FIELD OF THE INVENTION

The present invention, in at least some embodiments, relates to an apparatus, system and method for synthesizing genes de novo and cloning them in vitro in a cell-free environment for use in downstream applications, and in particular, such an apparatus, system and method which feature programmable microfluidics.

BACKGROUND OF THE INVENTION The study of biology has accelerated to an unprecedented pace due to the development of methods for massively parallel cell-free cloning and DNA sequencing and their integration into miniaturized hardware in desktop next generation sequencing (NGS) machines ¹ . Such machines enable DNA sequencing to be performed

automatically, in a conveniently sized device. Conversely, the engineering of biology is still largely restrained by fundamental limitations of gene synthesis and cloning methodologies ^{2 5} . The development of novel approaches and apparatus for gene synthesis and cloning and their integration into desktop devices would be extremely useful, enabling scientists to write genetic code to the extent that NGS technology improved their ability to read it through sequencing. Specifically, microfluidics is positioned to improve the ability of scientists to create custom DNA molecules by increasing the throughput of gene synthesis through parallelization and reducing its cost through miniaturization. The development of novel methods and hardware for microfluidic gene synthesis is the subject of intensive ongoing research. Specifically, several studies have already shown that genes can be made de novo using various microfluidic technologies that run one-pot enzymatic gene synthesis methodology ^{6 8} . However, fully harnessing the power of microfluidics for gene synthesis must involve breaking the limitation of assembling genes in one pot reactions. Implementing more complex and reliable gene synthesis methods in microfluidics is possible, but requires ad hoc methodology and a fully programmable microfluidic platform.

Specifically, such a microfluidic platform must accommodate the ability to explicitly program interactions among multiple individual low volume droplets. This would enable the implementation of complex liquid handling schemes used in advanced gene synthesis methodologies.

Programmable microfluidic platforms open opportunities in developing novel ad hoc gene synthesis methodologies that utilize programmable microfluidics advantages. However, these have not been developed yet for gene synthesis, primarily due to limitations of microfluidic technology in supporting random access, complex droplet routing schemes that are often required in more advanced, hierarchal gene synthesis methods ^9~n . Cloning of synthetic constructs is the major second and final phase of gene synthesis following the assembly phase. Despite the development of new cloning approaches it is still a major bottleneck in gene synthesis and remains largely un- addressed with microfluidics. Instead, microfluidic gene synthesis typically resorts to traditional cloning of the assembled genes off-chip ¹² ' ¹³ . Advancing the cloning of microfluidic gene synthesis beyond its current limits is essential for utilizing the potential throughput of microfluidic gene synthesis and will require the development of microfluidic, cell-free cloning methods. These could, theoretically, have throughput similar to that of NGS cell-free cloning but, in contrast, must also enable the physical retrieval of specific clones individually. Cell-free cloning of synthetic genes was first accomplished by the present inventors ¹⁴ and was later improved with higher throughput using selective collection of pyro-sequencing beads using micro-pipetting technology ¹⁵ . Still, to date integrating methods for gene synthesis and cloning onto single microfluidic devices remains a major barrier for the progress of synthetic biology and bio-engineering. SUMMARY OF THE INVENTION

The present invention, in at least some embodiments, overcomes the drawbacks of the background art by providing an apparatus, system and method for synthesizing genes de novo and cloning them in vitro for use in downstream applications, which optionally and more preferably feature programmable microfluidics. The apparatus is optionally and preferably implemented with a small physical footprint, sufficiently small for example to operate while resting on a desktop or other small surface. Furthermore, the apparatus, system and method preferably feature gene cloning in a cell free environment.

According to at least some embodiments, the apparatus comprises an

electrowetting on dielectric (EWOD) device which functions to perform the de novo synthesis and in vitro cloning of synthetic genes within sub-microliter reaction droplets using a single desktop microfluidic programmable electro- wetting on dielectric. One of the exemplary, illustrative, non-limiting methods that are employed by this apparatus, which could also optionally be performed independently of the apparatus, comprises Programmable Order Polymerization (POP) Assembly, a novel EWOD-tailored de novo DNA synthesis method and single-molecule PCR-based in vitro cloning to rapidly assemble, clone and retrieve a library of synthetic genes using the device.

According to at least some embodiments, there is provided an apparatus for performing synthesis of a target polynucleotide having a de novo sequence, comprising a voltage source, a plurality of droplets and a plurality of containers in fluid

communication, wherein each container comprises a voltage controlled electrowettable surface connected to said voltage source, wherein said containers contain said droplets, each droplet comprising a gene synthesis reagent, wherein a location of said droplets within said containers is determined by controlling said voltage source and wherein a gene synthesis process is performed by sequentially determining said location of said droplets, such that said reagents are mixed for constructing the polynucleotide. Optionally at least one container comprises a plurality of different locations and said locations comprise a plurality of different environments, wherein each environment has a different temperature.

Optionally the apparatus further comprises a microfluidic device containing said plurality of containers and said droplets, wherein said containers are connected by a plurality of microfluidic connectors, wherein said microfluidic connectors are dimensioned according a size of said droplets.

Optionally each container comprises a counter electrode, a substrate, a conductive layer and an additional hydrophobic layer, wherein said conductive layer covers said substrate and wherein said additional hydrophobic layer coats said conductive layer, such that said droplet is placed on said hydrophobic layer and said counter electrode is dipped in said droplet.

Optionally said droplet does not wet said hydrophobic layer until said voltage is applied to said container.

Optionally said droplet only wets said hydrophobic layer when said voltage is applied to said container.

Optionally said substrate comprises a PCB (printed circuit board).

Optionally the apparatus further comprises a top plate for defining a fluid space at least within said containers, and an oil for filling said fluid space, wherein said droplets move through said oil according to said sequential application of said voltage.

Optionally said oil comprises silicone oil.

Optionally said containers are at a plurality of different temperatures.

Optionally the apparatus is contained within a cartridge, dimensioned to be contained by a laboratory bench top sized instrument.

Optionally said de novo synthesis comprises assembling the polynucleotide from a plurality of existing oligonucleotide or polynucleotide segments. Optionally the apparatus does not feature any pumps, valves or moving parts.

According to at least some embodiments there is provided a system for performing synthesis of a target polynucleotide having a de novo sequence, comprising the apparatus according to any embodiment, subembodiment or combination of embodiments as described herein, a computational device and a set of instructions for operating said device, wherein said computational device comprises said instructions and controls said voltage source according to said instructions.

Optionally the system is dimensioned to be contained by a laboratory bench top sized instrument. According to at least some embodiments there is provided a method for performing synthesis of a target polynucleotide having a de novo sequence, comprising providing a voltage source, a plurality of containers and a plurality of droplets, wherein each container comprises a voltage controlled electrowettable surface connected to said voltage source, wherein said containers contain said droplets, each droplet comprising a gene synthesis reagent and wherein said containers are in fluid communication;

sequentially applying voltage from said voltage source to each of said plurality of containers; determining a location of said droplets in said containers according to said sequentially applied voltage; mixing said reagents for constructing the polynucleotide; and performing a plurality of reactions in said containers with said gene synthesis reagents to synthesize said polynucleotide de novo.

Optionally the method further comprises providing a computational device and a set of instructions for operating said device, wherein said computational device controls said voltage source according to said instructions; and performing said determining said location of said droplets according to said instructions, such that said reagents are mixed in a predetermined sequence for synthesizing said polynucleotide de novo.

Optionally said instructions are determined according to Programmable Order Polymerization (POP) Assembly.

Optionally said reactions together comprising smPCR (single molecule PCR). Optionally at least one container comprises a plurality of different locations and said locations comprise a plurality of different environments, wherein each environment has a different temperature; the method of determining said location of said droplets further comprising determining said location according to a required temperature for each reaction.

Optionally the method further comprises assembling, cloning and retrieving a library of synthetic genes.

Optionally said containers are connected by a plurality of microfluidic connectors, wherein said microfluidic connectors are dimensioned according a size of said droplets; the method further comprising maneuvering said droplets through said microfluidic connectors to appropriate containers according to said sequential application of said voltage.

