0001. This Application claims priority to U.S. provisional application No. 61/585,873 and 61/585,917, fifed January 12, 2012.

Technical Field

0002. The disclosure relates to genes that confer ethanol tolerance to yeasts used to produce ethanol by fermentation, in particular to increased ethanoi tolerance of xylose fermenting strains of H. polymorpha, to ethanoi sensitive mutants of . polymorpha useful to identify ethanoi tolerance genes, to ethanol tolerant recombinants of H, polymorpha, and more particularly to genetic sequences from H. polymorpha and P. stipitis herein designated HpETTl and PsETTl, respectively, that are similar in sequence to the ΜΡΈ1 gene of S. cerevisiae but that confer increased ethanol tolerance in yeasts including H. polymorpha and 5. cerevisiae.

Background

0003. The references cited in this Background section and in the Description that follows are to provide a better understanding of the invention described herein after, as a resource for materia is and methods that may further enable one to practice the methods and/or obtain the compositions later described herein, and as an abbreviation for such methods. Accordingly each reference cited herein is incorporated by reference to the extent the references provide a teaching that aids in the making and using of the invention later claimed, !f there is any conflict in the disclosure provided herein and the cited references, the present disclosure controis over the teaching of the cited reference to the extent they conflict. The citation of a reference anywhere herein is not an admission that such a reference is pertinent to, or prior art to the invention claimed hereafter. 0004, Honsen ^' ula polymorpha is a yeast species of both industrial and scientific importance. This non- conventional thermoto!erant methylotrophic yeast is one of the best yeast systems for the production of heterologous proteins {Ge!lissen, 2000; GeiSfSsen, (ed.). 2002; Suckow and Gellissen, 2002), it serves as a model to study peroxisome function { Van der Klei and Veenhuis, 2002), methanol metabolism, nitrate assimilation (Siverio, 2002) and stress responses (Ubiyvovk et ø/., 2006). H. pofymorpha also has potential to be useful in biofuel production fay fermentation of lignocellu!osic carbon sources because it is able to ferment xylose (Ryabova et af.,2003), and is one of the most thermotolerant of yeast species {Guerra et ah, 2005), However H. polymorpha's utility as an organism to produce ethanol by fermentation may be iimited because its growth is rather sensitive to ethanol in comparison to other yeasts, such as S, cerevisiae.

Summary

0005. The present inventors recognized that to be useful for commercial applications in biofuel production by fermentation, it would be desirable if the tolerance of H, pofymorpha to ethanol could be improved. The discoveries described herein srose from research that focused on identification of target gene(s) for constructing ethanol tolerant strains of . polymorpha. The inventors created a library collection of insertional mutants of H. polymorpha. From the collection of insertional mutants one transfromant {herein designated 7E) was selected that was shown to be highly sensitive to ethanol. From sequencing the insertional cassette in this mutant it was discovered that the insertion disrupted an open reading frame of a gene herein designated HpETTl {SEQ. ID NO: 1) encoding an unknown protein (SEQ. ID NO: 2) correspondingly designated Ettl. By comparing the amino acid sequence of Ettl to yeast databases, it was discovered that Ettl shares about 39% sequence identity with a protein of Saccharomyces cerevisiae (SEQ. ID NO; 5) encoded by the MPE1 gene (SEQ. ID NO; 6), This gene was reported to be an essential yeast gene that encodes a protein that is necessary for in vitro RNA 3'-end processing and is a subunit of the so-called CPF complex {Vo et at, 2001). The MPEl gene is. apparently essentia! for S. cerevisiae because a S, cerevisiae MPEl deletion mutant is not viable.

0006. !n contrast, the H. polymorpho mutant 7E identified by the inventors remains viable despite having a disruption in a gene that has close ORF similarity to the 5. cerevisiae MPEl gene. Despite its viability on ordinary growth media, as noted above, the 7E mutant is hypersensitive to ethanol. As further demonstrated herein, expression of the undisrupted HpETTl gene in the 7E mutant successfully complemented the mutant's hypersensitivity to ethanol.

0007. Searchin yeast databases revealed another homologous gene, herein designated PsETTl, present in the genome of another xylose fe menting yeast Pichia stipitiS. The product of PsETTl, PsEttl, has about 37% amino acid identity to HpEttl The inventors isolated and expressed the PsETTl gene in the H. polymorpha 7E mutant and demonstrated that like HpETTl _l expression of the the P, stipitis gene at least partially complemented the H. polymorpha ettl mutant's hypersensitivity to ethanol

0008. Still further, it is shown that overexpression of the native HpETTl gene in H. polymorpha using a multi-copy integrant constructed such as described herein resulted in a transformed strain of H, polymorpha having about a 10-foid increase in tolerance to ethanol relative to the parent strain. More surprisingly still, it is shown that expression of the H. polymorpha HpETTl gene in S, cerevisiae also conferred a detectable increase in ethanol tolerance in that yeast.

