diverse mixtures of docosahexaenoic acid (DHA) and EPA (concentrates), which are produced by distillation of fish oils.

In relation to existing sources of commercial ARA and EPA, a recombinant microbial approach of production has many advantages. Most notably, a microbial process for EPA production circumvents certain problems associated with fish-oil derived products, such as bad taste and contamination by environmental pollutants. In addition, the fatty acid composition of fish oil may vary during the fishing season. Many naturally ARA- and EPA-producing microbes also contain inherent drawbacks, such as low growth rates and difficult-to-control fermentation behaviour. In addition, lack of tools for genetic manipulation of natural producers makes it difficult to alter, e.g., the fatty acid composition in the oil that they produce. The use of a well-characterized microbial host for ARA and EPA production provides solutions for the above-mentioned problems and, importantly, offers possibilities to develop the process further by metabolic engineering.

Fluxome Sciences A/S has recently made use of baker's yeast, Saccharomyces cerevisiae, as a preferred host for production of PUFA-containing oil

(WO2005/118814 ). S. cerevisiae is one of the most well-characterized production organisms in biotechnology, and additionally has a long tradition in the manufacturing of food and beverage products. By expression of up to 6

heterologous fatty acid desaturases and elongases, S. cerevisiae was engineered to produce PUFAs from a non-fatty acid carbon source.

S. cerevisiae has previously been used as a platform in which to analyze the function and substrate specificity of various fatty acid desaturases and elongases (e.g. US 6,432,684, PCT/US98/07422, WO 200244320-A, WO 99/27111) by means of adding exogenous fatty acid substrates. Others have utilized S. cerevisiae to reconstitute parts of the pathway towards ARA and EPA with the intention of transferring this technology to plants (e.g. Domergue et al., 2003, Beaudoin et al., 2000, US 2003/0177508), still making use of an exogenous supplementation of desaturated fatty acid substrate.

In US2006/0094092 and US 60/624812, different approaches to increase the production of ARA and EPA by genetically modified Yarrowia lipolytica are reported. These approaches include deletion of native desaturases and acyltransferases, expression of heterologous acyltransferases and phospholipases, and variation of the types of desaturases and elongases used in the heterologous PUFA pathways. Specifically, the authors of said disclosures express a heterologous Acyl-CoA/lysophosphatidic acid acyltransferase, a heterologous diacylglycerol acyltransferase, a heterologous glycerol-3-phosphate acyltransferase and a heterologous phospholipase C in their production host Yarrowia lipolytica. In addition to phospholipase C, the authors claim a recombinant PUFA-producing Yarrowia lipolytica expressing phospholipase A2, although experimental results on the use of this type of phospholipase are not disclosed. The authors also claim expression of a phospholipid: DAG acyltransferase (PDAT) in Y. lipolytica, and more specifically over-expression of a native PDAT from Y. lipolytica. However, the effect of such an over-expression on the PUFA yield is not described in said disclosures.

Furthermore, several recent disclosures describe specific acyltransferases that can be used for increasing the yield of PUFAs in different production hosts (e.g. WO2004/076617-A2, WO06052807-A2, WO06052824A2, WO06052814A2).

PUFA production pathways have also been introduced into plant production hosts, disclosed e.g. in WO2004/057001 and WO2005/012316. In WO2006008099 metabolic engineering methods for increasing the yield of heterologoys PUFAs in transgenic plants are disclosed, including expression of a heterologous phospholipase, a ketoacyl-CoA reductase and a dehydratase involved in fatty acid elongation.

S. cerevisiae has the advantage of being well characterized, safe and easily manipulated by targeted genetic engineering. It is therefore well suited for yield improvement through metabolic engineering. It has been shown that the lipid content of PUFA-producing S. cerevisiae can be substantially increased by applying metabolic engineering approaches (WO2005/118814 ). Presently, applicants have introduced further genetic modifications into fungal cells that surprisingly and substantially alter the fatty acid composition and increase the yield of GLA, ARA and EPA in the recombinant yeast.

South African Patent Application No. 2004/8194 disclosed the use of a yeast producing resveratrol in preparing a food or beverage product, such as wine by fermentation with said yeast.

WO2008/000277 disclosed the microorganism modifications and strains used herein. It was disclosed there that following harvest of biomass, e.g. by centrifugation or filtration, and possible drying of the biomass to a suitable degree, it could be used as a functional food ingredient, for example as bakers yeast, yeast extract or as a flavour enhancer. The PUFA-containing biomass could also be used directly as a functional food, for example in tablets as an alternative to fish oil capsules. However, it was not suggested that the relevant micro-organisms could be used in the production of foods or beverages by fermentation of substrates in the process of manufacturing the food or beverage, e.g. using a yeast in leavening bread or in brewing beer.

SUMMARY OF THE INVENTION

The present invention relates to the construction and engineering of non-plants more particularly microorganisms, such as fungal cells, for improved PUFA

production through overexpression and/or deletion of various endogenous genes, or through expression of heterologous genes as described in WO2008/000277 and the use of the resulting engineered strains for making improved foodstuffs or beverages in which polyunsaturated fatty acids are produced by the microorganisms in situ. Such foodstuffs and beverages may include leavened foodstuffs such as bread and other leavened bakery products, as well as fermented foodstuff and beverages including fermented meat products such as sausages, fermented vegetable products such as sauerkraut and pickles, fermented milk products and fermented beverages such as beer. Surprisingly, it has been found that the use of an enhanced PUFA producing yeast for leavening a bakery product can actually reverse a loss of PUFA that normally occurs during baking.

Thus the present invention provides, a method for the production of a foodstuff or beverage containing polyunsaturated fatty acid (PUFA) comprising the use for fermentation in the preparation thereof of a microbial cell comprising at least two desaturases and having an increased in vivo desaturase efficiency in said cell, whereby said PUFA is produced in situ by metabolic activity of said microbial cell.

In this way, an increased PUFA content may be obtained without addition of PUFA (whether microbially produced or not) to the foodstuff or beverage or the ingredients thereof.

The PUFA may be secreted from the microbial cells, e.g. yeast, or may remain therein.

The invention includes a foodstuff or beverage containing a microbial cell, whether living or killed, comprising at least two desaturases and having an increased in vivo desaturase efficiency in said cell when live. The presence of said cells may be sufficiently demonstrated by the presence in said product of DNA characteristic of the organism. The invention further includes a foodstuff or beverage containing a Saccharomyces cerevisiae which producies EPA and ARA in the ratio of at least 1 : 1 in the course of the making of said foodstuff or beverage.

In particular, in preferred aspects, the present invention makes use of methods for improving production of polyunsaturated fatty acids comprising expression of heterologous genes and/or genetic modifications of native genes in a Saccharomyces cerevisiae.

Microbial cells used in the invention may provide improved production of particular PUFAs, including gamma-linolenic acid, arachidonic acid, and eicosapentaenoic acid.

The present invention particularly relates to improvement of the PUFA content in leavened or fermented products by production therein of PUFA in situ through the use of a microorganism improved through metabolic engineering, e.g. through over-expression of fatty acid synthases, over-expression of enzymes involved in fatty acid desaturation, over-expression or deletion of regulatory proteins, over-expression of acyltransferases and/or lipases, or expression of corresponding heterologous enzymes.

Thus in one aspect, the present invention relates to a method for the production of a leavened or fermented consumable product containing polyunsaturated fatty acid (PUFA) produced in situ therein in a microbial cell comprising at least two desaturases, said method comprises increasing the in vivo desaturase efficiency in said cell. Particularly over-expression of MCRl and/or CYB5 increases the in vivo desaturase efficiency.

Another aspect present invention relates to consumable products, whether foodstuffs or beverages, containing microbial cells containing the genetic engineering described in WO2008/000277 that yields EPA and ARA in the ratio of at least 1 : 1, preferably at least 2 : 1, most preferably 2.6: 1.

The invention also makes use of improvement of the total fatty acid content in the host organism through modification of transcriptional regulation of structural genes involved in phospholipid and fatty acid synthesis.

Thus, in another aspect, the present invention makes use of increasing the fatty acid content in microbial and in particular fungal cells. In one embodiment such an increase in the fatty acid content is achieved by over-expression of at least one gene selected from the group consisting of INO2 and INO4. In another embodiment with the same achievement is obtained by deletion of the gene OPIl.

In vivo desaturase efficiency

The distribution of fat between PUFA and saturated fatty acids does not only depend on the amount of desaturase present in the cell. It also depends on how efficient the desaturases work e.g. a certain level of PUFA can be obtained by either increasing the amount of desaturase or by increasing the efficiency of the desaturases present.

In vivo desaturase efficiency is a measure of how good a certain amount of desaturase works. The higher efficiency the more PUFA is created with the same amount of desaturase.

