Gene Therapeutic Agent of Cancer Comprising Recombinant Adeno- associated Virus Containing Antisense cDNAs of VEGF-A, VEGF-B and VEGF-C and Recombinant Adeno-associated Virus Containing VEGFR Truncated Soluble cDNA

TECHNICAL FIELD

The present invention relates to a gene therapeutic agent for cancer, comprising a recombinant adeno-associated virus (rAAV) vector containing the antisense cDNAs of VEGF-A, VEGF-B and VEGF-C and a rAAV vector containing the truncated soluble cDNA of VEGFR.

BACKGROUND ART

Mortality caused by cancer is increasing annually worldwide. Cancer is one of the leading causes of death in the world together with infectious diseases and cardiovascular diseases. According to the World Health Report of WHO, 7,121 ,000 persons accounting for 12.5% of the total number of deaths in 2004 died of cancer, and it is expected that, due to changes in eating habits and environment and an increase in life span, the population with the incidence of cancer will increase to about 30,000,000 persons every year within 25 years into the future, a population of 20,000,000 persons of which will be died of cancer.

Currently, methods used for the treatment of cancer can be broadly divided into surgical operation, radiotherapy and drug therapy, which are used alone or in combination of two or more thereof for the treatment of cancer. Generally,

the surgical operation can be applied in various cancer stages. Cancer in an early stage can be treated by the surgical operation, but in the case where cancer was significantly progressed or metastasized, the surgical operation is used in combination with radiotherapy or drug therapy because it is difficult to achieve the treatment of the cancer only by the surgical operation. The radiotherapy is a method of treating cancer by external radiation or by irradiating cancer cells with X-rays or γ-rays from radioactive substances administered in vivo. The drug therapy is a method of administering an anticancer agent orally or by injection to destroy or suppress the DNA or related enzymes, required for the proliferation of cancer cells. In comparison with other methods, the advantages of the drug therapy are that it allows a drug to be delivered to cancer occurred in any site of the body and can treat metastasized cancer. Currently, the drug therapy is used as a standard therapy for the treatment of metastatic cancer. Although it is, of course, impossible to completely cure metastasized cancer by the drug therapy, the drug therapy plays an important role in increasing life span by alleviating symptoms. However, chemical therapeutic agents used in this chemical therapy have problems, such as side effects and anticancer drug resistance.

However, by virtue of the remarkable development of the bioscience field, biotherapeutic agents are rapidly being developed. The biotherapeutic agents are used for the basic purpose of restoring or increasing the natural immune function of the body to weaken the activity of cancer cells, thus preventing the progression of cancer. If the immune system of the body exhibits its own function, the death of cancer cells can be effectively induced, but if not, cancer cells will be easily proliferated or our body gets easily attacked by other germs. To reduce this disadvantage, the biotherapeutic agents are sometimes used in combination with other therapies, such as surgical therapy, radiotherapy and chemotherapy.

Currently, biotherapeutic agents receiving attention in the bioscience field may include antisense anticancer agents and angiogenesis inhibitors. The antisense anticancer agents are strategies of using DNA fragments capable of complementally binding to cancer cell-specific mRNAs, to inhibit the processing of mRNAs or the expression of proteins, thus inducing the death of cancer cells. As a result of the human genome project, about 30,000 gene sequences were interpreted and about 100,000 mRNA sequences could be identified. With this, as a large amount of information for cancer cell- associated mRNA candidates is secured, genes associated with signaling pathways and genes associated with apoptosis and cell proliferation are screened and now in clinical trials.

The growth of tumors is possible only by angionesis supplying oxygen and nutrients required therefor. Generally, as cancer cells proliferate, the inside of tumors becomes a low-oxygen state, and tissue necrosis will occur. Also, blood vessels will be broken by the pressure of tumors themselves to make the low-oxygen state more severe. To overcome this low-oxygen state, tumors express angiogenesis-associated factors (e.g., VEGF, bFGF, IL-8, PDGF, PD- EGF, etc.), thus stimulate angiogenesis. Namely, angiogenesis is a necessary process for the growth of tumors.