0009. Accordingly, the present teaching present several usefui new aspects. One aspect is a mutant strain of H. polymorpho characterized as being ethanol sensitive and having a mutation that disrupts functional expression of the HpETTl gene. Another aspect is a method of identifying a gene that confers ethanol tolerance in a yeast strain that includes transforming the H. polymorpha ettl mutant strain with a vector that expresses a candidate nucleic acid, selecting a transformant that complements the ettl mutant's sensitivity to ethanol, and identifying the sequence of the candidate nucleic acid to identify the gene that confers ethanol tolerance. Another aspect is an isolated nucleic acid encoding an Ettl protein, which is characterized as a nucleic acid that when expressed in the ettl mutant complements the ethanol sensitivity of that mutant. Representative examples of nucleic acids encoding Ettl proteins are the HpETTl gene of SEQ.ID NO: 1 that encodes the HpEttl protein of SEQ.ID UQ:2 and the PsETTl gene of SEQ. ID NO: 3 that encodes the PsEttl protein of SEQ.ID.NO: 4, A related aspect is identification of a new type of protein class designated Ettl and isolated versions of the same. Still another related aspect is a recombinant nucleic acid comprising a sequence that encodes an Ettl protein and a promoter that is operable in a selected yeast strain operabiy configured io express the £771 gene in the selected yeast strain. Examples of such vectors are illustrated in Figure 1 and include p21+ETTlHp and p6L 36I+ETTlHp each configured to express the H. polymorpha Ettl protein and p7Q+ETTlPst that is configured to express a P. stipitis Ettl protein. These vectors have promoters selected to be particularly operable in H. polymorpha. Another example is prPGKlSc+ETTlHp which are configured to express the HpETTl gene in S. cerevisiae.

00010, Another important aspect is yeast strains having enhanced ethanol tolerance that can be produced by overexpressing an Ettl protein in the yeast strain. The yeast strain with increased ethanol tolerance can be a H, polymorpha strain, a 5. cerevisiae strain or a P. stipit strain comprising a recombinant nucleic acid that overexpresses at least one of the Ettl proteins from H. polymorpha or P. stipitiS. Exemplary embodiments of such strains include H. polymorpha strains 7E-GAPDHETTlPst, 7E-GAPDHETTlBp, and 3Leu+pETTl-10 and 5. cerevisiae strain BY4742+ prPGK ISc+ETT 1 Hp.

00011. it should be noted that initially the nomenclature for the vectors, genes, proteins and strains used in the materials and methods section had the root term "ΜΡΕ , followed by a suffix for the organism from which the gene was obtained, i.e., Hp for H. polymorpha, Pst for P, stipitis, and Sc, for 5. terevisiae. This nomenclature was originally used because after searching yeast databases for sequences that were similar to the gene disrupted in the H, polymorpha 7E mutant, it was discovered that the closest known sequence was the S. cerevisiae MPE1 gene, therefore the closest similar sequences from P. stipitis and H. polymorpha were originally given the same name. However, it being now discovered that the 5. cerevisiae MPE1 gene does not complement the ethanoi sensitivity of the H. polymorpha 7E mutant, while the similar sequences from H. polymorpha and P. stipitis, do complement the mutation, it is more appropriate to refer to the H. polymorpha and P. stipitis genes as a new type of ethanol tolerance genes denominated herein with the suffix "ETT " Accordingly, the vectors initially denominated as ρ21+ΜΡΕ1Ηρ and pGlG61+MPElHp or p70+MPElPst were renamed as p22+HpETTl and p6L661+HpETTl and p70+PsETTi. Only the S. cerevisiae gene is referred to strictly as MPE1.

Brief Description of the Drawings

Figures 1,1 and 1.2 show schematic representations of vectors described herein. Figures a and b show H. polymorpha expression vectors, c, d, and e show the constructs for expressing the H. polymorpha HpETTl gene, the S. cerevisiae MPE1 gene, and the P. stipitis PsETTl gene in H, polymorpha. Figure 1.2f shows a vector for multicopy integration of the HpETTl gene in H, polymorpha.

Figure 2 depicts solid media density assays showing ethanol sensitivity for the HpETTl mutant H, polymorpha strain 7E (1} in comparison to non-mutant strains 3Leu ⁺ (2) and parental strain NCYC495ieul-l (3). Panel A illustrates the densities after overnight growth at 37°C of cells initiaiiy plated at the indicated optical densities on YNB media plus 2% sucrose with the indicated percentage of ethanol Pane! B illustrates the densities after overnight growth on YNB media i the presence of 1% ethanol. Figure 3A illustrates a genomic integrant arid probe for identification of plasmid chromosomal integrant, and Figure 3B illustrates a Sothern blot for assaying copy number of integrants 7E, Nl and 2.

Figure 4 shows a sequence comparison between the H, poiymorpha HpEttl protein (Hp), 5. cerevissae Mpel protein (Sc), P. stipttis PsEttl protein (Ps) and the consensus sequences between them.

Figure 5 depicts a solid media density assay showing complementation of the H, poiy orpha IB mutation b expression of the HpETTl and PsETTl genes but not the S. cerevisiae MPE1 gene. The upper panel shows growth on YPD medium alone and the lowe panel shows growth on the same plus 7% ethanol. The strains are: (1) the H. poiymorpha 7E mutant parental strain; (2) the 3 Leu ^" control; (3) the 7£ transform ant designated 7E GAPDH PEiSc transformed with the S, cerevisiae ΜΡΕί gene; (4) the 7E transformant designated 7E-GAPDHETTlPst transformed with the stipites ETT1 gene; and (5) the 7E transformant designated 7£-pETT HP-l transformed with the H. poiymorpha ETTX gene.

