FUSION PROTEINS, RECOMBINANT BACTERIA, AND EXOSPORIUM

FRAGMENTS FOR ANIMAL HEALTH AND AQUACULTURE

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S Provisional Application Serial No. 62/309,259, filed on March 16, 2016, the entirety of which is herein incorporated by reference.

FIELD OF THE INVENTION

[0002] The present invention generally relates to fusion proteins, recombinant Bacillus cereus family members that express such fusion proteins, and exosporium fragments derived from spores of the recombinant Bacillus cereus family members. The present invention further relates to compositions containing spores of a recombinant Bacillus cereus family member or exosporium fragments derived from spores of a recombinant Bacillus cereus family member. Uses of spores of recombinant Bacillus cereus family members and exosporium fragments derived from spores of a recombinant Bacillus cereus family member in the fields of animal health and aquaculture are also provided. In particular, the invention relates to methods for using the spores or exosporium fragments for protecting an animal or an aquatic organism from a pathogen. The invention further relates to methods for using exosporium fragments and/or spores of a recombinant Bacillus cereus family member for producing an immunogenic response in an animal. Products for use in protecting animals from pathogens are also provided, including adhesive patches, wound dressings, insert trays for livestock footbaths, hoof bandages, feed, feed additives, and insect foggers.

BACKGROUND OF THE INVENTION

[0003] Colonization of an organism by a pathogen is the first step towards the occurrence of disease. Currently, no effective means for delivery of a peptide, enzyme, or other protein to an animal exists that allows the peptide, enzyme or other protein to remain active long enough to effectively disrupt bacteria, fungal, or protozoan colonization or infection. Thus, there is a need in the art for methods for stabilizing and delivering proteins or peptides that protect animals from pathogens through antibacterial, antifungal, antihelminthic, or insecticidal activity, or through suppression of pathogen reproduction. Previous attempts to introduce peptides, enzymes, and other proteins to animals has been hampered by quick degradation and limited absorption of enzymes, proteins, and peptides in or on the animal. Additionally, the prevalence of systemic proteases in animals; rapid metabolism; opsonization; conformational changes; dissociation of subunit proteins; non-covalent complex formation with blood products; and destruction of labile side-groups all are impairments in using protein, peptides, or enzymes as disease management in animals.

[0004] Aquaculture is the farming of aquatic organisms under controlled conditions for all or parts of their lifecycles. Interest in aquacultural production is on the rise because restrictions on the wild harvest of many seafood species may diminish wild harvest seafood supplies. Aquaculture growers can more easily maintain a steady supply of products. Farmed seafood is also likely to be more uniform in size and quantity, thus moderating price swings. Selective breeding can be used to enhance disease resistance, increase growth rates, or promote other desirable traits (e.g., better feed conversion). Despite the benefits of aquaculture, aquaculture also has some disadvantages as compared to wild harvest, such as waste disposal from intensive production sites (leading to eutrophi cation of nearby water ways), dangerous levels of cancer-causing chemicals due to feed sources, overuse of antibiotics and biological control agents, and the loss of product to disease outbreak among cultured fish. Thus, the aquaculture industry has been overwhelmed with its share of diseases and problems caused by viruses, bacteria, fungi, parasites and other undiagnosed and emerging pathogens. Current practices in aquaculture for disease management include use of chemical insecticides and pesticides as well as other common chemicals that are often toxic to the fish themselves. Bleach, iodophores, and benzalkonium chlorides are commonly used in aquaculture to reduce both disease and biofilm formation. Many of the microbial pathogens in aquaculture cause toxicity in fish and shrimp as a primary problem, and as a secondary problem also form biofilms making control of these pathogens critical to continue to see increased production from farmed fish. Thus, there is a need in the art for methods to control pathogens in aquaculture.

[0005] A biofilm forms when microorganisms adhere to the surface of some object in a moist environment and begin to reproduce. The microorganisms form an attachment to the surface of almost any object by secreting extracellular polymeric substances. Biofilms most often consist of mixtures of many microorganisms including species of bacteria, as well as fungi, algae, yeasts, and protozoa. It has been well demonstrated that bacteria within biofilms are hundreds to thousands of times more resistant to antibiotics and biocides than their free forms. In biofilms, poor antibiotic penetration, nutrient limitation and slow growth, adaptive stress responses, and formation of persister cells are hypothesized to constitute a multi-layered defense making them very difficult to eliminate. For these reasons biofilms present problems in animal health through formation on host tissue (e.g., chronic wounds, osteomyelitits, cystic fibrosis, otitis), surfaces in aquaculture systems (e.g., pipes, tanks, or even the gills of fish), medical devices (e.g., catheters, trancutaneous devices), and on medical equipment (e.g., hemodialysis machines, ventilators, shunts, hospital surfaces). Thus, there is a need in the art to prevent biofilm formation or to remove biofilms from surfaces once they have formed.

[0006] In methodologies for treating disease that is on the exterior of an animal (e.g., foot rot or mastitis) common practice is application of antibacterial solutions. The problem with this method is contamination to unaffected members of the herd or facility where milking or shearing is performed. Also, repeated applications are needed and antibiotic resistance or even ineffectiveness can occur. Mastitis is a disease that affects a large number of dairy cattle throughout the world and using antibiotics is not an ideal solution. Not only do they affect the milk being collected (withdrawal for days, contamination from antibiotic residues, problems associated with yogurt and cheese processing), antibiotics have not reduced the incidence of mastitis. Thus, there is a need in the art for improved methods for treating diseases such as foot rot and mastitis.

[0007] It is important to control insect vectors because the insect is the main transmitter of disease in animals. Vector-borne disease has significant negative impacts on animal health and dramatic economic implications. Without intervention by vector control dangerous disease would move quickly throughout the globe. Current methods of vector control include habitat control, reducing contact with vectors, biological control via predators, chemical control via insecticides or larvacides, bacterial toxins or botanical compounds. The current goals of finding long-lasting insecticides and finding new pesticides to combat resistant species is in effective for the global problem. Elimination of these insect vectors can alleviate disease spread and lower the mortality associated with the diseases they spread. Thus, there is also a need in the art for methods for protecting animals from pathogens by killing insect vectors.

SUMMARY OF THE INVENTION

[0008] A fusion protein is provided. The fusion protein comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member and at least one protein or peptide of interest. The protein or peptide of interest can comprise an antibody, an antibody fragment, a histone, a cecropin, a penaeidin, a bactenecin, a callinectin, a myticin, a tachyplesin, a clavanin, amisgurin, a pleurocidin, a parasin, an apyrase, an alginate lyase, a dispersin B, a DNAse, an endochitinase, an exochitinase , a proteinase K, a secreted insecticidal (Sip) protein, a mosquitocidal toxin, a Cry 1 Aa protein, a Cry 1 Ab protein, a Cry 1 Ac protein, a Cry ICa protein, a Cry IDa protein, a Cry2Aa protein, a Cry3Aa protein, a Cry3Bb protein, a Cry4Aa protein, a Cry4Ab protein, a Cryl lAa protein, a CytlAa protein, an AiiA, a Bacillus subtilis serine protease, or a combination of any thereof.

[0009] Another fusion protein is provided. The fusion protein comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member and a LfcinB. The LfcinB comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 212.

[0010] Yet another fusion protein is provided. The fusion protein comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member and a LysM. The LysM comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 213.

[0011] Another fusion protein is provided. The fusion protein comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member and a P-l,3-glucanase. The β- 1,3-glucanase comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 214 or 216.

[0012] A further fusion protein is provided. The fusion protein comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member and a Cry21A protein. The Cry21 A protein comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 215.

[0013] A recombinant Bacillus cereus family member that expresses any of the fusion proteins is provided.

[0014] Exosporium fragments derived from spores of any of the recombinant Bacillus cereus family members are also provided. [0015] Compositions comprising a carrier and spores of any of the recombinant Bacillus cereus family members described herein are provided.

[0016] Compositions comprising a carrier and exosporium fragments derived from spores of any of the recombinant Bacillus cereus family members described herein are also provided.

[0017] A pharmaceutical composition is provided. The pharmaceutical composition comprises a pharmaceutically acceptable carrier and exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects an animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the

recombinant Bacillus cereus family member.

[0018] A vaccine composition is provided. The composition comprises a

pharmaceutically acceptable carrier. The vaccine composition also comprises exosporium fragments of a first type and exosporium fragments of a second type. The exosporium fragments of the second type are different from the exosporium fragments of the first type. The exosporium fragments of the first and second types are derived from spores of a recombinant Bacillus cereus family member that comprises a mutation or expresses a protein, wherein the expression of the protein is increased as compared to the expression of the protein in a wild-type Bacillus cereus family member under the same conditions. The mutation or the increased expression of the protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore. At least one of the exosporium fragments of the first type and the exosporium fragments of the second type comprise a fusion protein. The fusion protein comprises an antigen or an immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[0019] Another vaccine composition is provided. The composition comprises a pharmaceutically acceptable carrier. The composition further comprises spores of a recombinant Bacillus cereus family member that expresses a first fusion protein. The first fusion protein comprising at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the first fusion protein to the exosporium of the recombinant Bacillus cereus family member. The composition also comprises exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member.

[0020] Yet another vaccine composition is provided. The composition comprises a pharmaceutically acceptable carrier. The composition also comprises a first immunogen or antigen. The composition further comprises exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member.

[0021] A method for producing an immunogenic response in an animal is provided. The method comprises administering any of the vaccine compositions to the animal.

[0022] A method for protecting an animal from a pathogen is provided. The method comprises administering spores of a recombinant Bacillus cereus family member that expresses a fusion protein to the animal, to the environment of the animal, or to the pathogen. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The protein or peptide that protects the animal from a pathogen does not comprise an antigen or an

immunogen.

[0023] Another method for protecting an animal from a pathogen is provided. The method comprises administering exosporium fragments to the animal, to the environment of the animal, or to the pathogen. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[0024] A composition is provided. The composition comprises a carrier acceptable for use in aquaculture and exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects an aquatic organism from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[0025] A method is provided for protecting an aquatic organism from a pathogen. The method comprises cultivating the aquatic organism in an aquaculture system. Spores of a recombinant Bacillus cereus family member that expresses a fusion protein are introduced into the aquaculture system. The fusion protein comprises at least one protein or peptide that protects the aquatic organism from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the

recombinant Bacillus cereus family member. The aquatic organism is selected from fish, amphibians, reptiles, crustaceans, mollusks, worms, coral, sponges, red algae, brown algae, or combinations of any thereof.

[0026] Another method for protecting an aquatic organism from a pathogen is provided. The method comprises cultivating the aquatic organism in an aquaculture system. Exosporium fragments are introduced into the aquaculture system. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects the aquatic organism from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The aquatic organism is selected from fish, amphibians, reptiles, crustaceans, mollusks, worms, coral, sponges, red algae, brown algae, or combinations of any thereof.

[0027] Adhesive patches and wound dressings are provided. The adhesive patch or wound dressing comprising a pharmaceutical composition is provided. The pharmaceutical composition comprises a pharmaceutically acceptable carrier and spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprising at least one protein or peptide that protects an animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[0028] Alternatively or in addition, the adhesive patch or wound dressing can comprise a pharmaceutical composition comprising a pharmaceutically acceptable carrier and exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects an animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[0029] An insert tray for a livestock footbath is provided. The insert tray comprises spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one protein or peptide that protects a hooved animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The spores are immobilized on an inner surface of the insert tray.

[0030] Alternatively or in addition, the insert tray comprises exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprising at least one protein or peptide that protects a hooved animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the

recombinant Bacillus cereus family member. The exosporium fragments are immobilized on an inner surface of the insert tray.

[0031] A hoof bandage is provided. The hoof bandage comprises a pharmaceutical composition. The pharmaceutical composition comprises a pharmaceutically acceptable carrier and spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one protein or peptide that protects a hooved animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[0032] Alternatively or in addition, the hoof bandage comprises a pharmaceutical composition comprising a pharmaceutically acceptable carrier and exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects a hooved animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the

recombinant Bacillus cereus family member.

[0033] Feed and feed additives are provided. The feed or feed additive comprises exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one protein or peptide that protects an animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[0034] A method for protecting an animal from a pathogen by killing an insect or arachnid vector of the pathogen is provided. The method comprises contacting the insect or arachnid vector or larvae of the insect or arachnid vector with spores of a recombinant Bacillus cereus family member. The recombinant Bacillus cereus family member expresses a fusion protein. The fusion protein comprises at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae of the insect or arachnid vector and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[0035] Alternatively or in addition, the method for protecting an animal from a pathogen by killing an insect or arachnid vector of the pathogen comprises contacting the insect or arachnid vector or larvae of the insect or arachnid vector with exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae of the insect vector and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[0036] An insecticidal or acaricidal composition is provided. The composition comprising a carrier and exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae or instars of the insect or arachnid vector. The fusion protein further comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[0037] An insect fogger is provided. The insect fogger comprises a carrier and spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae or instars of the insect or arachnid vector. The fusion protein further comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the

recombinant Bacillus cereus family member.

[0038] Alternatively or in addition, the insect fogger can comprise the carrier and exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae or instars of the insect or arachnid vector. The fusion protein further comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[0039] A method for producing an immunogenic response in an aquatic animal is provided. The method comprises administering exosporium fragments to the aquatic animal. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The exosporium fragments are administered to the aquatic animal by immersing the aquatic animal in a solution comprising the exosporium fragments.

[0040] Alternatively or in addition, the method for producing an immunogenic response in an aquatic animal comprises administering spores to the aquatic animal. The spores are spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The spores are administered to the aquatic animal by immersing the aquatic animal in a solution comprising the spores.

[0041] Another method for producing an immunogenic response in an aquatic animal is provided. The method comprises administering exosporium fragments to the aquatic animal. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The aquatic animal is selected from fish, amphibians, crustaceans, mollusks, and combinations of any thereof.

[0042] Another method for producing an immunogenic response in an aquatic animal is provided. The method comprises administering exosporium fragments to the aquatic animal. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The administration of the exosporium fragments to the aquatic animal results in vaccination of the aquatic animal against a pathogen selected from Renibacterium salmoninarum, Yersinia ruckeri, Edwarsdiella ictaluri, Flavobacterium columnare, Aerococcus viridans, Aeromonas salmonicida, Aeromonas hydrophila, Leucothrix mucor, Vibrio vulnificus, Vibrio

parahaemolyticus, Vibrio alginolyticus, a bacterial pathogen of the genus Shewanella spp., Xenohaliotis calif orniensis, Piscirickettsia salmonis, a pathogenic protist of the genus

Saprolengia, Branchiomyces sanguinis, Branchiomyces demigrna, Icthyophous hoferi, and combinations of any thereof.

[0043] Alternatively or in addition, the method for producing an immunogenic response in an aquatic animal comprises administering spores to the aquatic animal. The spores are spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The administration of the spores to the aquatic animal results in vaccination of the aquatic animal against a pathogen selected from

Renibacterium salmoninarum, Yersinia ruckeri, Edwarsdiella ictaluri, Flavobacterium columnare, Aerococcus viridans, Aeromonas salmonicida, Aeromonas hydrophila, Leucothrix mucor, Vibrio vulnificus, Vibrio parahaemolyticus, Vibrio alginolyticus, a bacterial pathogen of the genus Shewanella spp., Xenohaliotis californiensis, Piscirickettsia salmonis, a pathogenic protist of the genus Saprolengia, Branchiomyces sanguinis, Branchiomyces demigrna,

Icthyophous hoferi, and combinations of any thereof.

[0044] The features of the invention are further defined in the appended claims and the list of embodiments provided below in the Section entitled "EMBODIMENTS." Other objects and features will be in part apparent and in part pointed out hereinafter.

BRIEF DESCRIPTION OF THE DRAWINGS

[0045] FIGs. 1 A and IB show alignments of the amino acid sequence of an amino- terminal portion of Bacillus anthracis Sterne strain BclA and with the corresponding region from various exosporium proteins from Bacillus cereus family members.

[0046] FIG. 2 shows exemplary fluorescent microscopy results for the expression of fusion proteins containing various exosporium proteins linked to an mCherry reporter on the exosporium of a recombinant Bacillus cereus family member.

[0047] FIG. 3 is a transmission electron micrograph showing exosporium fragments and a Bacillus cereus family member spore from which the exosporium has been lost, generated using a recombinant Bacillus cereus family member having a knock-out mutation of its CotE gene.

[0048] FIG. 4 is a photograph of an SDS-PAGE gel showing a protein marker standard (lane 1) and proteins from exosporium fragments generated using a recombinant Bacillus cereus family member having a knock-out mutation of its CotE gene (lane 2).

[0049] FIG. 5 provides data illustrating enzyme activity of an acid phosphatase in exosporium fragments derived from a Bacillus cereus family member having a knock-out mutation of its CotE gene.

[0050] FIG. 6 provides a transmission electron micrographs showing: (A) intact spores of Bacillus thuringiensis BT013A surrounded by attached exosporium; (B) spores of an ExsY knockout strain of Bacillus thuringiensis BT013A, with detached exosporium; and (C) spores of a CotE knockout strain of Bacillus thuringiensis BT013A, with detached exosporium.

[0051] Corresponding reference characters indicate corresponding parts throughout the drawings.

DEFINITIONS

[0052] When the articles "a," "an," "one," "the," and "said" are used herein, they mean "at least one" or "one or more" unless otherwise indicated.

[0053] The term "animal" encompasses any non-human animal as well as humans. For example, where the term "animal" is used herein, the animal can be a mammal (e.g., humans, monkeys, sheep, goats, cows, pigs, deer, alpacas, bison, camels, donkeys, horses, mules, yaks, reindeer, llamas, rabbits, dogs, cats, ferrets, gerbils, guinea pigs, hamsters, mice, rabbits, or rats), a bird (e.g., chickens, turkeys, ducks, geese, quail, doves, pigeons, ostriches, emus, or pheasants), a fish (e.g., hobby fish, salmon, trout, halibut, seabass, snapper, grouper, mullet, tilapia, tuna, catfish, carp, or sturgeon), an amphibian (e.g., frogs, toads, newts, or salamanders), a reptile (e.g., snakes, lizards, iguanas, crocodiles, alligators, turtles, or tortoises), a crustacean (e.g., a shrimp, prawn, krill, lobster, crab, or crayfish), a mollusk (e.g., mussels, clams, oysters, scallops, snails, slugs, squid, cuttlefish, or octopi), a worm (e.g., earthworms, nematodes, flatworms, roundworms, tapeworms, or flukes), an insect (e.g., bees, ladybugs, butterflies, silkworms, flies, beetles, or the larvae of any thereof), a coral, or a sponge.

[0054] The term "aquaculture" as used herein refers to the farming of aquatic organisms, and in particular fish, amphibians, reptiles, crustaceans, mollusks, worms, coral, sponges, red algae, brown algae. The term "aquaculture" as used herein does not encompass farming of aquatic plants.

[0055] The term "Bacillus cereus family member" as used herein refers to any Bacillus species that is capable of producing an exosporium. Thus, the Bacillus cereus family of bacteria includes the species Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, and Bacillus toyoiensis. Bacillus cereus family members are also referred to in the art as "Bacillus cereus senso lato."

[0056] The terms "comprising," "including," and "having" are intended to be inclusive and mean that there may be additional elements other than the listed elements.

[0057] The term "fusion protein" as used herein refers to a protein having a polypeptide sequence that comprises sequences derived from two or more separate proteins. A fusion protein can be generated by joining together a nucleic acid molecule that encodes all or part of a first polypeptide with a nucleic acid molecule that encodes all or part of a second polypeptide to create a nucleic acid sequence which, when expressed, yields a single polypeptide having functional properties derived from each of the original proteins.

[0058] The term "hobby fish" as used herein refers to any fish that are kept in a private or public aquarium, garden pond, or other enclosure as pet fish, as ornamental fish, and/or for entertainment purposes (as opposed to fish that are farmed for food or for manufacture of a product).

[0059] The term "inactivate" or "inactivation" as used herein in reference to the inactivation of spores of a recombinant Bacillus cereus family member means that the spores are unable to germinate, or that the spores can germinate, but are damaged such that germination does not result in a living bacterium. The terms "partially inactivate" or "partial inactivation" mean that a percentage of the spores are inactivated, but that some spores retain the ability to germinate and return to a live, replicating state. The term "genetic inactivation" refers to inactivation of spores a recombinant Bacillus cereus family member by a mutation of the spore's DNA that results in complete or partial inactivation of the spore. The terms "physical inactivation" and "chemical inactivation refer to inactivation of spores using any physical or chemical means, e.g., by heat treatment, gamma irradiation, x-ray irradiation, UV-A irradiation, UV-B irradiation, or treatment with a solvent such as gluteraldehyde, formaldehyde, hydrogen peroxide, acetic acid, bleach, chloroform, or phenol, or any combination thereof. [0060] The term "non-vaccine method" as used herein refers to a method that does not require the use of a vaccine, antigen, or immunogen. Instead the desired effect of protecting the animal from the pathogen is achieved without the use of a vaccine, antigen, or immunogen.

[0061] The terms "protein or peptide that protects an animal from a pathogen" and "protein or peptide that protects an aquatic organism from a pathogen" as used herein include any protein or peptide that prevents or treats an infection of the animal or aquatic organism with the pathogen. Proteins or peptides that protect an animal or aquatic organism from a pathogen can act directly or indirectly on the pathogen. Protective mechanisms for the proteins or peptides that protect an animal or an aquatic organism from a pathogen include, but are not limited to lysis of cell walls of the pathogen, prevention of establishment or colonization of the animal by the pathogen, blocking of cell-to-cell communication in the pathogen, activation of an immune response in the animal (but do not induce an antibody response), and/or increasing recognition of the pathogen by the animal. Proteins or peptides that protect animals or aquatic organisms from a pathogen also include proteins or peptide that prevent or inhibit the formation of biofilms or promote the dissolution of biofilms on the animal or aquatic organism or on a surface within the environment of the animal or aquatic organism.

[0062] The term "recombinant" as used in reference to the bacteria described herein encompasses bacteria having any genetic modification as compared to wild-type bacteria of the same type, including bacteria that have been modified to delete of a gene or a portion of a gene (e.g., bacteria that have a "knock-out" of a gene), as well as bacteria that have been modified to express an exogenous peptide or protein.

[0063] The term "targeting sequence" as used herein refers to a polypeptide sequence that, when present as part of a longer polypeptide or a protein, results in the localization of the longer polypeptide or the protein to a specific subcellular location. The targeting sequences described herein result in localization of proteins to the exosporium of a Bacillus cereus family member.

DESCRIPTION OF THE INVENTION

L Fusion Proteins for Expression in Bacillus Cereus Family Members and

Recombinant Bacillus Cereus Family Members Expressing such Fusion Proteins

[0064] The present invention relates to fusion proteins, recombinant Bacillus cereus family members that express such fusion proteins, and exosporium fragments derived from spores of the recombinant Bacillus cereus family members. The present invention further relates to compositions containing spores of a recombinant Bacillus cereus family member or exosporium fragments derived from spores of a recombinant Bacillus cereus family member, as well as uses of spores of recombinant Bacillus cereus family members and exosporium fragments derived from spores of a recombinant Bacillus cereus family member in the fields of animal health and aquaculture. Various products that contain the spores or exosporium fragments are also provided, including adhesive patches or wound dressings comprising the spores or exosporium fragments, insert trays for livestock footbaths comprising the spores or exosporium fragments, hoof bandages comprising the spores or exosporium fragments, feed and feed additives comprising the spores or exosporium fragments, and insect foggers containing the spores or exosporium fragments.

[0065] The spores express fusion proteins comprising a targeting sequence, an exosporium protein, or an exosporium protein fragment targets the fusion protein to the exosporium of a Bacillus cereus family member and at least one protein or peptide of interest (e.g., a protein or peptide that protects an animal from a pathogen, a protein or peptide that protects an aquatic organism from a pathogen, a protein or peptide that has insecticidal activity against an insect vector of an animal pathogen or larvae of the insect vector, or an antigen or immunogen). When expressed in Bacillus cereus family member bacteria, these fusion proteins are targeted to the exosporium layer of the spore and are physically oriented such that the protein or peptide of interest is displayed on the outside of the spore.

[0066] This Bacillus exosporium display (BEMD) system can be used to deliver peptides, enzymes, and other proteins to animals, aquatic organisms, or insect vectors of animal pathogens. In addition, as is described further hereinbelow, the BEMD system can be modified such that the exosporium of the recombinant Bacillus cereus family member can be removed from the spore, generating exosporium fragments containing the fusion proteins. The exosporium fragments can also be used to deliver peptides, enzymes, and other proteins to animals, aquatic organisms, or insect vectors of animal pathogens in a cell-free preparation.

A. Targeting Sequences, Exosporium Proteins, and Exosporium Protein Fragments for

Targeting Proteins or Peptides of Interest to the Exosporium of a Bacillus cereus family member

[0067] For ease of reference, descriptions of the amino acid sequences for the targeting sequences, exosporium proteins, and exosporium protein fragments that can be used for targeting of proteins or peptides of interest (e.g., proteins or peptides that protect an animal from a pathogen or proteins or peptides that protect an aquatic organism from a pathogen) to the exosporium of a Bacillus cereus family members, are provided in Table 1 together with their SEQ ID NOs.

Table 1. Peptide and protein sequences used for targeting of proteins or peptides of interest to the exosporium of Bacillus cereus family members

Protein, protein fragment, or targeting sequence SEQ ID NO.

AA 1-41 of Bel A (B. anthracis Sterne) 1 *

Full length BclA (B. anthracis Sterne) 2*

AA 1-33 of BetA/BAS3290 (B. anthracis Sterne) 3

Full length BetA/BAS3290 (B. anthracis Sterne) 4

Met + AA 2-43 of BAS4623 (B. anthracis Sterne) 5

Full length BAS4623 (B. anthracis Sterne) 6

AA 1-34 of BclB (B. anthracis Sterne) 7

Full length BclB (B. anthracis Sterne) 8

AA 1-30 of B AS 1882 (B. anthracis Sterne) 9

Full length BAS1882 (B. anthracis Sterne) 10

AA 1-39 of gene 2280 (B. weihenstephensis KBAB4) 1 1

Full length KB AB4 gene 2280 (B. weihenstephensis KBAB4) 12

AA 1-39 of gene 3572 (B. weihenstephensis KBAB4) 13

Full Length KBAB4 gene 3572 (B. weihenstephensis KBAB4) 14

AA 1-49 of Exosporium Leader Peptide (B. cereus VD200) 15

Full Length Exosporium Leader Peptide (B. cereus VD200) 16

AA 1-33 of Exosporium Leader Peptide (B. cereus VD166) 17

Full Length Exosporium Leader Peptide (B. cereus VD166) 18

AA 1-39 of hypothetical protein IKG 04663 (B. cereus VD200) 19

Hypothetical protein IKG 04663, partial (B. cereus VD200) 20

AA 1-39 of YVTN β-propeller protein (B. weihenstephensis KBAB4) 21

Full length YVTN β-propeller protein KBAB4 (B. weihenstephensis KB AB4) 22

AA 1-30 of hypothetical protein bcerkbab4 2363 23

(B. weihenstephensis KBAB4)

Full length hypothetical protein bcerkbab4_2363 24

(B. weihenstephensis KBAB4)

AA 1-30 of hypothetical protein bcerkbab4 2131 25

(B. weihenstephensis KBAB4)

Full length hypothetical protein bcerkbab4_2131 26

(B. weihenstephensis KBAB4)

AA 1-36 of triple helix repeat containing collagen 27

(B. weihenstephensis KBAB4)

Full length triple helix repeat-containing collagen KBAB4 28

(B. weihenstephensis KBAB4)

AA 1-39 of hypothetical protein bmycoOOOl 21660 (B. mycoides 2048) 29

Full length hypothetical protein bmycoOOOl 21660 (B. mycoides 2048) 30

AA 1-30 of hypothetical protein bmycOOOl 22540 (B. mycoides 2048) 31

Full length hypothetical protein bmycOOOl 22540 (B. mycoides 2048) 32

AA 1-21 of hypothetical protein bmycOOOl 21510 (B. mycoides 2048) 33

Full length hypothetical protein bmycOOOl 21510 (B. mycoides 2048) 34

AA 1-22 of collagen triple helix repeat protein (B. thuringiensis 35646) 35 Protein, protein fragment, or targeting sequence SEQ ID NO.

Full length hypothetical protein BC4725 (B. cereus ATCC 14579) 80

AA 1-44 of hypothetical protein BCZK4476 (B. cereus E33L) 81

Full length hypothetical protein BCZK4476 (B. cereus E33L) 82

AA 1-40 of triple helix repeat-containing collagen 83

(B. anthracis str. 'Ames Ancestor')

Full length triple helix repeat-containing collagen 84

(B. anthracis str. 'Ames Ancestor')

AA 1-34 of Bel A protein (B. thuringiensis serovar konkukian str. 97-27) 85

Full length BclA protein (B. thuringiensis serovar konkukian str. 97-27) 86

AA 1-34 of conserved hypothetical protein (B. cereus ATCC 10987) 87

Full length conserved hypothetical protein (B. cereus ATCC 10987) 88

AA 1-34 of triple helix repeat-containing collagen (B. cereus ATCC 14579) 89

Full length triple helix repeat-containing collagen (B. cereus ATCC 14579) 90

AA 1-99 of exosporium leader peptide partial sequence (B. cereus) 91

Exosporium leader peptide partial sequence (B. cereus) 92

AA 1-136 of hypothetical protein ER45 27600, partial sequence 93

(B. weihenstephanensis)

Hypothetical protein ER45 27600, partial sequence (B. weihenstephanensis) 94

AA 1-196 of BclA (B. anthracis Sterne) 95*

Met + AA 20-35 of BclA (B. anthracis Sterne) 96

Met + AA 12-27 of BetA/BAS3290 (B. anthracis Sterne) 97

Met + AA 18-33 of gene 2280 (B. weihenstephensis KBAB4) 98

Met + AA 18-33 of gene 3572 (B. weihenstephensis KBAB4) 99

Met + AA 12-27 of Exosporium Leader Peptide (B. cereus VD166) 100

Met + AA 18-33 of YVTN β-propeller protein 101

(B. weihenstephensis KBAB4)

Met + AA 9-24 of hypothetical protein bcerkbab4_2363 102

(B. weihenstephensis KBAB4)

Met + AA 9-24 of hypothetical protein bcerkbab4_2131 103

(B. weihenstephensis KBAB4)

Met + AA 9-24 of hypothetical protein bmycOOOl 22540 (B. mycoides 2048) 104

Met + AA 9-24 of B AS 1882 (B. anthracis Sterne) 105

Met + AA 20-35 of exosporium leader WP016117717 (B. cereus) 106

Met + AA 9-24 of hypothetical protein BALH_2230 107

(B. thuringiensis str. Al Hakam)

Full length InhA (B. mycoides) 108

Full length B AS 1141 (ExsY) (B. anthracis Sterne) 109

Full length BAS1144 (BxpB/ExsFA) (B. anthracis Sterne) 110

Full length BAS1145 (CotY) (B. anthracis Sterne) 111

Full length BAS1140 (B. anthracis Sterne) 112

Full length ExsFB (B. anthracis H9401) 113

Full length InhAl (B. thuringiensis FID74) 114

Full length ExsJ (B. cereus ATCC 10876) 115

Full length ExsH (B. cereus) 116

Full length YjcA (B. anthracis Ames) 117

Full length YjcB (B. anthracis) 118

Full length BclC (B. anthracis Sterne) 119 Protein, protein fragment, or targeting sequence SEQ ID NO.

Full length acid phosphatase 120

{Bacillus thuringiensis serovar konkukian str. 97-27)

Full length InhA2 (B. thuringiensis HD74) 121

Full length InhA3 (B. mycoides) 122

AA = amino acids

* B. anthracis Sterne strain BclA has 100% sequence identity with B. thuringiensis BclA. Thus, SEQ ID NOs: 1, 2, and 95 also represent amino acids 1-41 of B. thuringiensis BclA, full length B. thuringiensis BclA, and amino acids 1-196 of B. thuringiensis BclA, respectively. Likewise, SEQ ID NO: 96 also represents a methionine residue plus amino acids 20-35 of B. thuringiensis BclA.

** B. mycoides hypothetical protein TIGR03720 has 100% sequence identity with B. mycoides hypothetical protein WP003189234. Thus, SEQ ID NOs: 57 and 58 also represent amino acids 1-136 of B. mycoides hypothetical protein WP003189234 and full length B. mycoides hypothetical protein WP003189234, respectively.

[0068] Bacillus is a genus of rod-shaped bacteria. The Bacillus cereus family of bacteria includes any Bacillus species that is capable of producing an exosporium. Thus, the Bacillus cereus family of bacteria includes the species Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, and Bacillus toyoiensis. Under stressful environmental conditions, Bacillus cereus family bacteria undergo sporulation and form oval endospores that can stay dormant for extended periods of time. The outermost layer of the endospores is known as the exosporium and comprises a basal layer surrounded by an external nap of hair-like projections. Filaments on the hair-like nap are predominantly formed by the collagen-like glycoprotein BclA, while the basal layer is comprised of a number of different proteins. Another collagen-related protein, BclB, is also present in the exosporium and exposed on endospores of Bacillus cereus family members. BclA, the major constituent of the surface nap, has been shown to be attached to the exosporium with its amino-terminus (N-terminus) positioned at the basal layer and its carboxy-terminus (C -terminus) extending outward from the spore.

[0069] It was previously discovered that certain sequences from the N-terminal regions of BclA and BclB could be used to target a peptide or protein to the exosporium of a Bacillus cereus family member endospore {see U.S. Patent Application Publication Nos. 2010/0233124 and 2011/0281316, and Thompson et al., Targeting of the BclA and BclB proteins to the Bacillus anthracis spore surface, Molecular Microbiology 70(2):421-34 (2008)). It was also found that the BetA/BAS3290 protein of Bacillus anthracis localized to the exosporium. Further targeting sequences, as well as exosporium proteins and fragments of exosporium proteins, that can be incorporated into a fusion protein and used to target a peptide or protein of interest to the exosporium of a recombinant Bacillus cereus family member are described in U.S. Patent Application Publication No. 2016/0031948, which is incorporated by reference herein in its entirety.

[0070] In particular, amino acids 20-35 of Bel A from Bacillus anthracis Sterne strain have been found to be sufficient for targeting to the exosporium. A sequence alignment of amino acids 1-41 of BclA (SEQ ID NO: 1) with the corresponding N-terminal regions of several other Bacillus cereus family exosporium proteins and Bacillus cereus family proteins having related sequences is shown in Figures 1 A and IB. As can be seen from Figures 1 A and IB, there is a region of high-homology among all of the proteins in the region corresponding to amino acids 20-41 of BclA. However, in these sequences, the amino acids corresponding to amino acids 36- 41 of BclA contain secondary structure and are not necessary for fusion protein localization to the exosporium. The conserved targeting sequence region of BclA (amino acids 20-35 of SEQ ID NO: 1) is shown in bold in Figures 1 A and IB and corresponds to the minimal targeting sequence needed for localization to the exosporium. A more highly conserved region spanning amino acids 25-35 of BclA within the targeting sequence is underlined in the sequences in Figures 1 A and IB, and is the recognition sequence for ExsFA/BxpB/ExsFB and homologs, which direct and assemble the described proteins on the surface of the exosporium. The amino acid sequences of SEQ ID NOs. 3, 5, and 7 in Figure 1 A are amino acids 1-33 of Bacillus anthracis Sterne strain BetA/BAS3290, a methionine followed by amino acids 2-43 of Bacillus anthracis Sterne strain BAS4623, and amino acids 1-34 of Bacillus anthracis Sterne strain BclB, respectively. (For BAS4623, it was found that replacing the valine present at position 1 in the native protein with a methionine resulted in better expression.) As can be seen from Figure 1 A, each of these sequences contains a conserved region corresponding to amino acids 20-35 of BclA (SEQ ID NO: 1; shown in bold), and a more highly conserved region corresponding to amino acids 20-35 of BclA (underlined).

[0071] Additional proteins from Bacillus cereus family members also contain the conserved targeting region. In particular, in Figures 1A and IB, SEQ ID NO: 9 is amino acids 1-30 of Bacillus anthracis Sterne strain BAS1882, SEQ ID NO: 11 is amino acids 1-39 of the Bacillus weihenstephensis KBAB4 2280 gene product, SEQ ID NO: 13 is amino acids 1-39 of the Bacillus weihenstephensis KBAB4 3572 gene product, SEQ ID NO: 15 is amino acids 1-49 of Bacillus cereus VD200 exosporium leader peptide, SEQ ID NO: 17 is amino acids 1-33 of Bacillus cereus VD166 exosporium leader peptide, SEQ ID NO: 19 is amino acids 1-39 of Bacillus cereus VD200 hypothetical protein IKG 04663, SEQ ID NO: 21 is amino acids 1-39 of Bacillus weihenstephensis KBAB4 YVTN β-propeller protein, SEQ ID NO: 23 is amino acids 1-30 of Bacillus weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363, SEQ ID NO: 25 is amino acids 1-30 of Bacillus weihenstephensis KBAB4 hypothetical protein

bcerkbab4_2131, SEQ ID NO: 27 is amino acids 1-36 of Bacillus weihenstephensis KBAB4 triple helix repeat containing collagen, SEQ ID NO: 29 is amino acids 1-39 of Bacillus mycoides 2048 hypothetical protein bmyco0001_21660, SEQ ID NO: 31 is amino acids 1-30 of Bacillus mycoides 2048 hypothetical protein bmyc0001_22540, SEQ ID NO: 33 is amino acids 1-21 of Bacillus mycoides 2048 hypothetical protein bmyc0001_21510, SEQ ID NO: 35 is amino acids 1-22 of Bacillus thuringiensis 35646 collagen triple helix repeat protein, SEQ ID NO: 43 is amino acids 1-35 of Bacillus cereus hypothetical protein WP 69652, SEQ ID NO: 45 is amino acids 1-41 of Bacillus cereus exosporium leader WP016117717, SEQ ID NO: 47 is amino acids 1-49 of Bacillus cereus exosporium peptide WP002105192, SEQ ID NO: 49 is amino acids 1-38 of Bacillus cereus hypothetical protein WP87353, SEQ ID NO: 51 is amino acids 1-39 of Bacillus cereus exosporium peptide 02112369, SEQ ID NO: 53 is amino acids 1- 39 of Bacillus cereus exosporium protein WP016099770, SEQ ID NO: 55 is amino acids 1-36 of Bacillus thuringiensis hypothetical protein YP006612525, SEQ ID NO: 57 is amino acids 1- 136 of Bacillus mycoides hypothetical protein TIGR03720, SEQ ID NO: 59 is amino acids 1-36 of B. cereus ATCC 10987 collagen triple helix repeat domain protein, SEQ ID NO: 61 is amino acids 1-39 of B. cereus E33L collagen-like protein, SEQ ID NO: 63 is amino acids 1-41 of B. weihenstephanensis KBAB4 triple helix repeat-containing collagen, SEQ ID NO: 65 is amino acids 1-30 of B. thuringiensis str. Al Hakam hypothetical protein BALH 2230, SEQ ID NO: 67 is amino acids 1-33 of B. cereus ATCC 14579 triple helix repeat-containing collagen, SEQ ID NO: 69 is amino acids 1-44 of B. cereus collagen triple helix repeat, SEQ ID NO: 71 is amino acids 1-38 of B. cereus ATCC 14579 triple helix repeat-containing collagen, SEQ ID NO: 73 is amino acids 1-30 of B. cereus E33L hypothetical protein BCZK1835, SEQ ID NO: 75 is amino acids 1-48 of B. weihenstephanensis KBAB4 triple helix repeat-containing collagen, SEQ ID NO: 77 is amino acids 1-30 of B. cereus ATCC 14579 triple helix repeat-containing collagen, SEQ ID NO: 79 is amino acids 1-39 of B. cereus ATCC 14579 hypothetical protein BC4725, SEQ ID NO: 81 is amino acids 1-44 of B. cereus E33L hypothetical protein BCZK4476, SEQ ID NO: 83 is amino acids 1-40 of B. anthracis str. 'Ames Ancestor' triple helix repeat- containing collagen, SEQ ID NO: 85 is amino acids 1-34 of B. thuringiensis serovar konkukian str. 97-27 BclA protein, SEQ ID NO: 87 is amino acids 1-34 of B. cereus ATCC 10987 conserved hypothetical protein, SEQ ID NO: 89 is amino acids 1-34 of B. cereus ATCC 14579 triple helix repeat-containing collagen, SEQ ID NO: 91 is amino acids 1-99 of B. cereus exosporium leader peptide partial sequence, and SEQ ID NO: 93 is amino acids 1-136 of B. weihenstephanensis hypothetical protein ER45 27600. As shown in Figures 1 A and IB, each of the N-terminal regions of these proteins contains a region that is conserved with amino acids 20- 35 of BclA (SEQ ID NO: 1), and a more highly conserved region corresponding to amino acids 25-35 of BclA.

[0072] Any portion of BclA which includes amino acids 20-35 can be used as to target a fusion protein to the exosporium. In addition, full-length exosporium proteins or exosporium protein fragments can be used for targeting the fusion proteins to the exosporium. Thus, full- length BclA or a fragment of BclA that includes amino acids 20-35 can be used for targeting to the exosporium. For example, full length BclA (SEQ ID NO: 2) or a midsized fragment of BclA that lacks the carboxy-terminus such as SEQ ID NO: 95 (amino acids 1-196 of BclA) can be used to target the fusion proteins to the exosporium. Midsized fragments such as the fragment of SEQ ID NO: 95 have less secondary structure than full length BclA and have been found to be suitable for use as a targeting sequence. The targeting sequence can also comprise much shorter portions of BclA which include amino acids 20-35, such as SEQ ID NO: 1 (amino acids 1-41 of BclA), amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, or SEQ ID NO: 96 (a methionine residue linked to amino acids 20-35 of BclA). Even shorter fragments of BclA which include only some of amino acids 20-35 also exhibit the ability to target fusion proteins to the exosporium. For example, the targeting sequence can comprise amino acids 22- 31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1.

[0073] Alternatively, any portion of BetA/BAS3290, BAS4623, BclB, BAS1882, the KBAB4 2280 gene product, the KBAB4 3572 gene product, B. cereus VD200 exosporium leader peptide, B. cereus VD166 exosporium leader peptide, B. cereus VD200 hypothetical protein IKG 04663, B. weihenstephensis KBAB4 YVTN β-propeller protein, B.

weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363, B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131, B. weihenstephensis KBAB4 triple helix repeat containing collagen, B. mycoides 2048 hypothetical protein bmyco0001_21660, B. mycoides 2048 hypothetical protein bmyc0001_22540, B. mycoides 2048 hypothetical protein

bmyc0001_21510, B. thuringiensis 35646 collagen triple helix repeat protein, B. cereus hypothetical protein WP 69652, B. cereus exosporium leader WP0161 17 '17, B. cereus exosporium peptide WP002105192, B. cereus hypothetical protein WP87353, B. cereus exosporium peptide 02112369, B. cereus exosporium protein WP016099770, B. thuringiensis hypothetical protein YP006612525, B. mycoides hypothetical protein TIGR03720, B. cereus ATCC 10987 collagen triple helix repeat domain protein, B. cereus E33L collagen-like protein, B. weihenstephanensis KBAB4 triple helix repeat-containing collagen, B. thuringiensis str. Al Hakam hypothetical protein BALH 2230, B. cereus ATCC 14579 triple helix repeat-containing collagen, B. cereus collagen triple helix repeat, B. cereus ATCC 14579 triple helix repeat- containing collagen, B. cereus E33L hypothetical protein BCZK1835, B. weihenstephanensis KBAB4 triple helix repeat-containing collagen, B. cereus ATCC 14579 triple helix repeat- containing collagen, B. cereus ATCC 14579 hypothetical protein BC4725, B. cereus E33L hypothetical protein BCZK4476, B. anthracis str. 'Ames Ancestor' triple helix repeat-containing collagen, B. thuringiensis serovar konkukian str. 97-27 Bel A protein, B. cereus ATCC 10987 conserved hypothetical protein, B. cereus ATCC 14579 triple helix repeat-containing collagen, B. cereus exosporium leader peptide partial sequence, or B. weihenstephanensis hypothetical protein ER45 27600 which includes the amino acids corresponding to amino acids 20-35 of BclA can serve as the targeting sequence.

[0074] As can be seen from Figure 1 A, amino acids 12-27 of BetA/BAS3290, amino acids 23-38 of BAS4623, amino acids 13-28 of BclB, amino acids 9-24 of BAS1882, amino acids 18-33 of KBAB4 2280 gene product, amino acids 18-33 of KBAB4 3572 gene product, amino acids 28-43 of B. cereus VD200 exosporium leader peptide, amino acids 12-27 of B. cereus VD166 exosporium leader peptide, amino acids 18-33 of B. cereus VD200 hypothetical protein IKG 04663, amino acids 18-33 B. weihenstephensis KBAB4 YVTN β-propeller protein, amino acids 9-24 of B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363, amino acids 9-24 of B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131, amino acids 15-30 of B. weihenstephensis KBAB4 triple helix repeat containing collagen, amino acids 18- 33 of B. mycoides 2048 hypothetical protein bmyco0001_21660, amino acids 9-24 of B.

mycoides 2048 hypothetical protein bmyc0001_22540, amino acids 1-15 of B. mycoides 2048 hypothetical protein bmyc0001_21510, amino acids 1-16 of B. thuringiensis 35646 collagen triple helix repeat protein, amino acids 14-29 of B. cereus hypothetical protein WP 69652, amino acids 20-35 of B. cereus exosporium leader WP016117717, amino acids 28-43 of B. cereus exosporium peptide WP002105192, amino acids 17-32 of B. cereus hypothetical protein WP87353, amino acids 18-33 of B. cereus exosporium peptide 02112369, amino acids 18-33 of B. cereus exosporium protein WP016099770, amino acids 15-30 of B. thuringiensis

hypothetical protein YP006612525, and amino acids 115-130 of B. mycoides hypothetical protein TIGR03720 correspond to amino acids 20-35 of BclA. As can be seen from Figure IB, amino acids 15-30 of B. cereus ATCC 10987 collagen triple helix repeat domain protein, amino acids 18-33 of B. cereus E33L collagen-like protein, amino acids 20-35 of B.

weihenstephanensis KBAB4 triple helix repeat-containing collagen, amino acids 9-24 of B. thuringiensis str. Al Hakam hypothetical protein BALH 2230, amino acids 12-27 of B. cereus ATCC 14579 triple helix repeat-containing collagen, amino acids 23-38 of B. cereus collagen triple helix repeat, amino acids 17-32 of B. cereus ATCC 14579 triple helix repeat-containing collagen, amino acids 9-24 of B. cereus E33L hypothetical protein BCZK1835, amino acids 27- 42 of B. weihenstephanensis KBAB4 triple helix repeat-containing collagen, amino acids 9-24 of B. cereus ATCC 14579 triple helix repeat-containing collagen, amino acids 18-33 of B. cereus ATCC 14579 hypothetical protein BC4725, amino acids 23-38 of B. cereus E33L hypothetical protein BCZK4476, amino acids 19-345. anthracis str. 'Ames Ancestor' triple helix repeat-containing collagen, amino acids 13-28 of B. thuringiensis serovar konkukian str. 97-27 BclA protein, amino acids 13-28 of B. cereus ATCC 10987 conserved hypothetical protein, amino acids 13-28 of B. cereus ATCC 14579 triple helix repeat-containing collagen, amino acids 78-93 of B. cereus exosporium leader peptide partial sequence, and amino acids 115-130 of B. weihenstephanensis hypothetical protein ER45 27600 correspond to amino acids 20-35 of BclA. Thus, any portion of these proteins that includes the above-listed corresponding amino acids can serve as the targeting sequence.

[0075] Furthermore, any amino acid sequence comprising amino acids 20-35 of BclA, or any of the above-listed corresponding amino acids, can serve as the targeting sequence.

[0076] Thus, the targeting sequence can comprise amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, SEQ ID NO: 1, SEQ ID NO: 96, amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1. Alternatively, the targeting sequence consists of amino acids 1-35 of SEQ ID NO: 1, amino acids 20-35 of SEQ ID NO: 1, SEQ ID NO: 1, or SEQ ID NO: 96. Alternatively, the targeting sequence can consist of amino acids 22-31 of SEQ ID NO: 1, amino acids 22-33 of SEQ ID NO: 1, or amino acids 20-31 of SEQ ID NO: 1. Alternatively, the exosporium protein can comprise full length BclA (SEQ ID NO: 2), or the exosporium protein fragment can comprise a midsized fragment of BclA that lacks the carboxy -terminus, such as SEQ ID NO: 59 (amino acids 1-196 of BclA). Alternatively, the exosporium protein fragment can consist of SEQ ID NO: 59. [0077] The targeting sequence can comprise amino acids 2-35 of SEQ ID NO: 1; amino acids 5-35 of SEQ ID NO: 1; amino acids 8-35 of SEQ ID NO: 1; amino acids 10-35 of SEQ ID NO: 1; or amino acids 15-35 of SEQ ID NO: 1.

[0078] The targeting sequence can also comprise amino acids 1-27 of SEQ ID NO: 3, amino acids 12-27 of SEQ ID NO: 3, or SEQ ID NO: 3, or the exosporium protein can comprise full length BetA/BAS3290 (SEQ ID NO: 4). It has also been found that a methionine residue linked to amino acids 12-27 of BetA/BAS3290 can be used as a targeting sequence. Thus, the targeting sequence can comprise SEQ ID NO: 97. The targeting sequence can also comprise amino acids 14-23 of SEQ ID NO: 3, amino acids 14-25 of SEQ ID NO: 3, or amino acids 12- 23 of SEQ ID NO: 3.

[0079] The targeting sequence can comprise amino acids 2-27 of SEQ ID NO: 3; amino acids 5-27 of SEQ ID NO: 3; amino acids 8-27 of SEQ ID NO: 3; or amino acids 10-27 of SEQ ID NO: 3.

[0080] The targeting sequence can also comprise amino acids 1-38 of SEQ ID NO: 5, amino acids 23-38 of SEQ ID NO: 5, or SEQ ID NO: 5, or the exosporium protein can comprise full length BAS4623 (SEQ ID NO: 6).

[0081] The targeting sequence can comprise amino acids 2-38 of SEQ ID NO: 5; amino acids 5-38 of SEQ ID NO: 5; amino acids 8-38 of SEQ ID NO: 5; amino acids 10-38 of SEQ ID NO: 5; amino acids 15-38 of SEQ ID NO: 5; or amino acids 20-38 of SEQ ID NO: 5.

[0082] Alternatively, the targeting sequence can comprise amino acids 1-28 of SEQ ID NO: 7, amino acids 13-28 of SEQ ID NO: 7, or SEQ ID NO: 7, or the exosporium protein can comprise full length BclB (SEQ ID NO:8).

[0083] The targeting sequence can comprise amino acids 2-28 of SEQ ID NO: 7; amino acids 5-28 of SEQ ID NO: 7; amino acids 8-28 of SEQ ID NO: 7; or amino acids 10-28 of SEQ ID NO: 7.

[0084] The targeting sequence can also comprise amino acids 1-24 of SEQ ID NO: 9, amino acids 9-24 of SEQ ID NO: 9, or SEQ ID NO: 9, or the exosporium protein can comprise full length BAS1882 (SEQ ID NO: 10). A methionine residue linked to amino acids 9-24 of BAS1882 can also be used as a targeting sequence. Thus, the targeting sequence can comprise SEQ ID NO: 105.

[0085] The targeting sequence can comprise amino acids 2-24 of SEQ ID NO: 9; amino acids 5-24 of SEQ ID NO: 9; or amino acids 8-24 of SEQ ID NO: 9. [0086] The targeting sequence can also comprise amino acids 1-33 of SEQ ID NO: 11, amino acids 18-33 of SEQ ID NO: 11, or SEQ ID NO: 11, or the exosporium protein can comprise the full length B. weihenstephensis KBAB4 2280 gene product (SEQ ID NO: 12). A methionine residue linked to amino acids 18-33 of the B. weihenstephensis KBAB4 2280 gene product can also be used as a targeting sequence. Thus, the targeting sequence can comprise SEQ ID NO: 98.

[0087] The targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 11; amino acids 5-33 of SEQ ID NO: 11; amino acids 8-33 of SEQ ID NO: 11; amino acids 10-33 of SEQ ID NO: 11; or amino acids 15-33 of SEQ ID NO: 11.

[0088] The targeting sequence can also comprise amino acids 1-33 of SEQ ID NO: 13, amino acids 18-33 of SEQ ID NO: 13, or SEQ ID NO: 13, or the exosporium protein can comprise the full length B. weihenstephensis KBAB4 3572 gene product (SEQ ID NO: 14). A methionine residue linked to amino acids 18-33 of the B. weihenstephensis KBAB4 3572 gene product can also be used as a targeting sequence. Thus, the targeting sequence can comprise SEQ ID NO: 99.

[0089] The targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 13; amino acids 5-33 of SEQ ID NO: 13; amino acids 8-33 of SEQ ID NO: 13; amino acids 10-33 of SEQ ID NO: 13; or amino acids 15-33 of SEQ ID NO: 13.

[0090] Alternatively, the targeting sequence can comprise amino acids 1-43 of SEQ ID NO: 15, amino acids 28-43 of SEQ ID NO: 15, or SEQ ID NO: 15, or the exosporium protein can comprise full length s, cereus VD200 exosporium leader peptide (SEQ ID NO: 16).

[0091] The targeting sequence can comprise amino acids 2-43 of SEQ ID NO: 15; amino acids 5-43 of SEQ ID NO: 15; amino acids 8-43 of SEQ ID NO: 15; amino acids 10-43 of SEQ ID NO: 15; amino acids 15-43 of SEQ ID NO: 15; amino acids 20-43 of SEQ ID NO: 15; or amino acids 25-43 of SEQ ID NO: 15.

[0092] The targeting sequence can also comprise amino acids 1-27 of SEQ ID NO: 17, amino acids 12-27 of SEQ ID NO: 17, or SEQ ID NO: 17, or the exosporium protein can comprise full-length B. cereus VD166 exosporium leader peptide (SEQ ID NO: 18). A methionine residue linked to amino acids 12-27 of the B. cereus VD166 exosporium leader peptide can also be used as a targeting sequence. Thus, the targeting sequence can comprise SEQ ID NO: 100. [0093] The targeting sequence can comprise amino acids 2-27 of SEQ ID NO: 17;

amino acids 5-27 of SEQ ID NO: 17; amino acids 8-27 of SEQ ID NO: 17; or amino acids 10- 27 of SEQ ID NO: 17.

[0094] The targeting sequence can also comprise amino acids 1-33 of SEQ ID NO: 19, amino acids 18-33 of SEQ ID NO: 19, or SEQ ID NO: 19, or the exosporium protein can comprise full length B. cereus VD200 hypothetical protein IKG 04663 (SEQ ID NO:20).

[0095] The targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 19;

amino acids 5-33 of SEQ ID NO: 19; amino acids 8-33 of SEQ ID NO: 19; amino acids 10-33 of SEQ ID NO: 19; or amino acids 15-33 of SEQ ID NO: 19.

[0096] Alternatively, the targeting sequence comprises amino acids 1-33 of SEQ ID NO: 21, amino acids 18-33 of SEQ ID NO: 21, or SEQ ID NO:21, or the exosporium protein can comprise full length B. weihenstephensis KBAB4 YVTN β-propeller protein (SEQ ID NO:22). A methionine residue linked to amino acids 18-33 of the B. weihenstephensis KBAB4 YVTN β-propeller protein can also be used as a targeting sequence. Thus, the targeting sequence can comprise SEQ ID NO: 101.

[0097] The targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 21;

amino acids 5-33 of SEQ ID NO: 21; amino acids 8-33 of SEQ ID NO: 21; amino acids 10-33 of SEQ ID NO: 21; or amino acids 15-33 of SEQ ID NO: 21.

[0098] The targeting sequence can also comprise amino acids 1-24 of SEQ ID NO: 23, amino acids 9-24 of SEQ ID NO: 23, or SEQ ID NO: 23, or the exosporium protein can comprise full length B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363 (SEQ ID NO:24). A methionine residue linked to amino acids 9-24 of B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2363 can also be used as a targeting sequence. Thus, the targeting sequence can comprise SEQ ID NO: 102.

[0099] The targeting sequence can comprise amino acids 2-24 of SEQ ID NO:23; amino acids 5-24 of SEQ ID NO: 23; or amino acids 8-24 of SEQ ID NO: 23.

[00100] The targeting sequence comprise amino acids 1-24 of SEQ ID NO: 25, amino acids 9-24 of SEQ ID NO: 25, or SEQ ID NO: 25, or the exosporium protein can comprise full length B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131 (SEQ ID NO:26). A methionine residue linked to amino acids 9-24 of B. weihenstephensis KBAB4 hypothetical protein bcerkbab4_2131 can also be used as a targeting sequence. Thus, the targeting sequence can comprise SEQ ID NO: 103. [00101] The targeting sequence can comprise amino acids 2-24 of SEQ ID NO: 25; amino acids 5-24 of SEQ ID NO: 25; or amino acids 8-24 of SEQ ID NO: 25.

[00102] Alternatively, the targeting sequence comprises amino acids 1-30 of SEQ ID NO: 27, amino acids 15-30 of SEQ ID NO: 27, or SEQ ID NO:27, or the exosporium protein can comprise full length B. weihenstephensis KBAB4 triple helix repeat containing collagen (SEQ ID NO:28).

[00103] The targeting sequence can comprise amino acids 2-30 of SEQ ID NO: 27; amino acids 5-30 of SEQ ID NO: 27; amino acids 8-30 of SEQ ID NO: 27; or amino acids 10- 30 of SEQ ID NO: 27.

[00104] The targeting sequence can also comprise amino acids 1-33 of SEQ ID NO: 29, amino acids 18-33 of SEQ ID NO: 29, or SEQ ID NO:29, or the exosporium protein can comprise full length B. mycoides 2048 hypothetical protein bmyco0001_21660 (SEQ ID

NO:30).

[00105] The targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 29; amino acids 5-33 of SEQ ID NO: 29; amino acids 8-33 of SEQ ID NO: 29; amino acids 10-33 of SEQ ID NO: 29; or amino acids 15-33 of SEQ ID NO: 29.

[00106] The targeting sequence can also comprise amino acids 1-24 of SEQ ID NO: 31, amino acids 9-24 of SEQ ID NO: 31, or SEQ ID NO: 31, or the exosporium protein can comprise full length B. mycoides 2048 hypothetical protein bmyc0001_22540 (SEQ ID NO:32). A methionine residue linked to amino acids 9-24 of B. mycoides 2048 hypothetical protein bmyc0001_22540 can also be used as a targeting sequence. Thus, the targeting sequence can comprise SEQ ID NO: 104.

[00107] The targeting sequence can comprise amino acids 2-24 of SEQ ID NO: 31; amino acids 5-24 of SEQ ID NO: 31 ; or amino acids 8-24 of SEQ ID NO: 31.

[00108] Alternatively, the targeting sequence comprises amino acids 1-15 of SEQ ID NO: 33, SEQ ID NO:33, or the exosporium protein comprises full length B. mycoides 2048 hypothetical protein bmyc0001_21510 (SEQ ID NO:34).

[00109] The targeting sequence can also comprise amino acids 1-16 of SEQ ID NO: 35, SEQ ID NO:35, or the exosporium protein can comprise full length B. thuringiensis 35646 collagen triple helix repeat protein (SEQ ID NO:36).

[00110] The targeting sequence can comprise amino acids 1-29 of SEQ ID NO:43, amino acids 14-29 of SEQ ID NO: 43, or SEQ ID NO: 43, or the exosporium protein can comprise full length B. cereus hypothetical protein WP 69652 (SEQ ID NO: 44). [00111] The targeting sequence can comprise amino acids 2-29 of SEQ ID NO: 43; amino acids 5-29 of SEQ ID NO: 43; amino acids 8-29 of SEQ ID NO: 43; or amino acids 10- 29 of SEQ ID NO: 43.

[00112] Alternatively, the targeting sequence can comprise amino acids 1-35 of SEQ ID NO: 45, amino acids 20-35 of SEQ ID NO: 45, or SEQ ID NO: 45, or the exosporium protein can comprise full length B. cereus exosporium leader WP016117717 (SEQ ID NO: 46). A methionine residue linked to amino acids 20-35 of B. cereus exosporium leader

WP016117717 can also be used as a targeting sequence. Thus, the targeting sequence can comprise SEQ ID NO: 106.

[00113] The targeting sequence can comprise amino acids 2-35 of SEQ ID NO: 45; amino acids 5-35 of SEQ ID NO: 45; amino acids 8-35 of SEQ ID NO: 45; amino acids 10-35 of SEQ ID NO: 45; or amino acids 15-35 of SEQ ID NO: 45.