Angiogenesis inhibitors are used to interfere with angiogenesis caused by tumors so as to suppress the growth of tumors, thus treat cancer. Direct angiogenesis inhibitors interfere with angiogenesis by inhibiting the proliferation or migration of vascular endothelial cells or by inhibiting reactions to angiogenesis factors. The direct angiogenesis inhibitors have an advantage in that they cause less acquired drug resistance. Indirect angiogenesis inhibitors suppress angiogenesis by inhibiting the expression of proteins in tumors activating angiogenesois or by blocking the binding between tumor proteins and vascular endothelial cell surface receptors.

As described above, it can be seen that the therapeutic substances in this field changes from the use of artificial chemical substances to the use of natural in vivo substances. Particularly, as genome research projects in various fields are conducted, genes acting as the cause of various diseases are found. In order to apply such research results to clinical treatment or prevention, studies on the gene transfer technology of introducing genes for correcting genes with lost or modified function into the body to normalize function or activate therapeutic function, i.e., studies on the gene therapy field, are actively being conducted. As interests and studies are concentrated in the gene therapy field for recent several years, the results therefrom are rapidly increasing.

The gene therapy, which is a method of treating diseases by gene transfer and expression, is used to correct the genetic defect of a certain disordered gene, unlike the drug therapy. The ultimate purpose of the gene therapy is to obtain useful therapeutic effects by genetically modifying a living gene. The gene therapy has various advantages, such as the accurate transfer of a genetic factor into a disease site, the complete decomposition of the genetic factor in vivo, the absence of toxicity and immune antigenicity, and the long-term stable expression of the genetic factor and thus is spotlighted as the best therapy for the treatment of diseases.

The main research field for gene therapy can be summarized as the field of introducing a gene showing a therapeutic effect on a certain disease, or increasing the resistant function of a normal cell so as to show resistance to an anticancer agent and the like, or substituting for a modified or deleted gene in patients with various genetic diseases.

The gene therapies are broadly classified into two categories, i.e., in vivo and in vitro therapies. The in vivo gene therapy comprises introducing a

therapeutic gene directly into the body, and the in vitro gene therapy comprises culturing a target cell in vitro, introducing a gene into the cell, and then, introducing the genetically modified cell into the body. Currently, in the research field for gene therapy, the in vitro therapy is more frequently used than the in vivo therapy.

The gene transfer technologies are broadly divided into a viral vector-based transfer method using virus as a carrier, a non-viral delivery method using synthetic phospholipid or synthetic cationic polymer, and a physical method, such as electroporation of introducing a gene by applying temporary electrical stimulation to a cell membrane.

Among the gene transfer technologies, the viral vector-based transfer method is considered to be preferable for the gene therapy because the transfer of a genetic factor can be efficiently made with a vector with the loss of a portion or whole of replicative ability, which has a gene substituted a therapeutic gene. Examples of virus used as the virus carrier or vector include RNA virus vectors (retrovirus vectors, lentivirus vector, etc.), and DNA virus vectors (adenovirus vectors, adeno-associated virus vectors, etc.). In addition, its examples include herpes simplex viral vectors, alpha viral vectors, etc. Among them, retrovirus and adenovirus vectors are particularly actively studied.

The characteristics of retrovirus acting to integrate into the genome of host cells are that it is harmless to the human body, but can inhibit the function of normal cells upon integration. Also, it infects various cells, proliferates fast, can receive about 1-7 kb of foreign genes, and is capable of producing replication-deficient virus. However, it has disadvantages in that it is hard to infect cells after mitosis, it is difficult to transfer a gene in vivo, and the somatic cell tissue is needed to proliferate always in vitro. In addition, since

it can be integrated into a proto-oncogene, it has the risk of mutation and can cause cell necrosis.