Figure 6 depicts a solid media density assay showing enhanced ethanol tolerance in the strain 3Leu+pETTl-10 over-expressing the HpETTl gene. The 3Leu+pETTl-10 strain was obtained by transformation of 3Leu+ strain with the multicopy integration vector pGlG61+ETTlBP, The upper pane! shows growth on YPS media alone and the lower panel shows growth on the same plus 7% ethanol The strains are; (1) the 7E mutant; (2) the 3Leu* control parent strain; and (3) the 3Leu ⁺ pETTi-10 strain, which is the control parent transformed with multiple copies of the H. poiymorpha pETTl gene.

Figure 7 are graphs showing enhanced ethanol tolerance in growth characteristics of strain 3ieu ⁺ pETTl-10 ove rex pressing the ΗρΕΤΤΪ gene in H. poiymorpha {dotted lines) in comparison to the controi strain 3Leu* (solid lines) when grown in YPD medium lacking ethanol (A) and in the same medium containing 6% ethanol (8),

Figure 8 are graphs showing ethanol sensitivity of the 7E mutant (dotted lines) and enhanced ethanol toleranc in growth characteristics of strain 3Leu ⁺ pETTl-10 (dashed lines) overexpressing the HpETTl gene in H. polymorpha in comparison to the control parent strain 3leu* (solid lines) on YP5 medium alone (A) or the same containing 7% ethanoi(B).

Figure 9 shows increased stress tolerance in the 3Leu ⁺ pETTl-lG (3) strain overexpressing the HpETTl gene b growth on solid media with and without ethanol or the stress inducing agent AZC in comparison to the parent control strain 3leu ⁺ (2) and the muta nt strain 7E strain (i).

Figure 10 is a graph depicting temperature sensitivity of the W. polymorpha 7E mutant (dashed line) in comparison with its parental strain Bleu* (solid Sine).

Figure 11 is a graph showing improved growth characteristics of the strain 3Leu'pETTl-10 overexpressing the HpETTl gene (dashed tine) when grown in Y 8 media using 2% xylose as the carbon source at 50°C in comparison to the 7E mutant (dotted line) and the parentai strain Bleu* (solid line),

Figure 12 depicts a solid media density assay showing increased ethanol tolerance in at least two S. cerevisiae strains (4 and 5) expressing the HpETTl gene from H. polymorpha. Strain 1 is the controi strain carrying only the 5. cerevisiae piasrnid vector Yep352 _i and strains 2 -6 were separate isolates of transformants with that vector but carrying the H, polymorpha HpETTl gene under control of a 5. cerevisiae promoter, The upper pane! is the control growth media (YN B plus sucrose, leu, lys and his) the lower panel is the same further containing 6% ethanol.

Figure 13 depicts a solid media density assay showing increased heat shock tolerance of the 3 Leu ^÷ pETTl-10 strain of H. polymorpha overexpressing the HpETTl gene (3) in comparison to the parentaS control 3!eu+ (2) and the strain EISc, which is 3Leu+ transformed with a vector to overexpress the S, cerevisiae MPEl protein, when grown at 37°C or heat shocked at 56 ⁰ C for IS roin prior to plating. figure 14 shows a 12% SDS PAGE result demonstrating isolation of the HpEttl protein (arrow) after overexpression in E, coli using a his-tagged expression vector. Lane assignments: 1, protein ladder; 2, total soluble proteins before column; 3 soluble protein flow through; 4-9 fractions subsequently eluied from column.

Detailed Description

Definitions

00012. Certain common or newly introduced terms that have been used herein are believed to be commonly understood to those of ordinary skilled In the art, or would be commonly understood in view of the present disclosure. Such commonly understood meanings are embraced herein, however, to resolve any questions of clarity that may be asserted by use of certain terms, the following non-limiting definitions are provided to assist in better understanding the present invention.

00013. A sibling strain, is one strain of microorganism that is of the same species as another strain although not necessarily of the same genotype.

00014. A parental strain, is a strain of microorganism that has the same genetic background as a derivative strain of the same microorganism, except for alterations that have been made in the derivative strain.

00015. An efrl mutant strain, is a strain of H, poly orp a, exemplified herein by H, polymorpho 7E, having a mutation that disrupts the expression of the gene identified herein as HpETTl and which shows sensitivity to growth on ethanol in comparison to a sibling or parental H. polymorpha strain lacking the mutation.

00016. An ETT1 gene is a gene from any source that encodes a protein {Ettl protein) that when expressed in an ettl mutant strain, at ieast parttally overcomes the ethanol sensitive growth properties of the mutant strain.

00017. A HpETTj gene is a nucleic acid obtained from a strain of H. polymorpha that encodes an Ettl protein, exemplified herein by SEQ. ID NO 1 for the gene and SEQ, ID NO 2 for the protein {HpEtti protein),

00018. A PsETTl gene is a nucleic acid obtained from a strain of P. stipitis that encodes an Ettl protein, exemplified herein by SEQ. ID NO 3 for the gene and SEQ, ID NO for the protein (PsEttl protein).

00019. Overexpress, means to geneticaliy express a nucleic acid encoding an ORF in a transformed host ce!i to a greater agree than the same nucleic acid is expressed in a non-transformed parent of the host cell under similar growth conditions.