In vivo desaturase efficiency can be estimated by relating the actual in vivo desaturation activity to the concentration of desaturase in the cell.

Actual in vivo desaturation activity can be measured by analyzing the fatty acid content and composition of the cell, since the cellular content of unsaturated fatty acids directly reflects the actual in vivo desaturation activity. The desaturation activity can be expressed as mg unsaturated fatty acids per mg cell dry-weight.

The concentration of a specific desaturase in the cell can be measured indirectly by performing Northern blot analysis or real-time RT PCR. By these methods, it is possible to estimate the imRNA copy number of the desaturase per mg cell dry- weight. Alternatively, if antibodies specific for the desaturases are available, the desaturase protein concentration can be measured directly by Western blot. However, this method is more cumbersome, especially since antibodies for PUFA

desaturases are generally not commercially available. The preferred method of measuring the level of desaturases in the cell is therefore to use real-time RT PCR to estimate the imRNA copy number per mg cell dry-weight for each desaturase present in the cell. Furthermore, if two different strains express the same set of desaturases, and each of these desaturases are present in the same gene-copy number, and furthermore are expressed using the same promoter in both strains, it can be considered that the two strains contain an equal number of desaturase imRNA copy number and also the same desaturase protein concentration.

By relating the actual in vivo desaturation activity with the desaturase concentration, it is possible to estimate of the desaturase efficiency expressed, for example, as mg unsaturated fatty acids per desaturase imRNA copy number.

The efficiency can be used to assess whether all desaturases are actually actively performing fatty acid desaturation. Thus, one can compare the in vivo desaturase efficiency of strains which have the same copy number of desaturases per mg cell dry-weight, but have different levels of other factors necessary for forming a desaturation complex. If the desaturase efficiency is the same in both strains, this indicates that all desaturase copies are active in both strains. In contrast, if the desaturase efficiency is increased in a strain with an increased level of one of the other factors required for fatty acid desaturation relative to a control strain, this indicates the presence of excess, inactive, desaturase enzyme in the control strain. In this situation, one can deduce that the increased level of other factors has enabled more desaturase molecules to actively perform fatty acid desaturation.

Accordingly, the the increased in vivo desaturase efficiency can be measured by the following steps:

- providing a first microbial cell population having a genotype comprising at least two genes encoding desaturases

- providing a second microbial cell population with the same genotype as the first microbial cell population and further adding in said cell population at least one modification increasing the in vivo desaturase efficiency,

- measuring the fraction of PUFA with 2 or more double bonds as % of total fatty acids produced in both the first and second microbial cell populations,

-identifying a microbial cell population as having an increased in vivo desaturase efficiency, if the second cell population compared to the first cell population show an increase in the PUFA fraction (% of PUFA of total fatty acid) by at least 0,5%, such as at least 1%, e.g. at least 1.5%, such as at least 5%, e.g. at least 25%, such as at least 40%, e.g. at least 50%.

In the present context the term "microbial cell population" is to be understood as one or more microbial cells.

Thus, desaturation efficiency can be measured indirectly by the accumulation of the end product of the pathway in cells. It can also be measured directly by measuring the enzyme activity of the desaturase(s). The enzyme activity is measured in moles of substrate converted per unit time per mg of total protein. For ER membrane proteins such as desaturases, the apparent enzyme activity is measurable in preparations of microsomes (vesicles of fragmented ER membrane). An excess of radioactively labeled substrate and other components needed in the reaction (e.g. NADH cofactor, Fe ions) are supplied to the microsomes and the rate of formation of radioactively labeled product is measured. Thus, the increased desaturation efficiency in a strain with increased levels of cytochrome b5 and cytochrome b5 reductase can be measured by measuring the enzyme activities of the desaturases in that strain and comparing them to the corresponding enzyme activities in a strain not having increased levels of cytochrome b5 and cytochrome b5 reductase.

These and other embodiments are disclosed or are obvious from and encompassed by, the following Detailed Description.

DETAILED DESCRIPTION OF THE INVENTION

It should be understood that any feature and/or aspect discussed above in connection with the methods according to the invention apply by analogy to the uses and products.

As will be apparent, preferred features and characteristics of one aspect of the invention may be applicable to other aspects of the invention.

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

The present inventors have described in WO2008/000277 improved methods for producing polyunsaturated fatty acids by metabolic engineering of fungal host cells expressing heterologous pathways to GLA, ARA and EPA.

As previously described (WO2005/118814 ), production of ARA in S. cerevisiae can be accomplished by simultaneous expression of heterologous genes encoding proteins with the following activities: delta-12 desaturase, delta-6 desaturase, delta-6 elongase and delta-5 desaturase (figure 1). Alternatively, production of ARA can be achieved by simultaneous heterologous expression of genes encoding delta-12 desaturase, delta-9 elongase, delta-8 desaturase and delta-5 desaturase (figure 2). As previously described, the yield of ARA can be improved by additionally expressing a heterologous delta-9 desaturase and/or applying various metabolic engineering strategies (WO2005/118814 ).

Furthermore, production of EPA in S. cerevisiae can be achieved by following the same strategies as described above for ARA, and additionally expressing a heterologous gene encoding an omega-3 desaturase (figure 3 and 4).

WO2008/000277 describes metabolic engineering strategies that further increases the yield of ARA, EPA, and/or intermediates in the pathway to ARA and EPA in a genetically modified fungal host cell, in particular s, cerevisiae, and demonstrates that metabolic engineering can be used to enable commercial production of polyunsaturated fatty acids in S. cerevisiae. Thus, the prior art approaches to produce ARA, EPA, and/or intermediates in the pathway to ARA and EPA in fungal cells are comprehended in the present term "expression of a heterologous pathway in a fungal cell".

WO2008/000277 disclosed further genetic modifications in fungal cells that surprisingly and substantially alter the fatty acid composition and increase the yield of GLA, ARA and EPA in the recombinant yeast comprising both prior art disclosed and potential novel heterologous pathways.

In one aspect, the present invention makes use for food and beverage production of a method for the production of polyunsaturated fatty acid (PUFA) in a fungal cell which accumulates in said food or beverage and which comprises at least two desaturases, where said method comprises increasing the in vivo desaturase efficiency in said cell. The in vivo desaturation efficiency is related to the desaturation complex within the cells, and by increasing the effect of the desaturation complex higher yields of PUFAs may be achieved as disclosed in the examples below.

This may for example be achieved by either over-expression or heterologous expression of at least one of the genes selected from the group consisting of MCRl and CYB5.

In one embodiment of the present aspect, the at least two desaturases are selected from the group consisting of delta-9 desaturase, delta-6 desaturase, delta- 12 desaturase, delta-5 desaturase, omega-3 desaturase, delta-4 desaturase and delta-8- desaturase.

The present invention also makes use in the production of a food or beverage of a method for producing polyunsaturated fatty acids comprising expression of a heterologous pathway in a fungal cell, wherein the heterologous expression further comprises over-expression of at least one of the genes selected from the group consisting of FAS2, LROl, SPO14, INO2, INO4, MCRl and CYB5.

It is desirable to provide a method for the production of a leavened or fermented food or beverage using a yeast that produces polyunsaturated fatty acid that has increased fatty acid content in the cells used.

As described in WO2008/000277, increasing the fatty acid content in cells, such as yeast, may be achieved by over-expression of the at least one gene selected from the group consisting of INO2 and INO4. The skilled artisan would be able to obtain such over expression both by increasing the endogenous expression of INO2 and INO4 by tools available in the art and by e.g. heterologous expression of the genes.

In a another aspect, the present invention relates to a method for producing a leavened or fermented food product or beverage including use of a fungal microorganism producing polyunsaturated fatty acids in situ in said food product or beverage, said microorganism providingexpression of a heterologous pathway in a fungal cell, wherein the heterologous expression further comprises heterologous expression of at least one of the nucleotide sequences selected from the group consisting of nucleotide sequences encoding cytochrome b5, cytochrome b5 reductase, FAS alpha subunit, FAS beta subunit and FAS (both subunits).

In a further aspect, the present invention relates to a method for producing polyunsaturated fatty acids in a leavened or fermented food or beverage product comprising expression of a heterologous pathway in a fungal cell in situ in the production of said food or beverage product, wherein the heterologous expression further comprises deletion of OPIl. Deletion of OPIl also generates metabolic engineered cells that have increased fatty acid content.

Food (or foodstuff) and beverage

Foods which are the subject of the present invention include especially leavened bakery products including especially breads. However, the concept extends to other foods in which fermentable substrates are fermented by microorganisms including fermented meat products such as certain traditional forms of sausage.

Beverages which are the subject of the invention include especially beers of all kinds including ales, lagers, stouts, 'barley wine' and others. In most such products, the fermenting yeast will largely be removed during manufacture, but some will always remain. In some such products a quantity of fermenting yeast is deliberately left in the product.