Meanwhile, adenovirus has various advantages for use as a cloning vector; it has moderate size, can be replicated within a cell nucleus, and is clinically nontoxic. Also, it is stable even when inserted with a foreign gene, and does not cause the rearrangement or loss of genes, can transform eucaryotes, and is stably expressed at a high level even when it is integrated into the chromosome of host cells. Good host cells for adenovirus are cells of causing human hematosis, lymphoma and myeloma. However, these cells are difficult to proliferate because they are linear DNAs. Also, it is not easy infected virus to be recovered, and they have low virus infection rate. Also, the expression of a transferred gene is the highest after 1-2 weeks, and in some cells, the expression is kept only for about 3-4 weeks. In addition, these have the problem of high immune antigenicity.

Adeno-associated virus (AAV) can overcome the above-described problems and at the same time, has many advantages for use as a gene therapeutic agent and thus is recently considered to be preferable. AAV, which is single-strand provirus, requires an assistant virus for replication, and the AAV genome is 4,680 bp in size and can be inserted into any site of chromosome 19 of infected cells. A trans-gene is inserted into plasmid DNA linked with 145 bp of each of two inverted terminal repeat sequence (ITR) and a signal sequence. This gene is transfected with another plasmid DNA expressing AAV rep and cap genes, and adenovirus is added as an assistant virus. AAV has advantages in that the range of its host cells to be transferred with a gene is wide, immune side effects due to repeated administration are little, and the gene expression time is long. Furthermore, it is stable even when the AAV genome is integrated into the chromosome of a host cell, and it does not cause the modification or rearrangement of gene expression in host cells.

Since an AAV vector containing a CFTR gene was approved by NIH for the treatment of cystic fibrosis in 1994, it has been used for the clinical treatment of various diseases. An AAV vector containing a factor IX gene, which is a blood coagulation factor, is used for the treatment of hemophilia B, and the development of a therapeutic agent for hemophilia A with the AAV vector is currently being conducted. Also, AAV vectors containing various kinds of anticancer genes were certified for use as tumor vaccines.

Gene therapies using VEGF can be exemplified by a recombinant deficient adenovirus containing a nucleic acid encoding an angiogenesis factor for the treatment of pulmonary hypertension (Korean patent application No. 10-2001- 7013633). However, because this therapy approach uses a VEGF sense base sequence, it can be used only for the treatment of ischemic diseases, and is unsuitable for the treatment of diseases caused by angiogenesis, particularly cancer. Furthermore, adenovirus is unsuitable to use for treatment, because it has the disadvantages of high immune antigenicity, low infectivity of host cells, and short gene expression time.

Studies on polypeptides for the treatment of cancer have been made in the prior art, but most of these substances belong to chemical therapeutic agents. Also, studies on polynucleotides have been continually made, but the results thereof are insufficient in connection with a method of effectively transferring the polynucleotides in vivo by virus vectors, and the like.

Meanwhile, the present inventors have found that a rAA V-ASh VEGF-A vector containing the anti-sense cDNA of VEGF-A (Korean patent application No. 10-2004-54043), and a rAA V- AShVEGF- ABC vector containing the anti- sense cDNAs of VEGF-A, VEGF-B and VEGF-C (PCT/KR2005/002435), are effective as gene therapeutic agents for cancer. In addition, the present

inventors filed a patent application relating to a gene therapeutic agent of cancer, comprising a rAA V-AShVEGF-A vector containing the anti-sense cDNA of VEGF-A, a rAA V-TSh VEGFR-I vector containing the truncated soluble cDNA of VEGFR-I, and a rAAV-TShVEGFR-2 containing the truncated soluble cDNA of VEGFR-2 (Korean patent application No. 10-2005- 67661).

The present inventors have made extensive efforts to develop a more effective therapeutic agent for cancer and as a result, found that a gene therapeutic agent comprising a rAA V- AShVEGF- ABC vector containing the antisense cDNAs of VEGF-A, VEGF-B and VEGF-C, a rAA V-TShVEGFR-I vector containing the truncated soluble cDNA of VEGFR-I, and a rAA V- TShVEGFR-2 vector containing the truncated soluble cDNA of VEGFR-2, shows excellent tumor inhibitory effects in vivo, thereby completing the present invention.