[00114] The targeting sequence can comprise amino acids 1-43 of SEQ ID NO: 47, amino acids 28-43 of SEQ ID NO: 47, or SEQ ID NO: 47, or the exosporium protein can comprise full length B. cereus exosporium peptide WP002105192 (SEQ ID NO: 48).

[00115] The targeting sequence can comprise amino acids 2-43 of SEQ ID NO: 47; amino acids 5-43 of SEQ ID NO: 47; amino acids 8-43 of SEQ ID NO: 47; amino acids 10-43 of SEQ ID NO: 47; amino acids 15-43 of SEQ ID NO: 47; amino acids 20-43 of SEQ ID NO: 47; or amino acids 25-43 of SEQ ID NO: 47.

[00116] The targeting sequence can comprise amino acids 1-32 of SEQ ID NO: 49, amino acids 17-32 of SEQ ID NO: 49, or SEQ ID NO: 49, or the exosporium protein can comprise full length B. cereus hypothetical protein WP87353 (SEQ ID NO: 50).

[00117] The targeting sequence can comprise amino acids 2-32 of SEQ ID NO: 49; amino acids 5-32 of SEQ ID NO: 49; amino acids 8-32 of SEQ ID NO: 49; amino acids 10-32 of SEQ ID NO: 49; or amino acids 15-32 of SEQ ID NO: 49.

[00118] Alternatively, the targeting sequence can comprise amino acids 1-33 of SEQ ID NO: 51, amino acids 18-33 of SEQ ID NO: 51, or SEQ ID NO: 51, or the exosporium protein can comprise full length B. cereus exosporium peptide 02112369 (SEQ ID NO: 52).

[00119] The targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 51; amino acids 5-33 of SEQ ID NO: 51; amino acids 8-33 of SEQ ID NO: 51; amino acids 10-33 of SEQ ID NO: 51; or amino acids 15-33 of SEQ ID NO: 51. [00120] The targeting sequence can comprise amino acids 1-33 of SEQ ID NO: 53, amino acids 18-33 of SEQ ID NO: 53, or SEQ ID NO: 53, or the exosporium protein can comprise full length B. cereus exosporium protein WP016099770 (SEQ ID NO: 54).

[00121] The targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 53; amino acids 5-33 of SEQ ID NO: 53; amino acids 8-33 of SEQ ID NO: 53; amino acids 10-33 of SEQ ID NO: 53; or amino acids 15-33 of SEQ ID NO: 53.

[00122] Alternatively, the targeting sequence can comprise acids 1-30 of SEQ ID NO: 55, amino acids 15-30 of SEQ ID NO: 55, or SEQ ID NO: 55, or the exosporium protein can comprise full length B. thuringiensis hypothetical protein YP006612525 (SEQ ID NO: 56).

[00123] The targeting sequence can comprise amino acids 2-30 of SEQ ID NO: 55; amino acids 5-30 of SEQ ID NO: 55; amino acids 8-30 of SEQ ID NO: 55; or amino acids 10- 30 of SEQ ID NO: 55.

[00124] The targeting sequence can also comprise amino acids 1-130 of SEQ ID NO: 57, amino acids 115-130 of SEQ ID NO: 57, or SEQ ID NO: 57, or the exosporium protein can comprise full length B. mycoides hypothetical protein TIGR03720 (SEQ ID NO: 58).

[00125] The targeting sequence can comprise amino acids 2-130 of SEQ ID NO: 57; amino acids 5-130 of SEQ ID NO: 57; amino acids 10-130 of SEQ ID NO: 57; amino acids 20- 130 of SEQ ID NO: 57; amino acids 30-130 of SEQ ID NO: 57; amino acids 40-130 of SEQ ID NO: 57; amino acids 50-130 of SEQ ID NO: 57; amino acids 60-130 of SEQ ID NO: 57; amino acids 70-130 of SEQ ID NO: 57; amino acids 80-130 of SEQ ID NO: 57; amino acids 90-130 of SEQ ID NO: 57; amino acids 100-130 of SEQ ID NO: 57; or amino acids 110-130 of SEQ ID NO: 57.

[00126] The targeting sequence can comprise amino acids 1-30 of SEQ ID NO: 59; or SEQ ID NO: 59; or the exosporium protein can comprise full length B. cereus ATCC 10987 collagen triple helix repeat domain protein (SEQ ID NO: 60).

[00127] The targeting sequence can comprise amino acids 2-30 of SEQ ID NO: 59; amino acids 4-30 of SEQ ID NO: 59; or amino acids 6-30 of SEQ ID NO: 59.

[00128] The targeting sequence can comprise amino acids 1-33 of SEQ ID NO: 61; amino acids 18-33 of SEQ ID NO: 61; or SEQ ID NO: 61; or the exosporium protein can comprise full length B. cereus E33L collagen-like protein (SEQ ID NO: 62).

[00129] The targeting sequence can comprise amino acids 2-33 of SEQ ID NO: 61; amino acids 5-33 of SEQ ID NO: 61; amino acids 10-33 of SEQ ID NO: 61; or amino acids 15- 33 of SEQ ID NO: 61. [00130] The targeting sequence can comprise amino acids 1-35 of SEQ ID NO: 63; or SEQ ID NO: 63; or the exosporium protein can comprise full length B. weihenstephanensis KBAB4 triple helix repeat-containing collagen (SEQ ID NO: 64).

[00131] The targeting sequence can comprise amino acids 2-35 of SEQ ID NO: 63; amino acids 5-35 of SEQ ID NO: 63; amino acids 8-35 of SEQ ID NO: 63; amino acids 10-35 of SEQ ID NO: 63; or amino acids 15-35 of SEQ ID NO: 63.

[00132] The targeting sequence can comprise amino acids 1-24 of SEQ ID NO: 65; acids 9-24 of SEQ ID NO: 65; SEQ ID NO: 65; or SEQ ID NO: 107; or the exosporium protein can comprise full length B. thuringiensis str. Al Hakam hypothetical protein BALH 2230 (SEQ ID NO: 66).

[00133] The targeting sequence can comprise amino acids 2-24 of SEQ ID NO: 65; or amino acids 5-24 of SEQ ID NO: 65.

[00134] The targeting sequence can comprise acids 1-27 of SEQ ID NO: 67; amino acids 12-27 of SEQ ID NO: 67; or SEQ ID NO: 67; or the exosporium protein can comprise full length B. cereus ATCC 14579 triple helix repeat-containing collagen (SEQ ID NO: 68).

[00135] The targeting sequence can comprise amino acids 2-27 of SEQ ID NO: 67; amino acids 5-27 of SEQ ID NO: 67; or amino acids 10-27 of SEQ ID NO: 67.

[00136] The targeting sequence can comprise amino acids 1-38 of SEQ ID NO: 69; amino acids 23-38 of SEQ ID NO: 69; or SEQ ID NO: 69; or the exosporium protein can comprise full length B. cereus collagen triple helix repeat (SEQ ID NO: 70).

[00137] The targeting sequence can comprise amino acids 2-38 of SEQ ID NO: 69; amino acids 5-38 of SEQ ID NO: 69; amino acids 10-38 of SEQ ID NO: 69; or amino acids 15- 38 of SEQ ID NO: 69.

[00138] The exosporium protein can comprise full length B. cereus ATCC 14579 triple helix repeat-containing collagen (SEQ ID NO: 72).

[00139] The targeting sequence can comprise SEQ ID NO: 73, or the exosporium protein can comprise full length B. cereus E33L hypothetical protein BCZK1835 (SEQ ID NO: 74).

[00140] The targeting sequence can comprise amino acids 1-42 of SEQ ID NO: 75; amino acids 27-42 of SEQ ID NO: 75; or SEQ ID NO: 75; or the exosporium protein can comprise full length B. weihenstephanensis KBAB4 triple helix repeat-containing collagen (SEQ ID NO: 76). [00141] The targeting sequence can comprise amino acids 2-42 of SEQ ID NO: 75; amino acids 5-42 of SEQ ID NO: 75; amino acids 10-42 of SEQ ID NO: 75; amino acids 15-42 of SEQ ID NO: 75; amino acids 20-42 of SEQ ID NO: 75; or amino acids 25-42 of SEQ ID NO: 75.

[00142] The targeting sequence can comprise amino acids 1-24 of SEQ ID NO: 77; amino acids 9-24 of SEQ ID NO: 77; or SEQ ID NO: 77; or the exosporium protein can comprise full length s, cereus ATCC 14579 triple helix repeat-containing collagen (SEQ ID NO: 78).

[00143] The targeting sequence can comprise amino acids 2-24 of SEQ ID NO: 77; or amino acids 5-24 of SEQ ID NO: 77;

[00144] The exosporium protein can comprise full length B. cereus ATCC 14579 hypothetical protein BC4725 (SEQ ID NO: 80).

[00145] The targeting sequence can comprise amino acids 1-38 of SEQ ID NO: 81 ; amino acids 23-38 of SEQ ID NO: 81; or SEQ ID NO: 81; or the exosporium protein can comprise full length B. cereus E33L hypothetical protein BCZK4476 (SEQ ID NO: 82).

[00146] The targeting sequence can comprise amino acids 2-38 of SEQ ID NO: 81; acids 5-38 of SEQ ID NO: 81; amino acids 10-38 of SEQ ID NO: 81; amino acids 15-38 of SEQ ID NO: 81; or amino acids 20-38 of SEQ ID NO: 81.

[00147] The targeting sequence can comprise amino acids 1-34 of SEQ ID NO: 83; or SEQ ID NO: 83; or the exosporium protein can comprise full length B. anthracis str. 'Ames Ancestor' triple helix repeat-containing collagen (SEQ ID NO: 84).

[00148] The exosporium protein can comprise full length B. thuringiensis serovar konkukian str. 97-27 Bel A protein (SEQ ID NO: 86).

[00149] The targeting sequence can comprise amino acids 1-28 of SEQ ID NO: 87; amino acids 13-28 of SEQ ID NO: 87; or SEQ ID NO: 87; or the exosporium protein can comprise full length s, cereus ATCC 10987 conserved hypothetical protein (SEQ ID NO: 88).

[00150] The targeting sequence can comprise amino acids 2-28 of SEQ ID NO: 87; amino acids 5-28 of SEQ ID NO: 87; or amino acids 10-28 of SEQ ID NO: 87.

[00151] The targeting sequence can comprise amino acids 1-28 of SEQ ID NO: 89; or SEQ ID NO: 89; or the exosporium protein can comprise full length B. cereus ATCC 14579 triple helix repeat-containing collagen (SEQ ID NO: 90).

[00152] The targeting sequence can comprise amino acids 2-28 of SEQ ID NO: 89; amino acids 5-28 of SEQ ID NO: 89; or amino acids 10-28 of SEQ ID NO: 89 [00153] The targeting sequence can comprise amino acids 1-93 of SEQ ID NO: 91; or SEQ ID NO: 91; or the exosporium protein can comprise B. cereus exosporium leader peptide partial sequence (SEQ ID NO: 92).

[00154] The targeting sequence can comprise amino acids 2-93 of SEQ ID NO: 91; amino acids 10-93 of SEQ ID NO: 91; amino acids 20-93 of SEQ ID NO: 91; amino acids 30- 93 of SEQ ID NO: 91; amino acids 40-93 of SEQ ID NO: 91; amino acids 50-93 of SEQ ID NO: 91; or amino acids 60-93 of SEQ ID NO: 91.

[00155] The targeting sequence can comprise amino acids 1-130 of SEQ ID NO: 93; or SEQ ID NO: 93; or the exosporium protein can comprise B. weihenstephanensis) hypothetical protein ER45 27600, partial sequence (SEQ ID NO: 94).

[00156] The targeting sequence can comprise amino acids 2-130 of SEQ ID NO: 93; amino acids 10-130 of SEQ ID NO: 93; amino acids 20-130 of SEQ ID NO: 93; or amino acids 30-130 of SEQ ID NO: 93.

[00157] Furthermore, as illustrated in the Examples provided hereinbelow, it has been found that sequences shorter than amino acids 20-35 of Bel A can be used to target a fusion protein to the exosporium of a recombinant Bacillus cereus family member. In particular, amino acids 20-33 of BclA, amino acids 20-31 of BclA, amino acids 21-33 of BclA, or amino acids 23-31 of BclA can be used to target a fusion protein to the exosporium of a recombinant Bacillus cereus family member. Thus, the targeting sequence can consist of amino acids 20-33 of SEQ ID NO: 1, amino acids 20-31 of SEQ ID NO: 1, amino acids 21-33 of SEQ ID NO: 1, or amino acids 23-31 of SEQ ID NO: 1. The corresponding regions of any of the SEQ ID NOs. shown in Figures 1 A and IB can also be used to target a fusion protein to the exosporium of a recombinant Bacillus cereus family member. By "corresponding regions," it is meant that when the sequences are aligned with SEQ ID NO: 1, as shown in Figure 1 A and IB, the regions of the other amino acid sequences that align with the amino acids of SEQ ID NO: are the

"corresponding regions" of those sequences. Thus, for example, amino acids 12-25 of SEQ ID NO: 3, amino acids 23-36 of SEQ ID NO: 5, amino acids 13-26 of SEQ ID NO: 7, etc. can be used to target a fusion protein to the exosporium of a recombinant Bacillus cereus family member, since these regions align with amino acids 20-33 of SEQ ID NO: 1 as shown in Figure 1A.

[00158] Even shorter regions within amino acids 20-35 of BclA can also be used for targeting a fusion protein to the exosporium of a recombinant Bacillus cereus family member. In particular, any amino acid sequence that includes amino acids 25-30 of SEQ ID NO: 1 or the corresponding amino acids from any of the sequences shown in Figures 1 A and IB can be used. A skilled person will recognize that starting with amino acids 25-30 of SEQ ID NO: 1 or the corresponding region of any of the sequences shown in Figures 1 A and IB, additional amino acids can be added to the amino-terminus, the carboxy terminus, or both the amino- and carboxy termini to create a targeting sequence that will be effective for targeting a fusion protein to the exosporium of a recombinant Bacillus cereus family member.

[00159] In addition, it can readily be seen from the sequence alignment in Figures 1 A and IB that while amino acids 20-35 of Bel A are conserved, and amino acids 25-35 are more conserved, some degree of variation can occur in this region without affecting the ability of the targeting sequence to target a protein to the exosporium. Figures 1 A and IB list the percent identity of each of corresponding amino acids of each sequence to amino acids 20-35 of Bel A ("20-35% Identity") and to amino acids 25-35 of Bel A ("25-35 % Identity"). Thus, for example, as compared to amino acids 20-35 of Bel A, the corresponding amino acids of

BetA/BAS3290 are about 81.3% identical, the corresponding amino acids of BAS4623 are about 50.0% identical, the corresponding amino acids of BclB are about 43.8% identical, the corresponding amino acids of B AS 1882 are about 62.5% identical, the corresponding amino acids of the KBAB4 2280 gene product are about 81.3% identical, and the corresponding amino acids of the KBAB4 3572 gene product are about 81.3% identical. The sequence identities over this region for the remaining sequences are listed in Figures 1 A and IB.

[00160] With respect to amino acids 25-35 of Bel A, the corresponding amino acids of BetA/BAS3290 are about 90.9% identical, the corresponding amino acids of BAS4623 are about 72.7%) identical, the corresponding amino acids of BclB are about 54.5% identical, the corresponding amino acids of BAS1882 are about 72.7% identical, the corresponding amino acids of the KBAB4 2280 gene product are about 90.9% identical, and the corresponding amino acids of the KBAB4 3572 gene product are about 81.8% identical. The sequence identities over this region for the remaining sequences are listed in Figures 1 A and IB.

[00161] Thus, the targeting sequence can comprise an amino acid sequence having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%. [00162] The targeting sequence can also comprise an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%>. Alternatively the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%).

[00163] The targeting sequence can also comprise an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.

[00164] The targeting sequence can also comprise an amino acid sequence having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%).

[00165] Alternatively, the targeting sequence can comprise an amino sequence having at least about 62% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. The targeting sequence can also consist of an amino acid sequence consisting of 16 amino acids and having at least about 62% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO: 1 is at least about 72%.

[00166] The targeting sequence can comprise an amino acid sequence having at least 68%) identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least 68% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.

[00167] The targeting sequence can also comprises an amino sequence having at least about 75%) identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO: 1 is at least about 72%.

[00168] The targeting sequence can also comprise an amino sequence having at least about 75%) identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%>. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 of SEQ ID NO: 1 is at least about 81%>.

[00169] The targeting sequence can also comprise an amino acid sequence having at least about 81%> identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%>. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 81%> identity with amino acids 20-35 of SEQ ID NO: l, wherein the identity with amino acids 25-35 is at least about 81%.

[00170] The targeting sequence can comprise an amino acid sequence having at least about 81 ) identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%. Alternatively, the targeting sequence consists of an amino acid sequence consisting of 16 amino acids and having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%.

[00171] The skilled person will recognize that variants of the above sequences can also be used as targeting sequences, so long as the targeting sequence comprises amino acids 20-35 of BclA, the corresponding amino acids of BetA/BAS3290, BAS4263, BclB, BAS1882, the KBAB4 2280 gene product, or the KBAB 3572 gene product, or a sequence comprising any of the above noted sequence identities to amino acids 20-35 and 25-35 of BclA is present.

[00172] Certain Bacillus cereus family exosporium proteins which lack regions having homology to amino acids 25-35 of BclA can also be used to target a peptide or protein to the exosporium of a Bacillus cereus family member. In particular, the fusion proteins can comprise an exosporium protein comprising SEQ ID NO: 108 (B. mycoides InhA), an exosporium protein comprising SEQ ID NO: 109 (B. anthracis Sterne BAS1141 (ExsY)), an exosporium protein comprising SEQ ID NO: 110 (B. anthracis Sterne BAS1144

(BxpB/ExsFA)), an exosporium protein comprising SEQ ID NO: 111 (B. anthracis Sterne BAS1145 (CotY)), an exosporium protein comprising SEQ ID NO: 112 (B. anthracis Sterne BAS1140), an exosporium protein comprising SEQ ID NO: 113 (B. anthracis H9401 ExsFB), an exosporium protein comprising SEQ ID NO: 114 (B. thuringiensis HD74 InhAl), an exosporium protein comprising SEQ ID NO: 115 (B. cereus ATCC 10876 ExsJ), an exosporium protein comprising SEQ ID NO: 116 (B. cereus ExsH), an exosporium protein comprising SEQ ID NO: 117 (B. anthracis Ames YjcA), an exosporium protein comprising SEQ ID NO: 118 (B. anthracis YjcB), an exosporium protein comprising SEQ ID NO: 119 (B. anthracis Sterne BclC), an exosporium protein comprising SEQ ID NO: 120 (Bacillus thuringiensis serovar konkukian str. 97-27 acid phosphatase), an exosporium protein comprising SEQ ID NO: 121 (B. thuringiensis HD74 InhA2), or an exosporium protein comprising SEQ ID NO: 122 (B.

mycoides InhA3). Inclusion of an exosporium protein comprising any of SEQ ID NOs: 108-122 in the fusion proteins described herein will result in targeting to the exosporium of a B. cereus family member.

[00173] Moreover, exosporium proteins having a high degree of sequence identity with any of the full-length exosporium proteins or the exosporium protein fragments described above can also be used to target a peptide or protein to the exosporium of a Bacillus cereus family member. Thus, the fusion protein can comprise an exosporium protein or exosporium protein fragment comprising an amino acid sequence having at least 85% identity with any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, and 122. Alternatively, the fusion protein can comprise an exosporium protein having at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, and 122.

[00174] During sporulation of a recombinant Bacillus cereus family member expressing any of the fusion proteins described herein, the targeting motif, exosporium protein, or exosporium protein fragment is recognized by the spore exosporium assembly machinery and directed to the exosporium, resulting in display of the protein or peptide of interest portion of the fusion protein on the outside of the spore.

[00175] As illustrated further by the Examples provided hereinbelow, the use of different targeting sequences allows for control of the expression level of the fusion protein on the surface of the Bacillus cereus family member spore. Use of certain of the targeting sequences described herein will result in a higher level of expression of the fusion protein, whereas use of others of the targeting sequences will result in lower levels of expression of the fusion protein on the surface of the spore.

[00176] In any of the fusion proteins described herein, the targeting sequence, exosporium protein, or exosporium protein fragment can comprise the amino acid sequence GXT at its carboxy terminus, wherein X is any amino acid.

[00177] In any of the fusion proteins described herein, the targeting sequence, exosporium protein, or exosporium protein fragment, can comprise an alanine residue at the position of the targeting sequence that corresponds to amino acid 20 of SEQ ID NO: 1.

[00178] In any of the fusion proteins described herein, the targeting sequence, exosporium protein, or exosporium protein fragment can further comprise a methionine, serine, or threonine residue at the amino acid position immediately preceding the first amino acid of the targeting sequence, exosporium protein, or exosporium protein fragment or at the position of the targeting sequence that corresponds to amino acid 20 of SEQ ID NO: 1.

B. Fusion Proteins for Expression in Recombinant Bacillus cereus Family Members

[00179] The present invention relates to fusion proteins comprising at least one protein or peptide of interest and a targeting sequence, exosporium protein fragment, or exosporium protein that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member. Recombinant Bacillus cereus family members that express such fusion proteins and exosporium fragments derived from spores of the recombinant Bacillus cereus family members are also provided. Compositions containing spores of a recombinant Bacillus cereus family member or exosporium fragments derived from spores of a recombinant Bacillus cereus family member are provided. In addition, the methods and products of the present invention involve the use of fusion proteins comprising at least one protein or peptide of interest (e.g., a protein or peptide that protects an animal from a pathogen, a protein or peptide that protects an aquatic organism from a pathogen, a protein or peptide that has insecticidal activity against an insect vector of an animal pathogen or larvae of the insect vector, or an antigen or immunogen) and a targeting sequence, exosporium protein fragment, or exosporium protein that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member.

[00180] In any of the fusion proteins, recombinant Bacillus cereus family members, compositions, methods, adhesive patches, wound dressings, insert trays, hoof bandages, feed, feed additives, or insect foggers described herein, the fusion protein can comprise: (1) a targeting sequence comprising an amino acid sequence having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%; (2) a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 1; (3) a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 1; (4) a targeting sequence comprising SEQ ID NO: 1; (5) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 2; (6) a targeting sequence comprising amino acids 2-35 of SEQ ID NO: 1; (7) a targeting sequence comprising amino acids 5-35 of SEQ ID NO: 1; (8) a targeting sequence comprising amino acids 8-35 of SEQ ID NO: 1; (9) a targeting sequence comprising amino acids 10-35 of SEQ ID NO: 1; (10) a targeting sequence comprising amino acids 15-35 of SEQ ID NO: 1; (11) a targeting sequence comprising amino acids 1-27 of SEQ ID NO: 3; (12) a targeting sequence comprising amino acids 12-27 of SEQ ID NO: 3; (13) a targeting sequence comprising SEQ ID NO: 3; (14) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 4; (15) a targeting sequence comprising amino acids 2-27 of SEQ ID NO: 3; (16) a targeting sequence comprising amino acids 5-27 of SEQ ID NO: 3; (17) a targeting sequence comprising amino acids 8-27 of SEQ ID NO: 3; (18) a targeting sequence comprising amino acids 10-27 of SEQ ID NO: 3; (19) a targeting sequence comprising amino acids 1-38 of SEQ ID NO: 5; (20) a targeting sequence comprising amino acids 23-38 of SEQ ID NO: 5; (21) a targeting sequence comprising SEQ ID NO: 5; (22) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 6; (23) a targeting sequence comprising amino acids 2-38 of SEQ ID NO: 5; (24) a targeting sequence comprising amino acids 5-38 of SEQ ID NO: 5; (25) a targeting sequence comprising amino acids 8-38 of SEQ ID NO: 5; (26) a targeting sequence comprising amino acids 10-38 of SEQ ID NO: 5; (27) a targeting sequence comprising amino acids 15-38 of SEQ ID NO: 5; (28) a targeting sequence comprising amino acids 20-38 of SEQ ID NO: 5; (29) a targeting sequence comprising amino acids 1-28 of SEQ ID NO: 7; (30) a targeting sequence comprising amino acids 13-28 of SEQ ID NO: 7; (31) a targeting sequence comprising SEQ ID NO: 7; (32) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 8; (33) a targeting sequence comprising amino acids 2-28 of SEQ ID NO: 7; (34) a targeting sequence comprising amino acids 5-28 of SEQ ID NO: 7; (35) a targeting sequence comprising amino acids 8-28 of SEQ ID NO: 7; (36) a targeting sequence comprising amino acids 10-28 of SEQ ID NO: 7; (37) a targeting sequence comprising amino acids 1-24 of SEQ ID NO: 9; (38) a targeting sequence comprising amino acids 9-24 of SEQ ID NO: 9; (39) a targeting sequence comprising SEQ ID NO: 9; (40) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 10; (41) a targeting sequence comprising amino acids 2-24 of SEQ ID NO: 9; (42) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 9; (43) a targeting sequence comprising amino acids 8-24 of SEQ ID NO: 9; (44) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 11; (45) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 11; (46) a targeting sequence comprising SEQ ID NO: 11; (47) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 12; (48) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 11; (49) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 11; (50) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 11; (51) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 11; (52) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 11; (53) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 13; (54) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 13; (55) a targeting sequence comprising SEQ ID NO: 13; (56) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 14; (57) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 13; (58) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 13; (59) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 13; (60) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 13; (61) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 13; (62) a targeting sequence comprising amino acids 1-43 of SEQ ID NO: 15; (63) a targeting sequence comprising amino acids 28-43 of SEQ ID NO: 15; (64) a targeting sequence comprising SEQ ID NO: 15; (65) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 16; (66) a targeting sequence comprising amino acids 2-43 of SEQ ID NO: 15; (67) a targeting sequence comprising amino acids 5-43 of SEQ ID NO: 15; (68) a targeting sequence comprising amino acids 8-43 of SEQ ID NO: 15; (69) a targeting sequence comprising amino acids 10-43 of SEQ ID NO: 15; (70) a targeting sequence comprising amino acids 15-43 of SEQ ID NO: 15; (71) a targeting sequence comprising amino acids 20-43 of SEQ ID NO: 15; (72) a targeting sequence comprising amino acids 25-43 of SEQ ID NO: 15; (73) a targeting sequence comprising amino acids 1-27 of SEQ ID NO: 17; (74) a targeting sequence comprising amino acids 12-27 of SEQ ID NO: 17; (75) a targeting sequence comprising SEQ ID NO: 17; (76) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 18; (77) a targeting sequence comprising amino acids 2-27 of SEQ ID NO: 17; (78) a targeting sequence comprising amino acids 5-27 of SEQ ID NO: 17; (79) a targeting sequence comprising amino acids 8-27 of SEQ ID NO: 17; (80) a targeting sequence comprising amino acids 10-27 of SEQ ID NO: 17; (81) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 19; (82) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 19; (83) a targeting sequence comprising SEQ ID NO: 19; (84) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO:20; (85) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 19; (86) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 19; (87) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 19; (88) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 19; (89) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 19; (90) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 21; (91) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 21; (92) a targeting sequence comprising SEQ ID NO:21; (93) an exosporium protein comprising an amino acid sequence having at least 85%> identity with SEQ ID NO:22; (94) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 21; (95) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 21; (96) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 21; (97) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 21; (98) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 21; (99) a targeting sequence comprising amino acids 1-24 of SEQ ID NO: 23; (100) a targeting sequence comprising amino acids 9-24 of SEQ ID NO: 23; (101) a targeting sequence comprising SEQ ID NO: 23; (102) an exosporium protein comprising an amino acid sequence having at least 85%> identity with SEQ ID NO:24; (103) a targeting sequence comprising amino acids 2-24 of SEQ ID NO:23; (104) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 23; (105) a targeting sequence comprising amino acids 8-24 of SEQ ID NO: 23; (106) a targeting sequence comprising amino acids 1-24 of SEQ ID NO: 25; (107) a targeting sequence comprising amino acids 9-24 of SEQ ID NO: 25; (108) a targeting sequence comprising SEQ ID NO:25; (109) an exosporium protein comprising an amino acid sequence having at least 85%> identity with SEQ ID NO:26; (110) a targeting sequence comprising amino acids 2-24 of SEQ ID NO: 25; (111) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 25; (112) a targeting sequence comprising amino acids 8-24 of SEQ ID NO: 25; (113) a targeting sequence comprising amino acids 1-30 of SEQ ID NO: 27; (114) a targeting sequence comprising amino acids 15-30 of SEQ ID NO: 27; (115) a targeting sequence comprising SEQ ID NO:27; (116) an exosporium protein comprising an amino acid sequence having at least 85%> identity with SEQ ID NO:28; (117) a targeting sequence comprising amino acids 2-30 of SEQ ID NO: 27; (118) a targeting sequence comprising amino acids 5-30 of SEQ ID NO: 27; (119) a targeting sequence comprising amino acids 8-30 of SEQ ID NO: 27; (120) a targeting sequence comprising amino acids 10-30 of SEQ ID NO: 27; (121) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 29; (122) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 29; (123) a targeting sequence comprising SEQ ID NO:29; (124) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO:30; (125) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 29; (126) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 29; (127) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 29; (128) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 29; (129) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 29; (130) a targeting sequence comprising amino acids 1-24 of SEQ ID NO: 31; (131) a targeting sequence comprising amino acids 9-24 of SEQ ID NO: 31; (132) a targeting sequence comprising SEQ ID NO:31 ; (133) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO:32; (134) a targeting sequence comprising amino acids 2-24 of SEQ ID NO: 31; (135) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 31; (136) a targeting sequence comprising amino acids 8-24 of SEQ ID NO: 31; (137) a targeting sequence comprising amino acids 1-15 of SEQ ID NO: 33; (138) a targeting sequence comprising SEQ ID NO:33; (139) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO:34; (140) a targeting sequence comprising amino acids 1-16 of SEQ ID NO: 35; (141) a targeting sequence comprising SEQ ID NO:35; (142) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO:36; (143) a targeting sequence comprising amino acids 1-29 of SEQ ID NO:43; (144) a targeting sequence comprising amino acids 14-29 of SEQ ID NO: 43; (145) a targeting sequence comprising SEQ ID NO: 43; (146) an exosporium protein comprising an amino acid sequence having at least 85%) identity with SEQ ID NO: 44; (147) a targeting sequence comprising amino acids 2-29 of SEQ ID NO: 43; (148) a targeting sequence comprising amino acids 5-29 of SEQ ID NO: 43; (149) a targeting sequence comprising amino acids 8-29 of SEQ ID NO: 43; (150) a targeting sequence comprising amino acids 10-29 of SEQ ID NO: 43; (151) a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 45; (152) a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 45; (153) a targeting sequence comprising SEQ ID NO: 45; (154) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 46; (155) a targeting sequence comprising amino acids 2-35 of SEQ ID NO: 45; (156) a targeting sequence comprising amino acids 5-35 of SEQ ID NO: 45; (157) a targeting sequence comprising amino acids 8-35 of SEQ ID NO: 45; (158) a targeting sequence comprising amino acids 10-35 of SEQ ID NO: 45; (159) a targeting sequence comprising amino acids 15-35 of SEQ ID NO: 45; (160) a targeting sequence comprising amino acids 1-43 of SEQ ID NO: 47; (161) a targeting sequence comprising amino acids 28-43 of SEQ ID NO: 47; (162) a targeting sequence comprising SEQ ID NO: 47; (163) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 48; (164) a targeting sequence comprising amino acids 2-43 of SEQ ID NO: 47; (165) a targeting sequence comprising amino acids 5-43 of SEQ ID NO: 47; (166) a targeting sequence comprising amino acids 8-43 of SEQ ID NO: 47; (167) a targeting sequence comprising amino acids 10-43 of SEQ ID NO: 47; (168) a targeting sequence comprising amino acids 15-43 of SEQ ID NO: 47; (169) a targeting sequence comprising amino acids 20-43 of SEQ ID NO: 47; (170) a targeting sequence comprising amino acids 25-43 of SEQ ID NO: 47; (171) a targeting sequence comprising amino acids 1-32 of SEQ ID NO: 49; (172) a targeting sequence comprising amino acids 17-32 of SEQ ID NO: 49; (173) a targeting sequence comprising SEQ ID NO: 49; (174) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 50; (175) a targeting sequence comprising amino acids 2-32 of SEQ ID NO: 49; (176) a targeting sequence comprising amino acids 5-32 of SEQ ID NO: 49; (177) a targeting sequence comprising amino acids 8-32 of SEQ ID NO: 49; (178) a targeting sequence comprising amino acids 10-32 of SEQ ID NO: 49; (179) a targeting sequence comprising amino acids 15-32 of SEQ ID NO: 49; (180) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 51; (181) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 51; (182) a targeting sequence comprising SEQ ID NO: 51; (183) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 52; (184) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 51; (185) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 51; (186) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 51; (187) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 51; (188) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 51; (189) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 53; (190) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 53; (191) a targeting sequence comprising SEQ ID NO: 53; (192) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 54; (193) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 53; (194) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 53; (195) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 53; (196) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 53; (197) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 53; (198) a targeting sequence comprising amino acids 1-30 of SEQ ID NO: 55; (199) a targeting sequence comprising amino acids 15-30 of SEQ ID NO: 55; (200) a targeting sequence comprising SEQ ID NO: 55; (201) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 56; (202) a targeting sequence comprising amino acids 2-30 of SEQ ID NO: 55; (203) a targeting sequence comprising amino acids 5-30 of SEQ ID NO: 55; (204) a targeting sequence comprising amino acids 8-30 of SEQ ID NO: 55; (205) a targeting sequence comprising amino acids 10-30 of SEQ ID NO: 55; (206) a targeting sequence comprising amino acids 1-130 of SEQ ID NO: 57; (207) a targeting sequence comprising amino acids 115-130 of SEQ ID NO: 57; (208) a targeting sequence comprising SEQ ID NO: 57; (209) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 58; (210) a targeting sequence comprising amino acids 2-130 of SEQ ID NO: 57; (211) a targeting sequence comprising amino acids 5-130 of SEQ ID NO: 57; (212) a targeting sequence comprising amino acids 10-130 of SEQ ID NO: 57; (213) a targeting sequence comprising amino acids 20-130 of SEQ ID NO: 57; (214) a targeting sequence comprising amino acids 30- 130 of SEQ ID NO: 57; (215) a targeting sequence comprising amino acids 40-130 of SEQ ID NO: 57; (216) a targeting sequence comprising amino acids 50-130 of SEQ ID NO: 57; (217) a targeting sequence comprising amino acids 60-130 of SEQ ID NO: 57; (218) a targeting sequence comprising amino acids 70-130 of SEQ ID NO: 57; (219) a targeting sequence comprising amino acids 80-130 of SEQ ID NO: 57; (220) a targeting sequence comprising amino acids 90-130 of SEQ ID NO: 57; (221) a targeting sequence comprising amino acids 100-130 of SEQ ID NO: 57; (222) a targeting sequence comprising amino acids 110-130 of SEQ ID NO: 57; (223) an exosporium protein fragment comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 95; (224) a targeting sequence comprising SEQ ID NO: 96; (225) a targeting sequence comprising SEQ ID NO: 97; (226) a targeting sequence comprising SEQ ID NO: 98; (227) a targeting sequence comprising SEQ ID NO: 99; (228) a targeting sequence comprising SEQ ID NO: 100; (229) a targeting sequence comprising SEQ ID NO: 101; (230) a targeting sequence comprising SEQ ID NO: 102; (231) a targeting sequence comprising SEQ ID NO: 103; (232) a targeting sequence comprising SEQ ID NO: 104; (233) a targeting sequence comprising SEQ ID NO: 105; (234) a targeting sequence comprising SEQ ID NO: 106; (235) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 108; (236) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 109; (237) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 110; (238) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 111; (239) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 112; (240) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 113; (241) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 114; (242) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 115; (243) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 116; (244) an exosporium protein comprising an amino acid sequence having at least 85%) identity with SEQ ID NO: 117; (245) an exosporium protein comprising an amino acid sequence having at least 85%> identity with SEQ ID NO: 118; (246) an exosporium protein comprising an amino acid sequence having at least 85%> identity with SEQ ID NO: 119; (247) an exosporium protein comprising an amino acid sequence having at least 85%> identity with SEQ ID NO: 120; (248) an exosporium protein comprising an amino acid sequence having at least 85%) identity with SEQ ID NO: 121; (249) a targeting sequence comprising amino acids 22-31 of SEQ ID NO: 1; (250) a targeting sequence comprising amino acids 22-33 of SEQ ID NO: 1; (251) a targeting sequence comprising amino acids 20-31 of SEQ ID NO: 1; (252) a targeting sequence comprising amino acids 14-23 of SEQ ID NO: 3; (253) a targeting sequence comprising amino acids 14-25 of SEQ ID NO: 3; (254) a targeting sequence comprising amino acids 12-23 of SEQ ID NO: 3; (255) a targeting sequence comprising amino acids 1-30 of SEQ ID NO: 59; (256) a targeting sequence comprising SEQ ID NO: 59; (257) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 60; (258) a targeting sequence comprising amino acids 2-30 of SEQ ID NO: 59; (259) a targeting sequence comprising amino acids 4-30 of SEQ ID NO: 59; (260) a targeting sequence comprising amino acids 6-30 of SEQ ID NO: 59; (261) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 61; (262) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 61; (263) a targeting sequence comprising SEQ ID NO: 61; (264) an exosporium protein comprising an amino acid sequence having at least 85% sequence identity with SEQ ID NO: 62; (265) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 61; (266) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 61; (267) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 61; (268) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 61; (269) a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 63; (270) a targeting sequence comprising SEQ ID NO: 63; (271) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 64; (272) a targeting sequence comprising amino acids 2-35 of SEQ ID NO: 63; (273) a targeting sequence comprising amino acids 5-35 of SEQ ID NO: 63; (274) a targeting sequence comprising amino acids 8-35 of SEQ ID NO: 63; (275) a targeting sequence comprising amino acids 10-35 of SEQ ID NO: 63; (276) a targeting sequence comprising amino acids 15-35 of SEQ ID NO: 63; (277) a targeting sequence comprising amino acids 1-24 of SEQ ID NO: 65; (278) a targeting sequence comprising amino acids 9-24 of SEQ ID NO: 65; (279) a targeting sequence comprising SEQ ID NO: 65; (280) an exosporium protein comprising an amino acid sequence having at least 85%> identity with SEQ ID NO: 66; (281) a targeting sequence comprising SEQ ID NO: 107; (282) a targeting sequence comprising amino acids 2-24 of SEQ ID NO: 65; (283) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 65; (284) a targeting sequence comprising amino acids 1-27 of SEQ ID NO: 67; (285) a targeting sequence comprising amino acids 12-27 of SEQ ID NO: 67; (286) a targeting sequence comprising SEQ ID NO: 67; (287) an exosporium protein comprising an amino acid sequence having at least 85%) identity with SEQ ID NO: 68; (288) an targeting sequence comprising amino acids 2-27 of SEQ ID NO: 67; (289) a targeting sequence comprising amino acids 5-27 of SEQ ID NO: 67; (290) a targeting sequence comprising amino acids 10-27 of SEQ ID NO: 67; (291) a targeting sequence comprising amino acids 1-38 of SEQ ID NO: 69; (292) a targeting sequence comprising amino acids 23-38 of SEQ ID NO: 69; (293) a targeting sequence comprising SEQ ID NO: 69; (294) an exosporium protein comprising an amino acid sequence having at least 85%o identity with SEQ ID NO: 70; (295) a targeting sequence comprising amino acids 2-38 of SEQ ID NO: 69; (296) a targeting sequence comprising amino acids 5-38 of SEQ ID NO: 69; (297) a targeting sequence comprising amino acids 10-38 of SEQ ID NO: 69; (298) a targeting sequence comprising amino acids 15-38 of SEQ ID NO: 69; (299) an exosporium protein comprising SEQ ID NO: 72; (300) a targeting sequence comprising SEQ ID NO: 73; (301) an exosporium protein comprising an amino acid sequence having at least 95% identity with SEQ ID NO: 74; (302) a targeting sequence comprising amino acids 1-42 of SEQ ID NO: 75; (303) a targeting sequence comprising amino acids 27-42 of SEQ ID NO: 75; (304) a targeting sequence comprising SEQ ID NO: 75; (305) an exosporium protein comprising an amino acid sequence having at least 85%> identity with SEQ ID NO: 76; (306) a targeting sequence comprising amino acids 2-42 of SEQ ID NO: 75; (307) a targeting sequence comprising amino acids 5-42 of SEQ ID NO: 75; (308) a targeting sequence comprising amino acids 10-42 of SEQ ID NO: 75; (309) a targeting sequence comprising amino acids 15-42 of SEQ ID NO: 75; (310) a targeting sequence comprising amino acids 20-42 of SEQ ID NO: 75; (311) a targeting sequence comprising amino acids 25-42 of SEQ ID NO: 75; (312) a targeting sequence comprising amino acids 1-24 of SEQ ID NO: 77; (313) a targeting sequence comprising amino acids 9-24 of SEQ ID NO: 77; (314) a targeting sequence comprising SEQ ID NO: 77; (315) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 78; (316) a targeting sequence comprising amino acids 2-24 of SEQ ID NO: 77; (317) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 77; (318) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 80; (319) a targeting sequence comprising amino acids 1-38 of SEQ ID NO: 81; (320) a targeting sequence comprising amino acids 23-38 of SEQ ID NO: 81; (321) a targeting sequence comprising SEQ ID NO: 81; (322) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 82; (323) a targeting sequence comprising amino acids 2-38 of SEQ ID NO: 81; (324) a targeting sequence comprising amino acids 5-38 of SEQ ID NO: 81; (325) a targeting sequence comprising amino acids 10-38 of SEQ ID NO: 81; (326) a targeting sequence comprising amino acids 15-38 of SEQ ID NO: 81; (327) a targeting sequence comprising amino acids 20-38 of SEQ ID NO: 81; (328) a targeting sequence comprising amino acids 1-34 of SEQ ID NO: 83; (329) a targeting sequence comprising SEQ ID NO: 83; (330) an exosporium protein comprising an amino acid sequence having at least 85%) identity with SEQ ID NO: 84; (331) an exosporium protein comprising an amino acid sequence having at least 85%> identity with SEQ ID NO: 86; (332) a targeting sequence comprising amino acids 1-28 of SEQ ID NO: 87; (333) a targeting sequence comprising amino acids 13-28 of SEQ ID NO: 87; (334) a targeting sequence comprising SEQ ID NO: 87; (335) an exosporium protein comprising an amino acid sequence having at least 85%> identity with SEQ ID NO: 88; (336) a targeting sequence comprising amino acids 2-28 of SEQ ID NO: 87; (337) a targeting sequence comprising amino acids 5-28 of SEQ ID NO: 87; (338) a targeting sequence comprising amino acids 10-28 of SEQ ID NO: 87; (339) a targeting sequence comprising amino acids 1-28 of SEQ ID NO: 89; (340) a targeting sequence comprising SEQ ID NO: 89; (341) an exosporium protein comprising an amino acid sequence having at least 85%) identity with SEQ ID NO: 90; (342) a targeting sequence comprising amino acids 2-28 of SEQ ID NO: 89; (343) a targeting sequence comprising amino acids 5-28 of SEQ ID NO: 89; (344) a targeting sequence comprising amino acids 10-28 of SEQ ID NO: 89; (345) a targeting sequence comprising amino acids 1-93 of SEQ ID NO: 91; (346) a targeting sequence comprising SEQ ID NO: 91; (347) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 92; (348) a targeting sequence comprising amino acids 2-93 of SEQ ID NO: 91; (349) a targeting sequence comprising amino acids 10-93 of SEQ ID NO: 91; (350) a targeting sequence comprising amino acids 20-93 of SEQ ID NO: 91; (351) a targeting sequence comprising amino acids 30-93 of SEQ ID NO: 91; (352) a targeting sequence comprising amino acids 40-93 of SEQ ID NO: 91; (353) a targeting sequence comprising amino acids 50-93 of SEQ ID NO: 91; (354) a targeting sequence comprising amino acids 60-93 of SEQ ID NO: 91; (355) a targeting sequence comprising amino acids 1-130 of SEQ ID NO: 93; (356) a targeting sequence comprising SEQ ID NO: 93; (357) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 94; (358) a targeting sequence comprising amino acids 2-130 of SEQ ID NO: 93; (359) a targeting sequence comprising amino acids 10-130 of SEQ ID NO: 93; (360) a targeting sequence comprising amino acids 20-130 of SEQ ID NO: 93; (361) a targeting sequence comprising amino acids 30-130 of SEQ ID NO: 93; (362) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 122; (363) a targeting sequence consisting of amino acids 20-33 of SEQ ID NO: 1; (364) a targeting sequence consisting of amino acids 21-33 of SEQ ID NO: 1; (365) a targeting sequence consisting of amino acids 23- 31 of SEQ ID NO: 1; (366) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 96; (367) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 96; (368) a targeting sequence consisting of amino acids 12-25 of SEQ ID NO: 3; (369) a targeting sequence consisting of amino acids 13-25 of SEQ ID NO: 3; (370) a targeting sequence consisting of amino acids 15-23 of SEQ ID NO: 3; (371) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 97; (372) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 98; (373) a targeting sequence consisting of amino acids 23-36 of SEQ ID NO: 5; (374) a targeting sequence consisting of amino acids 23-34 of SEQ ID NO: 5; (375) a targeting sequence consisting of amino acids 24-36 of SEQ ID NO: 5; (376) a targeting sequence consisting of amino acids 26-34 of SEQ ID NO: 5; (377) a targeting sequence consisting of amino acids 13-26 of SEQ ID NO: 7; (378) a targeting sequence consisting of amino acids 13-24 of SEQ ID NO: 7; (379) a targeting sequence consisting of amino acids 14- 26 of SEQ ID NO: 7; (380) a targeting sequence consisting of amino acids 16-24 of SEQ ID NO: 7; (381) a targeting sequence consisting of amino acids 9-22 of SEQ ID NO: 9; (382) a targeting sequence consisting of amino acids 9-20 of SEQ ID NO: 9; (383) a targeting sequence consisting of amino acids 10-22 of SEQ ID NO: 9; (384) a targeting sequence consisting of amino acids 12-20 of SEQ ID NO: 9; (385) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 105; (386) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO 105; (387) a targeting sequence consisting of amino acids 18-31 of SEQ ID NO: 11; (388) a targeting sequence consisting of amino acids 18-29 of SEQ ID NO: 11; (389) a targeting sequence consisting of amino acids 19-31 of SEQ ID NO: 11; (390) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 98; (391) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 98; (392) a targeting sequence consisting of amino acids 18- 31 of SEQ ID NO: 13; (393) a targeting sequence consisting of amino acids 18-29 of SEQ ID NO: 13; (394) a targeting sequence consisting of amino acids 19-31 of SEQ ID NO: 13; (395) targeting sequence consisting of amino acids 21-29 of SEQ ID NO: 13; (396) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 99; (397) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 99; (398) a targeting sequence consisting of amino acids 28-41 of SEQ ID NO: 15; (399) a targeting sequence consisting of amino acids 28- 39 of SEQ ID NO: 15; (400) a targeting sequence consisting of amino acids 29-41 of SEQ ID NO: 15; (401) a targeting sequence consisting of amino acids 31-39 of SEQ ID NO: 15; (402) targeting sequence consisting of amino acids 12-25 of SEQ ID NO: 17; (403) a targeting sequence consisting of amino acids 13-25 of SEQ ID NO: 17; (404) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 100; (405) a targeting sequence consisting of amino acids 18-31 of SEQ ID NO: 19; (406) a targeting sequence consisting of amino acids 18- 29 of SEQ ID NO: 19; (407) a targeting sequence consisting of amino acids 19-31 of SEQ ID NO: 19; (408) a targeting sequence consisting of amino acids 21-29 of SEQ ID NO: 19; (409) targeting sequence consisting of amino acids 18-31 of SEQ ID NO: 21; (410) a targeting sequence consisting of amino acids 18-29 of SEQ ID NO: 21; (411) a targeting sequence consisting of amino acids 19-31 of SEQ ID NO: 21; (412) a targeting sequence consisting of amino acids 21-29 of SEQ ID NO: 21; (413) a targeting sequence consisting of amino acids 1- 15 of SEQ ID NO: 101; (414) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 101; (415) a targeting sequence consisting of amino acids 9-22 of SEQ ID NO: 23; (416) targeting sequence consisting of amino acids 9-20 of SEQ ID NO: 23; (417) a targeting sequence consisting of amino acids 10-22 of SEQ ID NO: 23; (418) a targeting sequence consisting of amino acids 12-20 of SEQ ID NO: 23; (419) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 102; (420) a targeting sequence consisting of amino acids 1- 13 of SEQ ID NO: 102; (421) a targeting sequence consisting of amino acids 9-22 of SEQ ID NO: 25; (422) a targeting sequence consisting of amino acids 9-20 of SEQ ID NO: 25; (423) a targeting sequence consisting of amino acids 10-22 of SEQ ID NO: 25; (424) a targeting sequence consisting of amino acids 12-20 of SEQ ID NO: 25; (425) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 103; (426) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 103; (427) a targeting sequence consisting of amino acids 15- 28 of SEQ ID NO: 27; (428) a targeting sequence consisting of amino acids 15-26 of SEQ ID NO: 27; (429) a targeting sequence consisting of amino acids 16-28 of SEQ ID NO: 27; (430) a targeting sequence consisting of amino acids 18-26 of SEQ ID NO: 27; (431) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 104; (432) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 104; (433) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 33; (434) a targeting sequence consisting of amino acids 1-11 of SEQ ID NO: 33; (435) a targeting sequence consisting of amino acids 3-11 of SEQ ID NO: 33; (436) a targeting sequence consisting of amino acids 1-14 of SEQ ID NO: 35; (437) a targeting sequence consisting of amino acids 1-12 of SEQ ID NO: 35; (438) a targeting sequence consisting of amino acids 2-14 of SEQ ID NO: 35; (439) a targeting sequence consisting of amino acids 14-27 of SEQ ID NO: 43; (440) a targeting sequence consisting of amino acids 14-25 of SEQ ID NO: 43; (441) a targeting sequence consisting of amino acids 15- 27 of SEQ ID NO: 43; (442) a targeting sequence consisting of amino acids 20-33 of SEQ ID NO: 45; (443) a targeting sequence consisting of amino acids 20-31 of SEQ ID NO: 45; (444) a targeting sequence consisting of amino acids 21-33 of SEQ ID NO: 45; (445) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 106; (446) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 106; (447) a targeting sequence consisting of amino acids 28-41 of SEQ ID NO: 47; (448) a targeting sequence consisting of amino acids 28- 39 of SEQ ID NO: 47; (449) a targeting sequence consisting of amino acids 18-31 of SEQ ID NO: 53; (450) a targeting sequence consisting of amino acids 18-29 of SEQ ID NO: 53; (451) a targeting sequence consisting of amino acids 19-31 of SEQ ID NO: 53; (452) a targeting sequence comprising amino acids 18-31 of SEQ ID NO: 61; (453) a targeting sequence comprising amino acids 18-29 of SEQ ID NO: 61; (454) a targeting sequence comprising amino acids 19-31 of SEQ ID NO: 61; (455) a targeting sequence comprising amino acids 9-22 of SEQ ID NO: 65; (456) a targeting sequence comprising amino acids 9-20 of SEQ ID NO: 65; (457) a targeting sequence comprising amino acids 10-22 of SEQ ID NO: 65; (458) a targeting sequence comprising amino acids 1-15 of SEQ ID NO: 107; (459) a targeting sequence comprising amino acids 1-13 of SEQ ID NO: 107; (460) a targeting sequence comprising amino acids 12-25 of SEQ ID NO: 67; (461) a targeting sequence comprising amino acids 12-23 of SEQ ID NO: 67; (462) a targeting sequence comprising amino acids 13-25 of SEQ ID NO: 67; (463) a targeting sequence comprising amino acids 15-23 of SEQ ID NO: 67; (464) a targeting sequence comprising amino acids 23-36 of SEQ ID NO: 69; (465) a targeting sequence comprising amino acids 23-34 of SEQ ID NO: 69; (466) a targeting sequence comprising amino acids 24-36 of SEQ ID NO: 69; (467) a targeting sequence comprising amino acids 26-34 of SEQ ID NO: 69; (468) a targeting sequence comprising amino acids 27-40 of SEQ ID NO: 75; (469) a targeting sequence comprising amino acids 27-38 of SEQ ID NO: 75; (470) a targeting sequence comprising amino acids 9-22 of SEQ ID NO: 77; (471) a targeting sequence comprising amino acids 9-20 of SEQ ID NO: 77; (472) a targeting sequence comprising amino acids 10-22 of SEQ ID NO: 77; (473) a targeting sequence comprising amino acids 12-20 of SEQ ID NO: 77; (474) a targeting sequence comprising amino acids 23-36 of SEQ ID NO: 81; (475) a targeting sequence comprising amino acids 23-34 of SEQ ID NO: 81; (476) a targeting sequence comprising amino acids 24-36 of SEQ ID NO: 81; (477) a targeting sequence comprising amino acids 26-34 of SEQ ID NO: 81; (478) a targeting sequence comprising amino acids 13-26 of SEQ ID NO: 87; (479) a targeting sequence comprising amino acids 13-24 of SEQ ID NO: 87; or (480) a targeting sequence comprising amino acids 14-26 of SEQ ID NO: 87.

[00181] For example, the targeting sequence can comprise an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.

[00182] For example, the targeting sequence can comprise an amino acid sequence having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%.

[00183] For example, the targeting sequence can comprise an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.

[00184] For example, the targeting sequence can comprise an amino acid sequence having at least about 62% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%.

[00185] For example, the targeting sequence can comprise an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%. [00186] For example, the targeting sequence can comprise an amino acid sequence having at least about 68% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.

[00187] For example, the targeting sequence can comprise an amino acid sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.

[00188] For example, the targeting sequence can comprise an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%.

[00189] For example, the targeting sequence can comprise an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%.

[00190] For example, the targeting sequence can consist of: (a) an amino acid sequence consisting of 16 amino acids and having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%; (b) amino acids 1-35 of SEQ ID NO: 1; (c) amino acids 20-35 of SEQ ID NO: 1; (d) SEQ ID NO: 1; (e) SEQ ID NO: 96; or (f) SEQ ID NO: 120.

[00191] The targeting sequence can consist of the amino acid sequence as described in these examples.

[00192] The fusion protein can comprise an exosporium protein or an exosporium protein fragment comprising an amino acid sequence having at least 90% identity with SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, and 122.

[00193] The fusion protein can comprise an exosporium protein or an exosporium protein fragment comprising an amino acid sequence having at least 95% identity with SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, and 122.

[00194] The fusion protein can comprise an exosporium protein or an exosporium protein fragment comprising an amino acid sequence having at least 98% identity with SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, and 122.

[00195] The fusion protein can comprise an exosporium protein or an exosporium protein fragment comprising an amino acid sequence having at least 99% identity with SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112,

113, 114, 115, 116, 117, 118, 119, 120, 121, and 122.

[00196] The fusion protein can comprise an exosporium protein or an exosporium protein fragment comprising an amino acid sequence having 100% identity with SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 95, 108, 109, 110, 111, 112, 113,

114, 115, 116, 117, 118, 119, 120, 121, and 122.

[00197] The fusion protein can comprise an exosporium protein comprising an amino acid sequence having at least 90% identity with SEQ ID NO: 60, 62, 64, 66, 68, 70, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94 or 122.

[00198] The fusion protein can comprise an exosporium protein comprising an amino acid sequence having at least 95% identity with SEQ ID NO: 60, 62, 64, 66, 68, 70, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94 or 122.

[00199] The fusion protein can comprise an exosporium protein comprising an amino acid sequence having at least 98% identity with SEQ ID NO: 60, 62, 64, 66, 68, 70, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94 or 122.

[00200] The fusion protein can comprise an exosporium protein comprising an amino acid sequence having at least 99% identity with SEQ ID NO: 60, 62, 64, 66, 68, 70, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94 or 122.

[00201] The fusion protein can comprise an exosporium protein comprising an amino acid sequence having 100% identity with SEQ ID NO: 60, 62, 64, 66, 68, 70, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94 or 122.

[00202] The targeting sequence, exosporium protein, or exosporium protein fragment of the fusion protein can comprise the amino acid sequence GXT at its carboxy terminus, wherein X is any amino acid.

[00203] The targeting sequence, exosporium protein, or exosporium protein fragment can comprise an alanine residue at the position of the targeting sequence that corresponds to amino acid 20 of SEQ ID NO: 1. [00204] The targeting sequence, exosporium protein, or exosporium protein fragment can further comprise a methionine, serine, or threonine residue at the amino acid position immediately preceding the first amino acid of the targeting sequence, exosporium protein, or exosporium protein fragment or at the position of the targeting sequence that corresponds to amino acid 20 of SEQ ID NO: 1.

[00205] The protein or peptide of interest in the fusion protein described above can comprise a protein or peptide that protects an animal from a pathogen.

[00206] The protein or peptide of interest in the fusion protein described above can comprise a protein or peptide that protects an aquatic organism from a pathogen.

[00207] The protein or peptide of interest in the fusion protein described above can comprise a protein or peptide that has insecticidal activity against an insect vector of an animal pathogen or larvae of the insect vector.

[00208] The protein or peptide of interest in the fusion protein described above can comprise an antigen or an immunogen.

[00209] Fusion proteins are provided. In any of the fusion proteins, the targeting sequence, exosporium protein, or exosporium protein fragment can be any of the targeting sequences, exosporium proteins, or exosporium protein fragments described herein.

[00210] A fusion protein is provided. The fusion protein comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member and at least one protein or peptide of interest. The protein or peptide of interest can comprise an antibody, an antibody fragment, a histone, a cecropin, a penaeidin, a bactenecin, a callinectin, a myticin, a tachyplesin, a clavanin, amisgurin, a pleurocidin, a parasin, an apyrase, an alginate lyase, a dispersin B, a DNAse, an endochitinase, an exochitinase , a proteinase K, a secreted insecticidal (Sip) protein, a mosquitocidal toxin, a Cry 1 Aa protein, a Cry 1 Ab protein, a Cry 1 Ac protein, a Cry ICa protein, a CrylDa protein, a Cry2Aa protein, a Cry3Aa protein, a Cry3Bb protein, a Cry4Aa protein, a Cry4Ab protein, a Cryl lAa protein, a CytlAa protein, an AiiA, a Bacillus subtilis serine protease, or a combination of any thereof.

[00211] The DNAse can comprise DNAse I.

[00212] The endochitinase can comprise a chitinase C.

[00213] The exochitinase comprises a chitinase D.

[00214] The protein or peptide of interest can comprise an antibody, an antibody fragment, a histone, a cecropin, a penaeidin, a bactenecin, a callinectin, a myticin, a tachyplesin, a clavanin, amisgurin, a pleurocidin, a parasin, an apyrase, an alginate lyase, a dispersin B, a secreted insecticidal (Sip) protein, a mosquitocidal toxin, or a combination of any thereof.

[00215] For example, the protein or peptide of interest can comprise an apyrase.

[00216] Where the enzyme comprises an apyrase, the apyrase can comprise a

Solatium tuberosum apyrase encoded by the Rropl gene. The amino acid sequence for this Solatium tuberosum apyrase is provided by SEQ ID NO: 204.

[00217] Alternatively, where the enzyme comprises an apyrase, the apyrase can comprise a Bacillus subtilis apyrase encoded by the YtkD gene. The amino acid sequence for this Bacillus subtilis apyrase is provided by SEQ ID NO: 205.

[00218] Where the protein or peptide of interest comprises an apyrase, the apyrase can comprise an amino acid having at least 70% sequence identity to SEQ ID NO: 204 or 205.

[00219] The apyrase can comprise an amino acid having at least 75% sequence identity to SEQ ID NO: 204 or 205.

[00220] The apyrase can comprise an amino acid having at least 80% sequence identity to SEQ ID NO: 204or 205.

[00221] The apyrase can comprise an amino acid having at least 85% sequence identity to SEQ ID NO: 204 or 205.

[00222] The apyrase can comprise an amino acid having at least 90% sequence identity to SEQ ID NO: 204 or 205.

[00223] The apyrase can comprise an amino acid having at least 95% sequence identity to SEQ ID NO: 204 or 205.

[00224] The apyrase can comprise an amino acid having at least 98% sequence identity to SEQ ID NO: 204 or 205.

[00225] The apyrase can comprise an amino acid having at least 99% sequence identity to SEQ ID NO: 204 or 205.

[00226] The apyrase can comprise an amino acid having 100%) sequence identity to SEQ ID NO: 204 or 205.

[00227] For example, the apyrase can comprise an amino acid having at least 70% sequence identity to SEQ ID NO: 205.

[00228] The apyrase can comprise an amino acid having at least 75% sequence identity to SEQ ID NO: 205.