Even in the case of beverages from which the yeast is substantially removed, beneficial PUFAs will remain.

Foods and beverages which are the subject of the present invention include fermented milk based products including yoghurts and cheeses. Applicable microorganisms for use in the production of each type of food or beverage product mentioned above are well known in the art.

General desctription of the meaning and scope of the term Polyunsaturated fatty acid as used in this application is to be found in WO2008/000277.

The meaning of the terms Oxygen requiring pathway, as used in the present application is explained in WO2008/000277.

Endogenous genes

The genes natively present in the host organism, including genes in the pathway to fatty acids, including the pathway to any desirable PUFA in a cell of the present invention, are in the present context termed endogenous genes.

Heterologous Genes The technology described within WO2008/000277 relates to genetically engineered fungal host cells that produce PUFAs through expression of a

heterologous pathway, and that have been further genetically engineered to produce increased amounts of PUFAs.

However, in addition to any heterologous gene with a specific function mentioned therein, one or more endogenous genes with the same or similar function may be present in the chosen fungal host cell. Furthermore, the chosen fungal cell in question may contain endogenous genes that have satisfactory expression for PUFA production at commercially viable yields without the need for heterologous expression of a PUFA pathway. Thus, the technology described within the present invention also relates to such fungal cells, which contain an endogenous pathway for PUFA production.

As described in detail in prior art (WO2005/118814 ), the genetically transformed cells particularly harbour a heterologous pathway from stearic acid to PUFAs by expression of the following heterologous enzymes delta-9 desaturase, delta-12 desaturase, delta-9 elongase, delta-8 desaturase omega-3 desaturase, delta-6 desaturase, delta-6 elongase, delta-5 desaturase, or subsets hereof.

The heterologous genes in the pathway to PUFAs can be chosen among a wide range of described and published sequences, or can be isolated from any living organism, including fungi, plants, animals, algae and marine protists, amoeba and bacteria, that harbours pathways to oleic acid, linoleic acid, alpha-linolenic, gamma-linoleic acids, dihomo-gamma-linolenic acid, arachidonic acid, stearidonic acid, eicosatetraenoic acid or EPA.

In one embodiment, the present invention utilizes the simultaneous heterologous expression of genes encoding delta-12 desaturase, delta-6 desaturase, delta-6 elongase and delta-5 desaturase in a microorganism, which leads to the production of PUFAs, and in particular production of arachidonic acid.

Furthermore, it makes use of the simultaneous heterologous expression of genes encoding delta-12 desaturase, omega-3 desaturase, delta-6 desaturase, delta-6

elongase and delta-5 desaturase in a microorganism, which results in production of EPA and other PUFAs.

Heterologous expression of specific genes

By "expression", it is meant the production of a functional polypeptide through the transcription of a nucleic acid segment into imRNA and translation of the mRNA into a protein.

By "heterologous expression", it is generally meant that a nucleic acid, not naturally present in the host genome, is present in the host cell and is operably linked to promoter and terminator nucleic acid sequences in a way so it is expressed in the host cell.

Also, in the present context heterologous expression further relates to the presence of a nucleic acid with a similar function to a naturally present nucleic acid, wherein the expression of said heterologous nucleic acid product changes the fatty acid composition. For example, expression in yeast of a fungal delta-9 desaturase with different substrate specificity than the native yeast delta-9 desaturase changes the fatty acid composition of yeast.

Said nucleic acid may be contained on an extra chromosomal nucleic acid construct or may be integrated in the host genome. Methods for isolation of nucleic acids for heterologous expression and preferred embodiments of heterologous expression are further described in details below.

By heterologous expression of a pathway is meant that several genes are expressed heterologously, whose gene products constitute steps in a pathway, not naturally present in the host.

In this specification, the term 'over-expression' is used to include in relation to a gene of a microorganism strain the production of the expression product of said gene in an amount which exceeds (preferably by at least 5%, more preferably at least 10%, more preferably at least 50%, more preferably at least 100%) the production thereof in a reference strain of said microorganism.

Said reference strain may be a wild type strain of said microorganism.

Said microorganism strain may differ from said reference strain in that (a) it contains a greater number of copies of said gene in each cell (whether integrated in the genome thereof or carried on a replicating unit such as a plasmid); or (b) said gene is under the control of a regulatory gene sequence (such as promoter) which differs from that of the reference strain. In relation to (a) it may of course be the case that the gene is absent from the wild type, i.e. that said expression is heterologous.

In one aspect, the present invention relates to a method for the use of a fungal cell in the leavening or fermentation of a food or beverage product where the cell is one producing polyunsaturated fatty acids by expression of a heterologous pathway in a fungal cell, wherein the heterologous expression further comprises heterologous expression of nucleotide sequences encoding at least one of the enzymes selected from the group consisting cytochrome b5, cytochrome b5 reductase, FAS alpha subunit, FAS beta subunit and FAS (both subunits).

The expression of said heterologous genes allows not only the production of omega-6 fatty acids, but also the production of omega-3 fatty acids, simultaneously or not, in host cells that endogenously only produce fatty acids of up to 18 carbon atoms of length with up to one double bond. In particular, the expression of said heterologous genes allows the production of eicosapentaenoic acid in said host cells.

Furthermore, the expression of said heterologous genes generally improves the production of eicosapentaenoic acid and/or one or more of its intermediate precursors, including arachidonic acid, in a host cell. A general advantage of this method is that it allows the use of non-fatty acid substrates, such as sugars. However, fatty acid-containing substrates, such as oils derived from, for example, plants, animals or microorganisms, can also be used.

Methods suitable for producing PUFA producing yeasts that can be used in the present invention are described in detail in WO2008/000277. Microorganism host cells that can be metabolically engineered to produce PUFA are extensively described in WO2008/000277 and can be used in accordance with the present invention. The preferred microorganisms use in the invention may be S. cerevisiae, A. niger, Escherichia coli or Bacillus subtilis.

Suitable bacteria to be metabolically engineered for use according to the invention in making fermented food or beverage products include the lactic acid bacteria.

Suitable bacteria may be used for fermentative acidification in producing cured meat products. Preferred bacteria for use in making preserved meat products are acid producing bacteria, especially lactic acid producing bacteria such as sausages include Lactobacillus plantarum, Lactobacillus curvatus, Pediococcus cerevisiae, Pediococcus acidilacti and Staphylococcus camosus. Others are Lactobacillus lactis, Lactobacillus sakei, Lactobacillus carnosus, Lactobacillus farciminis, and Staphylococcus xylosus. Suitable preserved meat products include sausages, including moist, semi-dry and dried sausages. Starter cultures containing one or more of these metabolically engineered according to the invention may be added to sausage making meat as known in the art.

Suitable bacteria to be metabolically engineered and used according to the invention to produce milk based products include Lactobacillus bulgaricus, Lactobacillus lactis and Streptococcus thermophilus.

Suitable bacteria to be metabolically engineered and used according to the invention in making fermented vegetable products such as sauerkraut and fermented pickles include Leuconostoc mesenteroides.

The constructed and engineered microorganism can be cultivated using commonly known processes, including chemostat, batch, fed-batch cultivations, etc.

Genetic modification of fungal hosts other than S. cerevisiae

The present invention demonstrates how metabolic engineering can be used in S. cerevisiae to increase fatty acid content and fatty acid desaturation in food or beverage products. The invention may also be used with yeast species in general e.g. yeast species as described in WO2008/000277.

Fatty acid desaturation The present invention demonstrates methods to increase desaturation of fatty acids in food or beverage products produced using baker's yeast, S. cerevisiae. Desaturation requires the activity of a fatty acid desaturase, cytochrome b5 and cytochrome b5 reductase. NADH-cytochrome b5 reductase is encoded by MCRl and cytochrome b5 is encoded by CYB5. Recombinant S. cerevisiae cells expressing a heterologous pathway to polyunsaturated fatty acids show increased production of arachidonic acid and gamma-linolenic acid when over- expressing S. cerevisiae CYB5 and MCRl, respectively. Relevant associated methodology for making use of the yeast Y. lipolytica is described in WO2008/000277.

PUFA content

In one embodiment, the present invention relates to food and beverage products having an improved polyunsaturated fatty acid content, wherein said heterologous expression, over-expression or deletion increases the content of each individual specific polyunsaturated fatty acid, particularly ARA and EPA, to more than 3 % of the total fatty acid content, such as 3% of the total fatty acid content, 4% of the total fatty acid content, 5% of the total fatty acid content, 6% of the total fatty acid content, 7% of the total fatty acid content, 8% of the total fatty acid content, 9% of the total fatty acid content, 10% of the total fatty acid, 15% of the total fatty acid content or more.