Optionally said containers are at a plurality of different temperatures, such that said maneuvering said droplets to different containers is performed to bring said droplets to different temperatures.

Optionally the method is performed with the apparatus as described herein according to any embodiment, sub-embodiment or combination thereof.

Optionally the method is performed with the system as described herein according to any embodiment, sub-embodiment or combination thereof.

Optionally said droplets have a micro-liter size or smaller.

Optionally said droplets have a sub-microliter size.

Optionally said sub-microliter size is from 50 nano-liters to 750 nano-liters.

Optionally said sub-microliter size is from 200 nano-liters to 500 nano-liters.

Optionally said containers are dimensioned for control of said droplets according to their size by application of said voltage. Optionally said reactions are all cell-free.

Optionally at least one initial container contains a droplet containing a pre- synthesized oligonucleotide or polynucleotide.

Optionally a first reaction for synthesizing the target polynucleotide is performed in said at least one initial container.

Optionally said polynucleotide is at least 200 bp in length.

Optionally said polynucleotide is up to 10,000 bp in length.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The materials, methods, and examples provided herein are illustrative only and not intended to be limiting.

Implementation of the method and system of the present invention involves performing or completing certain selected tasks or steps manually, automatically, or a combination thereof. Moreover, according to actual instrumentation and equipment of preferred embodiments of the method and system of the present invention, several selected steps could be implemented by hardware or by software on any operating system of any firmware or a combination thereof. For example, as hardware, selected steps of the invention could be implemented as a chip or a circuit. As software, selected steps of the invention could be implemented as a plurality of software instructions being executed by a computer using any suitable operating system. In any case, selected steps of the method and system of the invention could be described as being performed by a data processor, including, but not limited to, a computing platform for executing a plurality of instructions.

Although the present invention is described with regard to a "computer" on a "computer network", it should be noted that optionally any device featuring a data processor and the ability to execute one or more instructions may be described as a computer, including but not limited to any type of personal computer (PC), a server, a cellular telephone, an IP telephone, a smart phone, any type of mobile device, a PDA (personal digital assistant), a pager, or a tablet. Any two or more of such devices in communication with each other may optionally comprise a "computer network".

BRIEF DESCRIPTION OF THE DRAWINGS

The invention is herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only, and are presented in order to provide what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention, the description taken with the drawings making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.

In the drawings:

Figure 1 A is an illustrative, non-limiting, exemplary schematic block diagram, illustrating the electro-wetting principle for digital microfluidics;

Figure IB shows photos of an exemplary digital microfluidics cartridge as implemented (top) and of the bench-top instrument controlling the cartridge (bottom);

Figure 1C is a schematic block diagram of an exemplary, illustrative non-limiting general layout of the cartridge, with annotated reservoir names;

Figure ID shows a schematic block diagram of an exemplary, illustrative non- limiting section of the microfluidics cartridge layout according to at least some embodiments of the present invention;

Figure IE shows the apparatus of Figure 1 A in more detail;

Figure 2A relates to a non-limiting, exemplary method for gene synthesis according to at least some embodiments, which in this illustrative example is performed according to POP assembly schematics;

Figure 2B relates to a non-limiting, exemplary method for cell free cloning according to at least some embodiments, which in this illustrative example is performed according to POP assembly schematics, demonstrated as a flow method with various components illustrated for clarity;

Figure 3 shows experimental results with the system and method as described herein;

Figure 4 shows the analysis of reproducibility between independent gene expression measurements of variants from the POP 5'UTR library. The gene expression from 40 POP variants (x axis) was compared in two independent measurements (grey and orange data points) and exhibited highly reproducible gene expression measurements (Y axis);

Figure 5A shows the analysis of the correlation between RBS folding (x axis) energy and experimental gene expression measurements (y axis), demonstrating that RBS folding energy can, at best, only explain a very small part of the variability in gene expression observed in the library, while Figure 5B shows that Uracil was the most frequent nucleotide in 8/14 positions of the 5'UTR library, compared to only 3/14 positions in low expression 5'UTRs;

Figure 6 shows the results of Gibson assembly with increasing number (from left to right) of fragments in the assembly reaction. The last two lanes on the far right are the negative and positive controls, respectively;

Figures 7-10 show gel results of POP assembly as follows: Figure 7 shows the gel results for POP assembly level 1; Figure 8 shows the gel results for POP assembly level2; Figure 9 shows the gel results for POP assembly level3; Figure 10 shows the gel results for POP assembly level4, producing the final target molecule;

Figure 11 shows a Sanger sequencing chromatogram of the 5'UTR of a representative several POP library S.cerevisiae clones. The 14 consecutive N bases of the clones 5'UTR, directly upstream of the ATG translation start site are marked with a black border;

Figure 12 shows the analysis of shared components between library members. The library is composed of 9 combinatorial segments (colored Blue, red and green) positioned at 3 regions of the molecule (3 each), totaling 27 variants (3 to the power of 3 combinations). Gray regions represents segments of the target molecules that are constant in sequence. The combinatorial segments are PCR copied from 3 plasmids that serve as the input fragments to the production process on the cartridge;

Figure 13 shows a tree representation of the liquid handling operations used to construct the Azurin library;

Figure 14 shows a schematic representation of the construction process of the 24 variants Azurin library with the DNA building blocks (grey), primers (blue arrows), intermediate assembly fragments (blue nodes a and b) and target molecules (green node);

Figure 15 shows gel electrophoresis of library targets after individual elution from the cartridge and off-cartridge amplification; and

Figure 16 shows the Western Blot analysis of purified Arsenate Reductase variant proteins from bacteria.

DESCRIPTION OF AT LEAST SOME EMBODIMENTS

The present invention, in at least some embodiments, relates to an apparatus, system and method for synthesizing genes de novo and cloning them in vitro for use in downstream applications, which optionally and more preferably feature programmable microfluidics. The apparatus is optionally and preferably implemented with a small physical footprint, sufficiently small for example to operate while resting on a desktop or other small surface. Furthermore, the apparatus, system and method preferably feature gene cloning in a cell free environment.

According to at least some embodiments, the apparatus comprises a dielectric

(EWOD) device which functions to perform the de novo synthesis and in vitro cloning of synthetic genes within sub-microliter reaction droplets using a single desktop microfluidic programmable electro-wetting on. The method employed by this apparatus, which could also optionally be performed independently of the apparatus, comprises Programmable Order Polymerization (POP) Assembly, a novel EWOD-tailored de novo DNA synthesis method and single-molecule PCR-based in vitro cloning to rapidly assemble, clone and retrieve a library of synthetic genes using the device.

Biological code is written in DNA. Scientists' ability to efficiently engineer this code, specifically within the realm of synthetic biology, depends largely on devising reliable DNA construction biochemistry as well as efficient, miniaturized liquid handling hardware to execute it. Scientists' ability to read the DNA code has advanced considerably during the past decade due to the development and integration of biochemistry and machinery for DNA sequencing. Analogous machinery for rapid, in- house prototyping of synthetic genes is positioned to revolutionize the engineering of biological systems. The development of reliable, programmable EWOD droplet manipulation technology and its integration into an instrument that executes dedicated methods for rapid de-novo DNA synthesis followed by cell-free cloning, as presented in this manuscript, paves a path for simple DNA synthesis and cloning machines. Reliable small-scale machinery for synthesizing and cloning synthetic genes will introduce the power of synthetic biology to non-specialist labs and is positioned to widely broaden the access to synthetic genetic code.

Example 1 - Apparatus and System for microfluidic gene synthesis and in vitro cell free cloning

This Example relates to an exemplary, illustrative, non-limiting, apparatus and system according to at least some embodiments of the present invention for performing microfluidic gene synthesis and in vitro cell free cloning.

As shown in Figures 1A-1D, an apparatus and system according to at least some embodiments of the present invention features an EWOD microfluidic device for gene synthesis and in vitro cloning. The system comprises a programmable microfluidic desktop device that both assembles synthetic genes and clones them using novel ad hoc methodologies. The device uses EWOD technology to maneuver multiple 300nl droplets on a hydrophobic coated PCB cartridge in a fully programmable manner by the application of an electric field under direct software control (although the application and implementation of such an electric field is novel and non-obvious, and was not previously applied in the background art, the general application of electric fields under direct software control for other implementations, functions and applications is known in the background art ^16-21 ).