00020. increased ethanol sensitivity or ethanol sensitive growth means that that when ethanol is present in a growth medium, a subject strain grows at a slower rate, to a lower density, or otherwise with decreased vigor in comparison to a sibling strain of the same organism grown on the same media,

00021. Enhanced ethano! tolerance means that when ethanol is present in a growth medium, a subject strain grows at a faster rate, to a greater density, or otherwise with increased vigor in comparison to a sibling strain of the same organism grown on the same media.

Materials and methods used to make exemplary embodiments 00022. Strains and growth conditions. The yeast strains dis osed herein are listed in Table 1, The . poiymorpha NCYC495 leul-1 strain was used as a recipient for insertional mutagenesis and was maintained on minimal medium containing 0.67% YN8 {Difco, Detroit, Ml, USA) supplemented with 2% sucrose and leucine at 40 mg L ^"1 at 37 °C. H. palymorpha 7E was selected as an insertions! mutant of . poiymorpha CYC495 leul-1 strain that is unable to grow on YPS medium {0.5% yeast extract, 1% peptone and 2% sucrose) supplemented with 7% ethanoS.

00023. The . poiymorpha CBS4732s strain (Lahtchev et ai., 2002) was used as a source of the HpETTl gene, The strain was maintained on YPD medium {0.5% yeast extract, 1% peptone and 2% glucose) at 37 °C

00024. The Pichia stipitis strain C8S6054 (Yang et al., 1994) was used as the source of the P. stipitis PsETTl gene, which is an ortho!ogue of HpETT S, cerevisiae strain BY4742 {Brachmann et al., 1998) was used as the source for the 5. cerevisiae MPE1 gene.

00025. The 3Leu+ strain {Ishchuk et al„ 2008) was used as a recipient strain for HpETTl overexpression in H, poiymorpha.

00026. Yeast transformants were se!ected either on YNB medium with 2% sucrose or on YPS medium (0.5% yeast extract, 1% peptone and 2% sucrose) supplemented with geneticin at 1 g I ^'1 or zeocin at 140 mg L ^' \

00027. The Escherichia coli strain DH5a [ 80άΙαεΖΑΜ15, recAl, endAl, gyrA96, thi-l, hsdRl ^' 7 {r _{K /} n ), supE44, retAl, deoR, &{lacZYA-argF) U169] was used in experiments which required a bacteria! host. The bacteria! strain was grown at _. 37° C in the rich (LB) medium as described in Sambrook et ai., 1989. Transformed f. coli cells were maintained on a medium containing 100 mg 1 ¹ of amplcillin.

Table I . Yeast strains used in this study

00028. Construction of plasmids Two integrative plasmid vectors p21 and p70 fFig.la, Fig. lb) were constructed for use as the H, poiymarpha integration and expression cassette. Each piasmid contains the strong polymorphs constitutive promoter for glycera!dehyde 3-phosphate dehydrogenase gene (GAPOH) and the terminator of alcohol oxidase {AOX). The plasmids p21 and p70 are the derivatives of pl9L2 (Voronovsky et ai., 2002) and differ only slightly in the restriction sites available for cloning of the subject gene to be expressed.

00029. Based on the initial discovery that the H. poiymarpha- 7E insertions! mutant contained an interruption of a gene having an open reading frame with about 39 % identity with the 5, cerevisiae MPEl gene we sought to obtain the natural H, poiymarpha homologue of MPEl. The resulting construct was plasmid p2!+ETTlHp (Fig.lc) which is based on the p21 plasmid cassette (Fig.la). The genomic D A isolated from H. poiymarpha CSS4732s strain served as a template to obtain the MPEl homologue herein designated HpETTl, which was obtained by amplification of the genomic DMA containing the open reading frame using the primers IS202 (5'- CGGAATTCCATATGGCTGTCATATACTATAAGTTG3') (SEQ. !O NO: 7} and 15203 {$'· TTTATAATG CGGCCG CTCACTTTTG ATTATTG GTCG-3' 1 (SEQ. ID NO: 8). The PCR fragment was treated with restriction endonucleases Ndel and Notl at the underlined restriction sites and cloned into Wdei/Wofi-lineanzed plasmid p21,

00030. The genes homologous to HpETTl were isolated from S. cerevisiae and A stipitis and subc!oned into the p7Q expression cassete {Fig.lb) resulting in the constructs p70+MPElSc and p70+ETTlPst I Fig. Id, Fig. le). The genomic DMA isolated from S. cerevisiae BY4742 and P. stipitis CBS6054 served as templates to amplify the open reading frames of 5. cerevisiae MPE1 and PsETTl geneS. For S, cerevisiae MPE1 the ORE primer pairs used were: IS249 {5'- CCCAAGCTTATGAGTAGCACGATATTTTAC-3') (SEQ. ID NO: 9) and iS250 (5'- ATCAAG CTTTCATTTCTT AGG G CTTGCGTC-3'ΐ (SEQ, !D NO: 10} for P, stipitis, the ORF primer pair used were: IS212 ( 5 '-CTCAAG CTTATGTGGTCA6TCGTCTACTATAA6-31 {SEQ. ID NO: 11} and 15213 (5'-6ΰΰ £ Τ€ΤΑΑΤΤεΤΤ0Τ 66πΑπΰΑ0-·3 ^/ ) {SEQ. !D NO: 12). The corresponding PCR fragments were treated with endonuclease HindtW at the underlined restriction site and cloned into Hind\l\- linearized plasmid p70,