Thus, in one presently particular preferred embodiment, the metabolic engineering increases the content of arachidonic acid to more than 4 % of the total fatty acid content in the genetically modified fungal cell described herein.

In another particular preferred embodiment, the metabolic engineering increases the content of eicosapentaenoic acid to more than 3 % of the total fatty acid content in the genetically modified fungal cell described herein.

In another particular preferred embodiment, the metabolic engineering increases the content of gamma-linolenic acid to more than 13 % of the total fatty acid content in the genetically modified fungal cell described herein.

In another embodiment the said heterologous expression increases the content of each individual specific polyunsaturated fatty acid to more than 0.2% of the biomass dry weight, such as 0.2% of the biomass dry weight, 0.3% of the biomass dry weight, 0.4% of the biomass dry weight, 0.5% of the biomass dry weight, 0.6% of the biomass dry weight, 0.7% of the biomass dry weight, 0.8% of the biomass dry weight, 0.9% of the biomass dry weight, 1% of the biomass dry weight, 2% of the biomass dry weight, 3 of the biomass dry weight, 4% of the biomass dry weight, 5% of the biomass dry weight or more.

In one embodiment, the present invention uses a Saccharomyces cerevisiae comprising EPA and ARA in the ratio of at least 1 : 1, preferably at least 2: 1, most preferably 2.6: 1.

In one embodiment of the present invention the metabolic engineered Saccharomyces cerevisiae comprises at least 0.4 mg EPA pr. gram dry weight cell, such as at least 0.5 mg EPA pr. gram dry weight cell, at least 0,6 mg EPA pr. gram dry weight cell, at least 0.7 mg EPA pr. gram dry weight cell, at least 0,8 mg EPA pr. gram dry weight cell, at least 0.9 mg EPA pr. gram dry weight cell, at least 10.0 mg EPA pr. gram dry weight cell or more,

In one embodiment of the present invention the metabolic engineered

Saccharomyces cerevisiae comprises at least 1,5 mg ARA pr. gram dry weight cell, such as at least 1.6 mg ARA pr. gram dry weight cell, at least 1.7 mg ARA pr. gram dry weight cell, at least 1.8 mg ARA pr. gram dry weight cell, at least

1.9 mg ARA pr. gram dry weight cell, at least 2.0 mg ARA pr. gram dry weight cell, at least 2.1 mg ARA pr. gram dry weight cell or more,

In one embodiment of the present invention the metabolic engineered Saccharomyces cerevisiae comprises at least 8.0 mg GLA pr. gram dry weight cell, such as at least 8.1 mg GLA pr. gram dry weight cell, at least 8.2 mg GLA pr. gram dry weight cell, at least 8.3 mg GLA pr. gram dry weight cell, at least 8.4 mg GLA pr. gram dry weight cell, at least 8.5 mg GLA pr. gram dry weight cell, at least 8.6 mg GLA pr. gram dry weight cell or more,

In one embodiment of the present invention the metabolic engineered Saccharomyces cerevisiae comprises at least 24 mg. PUFA pr. gram dry weight cell, such as at least 25 mg PUFA pr. gram dry weight cell, at least 26 mg PUFA pr. gram dry weight cell, at least 27 mg PUFA pr. gram dry weight cell, at least 28 mg PUFA pr. gram dry weight cell, at least 29 mg PUFA pr. gram dry weight cell, at least 30 mg PUFA pr. gram dry weight cell or more.

Methods for expressing heterologous genes applicable in the present invention are described in detail in WO2008/000277.

The invention will be further described and illustrated with reference to the examples below and the accompanying drawings, in which :

Figure 1 shows the construction of plasmid psF048, used in Example 15.

Figure 2 shows the construction of plasmid psF066, used in Example 15.

Figure 3 shows the construction of plasmid psF065, used in Example 15.

Molecular biology methods used in strain construction

Methods for introducing relevant genes into microorganisms for use in this invention are described in detail in WO2008/000277, particularly in Examples 1- 81 thereof.

Standard recombinant DNA and molecular cloning techniques used in the production of cells for the Examples below are well known in the art and are described by: Sambrook, J., Fritsch, E. F., and Maniatis, T. Molecular Cloning : A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY (1989). Materials and methods suitable for the maintenance and growth of microbial cultures are well known in the art as described by, e.g. Manual of Methods for General Bacteriology (Gerhardt, P., Murray, R. G. E., Costilow, R. N., Nester, E. W., Wood, W. A., Krieg, N. R., and Briggs, G., Eds.) American Society for Microbiology: Washington, D. C. (1994). All chemicals and reagents used for maintenance and growth of cells were obtained from Sigma, DIFCO Laboratories or GIBCO/BRL unless specified otherwise. PCR reactions were carried out using the Phusion polymerase (Finnzymes). Oligonucleotides and sequencing services were purchased from MWG Biotech, Ebersberg, Germany. Purification of DNA fragments was carried out using GFX-columns (Amersham) or the QiaexII purification kit (Qiagen).

For yeast transformation, yeast cells were grown at 30°C in YPD medium and were made competent by a LiAc-based method (Sambrook et al., supra).

The genetic nomenclature used for describing the genotypes of the strains is as follows: Native yeast genes are written in capital letters, while deleted or mutated native yeast genes are written in small letters. Yeast promoters are indicated by a small p, for example pADHl, pTDH3 for the ADHl and TDH3 promoters. Overexpressions of native yeast genes by the promoter- replacement method are indicated by the promoter name followed by the gene name, for example pADHl-FASl, pTDH3-DGAl for overexpression of FASl with the ADHl promoter and overexpression of DGAl with the TDH3

promoter. Disruption of native yeast genes are indicated by a double colon, for example poxl : : pTDH3-M. alpina OLEl, which means that the POXl gene has been disrupted and that the TDH3 promoter and the M. alpina OLEl gene has been integrated in its place.

Example 1

Construction of PUFA yeast FSO 1666 used for bread baking

The yeast strain FS01666 (MATa URA3 trpl-289-pPYKl-MaD6E-TRPl pTPIl- MCRl poxl : :pTDH3-M. alpina OLEl fox2: : pTDH3-D12D potl : :pADHl-D5D dcil : :pADHl-OtD6D gppl : : pHXT7-S.kluyveri FAD3 pADHl-FAS2) was used for bread baking. The strain was constructed by transforming strain FSO 1624 (MATa ura3-52 trpl-289-pPYKl-MaD6E-TRPl pTPIl-MCRl poxl : : pTDH3- M. alpina OLEl fox2: : pTDH3-D12D potl : :pADHl-D5D dcil : :pADHl-OtD6D gppl : :pHXT7-S.kluyveri FAD3 pADHl-FAS2) with a DNA fragment containing the URA3 gene. The construction of FS01624 is described in WO2008/000277. The DNA fragment containing the URA3 gene was amplified by PCR, using the primers Ura3-up-fw (5' TGCGAGGCATATTTATGGTG 3') and Ura3-dw-rv (5'

GGAGTTCAATGCGTCCATCT 3'), using genomic DNA from the strain FS01201 (MATa URA3) as template in the reaction. Following gel-purification of the DNA fragment, it was transformed into strain FSO 1624. Transformants were selected and streak-purified on medium lacking uracil.

Example 2

Yeast fermentations with strain FSO 1666

Continuous and batch cultivations were performed in Biostat ® B Plus fermenters (Sartorius). Yeast cells originated from a glycerol stock culture, with an optical density at 600 nm (OD 6 oo) of 30 were used for inoculation of 1.0 I defined minimal medium as given in Example 4 and 5 of WO2008/000277, respectively in order to obtained an OD 600 of 0.03 as measured by using a Spectronic Genesys 10 Bio spectrophotometer (Thermo Electron Corporation).

The fermentations were carried out at 30 0 C. The continuous and batch fermentations were carried out respectively at pH 5.5 and pH 6 and controlled by 1OM KOH and 2M KOH, respectively. Foaming was avoided by the addition of 100 μl Antifoam 204 (Sigma-Aldrich, St Louis, Missouri) per liter medium. During continuous fermentation, aerobic conditions were obtained by sparging the fermentor with mixture of sterile air and oxygen at a flow rate of 2,2 l/min to ensure that the dissolved oxygen concentration was 30%. During batch fermentation, aerobic conditions were obtained by sparging the fermentor with sterile air at a flow rate of 1.5 l/min. The stirring speed was kept at 1100 rpm and 100 rpm, respectively for continuous and batch fermentation.

The concentrations of oxygen and carbon dioxide in the exhaust gas from the fermenters were measured with a gas analyzer The Fermentation Monitor - INNOVA 1313 (Innova AirTech Instruments A/S, Bruel & Kjaer, Denmark).