DISCLOSURE OF THE INVENTION

Accordingly, it is an object of the present invention to provide a gene therapeutic agent for cancer, comprising a rAAV vector containing the antisense cDNAs of VEGF-A, VEGF-B and VEGF-C, a rAAV vector containing the truncated soluble cDNA of VEGFR-I, and a rAAV vector containing the truncated soluble cDNA of VEGFR-2.

To achieve the above object, the present invention provides a gene therapeutic agent for cancer, comprising: (a) a rAAV vector containing the antisense cDNAs of VEGF-A, VEGF-B and VEGF-C; (b) a rAAV vector containing the truncated soluble cDNA of VEGFR-I; and (c) a rAAV vector containing the truncated soluble cDNA of VEGFR-2.

In the present invention, the antisense cDNAs of VEGF-A, VEGF-B and VEGF-C preferably have base sequences of SEQ ID NO: 1 , SEQ ID NO: 4 and SEQ ID NO: 7, respectively. The truncated soluble cDNA of VEGFR-I and the truncated soluble cDNA of VEGFR-2 preferably have base sequences of SEQ ID NO: 12 and SEQ ID NO: 15, respectively.

The above and other features and embodiments of the present invention will be more fully apparent from the following detailed description and appended claims.

BRIEF DESCRIPTION OF DRAWINGS

FIG. 1 is a gene map of pAA V- AShVEGF-ABC according to the present invention.

FIG. 2 is a gene map of pAA V-TShVEGFR-I according to the present invention.

FIG. 3 is a gene map of pAAV-TShVEGFR-2 according to the present invention.

FIG. 4A is a graphic diagram showing the results of wound-healing cell migration assay by rAAV-TShVEGFR-1 and rAAV-TSh VEGFR-2 vectors.

FIG. 4B is a microscopic photograph showing the effects of rAAV- TSh VEGFR-I and rAAV-TShVEGFR-2 vectors on wound healing cell migration.

FIG. 5 is a graphic diagram showing the change in tumor volume in nude mice intra-abdominally injected with the inventive rAAV vector.

DETAILED DESCRIPTION OF THE INVENTION,

AND PREFERRED EMBODIMENTS THEREOF

Hereinafter, the present invention will be described in more detail by examples. It is to be understood, however, that these examples are given for illustrative purpose only and are not construed to limit the scope of the present invention.

Example 1; Cloning of pAAV plasmid containing gene with angiogenesis inhibitory function

To construct a rAAV vector containing the antisense cDNAs of VEGF-A, VEGF-B and VEGF-C, pAA V-AShVEGF-ABC-IRES-EGFP, which is a pAAV vector containing the antisense cDNAs, was first constructed. To construct the pAA V-AShVEGF-ABC-IRES-EGFP, pAA V-AShVEGF-B- IRES-EGFP was first constructed, to which the cDNAs of AShVEGF-A and AShVEGF-C were bound.

The truncated soluble cDNAs of VEGFR-I (FlM; NCBI accession # NM002019 for human) and VEGFR-2 (Kdr/Flk-1 ; NCBI accession # AF063658 for human), which are receptors acting with three isoforms of VEGF, were inserted or replaced in the same manner as described above, thus making trans-gene constructs of pAA V-TSh VEGFR-I and pAAV- TShVEGFR-2.

The trans-genes were inserted into pAAV plasmid DNA linked with 145 bp of each of two inverted terminal repeat (ITR) sequences, a CMV (human

cytomegalovirus) immediate early promoter and an SV40 early mRNA polyadenylation signal sequence.

(1) Construction of pAAV- AShVEGF- A cDNA was synthesized by the extraction of RNA from HUVEC (Cambrex Bio Science Walkersville, Inc., USA) cells, and human VEGF-A isoform antisense cDNA (SEQ ID NO: 1) was amplified by RT-PCR using the following AShVEGF-A primer. The amplified fragment was treated with restriction enzymes Kpήl and Xhol and ligated with a pAA V-FIX cis plasmid DNA (US 6,093,292) cut with the same restriction enzymes, thus constructing pAAV- AShVEGF-A.