[00229] The apyrase can comprise an amino acid having at least 80% sequence identity to SEQ ID NO: 205. [00230] The apyrase can comprise an amino acid having at least 85% sequence identity to SEQ ID NO: 205.

[00231] The apyrase can comprise an amino acid having at least 90% sequence identity to SEQ ID NO: 205.

[00232] The apyrase can comprise an amino acid having at least 95% sequence identity to SEQ ID NO: 205.

[00233] The apyrase can comprise an amino acid having at least 98% sequence identity to SEQ ID NO: 205.

[00234] The apyrase can comprise an amino acid having at least 99% sequence identity to SEQ ID NO: 205.

[00235] The apyrase can comprise an amino acid having 100% sequence identity to SEQ ID NO: 205.

[00236] The protein or peptide of interest can comprise a dispersin B.

[00237] The protein or peptide of interest can comprise an endochitinase, an exochitinase, or a combination thereof.

[00238] For example, the endochitinase can comprise a Bacillus thuringiensis endochitinase having the amino acid sequence provided by SEQ ID NO: 206.

[00239] Where the protein or peptide of interest comprises an endochitinase, the endochitinase can comprise an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 206.

[00240] The endochitinase can comprise an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 206.

[00241] The endochitinase can comprise an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 206.

[00242] The endochitinase can comprise an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 206.

[00243] The endochitinase can comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 206.

[00244] The endochitinase can comprise an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 206.

[00245] The endochitinase can comprise an amino acid sequence having at least 98% sequence identity to SEQ ID NO: 206. [00246] The endochitinase can comprise an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 206.

[00247] The endochitinase can comprise an amino acid sequence having 100% sequence identity to SEQ ID NO: 206.

[00248] The protein or peptide of interest can comprise an AiiA lactonase.

[00249] For example, the AiiA lactonase can comprise a Bacillus thuringiensis B184 AiiA or a Bacillus pseudomycoides B30 AiiA. An amino acid sequence for the Bacillus thuringiensis B184 AiiA is provided by SEQ ID NO: 207. An amino acid sequence for the Bacillus pseudomycoides B30 AiiA is provided by SEQ ID NO: 208.

[00250] Where the protein or peptide of interest comprises an AiiA lactonase, the AiiA lactonase can comprise an amino acid having at least 70% sequence identity to SEQ ID NO: 207 or 208.

[00251] The AiiA lactonase can comprise an amino acid having at least 75% sequence identity to SEQ ID NO: 207 or 208.

[00252] The AiiA lactonase can comprise an amino acid having at least 80% sequence identity to SEQ ID NO: 207or 208.

[00253] The AiiA lactonase can comprise an amino acid having at least 85% sequence identity to SEQ ID NO: 207or 208.

[00254] The AiiA lactonase can comprise an amino acid having at least 90% sequence identity to SEQ ID NO: 207or 208.

[00255] The AiiA lactonase can comprise an amino acid having at least 95% sequence identity to SEQ ID NO: 207or 208.

[00256] The AiiA lactonase can comprise an amino acid having at least 98% sequence identity to SEQ ID NO: 207or 208.

[00257] The AiiA lactonase can comprise an amino acid having at least 99% sequence identity to SEQ ID NO: 207 or 208.

[00258] The AiiA lactonase can comprise an amino acid having 100% sequence identity to SEQ ID NO: 207or 208.

[00259] The protein or peptide of interest can comprise a Bacillus subtilis serine protease. Illustrative amino acid sequences for Bacillus subtilis serine proteases are provided by SEQ ID NOs. 209 and 210. [00260] Where the protein or peptide of interest comprises a Bacillus subtilis serine protease, the serine protease can comprise an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 209.

[00261] The serine protease can comprise an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 209.

[00262] The serine protease can comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 209.

[00263] The serine protease can comprise an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 209.

[00264] The serine protease can comprise an amino acid sequence having at least 98% sequence identity to SEQ ID NO: 209.

[00265] The serine protease can comprise an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 209.

[00266] The serine protease can comprise an amino acid sequence having 100% sequence identity to SEQ ID NO: 209.

[00267] Where the protein or peptide of interest comprises a Bacillus subtilis serine protease, the Bacillus subtilis serine protease can comprise an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 210.

[00268] The serine protease can comprise an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 210.

[00269] The serine protease can comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 210.

[00270] The serine protease can comprise an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 210.

[00271] The serine protease can comprise an amino acid sequence having at least 98% sequence identity to SEQ ID NO: 210.

[00272] The serine protease can comprise an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 210.

[00273] The serine protease can comprise an amino acid sequence having 100% sequence identity to SEQ ID NO: 210.

[00274] The protein or peptide of interest can comprise a mosquitocidal toxin.

[00275] For example, the mosquitocidal toxin can comprise an Mtx-like

mosquitocidal toxin or a Bin-like mosquitocidal toxin. [00276] The Mtx-like mosquitocidal toxin can comprise Mtxl .

[00277] For example, the Mtxl can comprise a Bacillus sphaericus Mtxl . An amino acid sequence for a Bacillus sphaericus Mtxl is provided by SEQ ID NO: 211.

[00278] Where the protein or peptide of interest comprises Mtxl, the Mtxl can comprise an amino acid sequence having at least 70% identity to SEQ ID NO: 211.

[00279] The Mtxl can comprise an amino acid sequence having at least 75% identity to SEQ ID NO: 211.

[00280] The Mtxl can comprise an amino acid sequence having at least 80% identity to SEQ ID NO: 211.

[00281] The Mtxl can comprise an amino acid sequence having at least 85% identity to SEQ ID NO: 211.

[00282] The Mtxl can comprise an amino acid sequence having at least 90% identity to SEQ ID NO: 211.

[00283] The Mtxl can comprise an amino acid sequence having at least 95% identity to SEQ ID NO: 211.

[00284] The Mtxl can comprise an amino acid sequence having at least 98% identity to SEQ ID NO: 211.

[00285] The Mtxl can comprise an amino acid sequence having at least 99% identity to SEQ ID NO: 211.

[00286] The Mtxl can comprise an amino acid sequence havingl00% identity to SEQ ID NO: 211.

[00287] Another fusion protein is provided. The fusion protein comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member and a LfcinB. The LfcinB comprises an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 212.

[00288] For example, the LfcinB can comprise an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 212.

[00289] The LfcinB can comprise an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 212.

[00290] The LfcinB can comprise an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 212.

[00291] The LfcinB can comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 212. [00292] The LfcinB can comprise an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 212.

[00293] The LfcinB can comprise an amino acid sequence having at least 98% sequence identity to SEQ ID NO: 212.

[00294] The LfcinB can comprise an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 212.

[00295] The LfcinB can comprise an amino acid sequence having 100% sequence identity to SEQ ID NO: 212.

[00296] Yet another fusion protein is provided. The fusion protein comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member and a LysM. The LysM comprises an amino acid sequence having at least 70% identity to SEQ ID NO: 213.

[00297] For example, the LysM can comprise an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 213.

[00298] The LysM can comprise an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 213.

[00299] The LysM can comprise an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 213.

[00300] The LysM can comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 213.

[00301] The LysM can comprise an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 213.

[00302] The LysM can comprise an amino acid sequence having at least 98% sequence identity to SEQ ID NO: 213.

[00303] The LysM can comprise an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 213.

[00304] The LysM can comprise an amino acid sequence having 100% sequence identity to SEQ ID NO: 213.

[00305] Another fusion protein is provided. The fusion protein comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member and a P-l,3-glucanase. The β- 1,3-glucanase comprises an amino acid sequence having at least 70% identity to SEQ ID NO: 214 or 216. [00306] For example, the P-l,3-glucanase can comprise an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 214 or 216.

[00307] The P-l,3-glucanase can comprise an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 214 or 216.

[00308] The P-l,3-glucanase can comprise an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 214 or 216.

[00309] The P-l,3-glucanase can comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 214 or 216.

[00310] The P-l,3-glucanase can comprise an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 214 or 216.

[00311] The P-l,3-glucanase can comprise an amino acid sequence having at least 98% sequence identity to SEQ ID NO: 214 or 216.

[00312] The P-l,3-glucanase can comprise an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 214 or 216.

[00313] The P-l,3-glucanase can comprise an amino acid sequence having 100% sequence identity to SEQ ID NO: 214 or 216.

[00314] A further fusion protein is provided. The fusion protein comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member and a Cry21A protein. The Cry21A protein comprises an amino acid sequence having at least 70% sequence identity to SEQ ID NO: 215.

[00315] For example, the Cry21A protein can comprise an amino acid sequence having at least 75% sequence identity to SEQ ID NO: 215.

[00316] The Cry21 A protein can comprise an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 215.

[00317] The Cry21 A protein can comprise an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 215.

[00318] The Cry21 A protein can comprise an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 215.

[00319] The Cry21 A protein can comprise an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 215.

[00320] The Cry21 A protein can comprise an amino acid sequence having at least 98% sequence identity to SEQ ID NO: 215. [00321] The Cry21 A protein can comprise an amino acid sequence having at least 99% sequence identity to SEQ ID NO: 215.

[00322] The Cry21A protein can comprise an amino acid sequence having 100% sequence identity to SEQ ID NO: 215.

C. Methods for Making the Fusion Proteins

[00323] Any of the fusion proteins described herein can be made using standard cloning and molecular biology methods known in the art. For example, a gene encoding a protein or peptide of interest (e.g., a gene encoding a protein or peptide that protects an animal from a pathogen) can be amplified by polymerase chain reaction (PCR) and ligated to DNA coding for any of the above-described targeting sequences, exosporium proteins, or exosporium protein fragments, to form a DNA molecule that encodes the fusion protein. The DNA molecule encoding the fusion protein can be cloned into any suitable vector, for example a plasmid vector. The vector suitably comprises a multiple cloning site into which the DNA molecule encoding the fusion protein can be easily inserted. The vector also suitably contains a selectable marker, such as an antibiotic resistance gene, such that bacteria transformed, transfected, or mated with the vector can be readily identified and isolated. Where the vector is a plasmid, the plasmid suitably also comprises an origin of replication. Alternatively, DNA coding for the fusion protein can be integrated into the chromosomal DNA of the B. cereus family member or spore- forming bacterium host.

D. Tags, Markers, and Linkers that Can be Included in the Fusion Proteins

[00324] Any of the fusion proteins described herein can also comprise additional polypeptide sequences that are not part of the targeting sequence, exosporium protein, exosporium protein fragment, or the protein or peptide of interest. For example, the fusion protein can include tags or markers to facilitate purification or visualization of the fusion protein (e.g., a polyhistidine tag or a fluorescent protein such as GFP or YFP) or visualization of recombinant Bacillus cereus family member spores expressing the fusion protein.

[00325] Expression of fusion proteins on the exosporium of a Bacillus cereus family member using the targeting sequences, exosporium proteins, and exosporium protein fragments described herein is enhanced due to a lack of secondary structure in the amino-termini of these sequences, which allows for native folding of the fused proteins and retention of activity. Proper folding can be further enhanced by the inclusion of a short amino acid linker between the targeting sequence, exosporium protein, exosporium protein fragment, spore coat protein, and the protein or peptide of interest.

[00326] Thus, any of the fusion proteins described herein can comprise an amino acid linker between the targeting sequence, the exosporium protein, or the exosporium protein fragment and the protein or peptide of interest.

[00327] The linker can comprise a polyalanine linker or a polyglycine linker. A linker comprising a mixture of both alanine and glycine residues can also be used.

[00328] For example, in a fusion protein where the targeting sequence comprises SEQ ID NO: 1, a fusion protein can have one of the following structures:

No linker: SEQ ID NO: 1 - POI

Alanine Linker: SEQ ID NO: l-A _n -POI

Glycine Linker: SEQ ID NO: l-G _n -POI

Mixed Alanine and Glycine Linker: SEQ ID NO: 1 - (A/G) _n - POI

where A _n , G _n , and (A/G) _n are any number of alanines, any number of glycines, or any number of a mixture of alanines and glycines, respectively. For example, n can be 1 to 25, and is preferably 6 to 10. Where the linker comprises a mixture of alanine and glycine residues, any combination of glycine and alanine residues can be used. In the above structures, "POI" represents the protein or peptide of interest.

[00329] Alternatively or in addition, the linker can comprise a protease recognition site. Inclusion of a protease recognition site allows for targeted removal, upon exposure to a protease that recognizes the protease recognition site, of the protein or peptide of interest.

E. Recombinant Bacillus cereus family members hosts for expression of the fusion proteins

[00330] A recombinant Bacillus cereus family member that expresses a fusion protein is provided. The fusion protein can be any of the fusion proteins described above in Section LB.

[00331] Exosporium fragments derived from spores of the recombinant Bacillus cereus family members are also provided. The exosporium fragments can comprise any of the fusion proteins described above in Section LB. Mutations that allow for collection of exosporium fragments and methods for preparation of exosporium fragments are described below in Section III.

[00332] In addition, the compositions, methods, and products of the present invention involve the use of spores of recombinant Bacillus cereus family members that express a fusion protein, or exosporium fragments derived from such spores that comprise a fusion protein. The fusion protein can be any of the fusion proteins described herein.

[00333] Any Bacillus cereus family member can serve as a host for expression of fusion proteins comprising a targeting sequence, an exosporium protein, or an exosporium protein fragment that targets the fusion protein to the exosporium of the Bacillus cereus family member.

[00334] The recombinant Bacillus cereus family member can comprise any Bacillus species that is capable of producing an exosporium. For example, the recombinant Bacillus cereus family member can comprise Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, Bacillus toyoiensis, or a combination thereof. In particular, the recombinant Bacillus cereus family member can comprise Bacillus thuringiensis or Bacillus mycoides.

[00335] The recombinant Bacillus cereus family member can coexpress two or more of any of the fusion proteins discussed above. For example, the recombinant Bacillus cereus family member can coexpress two or more fusion proteins comprising proteins or peptides that protect an animal from a pathogen. The two or more proteins that protect an animal from a pathogen can protect the animal from the same pathogen. Alternatively, the two or more proteins that protect an animal from a pathogen can protect the animal from two different pathogens. For example, a recombinant Bacillus cereus family member could express a first fusion protein comprising an antibacterial protein or peptide and a second fusion protein comprising an antifungal protein or peptide.

[00336] To generate a recombinant Bacillus cereus family member expressing a fusion protein, any Bacillus cereus family member can be conjugated, transduced, or

transformed with a vector encoding the fusion protein using standard methods known in the art (e.g., by electroporation). The bacteria can then be screened to identify transformants by any method known in the art. For example, where the vector includes an antibiotic resistance gene, the bacteria can be screened for antibiotic resistance. Alternatively, DNA encoding the fusion protein can be integrated into the chromosomal DNA of a B. cereus family member host. The recombinant Bacillus cereus family member can then exposed to conditions which will induce sporulation. Suitable conditions for inducing sporulation are known in the art. For example, the recombinant Bacillus cereus family member can be plated onto agar plates, and incubated at a temperature of about 30°C for several days (e.g., 3 days). [00337] Inactivated strains, non-toxic strains, or genetically manipulated strains of any of the above species can also suitably be used. For example, a Bacillus thuringiensis that lacks the Cry toxin can be used. Alternatively or in addition, once the recombinant B. cereus family member spores expressing the fusion protein have been generated, they can be inactivated to prevent further germination once in use. Any method for inactivating bacterial spores that is known in the art can be used. Suitable methods include, without limitation, heat treatment, gamma irradiation, x-ray irradiation, UV-A irradiation, UV-B irradiation, chemical treatment (e.g., treatment with gluteraldehyde, formaldehyde, hydrogen peroxide, acetic acid, bleach, or any combination thereof), or a combination thereof. Alternatively, spores derived from nontoxigenic strains, or genetically or physically inactivated strains, can be used.

[00338] Many Bacillus cereus family member strains have inherent attributes that would be of benefit in the methods described herein. For example, some strains have

insecticidal, fungicidal, nematicidal, or bacteriocidal compounds. Thus, the recombinant Bacillus cereus family member that expresses the fusion protein can comprise a strain of bacteria that produces an insecticidal toxin (e.g., a Cry toxin), produces a fungicidal compound (e.g., a P-l,3-glucanase, a chitosanase, a lyticase, or a combination thereof), produces a nematocidal compound (e.g., a Cry toxin), or produces a bacteriocidal compound, is resistant to one or more antibiotics, or comprises one or more freely replicating plasmids.

[00339] The recombinant Bacillus cereus family member can comprise an inactivating mutation in its BclA gene, its CotE gene, or its CotO gene (e.g., a knock-out of the BclA gene, CotE gene, or CotO gene). For example, the recombinant Bacillus cereus family member can comprise an inactivating mutation in its BclA gene (e.g., a knock-out of the BclA gene). It has been found that expression of fusion proteins in a recombinant Bacillus cereus family member having such a mutation results in increased expression levels of the fusion protein.

F. Proteins and Peptides of Interest

[00340] Proteins or peptides of interest that can be included in the fusion proteins are described further hereinbelow in connection with each of the methods, compositions, and related products. The protein or peptide of interest can comprise: (a) a protein or peptide that protects an animal from a pathogen; (b) a protein or peptide that protects an aquatic organism from a pathogen; (c) a protein or peptide that has insecticidal activity against an insect vector of an animal pathogen or larvae of the insect vector; or (d) or an antigen or immunogen. II. Promoters for Expression of Fusion Proteins in Recombinant Bacillus cereus Family Members

[00341] The DNA encoding the fusion proteins used in the recombinant Bacillus cereus family members, compositions, methods, adhesive patches, wound dressings, insert trays, hoof bandages, feed, feed additives, and insect foggers described herein is suitably under the control of a sporulation promoter which will cause expression of the fusion protein on the exosporium of a B. cereus family member endospore (e.g., a native bclA promoter from a B. cereus family member).

[00342] Thus, any of the fusion proteins described above in Section LB can be expressed in the recombinant Bacillus cereus family member under the control of a sporulation promoter that is native to the targeting sequence, exosporium protein, or exosporium protein fragment of the fusion protein, or a portion of such a promoter.

[00343] Any of the fusion proteins s can be expressed under the control of a high- expression sporulation promoter.

[00344] The high-expression sporulation promoter can comprise a sigma-K

sporulation-specific polymerase promoter sequence.

[00345] For ease of reference, exemplary nucleotide sequences for promoters that can be used to express any of the fusion proteins in a recombinant Bacillus cereus family member are provided in Table 2 below, together with their SEQ ID NOs. Table 2 also provides exemplary minimal promoter sequences for many of the promoters. In Table 2, sigma-K sporulation-specific polymerase promoter sequences in the promoters are indicated by bold and underlined text. Several of the sequences have multiple sigma K sequences that overlap with one another. The overlaps are indicated by double underlining in the table. The promoter sequences are immediately upstream of the start codon for each of the indicated genes. In other words, in the sequences shown in Table 2 below, the last nucleotide of the promoter sequence immediately precedes the first nucleotide of the start codon for the coding region of the gene encoding the indicated protein. Table 2. Promoter Sequences for Expression of Fusion Proteins in Recombinant Bacillus cereus family members

Promoter Promoter Sequence

(SEQ ID NO)

ExsY promoter TTTCTTAATCCTTTACCCTTTACTTTTGTAAAAGTTGATACACTT (B. cereus F837776) CCATCCGGCTCTGTAATTTCTAATTCATCAATAAATGGTCTTCG

CAAAAAGCCTGTAATTTTATCATAAACAATTAAACGAGTGAGC

(SEQ ID NO: 37) CTAAAAGCAGCTAACGCGAAAATAAAAAATAAAAGCCAGCTT

GTAAACAGCATAATTCCACCTTCCCTTATCCTCTTTCGCCTATT

TAAAAAAAGGTCTTGAGATTGTGACCAAATCTCCTCAACTCCA

ATATCTTATTAATGTAAATACAAACAAGAAGATAAGGA

ExsY minimal promoter ACCAAATCTCCTCAACTCCAATATCTTATTAATGTAAATACAA (B. cereus F837776) ACAAGAAGATAAGGA

(SEQ ID NO: 38)

ExsFA/BxpB promoter ACCACCTACCGACGATCCAATCTGTACATTCCTAGCTGTACCA (B. anthracis Sterne) AATGCAAGATTAATATCGACTAACACTTGTCTTACTGTTGATTT (SEQ ID NO: 39) AAGTTGCTTCTGTGCGATTCAATGCTTGCGTGATGTTACGATTT

AAAACTAAATAATGAGCTAAGCATGGATTGGGTGGCAGAATT

ATCTGCCACCCAATCCATGCTTAACGAGTATTATTATGTAAATT

TCTTAAAATTGGGAACTTGTCTAGAACATAGAACCTGTCCTTTT

CATTAACTGAAAGTAGAAACAGATAAAGGAGTGAAAAAC

ExsFA/BxpB minimal ACATAGAACCTGTCCTTTTCATTAACTGAAAGTAGAAACAGAT promoter (B. anthracis AAAGGAGTGAAAAAC

Sterne)

(SEQ ID NO: 40)

CotY/CotZ promoter (B. TAGAAGAAGAACGCCGACTACTTTATGTCGCAATTACACGGGC anthracis Sterne)

AAAAAATTAGATATATCTCGTTTTTTATACACTGTGCGAAAAG

(SEQ ID NO: 41) ATTTACCTGAAAAGACATCCACTAAATAAGGATGTCTTTTTTTA

TATTGTATTATGTACATCCCTACTATATAAATTCCCTGCTTTTAT

CGTAAGAATTAACGTAATATCAACCATATCCCGTTCATATTGT

AGTAGTGTATGTCAGAACTCACGAGAAGGAGTGAACATA

CotY/CotZ minimal TCAACCATATCCCGTTCATATTGTAGTAGTGTATGTCAGAACT promoter (B. anthracis CACGAGAAGGAGTGAACATA

Sterne)

(SEQ ID NO: 42)

CotO promoter (B. cereus) TAACTCAATCTTAAGAGAAATTGAGGAGCGCGCACCACTTCGT (SEQ ID NO: 123) CGTACAACAACGCAAGAAGAAGTTGGGGATACAGCAGTATTCT

TATTCAGTGATTTAGCACGCGGCGTAACAGGAGAAAACATTCA

CGTTGATTCAGGGTATCATATCTTAGGATAAATATAATATTAA

TTTTAAAGGACAATCTCTACATGTTGAGATTGTCCTTTTTATTT

GTTCTTAGAAAGAACGATTTTTAACGAAAGTTCTTACCACGTTA

TGAATATAAGTATAATAGTACACGATTTATTCAGCTACGT

CotO minimal promoter (B. ACGTTGATTCAGGGTATCATATCTTAGGATAAATATAATATTA cereus) ATTTTAAAGGACAATCTCTACATGTTGAGATTGTCCTTTTTATT

(SEQ ID NO: 124) TGTTCTTAGAAAGAACGATTTTTAACGAAAGTTCTTACCACGTT

ATGAATATAAGTATAATAGTACACGATTTATTCAGCTACGT Promoter Promoter Sequence

(SEQ ID NO)

ExsH minimal promoter (B. AATATGTGAGTCATGAACATAATTAAATAATGTTTTCAAGTTT cereus F837/76) AATTATCGTTCATGTTTCCTATTTTAAGCAGAACAAATAACTCA

ATTACTTTTTTCGATTGGATCTTTTTTAACTCTTATAATAGGAA

(SEQ ID NO: 134) AACACTCAACTATAAAAATAAGTAAGGAGGAAATAA

YjcA promoter TATAAAATAAAAGGGCGTGTATTTGCTACTGATGCAGTATTGT (B. thuringiensis serovar GTGCGCCTAAAAATGGAATTTCACAACCAGATCCACATGTTGT kurstaki str. HD73) TGTAGAACAATCTTGTAATTCATTGATGAATTTTACAACGTCAA (SEQ ID NO: 135) CTACACAATGAGAAGAGCCATGGTGTTTATTTTCGTTACAACTC

ATTAATGTCACTCCTTATCTTCTTGTTTGTATTTACATTAATAA

GATATTGGAGTTGAGGAGATTTGGTCACAATCTCAAGACCTTT

TTTTTAAATAGGCGAAAGAGGATAAGGGAAGGTGGAATT

YjcA minimal promoter TCTTGTTTGTATTTACATTAATAAGATATTGGAGTTGAGGAGAT (B. thuringiensis serovar TTGGTCACAATCTCAAGACCTTTTTTTTAAATAGGCGAAAGAG kurstaki str. HD73) GATAAGGGAAGGTGGAATT

(SEQ ID NO: 136)

YjcB promoter ATCAACTTTTACAAAAGTAAAGGGTAAAGGATTAAGAAAGTG (B. thuringiensis serovar GATTGGCGAATTATTAAGCTGTTATTGGTGTACAGGTGTATGG kurstaki str. HD73) GTTAGTGCTTTTTTATTAGTTTTATATAATTGGATTCCGATCGTT (SEQ ID NO: 137) GCAGAGCCGTTACTTGCATTATTAGCTATTGCAGGAGCAGCAG

CAATCATTGAAACGATTACAGGATATTTTATGGGAGAATAAT

ATATTTTCATAATACGAGAAAAAGCGGAGTTTAAAAGAATGAG

GGAACGGAAATAAAGAGTTGTTCATATAGTAAATAGACAGAA

YjcB minimal promoter ACGGAAATAAAGAGTTGTTCATATAGTAAATAGACAGAA (B. thuringiensis serovar

kurstaki str. HD73)

(SEQ ID NO: 138)

BclC promoter TGAAGTATCTAGAGCTAATTTACGCAAAGGAATCTCAGGACAA

(B. anthracis Sterne) CACTTTCGCAACACCTATATTTTAAATTTAATAAAAAAAGAGA

(SEQ ID NO: 139) CTCCGGAGTCAGAAATTATAAAGCTAGCTGGGTTCAAATCAAA

AATTTCACTAAAACGATATTATCAATACGCAGAAAATGGAAAA

AACGCCTTATCATAAGGCGTTTTTTCCATTTTTTCTTCAAACAA

ACGATTTTACTATGACCATTTAACTAATTTTTGCATCTACTATG

ATGAGTTTCATTCACATTCTCATTAGAAAGGAGAGATTTA

BclC minimal promoter ACCATTTAACTAATTTTTGCATCTACTATGATGAGTTTCATTCA (B. anthracis Sterne) CATTCTCATTAGAAAGGAGAGATTTA

(SEQ ID NO: 140)

AcpC promoter (B. cereus GACTATGTTTATTCAGGATAAAATATAGCACTACACTCTCTCCT F837/76) CTTATTATGTAGCATCTCTCTAATCCATCATTTGTTTCATTTAGT

(SEQ ID NO: 141) TAAAATTGTAAATAAAATCACATGATTTGTCAATTATAATTGTC

ATTTCGACAATTAAACTTGTCAAAATAATTCTCATCATTTTTTC

TCATCTTTCTAATATAGGACATACTACTATATATACAAAAGAC

AATATGCAAATGTTCATACAAAAAATATTATTTTTCGATATAT

AATATTAACTGATTTTCTAACATCAAGGAGGGTACAT

AcpC minimal promoter (B. AGACAATATGCAAATGTTCATACAAAAAATATTATTTTTCGAT cereus F837/76) ATATAATATTAACTGATTTTCTAACATCAAGGAGGGTACAT (SEQ ID NO: 142) Promoter Promoter Sequence

(SEQ ID NO)

InhA3 promoter (B. ATAGTGAGTAATATGGTAATCCATAGATTAAATAGTATAGAA thuringiensis serovar AATATTTAATTCTTATTTTTATTAAAAAAGCATGAATCCCAGAT kurstaki str. HD73) TTACTGGGTTTTGATTGTAACTAAGAACATATAAAAGTTCACT (SEQ ID NO: 143) GTTATTTATAGGAGAGTCTGTTTGTTTTTATATCTTATGTATTT

CACCCTGCATAAAAAAATATTTCTCAACATTTTATTTGTTGAAA

AATATTGAATATTCGTATTATAACGAATATTATGTTGTTATCGG

CAAAAAACGATAATTTGCAGACACTGGGGAGGAAATACA

InhA3 minimal promoter (B. TCTTATGTATTTCACCCTGCATAAAAAAATATTTCTCAACATTT thuringiensis serovar TATTTGTTGAAAAATATTGAATATTCGTATTATAACGAATATTA kurstaki str. HD73) TGTTGTTATCGGCAAAAAACGATAATTTGCAGACACTGGGGAG (SEQ ID NO: 144) GAAATACA

Alanine racemase 1 promoter CTTCGTCAGCAATAAGTGTGAGCGGAGAATTGGTTGATCTTGG (B. cereus F837/76) CTTTACAATTGGAGCATTGACGAAAGACTCTTTAACGTGGTCG (SEQ ID NO: 145) CATAACGGAGTAGAATATATGCTCGTGTCTAAAGGTTTAGAGC

CGAAGGAGCTATTAATGGTTGCTCGTTCAGTTACAGAGAAGCA

AGTGAAGTAAACTTCTTAGACGTGGTGATATATGTGCACCACG

TCTTTTCTTAGTTTGAAGGGTGGATTTCATAAAAGAAGCATAT

AAAAGAATAAGCTTCGCATATCGTGTATAAGGAAGTGTATTT

Alanine racemase 1 minimal ATAAAAGAATAAGCTTCGCATATCGTGTATAAGGAAGTGTAT promoter (B. cereus F ^' 837/7 ^' 6) TT

(SEQ ID NO: 146)

Alanine racemase 2 promoter CATTTCAAATAATGAACGCTTCGATTGAATCGGAGCTATTTTCA (B. thuringiensis serovar AATCAATTTCAGTATATTGATCCAGCATTTGAATAGAAGTATC kurstaki str. HD73) AACAGCAACTTTAAGTTGATGCAATGCAGATTGTACAAACATT (SEQ ID NO: 147) GTAATTCTCCTCTTCTCCGTATATAATAGTTTCTTGAGGGTATT

ATATCATGCTCAAAATTCCGAAAATTCTAGTAGTTTGACTAGC

ATATTGAAAAGTATTATATTGTAAAAGGTCATATGAAACGTG

AAATAGAATGGAATGCAATTATTGAGTTAGGAGTTAGACCA

Alanine racemase 2 minimal TTATATTGTAAAAGGTCATATGAAACGTGAAATAGAATGGAA promoter (B. thuringiensis TGCAATTATTGAGTTAGGAGTTAGACCA

serovar kurstaki str. HD73)

(SEQ ID NO: 148)

BclA promoter (B. cereus ATCGATGGAACCTGTATCAACCACTATAATTTCATCCACAATTT F837/76) TTTCAACTGAGTCTAAACAACGGGCTATTGTCTTCTCCTCATCT

CGAACAATCATACATAAACTAATTGTAATTCCTTGCTTGTTCA

(SEQ ID NO: 149) ACATAATCACCCTCTTCCAAATCAATCATATGTTATACATATA

CTTTTCAATAATTCAAATGTCCGTGTCATTTTCTTTCGGTTTTGC ATCTACTATATAATGAACGCTTTATGGAGGTGAATTT

BclA minimal promoter (B. AATCAATCATATGTTATACATATACTAAACTTTCCATTTTTTT cereus F837/76) AAATTGTTCAAGTAGTTTAAGATTTCTTTTCAATAATTCAAATG

TCCGTGTCATTTTCTTTCGGTTTTGCATCTACTATATAATGAAC

(SEQ ID NO: 150) GCTTTATGGAGGTGAATTT

BclB promoter (B. GACCTGTAAGTCTGTAGGGAAGAATAATTTCAAGAGCCAGTGA thuringiensis serovar

CCTCATCTTTTAATTAGAACGTAACCAATTTAGTATTTTGAAA

konkukian str. 97-27) TAGAGCTATCATTTTATAATATGAATACTACTAGTTATAGAAA (SEQ ID NO: 151) CGGCAAAAAGTTTAATATATGTAAAAATCATTTGGATATGAAA

AAAGTAGCCATAGATTTTTTCGAAATGATAAATGTTTTATTTT

GTTAATTAGGAAACAAAAATGTGGAATGAGGGGGATTTAA Promoter Promoter Sequence

(SEQ ID NO)

BclB minimal promoter (B. ATATGAAAAAAGTAGCCATAGATTTTTTCGAAATGATAAATGT thuringiensis serovar TTTATTTTGTTAATTAGGAAACAAAAATGTGGAATGAGGGGGA

TTTAA

konkukian str. 97-27)

(SEQ ID NO: 152)

BxpA promoter (B. anthracis TTTTCATCTGCTACATCGTGAAGTAATGCTGCCATTTCAATTAT str. Sterne) AAAACGATTTCCTCCTTCTTGCTCGGATAAAGAAATCGCCAGTT

TATGTACACGCTCAATATGATACCAATCATGCCCACTGGCATC

(SEQ ID NO: 153) TTTTTCTAAAATATGTTTTACAAAAGTAATTGTTTTTTCTATCTT

TTCTTGTTTTGTCATTTTATCTTCACCCAGTTACTTATTGTAACA

CGCCCGCATTTTTTCATCACAIATTTTCTTGTCCGCCCATACA

CTAGGTGGTAGGCATCATCATGAAGGAGGAATAGAT

BxpA minimal promoter (B. ACATATTTTCTTGTCCGCCCATACACTAGGTGGTAGGCATCAT anthracis str. Sterne) CATGAAGGAGGAATAGAT

(SEQ ID NO: 154)

BclE promoter (B. anthracis GGTGACGACAACATATACAAGAGGCACTCCTGCTGGTACTGTA ASterne) ACAGGAACAAATATGGGGCAAAGTGTAAATACATCGGGTATA

GCACAAGCTGTCCCGAATACAGATAATATGGATTCAACGGCG

(SEQ ID NO: 155) GGACTCCCTTAAGAAATTAGGGGAGTCTTTATTTGGAAAAAGA

GCTTATGTTACATAAAAACAGGAGTAATTGTTTTAAAAGTAGT

ATTGGTGACGTTGTTAGAAAATACAATTTAAGTAGAAGGTGCG

TTTTTATATGAAATATATTTTATAGCTGTACTTTACCTTTCAAG

BclE minimal promoter (B. ACAAGCTGTCCCGAATACAGATAATATGGATTCAACGGCGGG anthracis ASterne) ACTCCCTTAAGAAATTAGGGGAGTCTTTATTTGGAAAAAGAGC

TTATGTTACATAAAAACAGGAGTAATTGTTTTAAAAGTAGTAT

(SEQ ID NO: 156) TGGTGACGTTGTTAGAAAATACAATTTAAGTAGAAGGTGCGTT

TTTATATGAAATATATTTTATAGCTGTACTTTACCTTTCAAG

Bet A promoter

(B. anthracis Sterne) AAAAAGCACCTCTCATTAATTTATATTATAGTCATTGAAATCTA

ATTTAATGAAATCATCATACTATATGTTTTATAAGAAGTAAAG

(SEQ ID NO: 157) GTACCATACTTAATTAATACATATCTATACACTTCAATATCAC

AGCATGCAGTTGAATTATATCCAACTTTCATTTCAAATTAAATA

AGTGCCTCCGCTATTGTGAATGTCATTTACTCTCCCTACTACAT

TTAATAATTATGACAAGCAATCATAGGAGGTTACTAC

BetA minimal promoter TAAGAAGTAAAGGTACCATACTTAATTAATACATATCTATACA (B. anthracis Sterne) CTTCAATATCACAGCATGCAGTTGAATTATATCCAACTTTCATT

TCAAATTAAATAAGTGCCTCCGCTATTGTGAATGTCATTTACTC

(SEQ ID NO: 158) TCCCTACTACATTTAATAATTATGACAAGCAATCATAGGAGGT

TACTAC

CotE promoter (B. cereus AGTTGTACAAGAATTTAAATCTTCACAAACATATGTAAATGAC AH820) TTACTACAGCTAGTTGCAAGTACGATTTCTAACAACGTAACAG

ATGAAATATTAATTTCAACTAATGGCGATGTATTGAAGGGTGA

(SEQ ID NO: 159) AACGGGCGCAGCGGTAGAAAGTAAAAAAGGAAATTGTGGTTG

TTAAAGAGATGTCGAAATGACATCTCTTTTTTTAGTGGATTAAA

CGTAAGTTCTTCTCAAAAAAAGAATGACACATTCCGCTATTGT

CACGCATATGATTAAGTGAATAGTGATTGAGGAGGGTTACGA

CotE minimal promoter (B. ACATTCCGCTATTGTCACGCATATGATTAAGTGAATAGTGATT cereus AH820) GAGGAGGGTTACGA

(SEQ ID NO: 160) Promoter Promoter Sequence

(SEQ ID NO)

ExsA promoter (B. cereus AACGTTATTAGCGTAGACAAACAAGTAACGGCAGAAGCAGTTC strain ATCC 10876) TTGCATTAAATCGTATGTTAGAGCGTGTGTAAAGCAACGGTAT (SEQ ID NO: 161) TCCCGTTGCTTTTTTTCATACATATAATCATAACGAGAACGAA

ATGGGCATACATTGTTTTGAAGAAATCATTGTGGTTCTTTATG

CTTATTCCACTTCGAATGATATTGAAAATCGAAGAAGTGATAA

AAGTAAAAAGAAGTTAATGTTATTTAGAAAGAGTTACTTCATG

AGATTTGTTACTTATAGATAAGTTATACAGGAGGGGGAAAAT

ExsA minimal promoter (B. TCATGAGATTTGTTACTTATAGATAAGTTATACAGGAGGGGGA cereus strain ATCC 10876) AAAT

(SEQ ID NO: 162)

ExsK promoter (B. AAGCCGCGGTCAATGCTGTATATGCAAATAAGATTGCAGCTTT thuringiensis serovar ACCTGAAGAAGAGCGTGATAGCTTCATTGCTGAAAAACGAGA konkukian str. 97-27) AGAGTATAAGAAAGATATTGATATTTACCATTTAGCATCAGAG (SEQ ID NO: 163) ATGGTCATTGATGGTATTGTTCATCCAAACAATTTAAGAGAAG

AGTTAAAAGGACGATTCGAAATGTATATGAGTAAATATCAAGT

ATTTACGGATCGTAAACATCCTGTTTATCCAGTTTAAAAGCCC

TATTTAGGGCTTTCTTGCTCAAAAAGTTAAGGAGGGGAAAACA

ExsK minimal promoter (B. TCAAGTATTTACGGATCGTAAACATCCTGTTTATCCAGTTTAA thuringiensis serovar AAGCCCTATTTAGGGCTTTCTTGCTCAAAAAGTTAAGGAGGGG konkukian str. 97-27) AAAACA

(SEQ ID NO: 164)

ExsB promoter (B. cereus AGGATTTCAGTGGGACGCCTCCTCTCTTCTTACATTAAATTAAT F837/76) CATACTATAAAATGAAAGAAATGAAATGAAAAATAGCGGAAA

(SEQ ID NO: 165) AATCAGA AATTTTTTCTGGTAGTATACAATATGTTACAATAAG

CTTTGTCAATGAAAGAAGGAATTCCGTGCAATGCACGGGAGAG

GTTCGCGAACTCCCTCTATAAAAAACTATGGAAACAACAATAT

CTTTAGGTATTGTTTTGTTTTTTTATTGTGACAGTTCAAGAACG

TTCTTTCTTCTTATTCGTAGTAGAGAAGGAGAATGAGTGAA

ExsB minimal promoter (B. ACTATGGAAACAACAATATCTTTAGGTATTGTTTTGTTTTTTTA cereus F837/76) TTGTGACAGTTCAAGAACGTTCTTTCTTCTTATTCGTAGTAGAG (SEQ ID NO: 166) AAGGAGAATGAGTGAA

YabG promoter (B. cereus TTTTGCACAACGCCGTAAAACTTTAATGAATAATTTATCAAAT AH820) AATTTAAATGGTTTCCCGAAAGATAAAGAGCTGTTGGATCGAA

(SEQ ID NO: 167) TTTTAACAGAAGTAGGAATTGATCCAAAACGAAGAGGCGAAA

CGCTATCTATCGAAGAGTTTGCGACATTAAGTAATGCATTAGTT

CTTCATAAGTTATCATAAGAATACAAAAGGGACAGTTCAATTT

GAACTGTCCCTTTTGTCACCTTTCTCCTCCTAAATTCATACTTT

AAAAACAGGTAAGATGGCCTAACGAGTTTGGAGGTAGGAGA

YabG minimal promoter (B. TCTCCTCCTAAATTCATACTTTAAAAACAGGTAAGATGGCCTA cereus AH820) ACGAGTTTGGAGGTAGGAGA

(SEQ ID NO: 168)

Tgl promoter (B. GGAAACAGAAGTCATCCCATTTGAAAATGCAGCAGGTCGTATT thuringiensis serovar ATAGCTGATTTCGTTATGGTTTATCCGCCAGGGATTCCAATCTT konkukian str. 97-27) TACTCCGGGGGAAATTATTACACAAGACAACTTAGAGTATATT (SEQ ID NO: 169) CGTAAAAACTTAGAAGCAGGTTTACCTGTACAAGGTCCTGAAG

ATATGACATTACAAACATTACGCGTGATCAAAGAGTACAAGCC TATCAGTTGATAGGCTTTTTTTCACCCTTTTTCCCTTTTCTCATA CGATATTATGTAATGTAACGTATAGGTGGGGATACTACT Promoter Promoter Sequence

(SEQ ID NO)

Tgl minimal promoter (B. ACCCTTTTTCCCTTTTCTCATACGATATTATGTAATGTAACGTA thuringiensis serovar TAGGTGGGGATACTACT

konkukian str. 97-27)

(SEQ ID NO: 170)

Superoxide dismutase ATTGTGGACCCTTAGCTCAGCTGGTTAGAGCAGACGGCTCATA (SODA1) promoter (B. ACCGTCCGGTCGTAGGTTCGAGTCCTACAGGGTCCATATCCATT

TCACATGTTTATTATGTCGGCAGGAAGCTTCCTTGTAGAAGGG

cereus F 837/76) AGCTTTTTTTATGAAATATATGAGCATTTTAATTGAAATGAAGT (SEQ ID NO: 171) GGGAATTTTGCTACTTTAATGATAGCAAGACAATGTGATTTATT

TGTTTGCACCCTATGGCAATTAGGGTAGAATGAAGTTGTATGT

CACTTAAGTGGCAATACATAAACTGGGAGGAATATAACA

Superoxide dismutase ACTTAAGTGGCAATACATAAACTGGGAGGAATATAACA

(SODA1) minimal promoter

(B. cereus F837/76)

(SEQ ID NO: 172)

Superoxide dismutase AATATAACAGAAAATTCTGATGTTTTTTCAAATCCTATAATAAG (SODA2) promoter (B. GAGTGTTCCGTATGATGCCTTTATATTTTCCGGAAGATAAAAC

AGAATATATTATTCCAGGGATTGTTTGTGTTCTATTTATCATCG

cereus AH820) GTGCGATTGCTACGTGGCGTATGTTCATTCGTGTATCAAAACG (SEQ ID NO: 173) AGAAGCAGAGCGATTACAGAAAGTTGAAGAAAAGCTGTTAGC

TGAAAAGAAACAGTAACTCATTTTTGTATGTTTCCCTCTATGCT

CGGACAATCTAAGGGCAGAATGTATTTTGGAGGGAATGAA

Superoxide dismutase TCCGGAAGATAAAACAGAATATATTATTCCAGGGATTGTTTGT (SODA2) minimal promoter GTTCTATTTATCATCGGTGCGATTGCTACGTGGCGTATGTTCAT

TCGTGTATCAAAACGAGAAGCAGAGCGATTACAGAAAGTTGA

(B. cereus AH820) AGAAAAGCTGTTAGCTGAAAAGAAACAGTAACTCATTTTTGTA (SEQ ID NO: 174) TGTTTCCCTCTATGCTCGGACAATCTAAGGGCAGAATGTATTTT

GGAGGGAATGAA

BclA promoter TAATCACCCTCTTCCAAATCAATCATATGTTATACATATACTA

(B. anthracis Sterne) AACTTTCCATTTTTTTAAATTGTTCAAGTAGTTTAAGATTTCTT

(SEQ ID NO: 175) TTCAATAATTCAAATGTCCGTGTCATTTTCTTTCGGTTTTGCAT

CTACTATATAATGAACGCTTTATGGAGGTGAATTT

BAS1882 promoter (£. AATTACATAACAAGAACTACATTAGGGAGCAAGCAGTCTAGCG anthracis Sterne)

ATATATACAATCGCTTGTCCATTTCATTTGGCTCTACCCACGCA

(SEQ ID NO: 176) TTTACTATTAGTAATATGAATTTTTCAGAGGTGGATTTTATT

Gene 3572 promoter CTATGATTTAAGATACACAATAGCAAAAGAGAAACATATTAT (B. weihenstephensis ATAACGATAAATGAAACTTATGTATATGTATGGTAACTGTATA

TATTACTACAATACAGTATACTCATAGGAGGTAGGT KBAB 4)

(SEQ ID NO: 177)

YVTN β-propeller protein GGTAGGTAGATTTGAAATATGATGAAGAAAAGGAATAACTAA promoter AAGGAGTCGATATCCGACTCCTTTTAGTTATAAATAATGTGGA

ATTAGAGTATAATTTTATATAGGTATATTGTATTAGATGAACGC

(B. weihenstephensis TTTATCCTTTAATTGTGATTAATGATGGATTGTAAGAGAAGGG

KBAB 4) GCTTACAGTCCTTTTTTTATGGTGTTCTATAAGCCTTTTTAAAA

(SEQ ID NO: 178) GGGGTACCACCCCACACCCAAAAACAGGGGGGGTTATAACTA

CATATTGGATGTTTTGTAACGTACAAGAATCGGTATTAATTACC

CTGTAAATAAGTTATGTGTATATAAGGTAACTTTATATATTCT

CCTACAATAAAATAAAGGAGGTAATAAA Promoter Promoter Sequence

(SEQ ID NO)

CrylA promoter AACCCTTAATGCATTGGTTAAACATTGTAAAGTCTAAAGCATG

(B. thuringiensis HD-73) GATAATGGGCGAGAAGTAAGTAGATTGTTAACACCCTGGGTCA

AAAATTGATATTTAGTAAAATTAGTTGCACTTTGTGCATTTTTT

(SEQ ID NO: 179) CATAAGATGAGTCATATGTTTTAAATTGTAGTAATGAAAAAC

AGTATTATATCATAATGAATTGGTATCTTA ATA A A AGAGATGG

AGGTAACTTA

ExsY promoter TAATTCCACCTTCCCTTATCCTCTTTCGCCTATTTAAAAAAAGG (B. thuringiensis serovar TCTTGAGATTGTGACCAAATCTCCTCAACTCCAATATCTTATTA

ATGTAAATACAAACAAGAAGATAAGGA

konkukian str. 97-27)

(SEQ ID NO: 180)

CotY promoter

(B. thuringiensis Al Hakam) AATTCCCTGCTTTTATCGTAAGAATTAACGTAATATCAACCATA

TCCCGTTCATATTGTAGTAGTGTATGTCAGAACTCACGAGAAG

(SEQ ID NO: 181) GAGTGAACATAA

YjcA promoter TTAATGTCACTCCTTATCTTCTTGTTTGTATTTACATTAATAAG (B. thuringiensis serovar ATATTGGAGTTGAGGAGATTTGGTCACAATCTCAAGACCTTTTT

TTTAAATAGGCGAAAGAGGATAAGGGAAGGTGGAATT

kurstaki str. HD73)

(SEQ ID NO: 182)

YjcB promoter ATATATTTTCATAATACGAGAAAAAGCGGAGTTTAAAAGAATG (B. thuringiensis serovar AGGGAACGGAAATAAAGAGTTGTTCATATAGTAAATAGACAG

AA

kurstaki str. HD73)

(SEQ ID NO: 183)

ExsFA/BxpB promoter AAACTAAATAATGAGCTAAGCATGGATTGGGTGGCAGAATTAT

(B. thuringiensis Al Hakam) CTGCCACCCAATCCATGCTTAACGAGTATTATTATGTAAATTT

CTTAAAATTGGGAACTTGTCTAGAACATAGAACCTGTCCTTTTC

(SEQ ID NO: 184) ATTAACTGAAAGTAGAAACAGATAAAGGAGTGAAAAAC

Rhamnose promoter ATTCACTACAACGGGGATGAGTTTGATGCGGATACATATGAG

(B. thuringiensis Al Hakam) AAGTACCGGAAAGTGTTTGTAGAACATTACAAAGATATATTAT

CTCCATCATAAAGGAGAGATGCAAAG

(SEQ ID NO: 185)

CotO promoter (B. anthracis CGCGCACCACTTCGTCGTACAACAACGCAAGAAGAAGTTGGGG Sterne) ATACAGCAGTATTCTTATTCAGTGATTTAGCACGCGGCGTAAC

AGGAGAAAACATTCACGTTGATTCAGGGTATCATATCTTAGGA

(SEQ ID NO: 186) TAAATATAATATTAATTTTAAAGGACAATCTCTACATGTTGAG

AGTTCTTACCACGTTATGAATATAAGTATAATAGTACACGATTT ATTCAGCTACGTA

Sigma K promoter TATATCATATGTAAAATTAGTTCTTATTCCCACATATCATATAG (B. anthracis Sterne) AATCGCCATATTATACATGCAGAAAACTAAGTATGGTATTATT

CTTAAATTGTTTAGCACCTTCTAATATTACAGATAGAATCCGTC

(SEQ ID NO: 187) ATTTTCAACAGTGAACATGGATTTCTTCTGAACACAACTCTTTT

TCTTTCCTTATTTCCAAAAAGAAAAGCAGCCCATTTTAAAATAC

GGCTGCTTGTAATGTACATTA

InhAl promoter TATCACATAACTCTTTATTTTTAATATTTCGACATAAAGTGAAA

(B. thuringiensis Al Hakam) CTTTAATCAGTGGGGGCTTTGTTCATCCCCCCACTGATTATTAA

TTGAACCAAGGGATAAAAAGATAGAGGGTCTGACCAGAAAAC

(SEQ ID NO: 188) TGGAGGGCATGATTCTATAACAAAAAGCTTAATGTTTATAGAA

TTATGTCTTTTTATATAGGGAGGGTAGTAAACAGAGATTTGGA

CAAAAATGCACCGATTTATCTGAATTTTAAGTTTTATAAAGGG

GAGAAATG Promoter Promoter Sequence

(SEQ ID NO)

BclA cluster glycosyl ATTTTTTACTTAGCAGTAAAACTGATATCAGTTTTACTGCTTTTT transferase operon 1 CATTTTTAAATTCAATCATTAAATCTTCCTTTTCTACATAGTCA

TAATGTTGTATGACATTCCGTAGGAGGCACTTATA

(B. thuringiensis serovar

konkukian str. 97-27)

(SEQ ID NO: 189)

BclA cluster glycosyl ACATAAATTCACCTCCATAAAGCGTTCATTATATAGTAGATGC transferase operon 2 AAAACCGAAAGAAAATGACACGGACATTTGAATTATTGAAAA

GAAATCTTAAACTACTTGAACAATTTAAAAAAATGGAAAGTTT

(B. thuringiensis serovar AGTATATGTATAACATATGATTGATTTGGAAGAGGGTGATTA kurstaki str. HD73)

(SEQ ID NO: 190)

Glycosyl transferase TTCTATTTTCCAACATAACATGCTACGATTAAATGGTTTTTTGC promoter AAATGCCTTCTTGGGAAGAAGGATTAGAGCGTTTTTTTATAGA

AACCAAAAGTCATTAACAATTTTAAGTTAATGACTTTTTTGTTT

(B. thuringiensis Al Hakam) GCCTTTAAGAGGTTTTATGTTACTATAATTATAGTATCAGGTAC (SEQ ID NO: 191) TAATAACAAGTATAAGTATTTCTGGGAGGATATATCA

[00346] The sigma-K sporulation-specific polymerase promoter sequences in the promoter sequences shown in Table 2 result in high expression levels of the fusion protein during late sporulation. The consensus sequence for the sigma-K sporulation-specific polymerase promoter sequence is CATANNNTN; however, this sequence can comprise up to two mutations and still be functional. The sigma-K sporulation-specific polymerase promoter sequence is generally found upstream of the ribosome binding site (RBS).

[00347] Promoters having a high degree of sequence identity to any of the sequences shown above in Table 2 can also be used to express the fusion proteins.

[00348] For example, the fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 80% identity with a nucleic acid sequence of any one of SEQ ID NOs: 37-42 and 123-191.

[00349] The fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 90% identity with a nucleic acid sequence of any one of SEQ ID NOs: 37-42 and 123-191.

[00350] The fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 95% identity with a nucleic acid sequence of any one of SEQ ID NOs: 37-42 and 123-191.

[00351] The fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 98%identity with a nucleic acid sequence of any one of SEQ ID NOs: 37-42 and 123-191. [00352] The fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 99% identity with a nucleic acid sequence of any one of SEQ ID NOs: 37-42 and 123-191.

[00353] The fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having 100% identity with a nucleic acid sequence of any one of SEQ ID NOs: 37-42 and 123-191.

[00354] For example, fusion protein can be expressed under the control of a BclA promoter (e.g., SEQ ID NO: 149, 150, 175, 189 or 190), a CotY promoter (e.g., SEQ ID NO: 41, 41 or 181), an ExsY promoter (e.g., SEQ ID NO: 37, 38, or 180), or a rhamnose promoter (e.g., SEQ ID NO: 185). For example, the fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 80%identity with a nucleic acid sequence of any one of SEQ ID NOs: 37, 38, 41, 42, 149, 150, 175, 180, 181, 185, 189, or 190.

[00355] The fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 85% identity with a nucleic acid sequence of any one of SEQ ID NOs: 37, 38, 41, 42, 149, 150, 175, 180, 181, 185, 189, or 190.

[00356] The fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 90% identity with a nucleic acid sequence of any one of SEQ ID NOs: 37, 38, 41, 42, 149, 150, 175, 180, 181, 185, 189, or 190.

[00357] The fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 95% identity with a nucleic acid sequence of any one of SEQ ID NOs: 37, 38, 41, 42, 149, 150, 175, 180, 181, 185, 189, or 190.

[00358] The fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 98% identity with a nucleic acid sequence of any one of SEQ ID NOs: 37, 38, 41, 42, 149, 150, 175, 180, 181, 185, 189, or 190.

[00359] The fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having at least 99% identity with a nucleic acid sequence of any one of SEQ ID NOs: 37, 38, 41, 42, 149, 150, 175, 180, 181, 185, 189, or 190.

[00360] The fusion protein can be expressed under the control of a promoter comprising a nucleic acid sequence having 100% identity with a nucleic acid sequence of any one of SEQ ID NOs: 37, 38, 41, 42, 149, 150, 175, 180, 181, 185, 189, or 190.

[00361] The fusion protein can be expressed under the control of a promoter comprising a sigma-K sporulation specific polymerase promoter sequence, wherein the sigma-K sporulati on-specific polymerase promoter sequence or sequences have 100% identity with the corresponding nucleotides of any of SEQ ID NOs: 37-42 and 123-191.

[00362] The fusion proteins can be expressed under the control of a promoter that is native to the targeting sequence, exosporium protein, or exosporium protein fragment of the fusion protein. Thus, for example, where the targeting sequence is derived from BclA, the fusion protein can be expressed under the control of a native BclA promoter (e.g., SEQ ID NO: 149, 150, 175, 189 or 190).

[00363] Table 2 also provides exemplary minimal promoter sequences. The fusion proteins can be expressed under any of these minimal promoter sequences.

[00364] Furthermore, the fusion protein can be expressed under a portion of any of the promoters listed above in Table 2, so long as the portion of the promoter includes a sigma-K sporulation-specific polymerase promoter sequence. For example, the fusion protein can be expressed under a promoter region that comprises the first 25, 50, 100, 150, 200, 250, or 300 nucleotides upstream of the start codon, so long as that region comprises a sigma-K sporulation- specific polymerase promoter sequence.

III. Mutations and Other Genetic Alterations to Recombinant Bacillus cereus Family Members that Allow for Collection of Free Exosporium

[00365] As is described further hereinbelow, the recombinant Bacillus cereus family members that express fusion proteins comprising a protein or peptide of interest and a targeting sequence, an exosporium protein, or an exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member can be used for various purposes, including delivering proteins or peptides of interest to animals, aquatic organisms, or an insect vector of an animal pathogen. However, in some cases, the presence of the living microorganisms may not be desirable, and instead, it would be desirable to separate the living spore from the fusion proteins in the exosporium on the outside surface of the spore.

For example, in some applications it will be desirable to increase enzyme activity without concern for spore integrity. In such situations, the exosporium fragments may be preferred over living microorganisms having the enzyme on their exosporium.

[00366] In addition, for some uses, it may be desirable to reduce the density of the product. In such instances, it would be desirable to separate the dense spore from the

exosporium (containing the fusion proteins). In the field of vaccines, it may be desirable to separate the spore from the exosporium (containing fusion proteins that comprise an antigen) in order to remove potential antigens present on the spore itself from the vaccine preparation. Furthermore, under some circumstances the presence of live spores would lead to potential for bacterial growth in a product, which would be undesirable for some applications (e.g., wound dressings).

[00367] Mutations or other genetic alterations (e.g., overexpression of a protein) can be introduced into the recombinant Bacillus cereus family members that allow free exosporium to be separated from spores of the recombinant Bacillus cereus family member. This separation process yields exosporium fragments that contain the fusion proteins but that are substantially free of the spores themselves. By "substantially free of spores" it is meant that once the free exosporium is separated from the spores, a preparation is obtained that contains less than 5% by volume of spores, preferably less than 3% by volume of spores, even more preferably less than 1% by volume of spores, and most preferably contains no spores or if spores are present, they are undetectable. These exosporium fragments can be used in place of the recombinant Bacillus cereus family members themselves and can be in any of the compositions, methods, adhesive patches, wound dressings, insert trays, hoof bandages, or insect foggers described herein.

[00368] Exosporium fragments derived from spores of a recombinant Bacillus cereus family member can be used in any of the compositions, methods, adhesive patches, wound dressings, insert trays, hoof bandages, feed or feed additives, insect foggers described herein. The recombinant Bacillus cereus family member expresses a fusion protein comprising at least one protein or peptide of interest and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The recombinant Bacillus cereus family member comprises a mutation or expresses a protein, wherein the expression of the protein is increased as compared to the expression of the protein in a wild-type Bacillus cereus family member under the same conditions. The mutation or the increased expression of the protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore.

[00369] As further described below in Section IV, for vaccine compositions that comprise exosporium fragments, the exosporium fragments need not comprise a fusion protein. Such exosporium fragments can be derived from spores of a recombinant Bacillus cereus family member that does not express a fusion protein. The recombinant Bacillus cereus family member comprises a mutation or expresses a protein, wherein the expression of the protein is increased as compared to the expression of the protein in a wild-type Bacillus cereus family member under the same conditions. The mutation or the increased expression of the protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore. As explained further in Section IV, the exosporium fragments can act as an adjuvant in the vaccine composition.

[00370] The recombinant Bacillus cereus family member: (i) can comprise a mutation in a CotE gene; (ii) can express an ExsY protein, wherein the expression of the ExsY protein is increased as compared to the expression of the ExsY protein in a wild-type Bacillus cereus family member under the same conditions, and wherein the ExsY protein comprises a carboxy- terminal tag comprising a globular protein; (iii) can express a BclB protein, wherein the expression of the BclB protein is increased as compared to the expression of the BclB protein in a wild-type Bacillus cereus family member under the same conditions; (iv) can express a YjcB protein, wherein the expression of the YjcB protein is increased as compared to the expression of the YjcB protein in a wild-type Bacillus cereus family member under the same conditions;(v) can comprise a mutation in an ExsY gene;(vi) can comprise a mutation in a CotY gene;(vii) can comprise a mutation in an ExsA gene; or (viii) can comprise a mutation in a CotO gene.

[00371] The recombinant Bacillus cereus family member can comprise a mutation in the CotE gene, such as a knock-out of the CotE gene or a dominant negative form of the CotE gene. The mutation in the CotE gene can partially or completely inhibit the ability of CotE to attach the exosporium to the spore.

[00372] The recombinant Bacillus cereus family member can express an ExsY protein. The ExsY protein comprises a carboxy-terminal tag comprising a globular protein (e.g., a green fluorescent protein (GFP) or a variant thereof), and the expression of the ExsY protein is increased as compared to the expression of the ExsY protein in a wild-type Bacillus cereus family member under the same conditions. The globular protein can have a molecular weight of between 25 kDa and 100 kDa. Expression of the ExsY protein comprising the carboxy-terminal tag comprising a globular protein can inhibit binding of the ExsY protein to its targets in the exosporium.

[00373] The recombinant Bacillus cereus family member can express a BclB protein. Expression of the BclB protein can result in the formation of a fragile exosporium. The expression of the BclB protein can be increased as compared to the expression of the BclB protein in a wild-type Bacillus cereus family member under the same conditions.