The reactor for continuous fermentation was started up in a batch mode with defined minimal medium as given in Example 4 of WO2008/000277. After depletion of the carbon source, level controlled continuous fermentation mode was applied at dilution rate of 0.018 h "1 using growth medium for continuous fermentation as given in Example 4 of WO2008/000277. The dilution rate was gradually increased to reach final dilution rate of 0.092 h "1 .

Example 3

Growth medium used in chemostat fermentation

A minimal growth medium was used in batch phase of chemostat fermentation (20 g/l glucose, 10 g/L (NH 4 ) 2 SO 4 , 0,5 g/L MgSO 4 *7H2O, 10 g/L , KH 2 PO 4 , /I vitamin solution and 1 ml/1 trace metal solution as specified in Example 6 of WO2008/000277)

For chemostat fermentation with 200 g/L glucose as carbon source, a minimal growth medium with a molar C/N ratio of 15 (assuming 8% total nitrogen in the yeast extract) was used. The medium contained : 200 g/L glucose, 25 g/L (NH4)2SO4, 10 g/l KH2PO4, 5.5 g/l MgSO4 *7H2O, 10 g/L yeast extract (Bacto™ Yeast Extract, Difco), 4.8 ml/L vitamin solution and

4.4 ml/L trace metal solution. The vitamin solution contained : 50 mg/L biotin, 1 g/L calcium panthotenate, 1 g/L nicotinic acid, 1 g/L thiamine HCI, 1 g/L pyridoxal HCI and 0.2 g/L para-aminobenzoic acid, while the trace metal solution contained : 15 g/L EDTA, 4.5 g/L ZnSO4 -7H2O, 1 g/L MnCI2-2H2O, 0.3 g/L COCI2-6H2O, 0.4 g/L Na2MoO4-2H2O, 4.5 g/L CaCI2-2H2O, 3 g/L FeSO4-7H2O, 1 g/L H3BO3 and 0.1 g/L KI.

Example 4

Growth medium used in batch fermentation

For batch fermentation with 35g/L glucose as carbon source, a minimal growth medium was used. The medium contained : 35 g/L glucose, 17,5 g/L (NH4)2SO4, 10 g/l KH2PO4, 1,75 g/l MgSO4 *7H2O, 1,75 ml/L vitamin solution and 1,75 ml/L trace metal solution. The vitamin solution contained : 50 mg/L biotin, 1 g/L calcium panthotenate, 1 g/L nicotinic acid, 25 g/L myo- inositol, 1 g/L thiamine HCI, 1 g/L pyridoxal HCI and 0.2 g/L para- aminobenzoic acid, while the trace metal solution contained : 15 g/L EDTA,

4.5 g/L ZnSO4 -7H2O, 1 g/L MnCI2-2H2O, 0.3 g/L CoCI2-6H2O, 0.4 g/L

Na2MoO4-2H2O, 4.5 g/L CaCI2-2H2O, 3 g/L FeSO4-7H2O, 1 g/L H3BO3 and 0.1 g/L KI.

Example 5

HPLC analysis

Glucose, galactose, ethanol, glycerol, acetate, succinate, and pyruvate concentrations in the culture broth were determined by column liquid chromatography (CLC) using a Dionex Summit CLC system (Dionex, Sunnyvale, CA) after removing the cells from the culture broth via centrifugation. An Aminex HPX-87H column (BioRad, Hercules, CA) was used at 60°C with a Waters 410 Differential refractive index detector (Millipore, Milford, MA) and a Waters 486 Tuneable Absorbance Detector (UV detector) set at 210 nm. The two detectors were connected in series. As mobile phase 5 mM H2SO4 was used at a flow rate of 0.6 ml/min.

Example 6

Yeast and bread dry weight determination

The cell dry weight was determined by filtering a known volume of the culture broth through a pre-dried, pre-weighed 0.45 μm Supor membrane (Pall Corporation, Ann Arbor, MI) filter. After washing with 1 volume of distilled water and drying in microwave oven for 15 minutes at 150 W, the filter was weighed again and the dry weight was calculated. For bread samples a known amount of bread (ca. 0.6g) was dried for 2x15 minutes at 150 W followed by passive drying in an exsiccator for 24 hours.

Example 7

Lipid extraction from yeast FS01666

Prior to lipid extraction, the yeast biomass was separated through centrifugation for 5 minutes at 5000 rpm. The biomass was re-dissolved in 10-15 ml distilled water and the resulting cell suspension was broken using the glass bead method to generate cell extract.

The cells for extraction were prepared by transferring 1 ml cell suspension (ca 40mg dry weight) to a micro tube with screw cap (Sarstedt, Germany), centrifuged at δOOOrpm for 4min and removing the supernatant. To the wet cells 1 ml glass beads with a particle size of 250-500 μm (Sigma-Aldrich, St Louis, Missouri) and 0.8ml 0.02% butylated hydroxytoluen (BHT) in chloroform-methanol (C:M, 2: 1, v/v) was added followed by 200μl internal standard (ISTD) (C23:0 methyl ester, >99% p. a., Sigma) C: M (2: 1, v/v) using a 200μl precision glass pipette (Socorex). The tube was shaken at level 4 for 20 sec. in a FastPrep FP120 instrument (Qbiogene, France). This was done in a total of 6 rounds for each tube with a 5 minutes intervening cooling of the tubes on ice after 3 rounds. The sample was immediately transferred to a glass tube with screw cap containing and the tube rinsed in 2xlml C:M (2: 1, v/v) and combined with the sample. An additional 5ml C:M (2: 1, v/v) was added, headspace was flushed with nitrogen, and the glass tube closed immediately and placed on a rotary mixer (Multi-Tube Vortexer, DVX-2500) at 2500 rpm for 15min using the pulse function (20 sec). The extract was then filtered through a Whatman filter (Whatman International, England), the tube and filter unit rinsed in 3x2 ml C:M (2: 1, v/v) and the collected solvent was washed with 3.5 ml 0.73% NaCI and dried over nitrogen. Traces of water were removed by adding 1 ml methanol and taking it to complete dryness under nitrogen. Finally 1 ml of toluene was added and the sample stored at -20 0 C if methylation could not be performed immediately.

Example 8

Lipid extraction from bread

Approximately 2Og of bread was taken from the middle and > lcm from the crust. Seeds were discarded and the remains cut into fine particles and used for dry weight determination and lipid extraction.

For each bread 3 samples of ca 0.6g were weighed precisely and transferred to individual 30ml homogenisation tubes containing 15ml chloroform: methanol (C:M, 2: 1, v/v) and internal standard (C23:0 methyl ester, >99% p. a., Sigma). Samples were extracted passively for 60min at 5°C and then actively by homogenisation using a polytron (PT-2000) at speed 1-2. Homogenisation was performed on ice for 3x15 sec intercepted by 3x45sec periods of cooling.

The extract was then filtered through a Whatman filter (Whatman

International, England), the ultra-turrex rod was rinsed down into the homogenisation tube with 2x2ml C: M (2: 1, v/v) and finally the filter unit was rinsed in 3x2 ml C:M (2: 1, v/v). The collected solvent was washed with 6 ml 0.73% NaCI and dried over nitrogen. Traces of water were removed by adding 1 ml methanol and taking it to complete dryness under nitrogen. Finally 1 ml of toluene was added and the sample was stored at -20 0 C if methylation could not be performed immediately.

Example 9

Fatty acid methylation

Fatty acid methyl esters (FAME) were produced by acidic transmethylation. To the lipid dissolved in 1 ml 0.02% butylated hydroxytoluene(BHT)-toluene (generated in Example 9 of WO2008/000277), 2 ml 1% sulphuric acid in methanol was added. The tube was closed after mixing and flushing

headspace with nitrogen, and lipids transesterified at 80°C for 1 hour. After cooling to room temperature the sample was washed with 2 ml saturated NaCI solution containing 0.2% sodium carbonate. FAME were subsequently extracted twice by adding 1 ml heptane, vortexing the sample, centrifugation at 3000 rpm for 2min (4°C) and collecting the organic upper phase. The combined upper phases were dried under a stream of nitrogen (40 0 C) and traces of water were removed by adding 1 ml methanol and taking it to complete dryness under nitrogen. FAME was dissolved in a suitable volume of heptane (0.2-1.0 ml) containing 0.01% BHT (Sigma-Aldrich, St Louis, Missouri), transferred to a 2 ml GC-vial with a 200μl insert and FAME analysed using gas-liquid-chromatography (GLC).

Example 10

Gas chromatography with FID detection

FAME were analysed on a gas chromatograph (GC) (GC-2010, Shimadzu) coupled to a mass-selective-detector (MS) (GCMS-QP2010, Shimadzu)) and a flame-ionisation-detector (FID). The GC-MS-FID was operated with a split/splitless auto-injector (AOS-20i, Shimadzu) and GCMSsolution software, Lab solution (version 2.50, Shimadzu).