AShVEGF-A F2 (SEQ ID NO: 2):

GGGGTA CCGTCTTGCTCTATCTTTC Kpnl

AShVEGF-A Rl (SEQ ID NO: 3):

CCCTCGA GGGCCTCCGAAACCATGAACT Xhol

(2) Construction of pAA V-ASh VEGF-B cDNA was synthesized by the extraction of RNA from HUVEC (Cambrex Bio Science Walkersville, Inc., USA) cells, and human VEGF-B isoform antisense cDNA (SEQ ID NO: 4) was amplified by RT-PCR using the following AShVEGF-B primer. The amplified fragment was treated with restriction enzymes EcoRV and Xhol, and ligated with pAA V-FIX cis plasmid DNA cut with the same enzymes, thus constructing p A AV- AShVEGF-B.

AShVEGF-B F2 (SEQ ID NO: 5):

KGA TA rCC AGAGTCCC AGCCCGGAAC AGA EcoRV

AShVEGF-B R2 (SEQ ID NO: 6):

CCCTCGA GATGAGCCCTCTGCTCCG

Xhol

(3) Construction of pAA V-AShVEGF-C cDNA was synthesized by the extraction of RNA from HUVEC cells, and human VEGF-C isoform antisense cDNA (SEQ ID NO: 7) ws amplified by RT-PCR using the following AShVEGF-C primer. The amplified fragment was treated with restriction enzymes Kpnl and Xhol, and ligated with pAAV- FIX cis plasmid DNA cut with the same enzymes, thus constructing pAAV- AShVEGF-C.

AShVEGF-C Fl (SEQ ID NO: 8):

GGGGTA CCACATCTGTAGACGGACACACA Kpnl

AShVEGF-C R3 (SEQ ID NO: 9):

CCCTCGA GCTCGACCTCTCGGACGC Xhol

(4) Construction of pAA V- AShVEGF-B-IRES-EGFP pIRES2-EGFP plasmid DNA (Clontech, Cat#6029-l , USA) was treated with restriction enzymes Xhol and Noil and a klenow fragment so as to prepare an IRES-EGFP cDNA insert. The pAA V-AShVEGF-B plasmid DNA constructed in the part (2) was treated with restriction enzymes Xhol and BamEI and a klenow fragment so as to prepare a linearized vector. The insert DNA and the linearized vector were mixed with each other, and subcloned by the addition of T4 DNA ligase, thus constructing pAAV- AShVEGF-B-IRES-EGFP.

(5) Preparation of pAAV-AShVEGF- AB-IRES-EGFP construct

The p AA V- AShVEGF- A plasmid DNA constructed in the part (1) was treated with restriction enzymes Kpnl and Xhol and a klenow fragment so as to prepare an AShVEGF-A cDNA insert. The pAAV-AShVEGF-B-IRES-EGFP plasmid DNA constructed in the part (4) was treated with restriction enzyme EcoRV so as to prepare a linearized vector. The insert DNA and the linearized vector were mixed with each other and subcloned by the addition of T4 DNA ligase, thus constructing pA A V- AShVEGF- AB-IRES-EGFP.

To examine the orientation of the insert DNA of the constructed pAAV- AShVEGF-AB-IRES-EGFP, PCR was performed using the following AShVEGF-A F2 primer (SEQ ID NO: 10) designed with the cDNA sequence of the antisense A and the following AShVEGF-B R2 primer (SEQ ID NO: 11) designed with the cDNA of the antisense B.