[00374] The recombinant Bacillus cereus family member can express a YjcB protein. Expression of the YjcB protein can cause the exosporium to form in pieces rather than in a complete structure. The expression of the YjcB protein can be increased as compared to the expression of the YjcB protein in a wild-type Bacillus cereus family member under the same conditions.

[00375] The recombinant Bacillus cereus family member can comprise a mutation an ExsY gene, such as a knock-out of the ExsY gene. The mutation in the ExsY gene can partially or completely inhibit the ability of ExsY to complete the formation of the exosporium or attach the exosporium to the spore.

[00376] The recombinant Bacillus cereus family member can comprise a mutation a CotY gene, such as a knock-out of the CotY gene. The mutation in the CotY gene can result in the formation of a fragile exosporium.

[00377] The recombinant Bacillus cereus family member can comprise a mutation an ExsA gene, such as a knock-out of the ExsA gene. The mutation in the ExsA gene can result in the formation of a fragile exosporium.

[00378] The recombinant Bacillus cereus family member can comprise a mutation a CotO gene, such as a knock-out of the CotO gene or a dominant negative form of the CotO gene. The mutation in the CotO gene can cause the exosporium to form in strips.

[00379] For ease of reference, descriptions of exemplary sequences for CotE, ExsY, BclB, YjcB, CotY, ExsA, and CotO are provided in Table 3 below.

Table 3. Sequences of Proteins that Can be Mutated or Otherwise Genetically Altered to Allow for Collection of Free Exos orium

[00380] Exosporium fragments can be prepared from any of these recombinant Bacillus cereus family members and used for various purposes as described further hereinbelow. Where the recombinant Bacillus cereus family member expresses a fusion protein, the exosporium fragments will comprise the fusion proteins. Upon purification of the exosporium fragments that contain the fusion proteins from the spores, a cell-free protein preparation is obtained in which the fusion proteins are stabilized and supported through covalent bonds to the exosporium fragments. [00381] To remove the exosporium from spores of the recombinant Bacillus cereus family member that have mutations or other genetic alterations that allow for collection of free exosporium, a suspension of the spores can be subjected to centrifugation or filtration to produce fragments of exosporium that are separated from the spores. Where the recombinant Bacillus cereus family member expresses a fusion protein, the exosporium fragments will comprise the fusion protein.

[00382] A suspension comprising the spores can be subjected to centrifugation, followed by collection of the supernatant. The supernatant comprises the fragments of the exosporium and is substantially free of spores.

[00383] Alternatively, a suspension comprising the spores can be subjected to filtration, followed by collection of the filtrate. The filtrate comprises the fragments of the exosporium and is substantially free of spores.

[00384] The suspension of spores can be agitated or mechanically disrupted prior to centrifugation or filtration.

[00385] The exosporium fragments can also be separated from the spores by gradient centrifugation, affinity purification, or by allowing the spores to settle out of the suspension.

[00386] Due to the strong covalent bonds between the fusion proteins and the exosporium fragments, the fusion proteins become resistant to heat. The heat resistance of the fusion proteins bound to the exosporium fragments allows them to be used for applications that require heat-resistant proteins or enzymes (e.g., in feed additives).

IV. Compositions

[00387] Compositions comprising a carrier and spores of any of the recombinant Bacillus cereus family members described herein are provided.

[00388] Compositions comprising a carrier and exosporium fragments derived from spores of any of the recombinant Bacillus cereus family members described herein are also provided.

[00389] The compositions can comprise spores of any of the recombinant Bacillus cereus family members described above in Section IE or exosporium fragments derived from such spores. A. Pharmaceutical, insecticidal, acaricidal, helminthicidal, and nematicidal compositions

[00390] The composition can be a pharmaceutical composition. Where the

composition comprises a pharmaceutical composition, the carrier comprises a pharmaceutically acceptable carrier.

[00391] The composition can be an insecticidal composition.

[00392] The composition can be an acaricidal composition.

[00393] Where the composition is an insecticidal or acaricidal composition, the protein of interest can comprise a secreted insecticidal (Sip) protein, a mosquitocidal toxin, an endochitinase, an exochitinase, a Cryl Aa protein, a Cry 1 Ab protein, a Cry 1 Ac protein, a Cry ICa protein, a Cry IDa protein, a Cry2Aa protein, a Cry3Aa protein, a Cry3Bb protein, a Cry4Aa protein, a Cry4Ab protein, a Cryl 1 Aa protein, a Cytl Aa protein, or a combination of any thereof.

[00394] The mosquitocidal toxin can comprise a Mtx-like mosquitocidal toxin (e.g., Mtxl) or a Bin-like mosquitocidal toxin. Where the mosquitocidal toxin comprises Mtxl, the Mtxl can be any of the Mtxl proteins described herein.

[00395] The composition can be a helminthicidal composition

[00396] The composition can be a nematicidal composition.

[00397] Where the composition is a helminthicidal or nematicidal composition, the protein or peptide of interest can comprise a chitinase C, a chitinase D, or a combination thereof.

[00398] A pharmaceutical composition is provided. The pharmaceutical composition comprises a pharmaceutically acceptable carrier and exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects an animal from a pathogen and a targeting sequence, exosporium protein, or

exosporium protein fragment that targets the fusion protein to the exosporium of the

recombinant Bacillus cereus family member.

[00399] Where the composition comprises a pharmaceutical composition, the composition can be suitable for topical, oral, intravenous, intra-arterial, intraperitoneal, intramuscular, subcutaneous, intrapleural, intranasal, intradermal, inhalation, rectal, transdermal, transepithelial administration, administration to an aquatic animal by immersion of the animal in the pharmaceutical composition, or a combination of any thereof.

[00400] For example, the pharmaceutical composition can be suitable for topical administration. [00401] The pharmaceutical composition can be in the form of a topical spray composition.

[00402] The pharmaceutical composition can be suitable for oral administration.

[00403] For example, the pharmaceutical composition can be formulated as a feed additive.

[00404] In any of the pharmaceutical compositions other than the vaccine

compositions, the protein or peptide that protects the animal from a pathogen preferably does not comprise an antigen or an immunogen.

[00405] In any of the pharmaceutical compositions, the protein or peptide that protects the animal from a pathogen preferably does not comprise a nucleic acid binding protein or peptide.

[00406] For any of the pharmaceutical compositions, the protein or peptide that protects an animal from a pathogen can protect any of the animals discussed herein.

[00407] For any of the pharmaceutical compositions, the protein or peptide that protects an animal from a pathogen can protect the animal from any of the pathogens discussed herein.

[00408] In any of the compositions described herein, the protein or peptide that protects the animal from a pathogen can have antibacterial activity, antifungal activity, antihelminthic activity, nematicidal activity, insecticidal activity, acaricidal activity, can suppress insect or worm reproduction, or a combination of any thereof.

[00409] For example, the protein or peptide that protects the animal from a pathogen can have antibacterial activity, antifungal activity, or a combination thereof

[00410] The protein or peptide that protects the animal from a pathogen can comprise a bacteriocin, an avidin, a streptavidin, an antimicrobial peptide, a conalbumin, an albumin, a lactoferrin, a lactoferrin peptide, a lysozyme peptide,TasA, a defensin, an antibody, an antibody fragment, an enzyme, a histone, or a combination of any thereof.

[00411] The lactoferrin peptide can comprise LfcinB.

[00412] The LfcinB can comprise a Bos taurus lactoferrin. The amino acid sequence for a Bos taurus lactoferrin is provided by SEQ ID NO: 212.

[00413] The LfcinB can comprise any of the LfcinB peptides described above in Section LB. Thus the LfcinB can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 212. [00414] The lysozyme peptide can comprise a LysM peptide. The LysM can comprise a Gallus gallus LysM. The amino acid sequence for a Gallus gallus LysM is provided by SEQ ID NO: 213.

[00415] The LysM can comprise any of the LysM peptides described above in Section LB. Thus, the LysM can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 213.

[00416] The ovalbumin can comprise an ovalbumin.

[00417] The antimicrobial peptide can comprise a non-ribosomal antibacterial peptide, a non-ribosomal antifungal peptide, a cecropin, a penaeidin, a bactenecin, a callinectin, a myticin, a tachyplesin, a clavanin, amisgurin, a pleurocidin, a parasin, or a combination of any thereof.

[00418] The enzyme can comprise a nuclease, a protease, a lactonase, an apyrase, a glycoside hydrolase, an alginate lyase, a glucanase, a chitosanase, a chitinase, a chitosanase-like enzyme, a lyticase, a mutanolysin, or a stapholysin, or a combination of any thereof.

[00419] Where the enzyme comprises an apyrase, the apyrase can comprise any of the apyrases described above in Section LB. Thus, the apyrase can comprise a Solarium tuberosum apyrase encoded by the Rropl gene. The amino acid sequence for this Solarium tuberosum apyrase is provided by SEQ ID NO: 204.

[00420] Alternatively, the apyrase can comprise a Bacillus subtilis apyrase encoded by the YtkD gene. The amino acid sequence for this Bacillus subtilis apyrase is provided by SEQ ID NO: 205

[00421] The apyrase can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 204 or 205.

[00422] Where the enzyme comprises a glycoside hydrolase, the glycoside hydrolase can comprise a lysozyme, a dispersin B, or a combination of any thereof.

[00423] Where the enzyme comprises a nuclease, the nuclease can comprise a DNase (e.g., DNAsel).

[00424] The lactonase can comprise any of the lactonases described above in Section LB. Thus, the lactonase can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 207 or 208. [00425] Where the enzyme comprises a chitinase, the chitinase can comprise an endochitinase (e.g., a chitinase C) or an exochitinase (e.g., a chitinase D).

[00426] Where the chitinase comprises an endochitinase, the endochitinase can comprise a Bacillus thuringiensis endochitinase. An amino acid sequence for ^ Bacillus thuringiensis endochitinase is provided by SEQ ID NO: 206.

[00427] The endochitinase can comprise any of the endochitinases described above in Section LB. Thus, the endochitinase can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 206.

[00428] The enzyme can comprise an enzyme that is specific for a bacterial signaling molecule. For example, the enzyme can comprise a protease or a lactonase. The protease can comprise any of the proteases described herein. The lactonase can comprise any of the lactonases described herein.

[00429] The lactonase can comprise a lactonase that is specific for a bacterial lactone homoserine signaling molecule.

[00430] Where the enzyme comprises a lactonase, the lactonase can comprise a 1,4- lactonase, a 2-pyrone-4,6-dicarboxylate lactonase, a 3-oxoadipate enol-lactonase, an

actinomycin lactonase, a deoxylimonate A-ring-lactonase, a gluconolactonase L-rhamnono-1,4- lactonase, a limonin-D-ring-lactonase, a steroid-lactonase, a triacetate-lactonase, a xylono-1,4- lactonase, or a combination of any thereof.

[00431] The lactonase can comprise an AiiA lactonase.

[00432] For example, the lactonase can comprise a Bacillus thuringiensis B184 AiiA or a Bacillus pseudomycoides B30 AiiA. An amino acid sequence for the Bacillus thuringiensis B184 AiiA is provided by SEQ ID NO: 207. An amino acid sequence for the Bacillus pseudomycoides B30 AiiA is provided by SEQ ID NO: 208.

[00433] The enzyme can comprise an enzyme specific for a cellular or extracellular component of a bacterium or fungus. For example, the enzyme can comprise a glucanase, a chitosanase, a chitinase, a chitosanase-like enzyme, a lyticase, a protease, a mutanolysin, a stapholysin, a lysozyme, or a combination of any thereof.

[00434] Where the enzyme comprises a glucanase, the glucanase can comprise a cellulase, P-l,3-glucanase, a P-l,4-glucanase, a β-Ι,ό-glucanase, or a combination thereof. [00435] Where the enzyme comprises a P-l,3-glucanase, the P-l,3-glucanase can comprise a Bacillus circulans P-l,3-glucanase encoded by the BglH gene. An amino acid sequence for this P-l,3-glucanase is provided by SEQ ID NO: 216.

[00436] Alternatively, the P-l,3-glucanase can comprise a Hordeum vulgare β-1,3- glucanase encoded by the HvGII gene. An amino acid sequence for this P-l,3-glucanase is provided by SEQ ID NO: 214.

[00437] The P-l,3-glucanase can comprise any of the P-l,3-glucanases described above in Section LB. Thus, the P-l,3-glucanase can comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 214or 216.

[00438] Where the enzyme comprises a protease, the protease can comprise a peptidase (e.g., an endopeptidase or an exopeptidase), a proteinase (e.g., proteinase K), or a combination thereof.

[00439] The protease can comprise an alkaline protease, an acid protease, or a neutral protease.

[00440] The protease can comprise a Bacillus subtilis serine protease.

[00441] For example, the Bacillus subtilis serine protease can comprise any of the Bacillus subtilis serine proteases described above in Section LB. Thus, the Bacillus subtilis serine protease can comprise an amino acid sequence having at least 80%>, at least 85%>, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 209.

[00442] The Bacillus subtilis serine protease can comprise an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 210.

[00443] The protein or peptide that protects the animal from a pathogen can have antihelminthic activity, nematicidal activity, insecticidal activity, acaricidal activity, can suppress insect or worm reproduction, or a combination of any thereof.

[00444] The protein or peptide that protects the animal from a pathogen can comprise an insecticidal bacterial toxin (e.g., a VIP insecticidal protein), an acaricidal bacterial toxin, an endotoxin (e.g., a delta endotoxin), a Cry toxin, a protease inhibitor protein or peptide (e.g., a trypsin inhibitor or an arrowhead protease inhibitor), a secreted insecticidal (Sip) protein, a mosquitocidal toxin (e.g., an Mtxl-like mosquitocidal toxin, a Bin-like mosquitocidal toxin, or a combination thereof), a cysteine protease, a Bacillus subtilis serine protease, a chitinase, or a combination of any thereof. [00445] The chitinase can comprise any of the chitinases described herein (e.g., any of the endochitinases described herein).

[00446] The Bacillus subtilis serine protease can comprise any of the Bacillus subtilis serine proteases described herein.

[00447] The Mtxl-like mosquitocidal toxin can comprise Mtxl .

[00448] The Mtxl can comprise any of the Mtxl toxins described above in

Section LB. Thus, for example, the Mtxl can comprise a Bacillus sphaericus Mtxl . An amino acid sequence for a Bacillus sphaericus Mtxl is provided by SEQ LD NO: 211.

[00449] The Mtxl can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 211.

[00450] The Cry toxin can comprise a Cry toxin from Bacillus thuringiensis.

[00451] The Cry toxin can comprise a Cry5B protein, a Cry21A protein, a CrylAa protein, a CrylAb protein, a CrylAc protein, a CrylCa protein, a CrylDa protein, a Cry2Aa protein, a Cry3Aa protein, a Cry3Bb protein, a Cry4Aa protein, a Cry4Ab protein, a Cry 11 Aa protein, a Cytl Aa protein, or a combination of any thereof.

[00452] For example, the Cry toxin can comprise a Cry21 A protein.

[00453] The Cry21 A protein can comprise a Bacillus thuringiensis Cry21 A protein. An amino acid sequence for a Bacillus thuringiensis Cry21A protein is provided by SEQ ID NO: 215.

[00454] The Cry21A protein can comprise any of the Cry21A proteins described above in Section LB. Thus, the Cry21A protein can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 215.

[00455] Additional compositions (e.g., vaccine compositions and compositions for use in aquaculture) are described hereinbelow.

B. Vaccine compositions

[00456] In any of the pharmaceutical compositions, the protein or peptide that protects an animal from a pathogen can comprise an antigen or an immunogen. Such pharmaceutical compositions are referred to herein as "vaccine compositions" and are suitable for use in connection with the methods for producing an immunogenic response described in Section VI below. 1. Vaccine compositions suitable for use to produce an immunogenic response in an aquatic animal

[00457] Pharmaceutical compositions that are suitable for use to provide an immunogenic response in an aquatic animal are provided. The aquatic animal can be any of the aquatic animals listed in Section VI.

[00458] In the pharmaceutical compositions wherein the protein or peptide that protects an animal from a pathogen comprises an antigen or an immunogen, the antigen or immunogen can comprise an antigen or immunogen derived from a pathogen of an aquatic animal (e.g., Renibacterium salmoninarum, Yersinia ruckeri, Edwarsdiella ictaluri,

Flavobacterium columnare, Aerococcus viridans, Aeromonas salmonicida, Aeromonas hydrophila, Leucothrix mucor, Vibrio vulnificus, Vibrio parahaemolyticus, Vibrio alginolyticus, a bacterial pathogen of the genus Shewanella spp., Xenohaliotis californiensis, Piscirickettsia salmonis, a pathogenic protist of the genus Saprolengia, Branchiomyces sanguinis,

Branchiomyces demigrna, or Icthyophous hqferi). Such compositions are suitable for use in methods for producing an immunogenic response in an aquatic animal, including the methods described in Section VI below.

[00459] The pharmaceutical composition can be in the form of a powder or liquid concentrate. Such compositions are particularly suitable for use in methods for producing an immunogenic response in an aquatic animal, including the methods described in Section VI below.

2. Vaccine compositions containing exosporium fragments as adjuvants and/or stability enhancers

[00460] The exosporium fragments can act as an adjuvant when included in a vaccine composition. In addition, different types of exosporium fragments (e.g., exosporium fragments derived from different species of bacteria or exosporium fragments derived from recombinant Bacillus family members having different mutations that allow for the collection of free exosporium) can have different adjuvant properties or effects.

[00461] In addition, where exosporium fragments are used in a vaccine composition the antigen or immunogen is covalently bound to the exosporium fragment. Without being bound to any particular theory, it is thought that this increases the long-term stability of the vaccine composition and thereby allow for longer term storage of the vaccine composition, while maintaining the ability of the antigen or immunogen to elicit an immune response in an animal.

[00462] As described in greater detail below, various vaccine compositions are provided herein that contain exosporium fragments. The exosporium fragments can be derived from spores of a recombinant Bacillus cereus family member that expresses a fusion protein, wherein the fusion protein comprises an antigen or an immunogen. In such a case, the exosporium fragments can both act as a carrier of the antigen or immunogen in the vaccine composition and exert their adjuvant effects. In other compositions, the exosporium fragments are derived from spores of a recombinant Bacillus cereus family that does not express a fusion protein comprising an antigen or an immunogen. Such exosporium fragments do not carry an antigen or immunogen, but can be used as an adjuvant in vaccine compositions that contain: (1) an antigen or immunogen; (2) exosporium fragments derived from spores of a recombinant Bacillus cereus family member that expresses a fusion protein comprising an antigen or an immunogen; or (3) spores of a recombinant Bacillus cereus family member that expresses a fusion protein comprising an antigen or immunogen.

[00463] The mutations and other genetic alterations that allow for collection of free exosporium are described in Section III. Any of these mutations or other genetic alterations can be used to generate the exosporium fragments that can be included in the vaccine compositions. a. Vaccine compositions containing exosporium fragments of a first type and exosporium fragments of a second type

[00464] A vaccine composition is provided. The composition comprises a

pharmaceutically acceptable carrier. The vaccine composition also comprises exosporium fragments of a first type and exosporium fragments of a second type. The exosporium fragments of the second type are different from the exosporium fragments of the first type. The exosporium fragments of the first and second types are derived from spores of a recombinant Bacillus cereus family member that comprises a mutation or expresses a protein, wherein the expression of the protein is increased as compared to the expression of the protein in a wild-type Bacillus cereus family member under the same conditions. The mutation or the increased expression of the protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore. At least one of the exosporium fragments of the first type and the exosporium fragments of the second type comprise a fusion protein. The fusion protein comprises an antigen or an immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00465] Both the exosporium fragments of the first type and the exosporium fragments of the second type cam comprise a fusion protein. The fusion protein comprises an antigen or an immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00466] Where both the exosporium fragments of the first type and the exosporium fragments of the second type comprise a fusion protein, the exosporium fragments of the first type and the exosporium fragments of the second type can comprise fusion proteins that are identical to one another.

[00467] Alternatively, the exosporium fragments of the first type and the exosporium fragments of the second type can comprise fusion proteins that are different from one another.

[00468] For example the exosporium fragments of the first type can comprise a fusion protein comprising a first antigen or immunogen and the exosporium fragments of the second type can comprise a fusion protein comprising a second antigen or immunogen, where the first antigen or immunogen is different from the second antigen or immunogen.

[00469] Alternatively or in addition, where the exosporium fragments of the first type and the exosporium fragments of the second type comprise fusion proteins that are different from one another, the exosporium fragments of the first type can comprise a fusion protein comprising a first targeting sequence, exosporium protein, or exosporium protein fragment. The exosporium fragments of the second type comprise a fusion protein comprising a second targeting sequence, exosporium protein, or exosporium protein fragment. The first targeting sequence, exosporium protein, or exosporium protein fragment is different from the second targeting sequence, exosporium protein, or exosporium protein fragment.

[00470] In any of the vaccine compositions comprising exosporium fragments of a first type and exosporium fragments of a second type, the exosporium fragments of the first type can be derived from spores of a first species of bacteria within the Bacillus cereus family, and the exosporium fragments of the second type can be derived from spores of a second species of bacteria within the Bacillus cereus family. The second species of bacteria is different from the first species of bacteria. For example, the first species of bacteria can comprise Bacillus thuringiensis and the second species of bacteria can comprise Bacillus pseudomycoides . [00471] In any of the vaccine compositions comprising exosporium fragments of a first type and exosporium fragments of a second type, the exosporium fragments of the first type can be derived from a spores of a recombinant Bacillus cereus family member that comprises a first mutation. The first mutation results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild- type spore. The exosporium fragments of the second type are derived from spores of a recombinant Bacillus cereus family member that comprises a second mutation. The second mutation results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore. The first mutation is different from the second mutation.

[00472] The first mutation and the second mutation can be independently selected from: (i) a mutation in a CotE gene; (ii) a mutation in an ExsY gene; (iii) a mutation in a CotY gene; (iv) a mutation in an ExsA gene; and (v) a mutation in a CotO gene. For example, the first mutation can comprise a knock-out of the CotE gene and the second mutation can comprise a knockout of the ExsY gene.

[00473] In any of the vaccine compositions comprising exosporium fragments of a first type and exosporium fragments of a second type, the exosporium fragments of the first type can be derived from spores of a recombinant Bacillus cereus family member that expresses a first protein, wherein the expression of the first protein is increased as compared to the expression of the first protein in a wild-type Bacillus cereus family member under the same conditions. The increased expression of the first protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore. The exosporium fragments of the second type are derived from spores of a recombinant Bacillus cereus family member that expresses a second protein, wherein the expression of the second protein is increased as compared to the expression of the second protein in a wild-type Bacillus cereus family member under the same conditions. The increased expression of the second protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild- type spore. The first protein is different from the second protein.

[00474] For example, the first protein and the second protein can be independently selected from: (i) an ExsY protein, wherein the expression of the ExsY protein is increased as compared to the expression of the ExsY protein in a wild-type Bacillus cereus family member under the same conditions, and wherein the ExsY protein comprises a carboxy-terminal tag comprising a globular protein; (ii) a BclB protein, wherein the expression of the BclB protein is increased as compared to the expression of the BclB protein in a wild-type Bacillus cereus family member under the same conditions; and (iii) a YjcB protein, wherein the expression of the YjcB protein is increased as compared to the expression of the YjcB protein in a wild-type Bacillus cereus family member under the same conditions.

[00475] In any of the vaccine compositions comprising exosporium fragments of a first type and exosporium fragments of a second type, the exosporium fragments of the first type can be derived from spores of a recombinant Bacillus cereus family member that comprises a mutation, wherein the mutation results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild- type spore. The exosporium fragments of the second type are derived from spores of a recombinant Bacillus cereus family member that expresses a protein, wherein the expression of the protein is increased as compared to the expression of the protein in a wild-type Bacillus cereus family member under the same conditions. The increased expression of the protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore.

[00476] For example, the mutation can be selected from: (i) a mutation in a CotE gene; (ii) a mutation in an ExsY gene; (iii) a mutation in a CotY gene; (iv) a mutation in an ExsA gene; and (v) a mutation in a CotO gene. The protein can be selected from: (i) an ExsY protein, wherein the expression of the ExsY protein is increased as compared to the expression of the ExsY protein in a wild-type Bacillus cereus family member under the same conditions, and wherein the ExsY protein comprises a carboxy-terminal tag comprising a globular protein; (ii) a BclB protein, wherein the expression of the BclB protein is increased as compared to the expression of the BclB protein in a wild-type Bacillus cereus family member under the same conditions; and (iii) a YjcB protein, wherein the expression of the YjcB protein is increased as compared to the expression of the YjcB protein in a wild-type Bacillus cereus family member under the same conditions. b. Vaccine compositions comprising spores of a recombinant Bacillus cereus family member and exosporium fragments

[00477] Another vaccine composition is provided. The composition comprises a pharmaceutically acceptable carrier. The composition further comprises spores of a recombinant Bacillus cereus family member that expresses a first fusion protein. The first fusion protein comprising at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the first fusion protein to the exosporium of the recombinant Bacillus cereus family member. The composition also comprises exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member.

[00478] The exosporium fragments can be derived from a recombinant Bacillus cereus family member that comprises a mutation or expresses a protein, wherein the expression of the protein is increased as compared to the expression of the protein in a wild-type Bacillus cereus family member under the same conditions. The mutation or the increased expression of the protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore.

[00479] The exosporium fragments can be derived from spores of a recombinant Bacillus cereus family member that expresses a second fusion protein. The second fusion protein comprises at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the second fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00480] The first fusion protein and the second fusion protein can be identical to one another. Alternatively, the first fusion protein and the second fusion protein can be different from one another.

[00481] For example, the first fusion protein can comprise a first antigen or immunogen and the second fusion protein can comprise a second antigen or immunogen. The first antigen or immunogen is different from the second antigen or immunogen.

[00482] Alternatively or in addition, the first fusion can comprise a first targeting sequence, exosporium protein, or exosporium protein fragment. The second fusion protein comprises a second targeting sequence, exosporium protein, or exosporium protein fragment. The first targeting sequence, exosporium protein, or exosporium protein fragment is different from the second targeting sequence, exosporium protein, or exosporium protein fragment.

[00483] For vaccine compositions that comprise spores of a recombinant Bacillus cereus family member, the spores are preferably inactivated. Methods for inactivating spores of Bacillus cereus family members are described above in Section IE and below in Section VIII. c. Vaccine compositions comprising an immunogen or antigen and exosporium fragments

[00484] Yet another vaccine composition is provided. The composition comprises a pharmaceutically acceptable carrier. The composition also comprises a first immunogen or antigen. The composition further comprises exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member.

[00485] The exosporium fragments can be derived from a recombinant Bacillus cereus family member that comprises a mutation or expresses a protein, wherein the expression of the protein is increased as compared to the expression of the protein in a wild-type Bacillus cereus family member under the same conditions. The mutation or the increased expression of the protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore.

[00486] The exosporium fragments can be derived from spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises a second antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00487] The first antigen or immunogen and the second antigen or immunogen can be the same the same.

[00488] Alternatively, the first antigen or immunogen and the second antigen or immunogen can be different from one another.

[00489] The immunogen or antigen preferably comprises a free antigen or free immunogen. The terms "free antigen" and "free immunogen" as used herein include partially purified, substantially purified, or purified antigen or immunogen.

[00490] Free antigens or immunogens can optionally be immobilized on a chemical matrix or support to allow for controlled release of the antigen or immunogen. The matrix or support can comprise charcoal, biochar, nanocarbon, agarose, an alginate, cellulose, a cellulose derivative, silica, plastic, stainless steel, glass, polystyrene, a ceramic, dolomite, a clay, diatomaceous earth, talc, a polymer, a gum, a water-dispersible material, or a combination of any thereof. Immobilization of the antigen or immunogen on the matrix or support preferably results in a slower release of the antigen or immunogen as compared to the release rate for the same non-immobilized antigen or immunogen, under the same conditions. [00491] In addition, free antigens or immunogens can be part of a fusion protein. However, free antigens or free immunogens preferably do not include antigens or immunogens that are bound to exosporium of a Bacillus cereus family member. Free antigens or immunogens also preferably do not include enzymes bound to the exosporium of an intact Bacillus cereus family member spore.

[00492] The antigen or immunogen can be in the form of a DNA encoding the antigen or immunogen. The DNA encoding the antigen or immunogen can be administered to the animal. The antigen or immunogen is then expressed in vivo by the animal.

[00493] The term "partially purified" as used herein in reference to the antigens and immunogens means that a crude preparation of the antigen or immunogen (e.g., a cell lysate) has been subjected to procedures that remove at least some non-antigen or non-immunogen components (e.g., waste proteins, dead cell material, excess water, and/or unwanted cell debris). In a partially purified antigen or immunogen preparation, the antigen or immunogen preferably comprises at least 1% of the total protein content in the preparation, more preferably at least 2.5% of the total protein content in the preparation, and even more preferably greater than 5% of the total protein content in the preparation.

[00494] The term "substantially purified" as used herein in connection with free antigens and free immunogens means that the antigen or immunogen preparation has been subjected to procedures that remove a substantial amount of non-antigen or non-immunogen components (e.g., waste proteins, dead cell material, excess water, and/or unwanted cell debris). In a substantially purified antigen or immunogen preparation, the antigen or immunogen preferably comprises greater than 30% of the total protein content in the preparation, more preferably greater than about 40% of the total protein content in the preparation, and even more preferably greater than 50% of the total protein content in the preparation.

3. Adjuvants

[00495] In any of the vaccine compositions described herein, the vaccine can also comprise an adjuvant.

[00496] Where the vaccine composition comprises exosporium fragments, the adjuvant can provide further adjuvant effects in addition to those provided by the exosporium fragments.

[00497] For example the adjuvant can comprise Freund's complete adjuvant (FCA), Freund's incomplete adjuvant (FIA), aluminum (e.g., an aluminum salt such as aluminum hydroxide, aluminum phosphate, or aluminum sulfate), monophosphoryl lipid A, squalene, an oil-based adjuvant, a saponin, a non-metabolizable oil (e.g., a mineral oil, a plant oil, or an animal oil), polymers, carbomers, surfactants, natural organic compounds, plant extracts, carbohydrates, water-in-oil or oil-in-water emulsions, or combinations of any thereof. Suitable saponin adjuvants include the QUIL-A (Invivogen), QS-21 (Cambridge Biotech, Inc., a purified plant extract from Quillaja saponaria containing water-soluble triterpene glucoside

compounds), and GPI-0100 (Galenica Pharmaceuticals, Inc., a semi-synthetic triterpene glycoside, derived from the naturally occurring saponins) products. Suitable emulsions include those comprising light liquid paraffin oil (European Pharmacopeia type); isoprenoid oil such as squalane or squalene; oil resulting from the oligomerization of alkenes, in particular of isobutene or decene; esters of acids or of alcohols containing a linear alkyl group, more particularly plant oils, ethyl oleate, propylene glycol di(caprylate/caprate), glyceryl tri-(caprylate/caprate) or propylene glycol di oleate; or esters of branched fatty acids or alcohols, in particular isostearic acid esters. The oil is used in combination with emulsifiers to form the emulsion. The emulsifiers are preferably nonionic surfactants, in particular esters of sorbitan, mannide (e.g. anhydromannitol oleate), glycol, polyglycerol, propylene glycol, and oleic, isostearic, ricinoleic or hydroxystearic acid, which are optionally ethoxylated, and polyoxypropylene- polyoxyethylene copolymer blocks, in particular the Pluronic products, especially L121. {See Hunter et al., The Theory and Practical Application of Adjuvants (Ed. Stewart- Tull, D. E. S.), John Wiley and Sons, NY, pp 51-94 (1995) and Todd et al., Vaccine 15:564-570 (1997)).

[00498] Where the vaccine composition is for use to produce an immunogenic response in an aquatic animal, suitable adjuvants include, but are not limited to a yeast extract such as LIEBER beta-S (high-purity 1,3/1,6-beta-D-glucan molecules from the cell wall of Saccharomyces cerevisiae), NUPRO S. cerevisiae (nucleoti de-rich Saccharomyces cerevisiae yeast protein), or MACROGARD (highly purified, exposed, and preserved beta 1,3/1,6 glucans produced from a strain of the yeast Saccharomyces; levamisole; dimer lysozyme; beta-hydroxy- methylbutyrate (HMB); and BIOIMMUNO (a mixture of glucans and methisoprinol).

V. Non- Vaccine Methods for Protecting Animals or Aquatic Organisms from

Pathogens, and Non- Vaccine Compositions and Products for Use in Protecting Animals or Aquatic Organisms from Pathogens

[00499] Methods for protecting an animal from a pathogen are provided. These methods are preferably non-vaccine methods, in that the methods do not require the use of a vaccine, antigen, or immunogen. Instead the desired effect of protecting the animal from the pathogen is achieved without the use of a vaccine, antigen, or immunogen.

[00500] Spores of the recombinant Bacillus cereus family members expressing a fusion protein described herein or exosporium fragments derived from such spores can be used to display proteins or peptides (e.g., enzymes) that protect animals from a pathogen through antibacterial activity, antifungal activity, antibiofilm activity and/or other protective activities. The proteins or peptides that protect animals from a pathogen can exert direct antimicrobial action on their targets (e.g., bacteriocins, albumin, conalbumin, lysozymes, and lactoferrin) and/or can bind to and sequester essential nutrients that pathogens require for virulence (e.g., avidins and streptavidins). For example, LfcinB or lactoferrin can be used to lyse bacterial cells. The proteins or peptides that protect animals from a pathogen can have specific action on select microbes, and can selectively target a group of pathogens without obstructing all microbes.

[00501] A method for protecting an animal from a pathogen is provided. The method comprises administering spores of a recombinant Bacillus cereus family member that expresses a fusion protein to the animal, to the environment of the animal, or to the pathogen. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The protein or peptide that protects the animal from a pathogen does not comprise an antigen or an

immunogen.

[00502] Alternatively or in addition, the method comprises administering exosporium fragments to the animal, to the environment of the animal, or to the pathogen. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the

recombinant Bacillus cereus family member.

[00503] The method can comprise administering the spores, the exosporium fragments, or a combination thereof to the animal.

[00504] The method preferably comprises administering the exosporium fragments.

[00505] The protein or peptide that protects the animal from a pathogen preferably does not comprise an antigen or an immunogen. [00506] The protein or peptide that protects the animal from a pathogen preferably does not comprise a nucleic acid binding protein or peptide.

[00507] The animal can comprise a mammal, a bird, a fish, an amphibian, a reptile, a crustacean, a mollusk, a worm, an insect, a coral, or a sponge.

[00508] Where the animal comprises the mammal, the mammal can comprise a human, a monkey, a sheep, a goat, a cow, a pig, a deer, an alpaca, a bison, a camel, a donkey, a horse, a mule, a yak, a reindeer, a llama, a rabbit, a dog, a cat, a ferret, a gerbil, a guinea pig, a hamster, a mouse, a rabbit, or a rat.

[00509] Where the animal comprises the bird, the bird can comprise a chicken, a turkey, a duck, a goose, a quail, a dove, a pigeon, an ostrich, an emu, or a pheasant.

[00510] Where the animal comprises the fish, the fish can comprise a hobby fish, a salmon, a trout, a halibut, a seabass, a snapper, a grouper, a mullet, a tilapia, a tuna, a catfish, a carp, or a sturgeon.

[00511] Where the animal comprises the amphibian, the amphibian can comprise a frog, a toad, a newt, or a salamander.

[00512] Where the animal comprises the reptile, the reptile can comprise a snake, a lizards, an iguana, a crocodile, an alligator, a turtle, or a tortoise.

[00513] Where the animal comprises the crustacean, the crustacean can comprise a shrimp, a prawn, a krill, a lobster, a crab, or a crayfish.

[00514] Where the animal comprises a bird, a fish, an amphibian, a reptile, or a crustacean, the method for protecting an animal from a pathogen can comprise protecting the animal's eggs from the pathogen.

[00515] Where the animal comprises a bird, a fish, an amphibian, a reptile, or a crustacean, the method for protecting an animal from a pathogen can comprise administering the exosporium fragments or spores to the animal's eggs.

[00516] Where the animal comprises the mollusk, the mollusk can comprise a mussel, a clam, an oyster, a scallop, a snail, a slug, a squid, a cuttlefish, or an octopus.

[00517] Where the animal comprises the worm, the worm can comprise an

earthworm, a nematode, a flatworm, a roundworm, a tapeworm, or a fluke.

[00518] Where the animal comprises the insect, the insect can comprise a bee, a ladybug, a butterfly, a silkworm, a fly, a beetle, or the larvae of any thereof.

[00519] The protein or peptide that protects the animal from a pathogen can have antibacterial activity, antifungal activity, antihelminthic activity, nematicidal activity, insecticidal activity, acaricidal activity, can suppress insect or worm reproduction, or a combination of any thereof.

[00520] For example, the protein or peptide that protects the animal from a pathogen can have antibacterial activity, antifungal activity, or a combination thereof

[00521] The protein or peptide that protects the animal from a pathogen can comprise a bacteriocin, an avidin, a streptavidin, an antimicrobial peptide, a conalbumin, an albumin, a lactoferrin, a lactoferrin peptide, TasA, a defensin, an antibody, an antibody fragment, an enzyme, a histone, or a combination of any thereof.

[00522] The lactoferrin peptide can comprise LfcinB.

[00523] The LfcinB can comprise a Bos taurus lactoferrin. The amino acid sequence for a Bos taurus lactoferrin is provided by SEQ ID NO: 212.

[00524] The LfcinB can comprise any of the LfcinB peptides described above in Section LB. Thus the LfcinB can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 212.

[00525] The ovalbumin can comprise an ovalbumin.

[00526] The antimicrobial peptide can comprise a non-ribosomal antibacterial peptide, a non-ribosomal antifungal peptide, a cecropin, a penaeidin, a bactenecin, a callinectin, a myticin, a tachyplesin, a clavanin, amisgurin, a pleurocidin, a parasin, or a combination of any thereof.

[00527] The enzyme can comprise a nuclease, a protease, a lactonase, an apyrase, a glycoside hydrolase, an alginate lyase, a glucanase, a chitosanase, a chitinase, a chitosanase-like enzyme, a lyticase, a mutanolysin, or a stapholysin, or a combination of any thereof.

[00528] Where the enzyme comprises an apyrase, the apyrase can comprise any of the apyrases described above in Section LB. Thus, the apyrase can comprise a Solarium tuberosum apyrase encoded by the Rro l gene. The amino acid sequence for this Solatium tuberosum apyrase is provided by SEQ ID NO: 204.

[00529] Alternatively, the apyrase can comprise a Bacillus subtilis apyrase encoded by the YtkD gene. The amino acid sequence for this Bacillus subtilis apyrase is provided by SEQ ID NO: 205.

[00530] The apyrase can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 204 or 205. [00531] Where the enzyme comprises a glycoside hydrolase, the glycoside hydrolase can comprise a lysozyme (e.g., LysM) a lysozyme peptide, dispersin B, or a combination of any thereof.

[00532] Where the glycoside hydrolase comprises LysM, the LysM can comprise a Gallus gallus LysM. The amino acid sequence for a Gallus gallus LysM is provided by SEQ ID NO: 213.

[00533] The LysM can comprise any of the LysM peptides described above in Section LB. Thus, the LysM can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 213.

[00534] Where the enzyme comprises a nuclease, the nuclease can comprise a DNase (e.g., DNAsel).

[00535] The lactonase can comprise any of the lactonases described above in Section LB. Thus, the lactonase can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 207 or 208.

[00536] Where the enzyme comprises a chitinase, the chitinase can comprise an endochitinase (e.g., a chitinase C) or an exochitinase (e.g., a chitinase D).

[00537] Where the chitinase comprises an endochitinase, the endochitinase can comprise a Bacillus thuringiensis endochitinase. An amino acid sequence for ^ Bacillus thuringiensis endochitinase is provided by SEQ ID NO: 206

[00538] The endochitinase can comprise any of the endochitinases described above in Section LB. Thus, the endochitinase can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 206.

[00539] The enzyme can comprise an enzyme that is specific for a bacterial signaling molecule. For example, the enzyme can comprise a protease or a lactonase. The protease can comprise any of the proteases described herein. The lactonase can comprise any of the lactonases described herein.

[00540] The lactonase can comprise a lactonase that is specific for a bacterial lactone homoserine signaling molecule.

[00541] Where the enzyme comprises a lactonase, the lactonase can comprise a 1,4- lactonase, a 2-pyrone-4,6-dicarboxylate lactonase, a 3-oxoadipate enol-lactonase, an actinomycin lactonase, a deoxylimonate A-ring-lactonase, a gluconolactonase L-rhamnono-1,4- lactonase, a limonin-D-ring-lactonase, a steroid-lactonase, a triacetate-lactonase, a xylono-1,4- lactonase, or a combination of any thereof.

[00542] The lactonase can comprise an AiiA lactonase.

[00543] For example, the lactonase can comprise a Bacillus thuringiensis B184 AiiA or a Bacillus pseudomycoides B30 AiiA. An amino acid sequence for the Bacillus thuringiensis B184 AiiA is provided by SEQ ID NO: 207. An amino acid sequence for the Bacillus pseudomycoides B30 AiiA is provided by SEQ ID NO: 208.

[00544] The enzyme can comprise an enzyme specific for a cellular or extracellular component of a bacterium or fungus. For example, the enzyme can comprise a glucanase, a chitosanase, a chitinase, a chitosanase-like enzyme, a lyticase, a protease, a mutanolysin, a stapholysin, a lysozyme, or a combination of any thereof.

[00545] Where the enzyme comprises a glucanase, the glucanase can comprise a cellulase, P-l,3-glucanase, a P-l,4-glucanase, a β-Ι,ό-glucanase, or a combination thereof.

[00546] Where the enzyme comprises a P-l,3-glucanase, the P-l,3-glucanase can comprise a Bacillus circulans β- 1,3 -glucanase encoded by the BglH gene. An amino acid sequence for this β- 1,3 -glucanase is provided by SEQ ID NO: 216.

[00547] Alternatively, the β- 1,3 -glucanase can comprise a Hordeum vulgare β-1,3- glucanase encoded by the HvGII gene. An amino acid sequence for this β-l,3-glucanase is provided by SEQ ID NO: 214.

[00548] The β-l,3-glucanase can comprise any of the β-l,3-glucanases described above in Section LB. Thus, the β- 1,3 -glucanase can comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 214 or 216.

[00549] Where the enzyme comprises a protease, the protease can comprise a peptidase (e.g., an endopeptidase or an exopeptidase), a proteinase (e.g., proteinase K), or a combination thereof.

[00550] The protease can comprise an alkaline protease, an acid protease, or a neutral protease.

[00551] The protease can comprise a serine protease.

[00552] For example, the serine protease can comprise a Bacillus subtilis serine protease. The Bacillus subtilis serine protease can comprise any of the Bacillus subtilis serine proteases described above in Section LB. Thus, the Bacillus subtilis serine protease can comprise an amino acid sequence having at least 80%, at least 85%>, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 209.

[00553] The Bacillus subtilis serine protease can comprise an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 210.

[00554] The protein or peptide that protects the animal from a pathogen can have antihelminthic activity, nematicidal activity, insecticidal activity, acaricidal activity, can suppress insect or worm reproduction, or a combination of any thereof.

[00555] The protein or peptide that protects the animal from a pathogen can comprise an insecticidal bacterial toxin (e.g., a VIP insecticidal protein), an acaricidal bacterial toxin, an endotoxin (e.g., a delta endotoxin), a Cry toxin, a protease inhibitor protein or peptide (e.g., a trypsin inhibitor or an arrowhead protease inhibitor), a secreted insecticidal (Sip) protein, a mosquitocidal toxin (e.g., an Mtxl-like mosquitocidal toxin, a Bin-like mosquitocidal toxin, or a combination thereof), a cysteine protease, a Bacillus subtilis serine protease, a chitinase, or a combination of any thereof.

[00556] The chitinase can comprise any of the chitinases described herein (e.g., any of the endochitinases described herein).

[00557] The Bacillus subtilis serine protease can comprise any of the Bacillus subtilis serine proteases described herein.

[00558] The Mtxl-like mosquitocidal toxin can comprise Mtxl .

[00559] The Mtxl can comprise any of the Mtxl toxins described above in

Section LB. Thus, for example, the Mtxl can comprise a Bacillus sphaericus Mtxl . An amino acid sequence for a Bacillus sphaericus Mtxl is provided by SEQ ID NO: 211.

[00560] The Mtxl can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 211.

[00561] The Cry toxin can comprise a Cry toxin from Bacillus thuringiensis.

[00562] The Cry toxin can comprise a Cry5B protein, a Cry21A protein, a CrylAa protein, a CrylAb protein, a CrylAc protein, a CrylCa protein, a CrylDa protein, a Cry2Aa protein, a Cry3Aa protein, a Cry3Bb protein, a Cry4Aa protein, a Cry4Ab protein, a Cry 11 Aa protein, a Cytl Aa protein, or a combination of any thereof.

[00563] For example, the Cry toxin can comprise a Cry21 A protein. [00564] The Cry21 A protein can comprise a Bacillus thuringiensis Cry21 A protein. An amino acid sequence for a Bacillus thuringiensis Cry21A protein is provided by SEQ ID NO: 215.

[00565] The Cry21A protein can comprise any of the Cry21A proteins described above in Section LB. Thus, the Cry21A protein can comprise an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 215.

[00566] The pathogen can comprise a bacterial pathogen, a fungal pathogen, a pathogenic worm, a pathogenic insect, a pathogenic arachnid, a pathogenic protist, or a combination of any thereof.

[00567] The bacterial pathogen can comprise a bacterial pathogen of the genus Staphylococcus, a bacterial pathogen of the genus Hemophilus, a bacterial pathogen of the genus Pseudomonas, a bacterial pathogen of the genus Streptococcus, a bacterial pathogen of the genus Mycobacterium, a bacterial pathogen of the genus Clostridium, a bacterial pathogen of the genus Enterobacteriaceae , a bacterial pathogen of the genus Enterococcus, a bacterial pathogen of the genus Aeromonas, a bacterial pathogen of the genus Acinetobacter , a bacterial pathogen of the genus Fusobacterium, a bacterial pathogen of the genus Prevotella, a bacterial pathogen of the genus Flavobacterium, a bacterial pathogen of the genus Edwardsiella, a bacterial pathogen of the genus Anaplasm, a bacterial pathogen of the genus Bacillus, a bacterial pathogen of the genus Bartonella, a bacterial pathogen of the genus Bordetella, a bacterial pathogen of the genus Borrelia, a bacterial pathogen of the genus Brucella, a bacterial pathogen of the genus

Burkolderia, a bacterial pathogen of the genus Chlamydophilia, a bacterial pathogen of the genus Coxiella, a bacterial pathogen of the genus Ehrlichia, a bacterial pathogen of the genus Helicobacter, a bacterial pathogen of the genus Klebsiella, a bacterial pathogen of the genus Lasonia, a bacterial pathogen of the genus Leptospira, a bacterial pathogen of the genus

Mycoplasma, a bacterial pathogen of the genus Neorickettsia, a bacterial pathogen of the genus Pasteurella, a bacterial pathogen of the genus Rickettsia, a bacterial pathogen of the genus Salmonella, or a combination of any thereof.

[00568] For example, the bacterial pathogen can comprise Acinetobacter baumannii, Aeromonas hydrophila, Anaplasma phagocytophila, Anaplasma phagocytophilum, Anaplasma platys, Bacillus anthracis, Bartonella henselae, Bartonella rochalimae, Bartonella vinsonii subspecies berkhoffii, Bordetella bronchiseptica, Borrelia theileri, Borrelia burgdorferi, Brucella abortus, Brucella melitensis, Brucella suis, Burkholderia mallei, Burkholderia pseudomallei, Chlamydophila abortus, Chlamydophila felis, Chlamydophila psittaci,

Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium piliforme, Clostridium tetani, Coxiella burnetii, Edwardsiella ictaluri, Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia ewingii, Ehrlichia ruminantium, Enterococcus faecalis, Erysipelothrix rhusiopathiae, Flavobacterium columnar e, Fusobacterium necrophorum, Hemophilus influenzae, Haemobartonella felis, Helicobacter hepaticus, Klebsiella pneumoniae, Lawsonia intracellularis, Leprospira Pomona, Leptospira autumnalis, Leptospira ballum, Leptospira canicola, Leptospira grippotyphosa, Leptospira icterohaemorrhagiae, Leptospira interrogans sensu lato, Mycobacterium avium group, Mycobacterium bovis, Mycobacterium fortuitum, Mycobacterium microti, Mycobacterium paratuberculosis, Mycobacterium tuberculosis, Mycoplasma agalactiae, Mycoplasma capricolum capricolum, Mycoplasma capricolum subspecies capripneumoniae, Mycoplasma felis, Mycoplasma mycoides Capri, Mycoplasma mycoides subspecies mycoides, Mycoplasma putrefasciens, Neorickettsia elokominica,

Neorickettsia helminthoeca, Neorickettsia risticii, Pasteurella multocida, Pseudomonas aeruginosa, Prevotella melaninogenicus, Rickettsia prowazekii, Rickettsia typhi, Spiroplasma mirum, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus pseudintermedius, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus bovis, Streptococcus Group A, Streptococcus Group B, Streptococcus Group C, Streptococcus Group D, Streptococcus Group G, Streptococcus equi subspecies equi, Streptococcus equi subspecies zooepidemicus, Taylorella equigenitalis, or a combination of any thereof.

[00569] The fungal pathogen can comprise a fungal pathogen of the genus

Aspergillus, a fungal pathogen of the genus Microsporum, a fungal pathogen of the genus Cryptococcus, a fungal pathogen of the genus Chrysosporium, a fungal pathogen of the genus Encephalitozoon, a fungal pathogen of the genus Enter ocytozoon, a fungal pathogen of the genus Fusarium, a fungal pathogen of the genus Lichtheimia, a fungal pathogen of the genus Malassezia, a fungal pathogen of the genus Trichophyton, a fungal pathogen of the genus Mortierella, a fungal pathogen of the genus Mycor, a fungal pathogen of the genus Absidia, a fungal pathogen of the genus Rhizopus, a fungal pathogen of the genus Cladosporium, a fungal pathogen of the genus Scopulariopsis, a fungal pathogen of the genus Prototheca, a fungal pathogen of the genus Pythium, a fungal pathogen of the genus Rhodotorula, a fungal pathogen of the genus Stachybotrys, a fungal pathogen of the genus Lagenidium, a fungal pathogen of the genus Sirolpidium, a fungal pathogen of the genus Candida, or a combination of any thereof. [00570] The fungal pathogen can comprise an opportunistic dematiaceous fungal pathogen.

[00571] The fungal pathogen can comprise Chrysosporium parvum, Encephalitozoon cuniculi, Lichtheimia corymbifera, Lagenidium myophilum, Mortierella wolfii, Stachybotrys chartarum, Cryptococcus neoformans, Candida albicans, Trichophyton verrucosum,

Trichophyton equinum, Trichophyton mentagrophytes, or a combination of any thereof.

[00572] The pathogenic worm can comprise a nematode, a helminth, a roundworm, a pinworm, a whipworm, a threadworm, a cecal worm, a stomach worm, a hairworm, a threadnecked worm, a fluke, a tapeworm, or a of any combination theroef.

[00573] For example, the pathogenic worm can comprise Ascaris suum, Trichinella spiralis, Trichuris suis, Ascaris lumbricoides, Ascaris spp., Trichinella sp., Ostertagia ostertagi, Haemonchus placet, Cooperia oncophora, Dictyocaulus viviparus, Fasciola hepatica,

Haemonchus contortus, Nematodirus battus, Strongyloides sp. , Ancylostoma caninum, Toxocara canis, Toxocara cati, Taenia taeniaeformis, or a combination of any thereof.

[00574] The pathogenic insect can comprise an endoparasite, an ectoparasite, or a combination thereof.

[00575] The ectoparasite can be selected from fleas, ticks, lice, mites, flies, mosquitoes, the larvae of any thereof, and combinations of any thereof.

[00576] The endoparasite can be selected from heel flies, bomb flies, bot flies, Gasterophilus sp., the larvae of any thereof, and combinations of any thereof.

[00577] The pathogenic protist can comprise a protist of the genus Babesia, a protist of the genus Neospora, a protist of the genus Sarcocystis, a protist of the genus Theileria, a protist of the genus Trypanosoma, a protist of the genus Entamoeba, a protist of the genus Giardis, a protist of the genus Cryptosporidium, a protist of the genus Trichomonas, a protist of the genus Toxoplasma, a protist of the genus Plasmodium, a protist of the genus Coccidia, a protist of the genus Leishmania, a protist of the genus Cryptosporidia, a protist of the genus Cyclospora, a protist of the genus Eimeria, a protist of the genus Naeglaria, a protist of the genus Sarcocystis, a protist of the genus Neosporia, a protist of the genus Blastocystis, a protist of the genus Microsporidia, or a combination of any thereof.

[00578] For example, the pathogenic protist can comprise Entamoeba histolytica, Babesia bovis, Babesia bigemina, Babesia canis, Eimeria maxima, Eimeria tenella, Giardia duodenalis, Leishmania donovani, Neospora caninum, Sarcocystis neurona, Theileria parva, Theileria annulata, Theileria hirci, Toxoplasma gondii, or a combination of any thereof. A. Aquaculture Compositions and Methods

[00579] Compositions for use in aquaculture and methods for protecting aquatic organisms from pathogens are provided herein. Many pathogens are problematic in aquaculture. Bacterial and fungal pathogens can directly infect aquatic organisms in an aquaculture system. In addition, biofilms often form in aquaculture systems. Biofilms can form on the organisms in the aquaculture system themselves (e.g., on the gills of fish) or on surfaces within the aquaculture system (e.g., pipes, tanks, pumps, or filters). Thus, there is a need for methods to protect aquatic organisms in aquaculture systems from pathogens.

[00580] A composition is provided. The composition comprises a carrier acceptable for use in aquaculture and exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects an aquatic organism from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00581] The carrier can comprise a hydrophobic polymer. Use of a hydrophobic polymer can aid the composition in adhering to surfaces within an aquaculture system.

[00582] The composition can be in the form of a dry powder or a water-dispersible granule.

[00583] In any of the compositions for use in aquaculture, the protein or peptide that protects an aquatic organism from a pathogen comprises an apyrase, a dispersin B, or a combination thereof. The apyrase can be any of the apyrases discussed herein, including any of the apyrases discussed above in Section LB.

[00584] A method is provided for protecting an aquatic organism from a pathogen. The method comprises cultivating the aquatic organism in an aquaculture system. Spores of a recombinant Bacillus cereus family member that expresses a fusion protein are introduced into the aquaculture system. The fusion protein comprises at least one protein or peptide that protects the aquatic organism from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the

recombinant Bacillus cereus family member. The aquatic organism is selected from fish, amphibians, reptiles, crustaceans, mollusks, worms, coral, sponges, red algae, brown algae, or combinations of any thereof. [00585] Alternatively or in addition, the method comprises cultivating the aquatic organism in an aquaculture system. Exosporium fragments are introduced into the aquaculture system. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects the aquatic organism from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The aquatic organism is selected from fish, amphibians, reptiles, crustaceans, mollusks, worms, coral, sponges, red algae, brown algae, or combinations of any thereof.

[00586] In any of the aquaculture compositions or methods, the protein or peptide that protects the aquatic organism from a pathogen preferably does not comprise an antigen or an immunogen.

[00587] The aquatic organism can comprise red algae, brown algae, or a combination thereof.

[00588] The brown algae can comprise seaweed (e.g., nori, kelp, or a combination thereof).

[00589] A method for protecting an aquatic animal from a pathogen is provided. The method comprises cultivating the aquatic animal in an aquaculture system and administering spores or exosporium fragments to the aquatic animal by introducing the spores or exosporium fragments into the aquaculture system. The spores are spores of a recombinant Bacillus cereus family member that expresses a fusion protein, wherein the fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence,

exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member and the protein or peptide that protects the animal from a pathogen does not comprise an antigen or an immunogen. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, wherein the fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00590] In any of the methods involving the use of an aquaculture system, the method preferably comprises introducing the exosporium fragments into the aquaculture system. [00591] For any of the compositions for use in aquaculture or any of the methods involving the use of an aquaculture system, the aquatic organism or the aquatic animal can comprise a fish, an amphibian, a reptile, a crustacean, a mollusk, a worm, a coral, a sponge, or a combination of any thereof.

[00592] Where the aquatic organism or the aquatic animal comprises the fish, the fish can comprise a salmon, a trout, a halibut, a seabass, a snapper, a grouper, a mullet, a tilapia, a tuna, a catfish, a carp, a sturgeon, or a combination of any thereof.

[00593] Where the aquatic organism or the aquatic animal comprises the amphibian, the amphibian can comprise a frog, a toad, a newt, a salamander, or a combination of any thereof.

[00594] Where the aquatic organism or the aquatic animal comprises the reptile, the reptile can comprise a snake, a lizard, a crocodile, an alligator, a turtle, a tortoise, or a combination of any thereof.

[00595] The aquatic organism the or aquatic animal can comprise a frog, a toad, an alligator, a turtle, or a combination of any thereof.

[00596] Where the aquatic organism or the aquatic animal comprises a crustacean, the crustacean can comprise a shrimp, a prawn, a krill, a lobster, a crab, a crayfish, or a combination of any thereof.

[00597] Where the aquatic organism or the aquatic animal comprises a mollusk, the mollusk can comprise a mussel, a clam, an oyster, a scallop, a snail, a slug, a squid, a cuttlefish, or octopus, or a combination of any thereof.

[00598] In any of the methods involving the use of an aquaculture system, the method can prevent or treat a disease of the aquatic organism or the aquatic animal caused by the pathogen.

[00599] In any of the methods involving the use of an aquaculture system, the method can prevent or inhibit biofilm formation or promotes dissolution of a biofilm on a surface within the aquaculture system (e.g., a surface of a pipe, a tank, a pump, a filter, or a combination of any thereof).

[00600] In any of the methods involving the use of an aquaculture system, introducing the exosporium fragments or spores into the aquaculture system can comprise adding the exosporium fragments or spores to water in the aquaculture system.

[00601] In any of the methods involving the use of an aquaculture system, introducing the exosporium fragments or spores into the aquaculture system can comprise applying the exosporium fragments or spores to a surface within the aquaculture system (e.g., a surface of a pipe, a tank, a pump, a filter, or a combination of any thereof).

[00602] In any of the methods involving the use of an aquaculture system, introducing the exosporium fragments or spores into the aquaculture system can comprise dipping the aquatic organism or the aquatic animal into a solution comprising the exosporium fragments or spores.

[00603] The aquaculture system can be a freshwater aquaculture system.

[00604] The aquaculture system can be a saltwater aquaculture system.

[00605] The aquaculture system can be a brackish water aquaculture system.

[00606] The exosporium fragments or spores can be introduced into the aquaculture system in a composition comprising the exosporium fragments or spores and a carrier.

[00607] Examples of proteins or peptides that protect the animal or the aquatic animal from a pathogen that can be used in any of aquaculture compositions or in any of the methods involving the use of an aquaculture system include, but are not limited, to apyrases, proteases (e.g., a Bacillus subtilis serine protease), chitinases, glucanases (e.g., β-1,3- glucanase), antimicrobial proteins or peptides (e.g., a lactoferrin peptide), and lactonases. Combinations of any of these proteins or peptides can also be used.

[00608] Where the protein or peptide comprises an apyrase, the apyrase can comprise any of the apyrases described herein, including any of the apyrases described in Section LB.

[00609] The protease can comprise a Bacillus subtilis serine protease. Where the protease comprises a Bacillus subtilis serine protease, the Bacillus subtilis serine protease can comprise any of the Bacillus subtilis serine proteases described herein, including the Bacillus subtilis serine proteases described in Section LB. For example, the Bacillus subtilis serine protease can comprise an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 209 or 210.

[00610] Where the protein or peptide comprises a chitinase, the chitinase can comprise any of the chitinases described herein, including any of the endochitinases described in Section LB.

[00611] Where the protein or peptide comprises a glucanase, the glucanase can comprise any of the glucanases described herein, including any of the β-1,3- glucanases described in Section LB. [00612] Where the protein or peptide comprises a lactonase, the lactonase can comprise any of the lactonases described herein, including any of the AiiA lactonases described in Section LB.

[00613] Where the antimicrobial protein or peptide comprises a lactoferrin peptide, the lactoferrin peptide can comprise a LfcinB. The LfcinB can comprise any of the lactoferrin peptides described herein, including any of the LfcinB peptides described in Section LB.

[00614] For any of the aquaculture compositions or for any of the methods involving the use of an aquaculture system, the pathogen can comprise a fungal pathogen of the genus Lagenidium, a fungal pathogen of the genus Sirolpidium, Aeromonas hydrophila, or a combination of any thereof.

B. Methods for the Treatment or Prevention an Infection in a Wound, Adhesive Patches, Wound Dressings, and Compositions for use in Connection with the Methods, Adhesive Patches, and Wound Dressings

[00615] Methods for protecting an animal from a pathogen by preventing or treating an infection of a wound in an animal are provided.