The device operates according to an implementation and application of electro- wetting principles for digital microfluidics. Figure 1A is an illustrative, non-limiting, exemplary schematic block diagram of a device which may optionally be incorporated within the apparatus and system according to at least some embodiments of the present invention, illustrating the electro- wetting principle for digital microfluidics.

As shown, a device 100 comprises a substrate 102 covered by a conductive layer 104, which is coated with an additional hydrophobic layer 106. A droplet 108 is placed on top of the stack (on top of hydrophobic layer 106), and a counter electrode 110 is dipped inside droplet 108. Counter electrode 110 is connected to a voltage source 112. As shown in the top illustration (labeled "Top"), without an applied voltage from voltage source 112, droplet 108 does not "wet" the hydrophobic surface of hydrophobic layer 106. As shown in the bottom illustration (labeled "Bottom"), with an applied voltage from voltage source 112, droplet 108 is forced to "wet" hydrophobic surface of hydrophobic layer 106. This principle of electro wetting is used in the cartridges of Figures IB-ID, as not only does electrowetting increase the surface area of droplet 108 that is in contact with the hydrophobic surface of hydrophobic layer 106, but this principle can also be used to cause droplet 108 to move along the hydrophobic surface of hydrophobic layer 106 in a controlled manner, with precise placement of droplet 108 at specific locations of the hydrophobic surface of hydrophobic layer 106 (for example when implemented as part of a microfluidics cartridge, as described below).

Figure IE shows device 100 in more detail, with the addition of a top plate 120, defining a space filled with a filler fluid 122, which preferably comprises oil. Droplet 108 then moves through filler fluid 122, controlled by activating electrodes 124 in conductive layer 104. Substrate 102 preferably comprises PCB material as shown. A more detailed description of microfluidics cartridges may be found in US Patent No. US8364315, which is hereby incorporated by reference as if fully set forth herein.

Figure IB shows photos of an exemplary digital microfluidics cartridge as implemented (top) and of the bench-top instrument controlling the cartridge (bottom). All liquid handling operations such as dispensing, transport, splitting and merging are combined to conduct complex protocols without the use of pumps, valves or moving parts. Instead, the system preferably comprises a disposable microfluidic cartridge in which reactions takes place and a bench-top instrument embedding the electronics for generating the electrowetting phenomenon. The cartridge itself is shown in more detail in a schematic diagram in Figure 1C. The cartridge is inserted into the instrument which performs all pre-programmed droplets operations. The cartridge consists of two parts: (1) a printed circuit board bottom plate and (2) a plastic injected-molded cover plate where througholes are used as wells for liquid loading into the working area of cartridge. The gap space between the cover plates is filled with approximately 5 mL of a dedicated filler fluid prior to use to ease the 300nl droplet transport and reduce evaporation.

Preferably, the printed circuit board bottom plate ( 1 ) is coated with a hydrophobic coating that exerts a contact angle of 106° in air, of 160° in the filler fluid without voltage and 60° at maximum voltage applied. The gap space between the cover plates (1) and (2) is optionally and preferably filled with 5 mL of silicone oil filler fluid of 5 cSt viscosity with surfactant (Tween20 at 0.01%), which facilitates robust droplet transport and reduces evaporation during temperature cycling.

A similar cartridge design is preferably used both DNA assembly methods and in vitro cloning.

Figure 1C is a schematic block diagram of an exemplary, illustrative non-limiting general layout of the cartridge, with annotated reservoir names. As shown, a cartridge 150 features a plurality of A wells 152, C wells 154, D wells 156, E wells 158 and S wells 160, connected by a plurality of microfluidic connectors 162, of which only some are labeled for clarity. Optionally as shown, eight each of A wells 152, C wells 154 and S wells 160 are provided, while also optionally as shown, 7 each of D wells 156 and E wells 158 are provided. These numbers are intended as non-limiting examples only.

The cartridge architecture is defined by its electrode structure and the different sets of reservoirs used to load and retrieve the different reagents of DNA assembly and cloning. Additionally, the cartridge harbors three programmable temperature zones that are used to perform reactions (such as PCR) by shuttling the droplets between the different zones in a programed manner.

Reservoir operational volumes range from 2μί to 40μί, with the dead volume varying between 0% and 10% of the total input depending on the liquid properties.

Collection of droplets containing the assembled products was performed using 10 pipette tips and visually guided by the programmed merging of droplets with dyed droplets prior to their transport to the collection well where they are retrieved.

Additionally, the cartridge harbors three programmable heater bars located at defined zones directly underneath the cartridge, which are used to perform reactions (such as

PCR) by shuttling the droplets between the different zones in a programmed manner.

Temperature calibration of the heater bars and the gradient between them was performed using miniature thermocouples inserted inside the cartridge.

A similar cartridge design is also used for the in vitro cloning cartridge of Figure ID, as described in greater detail below.

Figure ID shows a schematic block diagram of an exemplary, illustrative non- limiting section of the microfluidics cartridge layout according to at least some embodiments of the present invention. Different regions corresponding to different functions are highlighted. As shown, an in vitro cloning cartridge 176 comprises a dilution buffer reservoir

178, which contains the reagent used to perform dilutions to reach single molecule DNA concentrations. Buffer is emitted from reservoir 178 through a microfluidics connector 180 (such connectors are designated throughout this description as "180" but not all are labeled for the sake of clarity) to a POP Mix Reservoir "i" 182. POP Mix Reservoir "i" 182 is used to hold master mixes that contain the appropriate pairs of primers "i" used for POP assembly. POP Mix Reservoir "i" 182 is connected to a storage/mixing zone 184 through microfluidics connector 180 as shown.

During each phase of the EWOD program, as described in greater detail below with regard to Example 2, storage/mixing zone 184 is optionally and preferably continually loaded with the droplets required for the following stages of the run to speed up the protocol. Such material is then passed to a dilution zone 188 as shown, again through microfluidics connector 180 as shown. In addition, sample input material is preferably inserted to dilution zone 188 from a sample input 186, again through microfluidics connector 180 as shown. Any sample input material that is not required for transmission to dilution zone 188 preferably remains in sample input 186 as waste.

Dilution zone 188 is preferably used to perform the serial dilutions for both POP assembly and smPCR based in- vitro cloning. The suitably diluted material is then preferably passed to a thermal cycling zone 190. Thermal cycling zone 190 preferably features three temperature zones 194 at 62°C, 72°C, 95°C, with the droplet shuttling between each zone 194 by electrowetting. As shown, the high temperature zone (given as 95C for the sake of illustration) 194 is preferably somewhat separated from the other two temperature zones 194.

It should be noted that PCR with microfluidics devices has been previously described, for example with regard to US Patent No. 8364315 and US Patent Application No. 20100323405, which describe software and hardware for performing PCR with microfluidics devices, and processes thereof, both of which are hereby incorporated by reference as if fully set forth herein.

Example 2 - Programmable Order Polymerization (POP) assembly

As previously described with regard to Figure 1 , electrowetting is an important principle for operation of the described embodiments of the present invention, because it enables droplets to be maneuvered along hydrophobic surfaces with precise control of the desired droplet location. Figure 1 demonstrates the cartridge construction and operation that relies upon such precise control. However, in order for the illustrated cartridges to be suitably operative, software algorithmic control is also important (of course, logic gates, firmware or other constructions could also optionally be used in place of, or in combination with, pure software).

Programmable control over droplet maneuvering with the EWOD device of Figure 1 enables, for the first time, the implementation of complex microfluidic liquid handling schemes for gene synthesis (as opposed to PCR, which as described above has been performed with microfluidics devices). This technology was used to develop and implement POP DNA assembly, a rapid and robust ad hoc gene synthesis method specifically tailored for programmable microfluidics.