00031. Another plasmid for expression of the HpETTl gene constructed was pGLGSl+ETTlHp (Fig.lf), which is a derivative of plasmid vector pGLGSi {Sohn et al., 1999). The pGtG61 vector promotes mu!ti-copy-number integration of plasmid tandem repeats into the genome. The H ^, poiymarpha HpETTl gene was amplified from the genomic DNA of H, polymorpha CBS4732s strain using primer pair: fS206 (5'-ACGGAGCTCGGTAGATTAGTAAAGGAAATC-3*) (SEQ. ID NO: 13} and IS207 { 5 '-T ATGAGCTCTAGTG ATC6TTAAAGGTG ACC-3' ) (SEQ. ID NO: 14}. The PCR fragment was treated with restriction endonuclease Sot! at the underlined restriction site and ligated with 4.97 kb Sac\~ fragment of pGLGSl, 00032. Molecular, biology techniques Plasmid DMA isolations from E. coli were carried out by using NudeoSpin Piasmid GtuickPure ( acherey-NageL Germany). Taq DNA polymerase and Vent _R ^* OH A polymerase {both New England Biolabs, USA) were used for analytical and preparative PC , respectively. T4 DNA !igase, T4 DNA polymerase and restriction enzymes were purchased from Fermentas, Lithuania.

00033. Preparations of total DNA from yeast species were carried out by using DNeasy ^* Tissue Kit (Qjagen, Germany).

00034. Transformation of H. polymorpha was performed by electroporation as described previously (Faber et _. al., 1994).

00035. Southern blotting analysis was performed using the Amersham ECL Direct Nucleic Acid Labelling and Detection System (GE Healthcare, USA).

00036. Recombinant proteins The HpEtti protein encoded by the HpETTl gene of H. polymorpha with a sequence of 373 amino acids was expressed as Bis ₆ fusion peptide after being cloned into pET-32- ac (+) (Novagen), The recombinant polypeptide was produced in £. coli BL21{OE3) and purified on !iickel-nitrtloacetic acid agarose (Qiagen) according to the manufacturer's instructions.

Illustrative Results

00037. Isolation of H, _: polymorpha ?E mutant The parental H. polymorpha NCYC495 leul-l strain tolerates ethanoi concentrations in the medium up to 7-8%. However, insertional mutant 7E was selected among H. polymorpho NCYC49S leul-l insertional transformants as a one unable to grow on the YNB medium supplemented with 7 % ethanoi. For this purpose the pl9L2 p!asmid (Voronovsky et al., 2002} linearized with BamH was used as an insertional cassette. Leu+ transformants were replica-plated on the ethanoi supplemented medium and screened for the growtH. Among 200 transformants only one was unable to grow on the 7 % ethanoi {designated 7E), The 7E mutant proved to be approximately 300-500 times more sensitive to ethanoi compared to the control parental strain (SLeu-t- transformant) (Fig. 2A). Unlike the recipient strain, the 7E mutant does not tolerate the stress ethanoi concentration, but it does grow on the 1% ethanoi as a sole carbon source (Fig. 2B) meaning it lacks any defects in ethanoi utilization but is sensitive to ethanoi concentrations at stress levels.

00038. Plasmid pl912 carries the LEU2 gene of 5. cerevisiae and when it is used to transform a H, pofymorpha strain, 1 to a few copies of the plasmid might be integrated into the genome of H. pofymorpha. For this reason the copy number of the insertions! cassette in the genome of 7E mutant was estimated. The genomic DNA of the 7E mutant and a few other randomly selected Leu" transformants were treated with HindW and probed wit an ECt-labeled PC fragment carrying the 5, cerevisiae, LEU2 gene. There is no HindiW site within LEU2 gene so one Southern blotting signal corresponds to one pl9L2 copy in the genome (Fig.3B). ft was shown that the 7E mutant carried only one copy of insertional cassette integrated into the genome whereas transformants i and N2 gave 3 signals corresponding to 3 plasmids copies being integrated.

00039, The 7E insertional mutant of H, pofymorpha has a disrupted gene homologous to the 5, cerevisiae

I^El_gene The genomic region flanking the insertionaS cassette in the 7E mutant was sequenced. It was shown that the piasmid disrupted the H. pofymorpha open reading frame having 39% identity to protein (SEQ. ID NO: 6) encoded by the S. cerevisiae MPEl ge {$£& ID NO: 5) which is annotated as coding an essential component of a cleavage and polyadenyiation factor required for cieavage and polyadenyiation of rriR A (Vo et al., 2001). A sequence comparison (Fig. ) for sequences similar to the to S, cerevisiae MPEl gene motifs identified by Vo et al., 2001 revealed that the H, pofymorpha MPEl like ORF (i.e., the HpETTl gene) contains a zinc knuckle-like motif between amino acids 168 and 182; a cysteine-rich B domain resembling RiNG finger between amino acids 266 and 319; and a . region from amino acids 4 and 79 with high homology to the so ea!!ed "A domain" identif ied in the 5. cerevisiae homoiogue (Fig. 4). The insertionai cassette in the 7E mutant disrupted the H. polymorpha HpETTl gene by integration at a position 671 bp downstream of the start codon,