[00616] A method of protecting an animal from a pathogen is provided. The method comprises administering spores to the animal by applying the spores to a wound of the animal. The spores are spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The protein or peptide that protects the animal from a pathogen does not comprise an antigen or an immunogen.

[00617] Alternatively or in addition, the method comprises administering exosporium fragments to the animal by applying the exosporium fragments to a wound of the animal. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the

recombinant Bacillus cereus family member.

[00618] The method preferably comprises applying the exosporium fragments to the wound of the animal.

[00619] The method can prevent or treat an infection of the wound. [00620] The method can prevent or inhibit biofilm formation in the wound or promote dissolution of a biofilm within the wound.

[00621] The method can comprise applying the exosporium fragments or spores to the wound in a pharmaceutical composition comprising the exosporium fragments or spores and a pharmaceutically acceptable carrier.

[00622] The composition can comprise a solution, a lotion, a cream, an ointment, a gel, a foam, a spray, a dip, or a bath.

[00623] Any of the pharmaceutical compositions described herein can comprise a solution, a lotion, a cream, an ointment, a gel, a foam, a spray, a dip, or a bath. Such

compositions are suitable for application to a wound of an animal.

[00624] Any of the pharmaceutical compositions described herein can be provided in an adhesive patch or a wound dressing.

[00625] An adhesive patch or wound dressing comprising a pharmaceutical composition is provided. The pharmaceutical composition comprises a pharmaceutically acceptable carrier and spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprising at least one protein or peptide that protects an animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00626] Alternatively or in addition, the adhesive patch or wound dressing can comprise a pharmaceutical composition comprising a pharmaceutically acceptable carrier and exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects an animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00627] In any of the methods involving application of exosporium fragments or spores to a wound of an animal, in any of the compositions suitable for application to a wound of an animal, or in any of the adhesive patches or wound dressings, the protein or peptide that protects the animal from a pathogen can comprise, for example, an enzyme an antibacterial peptide, an endotoxin (e.g., a delta endotoxin), a Cry protein, an antifungal peptide or protein, or a combination of any thereof. [00628] The enzyme can comprise an apyrase, a lactonase, a protease, a glucanase, a chitinase, or a combination of any thereof.

[00629] Where the enzyme comprises an apyrase, the apyrase can comprise any of the apyrases described herein, including any of the apyrases described in Section LB.

[00630] Where the enzyme comprises a lactonase, the lactonase can comprise any of the lactonases described herein, including any of the AiiA lactonases described in Section LB.

[00631] Where the enzyme comprises an antibacterial peptide, the enzyme can comprise any of the antibacterial peptides described herein, including any of the LfcinB or LysM peptides described in Section LB.

[00632] In any of the methods involving application of exosporium fragments or spores to a wound of an animal, in any of the compositions suitable for application to a wound of an animal, or in any of the adhesive patches or wound dressings, the pathogen can comprises a bacterial pathogen of the genus Streptococcus, a bacterial pathogen of the genus

Staphylococcus, a bacterial pathogen of the genus Pseudomonas, a bacterial pathogen of the genus Enter ococcus, or a combination of any thereof. Alternatively or in addition, the pathogen can comprise Acinetobacter baumannii.

C. Methods for the Prevention or Treatment of Hoof Infections, Insert Trays for Livestock Footbaths, and Hoof Bandages

[00633] Methods for protecting an animal from a pathogen by preventing or treating hoof infections in a hooved animal are provided. Such methods can be used, for example, for treating infectious pododermatitis (also known as hoof rot or foot rot) or Leptospirosis.

[00634] A method for protecting a hooved animal from a pathogen is provided. The method comprises applying spores to one or more hooves of the animal. The spores are spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The protein or peptide that protects the animal from a pathogen does not comprise an antigen or an immunogen.

[00635] Alternatively or in addition, the method comprises applying exosporium fragments to one or more hooves of the hooved animal. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00636] The method preferably comprises applying the exosporium fragments to the one or more hooves of the animal.

[00637] The method can prevent or treat an infectious disease that affects the hooves of the animal.

[00638] The infectious disease can comprise infectious pododermatitis or

Leptospirosis, thrush, white line disease, an infection caused by a bacterial pathogen of the genus Treponema, an infection caused by a bacterial pathogen of the genus Dichelobacter, an infection caused by a bacterial pathogen of the genus Fusobacterium, an infection caused by a bacterial pathogen of the genus Actinomyces, or a combination of any thereof.

[00639] The hooved animal can comprise a cow, a sheep, a bison, a buffalo, a deer, a horse, a mule, a camel, a pig, or a goat.

[00640] Applying the exosporium fragments or spores to the one or more hooves of the animal can comprise the use of a footbath. For example, the method can comprise walking the animal through a footbath containing a composition comprising the exosporium fragments or spores and a carrier. The composition can be present in the footbath at a depth that is sufficient for the composition to make contact with an infected area of the animal's hoof as the animal walks through the footbath. The composition can comprise a liquid, a semisolid, a water- dispersible granule, a dissolvable powder, a foam, a lotion, or a gel. For example, the

composition can comprise a liquid concentrate or powder for use in a footbath.

[00641] Moreover, any of the pharmaceutical compositions described herein can comprise a liquid, a semisolid, a water-dispersible granule, a dissolvable powder, a foam, a lotion, or a gel. For example, any of the pharmaceutical compositions described herein can comprise a liquid concentrate or powder for use in a footbath. Such compositions are suitable for use in connection with the methods that comprise applying spores or exosporium fragments to one or more hooves of a hooved animal.

[00642] An insert tray for a livestock footbath is provided. The insert tray comprises spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one protein or peptide that protects a hooved animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The spores are immobilized on an inner surface of the insert tray. [00643] Alternatively or in addition, the insert tray comprises exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprising at least one protein or peptide that protects a hooved animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The exosporium fragments are immobilized on an inner surface of the insert tray.

[00644] The insert tray can be inserted into a livestock footbath. The term "inner surface" as used herein in reference to the insert tray means the surface of the insert tray that would come into contact with the hoof of a hooved animal when the hooved animal steps into the footbath.

[00645] The spores or exosporium fragments can be immobilized on the inner surface of the insert tray by spray drying the spores or exosporium fragments onto the surface. The spores or exosporium fragments would then be released from the surface of the insert tray upon addition of water to the insert tray by the end user.

[00646] The insert tray preferably comprises the exosporium fragments.

[00647] When footbaths are used and the hooved animals are dairy animals, the application methods and dosage regimens will generally depend in part on the frequency of milking, since the footbath units are generally accessible to the animals as they make their way from the milking parlor back to their stalls, corrals, barns, or pastures.

[00648] Footbath applications typically comprise a tank filled with at least about 4 to 6 inches of composition, or enough to cover any abscess, sole bruise, interdigital skin, interdigital cleft, or any area where there is foot rot, hairy foot warts or laminitis on the hoof. The composition should be deep enough so as to make contact with any infected area of the hoof.

[00649] Foam applications are effective where the foam composition can be applied directly to the hoof in order to insure the hoof is thoroughly coated with the foam.

[00650] Gel applications can be used in a footbath system as a replacement for a liquid dip composition. The main advantage of gels are their thickness, which allows the for a longer contact period between the composition and the hoof.

[00651] In any of the methods that comprise applying exosporium fragments or spores to one or more hooves of a hooved animal, the exosporium fragments or spores can be applied to the one or more hooves of the animal using a hoof bandage. The hoof bandage can comprise a composition comprising the exosporium fragments or spores and a carrier.

[00652] A hoof bandage is provided. The hoof bandage comprises a pharmaceutical composition. The pharmaceutical composition comprises a pharmaceutically acceptable carrier and spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one protein or peptide that protects a hooved animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00653] Alternatively or in addition, the hoof bandage comprises a pharmaceutical composition comprising a pharmaceutically acceptable carrier and exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects a hooved animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the

recombinant Bacillus cereus family member.

[00654] The spores or exosporium fragments can be immobilized on a surface of the bandage that contacts the hoof of a hooved animal.

[00655] The pharmaceutical composition in the hoof bandage preferably comprises the exosporium fragments.

[00656] The surface of the hoof bandage that contacts the hoof of a hooved animal can comprise a fabric or a foam, and immobilizing the spores or exosporium fragments on the surface of the hoof bandage can comprise soaking the fabric or foam in a solution comprising the spores or exosporium fragments. Alternatively or in addition, the spores or exosporium fragments can be suspended in an oil, an emulsion, a polymer, or a gel. The hoof bandage can then be impregnated with the oil, emulsion, polymer, or gel. The exosporium fragments or spores would then be released from the bandage when the bandage is applied to the hoof of the hooved animal by the end user.

[00657] Hoof bandages allow the infected hoof to be kept free of water and prolong contact of the composition with the infected hoof.

[00658] In any of the methods that comprise applying exosporium fragments or spores to one or more hooves of a hooved animal, in any of the compositions that are suitable for use in such methods, in any of the insert trays, or in any of the hoof bandages, the protein or peptide that protects the animal from a pathogen can comprise a lactoferrin or lactoferrin peptide (e.g., LfcinB), a lysozyme or lysozyme peptide (e.g., LysM), a protease, a glucanase, an antimicrobial peptide or protein, an apyrase, a lactonase, or a combination of any thereof.

[00659] The LfcinB can comprise any of the LfcinB peptides described herein, including any of the LfcinB peptides described in Section LB.

[00660] The LysM can comprise any of the LysM peptides described herein, including any of the LysM peptides described in Section LB.

[00661] The protease can comprise any of the proteases described herein, including any of the Bacillus subtilis serine proteases described in Section LB.

[00662] The glucanase can comprise any of the glucanases described herein, including any of the β- 1,3 -glucanases described in Section LB.

[00663] The apyrase can comprise any of the apyrases described herein, including any of the apyrases described in Section LB.

[00664] The lactonase can comprise any of the lactonases described herein, including any of the AiiA lactonases described in Section LB.

[00665] For any of the methods that comprise applying exosporium fragments or spores to one or more hooves of a hooved animal, for any of the compositions that are suitable for use in such methods, for any of the insert trays, or for any of the hoof bandages, the pathogen can comprise Fusobacterium necrophorum, Prevotella melaninogenicus, Chrysosporium parvum, a bacterial pathogen of the genus Leptospira, a bacterial pathogen of the genus

Actinomyces, a bacterial pathogen of the genus Treponema, Dichelobacter nodosus, a bacterial pathogen of the genus Fusobacterium, or a combination of any thereof.

[00666] The pathogen can comprise a mixture of two or more pathogens.

D. Methods for Preventing or Treating Bloat in Ruminants, Feed, and Feed Additives

[00667] Methods for preventing or treating bloat in ruminants are provided. Feedlot bloat (ruminal acidosis) occurs when large amounts of starch are added to the diet. Under these conditions, the growth of certain bacteria such as Streptococcus bovis is no longer restricted by a lack of this energy source and the bacterial population of S. bovis grows faster than other species of rumen bacteria. S. bovis produces lactic acid, an acid ten times stronger than acetic, propionic or butyric acid, the accumulation of which eventually exceeds the buffering capacity of rumen fluid resulting in disease.

[00668] A method for protecting a ruminant animal from a pathogen is provided. The method comprises orally administering spores to the ruminant. The spores are spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The protein or peptide that protects the animal from a pathogen does not comprise an antigen or an immunogen.

[00669] Alternatively or in addition, the method comprises orally administering exosporium fragments to the ruminant. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00670] The method preferably comprises orally administering the exosporium fragment to the ruminant.

[00671] For example, the spores or the exosporium fragments can be orally administered to the ruminant by feeding the spores or the exosporium fragments to the ruminant.

[00672] The ruminant can comprise a cow, a sheep, a bison, a goat, a deer, or a horse.

[00673] The method can treat or prevent bloat in the ruminant.

[00674] Feed and feed additives are provided. The feed or feed additive comprises exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one protein or peptide that protects an animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00675] In any of the methods for protecting a ruminant animal from a pathogen or in any of the feed or feed additives, the protein or peptide that protects the animal from a pathogen can comprise a lactoferrin or lactoferrin peptide (e.g., LfcinB), a lysozyme or lysozyme peptide (e.g., LysM), an antimicrobial protein or peptide, an enzyme (e.g., apyrase, a protease, a glucanase, a lactonase, or a combination of any thereof), or a combination of any thereof.

[00676] The LfcinB can comprise any of the LfcinB peptides described herein, including any of the LfcinB peptides described in Section LB.

[00677] The LysM can comprise any of the LysM peptides described herein, including any of the LysM peptides described in Section LB. [00678] The apyrase can be any of the apyrases described herein, including any of the apyrases described in Section LB.

[00679] The protease can comprise any of the proteases described herein, including any of the Bacillus subtilis serine proteases described in Section LB.

[00680] The glucanase can comprise any of the glucanases described herein, including any of the β- 1,3 -glucanases described in Section LB.

[00681] The lactonase can comprise any of the lactonases described herein, including any of the AiiA lactonases described in Section LB.

[00682] The pathogen can comprise Streptococcus bovis, Fusobacterium

necrophorum, or a combination thereof.

E. Methods and Compositions for Preventing or Treating Mastitis in Animals

[00683] Methods for preventing or treating mastitis in animals are provided.

[00684] A method for protecting an animal from a pathogen is provided. The method comprises administering spores to an animal for prevention or treatment of mastitis. The spores are spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The protein or peptide that protects the animal from a pathogen does not comprise an antigen or an immunogen.

[00685] Alternatively or in addition, the method comprises administering exosporium fragments to the animal for prevention or treatment of mastitis. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00686] The method preferably comprises administering the exosporium fragments.

[00687] The animal can comprise a dairy animal

[00688] The animal can comprise a goat, a cow, a sheep, a buffalo, a camel, a yak, a horse, a reindeer, a human, a dog, a cat, or a donkey. [00689] The method can comprise administering the exosporium fragments or spores in a composition comprising the exosporium fragments or spores and a pharmaceutically acceptable carrier.

[00690] The composition can be applied topically to the udder or teat of the animal.

[00691] The topical administration can comprise dipping the udder or teat of the animal into the composition, spraying the composition onto the udder or teat of the animal, or a composition thereof.

[00692] The mastitis can comprise fungal mastitis (e.g., .fungal mastitis caused by Cryptococcus neoformans, Candida albicans, a fungal pathogen of the genus Prototheca, or a combination thereof).

[00693] The mastitis can comprise bacterial mastitis (e.g., bacterial mastitis caused by a bacterial pathogen of the genus Staphylococcus, a bacterial pathogen of the genus Escherichia, or a combination thereof).

[00694] Where the mastitis comprises bacterial mastitis, the method can further comprise coadministration of an antibiotic.

[00695] Any of the pharmaceutical compositions described herein can be in the form of a teat dip composition. Such compositions are suitable for use in the methods for prevention or treatment of mastitis.

[00696] The composition can further comprise an antibiotic.

[00697] However, one of the advantages of the compositions and methods for preventing or treating mastitis described herein is that they can avoid the overuse of antibiotics. Thus, the method preferably does not further comprise co-administration of an antibiotic.

Likewise, the composition preferably does not further comprise an antibiotic.

[00698] In methods or compositions where an antibiotic is used, the antibiotic can comprise a β-lactam (e.g., amoxicillin, ceftiofur, cephapirin, cloxicillin, hetacillin, penicillin, or a combination of any thereof), a lincosamide (e.g., pirlimycin), or a combination thereof.

[00699] In any of the methods for prevention or treatment of mastitis or in any of the compositions suitable for use in methods for prevention or treatment of mastitis, the protein or peptide that protects the animal from a pathogen can comprise a glucanase (e.g., β-1,3- glucanase), a lyticase, a chitinase, a apyrase, an antimicrobial peptide or protein, a protease, a lactoferrin or lactoferrin peptide (e.g., LfcinB), a lysozyme or lysozyme peptide (e.g., LysM), a lactonase, or a combination of any thereof. [00700] The LfcinB can comprise any of the LfcinB peptides described herein, including any of the LfcinB peptides described in Section LB.

[00701] The LysM can comprise any of the LysM peptides described herein, including any of the LysM peptides described in Section LB.

[00702] The apyrase can be any of the apyrases described herein, including any of the apyrases described in Section LB.

[00703] The protease can comprise any of the proteases described herein, including any of the Bacillus subtilis serine proteases described in Section LB.

[00704] The glucanase can comprise any of the glucanases described herein, including any of the β- 1,3 -glucanases described in Section LB.

[00705] The lactonase can comprise any of the lactonases described herein, including any of the AiiA lactonases described in Section LB.

[00706] The chitinase can be any of the chitinases described herein, including any of the endochitinases described in Section LB.

F. Methods and Compositions for Preventing or Treating Insect, Arachnid, or Nematode Infections or Infestations in Animals

[00707] Methods for preventing or treating insect or worm infections in animals are provided.

[00708] A method for protecting an animal from a pathogen by preventing or treating an insect, arachnid, or nematode infection or infestation is provided. The method comprises administering spores to the animal or to the insect, arachnid, or nematode. The spores are spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The protein or peptide that protects the animal from a pathogen does not comprise an antigen or an

immunogen.

[00709] Alternatively or in addition, the method comprises administering exosporium fragments to the animal or to the insect, arachnid, or nematode. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00710] The animal can comprise a livestock animal, a human, or a companion animal.

[00711] The animal can comprise a cow, a horse, a sheep, a goat, a pig, a bison, a camel, a donkey, a mule, a yak, a reindeer, a llama, a rabbit, a dog, a cat, a ferret, a gerbil, a guinea pig, a hamster, a mouse, a rabbit, a rat, a turkey, a chicken, a goose, or a duck.

[00712] The method can prevent or treat a fly or fly larvae infestation (e.g., a fly or fly larvae infestation in a horse or a cow).

[00713] The method can prevent or treat an arachnid infestation (e.g., an arachnid infestation in a human).

[00714] The method can comprise topically administering the exosporium fragments or the spores to the animal.

[00715] For example, the method can comprise administering the exosporium fragments or spores via a topical spray, a topical lotion, a topical cream, a topical gel, or a combination of any thereof.

[00716] The pharmaceutical compositions described herein, and in particular the topical pharmaceutical compositions described herein, can be used in connection with the methods for preventing or treating an insect, arachnid, or nematode infection or infestation.

[00717] In any of the pharmaceutical compositions or in any of the methods for preventing or treating an insect, arachnid, or nematode infection or infestation, the protein or peptide that protects the animal from the pathogen can comprise Mtxl, a delta endotoxin, a Cry toxin, chitinase, a secreted insecticidal (Sip) protein, or a combination of any thereof.

[00718] The Mtxl can comprise any of the Mtxl proteins described herein, including any of the Mtx proteins described in Section LB.

[00719] The method can comprise preventing or treating a nematode infection.

[00720] The method can comprise feeding the exosporium fragments or spores to the nematode.

[00721] The protein or peptide that protects the animal from a pathogen can comprise a nematicidal protein or peptide.

[00722] A nematicidal composition is provided. The composition comprises a carrier and exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one nematicidal protein or peptide and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the

recombinant Bacillus cereus family member.

[00723] In any of the methods for preventing or treating a nematode infection or in any of the nematicidal compositions, the nematicidal protein or peptide can comprise a chitinase, a Cry protein, a delta endotoxin, or a combination of any thereof.

[00724] The chitinase can comprise any of the chitinases described herein, including the endochitinases described in Section LB.

[00725] The chitinase can comprise chitinase C, chitinase D, or a combination thereof.

[00726] The Cry protein can comprise a Cry5B protein, a Cry21A protein, or a combination of any thereof.

[00727] The Cry21A protein can comprise any of the Cry21A proteins described herein, including the Cry21 A proteins described in Section LB.

[00728] In any of the methods for preventing or treating a nematode infection or in any of the nematicidal compositions, the exosporium fragments can comprise exosporium fragments derived from a Bacillus cereus family member that naturally expresses a Cry toxin, a nematicidal toxin, a chitinase, a protease inhibitor protein, or a combination of any thereof.

[00729] In any of the methods for preventing or treating a nematode infection, the method can further comprise administering exosporium fragments derived from & Bacillus cereus family member that naturally expresses a Cry toxin, a nematicidal toxin, a chitinase, a protease inhibitor protein, or a combination thereof.

[00730] In any of the nematicidal compositions, the composition can further comprise exosporium fragments derived from a Bacillus cereus family member that naturally expresses a Cry toxin, a nematicidal toxin, a chitinase, a protease inhibitor protein, or a combination thereof.

[00731] In any of the methods for preventing or treating a nematode infection, the method can further comprise administering a Cry protein or spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprising at least one Cry protein and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00732] In any of the nematicidal compositions, the composition can further comprise a Cry protein or spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprising at least one Cry protein and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

G. Methods for Protecting Animals from Pathogens by Killing Insect Vectors o f the

Pathogen, Insecticidal and Acaricidal Compositions, and Insect Foggers

[00733] Methods for protecting animals from pathogens by killing insect vectors of the pathogen are provided.

[00734] A method for protecting an animal from a pathogen by killing an insect or arachnid vector of the pathogen is provided. The method comprises contacting the insect or arachnid vector or larvae of the insect or arachnid vector with spores of a recombinant Bacillus cereus family member. The recombinant Bacillus cereus family member expresses a fusion protein. The fusion protein comprises at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae of the insect or arachnid vector and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00735] Alternatively or in addition, the method comprises contacting the insect or arachnid vector or larvae of the insect or arachnid vector with exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae of the insect vector and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00736] The method preferably comprises contacting the insect or arachnid or larvae or instars thereof with the exosporium fragments.

[00737] An insecticidal or acaricidal composition is provided. The composition comprising a carrier and exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae or instars of the insect or arachnid vector. The fusion protein further comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00738] The composition can be suitable for topical administration. For example, the can be in the form of a lotion, gel, cream, or lotion.

[00739] The composition can be in the form of a dry powder, a cake, or a water dispersible granule.

[00740] Any of the insecticidal or acaricidal compositions described herein, including both those described in the present Section and those described above in Section IV, can be suitable for use in an insect fogger

[00741] An insect fogger is provided. The insect fogger comprises a carrier and spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae or instars of the insect or arachnid vector. The fusion protein further comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00742] Alternatively or in addition, the insect fogger can comprise the carrier and exosporium fragments. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae or instars of the insect or arachnid vector. The fusion protein further comprises a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00743] In any of the methods that involve killing an insect or arachnid vector of a pathogen, in any of the insecticidal or acaricidal compositions, or in any of the insect foggers, the protein or peptide that has insecticidal or acaricidal activity preferably does not comprise a nucleic acid binding protein or peptide.

[00744] In any of the methods that involve killing an insect or arachnid vector of a pathogen, in any of the insecticidal or acaricidal compositions, or in any of the insect foggers, the protein or peptide that has insecticidal or acaricidal activity can comprise an insecticidal bacterial toxin (e.g., a VIP insecticidal protein), an acaricidal bacterial toxin, an endotoxin (e.g., a delta endotoxin), a Cry toxin, a protease inhibitor protein or peptide (e.g., a trypsin inhibitor or an arrowhead protease inhibitor), a secreted insecticidal (Sip) protein, a mosquitocidal toxin (e.g., a Mtx-like mosquitocidal toxin, a Bin-like mosquitocidal toxin, or a combination thereof), a cysteine protease, a Bacillus subtilis serine protease, a chitinase, or a combination of any thereof.

[00745] The Mtxl-like mosquitocidal toxin can comprise a Mtxl protein. The Mtxl protein can comprise any of the Mtxl proteins described herein, including any of the Mtxl proteins described in Section LB.

[00746] The Cry toxin can comprise a Cry toxin from Bacillus thuringiensis.

[00747] The Cry toxin can comprise a CrylAa protein, a CrylAb protein, a Cry 1 Ac protein, a CrylCa protein, a CrylDa protein, a Cry2Aa protein, a Cry3Aa protein, a Cry3Bb protein, a Cry4Aa protein, a Cry4Ab protein, a Cry 11 Aa protein, or a Cytl Aa protein.

[00748] The serine protease can comprise any of the Bacillus subtilis serine proteases described herein, including any of the Bacillus subtilis serine proteases described in Section LB.

[00749] The chitinase can comprise any of the chitinases described herein, including any of the endochitinases described in Section LB

[00750] For any of the methods that involve killing an insect or arachnid vector of a pathogen, for any of the insecticidal or acaricidal compositions, or for any of the insect foggers, the insect or arachnid vector can comprise a flea, a fly (e.g., a sandfly or blackfly), a tick, a mite, a mosquito, an assassin bug, or a combination of any thereof.

[00751] The larvae or instar of the insect or arachnid vector can comprise larvae of a flea, a fly (e.g., e.g., larvae of a sandfly or a blackfly), a tick, a mite, a mosquito, an assassin bug, or a combination of any thereof.

[00752] For any of the methods that involve killing an insect or arachnid vector of a pathogen, for any of the insecticidal or acaricidal compositions, or for any of the insect foggers, the pathogen can comprise a yellow fever virus, dengue virus, a bacterial pathogen of the genus Yersinia, a pathogenic worm of the genus Onchocerca, a Zika virus, a bacterial pathogen of the genus Ehlichia, a bacterial pathogen of the genus Anaplasma, a bacterial pathogen of the genus Borrelia, a pathogen of the genus Babesia, a pathogenic protist of the genus Leishmania, a pathogenic protist of the genus Trypanosoma, a pathogenic protist of the genus Schistosoma, a West Nile virus, a pathogenic protist of the genus Plasmodium, a bacterial pathogen of the genus Rickettsia, a Kawaskai virus, a chikungunya virus, a pathogenic worm of the genus Dirofilaria, an Eastern equine encephalitis virus, a Saint Louis encephalitis virus, a LaCrosse encephalits virus, a Western Equine Encephalitis virus, a Pappataci virus, or a combination of any thereof. [00753] In any of the methods that involve killing an insect or arachnid vector of a pathogen, in any of the insecticidal or acaricidal compositions, or in any of the insect foggers, the exosporium fragments can comprise exosporium fragments derived from a Bacillus cereus family member that naturally expresses an insecticidal toxin (e.g., a Cry protein), an acaricidal toxin, or a combination thereof.

[00754] For any of the methods that involve killing an insect or arachnid vector of a pathogen, the method can further comprise administering exosporium fragments derived from a Bacillus cereus family member that naturally expresses an insecticidal toxin (e.g., a Cry protein), an acaricidal toxin, or a combination thereof.

[00755] In any of the insecticidal or acaricidal compositions, or in any of the insect foggers, the composition or insect fogger can further comprise exosporium fragments derived from a Bacillus cereus family member that naturally expresses an insecticidal toxin (e.g., a Cry protein), an acaricidal toxin, or a combination thereof.

[00756] In any of the methods that involve killing an insect or arachnid vector of a pathogen, the method can further comprise administering an insecticidal toxin (e.g., a Cry protein), an acaricidal toxin, or a combination thereof or spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one insecticidal toxin (e.g., a Cry protein) or acaricidal toxin and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00757] In any of the insecticidal or acaricidal compositions, or in any of the insect foggers, the composition or insect fogger can further comprise an insecticidal toxin (e.g., a Cry protein), an acaricidal toxin, or a combination thereof or spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one insecticidal toxin (e.g., a Cry protein) or acaricidal toxin and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00758] In any of the methods that involve killing an insect or arachnid vector of a pathogen, the method can comprise contacting the insect or arachnid vector or larvae of the insect vector with the exosporium fragments or spores comprising spraying a composition comprising the exosporium fragments or spores into the environment of the insects or larvae, applying a composition comprising the exosporium fragments or spores to a body of water or insect breeding grounds, applying the exosporium fragments or spores to a host of the pathogen, or a combination of any thereof.

[00759] Spraying the composition comprising the exosporium fragments or spores into the environment can comprise use of a fogger.

[00760] In any of the methods that involve killing an insect or arachnid vector of a pathogen, the method can comprise applying the exosporium fragments or spores to a host of the pathogen by spraying the host with a composition comprising the exosporium fragments or spores, immersing the host in a composition comprising the exosporium fragments or spores, or a combination thereof.

VI. Methods for Producing an Immunogenic Response in an Animal

[00761] A method for producing an immunogenic response in an animal is provided.

The method comprises administering any of the vaccine compositions described above in

Section IV.B to the animal.

[00762] Methods for producing immunogenic responses in aquatic animals are also provided.

[00763] A method for producing an immunogenic response in an aquatic animal is provided. The method comprises administering exosporium fragments to the aquatic animal. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The exosporium fragments are administered to the aquatic animal by immersing the aquatic animal in a solution comprising the exosporium fragments.

[00764] Alternatively or in addition, the method comprises administering spores to the aquatic animal. The spores are spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The spores are administered to the aquatic animal by immersing the aquatic animal in a solution comprising the spores.

[00765] Another method for producing an immunogenic response in an aquatic animal is provided. The method comprises administering exosporium fragments to the aquatic animal. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The aquatic animal is selected from fish, amphibians, crustaceans, mollusks, and combinations of any thereof.

[00766] In any of the methods for producing an immunogenic response in an aquatic animal, administration of the exosporium fragments to the aquatic animal can result in vaccination of the aquatic animal against a pathogen selected from Renibacterium

salmoninarum, Yersinia ruckeri, Edwarsdiella ictaluri, Flavobacterium columnare, Aerococcus viridans, Aeromonas salmonicida, Aeromonas hydrophila, Leucothrix mucor, Vibrio vulnificus, Vibrio parahaemolyticus, Vibrio alginolyticus, a bacterial pathogen of the genus Shewanella spp., Xenohaliotis calif orniensis, Piscirickettsia salmonis, a pathogenic protist of the genus Saprolengia, Branchiomyces sanguinis, Branchiomyces demigrna, Icthyophous hoferi, and combinations thereof.

[00767] Another method for producing an immunogenic response in an aquatic animal is provided. The method comprises administering exosporium fragments to the aquatic animal. The exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein. The fusion protein comprises at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The administration of the exosporium fragments to the aquatic animal results in vaccination of the aquatic animal against a pathogen selected from Renibacterium salmoninarum, Yersinia ruckeri, Edwarsdiella ictaluri, Flavobacterium columnare, Aerococcus viridans, Aeromonas salmonicida, Aeromonas hydrophila, Leucothrix mucor, Vibrio vulnificus, Vibrio

parahaemolyticus, Vibrio alginolyticus, a bacterial pathogen of the genus Shewanella spp., Xenohaliotis calif orniensis, Piscirickettsia salmonis, a pathogenic protist of the genus

Saprolengia, Branchiomyces sanguinis, Branchiomyces demigrna, Icthyophous hoferi, and combinations of any thereof.

[00768] Alternatively or in addition, the method comprises administering spores to the aquatic animal. The spores are spores of a recombinant Bacillus cereus family member that expresses a fusion protein. The fusion protein comprises at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. The administration of the spores to the aquatic animal results in vaccination of the aquatic animal against a pathogen selected from Renibacterium salmoninarum, Yersinia ruckeri, Edwarsdiella ictaluri, Flavobacterium columnare, Aerococcus viridans, Aeromonas salmonicida, Aeromonas hydrophila, Leucothrix mucor, Vibrio vulnificus, Vibrio parahaemolyticus, Vibrio alginolyticus, a bacterial pathogen of the genus Shewanella spp., Xenohaliotis californiensis, Piscirickettsia salmonis, a pathogenic protist of the genus Saprolengia, Branchiomyces sanguinis,

Branchiomyces demigrna, Icthyophous hqferi, and combinations of any thereof.

[00769] In any of the methods for producing an immunogenic response in an aquatic animal, the method preferably comprises administering the exosporium fragments.

[00770] When the protein or peptide of interest is an antigen or immunogen, display of the antigen or immunogen on the outside of the spore or on an exosporium fragment provides an immune system response to achieve vaccination against various pathogens or diseases.

Suitable antigens or small molecules are those that are known or expected to illicit a desired immune response that is sufficient to yield a therapeutic or protective effect when expressed on the exterior of a Bacillus cereus family member spore or displayed on an exosporium fragment. Suitability in large part will be determined by the folding in the three-dimensional structure once the recombinant antigen is incorporated into the exosporium, i.e. the antigenic portion(s) of the recombinant molecule must be available for detection by the immune system.

[00771] The antigen or immunogen can comprise a heat shock protein, a coat protein, a capsule protein, an outer membrane protein, a cell wall protein, a flagellar protein, a fimbrial protein, a pilus protein, a ciliar protein, a protein toxin, an i-antigen, or a combination of any thereof.

[00772] The exosporium fragments or spores can be administered to the aquatic animal by immersing the aquatic animal in a solution comprising the exosporium fragments or spores, by feeding the exosporium fragments or spores to the aquatic animal, by injecting the exosporium fragments or spores into the aquatic animal, or a combination of any thereof.

[00773] The injection can comprise intramuscular injection.

[00774] The exosporium fragments or spores can be administered to the aquatic animal by immersing the aquatic animal in a solution comprising the exosporium fragments, spores, or a combination thereof.

[00775] The exosporium fragments or spores can be administered in a composition comprising a carrier and the exosporium fragments, the spores, or a combination thereof. [00776] The composition can further comprise an adjuvant. Suitable adjuvants for use in connection with producing an immunogenic response in an aquatic animal are described above in Section IV.B.3.

[00777] The aquatic animal can be selected from a fish, an amphibian, a reptile, a crustacean, a mollusk, or combinations of any thereof.

[00778] For example, the aquatic animal can be selected from a fish, a crustacean, or a combination thereof.

[00779] When the aquatic animal comprises a fish, the fish can comprise a hobby fish, a salmon, a trout, a halibut, a seabass, a snapper, a grouper, a mullet, a tilapia, a tuna, a catfish, a carp, a sturgeon, or a combination of any thereof.

[00780] When the aquatic animal comprises a crustacean, the crustacean can comprise a shrimp, a prawn, a krill, a lobster, a crab, a crayfish, or a combination of any thereof.

[00781] When the aquatic animal comprises a mollusk, the mollusk can comprise a mussel, a clam, an oyster, a scallop, a snail, a slug, a squid, a cuttlefish, an octopus, or a combination of any thereof.

[00782] The method can comprise administering the exosporium fragments to eggs of the aquatic animal.

VII. Routes of Administration

[00783] In any of the methods described herein wherein a composition, exosporium fragments, or spores are administered to an animal, the exosporium fragments or spores can be administered to the animal by topical, oral, intraperitoneal, intra-arterial, intravenous, intramuscular, subcutaneous, intrapleural, intranasal, rectal, intradermal, inhalation, transdermal, or transepithelial administration, or by immersing the animal into a solution comprising the exosporium fragments or spores.

[00784] Combinations of any of these routes of administration can also be used.

[00785] Where the administration comprises oral administration, the composition, exosporium fragments, or spores can be added to food or water, wherein the food or water is then consumed by the animal. VIII. Inactivation of Spores Prior to Use

[00786] In any of the methods described herein that comprise the use of spores of a recombinant Bacillus cereus family member, the method can further comprise inactivating the spores prior to use in the method.

[00787] Thus, the method can comprise inactivating the spores of the recombinant Bacillus cereus family member prior to administering the vaccine composition to the animal, prior to administering the spores to the animal, prior to administering the spores to the environment of the animal, prior to administering the spores to the pathogen, prior to

introducing the spores into the aquaculture system, prior to contacting the insect or arachnid vector or larvae of the insect or arachnid vector with the spores, or prior to administering the spores to the aquatic animal.

[00788] Any of the recombinant Bacillus cereus family members described herein can be in the form of a spore, wherein the spore is inactivated.

[00789] In any of the compositions, adhesive patches, wound dressings, insert trays, hoof bandages, or insect foggers that comprise spores, the spores can be inactivated.

[00790] For example, the spores can be physically or chemically inactivated, e.g., by heat treatment, gamma irradiation, x-ray irradiation, UV-A irradiation, UV-B irradiation, or treatment with a solvent such as gluteraldehyde, formaldehyde, hydrogen peroxide, acetic acid, bleach, chloroform, or phenol, or any combination thereof. Alternatively, the spores can be genetically inactivated by introducing a mutation that results in complete or partial inactivation of the spore.

[00791] Having described the invention in detail, it will be apparent that modifications and variations are possible without departing from the scope of the invention defined in the appended claims.

EXAMPLES

[00792] The following non-limiting examples are provided to further illustrate the present invention.

Example 1. Use of various targeting sequences to express lipase on the surface of Bacillus thuringtensts.

[00793] A wide variety of targeting sequences that that have a high degree of homology with amino acids 20-35 of Bel A (amino acids 20-35 of SEQ ID NO: 1) can be used to display enzymes, proteins, and peptides on the surface of Bacillus cereus family members. Several targeting sequences were compared by making fusion proteins containing the targeting sequences linked to Bacillus subtilis lipase. Fusion constructs were synthesized using the promoters native to the targeting sequence, cloned into the replicating plasmid pMK4, and introduced into Bacillus thuringiensis BT013A. Bacillus thuringiensis BT013A was deposited with the United States Department of Agriculture (USD A) Agricultural Research Service (ARS), having the address 1815 North University Street, Peoria, Illinois 61604 U.S.A., on March 10, 2014, and assigned NRRL deposit number B-50924. Bacillus thuringiensis BT013A is also known as Bacillus thuringiensis 4Q7.

[00794] Strains were taken into sporulation by incubation at 30°C on nutrient agar plates containing chloramphenicol 10 μg/ml for 3 days. Spores were collected, washed, and resuspended in PBS at a rate of lxl0 ⁸ /ml. 1 X 10 ⁵ spores for each fusion construct spores were suspended in 400 μΐ dH ₂ 0. The reactions were warmed with the reaction components to the desired reaction temperature (40°C). 200 μΐ working buffer was added (9: 1 Solution A: Solution B). Solution A was 50 mM Tris pH 10 and 13.6 mM deoxycholic acid and Solution B was 3 mg/ml p-nitrophenyl palmitate in isopropanol. The reaction was incubated at 40°C for 10 minutes and placed on ice, centrifuged to remove spores, and absorbance at 420 nm was recorded. The results are shown in Table 4 below. Activity was normalized to a control fusion protein comprising amino acids 1-35 of SEQ ID NO: 1 fused to Bacillus subtilis lipase.

Table 4.

Strain Targeting sequence Enzyme Relative activity

B. thuringiensis Amino acids 1-35 of SEQ ID NO: 1 Lipase 100%

BT013A

B. thuringiensis Amino acids 1-27 of SEQ ID NO: 3 Lipase 92.5%

BT013A

B. thuringiensis Amino acids 1-28 of SEQ ID NO: 7 Lipase 13.5%

BT013A

B. thuringiensis Amino acid 1-24 of SEQ ID NO: 9 Lipase 24.8%

BT013A

B. thuringiensis Amino acid 1-33 of SEQ ID NO: 13 Lipase 98.5%

BT013A

B. thuringiensis Amino acid 1-33 of SEQ ID NO: 21 Lipase 107.8%

BT013A

B. thuringiensis SEQ ID NO: 96 Lipase 137.1%

BT013A

B. thuringiensis SEQ ID NO: 98 Lipase 146.3%

BT013A

B. thuringiensis SEQ ID NO: 100 Lipase 115.7%

BT013A

B. thuringiensis SEQ ID NO: 104 Lipase 81.5%

BT013A [00795] Several targeting sequences linked to lipase result in higher expression levels and activity of enzyme on the surface of spores. In particular, SEQ ID NOs. 96, 98, and 100, each containing a shorter targeting sequence, resulted in enhanced fusion expression on the surface of the BEMD spores. All the fusion proteins containing targeting sequences tested resulted in surface display of lipase.

Example 2. Use of various exosporium sequences to express lipase on the surface of Bacillus thuringiensis and demonstration of fusion protein localization to the exosporium surface.

[00796] A wide variety of exosporium proteins can be used to display enzymes, proteins, and peptides on the surface of Bacillus cereus family members. Several different exosporium proteins were compared by making fusion proteins containing the exosporium proteins linked to Bacillus subtilis lipase as described in Example 1. Fusion constructs were synthesized using the promoter native to the exosporium protein indicated in Table 5 below, cloned into the replicating plasmid pMK4, and introduced into Bacillus thuringiensis BT013A. Spores displaying the various exosporium protein-Bacillus subtilis 168 lipase fusions were made by growing the transformed bacteria in brain heart infusion broth with selective pressure from 10 μg/ml chloramphenicol, plating onto nutrient agar plates, and incubating at 30°C for 3 days. After 3 days, the spores were washed off the plates, purified by centrifugation, and resuspended in PBS at 1 X 10 ⁸ CFU/ml.

[00797] 1 X 10 ⁵ spores for each fusion construct were resuspended in 400 μΐ dH ₂ 0. The reactions were warmed with the reaction components to the desired reaction temperature (40°C). 200 μΐ of working buffer was added (9: 1 Solution A: Solution B). Solution A was 50 mM Tris pH 10 and 13.6 mM deoxycholic acid and Solution B was 3 mg/ml p-nitrophenyl palmitate in isopropanol. The reaction was incubated at 40°C for 10 minutes and placed on ice, centrifuged to remove spores and absorbance at 420 nm was recorded. Results are shown in Table 5 below. Activity was normalized to SEQ ID NO: 109 linked to lipase.

Table 5.

Strain Exosporium protein Enzyme Relative activity

B. thuringiensis BT013A SEQ ID NO 109 Lipase 100%

B. thuringiensis BT013A SEQ ID NO 110 Lipase 134.5%

B. thuringiensis BT013A SEQ ID NO 113 Lipase 17.8%

B. thuringiensis BT013A SEQ ID NO 117 Lipase 19.8%

B. thuringiensis BT013A SEQ ID NO 118 Lipase 8.2% [00798] Use of the exosporium proteins of SEQ ID NOs. 109 and 110 resulted in the highest enzyme activity on the spore. All the fusion proteins containing exosporium proteins resulted in surface display of active Bacillus subtilis 168 lipase, albeit at different levels.

[00799] Additional exosporium proteins were demonstrated to result in targeting of fusion proteins to the exosporium using the fluorescent reporter mCherry. Fusion constructs were created that contained the exosporium proteins of SEQ ID NOs. I l l, 120, and 110 linked to the mCherry reporter. Spores were grown for 1.5 days, collected, and resuspended as described above. 7 μΐ of fluorescent spores were put under a Nikon El 000 microscope and imaged during late sporulation. Circular localization in a ring is indicative of outer spore layer localization, and the appearance matches that of an exosporium protein. Fluorescent microscopy results are shown in Figure 2. Panels A, B, and C of Figure 2 are fluorescent microscopy images of spores expressing fusion proteins comprising the exosporium proteins of SEQ ID NOs. I l l, 120, and 110, respectively, and the mCherry reporter. All three fusions demonstrated high levels of fluorescence and exosporium localization, demonstrating their potential utility for the expression of foreign proteins on the surface of the exosporium.

Example 3: Use of Various Targeting Sequences to Express Endoglucanase on the Surface of Bacillus cereus Family Member Spores

[00800] The pSUPER plasmid (described in Example 8 below) was modified by cloning of a PCR generated fragment through homologous recombination that fused the BclA promoter, start codon, and amino acids 20-35 of BclA (amino acids 20-35 of SEQ ID NO: 1) in frame with Bacillus subtilis 168 endoglucanase (pSUPER-BclA 20-35-Endo). PCR fragments were generated that contained the BclA promoter (SEQ ID NO: 149), start codon, and amino acids 20-35 of BclA fused in frame to Bacillus subtilis 168 endoglucanase. These PCR fragments were digested with Xhol and ligated into the Sail site of the pSUPER plasmid to generate the plasmid pSUPER-BclA 20-35-Endoglucanase. This plasmid was then subjected to inverse PCR to amplify the entire plasmid backbone, but leaving out the sequence corresponding to amino acids 20-35 of BclA. This inverse PCR product was combined with a PCR product that amplified the equivalent region from each of SEQ ID NOs. 5, 15, 25, 81, 85, 87, or amino acids

20-33 of SEQ ID NO: 1. Thus, constructs were created that contained each of the following targeting sequences fused in frame with Bacillus subtilis 168 endoglucanase: (1) amino acids

20-35 of SEQ ID NO: 1; (2) amino acids 23-38 of SEQ ID NO: 5; (3) amino acids 28-43 of

SEQ ID NO: 15; (4) amino acids 9-24 of SEQ ID NO: 25; (5) amino acids 23-38 of SEQ ID NO: 81; (6) amino acids 13-28 of SEQ ID NO: 85; (7) amino acids 13-28 of SEQ ID NO: 87; and (8) amino acids 20-33 of SEQ ID NO: 1. Each construct contained the wildtype BclA promoter and a methionine at the start codon, followed by the targeting sequence fused in frame to the Bacillus subtilis endoglucanase gene. Each of these constructs was transformed into E. coli and plated to obtain single colonies on Luria plates plus ampicillin (100 μg/ml). Plasmids from each single colony were grown up in overnight cultures in Luria broth plus ampicillin, and purified using a WIZARD SV miniprep kit, and sequences were verified by Sanger sequencing. DNA was also quantified via spectrophotometry, and the DNA was introduced into Bacillus thuringiensis BT013A. In addition, the pSUPER-BclA-20-35 Endo construct was introduced into Bacillus thuringiensis BT013A which had the native BclA protein removed from its genome through homologous recombination (BclA knockout, "BclA KO"). Correct colonies were screened by plating on nutrient broth plate containing antibiotic (tetracycline at 10 μg/ml). Each positive colony was grown up in brain heart infusion broth at 30°C overnight at 300 rpm, with antibiotic, and genomic DNA was purified and re-sequenced to verify genetic purity.

Verified colonies were grown overnight in brain heart infusion broth with 10 μg/ml tetracycline, and induced to sporulate through sporulation in a yeast extract-based media.

[00801] Each of the production runs in the yeast extract-based media were collected at 48 hours post production of spores, and subjected to enzyme comparison of the resultant spores. The assay for endoglucanase activity was performed by determining cellulase activity using a carboxymethylcellulose (CMC) substrate and a dinitrosalicylic acid (DNS reagent). A commercial source of cellulase enzyme was used to prepare standards in 50 mM citrate buffer, pH 4.8. 1% CMC (carboxymethylcellulose sodium salt) was prepared in 50 mM citrate buffer, pH 4.8, to serve as the substrate for the reaction. 250 μΐ of spore preparation was pelleted and the spores were resuspended in 150 μΐ _^ of 50 mM citrate buffer, pH 4.8. The reaction was carried out with a reagent composed of 1% DNS, 1% NaOH, 0.05% Na ₂ S0 ₄ , 0.2% phenol, and 18.2%) Rochelle salts. 150 μΐ of the sample was mixed with 250 μΐ of the 1%> CMC substrate and incubated in a water bath at 50°C for 15 minutes. 300 μΐ of DNS reagent was added and the samples boiled at 100°C for 10 minutes and then cooled on ice. The solution was centrifuged for 5 minutes at 14,000 X g to remove the spores from the absorbance reading. The absorbance was determined at 540 nm using an IMPLEN nanospectrophotometer model P330. Samples were performed in triplicate with a blank for each reaction. The results from the enzyme readings are shown in Table 6. Table 6. Enzyme levels.

AA=amino acids

D=not determined

[00802] The above data show that the use of different targeting sequences allows for control of the expression level of the enzyme on the outside of the spore. Use of amino acids 20- 35 of SEQ ID NO: 1 or AA 13-28 of SEQ ID NO: 85 as the targeting sequence resulted in the highest levels of enzyme production. This is surprising considering the low degree of identity between these targeting sequences (43.8% identity over the entire length of the targeting sequence). Expression of the fusion protein containing amino acids 20-25 of SEQ ID NO: 1 as the targeting sequence in the BT013A BclA KO host led to very large (263.8%) increase in the amount of enzyme activity on the surface of the spores as compared to expression of the same fusion protein in the wild-type strain.

Example 4: Use of Various Targeting Sequences and Exosporium Proteins to Express Phospholipase, Lipase, and Endoglucanase on the Surface of Bacillus cereus Family Member Spores

[00803] The pSUPER plasmid was modified by cloning of a PCR generated fragment (Xhol digestion and ligation) that fused the BclA promoter, start codon, and amino acids 20-35 of BclA (amino acids 20-35 of SEQ ID NO: 1) followed by a six alanine linker sequence in frame with either Bacillus thuringiensis phosphatidylcholine-specific phospholipase C gene (PC-PLC) (pSUPER-BclA 20-35-PL) or Bacillus subtilis lipase LipA (pSUPER-BclA-20-35- Lipase), or Bacillus subtilis endoglucanase eglS (pSUPER-BclA-20-35-Endo) as described above in Example 3. These plasmids were then subjected to inverse PCR to amplify the entire plasmid backbone, but without the sequence corresponding to amino acids 20-35 of BclA. This inverse PCR product was combined with a PCR product that amplified the equivalent region from each of SEQ ID NOs. 5 (i.e., amino acids 23-38 of SEQ ID NO: 5), 15 (i.e., amino acids 28-43 of SEQ ID NO: 15), and 25 (i.e., amino acids 9-24 of SEQ ID NO: 25); the full-length exosporium proteins of SEQ ID NOs. 120, 111, 121, 108, and 114; or amino acids 20-33, 20- 31, 21-33, 23-33, or 23- 31 of SEQ ID NO: 1. Each of these constructs contained the wild-type BclA promoter, a methionine at the start codon, followed by the targeting sequence or exosporium protein fused in frame to the Bacillus cereus phosphatidylcholine-specific phospholipase C, Bacillus subtilis 168 Lipase LipA, or Bacillus subtilis 168 eglS endoglucanase gene. Each of these constructs was screened for correct transformants as described in Example 3 above.

[00804] Each of the production runs in the yeast extract-based media were collected at 48 hours post production of spores, and subjected to enzyme comparison of the resultant spores. Determination of enzyme data for endoglucanase was performed as described above in Example 3. For the phospholipase C enzyme assay, 1 ml of recombinant spores was pelleted at 10,000 ^χ g for 3 minutes, and supernatant removed and discarded. The spore pellet was then resuspended in 500 μΐ reaction buffer (0.25 mM Tris-HCL, 60% glycerol, 20 mM o-nitrophenyl

phosphorylcholine, pH 7.2). A negative control for enzyme assays contained BT013A spores with no enzyme expression. Each sample was incubated at 37°C for 18 hours, centrifuged again to remove the spores, diluted 1 : 1 in water, and the Abs540 read using a spectrophotometer. This was compared to a standard curve against commercially purchased phospholipase and lipase controls to establish the U/ml of activity. The results from the enzyme readings are shown in Tables 7 and 8.

Table 7. Endo lucanase Enz me Levels

AA=Amino acids [00805] Many of the targeting sequences and exosporium proteins were able to display a large amount of active enzymes on the surface of the spores, including SEQ ID NOs. 108, 111, 114, 120, and 121. Amino acids 20-31, 21-33, and 23-31 of SEQ ID NO: 1 provided similar enzyme expression levels to amino acids 20-35 of SEQ ID NO: 1, indicating that smaller fragments are adequate for the display of enzymes on the surface of the spores. Only amino acids 23-33 of SEQ ID NO: 1 exhibited a diminished enzyme display level on the spores.

Table 8. Phos holi ase Enz me levels

AA=Amino acids

[00806] Similar to the results shown above in Table 7, the highest levels of phospholipase or lipase on the spore surface were observed when amino acids 20-35 of SEQ ID NO: 1, amino acids 23-38 of SEQ ID NO: 5, or the exosporium protein sequence of SEQ ID NO: 120 were used.

Example 5. Enhanced expression of fusion constructs on the BEMD system by use of enhanced or alternative promoter elements.

[00807] The BEMD system can display a wide range of proteins, peptides, and enzymes using one or more of the targeting sequences described herein. Some of these targeting sequences have a high affinity for the exosporium which would be beneficial for fusion protein expression, but their low fusion protein expression level limits their use on the BEMD system.

For such fusion proteins and sequences, alternative high-expression sporulation promoters can be used instead of the native promoters.

[00808] For example, SEQ ID NO: 13 (amino acids 1-39 of B. weihenstephensis

KBAB4 gene 3572) provides a very effective N-terminal sequence for the delivery of proteins to the exosporium of Bacillus cereus family members, as shown in Table 9 below. All genes were synthesized in their complete form (including promoter regions and regions coding for fusion proteins) as described herein. When the native promoter elements for B. weihenstephensis KBAB4 gene 3572 (SEQ ID NO: 177) were used to express a fusion protein comprising the targeting sequence of SEQ ID NO: 13 fused to a β-galactosidase enzyme (from E. coli), a low level of fusion protein was expressed, leading to a reduction in enzyme activity on the surface of the spore. Enzyme activity was measure by the conversion of 0.5M o-nitrophenylgalactoside in solution over 10 minutes. Enzyme conversion was measured with a spectrophotometer at ABS ₅₄₀ . Replacement of the native promoter elements of the B. weihenstephensis KBAB4 gene 3572 with the high-expression promoters of SEQ ID NO: 157 (B. anthracis BetA/BAS3290) or SEQ ID NO: 178 (B. weihenstephensis KBAB4 YVTN β-propeller protein) led to a dramatic increase in the enzymatic activity of the spores. On the other hand, replacement of the native promoter elements for B. weihenstephensis KBAB4 gene 3572 with the promoter native to B. anthracis Sterne BAS1882 (SEQ ID NO: 176) led to a decrease in the enzymatic activity of the spores. The expression level of the targeting sequence of SEQ ID NO: 13 fused to β- galactosidase was much lower (0.38X) when driven by the promoter of BAS1882 (SEQ ID NO: 176), and was greatly improved when driven from the BetA promoter (SEQ ID NO: 197) or YVTN protein promoter (SEQ ID NO: 178).

Table 9

Example 6. Expression levels of fusion proteins using various Sigma-K containing promoters.

[00809] As shown in Example 5 above, replacing the native promoter of a targeting sequence, exosporium protein, or exosporium protein fragment can greatly affect the level of fusion protein expressed on the exosporium of a Bacillus cereus family spore. For example, replacing the native BclA promoter with the BclB promoter greatly reduces the level of fusion protein on the surface of Bacillus cereus family member spores. Alternatively, replacement of native BclB promoter with the BclA promoter increases fusion protein levels on the exosporium dramatically.

[00810] Relative promoter expression levels for various exosporium proteins under the control of their native sporulation promoters were obtained from microarray data from Bergman et al., 2008. The relative expression levels were determined during late sporulation timing (300 minutes after the start of the experiment), when sigma K promoters are most active. Sigma K promoters are key promoters for expression of exosporium localized genes and associated proteins. Relative expression is the increase in a gene's expression level when compared to the average of all other genes of the chromosome at all given times. Table 10 below shows the relative expression levels of a variety of sigma K driven genes in Bacillus cereus family members.

Table 10.

Example 7. Preparation of exosporium fragments from recombinant Bacillus cereus family members comprising a knockout of the CotE gene.

[00811] The plasmid pUCpE was constructed that contained the pUC19 backbone, which is able to replicate in E. coli, as well as the origin of replication erythromycin resistance cassette from pE194. This construct is able to replicate in both E. coli and Bacillus spp. A 1 kb

DNA region corresponding to the upstream region of the CotE gene and a 1 kb region corresponding to the downstream region of the gene CotE were PCR amplified from Bacillus anthracis ASterne. The two 1 kb regions were then spliced together using splicing by overlapping extension via 15 bp homologous overhangs that corresponded to the opposing PCR amplicons. This 2 kb fragment was digested with Xhol (in external primers) and ligated into the

Sail site of pUCpE. This plasmid construct was verified by digestion and DNA sequencing. A

Gram-positive omega-kanamycin resistance gene was digested with BamHI and placed between the two 1-kb regions. The final construct was again PCR verified and sequenced, and the final plasmid was introduced into Bacillus anthracis ASterne. Correct clones were screened by looking for both erythromycin resistance and kanamycin resistance.

[00812] Clones were passaged under high temperature (40°C) in brain heart infusion broth in the presence of kanamycin (25 μg/ml) and were routinely struck for isolation onto LB agar plates containing kanamycin and grown at 30°C. Individual colonies were toothpicked onto LB agar plates containing erythromycin 5 μg/ml and grown at 30°C. Clones that maintained kanamycin resistance but lost erythromycin resistance (signifying loss of the plasmid but recombination and removal of the CotE gene) were grown in brain heart infusion broth plus kanamycin, and chromosomal DNA was isolated using a Qiagen Chromosomal DNA isolation kit. Proper deletion of the CotE gene was determined by PCR amplification of the CotE gene region and loss of CotE, and gain of the kanamycin resistance cassette.

[00813] A construct was generated (pHP13-AcpC-eGFP) that encoded the exosporium protein AcpC (acid phosphatase) fused in frame to the fluorescent reporter protein eGFP (enhanced green fluorescent protein). The pHP13-AcpC-eGFP construct included the native AcpC promoter, ribosomal binding site, and coding sequence for AcpC (from B.

anthracis ASterne), fused in frame to eGFP (from pGFPuv). This construct was generated by PCR amplification of the individual AcpC and eGFP genes with corresponding primers that contained a 15 bp overlapping region corresponding to the alternate amplicons. The two PCR amplicons were then purified, and combined into a second PCR reaction using external primers that contained Xhol sites. The two amplicons prime each other with their compatible ends, and create a fusion PCR amplicons, that were purified and digested with Xhol for 1 hour at 37°C. The spliced PCR product was cloned into the Sail site of pFIP13, and correct clones were sequence verified and transformed into SCSI 10 E. coli. The plasmid DNA was subsequently isolated from the E. coli and introduced into B. anthracis ASterne CotE: :Kan, generated as described above, which was grown in brain heart infusion broth containing 10 μg/ml chloramphenicol overnight at 30°C. One milliliter of this culture was inoculated into nutrient broth (50 ml) in a baffled flask and grown at 30°C for 3 days. Spores were collected via centrifugation at 10,000 X g for 5 minutes, and the supernatant (containing the broken exosporium fragments) was filtered through a 100,000 Da membrane filter to obtain purified exosporium fragments containing the fusion proteins.

[00814] A transmission electron micrograph showing the CotE knockout spores is provided in Figure 3. The closed arrows indicate fragments of exosporium that have been separated from the spores, and the open arrow indicates a spore from which the exosporium has been removed.

[00815] The purification of the exosporium fragments was performed as follows: CotE: :kan spores were grown in brain heart infusion broth overnight at 30°C and swabbed onto nutrient agar plates and grown at 30°C for 3 days. After 3 days, the spores were collected by swabbing the plates with cotton swabs wetted with PBS and resuspended into 1 ml of PBS in a microcentrifuge tube. The spores were separated from the culture by centrifugation, and the supernatant containing the exosporium fragments was filtered through a 0.22 μΜ filter to remove any residual spores. The filtrate was then filtered through a 100 kDa filter to collect exosporium fragments but allow free proteins to pass through the filter. The 100 kDa filter was washed, and the collected exosporium fragments boiled in SDS buffer for 5 minutes and separated by SDS-PAGE electrophoresis. Figure 4 provides a photograph of an SDS-PAGE gel showing the purified exosporium fragments (lane 2) and a protein marker standard (lane 1). The exosporium fragments shown in lane 2 represent the individual proteins that constitute the exosporium fragments. Only a subset of bands that would normally be seen in a whole spore SDS-PAGE preparation is apparent.

[00816] Ten microliters of the exosporium fragment preparation containing the AcpC- eGFP fusion protein was tested for activity in a phosphatase assay against p PP (p-nitrophenyl polyphosphate). Acid phosphatase activity was detected by spectrophotometry based on release of p-nitrophenol from phosphate through phosphatase activity. Briefly, 1 ml of 10 mM pNPP in phosphate buffer at pH 6.0 was incubated with exosporium fragments in a 1 ml microcentrifuge tube and allowed to incubate at 37°C for 10 minutes. After 10 minutes, the tube was centrifuged for 1 minute to remove excess spores, and the supernatant read on a spectrophotometer at 420 nm for free p-nitrophenol. It was found that the purified exosporium fragments were able to effectively release the phosphate groups from pNPP, demonstrating that the AcpC was present in the exosporium fragments. The results of this assay are shown in Figure 5. In Figure 5, "CotE control spores" refers to CotE knock-out spores alone (not expressing the AcpC-eGFP fusion protein), "CotE Acp-eGFP" refers to the CotE knock-out spores expressing the AcpC-eGFP fusion protein, and "CotE AcpC-eGFP fragments" refers to the exosporium fragments obtained as described above from the CotE knock-out spores expressing the AcpC-eGFP fusion protein.

[00817] These results demonstrate that mutations that disrupt the exosporium, such as a knock-out mutation in the CotE gene, can be used to generate exosporium fragments that are substantially free of spores, and demonstrates that these exosporium fragments contain fusion proteins that are targeted to the exosporium.

Example 8: Generation of recombinant Bacillus cereus family members displaying ovalbumin or the Bacillus anthracis protective antigen.