Specifically, in POP assembly, as shown in Figure 2A, a synthetic construct is built from the inside-out via an ordered set of serial elongation reactions. In each of the elongation reactions only two DNA oligos extend the synthetic construct from both its ends with several cycles of polymerase-based overlap-extension. Once a pair of oligos has completed extending the construct a fresh droplet containing a new oligo pair is programmed to merge into the assembly reaction. Each oligo pair uses the extensions created by the former pair as hybridization sites and further extends the construct inside- out using overlap extension. This process of ordered overlap extension is iterated with the correctly ordered droplets (that contain the correct oligo pairs) until the full length construct is built. The success of the process depends on the precise, timely and ordered integration of DNA droplets into the POP assembly reaction. The process is completely pre-programmed, computer driven and uses three basic EWOD droplet operations, namely (1) move (2) split and (3) merge. Thus, rather than PCR, the method preferably only uses extension techniques for gene synthesis, controlled by software and/or firmware based commands.

Figure 2A relates to a non-limiting, exemplary method for gene synthesis according to at least some embodiments, which in this illustrative example is performed according to POP assembly schematics, demonstrated as a flow method with various components illustrated for clarity.

As shown, in stage 1 , a droplet containing template DNA (gray) is combined with assembly droplet 1 (AD 1 ) that contains the primers and assembly mix to form a reaction droplet (thermo-cycled, in gray). In stage 2, within this reaction droplet, assembly product 1 is generated.

In stage 3, the API containing droplet is then combined with assembly droplet 2 (AD2) that contains the primers and assembly mix to form a new reaction droplet (thermo-cycled, in gray). In stage 4, assembly product 2 (AP2) is generated within this new reaction droplet. The process is preferably iterated (with AD3 and AD4, as a repetition of stages 1-4) at least once and preferably a plurality of times, shown as stage 5, until the full length molecule (AP4) is constructed in stage 6.

Figure 2B relates to a non-limiting, exemplary method for cell free cloning according to at least some embodiments, which in this illustrative example is performed according to POP assembly schematics, demonstrated as a flow method with various components illustrated for clarity.

The full length construct generated by POP assembly is subjected to EWOD in- vitro cloning using single molecule PCR. In stage 1 , diluent is provided. The POP assembly product is iteratively diluted 2-fold using merge (with diluent), starting in stage 2. After the merge stage, the material is split in stage 3. In stage 4, one half of the material is sent to the trash. In stage 5, the second half is recycled into the serial dilution. This process, featuring stages 1-5, is optionally repeated as required, until a sufficient dilution is reached. Once diluted droplets contain (according to calculations) an average of one target DNA molecule per droplet, which is a sufficient dilution, the droplets are programmed to travel to the PCR zone in stage 6. In the PCR zone, single DNA molecule PCR droplets are amplified by PCR via their travel between the temperature zones.

In contrast to one -pot gene synthesis methods carried out in general ²² ' ²³ and specifically in microfluidic devices ^6"8 , POP assembly substantially reduces the complexity and increases reliability of the assembly reaction. It reduces the number of components that are simultaneously assembled at any given time in the reaction to the minimum and enables individualized reaction condition optimization for each DNA component in the system. One-pot assembly methods face the problem of simultaneously optimizing specificity and reaction conditions for multiple DNA components. This complexity is often mitigated through various computational and biophysical methodologies aimed at controlling the correct order and hybridization specificity between multiple oligos that exist in a single reaction ²³ . However, this has proven a challenge and one-pot assembly of multiple DNA components remains prone to construction failure and intensive downstream sifting through clones due to the generation of non-specific assembly products. The primary challenge is in avoiding cross-hybridizations when multiple DNA fragments are mixed and amplified in a single assembly reaction. However, this problem could potentially be resolved since at each phase of the assembly process only a small subset of the multiple DNA components present in the reaction are actually required for the assembly process.

Programmable, microfluidic POP DNA assembly resolves this problem, arguably the most frequent problem associated with one-pot DNA assembly, namely the creation of non-specific assembly products created by non-specific interactions between DNA assembly building blocks. It reduces the complexity of the assembly reaction by reducing the number of DNA components present at each phase of the assembly to the minimum. The complexity associated with having only the required DNA components present at each phase of the assembly reaction is transferred to pre-programmed droplet interaction schemes that, at each phase of the assembly reaction, merge droplets that contain DNA building blocks required for the assembly reaction at the precise time and order in which they are required. Controlling the order and time of synthetic DNA building block addition into the assembly reaction enables fine control over the components of the assembly reaction at every stage of the construction process. The exclusive addition of the minimal, essential components required for assembly at each stage of construction eliminates the generation of off-track assembly products, resulting in rapid and accurate gene synthesis. This process is facilitated by electrowetting and EWOD programmability, which was used to implement the droplet routing schemes required for POP assembly. It considerably reduced the complexity of assembling genes from multiple components by introducing into the assembly reaction at each stage only the components that are essential for construct growth at that particular phase of DNA assembly. This ensured maximal precision at every stage of construction. Consequently, the POP protocol is a continuous assembly reaction in which only the required DNA reagents are incrementally added to the mix in a timely and ordered fashion.

Physical and temporal separation between assembly DNA components relieves computational design constraints on the oligonucleotide sequences, enabling simple design rules for the oligo components to be used.

Example 3 - gene synthesis and cloning

In this Example, which is non-limiting and illustrative, a synthetic library of synthetic genes was built using POP assembly on-chip and then cloned on the same assembly chip by single molecule PCR-based in- vitro cloning. The library can be retrieved for downstream transformation, sequencing and gene expression. This Example relies upon the capabilities of the system as demonstrated in Examples 1 and 2, featuring a continuous assembly reaction in which only the required DNA reagents are

incrementally added to the mix in a timely and ordered fashion.

This protocol was programmed onto the previously described device, which then autonomously assembled a library of synthetic YFP reporter genes with randomized 5' UTR sequences. The POP assembled UTR library was then eluted from the EWOD cartridge and sequenced to validate its sequence. Finally, in the last step of construction the POP-EWOD DNA library was further assembled into 2KB fragments using the Y operation as previously described by the present inventors ⁹ ' ²⁴ and sequence validated. Before transformation of the library to yeast and its expression measurements, microfluidic methods were developed for its in vitro cloning using programmable EWOD, demonstrating for the first time how gene syntheses can be also cloned using microfluidics.

Methods

EWOD POP assembly Each 0.3ul POP assembly droplet contains at each phase of the assembly process:

(1) the correct pair of primers (different pair per POP phase) for overlap extension (0.1 pmol each primer), the correct template DNA (different template per POP phase), IX hot start KOD buffer (Novagen), 0.02U KOD Hot Start enzyme, 200 μΜ of dNTP. EWOD Cartridge Thermal Cycler program (per POP phase): Enzyme activation at 95 °C for 10 min, 4 cycles of denaturation 95°C 5 s, annealing at Tm of primers 5 s, extension 72°C 15 s/kb). A 64X dilution (via a 5 step serial 2 fold dilution) between POP assembly phases. Prior to POP assembly cartridges are filled with the filler fluid and placed inside the devices cartridge position. The electrodes are then turned on and each POP reagent is loaded at its appropriate wells on the EWOD cartridge. Surfactant was added to the POP assembly reactions to avoid the formation of stationary droplets. The POP assembly program was uploaded to the EWOD instrument and ran. Upon completion of the POP assembly program the POP Assembly products were routed to dedicated elution wells and were eluted manually from them.

EWOD smPCR smPCR was performed with KOD hot start (Novagen) polymerase on the EWOD cartridge. Single molecule templates were obtained via limiting dilution on-cartridge and PCR amplified through shuttling of droplets between three temperature zones. smPCR reactions were performed in various volumes on cartridge ranging between 0.3ul and 1.2ul final volume. Primers containing only CA bases (no GT) were used for

amplification to avoid primer dimer formation. Sites for the CA primers were pre- inserted into the POP assembly products at the final POP assembly phase. Each (0.3ul- 1.2ul) smPCR reaction droplet contains: IX hot start KOD buffer, 0.02U-0.08U KOD Hot Start enzyme, 0.1-0.4 pmol of the CA primer, 200 μΜ of dNTP. EWOD Cartridge Thermal Cycler program: Enzyme activation at 95 °C for 10 min, denaturation 95°C 5 s, annealing at Tm of primers 5 s, extension 72°C 15 s/kb, 50 cycles. It is important that the PCR is prepared in sterile environment using sterile equipment and uncontaminated reagents. Prior to smPCR cartridges are filled with the filler fluid and placed inside the devices cartridge position. The electrodes are then turned on and each smPCR reagent is loaded at its appropriate wells on the EWOD cartridge. Surfactant was added to the smPCR reactions to avoid the formation of stationary droplets. The smPCR program were uploaded to the EWOD instrument and ran. Upon completion of the smPCR program the in-vitro generated POP clones were routed to dedicated elution wells and were eluted manually from them.