00040 ^, Not S. cerevisiae but P. stipitis ETTl gene complement the ettl mutation in H. polymorpha. To study the functional complementation of ettl mutation of H, polymorpha two heterologous homologues were chosen: the S. cerevisiae MPEl gene and the gene from P. stipitis (another xylose fermenting yeast species) herein designated PsETTl, The putative product of PsETTl discovered to have about 37% amino acid identity with the HpEttl protein. The effect of expressing these heterlogou genes was compared with the expression of the H. polymorpha HpETTl gene a as a control. For this purpose the ?£ mutant was transformed with pSasmids p70+ PElSc _f p70+ETTlPst and pGlG61+ETTlHp (Figures 1.1- 1.2). There it was shown that S. cerevisiae MPEl gene did not restore the growth on the medium supplemented with 7% ethanol (Fig. 5). On the other hand, expression of the P. stipitis PsETTl gene in the 7E mutant resulted in partial restoration of ethanol tolerance. The corresponding transformant 7E-GAPDHETTlPst could grow on the medium with 7% ethanol although the growth was poor compared to those of the 3Leu+ and 7E-pETTlHp-l strains {Fig. 5), These data demonstrate that the genes of H. polymorpha and P. stipitis that are homologues of the MPEl gene of S. cerevisiae are involved in ethanol tolerance. Accordingly the H. polymorpha and P. stipitis genes are hereby given the suffix designation "ETTl " for ethanoi tolerance to distinguish them from MPEl of S. cerevisiae. Another distinction is that expression of the 5. cerevisiae MPEl gene in S. cerevisiae is essentia! because a 5. ^■ cerevisiae mutant in that gene is not viable, whereas in contrast, the H. polymorpha ettl 7E mutant isolated in herein is viable, although highly sensitive to exogenous ethanoi,

00041, Although the HpETTl gene appears to be not essentia! for growth for H. polymorpha, the presence of RNA-binding zinc knuckle domain in the HpETTl gene suggest a possible involvement in RNA maturation, which may be one of the processes negatively affected by ethanoi exposure in this and other organisms.

00042. Construction of H. polymorpha strain overexpressing native HpETTl gene. The H. polymorpha 3Leu+ strain (Ishchuk et al., 2008) was transformed with p!asmid vector pGLG61+£TTlHp (Fig.lf) for ove rex pressing the HpETTl gene in H, polymorpha. Being a pGLGSl {Sohn et aL, 1999) derivative the corresponding plasmtd vector contains the telomeric sequence and the bacterial aminoglycoside 3-phosphotransferase {APH, genetecin resistance) gene, This vector promotes multicopy integration of piasmid tandem repeats into the genome (Sohn et aL, 1999). The collection of geneticin resistant transformants was screened for improved ethanoi resistance. The ethanoi resistance varied among the transformants. Thi couid be explained by different copy number of the plasmtd integrated into the genome. The transforrnant 3Leu+pETTl-I0 proved to be approxirnate!y 10-fold more tolerant to exogenous ethanoi compared to the recipient parent strain 3Leu+ (Fig. 6). The copy number of the HpETTl gene in the transforrnant was estimated by Southern blotting (Figure 38), Comparin the intensity of the signal to the 3Leu+ strain which contains only one copy of the HpETTl gene, it was determined that the 3teu+pETTl 10 transforrnant carries approximately 6-7 copies in its genome.

00043. The H. polymorpha HpETTl muiticopy integrant has improved; growth on the medium with ethanoi. Tolerance of H. polymorpha strains to ethanoi was measured as the viability in the presence of ethanoi in liquid YPD/YPS media. In the media without ethanoi there was no difference between strains growth (Fig. 7A, Fig. 8A). The 3Leu+pETTM0 transforrnant had improved growth on both 6% and 7% ethanoi media {Fig. B, Fig. 8B). At cultivation time of 48 and 72 hours the growth density of the muiticopy HpETTl integrant was 2-foid higher than the 3Leu+ strain in the 6% ethanoi media!. Under conditions of cultivation in 7% ethanoi medium (Fig. 8 _. 8} a diffe ence in growth rate and density was observed within the first day of incubation and was 3.4 times higher for the 3leu+pETTI-10 transformant compared to the parent recipient strain 3L«u+, However, during prolonged cultivation (48, 72 and 96 hours) all strains exhibited a decline in growth, although the growth kinetics of the HpETTl multicopy integrant was observably better throughout the cultivation period. As noted before, the 7E mutant which is hypersensitive to ethanol, showed impaired growth on the 7% ethanol medium.

00044. The H. polvmoroha ETTl multi-copy integrant is resistant to other kinds of stress. The 3leu+pETTl-10 transformant is also more resistant to the proline analogue 2-azetidine earboxyiic acid, AZC {Fig, 9) than the parent recipient strain, AZC is incorporated into proteins competitively with proline and results in protein misfoiding (Lane et ai„ 1971; Zagari et al., 1990), and this compound is known to induce the expression of heat-shock proteinS. Thus the effect of AZC treatment is a stress response that resembles that of heat-shock {Trotter et al,, 2002}. This likely explains why the 7E mutant does not grow well at 50°C compared to the 3Leu+ parent strain (Fig. 10, Fig, 11). Further evidence that the product of the HpETTl is related to a heat shock response is that the 3Ley+pETTl-10 transformant that overexpresses HpETTl displays slightly improved growth at 50 ^o C comparing to the 3Leu+ strain {Fig.11} and is more tolerant to heat-shock (Fig,13).