[00818] The Gallus gallus ovalbumin gene from GenScript ORF clone OGa28271C and the Bacillus anthracis protective antigen (pagA) gene were amplified via polymerase chain reaction (PCR) using the primers shown below in Table 11. The amino acid sequence encoded by the ovalbumin gene is provided in SEQ ID NO: 217 and the amino acid sequence encoded by the pagA gene is provided in SEQ ID NO: 218.

Table 11.

[00819] The resulting PCR fragments were cloned into one of three expression plasmids (pSUPER-BclA-FL, pSUPER-BclA 20-35, or pSUPER-AcpC) using the splicing by overlapping extension (SOE) technique. The pSUPER-BclA-FL plasmid was generated through fusion of a PCR fragment which contained the BclA promoter (SEQ ID NO: 149), start codon, and coding sequence for full-length (FL) BclA fused in frame into the pSUPER plasmid. The pSUPER-BclA-20-35 plasmid was generated through fusion of a PCR fragment which contained the BclA promoter (SEQ ID NO: 149), start codon, and a coding sequence for amino acids 20-35 of BclA (amino acids 20-35 of SEQ ID NO: 1) fused in frame into the pSUPER plasmid. The pSUPER-AcpC plasmid was generated through fusion of a PCR fragment with included the native AcpC promoter (SEQ ID NO: 141), ribosomal binding site, and coding sequence for AcpC (from B. thuringiensis B TO 13 A; SEQ ID NO: 120), fused in frame into the pSUPER plasmid. The pSUPER plasmid was generated through fusion of the pUC57 plasmid (containing an ampicillin resistance cassette) with the pBC16-l plasmid from Bacillus

(containing a tetracycline resistance). This 5.5 kbp plasmid can replicate in both E. coli and Bacillus spp.

[00820] The pSUPER-BclA-FL-OVAL construct generated using these methods encodes a fusion protein comprising full-length BclA and ovalbumin, and the pSUPER-BclA- FL-PAG encodes a fusion protein comprising full-length BclA and the B. anthracis protective antigen. These constructs were transformed into and propagated in E. coli strains. The sequences of the plasmids were verified by DNA sequencing.

[00821] In order to remove the E. co/z ^' -derived portions of the pSUPER plasmids and create smaller plasmids for expression in Bacillus, sequence-verified pSUPER constructs were amplified with primers that amplify the Bacillus-denved segment of the plasmid backbone. The resulting PCR products were self-ligated to generate the pBC plasmids (pBC-BclA-FL-OVAL plasmid and pBC-BclA-FL-PAG) that were used to transform various Bacillus strains in the examples below.

Example 9: Preparation and purification of exosporium fragments.

[00822] Knock out (KO) Mutants: To make exsY and cotE knockout (KO) mutant strains of Bacillus thuringiensis BT013A, the plasmid pKOKI shuttle and integration vector was constructed that contained the pUC57 backbone, which is able to replicate in E. coli, as well as the origin of replication erythromycin resistance cassette from pE194. This construct is able to replicate in both E. coli and Bacillus spp. A 1 kb DNA region that corresponded to the upstream region of the cotE gene and a 1 kb region that corresponded to the downstream region of the gene cotE were PCR amplified from Bacillus thuringiensis BT013 A. A second construct was made that contained the 1 kb DNA region that corresponded to the upstream region of the exsY gene and a 1 kb region that corresponded to the downstream region of the gene exsY, both of which were PCR amplified from Bacillus thuringiensis BT013A. For each construct, the two 1 kb regions were then spliced together using homologous recombination with overlapping regions with the pKOKI plasmid. The plasmid constructs were verified by digestion and DNA sequencing. Clones were screened by looking for erythromycin resistance.

[00823] Clones were passaged under high temperature (40°C) in brain heart infusion

(BHI) broth. Individual colonies were toothpicked onto LB agar plates containing erythromycin

5μg/ml, grown at 30°C, and screened for the presence of the pKOKI plasmid as a free plasmid by colony PCR. Colonies that had an integration event were continued through passaging to screen for single colonies that lost erythromycin resistance (signifying loss of the plasmid but recombination and removal of the exsY or cotE gene). Verified deletions were confirmed by

PCR amplification and sequencing of the target region of the chromosome. The pBC-BclA-FL-

OVAL plasmid was transformed into the exsY knockout mutant and the pBC-BclA-FL-PAG plasmid was transformed into the cotE KO mutant. The pBC-BclA-FL-OVAL and pBC-BclA-

FL-PAG plasmids are described above in Example 8. [00824] Exosporium Fragment Creation: For each of the two KO mutants, overnight cultures were grown in BHI media at 30°C, 300 rpm, in baffled flasks with antibiotic selection. One milliliter of this overnight culture was inoculated into a yeast extract-based media (50 ml) in a baffled flask and grown at 30°C for 3 days. An aliquot of spores was removed, 1% Tween was added, and the spores were agitated by vortexing for one minute. The spores were collected via centrifugation at 10,000 X g for 5 minutes, and supernatant containing the exosporium fragments was filtered through a 0.22 μΜ filter to remove any residual spores. The supernatant (containing the exosporium fragments) was filtered through a 100,000 Da membrane filter to obtain purified exosporium fragments containing the fusion proteins. Smaller molecular weight proteins were removed by passaging through the 100 kDa filter. No spores were found in the filtrate or retentate of the supernatant.

[00825] Transmission electron micrographs are provided in Figure 6 showing intact spores of Bacillus thuringiensis BT013A (panel A) surrounded by attached exosporium, spores of the Bacillus thuringiensis BT013A ExsY knock-out mutant (panel B), and spores of the Bacillus thuringiensis BT013A CotE knock-out mutant (panel C) from which the exosporium has detached. The arrow in panel A of Figure 6 indicates the layers of exosporium of intact BT013A spores, while arrows in panels B and C of Figure 6 indicate exosporium that has detached from the spores in both the CotE and ExsY mutants. Images were taken on a JEOL JEM 1400 transmission electron microscope. No visible exosporium fragments were observed when control spores expressing a fusion protein {Bacillus thuringiensis BT013A without the CotE knockout, expressing the BclA-FL-OVAL fusion protein, data not shown) were subjected to same centrifugation and filtration procedures described above.

[00826] Presence of BclA-FL-OVAL or BclA-FL-PAG Protective Antigen in Exosporium Fragments Collected from the CotE and ExsY Knockout Mutants:

Exosporium fragments were created and purified as described above from spores that contained the pBC-BclA-FL-OVAL or pBC-BclA-FL-PAG plasmid. These spores create an exosporium that contains fusion proteins comprising full-length BclA and ovalbumin or protective antigen A. Exosporium fragments containing these constructs were created from the cotE knockout mutant spores and the exsY knockout mutant spores. The ovalbumin or protective antigen A protein concentration was determined by dot blot. Table 12 below summarizes the dot blot results as compared to purified protein. Briefly, an enriched exosporium fragment fraction generated as described above, whole cell broth, or purified ovalbumin or protective antigen was blotted onto nitrocellulose and then probed with commercially available rabbit polyclonal antibodies against full-length ovalbumin or Bacillus anthracis protective antigen. Whole cell broth was taken from the overnight cultures as described above in Example 9, and not subjected to any vortexing, filtration, or centrifugation steps. The blots were then developed with horseradish peroxidase (HRP)-conjugated secondary antibodies. The ovalbumin and protective antigen antibodies were verified by Western blot for size and specificity. Western blots were performed using purified ovalbumin and protective antigen proteins. The ovalbumin and protective antigen antibodies recognized bands of the correct size and did not cross-react with untransformed whole cell broth from Bacillus thuringiensis BT013A.

[00827] Dot blot results are shown below in Table 12. The results show that the protein of interest (OVAL or PAG) was present in both the whole cell broth and exosporium fragment-enriched fractions. Most of the protein of interest was retained in the exosporium fragment-enriched fractions, demonstrating that the proteins of interest were present on the exosporium fragments.

Example 10. Presence of BclA 20-35-endoglucanase in exosporium fragments collected from the CotE and ExsY Knockout and CotO Dominant Negative Mutants

[00828] To provide a further demonstration that exosporium fragments containing fusion proteins can be generated using the CotE knockout and ExsY knockout strains, and to demonstrate that exosporium fragments can be generated using CotO dominant negative strains,

PCR fragments were generated that contained the BclA promoter (SEQ ID NO: 149), start codon, and amino acids 20-35 of BclA fused in frame to Bacillus subtilis 168 endoglucanase.

These PCR fragments were digested with Xhol and ligated into the Sail site of the pSUPER plasmid to generate the plasmid pSUPER-BclA 20-35-Endoglucanase.

[00829] The CotE and ExsY knockout mutants were generated as described above in

Example 9.

[00830] Dominant Negative Mutants: To create dominant negative mutants, PCR amplification was performed on the N-terminal half and the C-terminal half of CotO (SEQ ID NO: 199), containing amino acids 1-81 and 81-199 respectively. These fragments were cloned into the pHP13 E coli/Bacillus shuttle vector using homologous recombination. Correct clones were verified by Sanger sequencing. Each of the two CotO dominant negative mutants was introduced into Bacillus thuringiensis BT013A.

[00831] Exosporium fragments were created and purified as described in Example 9 from spores that contained the pSUPER Bel A 20-35-Endo plasmid. These spores create an exosporium that displays fusion proteins comprising full-length BclA linked to endoglucanase. Exosporium fragments containing this construct were created from the cotE knockout mutant spores, exsY knockout mutant spores, CotO N-terminal dominant negative mutant spores, or CotO C-terminal dominant negative mutant spores. In each of these experiments, the amount of activity for the endoglucanase on the exosporium fragments was quantified as a percentage of the total enzyme levels. These results were compared against results generating using wild-type Bacillus thuringiensis BT013A that did not contain any mutations, but did contain the pSUPER BclA 20-35-Endo plasmid. The results are shown in Table 13 below.

[00832] These results demonstrate that mutations that disrupt the exosporium, such as a knock-out mutation in the cotE or exsY gene, or a dominant negative mutation in the CotO protein, can be used to generate exosporium fragments that are substantially free of spores, and demonstrates that these exosporium fragments contain fusion proteins that are targeted to the exosporium. There was a small amount of background endoglucanase activity in the exosporium fragment preparation from the BT013 strain having no mutations and expressing the BclA 20-25 Endo construct (BT013A BclA 20-35 Endo). This was unexpected and may represent a low level of unstable exosporium that is being released from spores and captured during the exosporium fragment collection process. CotE and ExsY KO strains contain the highest amount of enzyme in the exosporium fragment fraction. The CotO dominant negative mutants that express a fusion protein also have an elevated level of enzyme in the exosporium fragment fraction. Example 11: Use of exosporium fragments for vaccination of fish and to generate simultaneous protection against two antigens.

[00833] Vaccination of fish using exosporium fragments containing full-length

BclA linked to antigenic proteins, and use to simultaneously generate immunity against two different antigens: Full-length BclA linked to ovalbumin (pBC-BclA-FL-OVAL) was expressed in the exsY KO mutant and full-length BclA linked to protective antigen (pBC-BclA-

FL-PAG) was expressed in the cotE KO mutant as described above in Example 9. Purified exosporium fragments were prepared as described above in Example 9.

[00834] Purified exosporium fragments were diluted into in endotoxin-free

Dulbecco's phosphate buffered saline (DPBS) for a final concentration of 1 mg/ml protein. Both types of purified exosporium fragments (the fragments from the exsY KO mutant containing the BclA-FL-OVAL fusion protein and the fragments from the cotE KO mutant containing the BclA-FL-PAG fusion protein) were coinjected or fed to adult zebrafish with and without Freund's Complete Adjuvant (FCA). Kidney tissue was collected and examined for detection of an antibody response (by dot blot) and for specific antibodies (ELISA).

[00835] Two different immunization methods were used: intramuscular injection and feed immunization. For immunization by intramuscular injection, fish were anaesthetized with 0.168 mg/ml tricaine (3-amino benzoic acid ethylester). Adult zebrafish were injected intramuscularly between the dorsal fin and the lateral line with 5 μΐ of the exosporium fragment solution (containing both types of exosporium fragments) with a fine Hamilton syringe with a 36G needle to prevent negative effects of delivery.

[00836] Feed immunization was also performed. Zebrafish were given an

immunization food mixture containing a 1 : 10 ratio of purified exosporium fragments carrying BclA-antigen fusion proteins in liver paste that was hand fed by oral droplet into holding tanks to each animal to ensure the total amount was ingested.

[00837] No booster immunizations were performed for either immunization method.

[00838] Detection of antibodies by dot blot analysis and ELISA in fish injected or fed with exosporium fragments containing BclA-antigen fusion proteins: Generation of OVAL-specific antibodies, PAG-specific antibodies, and memory antibodies in the fish immunized by intramuscular injection was measured in the kidney 14 days after immunization in 8 animals per group. Zebrafish were euthanized by immersion in ice. Kidneys were removed from each fish and pooled into a single group on ice, homogenized, and centrifuged to pellet cellular debris. The supernatants containing soluble proteins were assayed for activity. [00839] In the feeding assay, animals were sacrificed at 3, 5 and 7 days post immunization with 3 animals per group and assayed for the generation of an immune response. Serum and kidneys were collected in the same manner as described above for the animals immunized by injection. Table 14 below shows the immune response as determined by dot blot analysis for zebrafish immune cells in this feeding assay. For detection of zebrafish IgM (zIgM), the kidney lysates were serially diluted and 2 μΐ _^ placed on nitrocellulose membranes and allowed to dry. The membrane was washed three times with PBST (phosphate-buffered saline with TWEEN detergent) and then blocked with 5% (w/v) skim milk in PBST for 2 hours. After washing with PBST, monoclonal mouse anti-zIgM was incubated with the membrane for 2 hours. Lysates from unimmunized zebrafish served as a negative control. After further washing steps, the membranes were incubated with anti-mouse HRP -linked antibody at a dilution of 1 :3000 as a secondary antibody for 1 hour. Finally, the membrane was observed by developing with PIERCE Fast Western Blot Kit Enhanced Chemiluminescense (ECL) Substrate (a peroxidase substrate). Results are shown in Table 14 below. The images were quantified using GENESYS image acquisition software.

Table 14: Zebrafish Immune Response to Feeding of Exosporium Fragments as Assessed by Kidney Immune Cell Generation

[00840] For zebrafish immunized by intramuscular injection, screening for generation of target-specific antibodies was also determined by enzyme-linked immunosorbent assay (ELISA) with NI CIMMUNO plates (96-wellplates for ELISA assays). Briefly, samples were collected from zebrafish after immunization to detect whether zIgM immune cells would cross react with poyclonal OVAL antibody generated from rabbit. The plates were coated by incubation with zIgM overnight. The kidney lysate was serially diluted and allowed to bind to the zIgM coated plate to retrieve all the immunoglobulin from the sample. The rabbit polyclonal antibody to OVAL was then allowed to bind to the specific fish immunoglobulin. Horseradish peroxidase (HRP)-conjugated goat anti-rabbit was then used as a conjugate to develop the ELISA. Results were quantified with a BIO-TEK microplate reader and GEN5 software. [00841] For detection of zlgM by dot blot, the kidney cell lysates were serially diluted and placed on solid-phased PVDF membranes and allowed to dry. The membrane was washed three times with PBST (phosphate-buffered saline with TWEEN detergent) and then blocked with 5% (w/v) skim milk in PBST for 2 hours. After washing with PBST, monoclonal mouse anti-zIgM was incubated with the membrane for 2 hours. Lysates from unimmunized zebrafish served as a negative control. After further washing steps, the membranes were incubated with anti-mouse HRP -linked antibody at a dilution of 1 :3000 as a secondary antibody for 1 hour. Finally, the membrane was observed by developing with PIERCE Fast Western Blot Kit Enhanced Chemiluminescense (ECL) Substrate (a peroxidase substrate). Results are shown in Table 15 below. * indicates statistically significant results by paired student t-test as compared to the negative control (saline injected). "Peptide OVA/PAG" refers to a mixture of purified ovalbumin and protective antigen A. "exsY K/O, cotE IO" refers to a mixture of exosporium fragments derived from exsY KO and cotE KO mutants that were not transformed with the BclA-FL-OVAL or BclA-FL-PAG constructs.† indicates that the results for the exosporium fragments derived from the non-transformed mutants represent total antibody.

Table 15: Zebrafish Immune Response to Two Antigens Codelivered at 14 Days After Injection of Exosporium Fragments, as Assessed by Kidney Immune Cell Generation and S ecific Reaction

Example 12: Use of exosporium fragments for vaccination of fish using antigenic proteins derived from fish pathogens.

[00842] Expression of fusion proteins containing full-length BclA and antigenic proteins in Bacillus cereus family member mutants that allow for collection of free exosporium. Proteins of fish pathogens are useful as antigens in developing fish vaccines. Table 16 below describes constructs encoding fusion proteins comprising Bel A linked to various antigenic proteins from fish pathogens. Each of these constructs will be cloned into Bacillus cereus family members having one of the mutations described above in Example 9 and 10 that allow for the collection of exosporium fragments (the exsY and CotE knockout and CotO dominant negative mutant strains of Bacillus thuringiensis BT013A). Exosporium fragments will be purified from these strains as described above in Example 9 and fish immunized as described above.

[00843] Vaccination against two known infecting microbes, Flavobacterium columnare and Edwardsiella ictaluri, will be used as examples. The antigens to be used are summarized in Table 16. Genetic sequences coding for Lipopolysaccharide (LPS), an essential component of Gram-negative bacteria, will be cloned into the pBC-BclA-FL vector (using the method described above in Example 8). Nucleotide sequences encoding DNAk, a protein in the cellular chaperone system for protein folding of infectious flavobacteria, will be cloned into same vector. FlgD is a soluble scaffolding flagellar basal body rod modification protein of Edwardsiella tarda that is necessary for flagellum hook assembly. EseD, a gene important in the type III secretion system (T3SS) of Edwardsiella ictaluri, a key virulence factor that contributes to pathogenesis in fish, will also be cloned into the same expression vector. The EseD protein is one of several possible translocon proteins, which form pores in the host membrane, which could be expressed as an antigen from a vaccine.

[00844] Detection of antibodies by dot blot analysis in fish injected, fed or bathed with exosporium fragments containing BclA-antigen fusion proteins. As described above in Example 8, the pSUPER-BclA-OVAL plasmid encodes ovalbumin fused to the BclA sequence. The pSUPER-BclA-O-PS, pSUPER-BclA-DNAk, pSUPER-BclA-LPS/FlgD, and pSUPER- BclA-EseD plasmids encode the LPS O-polysaccharide, DNAk, LPS/FlgD, and EseD antigens, respectively, fused to the BclA sequence. Purified exosporium fragments derived from the Bacillus thuringiensis BT013A exsY knockout, CotE knockout or CotO dominant negative mutant strains expressing the BclA-O-PS, BclA-DNAk, BclA-LPS/FlgD, or BclA-EseD fusion proteins will be dissolved in endotoxin-free Dulbecco's phosphate buffered saline (DPBS) without calcium chloride or magnesium chloride, or in 0.15 M NaCl dissolved in deionized distilled water for a final concentration of 0.001 mg/ml to 5 mg/ml protein.

[00845] Three different immunization methods will be used: intramuscular injection, feed immunization, and immersion immunization. For immunization by intramuscular injection, fish will first be anaesthetized with 0.168 mg/ml tricaine (3-amino benzoic acid ethylester) in water or by placing the fish on ice for 30-60 seconds before injection. Zebrafish will injected intramuscularly between the dorsal fin and the lateral line with 10 μΐ of the exosporium fragment solution.

[00846] Feed immunization will also be performed. Zebrafish will be given an immunization food mixture containing a 1 :4 ratio of purified exosporium fragments carrying BclA-antigen fusion proteins :TetraMin fish food, supplemented with ampicillin (final concentration 40 mg/g). A booster immunization will be given 10 days after the first

immunization.

[00847] For immunization by immersion, adult zebrafish will immersed in a tank containing the exosporium fragments (500 μg/mL) for 30 min, and then returned to a tank of clean water. A booster immunization will be given 10 days after the first immunization.

[00848] Generation of antibodies to the fish pathogen antigens will be measured in the antiserum, muscle, and gills 2.5 days after final immunization. Zebrafish will be killed by immersion in ice. The serum will be collected first and then the muscle and gills of the fish will be removed on ice, homogenized, and centrifuged to pellet cellular debris. The supernatants containing soluble proteins will be assayed for activity.

[00849] Screening for polyclonal antibodies will be done by dot blot analysis. Briefly, sample will be collected from zebrafish after immunization to detect whether zebrafish IgM (zlgM) immune cross reacts with the fish pathogen antigens using dot blotting. First, the recombinant protein (e.g., recombinant EseD) (50 to 500 ng) will be solid-phased on PVDF membranes and dry -up overnight. The membrane will be washed three times with PBST (phosphate-buffered saline with TWEEN detergent) and then blocked with 5% (w/v) skim milk in PBST for 2 hours. After washing with PBST, 10-μ1 zebrafish antiserum at a dilution of 1 : 100 will incubated with the membrane for 2 h. Unimmunized zebrafish serum will serve as a negative control. After further washing steps, the membranes will be incubated with anti- zebrafish IgM HRP-linked antibody at a dilution of 1 :3000 as a secondary antibody for 1 h. Finally the membrane will be observed by developing with Pierce Fast Western Blot Kit ECL Substrate.

[00850] It is expected that antibodies to the fish pathogen antigens will be generated following immunization with exosporium fragments by intramuscular injection, feeding, or immersion.

[00851] Immunity of fish immunized with the exosporium fragments against infecting pathogens. Bacterial isolates / , columnare (ATCC 23463) a d E. ictaluri (ATCC 33202) will be used throughout the study. All isolates will be retrieved from frozen glycerol stocks stored at -80°C and streaked onto F. columnare Growth Medium (FCGM); or tryptic soy agar with 5% sheep's blood (ThermoFisher, Waltham, MA). After 48 h of growth at 28°C, isolates will be dislodged from the agar using a sterile loop and inoculated into 50 mL of FCGM or brain-heart infusion medium (Becton Dickinson, Sparks, MD) and incubated in broth at 28°C for 24 hours. Bacterial cells will be harvested and counted before bacterial challenge is performed.

[00852] Bacterial challenge: Zebrafish will be prophylactically treated with 4 mg/L potassium permanganate for 30 min. After acclimatization and before bacterial challenge, two zebrafish will be randomly selected and routine diagnostic procedures will be performed.

External skin scrapings from multiple sites and gill clips will be viewed microscopically to determine whether external bacteria or parasites are present. Three days after the last

immunization the fish will be inoculated with bacteria. Groups of zebrafish (20 per group) will be immersed in F. columnare or E. ictaluria at concentrations of 2.4x 10 ⁴ colony-forming units (CFU)/mL, 2.4 10 ^s CFU/mL, and 2.4 l0 ⁶ CFU/mL, E. coli at a concentration of 2.4x l0 ⁶ CFU/mL, or PBS, respectively for 5 h. The eight groups will then be kept in five separate 3-L aquaria and observed for 21 days.

[00853] Relative percent survival experiments: Fish will be monitored daily and humane end-point criteria suggested by the national ethical board will be followed. Fish will be euthanized with an anesthetic overdose if they show any of the following signs: abnormal swimming, gasping, observable swelling or wasting, tissue damage, or lack of response to touch.

[00854] Bacterial counts in infected fish: Zebrafish from each group will be sampled for recovery of F. columnare or E. ictaluria at their deaths. Ascitic fluid will be aspirated and the wounds, livers, and pancreas will be separately homogenized in 10 mL of tryptic soy broth (TSB). The ascitic fluid and homogenized tissues will be plated on cefoperazone MacConkey agar and incubated at 37°C for 24h. Suspected bacterial isolates will be identified phenotypically by standard conventional biochemical methods. Isolates suspected to be F. columnare or E. ictaluria will be subject to partial 16S rRNA identification.

Example 13: Use of exosporium fragments for vaccination of mice to generate protection to two antigens concurrently.

[00855] Administration of exosporium fragments containing fusion proteins of full-length BclA and antigenic proteins to generate an immune response. BclA linked to ovalbumin (pBC-BclA-FL-OVAL) expressed in the exsY mutant and protective antigen

(pBC-BclA-FL-PAG) expressed in the cotE KO mutant as described above in Example 9 were coinjected subcutaneously or coadministered intranasally to adult mice with and without an adjuvant (FCA). For immunization by subcutaneous injection, groups of six BALB/c mice were immunized two times at an interval of two weeks. Each dose of antigen solution was a mixture of 25 μΐ of the two types of antigenic exosporium fragments (12.5 μΐ of each type of exosporium fragment, prepared as described above in Example 9; equivalent to 10 ⁸ CFU/ml of whole cell broth), with or without the adjuvant. For intranasal immunization, groups of six BALB/c mice were immunized two times at an interval of two weeks. Each dose of antigen solution was a mixture of 25 μΐ of two antigenic exosporium fragments (12.5 μΐ of each type of exosporium fragment, prepared as described above in Example 9; equivalent to 10 ⁸ CFU/ml of whole cell broth). Intranasal immunizations were carried out with the mouse held in a supine position with the head down while the antigen solution was delivered slowly with a micropipette onto the nares so that the mouse could sniff it in.

[00856] Serum was collected and examined for detection of longer-term immunity as assessed by specific antibodies (ELISA) four weeks after the first injection (two weeks after the booster injection). Blood was obtained from the lateral femoral vein in heparinized capillary tubes and was separated and stored at -20°C until it was analyzed.

[00857] Detection of antibodies by ELISA from mice injected with exosporium fragments containing BclA-antigen fusion proteins. Immunoglobulin IgG and IgA antibodies to OVAL and PAG were measured by enzyme-linked immunosorbent assay (ELISA) with COSTAR High-Binding Assay plates (96-wellplates for ELISA assays). Briefly, the plates were coated with 100 nM of protein by incubation with OVAL or PAG protein. Plasma samples were neutralized and diluted to 50 mg/mL, determined by bicinchoninic acid (BCA) protein assay. Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (γ chain specific) was used as a conjugate. Results are shown in Table 17 below. "Peptide OVAL/PAG" refers to a mixture of purified ovalbumin and protective antigen A injected as described above at (0.05 μg). "exsY K/0, cotE K/0" refers to a mixture of exosporium fragments derived from exsY KO and cotE KO mutants that were not transformed with the BclA-FL-OVAL or BclA-FL-PAG constructs. A standard curve for each protein was generated from known purified antibody and used to quantify the ng/mL of specific antibody produced in each animal. The values in the Table 17 represent the average of seven individual mice including the standard deviation. As can be seen from Table 17, antibodies to both PAG and OVA were generated simultaneously in response to both subcutaneous injection and intranasal administration. The exosporium-carried protein performed equally as well or better than the protein alone. Using the adjuvant (FCA) did not significantly increase the generation of protective antibody expressed on the exosporium, showing that it was unnecessary to add in order reach similar levels of specific antibody protection to the protein with the adjuvant.

Table 17: Generation of multiple antibodies to exosporium fragments administered to adult mice intranasally or subcutaneously.

ELISA Compared to saline injected

Serum IgG to OVA Serum IgG to PAG Serum IgG to Serum IgG to

generation from generation from OVA generation PAG generation

Adjuvant (FCA) Treatment Subcutaneous Subcutaneous from Intranasal from Intranasal

administration administration administration administration

(STD) (STD) (STD) (STD)

Saline 1.3 ±2.1 13.0 ± 10.8 3.5 ±0.2 6.7 ±4.3

Peptide OVAL/PAG 17.2+14.6 48.9 + 19.6 19.8+11.9 33.0+13.1

exs7KO/BclA-FL- 16.4 + 6.9 119.6 ±69.6 39.7 ±26.5 26.8 ± 12.2

- OVAL, cotEKO/

BclA-FL-PAG

exsYK/O, cotE K/O 26.5 + 4.1 68.4 ±50.5 24.3+21.1 43.7 ± 11.7

Adjuvant 2.0 + 0.7 8.3 ±4.3 3.5±0.5 4.4+4.1

Peptide OVAL/PAG 50.1 + 34.3 84.0 ±34.0 25.9 ±23.6 69.6 ±49.7

+ exs7KO/BclA-FL- 25.8 ±20.3 63.1 ±39.7 16.1 ± 10.6 29.7 ± 17.3

OVAL, cotEKO/

BclA-FL-PAG

exsY K/O, cotE K/O 9.0 ±4.8 13.2 ± 10.7 3.9 ±0.7 18.8+11.1

Example 14: Use of exosporium fragments displaying proteases or lactonases for protecting animals from pathogens.

[00858] Exosporium fragments that contain fusion proteins containing a targeting sequence or exosporium protein (e.g., BclA) and a protein or peptide that protects an animal from a pathogen can be generated using the methods described above in Examples 8 and 9. For example, these exosporium fragments can be used to display proteases or lactonases that protect animals from one or more pathogens. Certain bacterial pathogens can communicate between individual members via secretion of bacterial lactone homoserines or related signaling molecules. This signaling between bacteria results in secretion of toxins by the bacteria and upregulation of virulence factors. Thus, proteases or lactonases specific for bacterial lactone homoserine signaling molecules can protect animals from such bacterial pathogens by disrupting communication between bacteria. Suitable proteases specific for bacterial lactone homoserine signaling molecules include endopeptidases and exopeptidases. Fusion proteins containing proteases specific for bacterial lactone homoserine signaling molecules can be expressed in the exsY and CotE knockout and CotO dominant negative mutant strains of Bacillus thuringiensis

BT013A described above. Exosporium fragments containing the fusion proteins can then be prepared as described above.

Example 15: Use of exosporium fragments containing a lactonase or protease fusion protein for prevention of bacterial growth and disruption of biofilm formation.

[00859] N-Acylated homoserine lactone (AHL) lactonases are capable of degrading signaling molecules involved in bacterial quorum sensing. Lactonases can therefore be used to control bacterial infection. The precise regulation of protein levels is required for proper growth and function of all bacterial cells; a balance of the rate of protein synthesis and degradation maintains this. Addition of external proteases disrupts this balance. Bacillus subtilis serine proteases are especially effective against biofilm and bacterial growth because of their ability to influence the proteome during an adaptive response to changes in the bacteria's extracellular environment.

[00860] Genes responsible for the AHL lactonase activity in the Bacillus family (AiiA) or for protease activity were cloned into the pBC plasmid to generate a plasmid encoding a fusion protein containing an AiiA or a protease linked to a targeting sequence or exosporium protein (amino acids 20-25 of BclA or full-length BclA). The fusion proteins were then expressed in the exsY knockout strain of Bacillus thuringiensis BT013A using the methods described above in Example 9. Exosporium fragments were purified as described in Example 9. The fusion proteins used in the experiments described in this Example are summarized in Table 18 below.

Table 18: Fusion Proteins Containing a Lactonase or a Protease

[00861] Confirmation of quorum quenching activity. AHL inactivation assays were conducted using bioassay plates. Briefly, aliquots of N-hexanoyl-L-Homoserine lactone (C6- HSL) were incubated at 37°C for 2 hours with 0, 40 or 80 μΐ. of whole cell broth or exosporium fragments purified from the exsY KO mutant expressing a fusion protein comprising a lactonase {Bacillus thuringiensis B184 Aii A). The reaction mixture was inoculated onto LB agar seeded with the bio-reporter Chromobacterium violaceum CV026 and incubated at 30°C overnight. Disappearance of C6-HSL from the mixture was assessed by the loss of purple pigment that C. violaceum CV026 produces in response to C6-HSL. Results are summarized in Table 19 below. * indicates a statistically significant decrease as measured by students paired T-test as compared to the control (exosporium fragments from exsY KO spores that do not express a fusion protein).

[00862] The reduction in the total area of purple pigment produced by the reporting strain indicates that the lactone was degraded by both the whole cell broth and the purified exosporium fragments expressing the lactonase gene. Importantly, the exosporium fragments were more effective at degrading the lactone than the whole cell broth.

Table 19:Summary of Lactone Degradation by Exosporium Fragments Displaying a Lactonase.

Plasmid Exosporium Fraction % Area of pur pie pigment (cm ² )

Mutant Collected relative to cont rol

0 40 80

Control exsY KO None 100 100 100

pBC-BclA exsY KO Purified 160 125 11*

AiiA exosporium

fragments

pBC-BclA exsY KO Whole Cell Broth 138 134 57*

AiiA [00863] Prevention of Bacterial Growth. Bacterial cultures of Chromobacterium violaceum, Acinetobacter baumanii, Pseudomonas aeroginosa, and Staphylococcus epidermidis were grown for 24 hours to an O.D. 600 of 2.0. These cultures were inoculated into a plate assay at 1 iL into 500 μΐ. LB media, were allowed to grow in the plate for 4 hours before the addition of exosporium fragments. Exosporium fragments displaying a protease or a lactonase (16% v/v) were then added and the cultures were then incubated without shaking at 30°C for an additional 4 hours. XTT salt solution was then added to each well. XTT salt cleavage by bacterial dehydrogenases is an indicator of active cells and was measured as the absorbance at 490 nm after 3 hours of incubation at 30°C. Results are shown in Table 20 below.

[00864] Prevention and Dispersion of Biofilm. Bacterial cultures of

Chromobacterium violaceum, Acinetobacter baumanii, Pseudomonas aeroginosa, and

Staphylococcus epidermidis were grown for 24 hours to an O.D. 600 of 2.0. These cultures were inoculated into a plate assay at 1 iL into 500 iL LB media, were allowed to grow in the plate for 8 hours before the addition exosporium fragments. Exosporium fragments displaying a protease or a lactonase (16% v/v) were then added and the cultures were then incubated without shaking at 30°C for an additional 8 hours.

[00865] Additionally, the Acinetobacter baumanii strain was assessed for the ability to break up a formed biofilm. The assay was performed in the same manner as described above for assaying the prevention of biofilm formation, except that the exosporium fragments were added at 24 hours post inoculation. Following the incubation period, the bacterial cultures were poured out and the wells stained with XTT salt solution. XTT salt cleavage by bacterial dehydrogenases is a reading of active cells and was measured as the absorbance at 490 nm after 3 hours incubation at 30°C. Results are shown in Table 20 below. * indicates a statistically significant decrease as measured by students paired T-test as compared to the control (exosporium fragments from exsY spores that do not express a fusion protein).

Table 20. Summary of Activity of Exosporium Fragments Displaying Lactonase or Bacillus subtilis Serine

Example 16: Use of exosporium fragments containing a lactonase or protease fusion protein in a fish farm for prevention of bacterial infection.

[00866] It is expected that oral administration of the exosporium fragments containing the AiiA or protease fusion described above in Example 15 by supplementation of fish feed or administration by immersion bathing will significantly attenuate Aeromonas hydrophila infection in zebrafish.

[00867] Wild-type zebrafish (4 months of age, with an average weight of ~200 mg and an average length of ~2.5 cm) will be randomly divided into test and control groups and fed a diet supplemented with exosporium fragments over a range of (2-2 ^χ 10 ^~3 U) per gram of feed and immersed in hydrophila ^-l -containing water. Alternatively, the fish will be submerged in a bath containing lower concentrations of the exosporium fragments and placed in A.

hydrophila l-l -containing water. Mortality during the 25-day experimental period will be recorded each day. Dead fish will be removed daily and examined for bacteriological contamination. The water containing hydrophila NJ-l will also be examined daily for bacteriological contamination. To test bacterial contamination, the fish body will be sterilized with 75% ethanol and the body fluid will be extracted with a syringe under sterile conditions and streaked onto an ampicillin blood agar plate. Water samples will be streaked onto the same plate directly.

Example 17: Use of exosporium fragments containing antimicrobial peptide fusion proteins for prevention of bacterial growth and disruption of biofilm formation.

[00868] Construction of fusion proteins containing antimicrobial peptides and generation of exosporium fragments. Genes were synthesized that code for either of two antimicrobial peptides, LfcinB (derived from bovine lactoferrin, SEQ ID NO: 212) and LysM (derived from chicken lysozyme, SEQ ID NO: 213), linked to amino acids 20-35 of BclA (amino acids 20-35 of SEQ ID NO: 1), under the control of the BclA promoter (SEQ ID NO: 149). These genes were cloned into the pBC plasmid to create the constructs pBC-BclA 20-35- LfcinB and pBC-BclA 20-35-LysM. These constructs are summarized in Table 21 below. The constructs were then introduced into the exsY knockout mutant of Bacillus thuringiensis BT013A and exosporium fragments were prepared using the method described above in Example 9.

Table 21: Antimicrobial Fusion Proteins Containing LfcinB or LysM

[00869] Antimicrobial and Antibiofilm activity of exosporium fragments containing LysM or LfcinB fusion proteins. Using the methods described above in Example 15, a diverse set of microbes was assayed for the ability of exosporium fragments carrying LysM or LfcinB to prevent bacterial growth or biofilm formation. Results are shown in Table 22 below. * indicates a statistically significant decrease as measured by students paired T-test as compared to the control (exosporium fragments from exsY KO spores that do not express a fusion protein). Data are from two independent experiments.

Table 22. Summary of Activity Exosporium Fragments Displaying LysM or LfcinB antimicrobial peptide (16% v/v) on Bacterial Species.

Example 18: Use of exosporium fragments containing LfcinB or LysM fusion proteins to treat feedlot bloat.

[00870] It is expected that the exosporium fragments containing the fusion proteins containing the LysM or LfcinB peptides described above in Example 17 will kill a significant number of Streptococcus sp. cells. This would be expected to directly translate into killing of bacteria in the alimentary tracts of ruminants (e.g., cows, sheep, or horses) suffering from feedlot bloat. Feedlot bloat (ruminal acidosis) occurs when large amounts of starch are added to the diet. Under these conditions, the growth of Streptococcus bovis is no longer restricted by a lack of this energy source and the bacterial population of S. bovis grows faster than other species of rumen bacteria. S. bovis produces lactic acid, an acid ten times stronger than acetic, propionic or butyric acid, the accumulation of which eventually exceeds the buffering capacity of rumen fluid resulting in disease.

Example 19: Use of exosporium fragments containing LfcinB or LysM fusion proteins to treat foot rot in cattle.

[00871] Sheep and cattle are prone to bacterial hoof infections that can be quite debilitating. Interdigital phlegmon is an infection of the soft tissue between the claws of the feet and is caused by two anaerobic bacteria, Fusobacterium necrophorum and Prevotella melaninogenicus. Using the exosporium fragments described above in Example 17, growth of F. necrophorum and P. melaningogenicus cultures will be inhibited using the LfcinB or LysM exosporium fragments derived from the Bacillus thuringiensis BT013A mutants. Using these verified exosporium fragments, yearling steers with clinical signs of acute interdigital phlegmon (lameness with interdigital swelling, interdigital lesions, or both) will be randomly assigned to treatment groups: with different concentrations of the LfcinB or LysM exosporium fragments, with and without an antiseptic and astringent solution (e.g., copper or zinc sulfate [7%-10% in water]). The groups will be treated by footbath method. All animals will be treated for 3 days. Treatment will be considered successful if animals are no longer lame on day 4. Biopsy specimens will be collected prior to treatment in each group and submitted for bacterial culture and histologic examination.

Example 20: Inhibiting or preventing biofilm formation or promoting biofilm dissolution from surfaces in an aquaculture system using exosporium fragments containing an apyrase fusion protein.

[00872] Biofilms can form on surfaces within aquaculture systems such as pipes, pumps, filters, and collecting tanks, or even the gills of fish being cultivated in the aquaculture system. Apyrase hydrolyzes ATP to AMP and inorganic phosphate and has been shown to reduce biofilm biomass. Exosporium fragments containing an apyrase fusion protein (containing an apyrase encoded by the Rropl gene of Solarium tuberosum or the ytkD gene of Bacillus subtilis) were generated using the methods described in Examples 8 and 9. These constructs are summarized in Table 23 below. Bacterial strains were grown and then passaged in new medium containing isolated exosporium fragments containing the BclA-apyrase fusion proteins. The ability of apyrase exosporium fragments to inhibit biofilm formation or promote its dissolution was then measured. Using the methods described above in Example 15, a diverse set of microbes was assayed for the ability of the exosporium fragments to affect biofilms or microbial growth. Results are shown in Table 24 below. * indicates a statistically significant decrease as measured by students paired T-test as compared to the negative control (exosporium fragments from exsY or cotE KO spores that do not express a fusion protein).

Table 23: Antibiofilm Fusion Proteins Containing an Apyrase

Apyrase Targeting Sequence

Solarium tuberosum Rropl Amino acids 20-35 of Bel A (amino acids 20-35 of (SEQ ID NO: 204) SEQ ID NO: 1)

Bacillus subtilis YtkD Amino acids 20-35 of Bel A (amino acids 20-35 of (SEQ ID NO: 205) SEQ ID NO: 1) Table 24. Summary of Activity of Exosporium Fragments Displaying an Apyrase (16% v/v on Bacterial S ecies.

Example 21: Effect of exosporium fragments containing an apyrase fusion protein on Acinetobacter Baumannii initial biofilm adherence in an in vitro cell culture model of bovine epithelial cells.

[00873] Biofilms can also form within wounds. To show that exosporium fragments containing an apyrase fusion protein can be used to prevent or inhibit formation of such biofilms, several experiments will be performed. First, an in vitro bacterial adherence assay will be performed on bovine fibroblasts treated with or without exosporium fragments containing a

BclA-apyrase fusion protein (made as described in Examples 8 and 9). Bovine epithelial cell line BL-4 (ATCC CCL-44; American Tissue Culture Collection, Rockville, Md., USA) will be cultured in a Petri dish at 37°C in DMEM media (Gibco BRL, Grand Island, N.Y., USA) supplemented with penicillin G 100,000 U/L, streptomycin 50 mg/L and 5% (v/v) of fetal bovine serum (Gibco BRL) in a humidified atmosphere containing 5% (v/v) of C0 ₂ . When the fibroblasts have reached about 80% confluence on the bottom of the Petri dish, the medium will be replaced with 0.25% trypsin-EDTA (1689649, MP Biomedicals, Solon Ohio) and the Petri dish will be incubated at 37°C for 10 min. Cells will be collected using a cell scraper and washed with fresh medium three times by centrifuging at 300xg for 3 minutes. Washed cells will be adjusted to a concentration of 1 ^χ 10 ⁵ cells per mL with fresh media and 2 mL of cell solution will be transferred to each well of a 12-well plate containing a 13-mm-diameter plastic coverslip (Thermanox, Nunc, Rochester, N.Y., USA) in each well. The cells will be incubated at

37°C for about 3 days until cells cover about 90% of each coverslip and will then be washed with phosphate buffered saline (PBS) three times. Acinetobacter baumannii ATCC 17978 grown overnight in Luria Bertani (LB) medium will be collected and washed three times with fresh medium by centrifuging at 6,000 rpm for 3 minutes. Bacterial cells will be adjusted to a concentration of 1 x 10 ⁸ CFU/mL and mixed with the exosporium fragments containing BclA- apyrase fusion proteins. Each cell monolayer will be infected with 1 mL of bacterial suspension and incubated for 60 min at 37°C in a 5% (v/v) C0 ₂ atmosphere. For damaged cell assays, fibroblast cells in the central area of plastic coverslips will be damaged using the tip of a knife before the infection is performed. After infection with Acinetobacter baumannii, plastic coverslips will be washed with PBS buffer three times to remove non-adherent bacteria and then fixed in 100% of methanol for 20 min before being stained in a Giemsa staining solution for 30 minutes at room temperature. The coverslips will be air-dried, mounted and observed under a light microscope with a 60X objective lens. The number of bacteria adhering to 100 cells will be determined. Three independent experiments will be performed for each treatment.

Example 22: Effect of exosporium fragments containing a BclA-apyrase fusion protein on Acinetobacter Baumannii initial biofilm adherence in an in vivo mouse wound infection model.

[00874] Female pathogen-free C57BL/6 mice (Harlan, Indianapolis, Ind.), 12 weeks old, weighing approximately 20-23 grams will be used in all experiments. The animals will be kept on a 12 hour light cycle and will be provided with rodent chow (LabDiet 5001, PMI Int'l, Richmond, Ind.) and water ad libitum throughout the study. Pentobarbital (Nembutal, Ovation Pharmaceuticals, Inc., Deerfield, 111., manufactured by Hospira, Lake Forest, 111.) will be administered intraperitoneally (50 mg/kg IP) for anesthesia. During the study, all mice will be singly housed and will all receive 0.1 mg/kg buprenorphine (Buprenex; Reckitt Benckiser Pharmaceuticals Inc., Richmond, Va.) subcutaneously (SQ) twice daily for post-burn pain control. The skin over the lumbosacral and back region will be clipped using a 35-W model 5- 55E electrical clipper (Oyster-Golden A-S, Head no.80, blade size 40). Depilatory cream (Nair® lotion) will be applied for about 1.5 minutes, and then wiped off with a damp paper towel. Skin will be rinsed in lukewarm water and then blotted dry. The first buprenorphine dose (67 nl/20g, 83 μl/25g mouse or 0.1 μ^) will be administered SQ under the skin of the upper back.

[00875] To create burns, anesthetized mice will be placed in an insulated, custom- made mold which exposes only a lumbosacral and back region that is approximately 30% of the total body area. Partial thickness burns will be achieved by exposure of the skin to 60°C water for 18 seconds. [00876] Overnight-grown Acinetobacter baumannii cultures will be harvested and washed with 0.9% saline three times. The final cell concentration will be adjusted to 1 ^χ 10 ⁶ CFU/ml with 0.9% saline and used for inoculation. Either control (bacteria only) or treatment (bacteria with BclA-apyrase exosporium fragments) will be applied to each burn. TEGADERM wound dressing will be applied over the burn with MASTISOL liquid adhesive glue, taking care to not get MASTISOL on the wound.

[00877] At the time points for tissue harvest (24 and 48 hours), the mice will be given lethal IP injections of pentobarbital (150 mg/kg) and skin samples will be collected for bacteria counts, and for slides/staining. The skin will be removed with a scalpel and scissors. A small piece of skin will be placed in 5 mL of PBS buffer and homogenized for 1 min. The mixture will be diluted serially 10-fold and 50 μΐ of each dilution will be put on LB agar plates for bacteria counts.

Example 23: Use of exosporium fragments containing antifungal enzyme fusion proteins for preventing fungal growth.

[00878] Fusion proteins containing anti-fungal enzymes were prepared using the methods described in Example 9 above. These constructs are summarized in Table 25 below.

The constructs contained either full-length Bel A or amino acids 20-35 of Bel A (amino acids

20-35 of SEQ ID NO: 1) under the control of the BclA promoter (SEQ ID NO: 149). These constructs were introduced into the ExsY and CotE knockout mutants of Bacillus thuringiensis

BT013A. Exosporium fragments were prepared according to the method described above in

Example 9.

[00879] A fungicidal assay using clear 96 well flat bottom polystyrene tissue culture plates (BD-Falcon, USA) was performed. Fungal spores from Aspergillus niger, Aspergillus fumigatus and Penicillium chrysogenum were grown on potato dextrose agar with

chloramphenicol and chlortetracycline (PDCC) slant and allowed to sporulate at 30°C. The spores were collected off the slants by vortexing in PBS. The suspended spores were counted by hemocytometer and diluted to 10 ⁶ CFU/mL. Suspended spores were then serially diluted in nutrient broth in a 96-well plate, exosporium fragments containing fusion proteins were added in varying concentrations, and the plate was incubated at 30°C to allow inhibition of the fungal spore growth. Fungal growth was quantified by addition XTT to each well of the plate for 3 hours and read at A ₄ 90nm as described in Example 15 above. Results are shown in Table 26 below. * indicates a statistically significant decrease as measured by students paired T-test as compared to the negative control (exosporium fragments from exsY KO or cotE KO spores that do not express a fusion protein).

Table 25: Fusion proteins containing antifungal enzymes

Table 26: Effect of Exosporium Fragments on Fungi Growth

ND=not determined

Example 24: Use of exosporium fragments displaying antifungal enzyme fusion proteins for protection from pathogens in aquaculture.

[00880] World shrimp aquaculture now produces well over 4 million metric tons of shrimp. This reflects the dramatic increase in white leg shrimp culture in Southeast Asia. Shrimp production in many regions suffers from a wide variety of diseases. Fungal infection among shrimp is one of the most common disease infections in shrimp larvae and normally occurs during the dry season. Some species of fungus attack the larvae while others attack the grown shrimp.

[00881] Among the different species of fungal pathogens of shrimp, the most dangerous are Lagenidium sp. and Sirolpidium sp. Infection starts when zoospores settle on the body of the shrimp larvae. The spores then grow to become hyphae. The hyphae penetrate the bodies of the larvae and develop into mycelium and start to feed on the tissues. The mycelium develops and eventually invades the entire bodies of the shrimp larvae.

[00882] The exosporium fragments containing antifungal fusion proteins as described above in Example 23 will be incubated in PBS with the Lagenidium for 1 hour at 37°C, with shaking. Lagenidium myophilum (ATCC 200325) cultures will be grown overnight in By+ broth at 37°C. Typical media for cultivating marine microorganisms are based on sea water (e.g., 790 By+ medium [yeast extract 1.0 g, peptone 1.0 g, D+ glucose 5.0 g, sea water 1 L]).

[00883] The overnight cultures will then be pelleted, washed in PBS, and resuspended in PBS. The exosporium fragments containing the fusion proteins will be incubated in the PBS with the Lagenidium for 1 hour at 37°C, with shaking. A control sample of Lagenidium will be left untreated (no exosporium fragments). After the 3 hour incubation, dilution plates of the Lagenidium will be made and incubated at 37°C overnight. Lagenidium cultures will be counted the next day, and the percent killed quantified. This can translate into a method for dip treating infected shrimp or for treating entire shrimp ponds for the fungus.

Example 25: Use of exosporium fragments containing antifungal enzyme fusion proteins for the prevention of yeast growth.

[00884] Mastitis in dairy animals is an inflammatory reaction of the udder. Infection of the mammary gland is the most common and most costly disease in the dairy industry.

Cryptococcus neoformans and Candida albicans are the most common species of yeast to cause caprine mastitis, and the trend of fungal mastitis instead of bacterial has been increasing.

Currently, when mastitis is diagnosed the immediate course of action is through antibiotic therapy. However, antibiotic therapy is refractory if the organism is in fact fungal.

[00885] Antifungal exosporium fragments prepared as described in Example 23 were used to inhibit the growth of Saccharomyces cerevisiae as a model for yeast. Results are shown in Table 27 below. * indicates a statistically significant decrease as measured by students paired T-test as compared to the negative control (exosporium fragments from exsY KO spores that do not express a fusion protein). These data demonstrate a strong ability for multiple fusion proteins prepared from exosporium mutants to inhibit yeast growth.

Table 27: Effect of Exosporium Fragments on Saccharomyces growth

Example 26: Use of exosporium fragments containing antifungal enzyme fusion proteins for treatment of mastitis is dairy animals.

[00886] Lactating female goats aged 2-4 years will be kept under observation for a fortnight in a thoroughly cleaned premise before the start of the experiment and will be adjudged to be healthy. All of the animals selected for the study will be free from sub-clinical mastitis and no bacteria or fungi will be isolated from the pre-inoculation milk samples. A strain of C.

albicans isolated from a natural case of mastitis will be used and the isolate will be grown on

Sabouraud's dextrose agar (SDA) containing 0.03% chloramphenicol. After incubation for 5-6 days at 37°C, the growth will be harvested and the suspension homogenized and made ready for inoculation of half of the udder of each goat.

[00887] Treatment of the infected udders with exosporium fragments containing antifungal enzymes as described above in Example 23 will be performed for 3 days. The exosporium fragments will be prepared as described above in Example 9.

[00888] Re-isolation of the fungus will be attempted from milk and udder lesions. Isolates will be cultured on Sabouraud dextrose agar (SDA) slants at 37°C for 2-7 days.

Detection of the fungus in impression smears of milk and from udder tissues and paraffin tissue sections will be performed using Grocott's methanamine silver (GMS), Periodic acid schiff (PAS) and combined GMS-H&E. Example 27: Use of exosporium fragments containing fusion proteins for protecting animals from insect or worm pathogens.

[00889] Delivery of exosporium fragments containing fusion protein to mosquito larva by ingestion. Mosquito larvae [2-4 mm size range] were purchased from Sachs Systems

Aquaculture and maintained at 27°C in a room with 80% relative humidity and fed with plankton. To demonstrate that exosporium fragments can be used to deliver proteins or peptides to mosquito larva, fusion proteins were constructed that contained proteins having insecticidal and antihelminthic properties linked to amino acids 20-35 of Bel A (amino acids 20-35 of SEQ

ID NO: 1)), under the control of the BclA promoter (SEQ ID NO: 149). These constructs are summarized below in Table 28. The constructs were introduced into the ExsY and CotE knockout strain of Bacillus thuringiensis BT013A and exosporium fragments were prepared according to the methods described above in Example 9. Groups of ten mosquito larvae were transferred to 15 mL Falcon tubes in water and treated with an aqueous suspension mix of plankton and exosporium fragments containing fusion protein. Live larvae were recorded after

24 hours. Results are shown in Table 29 below. * indicates a statistically significant decrease as measured by students paired T-test as compared to the negative control (exosporium fragments from exsY O spores that do not express a fusion protein).

Table 28: Fusion proteins containing antihelminthic and insecticidal peptides or proteins

Table 29: Mos uito Larva survival 24 and 48 hr after ex osure to exos orium fra ments

N.D. = not determined Example 28: Delivery of exosporium fragments containing insecticidal Mtx-like toxin fusion proteins to equine animals by topical application to prevent fly infestation.

[00890] Five horses will be used in this study with one horse per group. The control group will be untreated. Four groups will be treated with an aqueous suspension of exosporium fragments containing the BclA20-35-Mtxl fusion protein described above in Example 27. The exosporium fragments will be diluted in water just prior to use and applied as a spray to each horse. Each horse will be treated with a pressurized spray apparatus by spraying each diluted spray over the dorsum and each side (barrel) of the body from the shoulders to the hips.

[00891] After the applied spray has dried, 6 Petri dish cages (3 per side) of unfed stable fly and 6 Petri dish cages (3 per side) of housefly, each containing 10 adult flies per dish, will be placed under a screened belt that will be tied around the animal. The bottom of the Petri dishes will have a mesh that allows the stable flies to probe through and obtain a blood meal and the house flies to probe through with their mouth parts with both being exposed to the treated hair and skin. The flies in the Petri dishes will be exposed to the treated surface of each horse for

20 minutes, after which the plates will be removed and taken to the laboratory to evaluate percent kill at 4, 8 and 24 hours post-exposure. Petri dishes will be positioned on and exposed to each treated horse immediately after treatment and again on days 1, 3, 5, 7 and 14 post-treatment to evaluate residual activity.

Example 29: Delivery of antihelminthic peptides to Caenorhabditis elegans nematodes by ingestion of exosporium fragments.

[00892] Wild type C. elegans nematodes were purchased from Carolina Biological

(North Carolina) and maintained at 23 °C on nematode growth media (NGM)-Lite agar plates coated with OP50 E. coli for food. The constructs described above in Table 28 were transformed into the ExsY and CotE knockout strains of Bacillus thuringiensis BT013A.

[00893] To prepare concentrated spores for feeding to nematodes, 1 mL of protein- free culture media containing the transformed ExsY KO and CotE KO strains was concentrated by high speed centrifugation and 900 μΙ_, of the media was removed. To feed spores to the worms, 10 μΙ_, of the concentrated suspension was added to a 60 mm NGM-lite agar plate with 10 [iL of PBS (phosphate buffered saline) to aid in spreading. No other food source was made available. In one experiment, twenty wild-type nematodes of various ages were transferred to the plates immediately. The plates were monitored for survival over time and percent survival was calculated. Survival was determined by monitoring under a microscope and recording the death rates of nematodes. Nematodes that did not move when prodded with a needle were considered dead at 24 hours. Survivability data are summarized in Table 30 below (column 3).

[00894] In a second experiment, an agar plug from a wildtype plate containing approximately 300 worms was placed in the center of a treated plate. The number of nematodes that migrated from the transferred plug was assessed by counting the number of live worms in one field of view a certain distance from the center of the plate at 72 hours post transfer. These data are summarized in Table 30 below (column 4). * indicates a statistically significant decrease as measured by students paired T-test as compared to the negative control (exosporium fragments from exsY KO or cotE KO spores that do not express a fusion protein). The exosporium mutants of ExsY and CotE equivalently killed nematodes when carrying the Cry21a protein.

Table 30: Antihelminthic Activity of Exosporium Fragments on C. elegans

[00895] Intestinal animal infections of flat worms, e.g., flukes (trematodes) and tapeworms (cestodes) as well as round worms (nematodes) could be treated using exosporium fragments containing antihelminthic chitinase fusion proteins. Parasitic worms that infect livestock and companion animals are an important animal welfare issue and place a major economic burden on food production.

[00896] In view of the above, it will be seen that the several objects of the invention are achieved and other advantageous results attained.

[00897] As various changes could be made in the above methods without departing from the scope of the invention, it is intended that all matter contained in the above description and shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense. EMBODIMENTS

[00898] For further illustration, additional non-limiting embodiments of the present disclosure are set forth below.

[00899] Embodiment 1 is a fusion protein comprising:

a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member; and

at least one protein or peptide of interest, the protein or peptide of interest comprising an antibody, an antibody fragment, a histone, a cecropin, a penaeidin, a bactenecin, a callinectin, a myticin, a tachyplesin, a clavanin, amisgurin, a pleurocidin, a parasin, an apyrase, an alginate lyase, a dispersin B, a DNAse, an endochitinase, an exochitinase , a proteinase K, a secreted insecticidal (Sip) protein, a mosquitocidal toxin, a Cry 1 Aa protein, a Cry 1 Ab protein, a Cry 1 Ac protein, a CrylCa protein, a CrylDa protein, a Cry2Aa protein, a Cry3Aa protein, a Cry3Bb protein, a Cry4Aa protein, a Cry4Ab protein, a Cry 11 Aa protein, a CytlAa protein, an AiiA lactonase, a Bacillus subtilis serine protease, or a combination of any thereof.

[00900] Embodiment 2 is the fusion protein of embodiment 1, wherein the DNAse comprises DNAse I, wherein the endochitinase comprises a chitinase C, or wherein the exochitinase comprises a chitinase D.

[00901] Embodiment 3 is the fusion protein of embodiment 1, wherein the protein or peptide of interest comprises an antibody, an antibody fragment, a histone, a cecropin, a penaeidin, a bactenecin, a callinectin, a myticin, a tachyplesin, a clavanin, amisgurin, a pleurocidin, a parasin, an apyrase, an alginate lyase, a dispersin B, a secreted insecticidal (Sip) protein, a mosquitocidal toxin, or a combination of any thereof.

[00902] Embodiment 4 is the fusion protein of embodiment 1 or 3, wherein the protein or peptide of interest comprises an apyrase.

[00903] Embodiment 5 is the fusion protein of embodiment 4, wherein the apyrase comprises an amino acid sequence having at least 70%, at least 75%>, at least 80%>, at least 85%>, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 204 or 205.

[00904] Embodiment 6 is the fusion protein of embodiment 5, wherein the apyrase comprises an amino acid sequence having at least 70%>, at least 75%>, at least 80%>, at least 85%>, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 205.

[00905] Embodiment 7 is the fusion protein of embodiment 1, wherein the protein or peptide of interest comprises a dispersin B.

[00906] Embodiment 8 is the fusion protein of embodiment 1, wherein the protein or peptide of interest comprises an endochitinase, an exochitinase, or a combination thereof.

[00907] Embodiment 9 is the fusion protein of embodiment 8, wherein the protein or peptide of interest comprises an endochitinase, the endochitinase comprising an amino acid sequence having at least 70%>, at least 75%>, at least 80%>, at least 85%>, at least 90%>, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 206.

[00908] Embodiment 10 is the fusion protein of embodiment 1, wherein the protein or peptide of interest comprises an AiiA lactonase.

[00909] Embodiment 11 is the fusion protein of embodiment 10, wherein the AiiA lactonase comprises an amino acid sequence having at least 70%>, at least 75%>, at least 80%>, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 207 or 208.

[00910] Embodiment 12 is the fusion protein of embodiment 1, wherein the protein or peptide of interest comprises a Bacillus subtilis serine protease.

[00911] Embodiment 13 is the fusion protein of embodiment 12, wherein the Bacillus subtilis serine protease comprises an amino acid sequence having at least 80%>, at least 85%>, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 209.

[00912] Embodiment 14 is the fusion protein of embodiment 12, wherein the Bacillus subtilis serine protease comprises an amino acid sequence having at least 80%>, at least 85%>, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 210.

[00913] Embodiment 15 is a fusion protein comprising:

a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member; and

a LfcinB, wherein the LfcinB comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 212. [00914] Embodiment 16 is a fusion protein comprising:

a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member; and

a LysM, wherein the LysM comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 213.

[00915] Embodiment 17 is a fusion protein comprising:

a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member; and

a P-l,3-glucanase, wherein the P-l,3-glucanase comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 214 or 216.