Methods for off-cartridge construction using the Y operation (adopted from Linshiz et al & Shabi et al)

Phosphorylation

Phosphorylation of all PCR primers used by the recursive construction protocol is performed beforehand simultaneously, according to the following protocol: A total of 300 pmol of 5' DNA termini in a 50 μΐ reaction containing 70 mM Tris-HCl, 10 mM MgC12, 7 mM dithiothreitol, pH 7.6 at 37°C, 1 mM ATP, 10 U T4 polynucleotide kinase (NEB, Ipswich, MA, USA). Incubation is at 37°C for 30 min and inactivation at 65°C for 20 min.

Overlap extension elongation between two ssDNA fragments

One to five Picomoles of 5' DNA termini of each progenitor in a reaction containing 25 mM TAPS pH 9.3 at 25°C, 2 mM MgC12, 50 mM KC1, 1 mM β- mercaptoethanol 200 μΜ each of dNTP, 4 U Thermo-Start DNA polymerase (ABgene). Thermal cycling program is as follows: enzyme activation at 95 °C for 15 min, slow annealing 0.1°C/s from 95°C to 62°C and elongation at 72°C for 10 min. PCR amplification of the above elongation product with two primers, one of which is phosphorylated

A total of 1-0.1 fmol template, 10 pmol of each primer in a 25 μΐ reaction containing 25 mM TAPS pH 9.3 at 25°C, 2 mM MgC12, 50 mM KC1, 1 mM β- mercaptoethanol 200 μΜ each of dNTP, 1.9 U AccuSure DNA Polymerase (BioLINE). Thermal cycling program is: enzyme activation at 95°C for 10 min, denaturation 95°C, annealing at Tm of primers, and extension 72°C for 1.5 min kb to be amplified 20 cycles.

Lambda exonuclease digestion of the above PCR product to re-generate ssDNA

One to five Picomoles of 5' phosphorylated DNA termini in a reaction containing 25 mM TAPS pH 9.3 at 25°C, 2 mM MgC12, 50 mM KC1, 1 mM β-mercaptoethanol 5 mM 1,4-Dithiothreitol, 5 U Lambda Exonuclease (Epicentre). Thermal cycling program is: enzyme activation at 37 °C for 15 min, 42°C for 2 min and enzyme inactivation at 70°C 10 min. Transformations to yeast

Expression measurements POP library strains were arrayed on SD-URA+NAT agar plates in 384 colony format using a robotic colony arrayer (RoToR, Singer instruments). The aforementioned colony arrayer was used to inoculate the library into SD-URA in 384 well microplates (Greiner bio-one, 781162). Following over-night incubation, strains were diluted and cultured in the desired media to a starting O.D600 of -0.1-0.2. A microplate reader (Neotec Infinite M200 monochromator) was used to measure growth (Absorbance at 600nm), mCherry (E.x. 570 E.m. 630) and YFP expression (E.x. 500 E.m. 540).

Sequencing

Sequencing of the POP DNA library and the smPCR products was performed using Sanger sequencing

Single-molecule PCR- based cloning of POP assembly Once synthetic genes are made they are traditional cloned into (most frequently) bacteria or yeast and this step is still a major bottleneck for high-throughput gene synthesis. To break this limitation methods for obtaining cloned synthetic DNA without resorting to cellular cloning are needed. The EWOD cartridge designed for POP assembly was also used to clone the POP-generated DNA library using single-molecule PCR on-cartridge. The DNA library was subjected to an EWOD smPCR-based cloning protocol that was programmed into the device. The program uses EWOD to serially dilute the POP assembly product to single molecules (using simple limiting dilution as previously described) and subsequently amplifies them, eight reactions at a time. These in- vitro cloned products were retrieved from the cartridge, after which a barcode region within them was sequenced for verification that amplification indeed originated from one DNA molecule. Detailed materials and methods are presented below.

Materials and Methods smPCR was performed with KOD hot start (Novagen) polymerase on the EWOD cartridge. Single molecule templates were obtained via limiting dilution and amplified through shuttling of droplets between temperature zones. smPCR reactions were performed in various volumes on cartridge ranging between 0.3ul and 1.2ul final volume. Primers containing only CA bases (no GT) were used for smPCR amplification to avoid primer dimer formation. Each (0.3ul-1.2ul) reaction droplet Reaction contains: IX hot start KOD buffer, 0.02U-0.08U KOD Hot Start enzyme, 0.1-0.4 pmol of the CA primer, 200 μΜ οί άΝΤΡ.

EWOD Cartridge Thermal Cycler program: Enzyme activation at 95 °C for 10 min, denaturation 95°C 5 s, annealing at Tm of primers 5 s, extension 72°C 15 s/kb, 50 cycles. It is important that the PCR is prepared in sterile environment using sterile equipment and uncontaminated reagents.

POP assembly programs were uploaded to the instrument and ran once cartridges were filled with the filler fluid, loaded with the POP reagents at the appropriate wells and the cartridge placed inside the device. Surfactant was added to the POP assembly reactions on cartridge to avoid the formation of stationary droplets. smPCR products were eluted manually from the dedicated collection wells.

Gene expression profiling of POP assembled library

The YFP 5'UTR library was integrated into the genome of yeast downstream to a TEF promoter, sequence validated it from clones and measured the YFP output of 80 5'UTR strains. The POP library was planned so that the clones have a YFP ORF sequence with completely randomized 5' UTR's. These, in turn, eventually resulted in yeast strains with differential expression profiles between library clones. A constant cherry reporter gene was also integrated as a control to validate that the variation in gene expression was due only to the variable 5'UTR inserted with POP assembly on the EWOD device. Large scale analysis of the correlation between randomized 5' UTR libraries and their corresponding gene expression profiles is a highly useful tool for both deciphering design principles of translation initiation from 5'UTR's and in establishing design rules for e use of synthetic 5'UTR's within genetic engineering projects

(manuscript in preparation). Specifically, the yeast gene expression data generated from the EWOD POP DNA library demonstrate the applied potential of our assembly methods and EWOD technology for rapidly generating genetic material useful for both the study and design of synthetic genetic elements.

Figure 3 A shows that YFP gene expression of 80 POP library clones (blue), expressed as YFP/OD, spans a 10-fold expression range due to variability in the 5'UTR (Kozak) of their YFP gene. In contrast, the Cherry/OD control of the same clones remains constant (red), validating that the variation in gene expression is due to the randomization of Kozak sequences of the POP generated YFP genes.

Figure 3B shows a detailed view of the randomized 5'UTR region of sequencing reaction performed on EWOD generated single molecule PCR clones made from the POP assembly products. The sequencing chromatograms validate that single POP generated molecules were amplified on chip since the randomized 5'UTR sequence also functions as a barcode that verifies clonality (center of chromatogram, lanes 1-3).

In contrast, negative control single molecule PCR experiments (controls with many template molecules) show a clear pattern of variability in the 5'UTR/barcode region (center of chromatogram, lanes 4-8; data not shown).

Figures 4 and 5 show additional results. The 5'UTR of the reporter clones were sequenced and their YFP output was measured using a 96-well plate reader (Tecan Infinite) in two independent duplicates which correlated very well (Figure 4). Each clone also harbored the same cherry reporter gene as an internal control. The resulting YFP gene expression of the 5'UTR reporter strains varied over 10-fold (see Figure 3B), indicating that 5'UTR RBS are features of the transcript that can be engineered to tune gene expression over a wide range of expression levels. The RNA folding energy (FE) ²⁹ and the sequence conservation (Hamming distance) of the 5'UTRs of all reporter clones were both calculated to determine whether they predicted the experimental gene expression measurements. In addition, the library was divided into high and low expression groups to investigate whether RBS sequence and folding energy differed significantly between sequences from high and low expression groups.