00045. Overexpression of the H, polymorpha ' HpETTl gene Lin S. csrevisi ^' ae increases ethanol tolerance.

The H, polymorpha HpETTl gene was cloned into a yeast expression vector under control of the 5, cerevisioe PGK1 promoter. Two transformants showed slightly increased growth on ethanol media {Fig.1 ^' 2). As with the case of expression in H. polymorpha Increased ethanol tolerance will likely be observed when S. cerevisioe is transformed with the expression vector in high-copy number,

00046. Purification of H. polymorpha HpEttl protein. The H. polymorpha HpEttl protein was overexpressed in bacteria as his tagged fusion protein, then isolated and partially purified as shown in th SDS polyacrylarnide gel depicted in Fig.14. 00047. Discussion. The S. cerevisiae pel protein was previously characterized as an essential evolutionary conserved protein participating in cleavage and polyadenylation of mRNA {Vo et al„ 2001). The present disclosure demonstrates that an orthologue present in H. polymorpha that shares 39% sequence identity with the 5. cerevisiae Mpel protein, which is herei designated HpEttl is involved in ethanoi resistance and high temperature resistance in H. polymorpha and also confers a detectable increase in ethanoi resistance when expressed in S. cerevisiae. Unlike its 5. cerevisiae orthologue, the HpETTl gene is not necessary for ceil viability. The ability to functionally complement the H. polymorpha 7E mutant was used as a method to isolate another Ettl like protein PsEttl from another xylose fermenting yeast. P. stipitiS. The PsEtti protein shares about 37% amino acid Identity with the HpEttl. Despite having similar sequence identity at 39% to the 5. cerevisiae homoiogue MPE1, expression of the S. cerevisiae protein in the H. polymorpha 7E mutant, which lacks a functional HpETTl gene did not restore the growth on 7% ethanoi. in spite of being evolutionary conserved, Ettlp of H. polymorpha as weli as other xyiose fermenting yeast species P. stipitis participate in ethanoi resistance. It is noted that the sequence of the H. polymorpha HpETTl contains several motifs (Fig. 4) recognized in the 5. cerevisiae gene to be involved in mRNA maturation {i.e., an RNA-binding zinc knuckle domain) (Vo et a!,, 2001). The question about involving the H. polymorpha HpETTl gene in mRNA maturation remains unclarified pending experimental evaluation.

00048. The results described herein show that H. polymorpha ethanoi toierance couid be substantially improved by introducing multiple copies of native £771 gene into the genome. The strain constructed in the present disclosure is a recombinant strain carrying 6-7 copies of ETT1 gene and has 10-fold higher resistance towards exogenous ethanoi and improved growth kinetics in the ethanoi media. Moreover, the corresponding multicopy integrant (3Leu+pETTl-10) proved to be more resistant to the protein misfoiding reagent, AZC. The 7E mutant is unable to grow at 50 "C, which is upper temperature limit to H. polymorpha (Guerra et ai 2005}. Ethanoi and temperature stresses cause some similar effects, particularly block of mature mRNA export from the nucleus and subsequently the accumulation of bulk poly (A) ⁺ mRNA in this ceil compartment (Tani e al 1995; .Saavedra et al., 1996; Krehber et aL, 1999). The defects in processes of mRNA maturation aiso cause the accumulation of bulk poiy (A) ⁺ mRNA in the nucleus (Brodsky and Silver, 2000; Jensen et al,, 2001). So it may be supposed that H, polymorpha EttlHp being a RNA- binding protein could influence the mRNA maturation under ethanoi stress and high temperature but not under optima! growth conditions.

References

Brachmann, C.B., A. Davies, GJ. Cost, L Caputo , J. ti , P, Hieter , and J.D. Boeke. 1998- Designer strains derived from Saccham yces cerevisiae S288C: usefuf set of strains and plasrnids for PGR- mediated gene disruption and other applications.Yeast 14: 115-132,

Brodsky, A. S. and Silver, P, A. (2000), Pre-mRMA processing factors are required for nuclear xport. RNA 6; 1737-1749.

Faber, K.N., P. Haima, , Harder, JV5, Veenhuls, and G. Ab, 1994. Highly-efficient e!ectrotransformation of the yeast Hansenula polymorpha. Cun Genet 25(4}: 305-310.

Geliissen, G. 2000. Heterologous protein production in methylotrophic yeasts. AppS, Microbiol. Biotechnok 54: 741-750.

Geliissen, G. fed.}. 2002. Hansenula polymorpha - Biology and Applications. Wiiey-VCH,Weinheim. Gleeson, M.A.G. and P.E. Sudbery. 1988. Genetic analysts in the tTiethyiotfophic yeast Hansenula polymorpha. Yeast 4: 293-303.