Sample injection volumes were 1 - 5μl (2-6mg/mL) and the split ratio 10: 1 - 50 : 1 operated at an injector temperature of 250°C. Number of rinses with sample prior to injection was 1 and after injection number of rinses with solvent was 5. Samples were split and components separated in parallel on two identical capillary columns (50mx0.25mmID, 0.25μm film thickness) (CP-Select CB for FAME, Varian). One column was fitted to a mass spectrometer (MS-quadropole) and one to a flame-ionization-detector (FID) for identification/structural clarification and quantification, respectively.

Helium was used as carrier gas and operated at a linear velocity of 36 cm/sec (18 cm/sec pr column). Purge flow was set at 3mL/min.

Based on the highly polar nature of the column coating (100% cyanopropyl) and an optimized temperature programme (see below), FAME were separated according to differences in polarity and boiling point. Oven temperature was initially set at 50°C. Immediately after injection it was increased to 145°C at 30°C/min, then increased to 205°C at 2°C/min and finally increased to 250 °C at 20°C/min and kept there for 5min. Total run time was 40.42 min.

The MS was operated in the SCAN mode (46m/z-500m/z) using electronic ionisation (EI) at 7OeV, with a scan speed of 1000 amu/sec and scan events every 0.5 sec. Ion source temperature was set at 105°C and interface temperature at 250°C. At the FID side helium as used as makeup gas (40ml_/min) and air/hydrogen set at 10 : 1 (400 :40ml/min). The detector was set at 275°C with a sampling rate of 40msec.

Along with MS spectra compared with the 1998 NIST Mass Spectral Database, FAME were routinely identified based on relative retention time (RRT) with C18:0 ME (Octadecanoic acid methyl ester) as reference component, using the GCMSsolution software (version 2.50, Shimadzu). RRT were produced and updated using an array of commercially available FAME standards (Sigma, Nu-Chek-Prep, Larodan, Avanti, Matreya). A quantitative FAME standard (GLC 68A, Nu-Chek-Prep) was run routinely to monitor the condition of the columns and over all GC performance.

Example 11

Fatty acid quantification and yield

Quantification was based on FID data auto-integrated by the GCMS solution software and manually corrected for potential artefacts. Amounts of individual fatty acids (FA) and total FA (mg) were calculated based on the ISTD (C23 :0 methylester), added during lipid extraction. The ISTD was made up in a solution of chloroform : methanol (2: 1, v/v) and a suitable amount was added to represent 5-10% of total FA. For comparative purposes an allowed total area range was set at 0.8-1.2 million. FA yield (mg FA/g DW) was determined by calculation based on the ISTD and divided by the dry weight (DW) of the biomass in 1 ml of the initial cell suspension.

Example 12

Production of PUFA yeast for bread baking in chemostat.

Yeast strain FS01666 was cultivated in chemostat fermentation as described in example 2 with the medium described in example 3. At steady state conditions, the fatty acid content in the yeast was analyzed. The fatty acid composition and fatty acid content of the yeast at steady state is shown in table Ia.

Table Ia. Fatty acid composition (% of total fatty acid) and fatty acid content of yeast strain FS01666 produced in chemostat fermentation. Values are an average of 2 samples taken during steady state conditions.

At steady state conditions, an amount of cultivation broth corresponding to 14 g yeast dry weight was withdrawn from the reactor. The yeast was harvested by centrifugation (4000 rpm for 5 minutes) and was stored first on ice for 4 hours and then in a fridge at 4 0 C for 2 hours before being used for bread baking.

Example 13

Production of PUFA yeast for bread baking in batch fermentation.

Yeast strain FSO 1666 was cultivated in batch fermentation as described in example 3 of WO2008/000277 with the medium described in example 5 thereof. After 44 hours of growth, a sample lipid analysis and cultivation broth corresponding to 12.5 g yeast dry weight was withdrawn from the reactor. The yeast was harvested by centrifugation (4000 rpm for 5 minutes) and was stored first on ice for 4 hours and then in a fridge at 4 0 C for 2 hours before being used for bread baking. The fatty acid composition and fatty acid content of the yeast at the time of harvest is shown in table 2a.

Table 2a. Fatty acid composition (% of total fatty acid) and fatty acid content of yeast strain FS01666 produced in batch fermentation. Values are an average of 2 samples taken after 44 hours of growth.

Example 14

Bread baking with PUFA yeast FS01666

The ready-made bread mix "Durumstykker med hele durumkerner" from Amo, Lantmannen Schulstad A/S, Hammerholmen 21-35, 2650 Hvidovre, Denmark was used for bread baking. According to the information from the supplier, the mix contained wheat flour, wheat grains, salt, wheat gluten, maize flour, stabilized wheat germ, inactivated yeast, malt flour, E300, alpha-amylase enzyme, hemicellulase enzyme.

Four loaves of bread were prepared. Bread 1 contained no added yeast, Bread 2 was baked with the commercial baker's yeast "Malteserkors gaer" from De danske spritfabrikker A/S, Copenhagen, Denmark, and Breads 3 and 4 were baked with the PUFA yeast FS01666. The PUFA yeast used for baking Bread 3 was produced as described in Example 12, while the PUFA yeast used for making Bread 4 was produced as described in Example 13.

Table 3a. Type and amount of yeast added to the dough for bread making. *) Dry weight indicated by supplier of commercial yeast

For preparation of the dough for bread baking, yeast in the amounts described in Table 3a was dissolved in 325 ml pre-warmed water (30°C) and 500 g of ready-made bread mix was added. The dough was allowed to

proove at 4°C for approximately 16 hours, was transferred to a baking pan and was placed at 200°C for 30 min.

The bread loaves were allowed to cool to room temperature, and the fatty acid content was analyzed as described in Examples 8-11. The fatty acid composition and content of fatty acids in the PUFA and control breads are presented in Table 4a.

By the use of the metabolically engineered yeast, the bread produced will have an enhanced (reduced) ratio of n-6/n-3 fatty acid contents.

Table 4a. Fatty acid composition and fatty acid content of bread baked without yeast (Bread* 1), with commercial yeast (Bread #2) and with PUFA yeast (Bread #3 and Bread #4).*)Co-elution with unidentified compound.

Example 15

Construction of PUFA yeast FS08105 used for bread baking

The yeast strain FS08105 (MATalpha ura3-52: :pSF048 trpl-289: : pSF066 leu2-3_112: :pSF065 poxl : : pTDH3-Molel pADHl-FASl pTPIl-MCRl potl : : pADHl-D5D dcil : : pADHl-D6D_OT fox2: : pTDH3-D12D) is used in bread baking (Example 22).

The strain was constructed by transforming strain FS01610 (MATalpha ura3- 52 trpl-289 Ieu2-3_112 poxl : : pTDH3-Molel pADHl-FASl pTPIl-MCRl potl : : pADH 1-D5D dcil : : pADH 1-D6D_OT fox2: : pTDH3-D12D) first with plasmid pSF048 linearized with restriction enzyme Ncol, which cuts once in URA3 DNA fragment, and selecting transformants on medium lacking uracil, and next with plasmid pSF066 linearized with restriction enzyme EcoRV, which cuts once in TRPl, and selecting transformants on medium lacking uracil and tryptophan, and finally with plasmid pSF065 linearized with restriction enzyme BstE2, which cuts once in LEU2, and selecting transformants on medium lacking uracil and tryptophan and leucine. The construction of FS01610 is described in WO2008/000277. The EPA pathway genes Mortierella alpina D12D, Ostreococcus tauri D6D, Mortierella alpina D6E, Mortierella alpina D5D and Saccharomyces kluyveri FAD3 is described in WO2008/000277.

Description of expression plasmids

Plasmid pSF048 (SEQ ID NO 1) is an integrative yeast plasmid with the following functional features: beta-lactamase for providing resistance to ampicillin for selection in E.coli.

URA3 for providing selection for growth on medium lacking uracil in yeast.

Expression of Mortierella alpina D5D from a TEFl promoter /ADHl terminator.

Expression of Ostreococcus tauri D6D from a TDH3 promoter /CYCl terminator. pSF48 is a derivative of pRS306 (Sikorski,R.S. and Hieter,P. λ A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae'. Genetics 122 (1), 19-27

(1989)) where the expression cassettes were introduced using standard molecular biology methods.

Plasmid pSF065 (SEQ ID NO 2) is an integrative yeast plasmid with the following functional features: beta-lactamase for providing resistance to ampicillin for selection in E.coli.

LEU2 for providing selection for growth on medium lacking leucine in yeast.