Interestingly, the results show that sequence homology between RBSs and their folding energy do not predict RBS-mediated variability in gene expression in the library very well. For example, sequence homology (measured in average Hamming distance) is nearly identical when compared within highly expressed 5'UTRs (Hamming score 3.66) and between all sequences (Hamming score 3.7). This indicates that RBSs with similar gene expression are not biased towards similar RBS sequences. Additionally, folding energy of RBSs did not correlate significantly with gene expression (Figure 5A).

However, a comparative analysis of the composition of the four RNA bases within high and low expression groups showed that RBS nucleotide composition does modify gene expression. In addition, 5'UTRs associated with high gene expression were found to be biased towards high Uracil content compared to 5'UTRs with low gene expression. Specifically, Uracil was the most frequent nucleotide in 8/14 positions of the 5'UTR library, compared to only 3/14 positions in low expression 5'UTRs (Figure 5B). Extreme cases of Uracil rich 5'UTRs (10/14 bases or more) are 15 fold more likely to be found in high expression compared to low expression sequence groups. Additionally, more moderate enrichments of 50%-75% were also observed for low Cytosine content in poorly expressed 5'UTRs and high Guanine content in highly expressed5'UTRs. While these results highlight the applied potential of combining DMF with ad hoc microfluidic DNA synthesis methodology (POP assembly) for tuning gene expression, they more generally demonstrate the potential for utilizing this technology for rapidly generating genetic material on demand, which should be useful for both the study and design of synthetic genetic elements in synthetic biology and in biology in general.

Comparison of the Inventive Method with Gibson Assembly

The POP assembly of the YFP library head-to-head to a typical one pot-assembly reaction using Gibson assembly (Gibson, D.G. et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods 6, 343-345 (2009)) of the same molecule. While Gibson assembly resulted in an increasing fraction of spurious assembly reactions with an increase in number of DNA fragments in the assembly reaction (Figure 6, from left to right), POP assembly showed no spurious assembly products in any of its construction stages as demonstrated by the gel results (Figures 7-10), starting from POP assembly level 1 (Figure 7) and up to the final POP assembly level 4 (Figure 10). DMF POP assembly used nine Ultramer (IDT DNA) oligonucleotides as building blocks in total and proceeded according to the principles of POP assembly, with each POP stage adding approximately 160bp of synthetic DNA to the construct. Each step in the assembly process was monitored separately using gel electrophoresis to verify its success, as shown in Figures 7-10.

The sequence of POP assembly constructs was validated from 80 clones by amplification and sequencing of the corresponding part of the genome. The error rate of POP constructs was 1/450, reflecting the known error-rate of conventional oligo synthesis which were used as input for POP assembly (see supplementary for oligo sequences), demonstrating that the use of DMF technology does not introduce unexpected error into the DNA construction process. Library variability, originating from the 14 consecutive N bases we inserted at the 5'UTR ribosome binding site (RBS), directly upstream of the ATG translation start site, was maintained throughout the construction process and onto yeast clones since none of the clones that we sequenced had the same RBS sequence (Figure 11). Several features of the variant library RBS and their corresponding gene expression profiles in yeast were considered (discussed in detail later in the manuscript). The time required to complete POP assembly for targets of this length is approximately 1-2 hours, depending on the number of target molecules assembled in parallel.

The number of constructs that can be made on a single cartridge depends on the structure of the library in hand. For example, the number of final targets can be increased if different target constructs share DNA building blocks between them, as in the case of the Arsenate reductase library (Figures 12-14) and is often the case when constructing variants of a target molecule. A single run of a single cartridge enables the construction of than 20-30 constructs if several DNA components are shared between library members (for example, see Arsenate reductase library assembly below) and approximately 4 different constructs if there the constructs are completely unrelated and have no sharing of DNA components between them. Additionally, once assembly is completed the cartridge can be re-used for additional runs of POP assembly (we have tried up to 3 runs on the same cartridge). Example 4 - M -CAD -Microfluidic Combinatorial Assembly of DNA

The term "M-CAD" refers to Microfluidic Combinatorial Assembly of DNA. Procedures were developed for M-CAD, which enable the individual construction of combinatorial, rationally designed DNA libraries and their retrieval as individual, separated variants from the cartridge. M-CAD was applied to the construction of a 24 variant library of the Arsenate reductase gene that systematically explores the synonymous sequence of a protein binding site on the Arsenate reductase mRNA coding region by altering its DNA\RNA sequence without altering its amino acid sequence. To develop M-CAD the complete programmable control over droplet manipulation provided by the various embodiments of the present invention to implement a complex microfluidic DNA assembly process, involving (1) the combinatorial re-use of DNA reagents in the assembly process, (2) parallel multi-stage, multi-target DNA construction, (3) utilization of multiple DNA inputs into the construction process, (4) the development of on- cartridge, intermediate-assembly-product storage strategies required for multi-stage DNA assembly schemes and (5) that the library variants can be accurately and individually eluted off the cartridge using simple manual pipetting operations with no detectible cross-target contamination.

The complete protocol for the library assembly required 59 enzymatic reactions programmed to run autonomously using a single DMF cartridge (program not shown). The 59 reactions were staggered in 3 successive assembly stages including up to 24 individual reaction droplets simultaneously. To facilitate throughput a new droplet manipulation scheme dubbed "circular permutation PCR" was developed, that enables PCR with multiple droplets on the same cartridge PCR lane. Shuttling of multiple droplets between temperature zones of a single PCR lane by using circular permutations (program not shown), effectively triples (in this case) the throughput of each lane on DMF cartridges. M-CAD was used to generate a library of 24 rationally designed variants of the Arsenate reductase gene by programming a DMF LH scheme that enabled the parallel assembly and individual retrieval of explicitly specified gene variants from the microfluidic cartridge. Assembly was accomplished through binary overlap extension reactions between PCR products. Prior to assembly, a shared component analysis of the Arsenate reductase library was computed using a heuristic for maximizing DNA reuse in the library 28 and other previously developed tools 27 were used to devise an actual construction plan from it for liquid handling robots.

The plan was translated into two automated protocols for the construction of the library, one using liquid handling robots (see scheme of robot LH plan in Figure 13) and the other using M-CAD and executed both. The M-CAD Arsenate reductase library construction process followed the aforementioned plan and consisted of: (1) PCR amplification of building blocks from three different plasmid templates using 6 different primers (Figure 14), generating twelve PCR products (Figure 14, blue nodes a & b). These twelve PCR products were further assembled in a combinatorial fashion using binary overlap extension to yield 24 out of the 27 possible target combinations and a final PCR amplification of the 24 full length assembled targets using external primers was also performed.

All library targets were then individually eluted from the cartridge, sized using gel electrophoresis following off-cartridge amplification (Figure 15) and DNA sequenced to verify their sequence. Their sequence was identical to the same constructs made using a control construction of the same target molecules using the liquid handling robot program and construction methodologies previously developed. Initial downstream processing of the resulting Arsenate Reductase DNA variants from the robotic liquid handler included the purification of Arsenate Reductase variant proteins from bacteria and their Western Blot analysis (Figure 16). Although this data only includes preliminary analysis of a small fraction of the Azurin library variants, it already shows that relatively minor, synonymous alterations to a binding site on the Arsenate reductase mRNA coding region dramatically alter Arsenate reductase protein expression. The entire library is now being further processed to study the role that this novel mRNA binding site plays in the function of Arsenate reductase.

M -CAD was performed with KOD hot start (Novagen) polymerase on the EWOD cartridge. DNA templates used for generating the library building blocks on cartridge were plasmids purified from bacteria. Overlapping PCR building blocks were assembled using thermal cycling as follows: EWOD Cartridge Thermal Cycler program: denaturation 95°C 5 s, annealing at Tm of primers -5, extension 72°C 15 s/kb, 10 cycles. Each 300nl reaction droplet Reaction contains: IX hot start KOD buffer, 0.02U-0.08U KOD Hot Start enzyme, two overlapping PCR building blocks and 200 μΜ of dNTP.