Guerra, E., P.P. Chye, E, Berardi and P,W, Piper. 2005. Hypoxia aboiishes transience of the heat- shock response in the methylotrophic yeast Hansenula polymorpha. Microbiology 151: 805-811.

Ishchuk, O.P., A.Y. Voronovsky, O.V. Stasyk, G.Z. Gayda, M,V, Gonchar, C.A. Abbas, and A. A. Sibirny. 2008. Overexpresston of pyruvate decarboxylase in the yeast Hansenula polymorpha results in increased ethanol yield in high-temperature fermentation of xylose. FEMS Yeast Res 7: 1167-1174.

Jensen, T. H., . Patricio, _. T. McCarthy and IVt. Rosbash, 2001. A block to mRNA nuclear export in S ^, cerevisiae leads to hyperadenylation of transcripts that accumulate at the site of transcription. Mo! Cell 7: 887-898.

Krebber, H., T. Taura, M.S. tee and P.A. Silver. 1999. Uncoupling of hnRNP Npl3p from mR As during the stress-induced block in mRNA export. Genes Dev 13: 1994-2004, Lahtehev, K.L., V,D. Semenova, Li, Tolstorukov, I. van der lei, and M, Veenhuis. 2002. isolation and properties of genettcaliy defined strains of the methylotrophic yeast Hansenula polymorpha CBS4732. Arch. Microbiol. 177: 150-158.

Lane, J.M., P. Dehm, and D.J. Prockop. 1971. Effect of the proline analogue azetidine-2-carboxylic acid on collagen synthesis in vivo. L Arrest of collagen accumulation in growing chick embryos. Siochim Biophys Acta 236(3}: 517-527.

Ryabova, O.B., O.M. Chmil, and A.A. Sibirny. 2003. Xylose and celiobiose fermentation to ethano! by the thermotelerant methylotrophic yeast Hansenula polymorpha, FEMS Yeast Res. 4(2): 157- 164.

Saavedra, C, K. S. Tung, DX. Amberg, AX Hopper, and C.N. Cole. 1996. Regulation of rnRWA export in response to stress in Saccharomyces cerevtsiae. Genes Dev 10: 1608-1620.

Sam brook, J., E.F. Fritsh, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual, 2nd edition., Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Siverio, J. (VS. 2002. Biochemistry and genetics of nitrate assimilation. In . Gellissen (ed.), Hansenula polymorpha - Biology and Applications. Wi!ey-VCH, Weinhetm.

Sobn, J.H., E.S. Choi, H.A. Kang, J.S. Rhee, .O. Agaphonov, M.D. Ter-Avanesyan, and S.K. Rhee.

1999. A dominant selection system designed for copynumber- controlled gene integration in Hansenula polymorpha DL-l. Appl. Microbiol, Biotechnol. 51: 800-807.

Suckow, M., and 6. Geftissen. 2002. The expression platform based on H. polymorpha str in R81.1 and its derivatives - history,status and perspectives. In 6. Gellissen {ed.), Hansenula polymorpha - Biology and Applications. Wiley-VCH, Weinheim.

Tani, T., RJ. Derby, Y. Hiraoka, and D.t. Spector. 1995. Nuciear accumulation of poly (A)+ RNA in heat-shocked yeast cells: implication of nucleolar involvement in mRNA transport. Moi Bio!. Ceil 5: 1515-1534. Trotter, E.W., CM. Kao, L Berenfe!d, D, Botstein, G.A, Petsko, and J.V. Gray, 2002, isfaided proteins are competent to mediate a subset of the responses to heat shock in Saccharomyces cerevisiae. i Bioi Chern 277(47): 44817-44825,

Ubiyvovk, V.M., O.V. Biazhenko, D. Gigot, M, Penninckx, and A.A. Sibirny. 2006. Role of gamma- giutarriyltranspeptidase in detoxification of xenobiotics in the yeasts Hansenula polymorpha and Saccharomyces cerevisiae, Ce!i Bio! Int 30: 665-671.

Van der Kiel, L J., and . Veenhuis. 2002. Hansenula polymorpha: a versatile model organism in peroxisome research, in 6. Gel!issen (ed,}, Hansenula polymorpha - Biology and Applications. Wi!ey-VCH, Weinheim.

Vo, t. T., M. Mirtet, J. M. SchmJtter, F. Lacroute, and F. Wyers, 2001. Mpel, a zinc knuckle protein, is an essential component of yeast cleavage and polyadenylation factor required for the cleavage and polyadenylation of mRNA. Mol, Cell Biol. 21{24): 8346-8356.

Voronovsky, A., C.A. Abbas, L. . Fayura, 8.V. shanovska, K.V. Dmytruk, K.A. Sybirrta and A.A,

Sibirny. 2002. Development of a transformation system for the f!avinogenic yeast Candida famata. f EMS Yeast Res. 2; 381-3SS.

Yang, V.W., J.A. Marks, 8, Davis, and T. Jeffries. 1994. High-efficiency transformation of Pichio stipitis based on its URA3 gene and a homologous autonomous replication sequence, ARS2. Appl. Environ. Microbiol. 60: 4245-4254,

Zagari, A., G. Nemethy, and H.A. Scheraga. 1990, The effect of the L-azetidine-2-carboxyiic acid residue on protein conformation. I. Conformations of the residue and of dipeptideS. Biopolymers 30(9-10): 951-959.