BACKGROUND OF THE INVENTION CARDIOVASCULAR DISORDERS AND RESPONSE TO STATIN TREATMENT Cardiovascular disorders include, for example, acute coronary events such as myocardial infarction and stroke.

Myocardial Infarction Myocardial infarction (MI) is the most common cause of mortality in developed countries. It is a multifactorial disease that involves atherogenesis, thrombus formation and propagation. Thrombosis can result in complete or partial occlusion of coronary arteries. The luminal narrowing or blockage of coronary arteries reduces oxygen and nutrient supply to the cardiac muscle (cardiac ischemia), leading to myocardial necrosis and/or stunning. MI, unstable angina, or sudden ischemic death are clinical manifestations of cardiac muscle damage. All three endpoints are part of the Acute Coronary Syndrome since the underlying mechanisms of acute complications of atherosclerosis are considered to be the same.

Atherogenesis, the first step of pathogenesis of MI, is a complex interaction between blood elements, mechanical forces, disturbed blood flow, and vessel wall abnormality. On the cellular level, these include endothelial dysfunction, monocytes/macrophages activation by modified lipoproteins, monocytes/macrophages migration into the neointima and subsequent migration and proliferation of vascular smooth muscle cells (VSMC) from the media that results in plaque accumulation.

In recent years, an unstable (vulnerable) plaque was recognized as an underlying cause of arterial thrombotic events and MI. A vulnerable plaque is a plaque, often not stenotic, that has a high likelihood of becoming disrupted or eroded, thus forming a thrombogenic focus. Two vulnerable plaque morphologies have been described. A first type of vulnerable plaque morphology is a rupture of the protective fibrous cap. It can occur in plaques that have distinct morphological features such as large and soft lipid pool with distinct necrotic core and thinning of the fibrous cap in the region of the plaque shoulders. Fibrous caps have considerable metabolic activity. The imbalance between matrix synthesis and matrix degradation thought to be regulated by inflammatory mediators combined with VSMC apoptosis are the key underlying mechanisms of plaque rupture. A second type of vulnerable plaque morphology, known as"plaque erosion", can also lead to a fatal coronary thrombotic event. Plaque erosion is morphologically different from plaque rupture. Eroded plaques do not have fractures in the plaque fibrous cap, only superficial erosion of the intima. The loss of endothelial cells can expose the thrombogenic subendothelial matrix that precipitates thrombus formation. This process

could be regulated by inflammatory mediators. The propagation of the acute thrombi for both plaque rupture and plaque erosion events depends on the balance between coagulation and thrombolysis. MI due to a vulnerable plaque is a complex phenomenon that includes: plaque vulnerability, blood vulnerability (hypercoagulation, hypothrombolysis), and heart vulnerability (sensitivity of the heart to ischemia or propensity for arrhythmia).

Recurrent myocardial infarction (RMI) can generally be viewed as a severe form of MI progression caused by multiple vulnerable plaques that are able to undergo pre- rupture or a pre-erosive state, coupled with extreme blood coagulability.

The incidence of MI is still high despite currently available preventive measures . and therapeutic intervention. More than 1, 500,000 people in the US suffer acute MI each year (many without seeking help due to unrecognized MI), and one third of these people die. The lifetime risk of coronary artery disease-events at age 40 years is 42.4% for men (one in two) and 24.9% for women (one in four) (Lloyd-Jones DM; Lancet, 1999 353: 89-92).

The current diagnosis of MI is based on the levels of troponin I or T that indicate the cardiac muscle progressive necrosis, impaired electrocardiogram (ECG), and detection of abnormal ventricular wall motion or angiographic data (the presence of acute thrombi). However, due to the asymptomatic nature of 25% of acute MIs (absence of atypical chest pain, low ECG sensitivity), a significant portion of MIs are not diagnosed and therefore not treated appropriately (e. g. , prevention of recurrent MIs).

Despite a very high prevalence and lifetime risk of MI, there are no good prognostic markers that can identify an individual with a high risk of vulnerable plaques and justify preventive treatments. MI risk assessment and prognosis is currently done using classic risk factors or the recently introduced Framingham Risk Index. Both of these assessments put a significant weight on LDL levels to justify preventive treatment.

However, it is well established that half of all MIs occur in individuals without overt hyperlipidemia. Hence, there is a need for additional risk factors for predicting predisposition to MI.

Other emerging risk factors are inflammatory biomarkers such as C-reactive protein (CRP), ICAM-1, SAA, TNF a, homocysteine, impaired fasting glucose, new lipid

markers (ox LDL, Lp-a, MAD-LDL, etc. ) and pro-thrombotic factors (fibrinogen, PAI-1).