AShVEGF-A F2 (SEQ ID NO: 10): GGGGT ACCGTCTTGCTCT ATCTTTC AShVEGF-B R2 (SEQ ID NO: 11): CCCTCGAGATGAGCCCTCTGCTCCG

(6) Construction of pAAV-AShVEGF-ABC-IRES-EGFP

The pAAV-AShVEGF-C plasmid DNA constructed in the part (3) was treated with restriction enzymes Kpnl and BamHl and a klenow fragment so as to prepare AShVEGF-C cDNA insert DNA. The pAA V-AShVEGF-AB-IRES-

EGFP plasmid DNA constructed in the part (5) was treated with restriction enzyme Xhol and a klenow fragment so as to prepare a linearized vector. The insert DNA and the linearized vector were mixed with each other and subcloned by the addition of T4 DNA ligase, thus constructing pAAV-

AShVEGF-ABC-IRES-EGFP.

(7) Construction of pAA V-AShVEGF- ABC

The pAAV-AShVEGF-ABC-IRES-EGFP constructed in the part (6) was treated with restriction enzymes Xbal and Xhol so as to prepare an AShVEGF-

ABC fragment. This fragment was mixed and ligated with a pAAV-FIX cis plasmid treated with the same restriction enzymes Xbal and Xhoϊ, thus constructing pAAV-AShVEGF-ABC (FIG. 1).

(8) Construction of pAA V-TShVEGFR-I cDNA was synthesized by the extraction of RNA from cancer cell line LCSC#1 (WO 02/061069), and truncated soluble human VEGFR-I receptor cDNA (SEQ ID NO: 12) was amplified by RT-PCR with the following TShVEGFR-I Fl and TShVEGFR-I R3 primers. The amplified fragment was treated with restriction enzymes Kpnl and Xhol, and ligated with pAAV- FIX cis plasmid DNA cut with the same restriction enzymes, thus constructing pAAV-TShVEGFR-1 (FIG. 2).

TShVEGFR-I Fl (SEQ ID NO: 13): AAGGTA CCGCCA CCATGGTC AGCT ACTGGGAC A

Kpnl Kozak TShVEGFR-I R3 (SEQ ID NO: 14):

CGCTCGiGCXiTCTGATTGTAATTTCTTTCTTCTG Xhol stop codon

(9) Construction of pAAV-TShVEGFR-2 cDNA was synthesized from the extraction of RNA from cancer cell line LCSC#1, and truncated soluble human VEGFR-2 receptor cDNA (SEQ ID NO: 15) was amplified by RT-PCR using the following TShVEGFR-2 Fl and TShVEGFR-2 R2 primers. The amplified fragment was treated with restriction enzymes Kpnl and Xhol, and ligated with pAA V-FIX cis plasmid DNA cut with the same restriction enzymes, thus constructing pAAV- TSh VEGFR-2 (FIG. 3).

TShVEGFR-2 Fl (SEQ ID NO: 16):

GGGGTA CCGCCA CCATGGAGAGC AAGGTGCT Kpnl Kozak

TShVEGFR-2 R2 (SEQ ID NO: 17):

CGCTC£4(77TAGCCTGTCTTCAGTTCCCCTCCATT Xhol stop codon

Example 2: Construction of rAAV vector for use as gene therapeutic agent for inhibition of angiogenesis

To construct a recombinant AAV-AShVEGF-ABC (rAAV-ASh VEGF-ABC) vector for use in gene therapy, AAV rep-cap plasmid DNA (pAAV-RC plasmid; Stratagene Co., USA) expressing AAV rep and cap genes and an adenovirus helper plasmid (pHelper plasmid; Stratagene Co., USA) are required in addition to the pAAV-AShVEGF-ABC constructed in Example 1. These three plasmid DNAs (pAA V-AShVEGF-ABC, pAAV-RC and pHelper) were all transfected into HEK293 (human embryonic kidney 293; ATCC CRL- 1573) cells, and cultured for 96 hours. The cultured HEK293 cells were collected and disrupted by sonication, and the recombinant AAV (rAAV) particles were subjected to CsCl density gradient centrifugation three times, so as to collect a pure fraction with a RI (Refractive Index) of 1.37-1.41 g/ml, thus obtaining a rAAV- ASh VEGF-ABC vector. A rAA V-TSh VEGFR-I vector was obtained in the same manner as described above except that pAAV-TShVEGFR-1 in place of pAA V-AShVEGF- ABC was used. A rAAV-TShVEGFR-2 vector was obtained in the same manner as described above except that pAAV-TShVEGFR-2 in place of pAA V-AShVEGF-ABC was used.