Expression of Saccharomyces kluyveri FAD3 from a TDH3 promoter /CYCl terminator. pSF65 is a derivative of pESC-LEU (Stratagene) where the 2 micron origin was removed by digesting the vector with restriction enzyme Afel, which cuts 8 times in the 2 micron origin, followed by religation of the vector backbone and next replacing the GALlGALlO promoter region with pTDH3-

SkFAD3 using standard molecular biology methods.

Plasmid pSF066 (SEQ ID NO 3) is an integrative yeast plasmid with the following functional features: beta-lactamase for providing resistance to ampicillin for selection in E.coli.

TRPl for providing selection for growth on medium lacking tryptophan in yeast.

Expression of Mortierella alpina D6E from a TEFl promoter /ADHl terminator.

Expression of Mortierella alpina D12D from a TDH3 promoter /CYCl terminator.

pSF66 is a derivative of pESC-TRP (Stratagene) where the 2 micron origin was removed by digesting the vector with restriction enzyme Afel, which cuts 8 times in the 2 micron origin, followed by religation of the vector backbone and next replacing the GALlGALlO promoter region with pTEFl- MaD6EpTDH3-MaD12D using standard molecular biology methods.

Example 16

Yeast fermentation with strain FS08105

Fed-batch cultivation was performed in Biostat ® B Plus fermenter (Sartorius). Yeast cells originated from a glycerol stock culture, with an optical density at 600 nm (OD 6 oo) of 100 were used for inoculation of 0.5 I defined minimal medium as given in Example 17, in order to obtained an OD 6 oo of 0.1 as measured by using a Spectronic Genesys 10 Bio spectrophotometer (Thermo Electron Corporation).

The fermentation was carried out at 30 0 C and at pH 5.5 controlled by 4M KOH and 4M NH 4 OH. Foaming was avoided by the addition of 50 μl and 100 μl of Antifoam 204 (Sigma-Aldrich, St Louis, Missouri) per liter medium, respectively in the batch phase and in the feed.

During the fed-batch fermentation, aerobic conditions were obtained by sparging the fermenter with mixture of sterile air and oxygen at a flow rate of 1,5 l/min. The stirring speeds was kept at 1000 rpm for the batch phase and during the feeding phase a cascade control mode (1000-1200 rpm), based on the dissolved oxygen levels, was applied.

The concentrations of oxygen, carbon dioxide and ethanol percentage in the exhaust gas from the fermenter were measured with a gas analyzer - The

Fermentation Monitor - INNOVA 1313 (Innova AirTech Instruments A/S, Brϋel & Kjaer, Denmark).

The reactor for fed-batch fermentation was started up in a batch mode with defined minimal medium as given in Example 17. After depletion of the carbon source and the ethanol, the feeding phase was started by feeding a defined minimal medium as given in Example 17. The feeding rate was set to an exponential profile in function of the feed volume added (see equation 1), V [I] :

(Equation 1)

where V 0 [I] denotes the volume of liquid at the start of the fed-batch process; X 0 [g DW/I] the biomass concentration at the start of the fed-batch process; Sf ee d [g/l], the substrate concentration in the feed; Yxs [g/g DW], the inverse of biomass yield on substrate; and μ 0 [IV 1 ], the specific growth rate.

The parameters used for calculating the exponential feeding profile in the fed-batch cultivation were:

- μ 0 [IV 1 ] = 0.100

X 0 [g DW/I] = 8.5 (value measured before start the feeding)

- Sfeed [g/l] = 200

- Yxs [g/g DW] = 2.86

- V 0 [I] = 0.5

The feed rate was automatically controlled by an on-off feedback control system based on the ethanol fraction in the off-gas analyser (% Ethanol) : if % Ethanol < 0.010, feed pump switched on; if % Ethanol > 0.010, feed pump switched off. After app 23h of feeding with the exponential profile, the feeding rate was set to a constant profile, 0.022 l/h.

Example 17

Growth medium used in the fed-batch fermentation

A minimal growth medium was used in batch phase as well as in the feed of the fed-batch fermentation. The medium used in the batch phase contained: 40 g/l glucose, 8,75 g/l (NH 4 ) 2 SO 4 , 1,75 g/l MgSO 4 -7H 2 O, 17,5 g/l KH 2 PO 4 , 1,75 ml/1 vitamin solution and 1 ml/1 trace metal solution. The medium used in the feed contained : 200 g/l glucose, 15 g/l KH 2 PO 4 , 10 g/l MgSO 4 -7H 2 O, 3,5 g/l K 2 SO 4 , 0,5 g/l Na 2 SO 4 , 15 ml/1 vitamin solution and 15 ml/1 trace metal solution.

The vitamin solution contained : 50 mg/l biotin, 1 g/l calcium panthotenate, 1 g/l nicotinic acid, 25 g/l myo-inositol, 1 g/l thiamine HCI, 1 g/l pyridoxal HCI and 0.2 g/L para-aminobenzoic acid, while the trace metal solution contained : 15 g/l EDTA, 4.5 g/l ZnSO 4 -7H 2 O, 1 g/l MnCI 2 -2H 2 O, 0.3 g/l CoCI 2 -6H 2 O, 0.3 CuSO 4 -5 H 2 O, 0.4 g/l Na 2 MoO 4 -2H 2 O, 4.5 g/l CaCI 2 -2H 2 O, 3 g/l FeSO 4 -7H 2 O, 1 g/l H 3 BO 3 and 0.1 g/l KI.

Example 18

Lipid extraction and methylation of fatty acids from yeast strain FS08105

Prior to lipid extraction, an estimation of dry-weight (DW) concentration of the culture was done and the culture either diluted or concentrated in dH 2 O, such that a suspension with a dry-weight concentration of approximately 8 mg/ml was obtained.

The cells for extraction were prepared by transferring 1 ml cell suspension (ca 8mg dry weight) to a trans-methylation tubes (lOOxlβmm) with "red" PTFE-lined "black" screw-on caps micro tube with screw cap (SciLabware Limited, Staffordshire, United Kingdom), centrifuged at δOOOrpm for 4 min and removing the supernatant. 50 μl internal standard was added (C23:0 FFA, >99% p. a., Larodan) with 140 μl ION KOH and 1250 μl methanol, the samples were vortexed and incubated for 90 min at 55 ^ with thoroughly hand-shaking for 5 sec every 20 min. After incubation, the samples were allowed to cool down below room temperature in an ice bath. Subsequently, 115 μl 24N H 2 SO 4 was added and mixed thoroughly by hand-shaking and incubated for 90 min at 55^ with hand-shaking for 5 sec every 20 min. Again the samples were allowed to cool down in an ice bath, before adding 600μl heptane. The samples were then vortexed for 5 min and centrifugated for 5 min at 1739xg for phase separation. About 150 μl of the upper heptane phase was transferred to a GC vial with an insert (200μl) and stored at -20 0 C until GC analysis.

Example 20

Extraction of lipids from dough

Approximately 20 g of dough (before and after prooving) was taken for analysis. The bread was then cut into fine particles and used for dry weight determination (Example 7) and lipid extraction.

For each dough, 3 samples of Ig were weighed precisely and transferred to individual 30 ml homogenisation tubes containing 15ml chloroform: methanol (C:M, 2: 1, v/v) and 50 μl internal standard (C23:0 FFA, >99% p. a., Larodan). Lipid extraction from the dough samples then continued in the same way as described for the bread samples (Example 8) and fatty acids

were methylated as described in Example 9. Fatty acids were analyzed by fast GC (Example 21) and quantified as described in Example 11.

Example 20

Fast gas chromatography with FID detection

FAME were analysed on a gas chromatograph (GC) (Agilent 7890A, Agilent) coupled to a flame-ionisation-detector (FID). The GC-FID was operated with an auto-injector (GC-PaI, CTC Analytics) and GC software, EZChrom Elite (version 3.3.1).

Sample injection volumes was lμl (2-6mg/ml_) and the split ratio 200: 1 operated at an injector temperature of 250°C. Number of rinses with sample prior to injection was 1 and after injection the number of rinses with solvent was 5. Samples were separated on a DB-Wax column (lOmxO.lmmID, O. lμm film thickness) (J&W Scientifics). The column was fitted to a flame- ionization-detector (FID) for identification and quantification. Hydrogen was used as carrier gas and operated at a linear velocity of 30 ml/min

Based on the polar nature of the column coating (100% DB-Wax) and an optimized temperature programme (see below), FAME were separated according to differences in polarity and boiling point. Oven temperature was initially set at 190°C. Immediately after injection it was increased to 230°C at 40°C/min, then increased to 240°C at 12°C/min and finally increased to 260 °C at 60°C/min and kept there for 0.5 min. Total run time was 3.0667 min.

On the FID side, nitrogen was used as makeup gas (25ml_/min) and the air/hydrogen ratio set at 13.33: 1 (400 :30ml/min). The FID-detector was set at 275°C.