[00916] Embodiment 18 is a fusion protein comprising:

a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of a recombinant Bacillus cereus family member; and

a Cry21 A protein, wherein the Cry21 A protein comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 215.

[00917] Embodiment 19 is a recombinant Bacillus cereus family member that expresses a fusion protein of any one of embodiments 1-18.

[00918] Embodiment 20 is exosporium fragments derived from spores of a

recombinant Bacillus cereus family member of embodiment 19.

[00919] Embodiment 21 is a composition comprising spores of a recombinant Bacillus cereus family member of embodiment 19 or exosporium fragments of embodiment 20 and a carrier.

[00920] Embodiment 22 the composition of embodiment 21, wherein the composition is a pharmaceutical composition and the carrier comprises a pharmaceutically acceptable carrier. [00921] Embodiment 23 is the composition of embodiment 21, wherein the composition is an insecticidal or acaricidal composition.

[00922] Embodiment 24 is the composition of embodiment 21 or 23, wherein the protein or peptide of interest comprises a secreted insecticidal (Sip) protein, a mosquitocidal toxin, an endochitinase, an exochitinase, a CrylAa protein, a CrylAb protein, a Cry 1 Ac protein, a CrylCa protein, a CrylDa protein, a Cry2Aa protein, a Cry3Aa protein, a Cry3Bb protein, a Cry4Aa protein, a Cry4Ab protein, a Cryl 1 Aa protein, a Cytl Aa protein, or a combination of any thereof.

[00923] Embodiment 25 is the fusion protein of embodiment 1 or 3, the recombinant Bacillus cereus family member of embodiment 19, the exosporium fragments of embodiment 20, or the composition of embodiment 21, wherein the protein or peptide of interest comprises a mosquitocidal toxin.

[00924] Embodiment 26 is the fusion protein, recombinant Bacillus cereus family member, exosporium fragments, or composition of embodiment 25, wherein the mosquitocidal toxin comprises an Mtx-like mosquitocidal toxin or a Bin-like mosquitocidal toxin.

[00925] Embodiment 27 is the fusion protein, recombinant Bacillus cereus family member, exosporium fragments, or composition of embodiment 26, wherein the Mtx-like mosquitocidal toxin comprises Mtxl .

[00926] Embodiment 28 is the fusion protein, recombinant Bacillus cereus family member, exosporium fragments, or composition of embodiment 27, wherein the Mtxl comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 211.

[00927] Embodiment 29 is the composition of embodiment 21, wherein the composition is a helminthicidal or nematicidal composition.

[00928] Embodiment 30 is the composition of embodiment 29, wherein the protein or peptide of interest comprises a chitinase C, a chitinase D, or a combination thereof.

[00929] Embodiment 31 is a pharmaceutical composition comprising a

pharmaceutically acceptable carrier and exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one protein or peptide that protects an animal from a pathogen and a targeting sequence, exosporium protein, or

exosporium protein fragment that targets the fusion protein to the exosporium of the

recombinant Bacillus cereus family member. [00930] Embodiment 32 is the pharmaceutical composition of embodiment 22 or 31, wherein the composition is suitable for topical, oral, intravenous, intra-arterial, intraperitoneal, intramuscular, subcutaneous, intrapleural, intranasal, intradermal, inhalation, rectal, transdermal, transepithelial administration, administration to an aquatic animal by immersion of the animal in the pharmaceutical composition, or a combination of any thereof.

[00931] Embodiment 33 is the pharmaceutical composition of embodiment 32, wherein the composition is suitable for topical administration.

[00932] Embodiment 34 is the pharmaceutical composition of embodiment 33, wherein the composition is in the form of a topical spray composition.

[00933] Embodiment 35 is the pharmaceutical composition of embodiment 32, wherein the composition is suitable for oral administration.

[00934] Embodiment 36 is the pharmaceutical composition of embodiment 35, wherein the composition is formulated as a feed additive.

[00935] Embodiment 37 is a vaccine composition comprising a pharmaceutically acceptable carrier and:

exosporium fragments of a first type;

exosporium fragments of a second type;

the exosporium fragments of the second type being different from the exosporium fragments of the first type;

wherein the exosporium fragments of the first and second types are derived from spores of a recombinant Bacillus cereus family member that comprises a mutation or expresses a protein, wherein the expression of the protein is increased as compared to the expression of the protein in a wild-type Bacillus cereus family member under the same conditions, and wherein the mutation or the increased expression of the protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore; and

wherein at least one of the exosporium fragments of the first type and the exosporium fragments of the second type comprise a fusion protein, the fusion protein comprising an antigen or an immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00936] Embodiment 38 is the vaccine composition of embodiment 37, wherein both the exosporium fragments of the first type and the exosporium fragments of the second type comprise a fusion protein, the fusion protein comprising an antigen or an immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00937] Embodiment 39 is the vaccine composition of embodiment 38, wherein the exosporium fragments of the first type and the exosporium fragments of the second type comprise fusion proteins that are identical to one another.

[00938] Embodiment 40 is the vaccine composition of embodiment 38, wherein the exosporium fragments of the first type and the exosporium fragments of the second type comprise fusion proteins that are different from one another.

[00939] Embodiment 41 is the vaccine composition of embodiment 40, wherein the exosporium fragments of the first type comprise a fusion protein comprising a first antigen or immunogen and the exosporium fragments of the second type comprise a fusion protein comprising a second antigen or immunogen, the first antigen or immunogen being different from the second antigen or immunogen.

[00940] Embodiment 42 is the vaccine composition of embodiment 40 or 41, wherein the exosporium fragments of the first type comprise a fusion protein comprising a first targeting sequence, exosporium protein, or exosporium protein fragment and the exosporium fragments of the second type comprise a fusion protein comprising a second targeting sequence, exosporium protein, or exosporium protein fragment, the first targeting sequence, exosporium protein, or exosporium protein fragment being different from the second targeting sequence, exosporium protein, or exosporium protein fragment.

[00941] Embodiment 43 is the vaccine composition of any one of embodiments 37- 42, wherein the exosporium fragments of the first type are derived from spores of a first species of bacteria within the Bacillus cereus family and the exosporium fragments of the second type are derived from spores of a second species of bacteria within the Bacillus cereus family, the second species of bacteria being different from the first species of bacteria.

[00942] Embodiment 44 is the vaccine composition of embodiment 43, wherein the first species of bacteria comprises Bacillus thuringiensis and the second species of bacteria comprises Bacillus pseudomycoides .

[00943] Embodiment 46 is the vaccine composition of any one of embodiments 37- 44, wherein:

the exosporium fragments of the first type are derived from spores of a recombinant Bacillus cereus family member that comprises a first mutation, wherein the first mutation results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore; and

the exosporium fragments of the second type are derived from spores of a recombinant Bacillus cereus family member that comprises a second mutation, wherein the second mutation results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore;

and wherein the first mutation is different from the second mutation.

[00944] Embodiment 46 is the vaccine composition of embodiment 45, wherein the first mutation and the second mutation are independently selected from:

(i) a mutation in a CotE gene;

(ii) a mutation in an ExsY gene;

(iii) a mutation in a CotY gene;

(iv) a mutation in an ExsA gene; and

(v) a mutation in a CotO gene.

[00945] Embodiment 47 is the vaccine composition of embodiment 46, wherein the first mutation comprises a knock-out of the CotE gene and the second mutation comprises a knockout of the ExsY gene.

[00946] Embodiment 48 is the vaccine composition of any one of embodiments 37- 44, wherein:

the exosporium fragments of the first type are derived from spores of a recombinant Bacillus cereus family member that expresses a first protein, wherein the expression of the first protein is increased as compared to the expression of the first protein in a wild-type Bacillus cereus family member under the same conditions, and wherein the increased expression of the first protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore; and

the exosporium fragments of the second type are derived from spores of a recombinant Bacillus cereus family member that expresses a second protein, wherein the expression of the second protein is increased as compared to the expression of the second protein in a wild-type Bacillus cereus family member under the same conditions, and wherein the increased expression of the second protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore;

and wherein the first protein is different from the second protein.

[00947] Embodiment 49 is the vaccine composition of embodiment 48, wherein the first protein and the second protein are independently selected from:

(i) an ExsY protein, wherein the expression of the ExsY protein is increased as compared to the expression of the ExsY protein in a wild-type Bacillus cereus family member under the same conditions, and wherein the ExsY protein comprises a carboxy-terminal tag comprising a globular protein;

(ii) a BclB protein, wherein the expression of the BclB protein is increased as compared to the expression of the BclB protein in a wild-type Bacillus cereus family member under the same conditions; and

(iii) a YjcB protein, wherein the expression of the YjcB protein is increased as compared to the expression of the YjcB protein in a wild-type Bacillus cereus family member under the same conditions.

[00948] Embodiment 50 is the vaccine composition of any one of embodiments 37- 44, wherein:

the exosporium fragments of the first type are derived from spores of a recombinant Bacillus cereus family member that comprises a mutation, wherein the mutation results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore; and the exosporium fragments of the second type are derived from spores of a recombinant Bacillus cereus family member that expresses a protein, wherein the expression of the protein is increased as compared to the expression of the protein in a wild-type Bacillus cereus family member under the same conditions, and wherein the increased expression of the protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore.

[00949] Embodiment 51 isthe vaccine composition of embodiment 50, wherein: the mutation is selected from:

(i) a mutation in a CotE gene;

(ii) a mutation in an ExsY gene;

(iii) a mutation in a CotY gene; (iv) a mutation in an ExsA gene; and

(v) a mutation in a CotO gene;

and wherein the protein is selected from:

(i) an ExsY protein, wherein the expression of the ExsY protein is increased as compared to the expression of the ExsY protein in a wild- type Bacillus cereus family member under the same conditions, and wherein the ExsY protein comprises a carboxy-terminal tag comprising a globular protein;

(ii) a BclB protein, wherein the expression of the BclB protein is increased as compared to the expression of the BclB protein in a wild- type Bacillus cereus family member under the same conditions; and

(iii) a YjcB protein, wherein the expression of the YjcB protein is increased as compared to the expression of the YjcB protein in a wild- type Bacillus cereus family member under the same conditions.

[00950] Embodiment 52 is a vaccine composition comprising a pharmaceutically acceptable carrier and:

spores of a recombinant Bacillus cereus family member that expresses a first fusion protein, the first fusion protein comprising at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the first fusion protein to the exosporium of the recombinant Bacillus cereus family member; and

exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member.

[00951] Embodiment 53 is a vaccine composition comprising a pharmaceutically acceptable carrier and:

a first immunogen or antigen;

exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member.

[00952] Embodiment 54 is the vaccine composition of embodiment 52 or 53, wherein the exosporium fragments are derived from a recombinant Bacillus cereus family member that comprises a mutation or expresses a protein, wherein the expression of the protein is increased as compared to the expression of the protein in a wild-type Bacillus cereus family member under the same conditions, and wherein the mutation or the increased expression of the protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore.

[00953] Embodiment 55 is the vaccine composition of embodiment 52 or 54, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member that expresses a second fusion protein, the second fusion protein comprising at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the second fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00954] Embodiment 56 is the vaccine composition of embodiment 55, wherein the first fusion protein and the second protein are identical to one another.

[00955] Embodiment 57 is the vaccine composition of embodiment 55, wherein the first fusion protein and the second fusion protein are different from one another.

[00956] Embodiment 58 is the vaccine composition of embodiment 57, wherein the first fusion protein comprises a first antigen or immunogen and the second fusion protein comprises a second antigen or immunogen, the first antigen or immunogen being different from the second antigen or immunogen.

[00957] Embodiment 59 is the vaccine composition of embodiment 57 or 58, wherein the first fusion comprises a first targeting sequence, exosporium protein, or exosporium protein fragment and the second fusion protein comprises a second targeting sequence, exosporium protein, or exosporium protein fragment, the first targeting sequence, exosporium protein, or exosporium protein fragment being different from the second targeting sequence, exosporium protein, or exosporium protein fragment.

[00958] Embodiment 60 is the vaccine composition of embodiment 53 or 54, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising a second antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[00959] Embodiment 61 is the vaccine composition of embodiment 60, wherein the first antigen or immunogen and the second antigen or immunogen are the same.

[00960] Embodiment 62 is the vaccine composition of embodiment 61, wherein the first antigen or immunogen and the second antigen or immunogen are different from one another. [00961] Embodiment 63 is the vaccine composition of any one of embodiments 37- 62, wherein the composition further comprises an adjuvant.

[00962] Embodiment 64 is a method for producing an immunogenic response in an animal comprising administering a vaccine composition of any one of embodiments 37-63 to the animal.

[00963] Embodiment 65 is a method for protecting an animal from a pathogen comprising administering to the animal, to the environment of the animal, or to the pathogen:

spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member, wherein the protein or peptide that protects the animal from a pathogen does not comprise an antigen or an immunogen;

exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one protein or peptide that protects the animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

or a combination thereof.

[00964] Embodiment 66 is the method of embodiment 65, wherein the method comprises administering the spores, the exosporium fragments, or a combination thereof to the animal.

[00965] Embodiment 67 is the method of embodiment 65 or 66, wherein the method comprises administering the exosporium fragments.

[00966] Embodiment 68 is the composition of any one of embodiments 31-36 or the method of any one of embodiments 65-67, wherein the protein or peptide that protects the animal from a pathogen does not comprise an antigen or an immunogen.

[00967] Embodiment 69 is the composition of any one of embodiments 31-36 and 68, or the method of any one of embodiments 65-68, wherein the protein or peptide that protects the animal from a pathogen does not comprise a nucleic acid binding protein or peptide.

[00968] Embodiment 70 is the composition of any one of embodiments 31-36, 68, and 69, or the method of any one of embodiments 64-69, wherein the animal is selected from mammals, birds, fish, amphibians, reptiles, crustaceans, mollusks, worms, insects, corals, and sponges.

[00969] Embodiment 71 is the composition or method of embodiment 70, wherein the animal comprises the mammal, the mammal being selected from humans, monkeys, sheep, goats, cows, pigs, deer, alpacas, bison, camels, donkeys, horses, mules, yaks, reindeer, llamas, rabbits, dogs, cats, ferrets, gerbils, guinea pigs, hamsters, mice, rabbits, and rats.

[00970] Embodiment 72 is the composition or method of embodiment 70, wherein the animal comprises the bird, the bird being selected from chickens, turkeys, ducks, geese, quail, doves, pigeons, ostriches, emus, and pheasants.

[00971] Embodiment 73 is the composition or method of embodiment 70, wherein the animal comprises the fish, the fish being selected from hobby fish, salmon, trout, halibut, seabass, snapper, grouper, mullet, tilapia, tuna, catfish, carp, and sturgeon.

[00972] Embodiment 74 is the composition or method of embodiment 70, wherein the animal comprises the amphibian, the amphibian being selected from frogs, toads, newts, and salamanders.

[00973] Embodiment 75 is the composition or method of embodiment 70, wherein the animal comprises the reptile, the reptile being selected from snakes, lizards, iguanas, crocodiles, alligators, turtles, and tortoises.

[00974] Embodiment 76 is the composition or method of embodiment 70, wherein the animal comprises the crustacean, the crustacean being selected from shrimp, prawns, krill, lobsters, crabs, and crayfish.

[00975] Embodiment 77 is the method of any one of embodiments 72-76, wherein the method for protecting an animal from a pathogen comprises protecting the animal's eggs from the pathogen.

[00976] Embodiment 78 is the method of any one of embodiments 72-77, wherein the method comprises administering the exosporium fragments or spores to the animal's eggs.

[00977] Embodiment 79 is the composition or method of embodiment 70, wherein the animal comprises the mollusk, the mollusk being selected from mussels, clams, oysters, scallops, snails, slugs, squid, cuttlefish, and octopi.

[00978] Embodiment 80 the composition or method of embodiment 70, wherein the animal comprises the worm, the worm being selected from earthworms, nematodes, flatworms, roundworms, tapeworms, and flukes. [00979] Embodiment 81 is the composition or method of embodiment 70, wherein the animal comprises the insect, the insect being selected from bees, ladybugs, butterflies, silkworms, flies, beetles, and the larvae of any thereof.

[00980] Embodiment 82 is the composition of any one of embodiments 31-36, 65-72, and 79-81, or the method of any one of embodiments 65-81, wherein protein or peptide that protects the animal from a pathogen has antibacterial activity, antifungal activity, antihelminthic activity, nematicidal activity, insecticidal activity, acaricidal activity, suppresses insect or worm reproduction, a combination of any thereof.

[00981] Embodiment 83 is the composition or method of embodiment 82, wherein the protein or peptide that protects the animal from a pathogen has antibacterial activity, antifungal activity, or a combination thereof.

[00982] Embodiment 84 the composition or method of embodiment 82 or 83, wherein the protein or peptide that protects the animal from a pathogen comprises a bacteriocin, an avidin, a streptavidin, an antimicrobial peptide, a conalbumin, an albumin, a lactoferrin, a lactoferrin peptide, a lysozyme peptide, TasA, a defensin, an antibody, an antibody fragment, an enzyme, a histone, or a combination of any thereof.

[00983] Embodiment 85 is the composition or method of embodiment 84, wherein the lactoferrin peptide comprises a LfcinB; wherein the lysozyme peptide comprises LysM; or wherein the albumin comprises an ovalbumin.

[00984] Embodiment 86 is the composition or method of embodiment 85, wherein the antimicrobial peptide comprises a non-ribosomal antibacterial peptide, a non-ribosomal antifungal peptide, a cecropin, a penaeidin, a bactenecin, a callinectin, a myticin, a tachyplesin, a clavanin, amisgurin, a pleurocidin, a parasin, or a combination of any thereof.

[00985] Embodiment 87 is the composition or method of embodiment 84, wherein the enzyme comprises a nuclease, a protease, a lactonase, an apyrase, a glycoside hydrolase, an alginate lyase, a glucanase, a chitosanase, a chitinase, a chitosanase-like enzyme, a lyticase, a mutanolysin, a stapholysin, or a combination of any thereof.

[00986] Embodiment 88 is the composition or method of embodiment 87, wherein the glycoside hydrolase comprises a lysozyme, a dispersin B, or a combination thereof; wherein the nuclease comprises a DNAse; or wherein the chitinase comprises an endochitinase, an exochitinase, or a combination thereof. [00987] Embodiment 89 is the composition or method of embodiment 88, wherein the DNAse comprises DNasel; wherein the endochitinase comprises a chitinase C; or wherein the exochitinase comprises a chitinase D.

[00988] Embodiment 90 is the composition or method of embodiment 84, wherein the enzyme comprises an enzyme that is specific for a bacterial signaling molecule.

[00989] Embodiment 91 is the composition or method of embodiment 90, wherein the enzyme comprises a protease or a lactonase.

[00990] Embodiment 92 is the composition or method of embodiment 91, wherein the lactonase comprises a lactonase that is specific for a bacterial lactone homoserine signaling molecule.

[00991] Embodiment 93 is the composition or method of embodiment 87, 91, or 92, wherein the lactonase comprises a 1,4-lactonase, a 2-pyrone-4,6-dicarboxylate lactonase, a 3- oxoadipate enol-lactonase, an actinomycin lactonase, a deoxylimonate A-ring-lactonase, a gluconolactonase L-rhamnono- 1,4-lactonase, a limonin-D-ring-lactonase, a steroid-lactonase, a triacetate-lactonase, a xylono- 1,4-lactonase, or a combination of any thereof.

[00992] Embodiment 94 is the composition or method of embodiment 84, wherein the enzyme comprises an enzyme that is specific for a cellular or extracellular component of a bacterium or fungus.

[00993] Embodiment 95 is the composition or method of embodiment 94, wherein the enzyme comprises a glucanase, a chitosanase, a chitinase, a chitosanase-like enzyme, a lyticase, a protease, a mutanolysin, a stapholysin, a lysozyme, or a combination of any thereof.

[00994] Embodiment 96 is the composition or method of embodiment 87 or 95 wherein the glucanase comprises a cellulase, β- 1,3 -glucanase, a β-Ι,ό-glucanase, or a combination of any thereof.

[00995] Embodiment 97 is the composition or method of embodiment 87 or 95, wherein the protease comprises a peptidase, a proteinase, or a combination thereof.

[00996] Embodiment 98 is the composition or method of embodiment 97, wherein the proteinase comprises proteinase K; or wherein the peptidase comprises an endopeptidase or an exopeptidase.

[00997] Embodiment 99 is the composition or method of embodiment 87 or 95, wherein the protease comprises an alkaline protease, an acid protease, or a neutral protease.

[00998] Embodiment 100 is the composition or method of embodiment 87 or 95, wherein the protease comprises a Bacillus subtilis serine protease. [00999] Embodiment 101 is the composition or method of embodiment 100, wherein the Bacillus subtilis serine protease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 209 or 210.

[001000] Embodiment 102 is the composition or method of embodiment 82, wherein the protein or peptide that protects the animal from a pathogen has antihelminthic activity, nematicidal activity, insecticidal activity, acaricidal activity, suppresses insect or worm reproduction, or a combination of any thereof.

[001001] Embodiment 103 is the composition or method of embodiment 102, wherein the protein or peptide that protects the animal from a pathogen comprises an insecticidal bacterial toxin, an acaricidal bacterial toxin, an endotoxin, a Cry toxin, a protease inhibitor protein or peptide, a secreted insecticidal (Sip) protein, a mosquitocidal toxin, a cysteine protease, a Bacillus subtilis serine protease, a chitinase, or a combination of any thereof.

[001002] Embodiment 104 is the composition or method of embodiment 103, wherein the insecticidal bacterial toxin comprises a VIP insecticidal protein; wherein the Cry toxin comprises a Cry toxin from Bacillus thuringiensis; wherein the protease inhibitor protein or peptide comprises a trypsin inhibitor or an arrowhead protease inhibitor; wherein the

mosquitocidal toxin comprises an Mtx-like mosquitocidal toxin, a Bin-like mosquitocidal toxin, or a combination thereof; or wherein the endotoxin comprises a delta endotoxin.

[001003] Embodiment 105 is the composition or method of embodiment 104, wherein the Mtx-like mosquitocidal toxin comprises Mtxl .

[001004] Embodiment 106 is the composition or method of embodiment 103 or 104, wherein the Cry toxin comprises a Cry5B protein, a Cry21A protein, a CrylAa protein, a Cry 1 Ab protein, a Cryl Ac protein, a Cry ICa protein, a Cry IDa protein, a Cry2Aa protein, a Cry3Aa protein, a Cry3Bb protein, a Cry4Aa protein, a Cry4Ab protein, a Cry 11 Aa protein, a Cytl Aa protein, or a combination of any thereof.

[001005] Embodiment 107 is the composition of any one of embodiments 31-36, 68- 76, and 79-106 or the method of any one of embodiments 65-106, wherein the pathogen comprises a bacterial pathogen, a fungal pathogen, a pathogenic worm, a pathogenic insect, a pathogenic arachnid, a pathogenic protist, or a combination of any thereof.

[001006] Embodiment 108 is the composition or method embodiment 107, wherein the pathogen comprises the bacterial pathogen, the bacterial pathogen comprising a bacterial pathogen of the genus Staphylococcus, a bacterial pathogen of the genus Hemophilus, a bacterial pathogen of the genus Pseudomonas, a bacterial pathogen of the genus Streptococcus, a bacterial pathogen of the genus Mycobacterium, a bacterial pathogen of the genus Clostridium, a bacterial pathogen of the genus Enter obacteriaceae, a bacterial pathogen of the genus Enterococcus, a bacterial pathogen of the genus Aeromonas, a bacterial pathogen of the genus Acinetobacter, a bacterial pathogen of the genus Fusobacterium, a bacterial pathogen of the genus Prevotella, a bacterial pathogen of the genus Flavobacterium, a bacterial pathogen of the genus Edwardsiella, a bacterial pathogen of the genus Anaplasm, a bacterial pathogen of the genus Bacillus, a bacterial pathogen of the genus Bartonella, a bacterial pathogen of the genus Bordetella, a bacterial pathogen of the genus Borrelia, a bacterial pathogen of the genus Brucella, a bacterial pathogen of the genus Burkolderia, a bacterial pathogen of the genus Chlamydophilia, a bacterial pathogen of the genus Coxiella, a bacterial pathogen of the genus Ehrlichia, a bacterial pathogen of the genus Helicobacter, a bacterial pathogen of the genus Klebsiella, a bacterial pathogen of the genus Lasonia, a bacterial pathogen of the genus Leptospira, a bacterial pathogen of the genus Mycoplasma, a bacterial pathogen of the genus Neorickettsia, a bacterial pathogen of the genus Pasteurella, a bacterial pathogen of the genus Rickettsia, a bacterial pathogen of the genus Salmonella, or a combination of any thereof.

[001007] Embodiment 109 is the composition or method of embodiment 108, wherein the bacterial pathogen comprises Acinetobacter baumannii, Aeromonas hydrophila, Anaplasma phagocy tophi la, Anaplasma phagocytophilum, Anaplasma platys, Bacillus anthracis, Bartonella henselae, Bartonella rochalimae, Bartonella vinsonii subspecies berkhoffii, Bordetella bronchiseptica, Borrelia theileri, Borrelia burgdorferi, Brucella abortus, Brucella melitensis, Brucella suis, Burkholderia mallei, Burkholderia pseudomallei, Chlamydophila abortus, Chlamydophila felis, Chlamydophila psittaci, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Clostridium piliforme, Clostridium tetani, Coxiella burnetii,

Edwardsiella ictaluri, Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia ewingii, Ehrlichia ruminantium, Enterococcus faecalis, Erysipelothrix rhusiopathiae, Flavobacterium columnare, Fusobacterium necrophorum, Hemophilus influenzae, Haemobartonella felis, Helicobacter hepaticus, Klebsiella pneumoniae, Lawsonia intracellulars, Leprospira Pomona, Leptospira autumnalis, Leptospira ballum, Leptospira canicola, Leptospira grippotyphosa, Leptospira icterohaemorrhagiae, Leptospira interrogans sensu lato, Mycobacterium avium group,

Mycobacterium bovis, Mycobacterium fortuitum, Mycobacterium microti, Mycobacterium paratuberculosis, Mycobacterium tuberculosis, Mycoplasma agalactiae, Mycoplasma capricolum capricolum, Mycoplasma capricolum subspecies capripneumoniae, Mycoplasma felis, Mycoplasma mycoides Capri, Mycoplasma mycoides subspecies mycoides, Mycoplasma putrefasciens, Neorickettsia elokominica, Neorickettsia helminthoeca, Neorickettsia risticii, Pasteurella multocida, Pseudomonas aeruginosa, Prevotella melaninogenicus, Rickettsia prowazekii, Rickettsia typhi, Spiroplasma mirum, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus pseudintermedius, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus bovis, Streptococcus Group A, Streptococcus Group B, Streptococcus Group C, Streptococcus Group D, Streptococcus Group G, Streptococcus equi subspecies equi, Streptococcus equi subspecies zooepidemicus, Taylorella equigenitalis, or a combination of any thereof.

[001008] Embodiment 110 is the composition or method of embodiment 107, wherein the pathogen comprises the fungal pathogen, the fungal pathogen comprising a fungal pathogen of the genus Aspergillus, a fungal pathogen of the genus Microsporum, a fungal pathogen of the genus Cryptococcus, a fungal pathogen of the genus Chrysosporium, a fungal pathogen of the genus Encephalitozoon, a fungal pathogen of the genus Enter ocytozoon, a fungal pathogen of the genus Fusarium, a fungal pathogen of the genus Lichtheimia, a fungal pathogen of the genus Malassezia, a fungal pathogen of the genus Trichophyton, a fungal pathogen of the genus Mortierella, a fungal pathogen of the genus Mycor, a fungal pathogen of the genus Absidia, a fungal pathogen of the genus Rhizopus, a fungal pathogen of the genus Cladosporium, a fungal pathogen of the genus Scopulariopsis, a fungal pathogen of the genus Prototheca, a fungal pathogen of the genus Pythium, a fungal pathogen of the genus Rhodotorula, a fungal pathogen of the genus Stachybotrys, a fungal pathogen of the genus Lagenidium, a fungal pathogen of the genus Sirolpidium, a fungal pathogen of the genus Candida, or a combination of any thereof.

[001009] Embodiment 111 is the composition or method embodiment 107, wherein the pathogen comprises the fungal pathogen, the fungal pathogen comprising an opportunistic dematiaceous fungal pathogen.

[001010] Embodiment 112 is the composition or method of embodiment 110, wherein the fungal pathogen comprises Chrysosporium parvum, Encephalitozoon cuniculi, Lichtheimia corymbifera, Lagenidium myophilum, Mortierella wolfii, Stachybotrys chartarum, Cryptococcus neoformans, Candida albicans, Trichophyton verrucosum, Trichophyton equinum, Trichophyton mentagrophytes, or a combination of any thereof.

[001011] Embodiment 113 is the composition or method of embodiment 107, wherein the pathogen comprises the pathogenic worm, the pathogenic worm comprising a nematode, a helminth, a roundworm, a pinworm, a whipworm, a threadworm, a cecal worm, a stomach worm, a hairworm, a threadnecked worm, a fluke, a tapeworm, or a combination of any theroef.

[001012] Embodiment 114 is the composition or method of embodiment 113, wherein the pathogenic worm comprises Ascaris suum, Trichinella spiralis, Trichuris suis, Ascaris lumbricoides, Ascaris spp., Trichinella sp., Ostertagia ostertagi, Haemonchus placei, Cooperia oncophora, Dictyocaulus viviparus, Fasciola hepatica, Haemonchus contortus, Nematodirus battus, Strongyloides sp. , Ancylostoma caninum, Toxocara canis, Toxocara cati, Taenia taeniaeformis, or a combination of any thereof.

[001013] Embodiment 115 is the composition or method of embodiment 107, wherein the pathogen comprises the pathogenic insect, the pathogenic insect comprising an endoparasite, an ectoparasite, or a combination thereof.

[001014] Embodiment 116 is the composition or method of embodiment 115, wherein the pathogenic insect comprises an ectoparasite and the ectoparasite is selected from fleas, ticks, lice, mites, flies, mosquitoes, the larvae of any thereof, and combinations of any thereof; or wherein the pathogenic insect comprises an endoparasite and the endoparasite is selected from heel flies, bomb flies, bot flies, Gasterophilus sp., the larvae of any thereof, and combinations of any thereof.

[001015] Embodiment 117 is the composition or method of embodiment 107, wherein the pathogen comprises a pathogenic protist, the pathogenic protist comprising a protist of the genus Babesia, a protist of the genus Neospora, a protist of the genus Sarcocystis, a protist of the genus Theileria, a protist of the genus Trypanosoma, a protist of the genus Entamoeba, a protist of the genus Giardis, a protist of the genus Cryptosporidium, a protist of the genus Trichomonas, a protist of the genus Toxoplasma, a protist of the genus Plasmodium, a protist of the genus Coccidia, a protist of the genus Leishmania, a protist of the genus Cryptosporidia, a protist of the genus Cyclospora, a protist of the genus Eimeria, a protist of the genus Naeglaria, a protist of the genus Sarcocystis, a protist of the genus Neosporia, a protist of the genus Blastocystis, a protist of the genus Microsporidia, or a combination of any thereof.

[001016] Embodiment 118 is the composition or method of embodiment 117, wherein the pathogenic protist comprises Entamoeba histolytica, Babesia bovis, Babesia bigemina, Babesia canis, Eimeria maxima, Eimeria tenella, Giardia duodenalis, Leishmania donovani, Neospora caninum, Sarcocystis neurona, Theileria parva, Theileria annulata, Theileria hirci, Toxoplasma gondii, or a combination of any thereof. [001017] Embodiment 1 19 is the method of any one of embodiments 64-1 18, wherein the vaccine composition, exosporium fragments or spores are administered to the animal by topical, oral, intraperitoneal, intra-arterial, intravenous, intramuscular, subcutaneous, intrapleural, intranasal, rectal, intradermal, inhalation, transdermal, or transepithelial

administration, or by immersing the animal into a solution comprising the exosporium fragments or spores.

[001018] Embodiment 120 is a composition comprising a carrier acceptable for use in aquaculture and exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one protein or peptide that protects an aquatic organism from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[001019] Embodiment 121 is the composition of embodiment 120, wherein the carrier comprises a hydrophobic polymer.

[001020] Embodiment 122 is the composition of embodiment 120 or 121, wherein the composition is in the form of a dry powder or a water-dispersible granule.

[001021] Embodiment 123 is the composition of any one of embodiments 120-122, wherein the protein or peptide that protects an aquatic organism from a pathogen comprises an apyrase, a dispersin B, or a combination thereof.

[001022] Embodiment 124 is a method for protecting an aquatic organism from a pathogen, comprising cultivating the aquatic organism in an aquaculture system and introducing into the aquaculture system:

spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising at least one protein or peptide that protects the aquatic organism from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one protein or peptide that protects the aquatic organism from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member; or a combination thereof;

and wherein the aquatic organism is selected from fish, amphibians, reptiles, crustaceans, mollusks, worms, coral, sponges, red algae, brown algae, or combinations of any thereof.

[001023] Embodiment 125 is the composition of any one of embodiments 120-123 or the method of embodiment 124, wherein the protein or peptide that protects the aquatic organism from a pathogen does not comprise an antigen or an immunogen.

[001024] Embodiment 126 is the composition of any one of embodiments 120-123 and 125 or the method of embodiment 124 or 125, wherein the aquatic organism comprises red algae, brown algae, or a combination thereof.

[001025] Embodiment 127 is the composition or method of embodiment 126, wherein the brown algae comprises seaweed.

[001026] Embodiment 128 is the composition or method of embodiment 127, wherein the seaweed comprises nori, kelp, or a combination thereof.

[001027] Embodiment 129 is the method of any one of embodiments 65-119 and 124- 128, wherein the method is a method for protecting an aquatic animal from a pathogen and the method comprises cultivating the aquatic animal in an aquaculture system and administering the spores or exosporium fragments to the aquatic animal by introducing the spores or exosporium fragments into the aquaculture system.

[001028] Embodiment 130 is the method of any one of embodiments 124-129, wherein the method comprises introducing the exosporium fragments into the aquaculture system.

[001029] Embodiment 131 is the composition of any one of embodiments 120-123 and 125 or the method of any one of embodiments 124-130, wherein the aquatic organism or the aquatic animal is selected from fish, amphibians, reptiles, crustaceans, mollusks, worms, coral, sponges, or combinations of any thereof.

[001030] Embodiment 132 is the composition or method of embodiment 131, wherein the aquatic organism or the aquatic animal comprises the fish, the fish being selected from salmon, trout, halibut, seabass, snapper, grouper, mullet, tilapia, tuna, catfish, carp, sturgeon, or combinations of any thereof.

[001031] Embodiment 133 is the composition or method of embodiment 131, wherein the aquatic organism or the aquatic animal comprises the amphibians, the amphibians being selected from frogs, toads, newts, salamanders, or combinations of any thereof; or wherein the aquatic organism or the aquatic animal comprises the reptile, the reptile being selected from snakes, lizards, crocodiles, alligators, turtles, tortoises, or combinations of any thereof.

[001032] Embodiment 134 is the composition or method of embodiment 133, wherein the aquatic organism or the aquatic animal comprises frogs, toads, alligators, turtles, or a combination of any thereof.

[001033] Embodiment 135 is the composition or method of embodiment 131, wherein the aquatic organism or the aquatic animal comprises the crustaceans, the crustaceans being selected from shrimp, prawns, krill, lobsters, crabs, crayfish, and combinations of any thereof.

[001034] Embodiment 136 is the composition or method of embodiment 131, wherein the aquatic organism or the aquatic animal comprises the mollusks, the mollusks being selected from mussels, clams, oysters, scallops, snails, slugs, squid, cuttlefish, octopi, and combinations of any thereof.

[001035] Embodiment 137 is the method of any one of embodiments 124-136, wherein the method prevents or treats a disease of the aquatic organism or the aquatic animal caused by the pathogen.

[001036] Embodiment 138 is the method of any one of embodiments 124-137, wherein the method prevents or inhibits biofilm formation or promotes dissolution of a biofilm on a surface within the aquaculture system.

[001037] Embodiment 139 is the method of any one of embodiments 124-138, wherein introducing the exosporium fragments or spores into the aquaculture system comprises adding the exosporium fragments or spores to water in the aquaculture system.

[001038] Embodiment 140 is the method of any one of embodiments 124-139, wherein introducing the exosporium fragments or spores into the aquaculture system comprises applying the exosporium fragments or spores to a surface within the aquaculture system.

[001039] Embodiment 141 is the method of embodiment 138 or 140, wherein the surface comprises a surface of a pipe, tank, pump, filter, or a combination of any thereof.

[001040] Embodiment 142 is the method of any one of embodiments 124-141, wherein introducing the exosporium fragments or spores into the aquaculture system comprises dipping the aquatic organism or the aquatic animal into a solution comprising the exosporium fragments or spores.

[001041] Embodiment 143 is the method of any one of embodiments 124-142, wherein the aquaculture system is a freshwater aquaculture system. [001042] Embodiment 144 is the method of any one of embodiments 124-142, wherein the aquaculture system is a saltwater aquaculture system.

[001043] Embodiment 145 is the method of any one of embodiments 124-142, wherein the aquaculture system is a brackish water aquaculture system.

[001044] Embodiment 146 is the method of any one of embodiments 124-145, wherein the exosponum fragments or spores are introduced into the aquaculture system in a composition comprising the exosporium fragments or spores and a carrier.

[001045] Embodiment 147 is the composition of any one of embodiments 120-122, 125-128, and 131-136, or the method of any one of embodiments 124-146, wherein the protein or peptide that protects the aquatic organism from a pathogen or the protein or peptide that protects the animal from a pathogen comprises an apyrase, a protease, a chitinase, a glucanase, an antimicrobial protein or peptide, a lactonase, or a combination of any thereof.

[001046] Embodiment 148 is the composition or method of embodiment 147, wherein the glucanase comprises a P-l,3-glucanase.

[001047] Embodiment 149 is the composition or method of embodiment 147, wherein the protease comprises a Bacillus subtilis serine protease.

[001048] Embodiment 150 is the composition or method of embodiment 149, wherein the Bacillus subtilis serine protease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 209 or 210.

[001049] Embodiment 151 is the composition or method of embodiment 147, wherein the antimicrobial protein or peptide comprises a lactoferrin peptide.

[001050] Embodiment 152 is the composition or method of embodiment 151, wherein the lactoferrin peptide comprises a LfcinB.

[001051] Embodiment 153 is the composition of any one of embodiments 120-123, 125-128, 131-136, and 147-152 or the method of any one of embodiments 124-152, wherein the pathogen comprises a fungal pathogen of the genus Lagenidium, a fungal pathogen of the genus Sirolpidium, Aeromonas hydrophila, or a combination of any thereof.

[001052] Embodiment 154 is the method of any one of embodiments 65-119, wherein administering the exosporium fragments or spores to the animal comprises applying the exosporium fragments or spores to a wound of the animal.

[001053] Embodiment 155 is the method of embodiment 154, wherein the method comprises applying the exosporium fragments to the wound of the animal. [001054] Embodiment 156 the method of embodiment 154 or 155, wherein the method prevents or treats an infection of the wound.

[001055] Embodiment 157 is the method of any one of embodiments 154-156, wherein the method prevents or inhibits biofilm formation in the wound or promotes dissolution of a biofilm within the wound.

[001056] Embodiment 158 is the method of any one of embodiments 154-157, comprising applying the exosporium fragments or spores to the wound in a pharmaceutical composition comprising the exosporium fragments or spores and a pharmaceutically acceptable carrier.

[001057] Embodiment 159 is the composition of embodiment 31 or the method of embodiment 158, wherein the composition comprises a solution, lotion, cream, ointment, gel, foam, spray, dip, or bath.

[001058] Embodiment 160 is the composition of embodiment 31 or 159, wherein the protein or peptide that protects an animal from a pathogen comprises an apyrase.

[001059] Embodiment 161 is the composition of embodiment 31 or 160 or the method of embodiment 158, wherein the composition is provided in an adhesive patch or a wound dressing.

[001060] Embodiment 162 is an adhesive patch or wound dressing comprising a pharmaceutical composition, wherein the pharmaceutical composition comprises a

pharmaceutically acceptable carrier and:

spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising at least one protein or peptide that protects an animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one protein or peptide that protects an animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

or a combination thereof. [001061] Embodiment 163 is the composition of any one of embodiments 31 and 159— 161, the method of any one of embodiments 154-159 and 161, or the adhesive patch or wound dressing of embodiment 162, wherein the protein or peptide that protects the animal from a pathogen comprises an enzyme, an antibacterial peptide an endotoxin, a Cry protein, an antifungal peptide or protein, or a combination of any thereof.

[001062] Embodiment 164 is the composition, method, adhesive patch, or wound dressing of embodiment 163, wherein the enzyme comprises an apyrase, a lactonase, a protease, a glucanase, a chitinase, or a combination of any thereof; or wherein the endotoxin comprises a delta endotoxin.

[001063] Embodiment 165 is the composition of any one of embodiments 31 and 159— 161, 163, and 164, the method of any one of embodiments 154-159, 161, 163, and 164, or the adhesive patch or wound dressing of any one of embodiments 162-164, wherein the pathogen comprises Acinetobacter baumannii.

[001064] Embodiment 166 the composition of any one of embodiments 31 and 159— 161, 163, and 164, the method of any one of embodiments 154-159, 161, 163, and 164, or the adhesive patch or wound dressing of any one of embodiments 162-164, wherein the pathogen comprises a bacterial pathogen of the genus Streptococcus, a bacterial pathogen of the genus Staphylococcus, a bacterial pathogen of the genus Pseudomonas, a bacterial pathogen of the genus Enter ococcus, or a combination of any thereof.

[001065] Embodiment 167 is the method of any one of embodiments 65-119, wherein the animal comprises a hooved animal and wherein administering the exosporium fragments or spores to the animal comprises applying the exosporium fragments or spores to one or more hooves of the animal.

[001066] Embodiment 168 is the method of embodiment 167, wherein the method comprises applying the exosporium fragments to the one or more hooves of the animal.

[001067] Embodiment 169 is the method of embodiment 167 or 168, wherein the method prevents or treats an infectious disease that affects the hooves of the animal.

[001068] Embodiment 170 is the method of embodiment 169, wherein the infectious disease comprises infectious pododermatitis, Leptospirosis, thrush, white line disease, an infection caused by a bacterial pathogen of the genus Treponema, an infection caused by a bacterial pathogen of the genus Dichelobacter, an infection caused by a bacterial pathogen of the genus Fusobacterium, an infection caused by a bacterial pathogen of the genus Actinomyces, or a combination of any thereof. [001069] Embodiment 171 is the method of any one of embodiments 167-170, wherein the hooved animal comprises a cow, a sheep, a bison, a buffalo, a deer, a horse, a mule, a camel, a pig, or a goat.

[001070] Embodiment 172 is the method of any one of embodiments 167-171, wherein applying the exosporium fragments or spores to the one or more hooves of the animal comprises the use of a footbath.

[001071] Embodiment 173 is the method of embodiment 172, wherein the method comprises walking the animal through a footbath containing a composition comprising the exosporium fragments or spores and a carrier.

[001072] Embodiment 174 is the method of embodiment 173, wherein the composition is present in the footbath at a depth that is sufficient for the composition to make contact with an infected area of the animal's hoof as the animal walks through the footbath.

[001073] Embodiment 175 is the composition of any one of embodiments 31-33 or the method of embodiment 173 or 174, wherein the composition comprises a liquid, a semisolid, a water-dispersible granule, a dissolvable powder, a foam, a lotion, or a gel.

[001074] Embodiment 176 is the composition of any one of embodiments 31-33 or the method of embodiment 173 or 174, wherein the composition is a liquid concentrate or a powder for use in a footbath.

[001075] Embodiment 177 is an insert tray for a livestock footbath, wherein the insert tray comprises:

spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising at least one protein or peptide that protects a hooved animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one protein or peptide that protects a hooved animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

or a combination thereof; and wherein the spores or exosporium fragments are immobilized on an inner surface of the insert tray.

[001076] Embodiment 178 is the insert tray of embodiment 177, wherein the insert tray comprises the exosporium fragments.

[001077] Embodiment 179 is the method of any one of embodiments 167-175, wherein applying the exosporium fragments or spores to the one or more hooves of the animal comprises the use of a hoof bandage comprising a composition comprising the exosporium fragments or spores and a carrier.

[001078] Embodiment 180 is a hoof bandage comprising a pharmaceutical

composition, wherein the pharmaceutical composition comprises a pharmaceutically acceptable carrier and:

spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising at least one protein or peptide that protects a hooved animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one protein or peptide that protects a hooved animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

or a combination thereof.

[001079] Embodiment 181 is the hoof bandage of embodiment 180, wherein the spores or exosporium fragments are immobilized on a surface of the bandage that contacts the hoof of a hooved animal.

[001080] Embodiment 182 is the hoof bandage of embodiment 180 or 181, wherein the pharmaceutical composition comprises the exosporium fragments.

[001081] Embodiment 183 is the method of any one of embodiments 167-176 and 179, the composition of embodiment 175 or 176, the insert tray of embodiment 177 or 178, or the hoof bandage of embodiment 180-182, wherein the protein or peptide that protects the animal from a pathogen comprises a lactoferrin, a lactoferrin peptide, a lysozyme, a lysozyme peptide, a protease, a glucanase, an antimicrobial peptide or protein, an apyrase, a lactonase, or a combination of any thereof.

[001082] Embodiment 184 is the method, composition, insert tray, or hoof bandage of embodiment 183, wherein the lactoferrin peptide comprises a LfcinB or wherein the lysozyme peptide comprises a LysM.

[001083] Embodiment 185 is the method of any one of embodiments 167-176, 179, 183, and 184, the composition of any one of embodiments 175, 176, 183, and 184, the insert tray of any one of embodiments 177, 178, 183, and 184 or the hoof bandage of any one of embodiments 180-184, wherein the pathogen comprises Fusobacterium necrophorum,

Prevotella melaninogenicus, Chrysosporium parvum, a bacterial pathogen of the genus

Leptospira, a bacterial pathogen of the genus Actinomyces, a bacterial pathogen of the genus Treponema, Dichelobacter nodosus, a bacterial pathogen of the genus Fusobacterium, or a combination of any thereof.

[001084] Embodiment 186 is the method of any one of embodiments 167-176, 179, and 183-185, the composition of any one of embodiments 175, 176, and 183-185, the insert tray of any one of embodiments 177, 178, and 183-185, or the hoof bandage of any one of embodiments 180-185, wherein the pathogen comprises a mixture of two or more pathogens.

[001085] Embodiment 187 is the method of any one of embodiments 65-119, wherein the animal comprises a ruminant and the method comprises orally administering the spores or the exosporium fragments to the ruminant.

[001086] Embodiment 188 is the method of embodiment 187, wherein the method comprises orally administering the exosporium fragments to the ruminant.

[001087] Embodiment 189 is the method of embodiment 187 or 188, wherein orally administering the spores or the exosporium fragments to the ruminant comprises feeding the spores or the exosporium fragments to the ruminant.

[001088] Embodiment 190 is the method of any one of embodiments 187-189, wherein the ruminant comprises a cow, a sheep, a bison, a goat, a deer, or a horse.

[001089] Embodiment 191 is the method of any one of embodiments 187-190, wherein the method treats or prevents bloat in the ruminant.

[001090] Embodiment 192 is feed or a feed additive comprising exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one protein or peptide that protects an animal from a pathogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[001091] Embodiment 193 is the method of any one of embodiments 187-191 or the feed or feed additive of embodiment 192, wherein the protein or peptide that protects the animal from a pathogen comprises a lactoferrin, a lactoferrin peptide, a lysozyme or lysozyme peptide, an antimicrobial protein or peptide, an enzyme, or a combination of any thereof.

[001092] Embodiment 194 is the method, feed, or feed additive of embodiment 193, wherein the enzyme comprises an apyrase, a protease, a glucanase, a lactonase, or a combination of any thereof.

[001093] Embodiment 195 is the method, feed, or feed additive of embodiment 193, wherein the lactoferrin peptide comprises a LfcinB or wherein the lysozyme comprises a LysM.

[001094] Embodiment 196 is the method of any one of embodiments 187-191,193- 195, or the feed or feed additive of any one of embodiments 192-195, wherein the pathogen comprises Streptococcus bovis, Fusobacterium necrophorum, or a combination thereof.

[001095] Embodiment 197 is the method of any one of embodiments 65-119, wherein the method comprises administering the exosporium fragments or spores to an animal for prevention or treatment of mastitis.

[001096] Embodiment 198 is the method of embodiment 197, wherein the method comprises administering the exosporium fragments.

[001097] Embodiment 199 is the method of embodiment 197 or 198, wherein the animal comprises a dairy animal.

[001098] Embodiment 200 is the method of embodiment 197 or 198, wherein the animal comprises a goat, a cow, a sheep, a buffalo, a camel, a yak, a horse, a reindeer, a human, a dog, a cat, or a donkey.

[001099] Embodiment 201 is the method of any one of embodiments 197-200, comprising administering the exosporium fragments or spores in a composition comprising the exosporium fragments or spores and a pharmaceutically acceptable carrier.

[001100] Embodiment 202 is the method of embodiment 201, wherein the composition is applied topically to the udder or teat of the animal.

[001101] Embodiment 203 is the method of embodiment 202, wherein the topical administration comprises dipping the udder or teat of the animal into the composition, spraying the composition onto the udder or teat of the animal, or a combination thereof. [001102] Embodiment 204 is the method of any one of embodiments 197-203, wherein the mastitis comprises fungal mastitis.

[001103] Embodiment 205 is the method of embodiment 204, wherein the fungal mastitis comprises fungal mastitis caused by Cryptococcus neoformans, Candida albicans, a fungal pathogen of the genus Prototheca, or a combination thereof.

[001104] Embodiment 206 is the method of any one of embodiments 197-205, wherein the mastitis comprises bacterial mastitis.

[001105] Embodiment 207 is the method of embodiment 206, wherein the bacterial mastitis comprises bacterial mastitis caused by a bacterial pathogen of the genus

Staphylococcus, a bacterial pathogen of the genus Escherichia, or a combination thereof.

[001106] Embodiment 208 is the method of embodiment 206 or 207, wherein the method further comprises coadministration of an antibiotic.

[001107] Embodiment 209 is the method of embodiment 206 or 207, wherein the method does not further comprise co-administration of an antibiotic.

[001108] Embodiment 210 is the composition of embodiment 33, wherein the topical composition is in the form of a teat dip composition.

[001109] Embodiment 211 is the composition of any one of embodiments 33, 34, and 210, wherein the composition does not comprise an antibiotic.

[001110] Embodiment 212 is the composition of any one of embodiments 33, 34, and 210, wherein the composition further comprises an antibiotic.

[001111] Embodiment 213 is the method of embodiment 208 or the composition of embodiment 212, wherein the antibiotic comprises a β-lactam, a lincosamide, or a combination thereof.

[001112] Embodiment 214 is the method or composition of embodiment 213, wherein the β-lactam comprises amoxicillin, ceftiofur, cephapirin, cloxicillin, hetacillin, penicillin, or a combination of any thereof; or wherein the lincosamide comprises pirlimycin.

[001113] Embodiment 215 is the method of any one of embodiments 197-209, 213, and 214 or the composition of any one of embodiments 31-34 and 210-213, wherein the protein or peptide that protects the animal from a pathogen comprises a glucanase, a lyticase, a chitinase, a apyrase, an antimicrobial peptide or protein, a protease, a lactoferrin or lactoferrin peptide, a lysozyme or lysozyme peptide, a lactonase, or a combination of any thereof. [001114] Embodiment 216 is the method or composition of embodiment 215, wherein the glucanase comprises a P-l,3-glucanase; wherein the lactoferrin peptide comprises a LfcinB; or wherein the lysozyme peptide comprises a LysM.

[001115] Embodiment 217 is the method of any one of embodiments 65-119, wherein the method comprises prevention or treatment of an insect, arachnid, or nematode infection or infestation.

[001116] Embodiment 218 is the method of embodiment 217, wherein the animal comprises a livestock animal, a human, or a companion animal.

[001117] Embodiment 219 is the method of embodiment 218, wherein the animal comprises a cow, a horse, a sheep, a goat, a pig, a bison, a camel, a donkey, a mule, a yak, a reindeer, a llama, a rabbit, a dog, a cat, a ferret, a gerbil, a guinea pig, a hamster, a mouse, a rabbit, a rat, a turkey, a chicken, a goose, or a duck.

[001118] Embodiment 220 is the method of any one of embodiments 217-219, wherein the method prevents or treats a fly or fly larvae infestation.

[001119] Embodiment 221 is the method of embodiment 220, wherein the method prevents or treats a fly or fly larvae infestation in horses or cows.

[001120] Embodiment 222 is the method of any one of embodiments 217-219, wherein the method prevents or treats an arachnid infestation.

[001121] Embodiment 223 is the method of embodiment 222, wherein the method prevents or treats an arachnid infestation in a human.

[001122] Embodiment 224 is the method of any one of embodiments 217-223, wherein the method comprises topically administering the exosporium fragments or the spores to the animal.

[001123] Embodiment 225 is the method of embodiment 224, wherein the method comprises administering the exosporium fragments or spores via a topical spray, a topical lotion, a topical cream, a topical gel, or a combination of any thereof.

[001124] Embodiment 226 is the composition of any one of embodiments 31-34 or the method of any one of embodiments 217-225, wherein the protein or peptide that protects the animal from the pathogen comprises Mtxl, a delta endotoxin, a Cry toxin, chitinase, a secreted insecticidal (Sip) protein, or a combination of any thereof.

[001125] Embodiment 227 is the method of any one of embodiments 217-219, wherein the method comprises preventing or treating a nematode infection. [001126] Embodiment 228 is the method of embodiment 227, wherein the method comprises feeding the exosporium fragments or spores to the nematode.

[001127] Embodiment 229 is the method of embodiment 227 or 228, wherein the protein or peptide that protects the animal from a pathogen comprises a nematicidal protein or peptide.

[001128] Embodiment 230 is a nematicidal composition comprising a carrier and exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one nematicidal protein or peptide and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[001129] Embodiment 231 is the method of embodiment 229 or the composition of embodiment 230, wherein the nematicidal protein or peptide comprises a chitinase, a Cry protein, a delta endotoxin, or a combination of any thereof.

[001130] Embodiment 232 is the method or composition of embodiment 231, wherein the chitinase comprises a chitinase C, chitinase D, or a combination thereof; or wherein the Cry protein comprises a Cry5B protein, a Cry21A protein, or a combination of any thereof.

[001131] Embodiment 233 is the method of any one of embodiments 227-229, 231, and 232 or the composition of any one of embodiments 230-233, wherein the exosporium fragments comprise exosporium fragments derived from a Bacillus cereus family member that naturally expresses a Cry toxin, a nematicidal toxin, a chitinase, a protease inhibitor protein, or a combination of any thereof.

[001132] Embodiment 234 is the method of any one of embodiments 227-229 and 231-233 or the composition of any one of embodiments 230-233, wherein the method further comprises administering exosporium fragments derived from a Bacillus cereus family member that naturally expresses a Cry toxin, a nematicidal toxin, a chitinase, a protease inhibitor protein, or a combination thereof or wherein the composition further comprises exosporium fragments derived from a Bacillus cereus family member that naturally expresses a Cry toxin, a

nematicidal toxin, a chitinase, a protease inhibitor protein, or a combination thereof.

[001133] Embodiment 235 is the method of any one of embodiments 227-229 and 231-234 or the composition of any one of embodiments 230-234, wherein the method further comprises administering a Cry protein or spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising at least one Cry protein and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member; or wherein the composition further comprises a Cry protein or spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising at least one Cry protein and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[001134] Embodiment 236 is a method for protecting an animal from a pathogen by killing an insect or arachnid vector of the pathogen, wherein the method comprises contacting the insect or arachnid vector or larvae of the insect or arachnid vector with:

spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae of the insect or arachnid vector and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae of the insect vector and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

or a combination thereof.

[001135] Embodiment 237 is the method of embodiment 236, wherein the method comprises contacting the insect or arachnid or larvae or instars thereof with the exosporium fragments.

[001136] Embodiment 238 is an insecticidal or acaricidal composition comprising a carrier and exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae or instars of the insect or arachnid vector and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member. [001137] Embodiment 239 is the composition of embodiment 238, wherein the composition is suitable for topical administration.

[001138] Embodiment 240 the composition of embodiment 238 or 239, wherein the composition is in the form of a lotion, gel, cream, or lotion.

[001139] Embodiment 241 is the composition of embodiment 238 or 239, wherein the composition is in the form of a dry powder, a cake, or a water dispersible granule.

[001140] Embodiment 242 is the composition of any one of embodiments 23-28, 238, and 239, for use in an insect fogger.

[001141] Embodiment 243 an insect fogger comprising a composition comprising a carrier and:

spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae or instars of the insect or arachnid vector and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one protein or peptide that has insecticidal or acaricidal activity against an insect or arachnid vector of an animal pathogen or larvae or instars of the insect or arachnid vector and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

or a combination thereof.

[001142] Embodiment 244 is the method of embodiment 236 or 237, the composition of any one of embodiments 238-242, or the insect fogger of embodiment 243, wherein the protein or peptide that has insecticidal or acaricidal activity does not comprise a nucleic acid binding protein or peptide.

[001143] Embodiment 245 is the method of any one of embodiments 236, 237, and 244 the composition of any one of embodiments 238-242 and 244, or the insect fogger of embodiment 243 or 244, wherein the protein or peptide that has insecticidal or acaricidal activity comprises an insecticidal bacterial toxin, an acaricidal bacterial toxin, an endotoxin, a Cry toxin, a protease inhibitor protein or peptide, a secreted insecticidal (Sip) protein, a mosquitocidal toxin, a cysteine protease, a Bacillus subtilis serine protease, a chitinase, or a combination of any thereof.

[001144] Embodiment 246 is the method, composition, or insect fogger of embodiment

245, wherein the insecticidal bacterial toxin comprises a VIP insecticidal protein; wherein the Cry toxin comprises a Cry toxin from Bacillus thuringiensis; wherein the protease inhibitor protein or peptide comprises a trypsin inhibitor or an arrowhead protease inhibitor; wherein the mosquitocidal toxin comprises an Mtx-like mosquitocidal toxin, a Bin-like mosquitocidal toxin, or a combination thereof; or wherein the endotoxin comprises a delta endotoxin.

[001145] Embodiment 247 is the method, composition, or insect fogger of embodiment

246, wherein the Mtx-like mosquitocidal toxin comprises Mtxl .

[001146] Embodiment 248 is the method, composition, or insect fogger of embodiment 245 or 246, wherein the Cry toxin comprises a Cry 1 Aa protein, a Cry 1 Ab protein, a Cry 1 Ac protein, a CrylCa protein, a CrylDa protein, a Cry2Aa protein, a Cry3Aa protein, a Cry3Bb protein, a Cry4Aa protein, a Cry4Ab protein, a Cry 11 Aa protein, or a Cytl Aa protein.

[001147] Embodiment 249 is the method of any one of embodiments 236, 237, and 244-250, the composition of any one of embodiments 238-242, and 244-250, or the insect fogger of any one of embodiments 243-250, wherein the insect or arachnid vector comprises a flea, a fly, a tick, a mite, a mosquito, an assassin bug, or a combination of any thereof; or wherein the larvae or instar of the insect or arachnid vector comprise larvae of a flea, a fly, a tick, a mite, a mosquito, an assassin bug, or a combination of any thereof.

[001148] Embodiment 250 is the method, composition, or insect fogger of embodiment 249, wherein the fly comprises a sandfly or a blackfly or wherein the larvae or instar comprises larvae or instar of a sandfly or a blackfly.

[001149] Embodiment 251 is the method of any one of embodiments 236, 237, and 244-250, the composition of any one of embodiments 238-242, and 244-250, or the insect fogger of any one of embodiments 243-250, wherein the pathogen comprises a yellow fever virus, dengue virus, a bacterial pathogen of the genus Yersinia, a pathogenic worm of the genus Onchocerca, a Zika virus, a bacterial pathogen of the genus Ehlichia, a bacterial pathogen of the genus Anaplasma, a bacterial pathogen of the genus Borrelia, a pathogen of the genus Babesia, a pathogenic protist of the genus Leishmania, a pathogenic protist of the genus Trypanosoma, a pathogenic protist of the genus Schistosoma, a West Nile virus, a pathogenic protist of the genus Plasmodium, a bacterial pathogen of the genus Rickettsia, a Kawaskai virus, a chikungunya virus, a pathogenic worm of the genus Dirofilaria, an Eastern equine encephalitis virus, a Saint Louis encephalitis vims, a LaCrosse encephalits virus, a Western Equine Encephalitis virus, a Pappataci virus, or a combination of any thereof.