The titration of the obtained rAA V- AShVEGF-ABC, rAAV-TSh VEGFR-I and

rAAV-TShVEGFR-2 particles was performed by quantitative PCR with the following PCR primers constructed for a CMV promoter region:

CMV Fl (SEQ ID NO: 18): 5'-GGG CGT GGA TAG CGG TTT GAC TC-3' CMV Rl (SEQ ID NO: 19): 5'-CGG GGC GGG GTT ATT ACG ACA TT-3'

At this time, each of pAAV plasmid DNAs with known concentrations was used as a standard substance, and it was found that the recombinant rAAV produced and isolated as described above generally had a rAAV particle titer of 10 ¹² ~10 ¹³ viral particles/ml.

Example 3: Wound healing migration assay of r AA V-TSh VEGFR-I and rAAV-TShVEGFR-2 vectors

HUVEC cells cultured in a complete medium (EGM-2 BulletKit, Cat# CC- 3162, Cambrex Bio Science Walkersville, Inc., USA) were treated with each of rAAV-TShVEGFR-1, rAAV-TShVEGFR-2, and both of rAAV- TShVEGFR-I and rAAV-TShVEGFR-2 to an M.O.I of 2 x 10 ⁵ for 24 hours. After 48 hours, a plate where the cells have been grown was wounded with a cell scraper. The wounded plate was washed two times with a collection medium [EBM-2 (Cat# CC-3156, Cambrex Bio Science Walkersville, Inc., USA) + 1% FBS] to remove detached cells. The plate was treated with 10 ng/ml of a VEGF protein (Calbiochem, Cat. #676472), and 24 hours later, migrated cells were photographed and analyzed.

As a result, as shown in Table 1 , FIG. 4A and FIG. 4B, the number of the migrated cells was remarkably lower in the case of treatment with each or both of rAA V-TShVEGFR-I and rAAV-TShVEGFR-2 than a control group and a group treated with the VEGF protein alone.

This suggests that treatment with rAA V-TShVEGFR-I and/or rAA V- TShVEGFR-2 inhibits the function of VEGF, thus inhibiting wound-healing cell migration. From this result, it could be seen that the inventive rAAV- TShVEGFR-I and/or rAAV-TShVEGFR-2 inhibited VEGF from causing angiogenesis by the migration of vascular endothelial cells, so as to prevent the proliferation of tumors, thus showing anticancer effects.

Table 1 : Inhibiting effect of wound-healing cell migration by treatment of rAAV vector according to this invention

Example 4; Anticancer effect of rAAV vector (Xenograft assay)

In this Example, the anticancer effect of the case administered with all of rAA V-TShVEGFR-I and rAAV-TShVEGFR-2 with anticancer effects proven in the wound healing migration assay of Example 3, and rAA V- AShVEGF- ABC with anticancer effects proven in PCT patent application No. PCT/KR2005/002435 filed under the name of the present inventors, was examined in vivo.

(1) Test animals and environmental conditions

4- week-old male BABL/c nu/nu mice weighing 16 ± 0.2 g (Japan SLC, Inc.) were introduced with human lung cancer cell line NCI-H460 (ATCC HTB- 177) to prepare solid cancer- induced models. Then, the solid cancer-induced models were used to examine the effect of the inventive gene therapeutic agent

(rAAV- AShVEGF-ABC + rAA V-TSh VEGFR- 1 + rAAV-TShVEGFR-2).

The nude mice used in this Example were subjected to veterinary inspection for general health conditions upon reception, and acclimated for 1 week to select healthy individuals suitable to conduct the test. The test was carried out in an animal experiment laboratory maintained at a temperature of 23+2 ⁰ C, a relative humidity of 55+5%, 10-12 ventilations/hr, 12 hours of light time (07:00-19:00), and an illumination intensity of 150-300 Lux. The animals were allowed to freely take sterile solid feed for animal experiment (Samtako Bio Korea, Inc.) and purified sterile water as drinking water.