The FAME were identified based on relative retention time (RRT). Using the GC software (EzChrom Elite), RRTs were produced and updated using an array of commercially available FAME standards (GLC reference standard 68D, 409 and 85, Nu-Chek-Prep) and C22:4 (n-6), C23:0, C22: 5 (n-3) and C18:4 (n-3) (Sigma, Larodan and Avanti). A quantitative FAME standard (GLC 68D, Nu-Chek-Prep) was run routinely to monitor the condition of the column and overall GC performance.

Example 21

Production in fed-batch of PUFA yeast FS08105 for bread baking

Yeast strain FS08105 was cultivated in fed-batch fermentation as described in Example 16 with the medium described in Example 17. After 64 hours of cultivation, an amount of cultivation broth corresponding to 14 g yeast dry weight, for each bread baking, was withdrawn from the reactor. The yeast was harvested by centrifugation (4000 rpm for 5 minutes) and was stored at 4 0 C for 2 hours before being used for bread baking. A sample of the culture broth was collected at the time of harvest and used for lipid extraction according to Example 18. Fatty acids were analyzed by fast GC as described in Example 20 and were quantified as described in Example 11. The fatty acid yield and composition in the yeast biomass at the time of harvest is presented in Table 5.

Table 5. Fatty acid composition (% of total fatty acid) and fatty acid content of yeast strain FS08105 produced in fed-batch fermentation.

Example 22

Bread baking with PUFA yeast FS08105

The ready-made bread mix "Ciabatta" from Amo, Lantmannen Schulstad A/S, Hammerholmen 21-35, 2650 Hvidovre, Denmark was used for bread baking. According to the information from the supplier, the mix contained wheat flour, salt, wheat gluten, maize flour, stabilized wheat germ, inactivated yeast, malt flour, E300, alpha-amylase enzyme, hemicellulase enzyme.

Four loafs of bread were prepared. Bread 5 contained no added yeast, Bread 6 was baked with the commercial baker's yeast "Malteserkors gaer" from De danske spritfabrikker A/S, Copenhagen, Denmark, and Breads 7 and 8 were baked with the PUFA yeast FS08105, prepared as described in Example 21.

Table 6. Type and amount of yeast added to the dough for bread making. *) Dry weight indicated by supplier of commercial yeast

For preparation of the dough for bread baking, yeast in the amounts described in Table 6 was dissolved in 325 ml pre-warmed water (30°C) and

500 g of ready-made bread mix was added. The dough for breads 5, 6 and 7 was then allowed to proove at room temperature, while the dough for bread 8 was placed at 4°C for prooving. Following prooving for approximately 15 hours, the dough was transferred to baking pans and the breads were baked at 220°C for 30 min. Samples of the dough were collected before and after prooving. The dough samples were and kept at -20°C until extraction of lipids, which was performed as described in Example 19. The bread loaves were allowed to cool to room temperature before excising samples and extracting lipids as described in Example 8. Lipid samples from the dough and breads were methylated as described in Example 9, and the FAMEs were analyzed by fast GC as described in Example 20 and quantified as described in Example 11.

The fatty acid composition and content of fatty acids in the PUFA and control breads are presented in Table 7. The fatty acid composition and content of fatty acids in the dough samples before and after prooving is presented in Table 8 (bread #5 and 6) and Table 9 (bread #7 and 8).

Table 7. Fatty acid composition and fatty acid content of bread baked without yeast (Bread#5), with commercial yeast (Bread #6) and with PUFA yeast with different prooving conditions (Bread #7 and Bread #8). *)Co-elution with unidentified compound.

Table 8. Fatty acid composition and fatty acid content of the dough before and after prooving for dough prepared without yeast (Dough#5) and with commercial yeast (Dough #6). *) Co-elution with unidentified compound.

20:4(n-3) Eicosatetraenoic acid 0.2 0.0 0.3 0.1 0.3 0.0 0.3 0.1

20:5(n-3) Eicosapentaenoic acid (EPA) 0.3* 0. 1 0.3* 0. 1 0.3* 0. 0 0.3* 0. 1

Total other fatty acids (%) 4.4 4.2 6.0 6.6

SUM (%) 100.0 100.0 100.0 100.0

SUM, Saturated FA (%) 19 .0 0. 15 19 .3 0. 15 18 .6 0.2 18 .6 0.1

SUM,MUFA (%) 13 .0 0 .1 13 .2 0. 15 13 .4 0 14 .3 0.2

SUM, PUFA ( 2 double bonds) (%) 63 .4 0 .5 63 .2 0 .9 61 .9 0.3 60 .3 0.3

SUM, PUFA ( 3 double bonds) (%) 4. 6 0 .1 4. 6 0 .0 4. 8 0.1 4. 8 0.4

Table 9. Fatty acid composition and fatty acid content of the dough before and after prooving for dough prepared with PUFA yeast FS08105, with prooving at room temperature (Dough#7) and at 4°C (Dough #8). *) Co-elution with unidentified compound.

20:4(n-3) Eicosatetraenoic acid 0.3 0.0 0.3 0.0 0.3 0.0 0.4 0.1

20:5(n-3) Eicosapentaenoic acid (EPA) 0.4* 0. 0 0.5* 0 .0 0.4* 0. 1 0.5* 0. 1

Total other f " atty acids (%) 5.2 6.0 5.8 6.5

SUM (%) 100.0 100.0 100.0 100.0

SUM, Saturated FA (%) 18 .8 0.3 19 .1 0.3 18 .6 0 19 .0 0.2

SU M, M U FA (%) 13 .5 0.3 14 .1 0.1 13 .5 0 14 .1 0.1

SUM, PUFA ( 2 double bonds) (%) 62 .5 0.4 60 .8 0.4 62 .1 0.3 60 .4 0.4

SUM, PUFA ( 3 double bonds) (%) 4. 7 0.1 5. 3 0.2 4. 9 0.2 5. 1 0.0

In Table 10 below, data is extracted from Tables 7, 8 and 9. The values are mg/g dry weight. They represent the content of the given fatty acids in the dough before and after proving and in the baked product. By way of example as to how these are calculated, SUM PUFA(>3 double bonds) for bread#5 dough before = FA content times percentage of FA = 10.6 mg/g * 4.6 % = 0,488 mg/g.

It can be seen is that it is only when the yeast FS08105 exemplifying the invention is used that ARA is produced and that the EPA is produced during the process so that the final level of EPA is increased. The EPA production is more clearly appreciated when breads #7 and #8 are compared to breads #5 and #6 demonstrating that in the control breads the EPA present from the beginning is decomposed during the baking process. Since in breads #7 and #8, the amounts of PUFA actually increase during baking and the amounts of EPA scarcely fall, this implies that EPA and other PUFA are produced even during the baking process. The result is that a more healthy bakery product can be obtained when using the modified yeast. If it is thought that the changes are relatively small, they should be compared with the UK Government recommendation for the daily intake of long chain omega-3 polyunsaturates such as EPA, which is only 450 mg/person/day.

Looking in more detail only at omega-3 then the absolute results are (Table 11) :

oo

LD

In summary, bread with no yeast loses 23% of its omega-3 fatty acids during the baking process, a bread with a commercial yeast looses 10% whereas the two breads with the modified yeast increase their content by 10% and 32% respectively. A bread baked with the modified yeast contains 24% and 35% more omega-3 fatty acids respectively compared to a bread baked with a commercial yeast.

Lastly, it has been observed that the breads described above baked with the modified yeast have no 'fishy' smell, whereas the simple addition of fatty acids to a bread mixture is known to produce this. We surmise that this may be due to PUFA's being held within yeast cells.

REFERENCES

WO2005/118814

PCT/EP2005/007754

US 98/07422 5 US 60/624812

US2006/0094092

US-2006-0051847-A1

US 2003/0177508

WO2005/012316 10 WO2004/057001

WO2004/076617-A2,

WO06052807-A2,

WO06052824A2,

WO06052814A2 15 WO 200244320-A

WO2006125000

WO2006055322

Beaudoin, F., et al. (2000). Heterologous reconstitution in yeast of the polyunsaturated fatty acid biosynthetic pathway. Proc. Natl. Acad. Sci. U. S. A 97, 20 6421-6426.

Domergue, F., et al. (2003). Acyl carriers used as substrates by the desaturases and elongases involved in very long-chain polyunsaturated fatty acids biosynthesis reconstituted in yeast. J Biol. Chem 278, 35115-35126.

Gerhardt, P., et al., Eds. Manual of Methods for General Bacteriology. American 25 Society for Microbiology: Washington, D. C. (1994)

Sikorski,R.S. and Hieter,P. λ A system of shuttle vectors and yeast host strains designed for efficient

manipulation of DNA in Saccharomyces cerevisiae'. Genetics 122 (1), 19-27 (1989)