[001150] Embodiment 252 is the method of any one of embodiments 236, 237, and 244-251, the composition of any one of embodiments 238-242, and 244-251, or the insect fogger of any one of embodiments 243-351, wherein the exosporium fragments comprise exosporium fragments derived from a Bacillus cereus family member that naturally expresses an insecticidal toxin, an acaricidal toxin, or a combination thereof.

[001151] Embodiment 253 is the method of any one of embodiments 236, 237, and 244-252, the composition of any one of embodiments 238-242, and 244-252, or the insect fogger of any one of embodiments 243-252, wherein the method further comprises

administering exosporium fragments derived from a Bacillus cereus family member that naturally expresses an insecticidal toxin, an acaricidal toxin, or a combination thereof; or wherein the composition or insect fogger further comprises exosporium fragments derived from a Bacillus cereus family member that naturally expresses an insecticidal toxin, an acaricidal toxin, or a combination thereof.

[001152] Embodiment 254 is the method of any one of embodiments 236, 237, and 244-253, the composition of any one of embodiments 238-242, and 244-253, or the insect fogger of any one of embodiments 243-253, wherein the method further comprises

administering an insecticidal toxin, an acaricidal toxin, or a combination thereof or spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising at least one insecticidal toxin or acaricidal toxin and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member; or wherein the composition or insect fogger further comprises an insecticidal toxin, an acaricidal toxin, or a combination thereof or spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising at least one insecticidal toxin or acaricidal toxin and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member.

[001153] Embodiment 255 is the method, composition, or insect fogger of any one of embodiments 251-254, wherein the insecticidal toxin comprises a Cry protein.

[001154] Embodiment 256 is the method of any one of embodiments 236, 237, and 233-255, wherein contacting the insect or arachnid vector or larvae of the insect or arachnid vector with the exosporium fragments or spores comprises spraying a composition comprising the exosporium fragments or spores into the environment of the insects or larvae, applying a composition comprising the exosporium fragments or spores to a body of water or insect breeding grounds, applying the exosporium fragments or spores to a host of the pathogen, or a combination of any thereof.

[001155] Embodiment 257 is the method of embodiment 256, wherein spraying the composition comprising the exosporium fragments or spores into the environment comprises use of a fogger.

[001156] Embodiment 258 is the method of embodiment 256, wherein applying the exosporium fragments or spores to a host of the pathogen comprises spraying the host with a composition comprising the exosporium fragments or spores, immersing the host in a composition comprising the exosporium fragments or spores, or a combination thereof.

[001157] Embodiment 259 is the pharmaceutical composition of any one of embodiments 31-36, wherein the protein or peptide that protects an animal from a pathogen comprises an antigen or an immunogen.

[001158] Embodiment 260 is the pharmaceutical composition of embodiment 259, wherein the antigen or immunogen is derived from a pathogen selected from Renibacterium salmoninarum, Yersinia ruckeri, Edwarsdiella ictaluri, Flavobacterium columnare, Aerococcus viridans, Aeromonas salmonicida, Aeromonas hydrophila, Leucothrix mucor, Vibrio vulnificus, Vibrio parahaemolyticus, Vibrio alginolyticus, a bacterial pathogen of the genus Shewanella spp., Xenohaliotis calif orniensis, Piscirickettsia salmonis, a pathogenic protist of the genus Saprolengia, Branchiomyces sanguinis, Branchiomyces demigrna, and Icthyophous hqferi.

[001159] Embodiment 261 is the pharmaceutical composition of embodiment 259 or 260, wherein the composition is in the form of a powder or liquid concentrate.

[001160] Embodiment 262 is a method for producing an immunogenic response in an aquatic animal comprising administering to the aquatic animal:

exosporium fragments, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising at least one antigen or immunogen and a targeting sequence, exosponum protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

or a combination thereof;

and wherein the exosporium fragments or spores are administered to the aquatic animal by immersing the aquatic animal in a solution comprising the exosporium fragments.

[001161] Embodiment 263 is a method for producing an immunogenic response in an aquatic animal comprising administering exosporium fragments to the aquatic animal, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member; and wherein the aquatic animal is selected from fish, amphibians, crustaceans, mollusks, and combinations of any thereof.

[001162] Embodiment 264 is the method of embodiment 262 or 263, wherein administration of the exosporium fragments or spores to the aquatic animal results in vaccination of the aquatic animal against a pathogen selected from Renibacterium salmoninarum, Yersinia ruckeri, Edwarsdiella ictaluri, Flavobacterium columnare, Aerococcus viridans, Aeromonas salmonicida, Aeromonas hydrophila, Leucothrix mucor, Vibrio vulnificus, Vibrio

parahaemolyticus, Vibrio alginolyticus, a bacterial pathogen of the genus Shewanella spp., Xenohaliotis californiensis, Piscirickettsia salmonis, a pathogenic protist of the genus

Saprolengia, Branchiomyces sanguinis, Branchiomyces demigrna, Icthyophous hqferi, and combinations of any thereof.

[001163] Embodiment 265 is a method for producing an immunogenic response in an aquatic animal comprising administering to the aquatic animal:

exosporium fragments to the aquatic animal, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member and comprise a fusion protein, the fusion protein comprising at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member; spores of a recombinant Bacillus cereus family member that expresses a fusion protein, the fusion protein comprising at least one antigen or immunogen and a targeting sequence, exosporium protein, or exosporium protein fragment that targets the fusion protein to the exosporium of the recombinant Bacillus cereus family member;

or a combination thereof;

and wherein the administration of the exosporium fragments or spores to the aquatic animal results in vaccination of the aquatic animal against a pathogen selected from Renibacterium salmoninarum, Yersinia ruckeri, Edwarsdiella ictaluri,

Flavobacterium columnare, Aerococcus viridans, Aeromonas salmonicida, Aeromonas hydrophila, Leucothrix mucor, Vibrio vulnificus, Vibrio parahaemolyticus, Vibrio alginolyticus, a bacterial pathogen of the genus Shewanella spp., Xenohaliotis californiensis, Piscirickettsia salmonis, a pathogenic protist of the genus Saprolengia, Branchiomyces sanguinis, Branchiomyces demigrna, Icthyophous hoferi, and combinations of any thereof.

[001164] Embodiment 266 is the method of any one of clams 262, 264, and 265, wherein the method comprises administering the exosporium fragments.

[001165] Embodiment 267 is the composition of any one of embodiments 259-261 or the method of any one of embodiments 262-266, wherein the antigen or immunogen comprises a heat shock protein, a coat protein, a capsule protein, an outer membrane protein, a cell wall protein, a flagellar protein, a fimbrial protein, a pilus protein, a ciliar protein, a protein toxin, an i-antigen, or a combination of any thereof.

[001166] Embodiment 268 is the method of any one of embodiments embodiment 263- 267, wherein the exosporium fragments or spores are administered to the aquatic animal by immersing the aquatic animal in a solution comprising the exosporium fragments or spores, by feeding the exosporium fragments or spores to the aquatic animal, by injecting the exosporium or spores fragments into the aquatic animal, or a combination of any thereof.

[001167] Embodiment 269 is the method of embodiment 268, wherein the injection comprises intramuscular injection.

[001168] Embodiment 270 is the method of embodiment 268, wherein the exosporium fragments or spores are administered to the aquatic animal by immersing the aquatic animal in a solution comprising the exosporium fragments, the spores, or a combination thereof.

[001169] Embodiment 271 is the method of any one of embodiments 262-270, wherein the exosporium fragments or spores are administered in a composition comprising a carrier and the exosporium fragments, the spores, or a combination thereof. [001170] Embodiment 272 is the composition of any one of embodiments 259-261 and 267 or the method of embodiment 271, wherein the composition further comprises an adjuvant.

[001171] Embodiment 273 is the composition of any one of embodiments 259-261, 267, and 272 or the method of any one of embodiments 262 and 264-272, wherein the aquatic animal is selected from fish, amphibians, reptiles, crustaceans, mollusks, or combinations of any thereof.

[001172] Embodiment 274 is the method of embodiment 263 or the composition or method of embodiment 273, wherein the aquatic animal is selected from fish, crustaceans, or a combination thereof.

[001173] Embodiment 275 the method of embodiment 263 or the composition or method of embodiment 273, wherein the aquatic animal comprises the fish, the fish being selected from hobby fish, salmon, trout, halibut, seabass, snapper, grouper, mullet, tilapia, tuna, catfish, carp, sturgeon, and combinations of any thereof.

[001174] Embodiment 276 is the method of embodiment 263 or the composition or method of embodiment 273, wherein the aquatic animal comprises the crustaceans, the crustaceans being selected from shrimp, prawns, krill, lobsters, crabs, crayfish, and

combinations of any thereof.

[001175] Embodiment 277 is the method of embodiment 263 or the composition or method of embodiment 273, wherein the aquatic animal comprises the mollusks, the mollusks being selected from mussels, clams, oysters, scallops, snails, slugs, squid, cuttlefish, octopi, and combinations of any thereof.

[001176] Embodiment 278 is the method of any one of embodiments 262-277, wherein the method comprises administering the exosporium fragments or spores to eggs of the aquatic animal.

[001177] Embodiment 279 is the method of any one of embodiments 64-119, 124-159, 161, 163-176, 179, 183-191, 193-209, 213-229, 231-237, 244-258, and 262-278, wherein the method comprises inactivating the spores of the recombinant Bacillus cereus family member prior to administering the vaccine composition to the animal, prior to administering the spores to the animal, prior to administering the spores to the environment of the animal, prior to administering the spores to the pathogen, prior to introducing the spores into the aquaculture system, prior to contacting the insect or arachnid vector or larvae of the insect or arachnid vector with the spores, or prior to administering the spores to the aquatic animal. [001178] Embodiment 280 is the recombinant Bacillus cereus family member of any one of embodiments 19 and 25-28, wherein the recombinant Bacillus cereus family member is in the form of a spore and the spore is inactivated.

[001179] Embodiment 281 is the composition of any one of embodiments 21-30, 32- 36, 52, 54-59, 63, 68-76, 79-118, 175, 176, 183-186, 210-216, 226, 259-261, and 272-277, the adhesive patch or wound dressing of any one of embodiments 162-166, the insert tray of any one of embodiments 177, 178, and 183-186, the hoof bandage of any one of embodiments 180— 185, or the insect fogger of any one of embodiments 234-255, wherein the spores are inactivated.

[001180] Embodiment 282 is the exosporium fragments of any one of embodiments 20, and 25-28, the composition of any one of embodiments 21-36, 68-76, 79-118, 120-123, 125- 128, 131-136, 147-153, 159-161, 163-166, 175, 176, 183-186, 210-216. 226, 230-235, 238- 242, 244-255, 259-261, and 272-277, the method of any one of embodiments 64-119, 124- 159, 161, 164-176, 179, 183-191, 193-209, 213-229, 231-237, 244-258, and 262-279, the adhesive patch or wound dressing of any one of embodiments 162-166 and 281, the insert tray of any one of embodiments 177, 178, 183-186, and 281, the hoof bandage of any one of embodiments 180-185 and 281, the feed or feed additive of any one of embodiments 192-196, or the insect fogger of any one of embodiments 243-255, wherein the exosporium fragments are derived from spores of a recombinant Bacillus cereus family member that expresses the fusion protein, wherein the recombinant Bacillus cereus family member also comprises a mutation or expresses a protein, wherein the expression of the protein is increased as compared to the expression of the protein in a wild-type Bacillus cereus family member under the same conditions, and wherein the mutation or the increased expression of the protein results in Bacillus cereus family member spores having an exosporium that is easier to remove from the spore as compared to the exosporium of a wild-type spore.

[001181] Embodiment 283 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 282, the composition of any one of embodiments 54-63, or the method of embodiment 64, wherein the recombinant Bacillus cereus family member:

(i) comprises a mutation in a CotE gene;

(ii) expresses an ExsY protein, wherein the expression of the ExsY protein is increased as compared to the expression of the ExsY protein in a wild-type Bacillus cereus family member under the same conditions, and wherein the ExsY protein comprises a carboxy-terminal tag comprising a globular protein;

(iii) expresses a BclB protein, wherein the expression of the BclB protein is increased as compared to the expression of the BclB protein in a wild-type Bacillus cereus family member under the same conditions;

(iv) expresses a YjcB protein, wherein the expression of the YjcB protein is increased as compared to the expression of the YjcB protein in a wild-type Bacillus cereus family member under the same conditions;

(v) comprises a mutation in an ExsY gene;

(vi) comprises a mutation in a CotY gene;

(vii) comprises a mutation in an ExsA gene; or

(viii) comprises a mutation in a CotO gene.

[001182] Embodiment 284 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 282 or 283 or the composition of embodiment 46 or 51, wherein the recombinant Bacillus cereus family member comprises a mutation in a CotE gene.

[001183] Embodiment 285 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 284, wherein the mutation in the CotE gene partially or completely inhibits the ability of CotE to attach the exosporium to the spore.

[001184] Embodiment 286 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 284 or 285, wherein the mutation in the CotE gene comprises a knock-out of the CotE gene or a dominant negative form of the CotE gene.

[001185] Embodiment 287 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of any one of embodiments 282-286 or the composition of 49 or 51, wherein the recombinant Bacillus cereus family member expresses an ExsY protein, wherein the expression of the ExsY protein is increased as compared to the expression of the ExsY protein in a wild-type Bacillus cereus family member under the same conditions, and wherein the ExsY protein comprises a carboxy-terminal tag comprising a globular protein.

[001186] Embodiment 288 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 287, wherein the globular protein has a molecular weight of between 25 kDa and 100 kDa.

[001187] Embodiment 289 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 287 or 288, wherein the globular protein comprises a green fluorescent protein (GFP) or a variant thereof.

[001188] Embodiment 290 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of any one of embodiments 287-289, wherein the expression of the ExsY protein comprising the carboxy-terminal tag comprising a globular protein inhibits binding of the ExsY protein to its targets in the exosporium.

[001189] Embodiment 291 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of any one of embodiments 282-290 or the composition of embodiment 49 or 51, wherein the recombinant Bacillus cereus family member expresses a BclB protein, wherein the expression of the BclB protein is increased as compared to the expression of the BclB protein in a wild-type Bacillus cereus family member under the same conditions.

[001190] Embodiment 292 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 291, wherein the expression of the BclB protein results in the formation of a fragile exosporium.

[001191] Embodiment 293 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of any one of embodiments 282-292 or the composition of embodiment 49 or 51, wherein the recombinant Bacillus cereus family member expresses a YjcB protein, wherein the expression of the YjcB protein is increased as compared to the expression of the YjcB protein in a wild-type Bacillus cereus family member under the same conditions.

[001192] Embodiment 294 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 293, wherein the expression of the YjcB protein causes the exosporium to form in pieces rather than in a complete structure.

[001193] Embodiment 295 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of any one of embodiments 282-294 or the composition of embodiment 46 or 51, wherein the recombinant Bacillus cereus family member comprises a mutation an ExsY gene.

[001194] Embodiment 296 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 295, wherein the mutation in the ExsY gene partially or completely inhibits the ability of ExsY to complete the formation of the exosporium or attach the exosporium to the spore.

[001195] Embodiment 297 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 295 or 296, wherein the mutation in the ExsY gene comprises a knock-out of the ExsY gene.

[001196] Embodiment 298 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of any one of embodiments 282-297 or the composition of embodiment V9 or V14, wherein the recombinant Bacillus cereus family member comprises a mutation in a CotY gene.

[001197] Embodiment 299 the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 298, wherein the mutation in the CotY gene comprises a knock-out of the CotY gene.

[001198] Embodiment 300 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 298 or 299, wherein the mutation in the CotY gene results in the formation of a fragile exosporium.

[001199] Embodiment 301 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of any one of embodiments 282-300 or the composition of embodiment 46 or 51, wherein the recombinant Bacillus cereus family member comprises a mutation in an ExsA gene.

[001200] Embodiment 302 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 301, wherein the mutation in the ExsA gene comprises a knock-out of the ExsA gene.

[001201] Embodiment 303 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 301 or 302, wherein the mutation in the ExsA gene results in the formation of a fragile exosporium.

[001202] Embodiment 304 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of any one of embodiments 282-303 or the composition of embodiment 46 or 51, wherein the recombinant Bacillus cereus family member comprises a mutation in a CotO gene.

[001203] Embodiment 305 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 304, wherein the mutation in the CotO gene comprises a knock-out of the CotO gene or a dominant negative form of the CotO gene.

[001204] Embodiment 306 is the exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 304 or 305, wherein the mutation in the CotO gene causes the exosporium to form in strips.

[001205] Embodiment 307 is the fusion protein of any one of embodiments 1-18 and 25-28, the recombinant Bacillus cereus family member of any one of embodiments 19, 25-28, and 280, the exosporium fragments of any one of embodiments 20, 25-28, and 282-306, the composition of any one of embodiments 21-52, 55-63, 68-76, 79-118, 120-123, 125-128, 131-136, 147-153, 159-161, 163-166, 175, 176, 183-186, 210-216, 226, 230-235, 238-242, 244-255, 259-261, 267, 272, 278, and 281-306, the method of any one of embodiments 64- 119, 124-159, 161, 163-176, 179, 183-191, 193-209, 213-229, 231-237, 244-258, 262-279, and 282-306, the adhesive patch or wound dressing of any one of embodiments 162-166, and 281-306, the insert tray of any one of embodiments 177, 178, 183-186, and 281-306, the hoof bandage of any one of embodiments 180-186 and 281-306, the feed or feed additive of any one of embodiments 192-196 and 282-306, or the insect fogger of any one of embodiments 243- 255 and 281-306, wherein the targeting sequence, exosporium protein, or exosporium protein fragment comprises:

(1) a targeting sequence comprising an amino acid sequence having at least about 43%

identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%;

(2) a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 1;

(3) a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 1;

(4) a targeting sequence comprising SEQ ID NO: 1; (5) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 2;

(6) a targeting sequence comprising amino acids 2-35 of SEQ ID NO: 1;

(7) a targeting sequence comprising amino acids 5-35 of SEQ ID NO: 1;

(8) a targeting sequence comprising amino acids 8-35 of SEQ ID NO: 1;

(9) a targeting sequence comprising amino acids 10-35 of SEQ ID NO: 1;

(10) a targeting sequence comprising amino acids 15-35 of SEQ ID NO: 1;

(11) a targeting sequence comprising amino acids 1-27 of SEQ ID NO: 3;

(12) a targeting sequence comprising amino acids 12-27 of SEQ ID NO: 3;

(13) a targeting sequence comprising SEQ ID NO: 3;

(14) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 4;

(15) a targeting sequence comprising amino acids 2-27 of SEQ ID NO: 3;

(16) a targeting sequence comprising amino acids 5-27 of SEQ ID NO: 3;

(17) a targeting sequence comprising amino acids 8-27 of SEQ ID NO: 3;

(18) a targeting sequence comprising amino acids 10-27 of SEQ ID NO: 3;

(19) a targeting sequence comprising amino acids 1-38 of SEQ ID NO: 5;

(20) a targeting sequence comprising amino acids 23-38 of SEQ ID NO: 5;

(21) a targeting sequence comprising SEQ ID NO: 5;

(22) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 6;

(23) a targeting sequence comprising amino acids 2-38 of SEQ ID NO: 5;

(24) a targeting sequence comprising amino acids 5-38 of SEQ ID NO: 5;

(25) a targeting sequence comprising amino acids 8-38 of SEQ ID NO: 5;

(26) a targeting sequence comprising amino acids 10-38 of SEQ ID NO: 5;

(27) a targeting sequence comprising amino acids 15-38 of SEQ ID NO: 5;

(28) a targeting sequence comprising amino acids 20-38 of SEQ ID NO: 5;

(29) a targeting sequence comprising amino acids 1-28 of SEQ ID NO: 7;

(30) a targeting sequence comprising amino acids 13-28 of SEQ ID NO: 7;

(31) a targeting sequence comprising SEQ ID NO: 7;

(32) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 8;

(33) a targeting sequence comprising amino acids 2-28 of SEQ ID NO: 7; (34) a targeting sequence comprising amino acids 5-28 of SEQ ID NO: 7;

(35) a targeting sequence comprising amino acids 8-28 of SEQ ID NO: 7;

(36) a targeting sequence comprising amino acids 10-28 of SEQ ID NO: 7;

(37) a targeting sequence comprising amino acids 1-24 of SEQ ID NO: 9;

(38) a targeting sequence comprising amino acids 9-24 of SEQ ID NO: 9;

(39) a targeting sequence comprising SEQ ID NO: 9;

(40) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 10;

(41) a targeting sequence comprising amino acids 2-24 of SEQ ID NO: 9;

(42) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 9;

(43) a targeting sequence comprising amino acids 8-24 of SEQ ID NO: 9;

(44) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: l 1;

(45) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 11;

(46) a targeting sequence comprising SEQ ID NO: 11;

(47) an exosporium protein comprising an amino acid sequence having at least 85%> identity with SEQ ID NO: 12;

(48) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 11;

(49) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 11;

(50) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 11;

(51) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 11;

(52) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 11;

(53) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 13;

(54) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 13;

(55) a targeting sequence comprising SEQ ID NO: 13;

(56) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 14;

(57) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 13;

(58) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 13;

(59) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 13;

(60) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 13;

(61) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 13;

(62) a targeting sequence comprising amino acids 1-43 of SEQ ID NO: 15;

(63) a targeting sequence comprising amino acids 28-43 of SEQ ID NO: 15; (64) a targeting sequence comprising SEQ ID NO: 15;

(65) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 16;

(66) a targeting sequence comprising amino acids 2-43 of SEQ ID NO: 15;

(67) a targeting sequence comprising amino acids 5-43 of SEQ ID NO: 15;

(68) a targeting sequence comprising amino acids 8-43 of SEQ ID NO: 15;

(69) a targeting sequence comprising amino acids 10-43 of SEQ ID NO: 15;

(70) a targeting sequence comprising amino acids 15-43 of SEQ ID NO: 15;

(71) a targeting sequence comprising amino acids 20-43 of SEQ ID NO: 15;

(72) a targeting sequence comprising amino acids 25-43 of SEQ ID NO: 15;

(73) a targeting sequence comprising amino acids 1-27 of SEQ ID NO: 17;

(74) a targeting sequence comprising amino acids 12-27 of SEQ ID NO: 17;

(75) a targeting sequence comprising SEQ ID NO: 17;

(76) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 18;

(77) a targeting sequence comprising amino acids 2-27 of SEQ ID NO: 17;

(78) a targeting sequence comprising amino acids 5-27 of SEQ ID NO: 17;

(79) a targeting sequence comprising amino acids 8-27 of SEQ ID NO: 17;

(80) a targeting sequence comprising amino acids 10-27 of SEQ ID NO: 17;

(81) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 19;

(82) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 19;

(83) a targeting sequence comprising SEQ ID NO: 19;

(84) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO:20;

(85) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 19;

(86) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 19;

(87) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 19;

(88) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 19;

(89) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 19;

(90) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 21;

(91) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 21;

(92) a targeting sequence comprising SEQ ID NO:21; (93) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO:22;

94) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 21;

95) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 21;

96) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 21;

97) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 21;

98) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 21;

99) a targeting sequence comprising amino acids 1-24 of SEQ ID NO: 23;

100) a targeting sequence comprising amino acids 9-24 of SEQ ID NO: 23;

101) a targeting sequence comprising SEQ ID NO: 23;

102) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO:24;

103) a targeting sequence comprising amino acids 2-24 of SEQ ID NO:23;

104) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 23;

105) a targeting sequence comprising amino acids 8-24 of SEQ ID NO: 23;

106) a targeting sequence comprising amino acids 1-24 of SEQ ID NO: 25;

107) a targeting sequence comprising amino acids 9-24 of SEQ ID NO: 25;

108) a targeting sequence comprising SEQ ID NO:25;

109) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO:26;

110) a targeting sequence comprising amino acids 2-24 of SEQ ID NO: 25;

111) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 25;

112) a targeting sequence comprising amino acids 8-24 of SEQ ID NO: 25;

113) a targeting sequence comprising amino acids 1-30 of SEQ ID NO: 27;

114) a targeting sequence comprising amino acids 15-30 of SEQ ID NO: 27;

115) a targeting sequence comprising SEQ ID NO:27;

116) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO:28;

117) a targeting sequence comprising amino acids 2-30 of SEQ ID NO: 27;

118) a targeting sequence comprising amino acids 5-30 of SEQ ID NO: 27;

119) a targeting sequence comprising amino acids 8-30 of SEQ ID NO: 27;

120) a targeting sequence comprising amino acids 10-30 of SEQ ID NO: 27;

121) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 29; (122) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 29;

(123) a targeting sequence comprising SEQ ID NO:29;

(124) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 30;

(125) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 29;

(126) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 29;

(127) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 29;

(128) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 29;

(129) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 29;

(130) a targeting sequence comprising amino acids 1-24 of SEQ ID NO: 31;

(131) a targeting sequence comprising amino acids 9-24 of SEQ ID NO: 31;

(132) a targeting sequence comprising SEQ ID NO: 31;

(133) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO:32;

(134) a targeting sequence comprising amino acids 2-24 of SEQ ID NO: 31;

(135) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 31;

(136) a targeting sequence comprising amino acids 8-24 of SEQ ID NO: 31 ;

(137) a targeting sequence comprising amino acids 1-15 of SEQ ID NO: 33;

(138) a targeting sequence comprising SEQ ID NO:33;

(139) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO:34;

(140) a targeting sequence comprising amino acids 1-16 of SEQ ID NO: 35;

(141) a targeting sequence comprising SEQ ID NO:35;

(142) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO:36;

(143) a targeting sequence comprising amino acids 1-29 of SEQ ID NO:43;

(144) a targeting sequence comprising amino acids 14-29 of SEQ ID NO: 43;

(145) a targeting sequence comprising SEQ ID NO: 43;

(146) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 44;

'147) a targeting sequence comprising amino acids 2-29 of SEQ ID NO: 43;

(148) a targeting sequence comprising amino acids 5-29 of SEQ ID NO: 43;

(149) a targeting sequence comprising amino acids 8-29 of SEQ ID NO: 43; (150) a targeting sequence comprising amino acids 10-29 of SEQ ID NO: 43;

(151) a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 45;

(152) a targeting sequence comprising amino acids 20-35 of SEQ ID NO: 45;

(153) a targeting sequence comprising SEQ ID NO: 45;

(154) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 46;

(155) a targeting sequence comprising amino acids 2-35 of SEQ ID NO: 45;

(156) a targeting sequence comprising amino acids 5-35 of SEQ ID NO: 45;

(157) a targeting sequence comprising amino acids 8-35 of SEQ ID NO: 45;

(158) a targeting sequence comprising amino acids 10-35 of SEQ ID NO: 45;

(159) a targeting sequence comprising amino acids 15-35 of SEQ ID NO: 45;

(160) a targeting sequence comprising amino acids 1-43 of SEQ ID NO: 47;

(161) a targeting sequence comprising amino acids 28-43 of SEQ ID NO: 47;

(162) a targeting sequence comprising SEQ ID NO: 47;

(163) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 48;

(164) a targeting sequence comprising amino acids 2-43 of SEQ ID NO: 47;

(165) a targeting sequence comprising amino acids 5-43 of SEQ ID NO: 47;

(166) a targeting sequence comprising amino acids 8-43 of SEQ ID NO: 47;

(167) a targeting sequence comprising amino acids 10-43 of SEQ ID NO: 47;

(168) a targeting sequence comprising amino acids 15-43 of SEQ ID NO: 47;

(169) a targeting sequence comprising amino acids 20-43 of SEQ ID NO: 47;

(170) a targeting sequence comprising amino acids 25-43 of SEQ ID NO: 47;

(171) a targeting sequence comprising amino acids 1-32 of SEQ ID NO: 49;

(172) a targeting sequence comprising amino acids 17-32 of SEQ ID NO: 49;

(173) a targeting sequence comprising SEQ ID NO: 49;

(174) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 50;

(175) a targeting sequence comprising amino acids 2-32 of SEQ ID NO: 49;

(176) a targeting sequence comprising amino acids 5-32 of SEQ ID NO: 49;

(177) a targeting sequence comprising amino acids 8-32 of SEQ ID NO: 49;

(178) a targeting sequence comprising amino acids 10-32 of SEQ ID NO: 49;

(179) a targeting sequence comprising amino acids 15-32 of SEQ ID NO: 49; (180) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 51;

(181) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 51 ;

(182) a targeting sequence comprising SEQ ID NO: 51;

(183) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 52;

(184) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 51 ;

(185) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 51;

(186) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 51;

(187) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 51 ;

(188) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 51 ;

(189) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 53;

(190) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 53;

(191) a targeting sequence comprising SEQ ID NO: 53;

(192) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 54;

(193) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 53;

(194) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 53;

(195) a targeting sequence comprising amino acids 8-33 of SEQ ID NO: 53;

(196) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 53;

(197) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 53;

(198) a targeting sequence comprising amino acids 1-30 of SEQ ID NO: 55;

(199) a targeting sequence comprising amino acids 15-30 of SEQ ID NO: 55;

(200) a targeting sequence comprising SEQ ID NO: 55;

(201) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 56;

(202) a targeting sequence comprising amino acids 2-30 of SEQ ID NO: 55;

(203) a targeting sequence comprising amino acids 5-30 of SEQ ID NO: 55;

(204) a targeting sequence comprising amino acids 8-30 of SEQ ID NO: 55;

(205) a targeting sequence comprising amino acids 10-30 of SEQ ID NO: 55;

(206) a targeting sequence comprising amino acids 1-130 of SEQ ID NO: 57;

(207) a targeting sequence comprising amino acids 115-130 of SEQ ID NO: 57;

(208) a targeting sequence comprising SEQ ID NO: 57; (209) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 58;

(210) a targeting sequence comprising amino acids 2-130 of SEQ ID NO: 57;

(21 1) a targeting sequence comprising amino acids 5-130 of SEQ ID NO: 57;

(212) a targeting sequence comprising amino acids 10-130 of SEQ ID NO: 57;

(213) a targeting sequence comprising amino acids 20-130 of SEQ ID NO: 57;

(214) a targeting sequence comprising amino acids 30-130 of SEQ ID NO: 57;

(215) a targeting sequence comprising amino acids 40-130 of SEQ ID NO: 57;

(216) a targeting sequence comprising amino acids 50-130 of SEQ ID NO: 57;

(217) a targeting sequence comprising amino acids 60-130 of SEQ ID NO: 57;

(218) a targeting sequence comprising amino acids 70-130 of SEQ ID NO: 57;

(219) a targeting sequence comprising amino acids 80-130 of SEQ ID NO: 57;

(220) a targeting sequence comprising amino acids 90-130 of SEQ ID NO: 57;

(221) a targeting sequence comprising amino acids 100-130 of SEQ ID NO: 57;

(222) a targeting sequence comprising amino acids 110-130 of SEQ ID NO: 57;

(223) an exosporium protein fragment comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 95;

(224) a targeting sequence comprising SEQ ID NO: 96;

(225) a targeting sequence comprising SEQ ID NO: 97;

(226) a targeting sequence comprising SEQ ID NO: 98;

(227) a targeting sequence comprising SEQ ID NO: 99;

(228) a targeting sequence comprising SEQ ID NO: 100;

(229) a targeting sequence comprising SEQ ID NO: 101 ;

(230) a targeting sequence comprising SEQ ID NO: 102;

(231) a targeting sequence comprising SEQ ID NO: 103;

(232) a targeting sequence comprising SEQ ID NO: 104;

(233) a targeting sequence comprising SEQ ID NO: 105;

(234) a targeting sequence comprising SEQ ID NO: 106;

(235) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 108;

(236) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 109; (237) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 110;

(238) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 111;

(239) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 112;

(240) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 113;

(241) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 114;

(242) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 115;

(243) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 116;

(244) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 117;

(245) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 118;

(246) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 119;

(247) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 120;

(248) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 121;

(249) a targeting sequence comprising amino acids 22-31 of SEQ ID NO: 1;

(250) a targeting sequence comprising amino acids 22-33 of SEQ ID NO: 1;

(251) a targeting sequence comprising amino acids 20-31 of SEQ ID NO: 1 ;

(252) a targeting sequence comprising amino acids 14-23 of SEQ ID NO: 3;

(253) a targeting sequence comprising amino acids 14-25 of SEQ ID NO: 3;

(254) a targeting sequence comprising amino acids 12-23 of SEQ ID NO: 3;

(255) a targeting sequence comprising amino acids 1-30 of SEQ ID NO: 59;

(256) a targeting sequence comprising SEQ ID NO: 59; (257) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 60;

(258) a targeting sequence comprising amino acids 2-30 of SEQ ID NO: 59;

(259) a targeting sequence comprising amino acids 4-30 of SEQ ID NO: 59;

(260) a targeting sequence comprising amino acids 6-30 of SEQ ID NO: 59;

(261) a targeting sequence comprising amino acids 1-33 of SEQ ID NO: 61;

(262) a targeting sequence comprising amino acids 18-33 of SEQ ID NO: 61;

(263) a targeting sequence comprising SEQ ID NO: 61 ;

(264) an exosponum protein comprising an amino acid sequence having at least 85% sequence identity with SEQ ID NO: 62;

(265) a targeting sequence comprising amino acids 2-33 of SEQ ID NO: 61;

(266) a targeting sequence comprising amino acids 5-33 of SEQ ID NO: 61 ;

(267) a targeting sequence comprising amino acids 10-33 of SEQ ID NO: 61;

(268) a targeting sequence comprising amino acids 15-33 of SEQ ID NO: 61;

(269) a targeting sequence comprising amino acids 1-35 of SEQ ID NO: 63;

(270) a targeting sequence comprising SEQ ID NO: 63;

(271) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 64;

(272) a targeting sequence comprising amino acids 2-35 of SEQ ID NO: 63;

(273) a targeting sequence comprising amino acids 5-35 of SEQ ID NO: 63;

(274) a targeting sequence comprising amino acids 8-35 of SEQ ID NO: 63;

(275) a targeting sequence comprising amino acids 10-35 of SEQ ID NO: 63;

(276) a targeting sequence comprising amino acids 15-35 of SEQ ID NO: 63;

(277) a targeting sequence comprising amino acids 1-24 of SEQ ID NO: 65;

(278) a targeting sequence comprising amino acids 9-24 of SEQ ID NO: 65;

(279) a targeting sequence comprising SEQ ID NO: 65;

(280) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 66;

(281) a targeting sequence comprising SEQ ID NO: 107;

(282) a targeting sequence comprising amino acids 2-24 of SEQ ID NO: 65;

(283) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 65;

(284) a targeting sequence comprising amino acids 1-27 of SEQ ID NO: 67;

(285) a targeting sequence comprising amino acids 12-27 of SEQ ID NO: 67; (286) a targeting sequence comprising SEQ ID NO: 67;

(287) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 68;

(288) an targeting sequence comprising amino acids 2-27 of SEQ ID NO: 67;

(289) a targeting sequence comprising amino acids 5-27 of SEQ ID NO: 67;

(290) a targeting sequence comprising amino acids 10-27 of SEQ ID NO: 67;

(291) a targeting sequence comprising amino acids 1-38 of SEQ ID NO: 69;

(292) a targeting sequence comprising amino acids 23-38 of SEQ ID NO: 69;

(293) a targeting sequence comprising SEQ ID NO: 69;

(294) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 70;

(295) a targeting sequence comprising amino acids 2-38 of SEQ ID NO: 69;

(296) a targeting sequence comprising amino acids 5-38 of SEQ ID NO: 69;

(297) a targeting sequence comprising amino acids 10-38 of SEQ ID NO: 69;

(298) a targeting sequence comprising amino acids 15-38 of SEQ ID NO: 69;

(299) an exosporium protein comprising SEQ ID NO: 72;

(300) a targeting sequence comprising SEQ ID NO: 73;

(301) an exosporium protein comprising an amino acid sequence having at least 95% identity with SEQ ID NO: 74;

(302) a targeting sequence comprising amino acids 1-42 of SEQ ID NO: 75;

(303) a targeting sequence comprising amino acids 27-42 of SEQ ID NO: 75;

(304) a targeting sequence comprising SEQ ID NO: 75;

(305) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 76;

(306) a targeting sequence comprising amino acids 2-42 of SEQ ID NO: 75;

(307) a targeting sequence comprising amino acids 5-42 of SEQ ID NO: 75;

(308) a targeting sequence comprising amino acids 10-42 of SEQ ID NO: 75;

(309) a targeting sequence comprising amino acids 15-42 of SEQ ID NO: 75;

(310) a targeting sequence comprising amino acids 20-42 of SEQ ID NO: 75;

(311) a targeting sequence comprising amino acids 25-42 of SEQ ID NO: 75;

(312) a targeting sequence comprising amino acids 1-24 of SEQ ID NO: 77;

(313) a targeting sequence comprising amino acids 9-24 of SEQ ID NO: 77;

(314) a targeting sequence comprising SEQ ID NO: 77; (315) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 78;

(316) a targeting sequence comprising amino acids 2-24 of SEQ ID NO: 77;

(317) a targeting sequence comprising amino acids 5-24 of SEQ ID NO: 77;

(318) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 80;

(319) a targeting sequence comprising amino acids 1-38 of SEQ ID NO: 81;

(320) a targeting sequence comprising amino acids 23-38 of SEQ ID NO: 81;

(321) a targeting sequence comprising SEQ ID NO: 81;

(322) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 82;

(323) a targeting sequence comprising amino acids 2-38 of SEQ ID NO: 81;

(324) a targeting sequence comprising amino acids 5-38 of SEQ ID NO: 81;

(325) a targeting sequence comprising amino acids 10-38 of SEQ ID NO: 81 ;

(326) a targeting sequence comprising amino acids 15-38 of SEQ ID NO: 81;

(327) a targeting sequence comprising amino acids 20-38 of SEQ ID NO: 81;

(328) a targeting sequence comprising amino acids 1-34 of SEQ ID NO: 83;

(329) a targeting sequence comprising SEQ ID NO: 83;

(330) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 84;

(331) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 86;

(332) a targeting sequence comprising amino acids 1-28 of SEQ ID NO: 87;

(333) a targeting sequence comprising amino acids 13-28 of SEQ ID NO: 87;

(334) a targeting sequence comprising SEQ ID NO: 87;

(335) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 88;

(336) a targeting sequence comprising amino acids 2-28 of SEQ ID NO: 87;

(337) a targeting sequence comprising amino acids 5-28 of SEQ ID NO: 87;

(338) a targeting sequence comprising amino acids 10-28 of SEQ ID NO: 87;

(339) a targeting sequence comprising amino acids 1-28 of SEQ ID NO: 89;

(340) a targeting sequence comprising SEQ ID NO: 89; (341) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 90;

(342) a targeting sequence comprising amino acids 2-28 of SEQ ID NO: 89;

(343) a targeting sequence comprising amino acids 5-28 of SEQ ID NO: 89;

(344) a targeting sequence comprising amino acids 10-28 of SEQ ID NO: 89;

(345) a targeting sequence comprising amino acids 1-93 of SEQ ID NO: 91 ;

(346) a targeting sequence comprising SEQ ID NO: 91;

(347) an exosponum protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 92;

(348) a targeting sequence comprising amino acids 2-93 of SEQ ID NO: 91 ;

(349) a targeting sequence comprising amino acids 10-93 of SEQ ID NO: 91;

(350) a targeting sequence comprising amino acids 20-93 of SEQ ID NO: 91;

(351) a targeting sequence comprising amino acids 30-93 of SEQ ID NO: 91;

(352) a targeting sequence comprising amino acids 40-93 of SEQ ID NO: 91 ;

(353) a targeting sequence comprising amino acids 50-93 of SEQ ID NO: 91;

(354) a targeting sequence comprising amino acids 60-93 of SEQ ID NO: 91;

(355) a targeting sequence comprising amino acids 1-130 of SEQ ID NO: 93;

(356) a targeting sequence comprising SEQ ID NO: 93;

(357) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 94;

(358) a targeting sequence comprising amino acids 2-130 of SEQ ID NO: 93;

(359) a targeting sequence comprising amino acids 10-130 of SEQ ID NO: 93;

(360) a targeting sequence comprising amino acids 20-130 of SEQ ID NO: 93;

(361) a targeting sequence comprising amino acids 30-130 of SEQ ID NO: 93;

(362) an exosporium protein comprising an amino acid sequence having at least 85% identity with SEQ ID NO: 122;

(363) a targeting sequence consisting of amino acids 20-33 of SEQ ID NO: 1 ;

(364) a targeting sequence consisting of amino acids 21-33 of SEQ ID NO: 1;

(365) a targeting sequence consisting of amino acids 23-31 of SEQ ID NO: 1;

(366) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 96;

(367) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 96;

(368) a targeting sequence consisting of amino acids 12-25 of SEQ ID NO: 3;

(369) a targeting sequence consisting of amino acids 13-25 of SEQ ID NO: 3; (370) a targeting sequence consisting of amino acids 15-23 of SEQ ID NO: 3;

(371) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 97;

(372) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 98;

(373) a targeting sequence consisting of amino acids 23-36 of SEQ ID NO: 5;

(374) a targeting sequence consisting of amino acids 23-34 of SEQ ID NO: 5;

(375) a targeting sequence consisting of amino acids 24-36 of SEQ ID NO: 5;

(376) a targeting sequence consisting of amino acids 26-34 of SEQ ID NO: 5;

(377) a targeting sequence consisting of amino acids 13-26 of SEQ ID NO: 7;

(378) a targeting sequence consisting of amino acids 13-24 of SEQ ID NO: 7;

(379) a targeting sequence consisting of amino acids 14-26 of SEQ ID NO: 7;

(380) a targeting sequence consisting of amino acids 16-24 of SEQ ID NO: 7;

(381) a targeting sequence consisting of amino acids 9-22 of SEQ ID NO: 9;

(382) a targeting sequence consisting of amino acids 9-20 of SEQ ID NO: 9;

(383) a targeting sequence consisting of amino acids 10-22 of SEQ ID NO: 9;

(384) a targeting sequence consisting of amino acids 12-20 of SEQ ID NO: 9;

(385) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 105;

(386) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 105;

(387) a targeting sequence consisting of amino acids 18-31 of SEQ ID NO: 11;

(388) a targeting sequence consisting of amino acids 18-29 of SEQ ID NO: 11;

(389) a targeting sequence consisting of amino acids 19-31 of SEQ ID NO: 11;

(390) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 98;

(391) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 98;

(392) a targeting sequence consisting of amino acids 18-31 of SEQ ID NO: 13;

(393) a targeting sequence consisting of amino acids 18-29 of SEQ ID NO: 13;

(394) a targeting sequence consisting of amino acids 19-31 of SEQ ID NO: 13;

(395) a targeting sequence consisting of amino acids 21-29 of SEQ ID NO: 13;

(396) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 99;

(397) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 99;

(398) a targeting sequence consisting of amino acids 28-41 of SEQ ID NO: 15;

(399) a targeting sequence consisting of amino acids 28-39 of SEQ ID NO: 15;

(400) a targeting sequence consisting of amino acids 29-41 of SEQ ID NO: 15;

(401) a targeting sequence consisting of amino acids 31-39 of SEQ ID NO: 15;

(402) a targeting sequence consisting of amino acids 12-25 of SEQ ID NO: 17; (403) a targeting sequence consisting of amino acids 13-25 of SEQ ID NO: 17;

(404) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 100;

(405) a targeting sequence consisting of amino acids 18-31 of SEQ ID NO: 19;

(406) a targeting sequence consisting of amino acids 18-29 of SEQ ID NO: 19;

(407) a targeting sequence consisting of amino acids 19-31 of SEQ ID NO: 19;

(408) a targeting sequence consisting of amino acids 21-29 of SEQ ID NO: 19;

(409) a targeting sequence consisting of amino acids 18-31 of SEQ ID NO: 21 ;

(410) a targeting sequence consisting of amino acids 18-29 of SEQ ID NO: 21 ;

(41 1) a targeting sequence consisting of amino acids 19-31 of SEQ ID NO: 21;

(412) a targeting sequence consisting of amino acids 21-29 of SEQ ID NO: 21;

(413) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 101 ;

(414) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 101 ;

(415) a targeting sequence consisting of amino acids 9-22 of SEQ ID NO: 23;

(416) a targeting sequence consisting of amino acids 9-20 of SEQ ID NO: 23;

(417) a targeting sequence consisting of amino acids 10-22 of SEQ ID NO: 23;

(418) a targeting sequence consisting of amino acids 12-20 of SEQ ID NO: 23;

(419) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 102;

(420) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 102;

(421) a targeting sequence consisting of amino acids 9-22 of SEQ ID NO: 25;

(422) a targeting sequence consisting of amino acids 9-20 of SEQ ID NO: 25;

(423) a targeting sequence consisting of amino acids 10-22 of SEQ ID NO: 25;

(424) a targeting sequence consisting of amino acids 12-20 of SEQ ID NO: 25;

(425) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 103;

(426) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 103;

(427) a targeting sequence consisting of amino acids 15-28 of SEQ ID NO: 27;

(428) a targeting sequence consisting of amino acids 15-26 of SEQ ID NO: 27;

(429) a targeting sequence consisting of amino acids 16-28 of SEQ ID NO: 27;

(430) a targeting sequence consisting of amino acids 18-26 of SEQ ID NO: 27;

(431) a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 104;

(432) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 104;

(433) a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 33;

(434) a targeting sequence consisting of amino acids 1-11 of SEQ ID NO: 33;

(435) a targeting sequence consisting of amino acids 3-11 of SEQ ID NO: 33; a targeting sequence consisting of amino acids 1-14 of SEQ ID NO: 35; a targeting sequence consisting of amino acids 1-12 of SEQ ID NO: 35; a targeting sequence consisting of amino acids 2-14 of SEQ ID NO: 35; a targeting sequence consisting of amino acids 14-27 of SEQ ID NO: 43; a targeting sequence consisting of amino acids 14-25 of SEQ ID NO: 43; a targeting sequence consisting of amino acids 15-27 of SEQ ID NO: 43; a targeting sequence consisting of amino acids 20-33 of SEQ ID NO: 45; a targeting sequence consisting of amino acids 20-31 of SEQ ID NO: 45; a targeting sequence consisting of amino acids 21-33 of SEQ ID NO: 45; a targeting sequence consisting of amino acids 1-15 of SEQ ID NO: 106; a targeting sequence consisting of amino acids 1-13 of SEQ ID NO: 106; a targeting sequence consisting of amino acids 28-41 of SEQ ID NO: 47; a targeting sequence consisting of amino acids 28-39 of SEQ ID NO: 47; a targeting sequence consisting of amino acids 18-31 of SEQ ID NO: 53; a targeting sequence consisting of amino acids 18-29 of SEQ ID NO: 53; a targeting sequence consisting of amino acids 19-31 of SEQ ID NO: 53; a targeting sequence comprising amino acids 18-31 of SEQ ID NO: 61; a targeting sequence comprising amino acids 18-29 of SEQ ID NO: 61 ; a targeting sequence comprising amino acids 19-31 of SEQ ID NO: 61 ; a targeting sequence comprising amino acids 9-22 of SEQ ID NO: 65; a targeting sequence comprising amino acids 9-20 of SEQ ID NO: 65; a targeting sequence comprising amino acids 10-22 of SEQ ID NO: 65; a targeting sequence comprising amino acids 1-15 of SEQ ID NO: 107; a targeting sequence comprising amino acids 1-13 of SEQ ID NO: 107; a targeting sequence comprising amino acids 12-25 of SEQ ID NO: 67; a targeting sequence comprising amino acids 12-23 of SEQ ID NO: 67; a targeting sequence comprising amino acids 13-25 of SEQ ID NO: 67; a targeting sequence comprising amino acids 15-23 of SEQ ID NO: 67; a targeting sequence comprising amino acids 23-36 of SEQ ID NO: 69; a targeting sequence comprising amino acids 23-34 of SEQ ID NO: 69; a targeting sequence comprising amino acids 24-36 of SEQ ID NO: 69; a targeting sequence comprising amino acids 26-34 of SEQ ID NO: 69; a targeting sequence comprising amino acids 27-40 of SEQ ID NO: 75; (469) a targeting sequence comprising amino acids 27-38 of SEQ ID NO: 75;

(470) a targeting sequence comprising amino acids 9-22 of SEQ ID NO: 77;

(471) a targeting sequence comprising amino acids 9-20 of SEQ ID NO: 77;

(472) a targeting sequence comprising amino acids 10-22 of SEQ ID NO: 77;

(473) a targeting sequence comprising amino acids 12-20 of SEQ ID NO: 77;

(474) a targeting sequence comprising amino acids 23-36 of SEQ ID NO: 81 ;

(475) a targeting sequence comprising amino acids 23-34 of SEQ ID NO: 81;

(476) a targeting sequence comprising amino acids 24-36 of SEQ ID NO: 81;

(477) a targeting sequence comprising amino acids 26-34 of SEQ ID NO: 81;

(478) a targeting sequence comprising amino acids 13-26 of SEQ ID NO: 87;

(479) a targeting sequence comprising amino acids 13-24 of SEQ ID NO: 87; or

(480) a targeting sequence comprising amino acids 14-26 of SEQ ID NO: 87.

[001206] Embodiment 308 is the fusion protein, recombinant Bacillus cereus family member, exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 307, wherein the targeting sequence comprises:

an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%; an amino acid sequence having at least about 50% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%; an amino acid sequence having at least about 56% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 63%; an amino sequence having at least about 62% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%;

an amino acid sequence having at least about 68% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%; an amino sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 72%;

an amino sequence having at least about 75% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%;

an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 81%; or an amino acid sequence having at least about 81% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 90%.

[001207] Embodiment 309 is the fusion protein, recombinant Bacillus cereus family member, exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 307, wherein the targeting sequence consists of:

(a) an amino acid sequence consisting of 16 amino acids and having at least about 43% identity with amino acids 20-35 of SEQ ID NO: 1, wherein the identity with amino acids 25-35 is at least about 54%;

(b) amino acids 1-35 of SEQ ID NO: 1;

(c) amino acids 20-35 of SEQ ID NO: 1;

(d) SEQ ID NO: 1;

(e) SEQ ID NO: 96; or

(f) SEQ ID NO: 120.

[001208] Embodiment 310 is the fusion protein, recombinant Bacillus cereus family member, exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 308, wherein the targeting sequence consists of the amino acid sequence.

[001209] Embodiment 311 is the fusion protein, recombinant Bacillus cereus family member, exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 307, wherein the fusion protein comprises an exosporium protein or an exosporium protein fragment comprising an amino acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 44, 46, 48, 50, 52, 54, 56, 58, 95, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, and 121.

[001210] Embodiment 312 is the fusion protein, recombinant Bacillus cereus family member, exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 307, wherein the fusion protein comprises an exosporium protein comprising an amino acid sequence having at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with SEQ ID NO: 60, 62, 64, 66, 68, 70, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, or 122. [001211] Embodiment 313 is the fusion protein of any one of embodiments 1-18, 25- 28, and 307-312, the recombinant Bacillus cereus family member of any one of embodiments 19, 25-28, 280, and 307-312, the exosporium fragments of any one of embodiments 20, 25-28, 282-306, and 307-312, the composition of any one of embodiments 21-52, 55-63, 68-76, 79- 118, 120-123, 125-128, 131-136, 147-153, 159-161, 163-166, 175, 176, 183-186, 210-216, 226, 230-235, 238-242, 244-255, 259-261, 267, 272, 278, and 281-312, the method of any one of embodiments 64-119, 124-159, 161, 163-176, 179, 183-191, 193-209, 213-229, 231-237, 244-258, 262-279, and 282-312, the adhesive patch or wound dressing of any one of embodiments 162-166, and 281-312, the insert tray of any one of embodiments 177, 178, 183— 186, and 281-312, the hoof bandage of any one of embodiments 180-186 and 281-312, the feed or feed additive of any one of embodiments 192-196 and 282-312, or the insect fogger of any one of embodiments 243-255 and 281-312, wherein the targeting sequence, exosporium protein, or exosporium protein fragment comprises the amino acid sequence GXT at its carboxy terminus, wherein X is any amino acid.

[001212] Embodiment 314 is the fusion protein of any one of embodiments 1-18, 25- 28, and 307-313, the recombinant Bacillus cereus family member of any one of embodiments 19, 25-28, 280, and 307-313, the exosporium fragments of any one of embodiments 20, 25-28, 282-306, and 307-313, the composition of any one of embodiments 21-52, 55-63, 68-76, 79- 118, 120-123, 125-128, 131-136, 147-153, 159-161, 163-166, 175, 176, 183-186, 210-216, 226, 230-235, 238-242, 244-255, 259-261, 267, 272, 278, and 281-313, the method of any one of embodiments 64-119, 124-159, 161, 163-176, 179, 183-191, 193-209, 213-229, 231-237, 244-258, 262-279, and 282-313, the adhesive patch or wound dressing of any one of embodiments 162-166, and 281-313, the insert tray of any one of embodiments 177, 178, 183— 186, and 281-313, the hoof bandage of any one of embodiments 180-186 and 281-313, the feed or feed additive of any one of embodiments 192-196 and 282-313, or the insect fogger of any one of embodiments 243-255 and 281-313, wherein the targeting sequence, exosporium protein, or exosporium protein fragment comprises an alanine residue at the position of the targeting sequence that corresponds to amino acid 20 of SEQ ID NO: 1.

[001213] Embodiment 315 is the fusion protein of any one of embodiments 1-18, 25- 28, and 307-314, the recombinant Bacillus cereus family member of any one of embodiments 19, 25-28, 280, and 307-314, the exosporium fragments of any one of embodiments 20, 25-28, 282-306, and 307-314, the composition of any one of embodiments 21-52, 55-63, 68-76, 79- 118, 120-123, 125-128, 131-136, 147-153, 159-161, 163-166, 175, 176, 183-186, 210-216, 226, 230-235, 238-242, 244-255, 259-261, 267, 272, 278, and 281-314, the method of any one of embodiments 64-119, 124-159, 161, 163-176, 179, 183-191, 193-209, 213-229, 231-237, 244-258, 262-279, and 282-314, the adhesive patch or wound dressing of any one of embodiments 162-166, and 281-314, the insert tray of any one of embodiments 177, 178, 183— 186, and 281-314, the hoof bandage of any one of embodiments 180-186 and 281-314, the feed or feed additive of any one of embodiments 192-196 and 282-314, or the insect fogger of any one of embodiments 243-255 and 281-314, wherein the targeting sequence, exosporium protein, or exosporium protein fragment further comprises a methionine, serine, or threonine residue at the amino acid position immediately preceding the first amino acid of the targeting sequence, exosporium protein, or exosporium protein fragment or at the position of the targeting sequence that corresponds to amino acid 20 of SEQ ID NO: 1.

[001214] Embodiment 316 is the fusion protein of any one of embodiments 1-18, 25- 28, and 307-315, the recombinant Bacillus cereus family member of any one of embodiments 19, 25-28, 280, and 307-315, the exosporium fragments of any one of embodiments 20, 25-28, 282-306, and 307-315, the composition of any one of embodiments 21-52, 55-63, 68-76, 79- 118, 120-123, 125-128, 131-136, 147-153, 159-161, 163-166, 175, 176, 183-186, 210-216, 226, 230-235, 238-242, 244-255, 259-261, 267, 272, 278, and 281-315, the method of any one of embodiments 64-119, 124-159, 161, 163-176, 179, 183-191, 193-209, 213-229, 231-237, 244-258, 262-279, and 282-315, the adhesive patch or wound dressing of any one of embodiments 162-166, and 281-315, the insert tray of any one of embodiments 177, 178, 183— 186, and 281-315, the hoof bandage of any one of embodiments 180-186 and 281-315, the feed or feed additive of any one of embodiments 192-196 and 282-315, or the insect fogger of any one of embodiments 243-255 and 281-315, wherein the fusion protein further comprises an amino acid linker between the targeting sequence, the exosporium protein, or the exosporium protein fragment and the protein or peptide of interest.

[001215] Embodiment 317 is the fusion protein, recombinant Bacillus cereus family member, exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 316, wherein the linker comprises a polyalanine linker, a polyglycine linker, or a linker comprising a mixture of both alanine and glycine residues.

[001216] Embodiment 318 is the fusion protein, recombinant Bacillus cereus family member, exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 316 or 317, wherein the linker comprises a protease recognition site.

[001217] Embodiment 319 is the recombinant Bacillus cereus family member of any one of embodiments 19, 25-28, 280, and 307-318, the exosporium fragments of any one of embodiments 20, 25-28, 282-306, and 307-318, the composition of any one of embodiments 21-52, 55-63, 68-76, 79-118, 120-123, 125-128, 131-136, 147-153, 159-161, 163-166, 175, 176, 183-186, 210-216, 226, 230-235, 238-242, 244-255, 259-261, 267, 272, 278, and 281- 318, the method of any one of embodiments 64-119, 124-159, 161, 163-176, 179, 183-191, 193-209, 213-229, 231-237, 244-258, 262-279, and 282-318, the adhesive patch or wound dressing of any one of embodiments 162-166, and 281-318, the insert tray of any one of embodiments 177, 178, 183-186, and 281-318, the hoof bandage of any one of embodiments 180-186 and 281-318, the feed or feed additive of any one of embodiments 192-196 and 282- 318, or the insect fogger of any one of embodiments 243-255 and 281-318, wherein the fusion protein is expressed under the control of a sporulation promoter native to the targeting sequence, exosporium protein, or exosporium protein fragment of the fusion protein or a portion thereof.

[001218] Embodiment 320 is the recombinant Bacillus cereus family member of any one of embodiments 19, 25-28, 280, and 307-318, the exosporium fragments of any one of embodiments 20, 25-28, 282-306, and 307-318, the composition of any one of embodiments 21-52, 55-63, 68-76, 79-118, 120-123, 125-128, 131-136, 147-153, 159-161, 163-166, 175, 176, 183-186, 210-216, 226, 230-235, 238-242, 244-255, 259-261, 267, 272, 278, and 281- 318, the method of any one of embodiments 64-119, 124-159, 161, 163-176, 179, 183-191, 193-209, 213-229, 231-237, 244-258, 262-279, and 282-318, the adhesive patch or wound dressing of any one of embodiments 162-166, and 281-318, the insert tray of any one of embodiments 177, 178, 183-186, and 281-318, the hoof bandage of any one of embodiments 180-186 and 281-318, the feed or feed additive of any one of embodiments 192-196 and 282- 318, or the insect fogger of any one of embodiments 243-255 and 281-318, wherein the fusion protein is expressed under the control of a high-expression sporulation promoter.

[001219] Embodiment 321 is the recombinant Bacillus cereus family member, exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of embodiment 320, wherein the high-expression sporulation promoter comprises a sigma-K sporulation-specific polymerase promoter sequence.

[001220] Embodiment 322 is the recombinant Bacillus cereus family member, exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of any one of embodiments 319-321, wherein the sporulation promoter comprises a nucleic acid sequence having at least 80%, at least 90%, at least 95%), at least 98%>, at least 99% or 100%> identity with a nucleic acid sequence of any one of SEQ ID NOs: 37-42 and 123-191.

[001221] Embodiment 323 is the recombinant Bacillus cereus family member, exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of any one of embodiments 319-321, wherein the promoter comprises a nucleic acid sequence having at least 80%>, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 37, 38, 41, 42, 149, 150, 175, 180, 181, 185, 189, or 190.

[001222] Embodiment 324 is the recombinant Bacillus cereus family member, exosporium fragments, composition, method, adhesive patch, wound dressing, insert tray, hoof bandage, feed, feed additive, or insect fogger of any one of embodiments 319-323, wherein the sigma-K sporulati on-specific polymerase promoter sequence or sequences have 100% identity with the corresponding nucleotides of any of SEQ ID NOs: 37-42 and 123-191.

[001223] Embodiment 325 is the recombinant Bacillus cereus family member of any one of embodiments 019, 25-28, 280, and 307-324, the exosporium fragments of any one of embodiments 20, 25-28, 282-306, and 307-324, the composition of any one of embodiments 21-63, 68-76, 79-118, 120-123, 125-128, 131-136, 147-153, 159-161, 163-166, 175, 176, 183-186, 210-216, 226, 230-235, 238-242, 244-255, 259-261, 267, 272, 278, and 281-324, the method of any one of embodiments 64-119, 124-159, 161, 163-176, 179, 183-191, 193- 209, 213-229, 231-237, 244-258, 262-279, and 282-324, the adhesive patch or wound dressing of any one of embodiments 162-166, and 281-324, the insert tray of any one of embodiments 177, 178, 183-186, and 281-324, the hoof bandage of any one of embodiments 180-186 and 281-324, the feed or feed additive of any one of embodiments 192-196 and 282-324, or the insect fogger of any one of embodiments 243-255 and 281-324, wherein the recombinant Bacillus cereus family member comprises Bacillus anthracis, Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus pseudomycoides, Bacillus samanii, Bacillus gaemokensis, Bacillus weihenstephensis, Bacillus toyoiensis, or a combination of any thereof.