The Assembled is then serially diluted on-cartridge and PCR amplified with external primers using EWOD Cartridge Thermal Cycler program: denaturation 95°C 5 s, annealing at Tm of primers -5, extension 72°C 15 s/kb, 30 cycles. M -CAD assembly programs were uploaded to the instrument and ran once cartridges were filled with the filler fluid, loaded with the M -CAD reagents (tempaltes, primers, polymerase mix) at the appropriate wells and the cartridge placed inside the device. Surfactant was added to the M -CAD assembly reactions on cartridge to avoid the formation of stationary droplets. Assembled target molecules of the Azurin combinatorial library were eluted manually from the dedicated collection wells and verified by sequencing.

Azurin Library Western Blot

For detection of Azurin by western blot, Pseudomonas aeruginosa PAOl wild type and azurin in frame deletion mutant (published elsewhere) were grown in 10 ml LB (Luria Bertani) broth for 16h under vigorous shaking (200 rpm). A volume of 1 ml culture was centrifuged and cell pellets suspended in SDS sample buffer containing 6 % β- mercaptoethanol. Samples were run on 30 % SDS-polyacrylamide gel and blotted to Hybond-ECL nitrocellulose membrane (Amersham) in a BioRad Mini-Protean system. The blot buffer consisted of (12.5 mM) Tris-Base, 96 mM glycine and 20% methanol. After blotting the membrane was incubated overnight at 4oC in TBST (1 mM Tris-HCI, 150 mM NaCI, 0.05% Tween 20, pH 7.4) containing 5% milk (from non-fat milk powder) and azurin antibody (1:2000) (Yamada et al., 2005). The membrane was washed once with TBST and incubated for a further 60 min at room temperature with TBST containing anti-goat IgG alkaline phosphatase conjugate (1:5000). Azurin was detected using ECL chemiluminescence detection kit (Amersham). Commercial azurin (Sigma) was used as a standard.

Methods for off-cartridge construction using the Y operation Phosphorylation Phosphorylation of all PCR primers used by the recursive construction protocol is performed beforehand simultaneously, according to the following protocol: A total of 300 pmol of 5' DNA termini in a 50 μΙ reaction containing 70 mM Tris-HCI, 10 mM MgCI2, 7 mM dithiothreitol, pH 7.6 at 37°C, 1 mM ATP, 10 U T4 polynucleotide kinase (NEB, Ipswich, MA, USA). Incubation is at 37°C for 30 min and inactivation at 65°C for 20 min.

Overlap extension elongation between two ssDNA fragments

One to five Picomoles of 5' DNA termini of each progenitor in a reaction containing 25 mM TAPS pH 9.3 at 25°C, 2 mM MgCI2, 50 mM KG, 1 mM β-mercaptoethanol 200 μΜ each of dNTP, 4 U Thermo-Start DNA polymerase (ABgene). Thermal cycling program is as follows: enzyme activation at 95°C for 15 min, slow annealing 0.1°C/s from 95°C to 62°C and elongation at 72°C for 10 min. PCR amplification of the above elongation product with two primers, one of which is phosphorylated

A total of 1-0.1 fmol template, 10 pmol of each primer in a 25 μΙ reaction containing 25 mM TAPS pH 9.3 at 25°C, 2 mM MgCI2, 50 mM KG, 1 mM β-mercaptoethanol 200 μΜ each of dNTP, 1.9 U AccuSure DNA Polymerase (BioLINE). Thermal cycling program is: enzyme activation at 95°C for 10 min, denaturation 95°C, annealing at Tm of primers, and extension 72°C for 1.5 min/kb to be amplified 20 cycles.

Lambda exonuclease digestion of the above PCR product to re-generate ssDNA

One to five Picomoles of 5' phosphorylated DNA termini in a reaction containing 25 mM TAPS pH 9.3 at 25°C, 2 mM MgCI2, 50 mM KCI, 1 mM β-mercaptoethanol 5 mM 1,4-

Dithiothreitol, 5 U Lambda Exonuclease (Epicentre). Thermal cycling program is: enzyme activation at 37°C for 15 min, 42°C for 2 min and enzyme inactivation at 70°C 10 min.

Transformations to yeast

The POP-generated variants were transformed into the yeast master strain using the LiAc/SS carrier DNA/PEG method. Cells were plated on solid agar SD-URA selective media and incubated at 30 °C for 3-4 days. Transformant colonies were handpicked and patched on SD-URA + NAT (Werner BioAgents) agar plates. Correct transformation was verified for all variants by PCR amplification from the yeast's genome, gel

electrophoresis and verified by sequencing

Yeast library Gene Expression measurements POP library strains were arrayed on SD-URA+NAT agar plates in 96 colony format using a robotic colony arrayer (RoToR, Singer instruments). The colony arrayer was used to inoculate the library into SD-URA in 96 well microplates (Greiner bio-one, 781162). Following over-night incubation, strains were diluted 1:20 into SD complete media and cultured. A microplate reader (Neotec Infinite M200 monochromator) was set to measure growth (Absorbance at 600nm), mCherry (E.x. 570 E.m. 630) and YFP expression (E.x. 500 E.m. 540) in 10 min intervals. Each cycle contained 4 min of orbital shaking at amplitude of 3 mm. The number of cycles was set to 100 (16h) and the temperature to 30 °C. The entire procedure was performed in 3 times. The transformation "master strain"

The library transformation master strain was generously provided by Eran Segal. The master strain was created by integrating into the yeast genome a cassette expressing the fluorescent mCherry under a TEF2 promoter and a promoter-less YFP, followed by a NAT (Nourseothricin) resistance marker under its own promoter. The entire sequence was inserted into the his3Al locus of strain Y8205 (A strain derived from S. cerevisiae S288C, BY4741, mat alpha, Charlie Boone lab).

A microplate reader (Neotec Infinite M200 monochromator) was then set to measure the following parameters in cycles of 10 min: Cell growth (as extracted from absorbance at 600 nm) and YFP expression (Ex. 500 Em. 540). Each cycle contained 4 min of orbital shaking at amplitude of 3 mm. The number of cycles was set to 100 (16h) and the temperature to 30 °C.

DNA Sequencing Sequencing of the POP DNA library and the smPCR products was performed standard Sanger sequencing at the Weizmann institute sequencing facility.

DNA oligos

All DNA oligos for POP assembly were ordered as Ultramers from Integrated DNA technologies (IDT). Oligos for single molecule PCR and for the construction of the Azurin library were ordered as standard desalted oligos from IDT.

Sequences of synthetic oligos used in POP assembly on cartridge

>CPA_Fwdl TA rTTAGGTTATGGTTTGATGTGTTTTGCTAGATACCCAGATCATATGA AACAACATG ACTTTTTCAAGTCTG CCATG CCAG A AG GTTATGTTCAAG AA AGAA

>CPA_Fwd2

CTACTTACGGTAAATTGACCTTAAAATTTATTTGTACTACTGGTAAATTG CCAGTTCCATG GCCAACCTTAGTCACTACTTTAG GTTATG GTTTG ATGTG TTTTG >CPA_Fwd3

TTTTGGTTGAATTAGATGGTGATGTTAATGGTCACAAATTTTCTGTCTCC GGTGAAGGTGAAGGTGATGCTACTTACGGTAAATTGACCTTAAAATTTAT TTG

>CPA_Fwd4 CGGTCAACGAACTATAATTAACTAAACACTAGTACCATGTCTAAAGGTGA

AGAATTATTCACTGGTGTTGTCCCAATTTTGGTTGAATTAGATGGTGATG

TTAAT

>CPA_Revl

CC ATTCTTTTGTTTGTC AG CC ATG ATGTA A ACATTGTG AG AGTTATAGTT GTATTCCAATTTGTGACCTAAAATGTTACCATCTTCTTTAAAATCAATAC

>CPA_Rev2

GTATTTTGTTGATAATGGTCAGCTAATTGAACAGAACCATCTTCAATGTT GTGTCTAATTTTGAAGTTAACTTTGATACCATTCTTTTGTTTGTCAGCCA

>CPA_Rev3

CTTTGG ATAAG G CAG ATTG ATAG G ATAAGTAATG GTTGTCTG GTAACA AG ACTG G ACCATC ACC A ATTG G AGTATTTTGTTG ATA ATG GTC AG CTA ATTG