The drinking water before use in the test was analyzed by Chung Buk Institute of Health & Environment Research, (140-50, Songjung-dong, Chungju-shi, Chungchongbuk-do, Korea), and as a result, mercury, cadmium, arsenic and the like, which influence the test, were not detected, and general bacteria, E. coli, fecal coliforms and total coliforms, were not detected.

(2) Experimental conditions

The carcinogenesis of BAB L/c nu/nu mice used in the experiment was carried out in the following manner. The NCI-H460 cell line was subcultured at least three times in a RPMI- 1640 medium containing 10% FBS and antibiotics, and then, 5xlO ⁸ cells/ml of the NCI-H460 cells were injected into the subcutis below the shoulder of the nude mice in an amount of 0.2 ml using a syringe needle (26 gauge). After 20 days, the formed tumors were enucleated, and the solid tumor tissue at the edge was transplanted into new individuals. After 14~16 days, a tumor section (3 x 3 x 3 mm) cut from the tumor tissue was transplanted into mice to be finally used in the experiment, by trocha in the same manner as in the second implantation. Among the mice, individuals with a tumor volume of 200-300 mm ³ were selected and grouped, and the test substance was injected into the tail vein of the selected animals.

In this Example, the rAA V- AShVEGF-ABC, rA A V-T ShVEGFR-I and rAAV- TShVEGFR-2 constructed in Example 2 were administered to the mice by tail vein injection. Specifically, each of the rAA V-AShVEGF-ABC, rAAV- TShVEGFR-I and rAAV-TShVEGFR-2 vectors according to the present invention was administered to 6-week-old male mice in an amount of 0.3 ml (1.5xlO ^π virus particles/mouse) by tail vein injection. The amount of each of the administered rAA V-AShVEGF- ABC, rAA V-TSh VEGFR-I and rAAV- TShVEGFR-2 vectors was 0.5x10 ¹¹ virus particles/mouse, respectively. Meanwhile, HEPES buffer used as a control group was also administered by tail vein injection, and rAA V- ASh VEGF- A and r AAV- AShVEGF- ABC vectors with anticancer effects verified by the present inventors were also administered in the same manner as described above (Table T).

Table 2: Test group of tail vein injection

10 minutes, 30 minutes, 1 hour, 2 hours, 4 hours and 12 hours after administration with the test substances, the animals were examined for survival and other clinical symptoms, and then, examined for survival and abnormalities two times a day for 4 weeks.

(3) Measurement of bodyweight change and tumor volume

The bodyweight of all the animals was measured just before administration with the test substance and two times a week after the administration, and the volume of tumors was measured with a vernier calipers two times a week for 4

weeks. As a result, the animals showed a low increase in bodyweight, and there was no correlation between cancer therapeutic effect and a change in the bodyweight of the test animals.

Meanwhile, a change in the tumor volume of the animals was measured. As a result, as shown in FIG. 5, it could be seen that the group administered with a combination of r AAV- AShVEGF- ABC + r AAV-TShVEGFR-I + rAAV- TShVEGFR-2, which are a gene therapeutic agent according to the present invention, showed excellent tumor inhibitory effect as compared to the group administered with rAA V- AShVEGF- A and the group administered with rAAV-AShVEGF-ABC.

Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only for a preferred embodiment and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

INDUSTRIAL APPLICABILITY

As described in detail above, the present invention provides a gene therapeutic agent for cancer, comprising a rAAV vector containing the antisense cDNAs of VEGF-A, VEGF-B and VEGF-C, a rAAV vector containing the truncated soluble cDNA of VEGFR-I, and a rAAV vector containing the truncated soluble cDNA of VEGFR-2.

The gene therapeutic agent according to the present invention reduces the growth of tumors by inhibiting the expression and function of VEGF involved in angiogenesis necessary for the proliferation and metastasis of tumors.

Thus, the inventive gene therapeutic agent can be effectively used to treat cancer at a gene level.