>CPA_Rev4

TCCATACCATGGGTAATACCAGCAGCAGTAACAAATTCTAACAAGACCAT GTGGTCTCTCTTTTCGTTTGGATCTTTGGATAAGGCAGATTGATAGGATA

>CPA_Template

G CC AG A AG GTTATGTTC A AG A A AG A ACTATTTTTTTC A A AG ATG ACG GTA ACTACAAGACCAGAGCTGAAGTCAAGTTTGAAGGTGATACCTTAGTTAAT AG A ATCG A ATTA A A AG GTATTG ΑΤΠΤΑ A AG A AG ATG GTA AC ATTTTAG G

>CPA-U RA_Rev GGTACTAGTGTTTAGTTAATTATAGTTCGTTGACCG >CPA_Fwd4_KOZAK_&_smPCR

CA ACACACCACCCACCCA ACCGGTCA ACG AACTATAATTAACN N N N N N N N N N N N N N ATGTCTA AAG GTG AAG AATTATTCACTG GTGTTGTCCCAATTTT GGTTGAATTAGATGGTGATGTTAAT

Example 5 - Microfluidic ln-vitro Cloning (MIC)

Once synthetic genes are made they are most often sequenced following cloning into bacteria or yeast, which is a major bottleneck for generating novel, error-free genetic material. To break this limitation methods for sequencing synthetic DNA clones without resorting to cellular cloning are needed. To this end, the same DMF cartridge design used for POP and M-CAD was used to clone the POP-generated DNA library using Microfluidic ln-vitro Cloning (MIC) based on single-molecule PCR and programmed it into the device. The DMF program employs a simple serial 2-fold limiting dilution scheme of POP assembly products to single molecules. Diluted droplets containing single molecules are subsequently amplified, eight smPCR reactions at a time. The amplification products were retrieved from the cartridge and Sanger sequenced a barcode region on them that contained 14 consecutive N bases, which enabled us to verify whether amplification indeed originated from single DNA molecules. The sequencing results show that single molecules were indeed amplified (data not shown), while control amplifications with many template molecules showed the expected heterogeneous sequencing pattern at the barcode region (data not shown). However, not all reactions yielded amplification products that originated from single molecules (data not shown). This is expected due to the natural distribution of the number of molecules per volume, even at concentrations that maximize the fraction of droplets with a single DNA molecule. Example 6 - Other Gene Synthesis Protocols

Various gene synthesis protocols can be used with the method of the present invention, according to various embodiments. One example of such a protocol is the Gibson Assembly Protocol, also known as Gibson Assembly Cloning, the drawbacks of which are described above. This protocol provides for the assembly of multiple linear DNA fragments (Nat Methods 2009;6(5):343-5). Regardless of fragment length or end compatibility, multiple overlapping DNA fragments can be joined in a single isothermal reaction which uses three different enzymes. This method relates to a fully ligated double-stranded DNA molecule. The method has only been used for the assembly of polynucleotides as large as plasmids.

This method doesn't require specific restriction sites. Also it can be performed in a single tube and can combine many DNA fragments at once. Therefore, it can easily be incorporated to the exemplary methods described herein in place of POP assembly.

Other methods that can be used in place of POP assembly are described in "Single-step assembly of a gene and entire plasmid from large numbers of

oligodeoxyribonucleotides", Stemmer et al, Gene, Volume 164, Issue 1, 16 October 1995, Pages 49-53; and "Recursive construction of perfect DNA molecules from imperfect oligonucleotides", Linshiz et al, Molecular Systems Biology 4 Article number: 191 doi: 10.1038/msb.2008.26; Published online: 6 May 2008.

References

1. Metzker, M.L. Sequencing technologies - the next generation. Nat Rev Genet 11, 31-46 (2010).

2. Heinemann, M. & Panke, S. Synthetic biology— putting engineering into biology. Bioinformatics 22, 2790-2799 (2006).

3. Khalil, A.S. & Collins, JJ. Synthetic biology: applications come of age. Nat Rev Genet 11, 367-379 (2010).

4. Andrianantoandro, E., Basu, S., Karig, D.K. & Weiss, R. Synthetic biology: new engineering rules for an emerging discipline. Mol Syst Biol 2, 2006.0028 (2006).

5. Purnick, P.E. & Weiss, R. The second wave of synthetic biology: from modules to systems. Nat Rev Mol Cell Biol 10, 410-422 (2009).

6. Quan, J. et al. Parallel on-chip gene synthesis and application to optimization of protein expression. Nat Biotechnol 29, 449-452 (2011).

7. Tian, J., Ma, K. & Saaem, I. Advancing high-throughput gene synthesis technology. Mol Biosyst 5, 714-722 (2009).

8. Zhou, X. et al. Microfluidic PicoArray synthesis of oligodeoxynucleotides and simultaneous assembling of multiple DNA sequences. Nucleic Acids Res 32, 5409- 5417 (2004).

9. Linshiz, G. et al. Recursive construction of perfect DNA molecules from imperfect oligonucleotides. Mol Syst Biol 4, 191 (2008).

10. Kim, H., Jeong, J. & Bang, D. Hierarchical gene synthesis using DNA microchip oligonucleotides. J Biotechnol 151, 319-324 (2011).

11. Kosuri, S. et al. Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips. Nat Biotechnol 28, 1295-1299 (2010).

12. Huang, M.C., Ye, H., Kuan, Y.K., Li, M.H. & Ying, J.Y. Integrated two- step gene synthesis in a microfluidic device. Lab Chip 9, 276-285 (2009).

13. Kong, D.S., Carr, P.A., Chen, L., Zhang, S. & Jacobson, J.M. Parallel gene synthesis in a microfluidic device. Nucleic Acids Res 35, e61 (2007). 14. Ben Yehezkel, T. et al. De novo DNA synthesis using single molecule PCR. Nucleic Acids Res 36, el07 (2008).

15. Matzas, M. et al. High-fidelity gene synthesis by retrieval of sequence- verified DNA identified using high-throughput pyrosequencing. Nat Biotechnol 28, 1291- 1294 (2010).

16. Pollack, M.G., Shenderov, A.D. & Fair, R.B. Electrowetting-based actuation of droplets for integrated microfluidics. Lab Chip 2, 96-101 (2002).

17. Fair, R.B., Vol. 3:245-281 (Microfluid Nanofluid, 2007).

18. Delattre, C. et al. Macro to microfluidics system for biological

environmental monitoring. Biosens Bioelectron 36, 230-235 (2012).

19. Fouillet, Y. et al. Digital microfluidic design and optimization of classic and new fluidic functions for lab on a chip systems. Microfluidics and Nanofluidics 4, 159-165 (2013).

20. Nelson, W.C. & Kim, C.-J.C. Droplet Actuation by Electrowetting-on- Dielectric (EWOD): A Review. (2012).

21. Sista, R.S. et al. Digital microfluidic platform for multiplexing enzyme assays: implications for lysosomal storage disease screening in newborns. Clin Chem 57, 1444-1451 (2011).

22. Ye, H., Huang, M.C., Li, M.H. & Ying, J.Y. Experimental analysis of gene assembly with TopDown one-step real-time gene synthesis. Nucleic Acids Res 37, e51 (2009).

23. Gao, X., Yo, P., Keith, A., Ragan, TJ. & Harris, T.K. Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences. Nucleic Acids Res 31, el43 (2003).

24. Shabi, U. et al. Processing DNA molecules as text. Syst Synth Biol 4, 227-

236 (2010). It will be appreciated that various features of the invention which are, for clarity, described in the contexts of separate embodiments may also be provided in combination in a single embodiment. Conversely, various features of the invention which are, for brevity, described in the context of a single embodiment may also be provided separately or in any suitable sub-combination. It will also be appreciated by persons skilled in the art that the present invention is not limited by what has been particularly shown and described hereinabove.

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to additionally embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.