Despite showing some promise, these markers have significant limitations such as low specificity and low positive predictive value, and the need for multiple reference intervals to be used for different groups of people (e. g. , males-females, smokers-non smokers, hormone replacement therapy users, different age groups). These limitations diminish the utility of such markers as independent prognostic markers for MI screening.

Genetics plays an important role in MI risk. Families with a positive family history of MI account for 14% of the general population, 72% of premature MIs, and 48% of all MIs (Williams R R, Am J Cardiology, 2001; 87: 129). In addition, replicated linkage studies have revealed evidence of multiple regions of the genome that are associated with MI and relevant to MI genetic ! traits, including regions on chromosomes 14,2, 3 and 7 (Broeckel U, Nature Genetics, 2002; 30 : 210; Harrap S, Arterioscler Ihr. omb Vasc Biol, 2002; 22: 874-878, Shearman A, Human. Molecular Genetics, 2000,.

9 ; 9, 1315-1320), implying that genetic risk factors influence the onset, manifestation, and progression of MI. Recent association studies have identified allelic variants that are associated with acute complications of coronary heart disease, including allelic variants of the ApoE, ApoA5, Lpa, APOCIII, and Klotho genes.

Genetic markers such as single nucleotide polymorphisms are preferable to other types of biomarkers. Genetic markers that are prognostic for MI can be genotyped early in. life and could predict individual response to various risk factors. The combination of serum protein levels and genetic predisposition revealed by genetic analysis of susceptibility genes can provide an integrated assessment of the interaction between genotypes and environmental factors, resulting in synergistically increased prognostic value of diagnostic tests.

Thus, there is an urgent need for novel genetic markers that are predictive of predisposition to MI, particularly for individuals who are unrecognized as having a predisposition to MI. Such genetic markers may enable prognosis of MI in much larger populations compared with the populations that can currently be evaluated by using existing risk factors and biomarkers. The availability of a genetic test may allow, for example, appropriate preventive treatments for acute coronary events to be provided for susceptible individuals (such preventive treatments may include, for example, statin

treatments and statin dose escalation, as well as changes to modifiable risk factors), lowering of the thresholds for ECG and angiography testing, and allow adequate monitoring of informative biomarkers.

Moreover, the discovery of genetic markers associated with MI will provide novel targets for therapeutic intervention or preventive treatments of MI, and enable the development of new therapeutic agents for treating MI and other cardiovascular disorders.

Stroke Stroke is a prevalent and serious disease. Stroke is the most common cause of disability, the second leading cause of dementia, and the third leading cause of mortality in the United States. It affects 4.7 million individuals in the United States, with 500,000 first attacks and 200,000 recurrent cases yearly. Approximately one in four men and one in five women aged 45 years will have a stroke if they live : to their 85th year. About 25% of those who have a stroke die within a year. For that, stroke is the third leading cause of mortality in the United States and is responsible for 170,000 deaths a year. Among those who survive the stroke attack, 30 to 50% do not regain functional independence.

Stroke occurs when an artery bringing oxygen or nutrients to the brain either ruptures, causing the hemorrhagic type of strokes, or gets occluded, causing the thrombotic/embolic strokes that are collectively referred to as ischemic strokes. In each case, a cascade of cellular changes due to ischemia or increased cranial pressure leads to injuries or death of the brain cells. In the United States, the majority (about 80-90%) of strokes are ischemic, including 31% large-vessel thrombotic (also referred to as large- vessel occlusive disease), 20% small-vessel thrombotic (also referred to as small-vessel occlusive disease), and 32% embolic or cardiogenic (caused by a clot originating from elsewhere in the body, e. g. , from blood pooling due to atrial fibrillation, or from carotid artery stenosis). The ischemic form of stroke shares common pathological etiology with atherosclerosis and thrombosis. 10-20% of strokes are of the hemorrhagic type, involving bleeding within or around the brain. Bleeding within the brain is known as cerebral hemorrhage, which is often linked to high blood pressure. Bleeding into the meninges surrounding the brain is known as a subarachnoid hemorrhage, which could be caused by

a ruptured cerebral aneurysm, an arteriovenous malformation, or a head injury. The hemorrhagic strokes, although less prevalent, pose a greater danger. Whereas about 8% of ischemic strokes result in death within 30 days, about 38% of hemorrhagic strokes result in death within the same time period.

Known risk factors for stroke can be divided into modifiable and non-modifiable risk factors. Older age, male sex, black or Hispanic ethnicity, and family history of stroke are non-modifiable risk factors. Modifiable risk factors include hypertension, smoking, increased insulin levels, asymptomatic carotid disease, cardiac vessel disease, and hyperlipidemia. Information derived from the Dutch Twin Registry estimates the heritability of stroke as 0.32 for stroke death and 0.17 for stroke hospitalization.

The acute nature of stroke leaves physicians with little time to prevent or lessen the devastation of brain damage. Strategies to diminish the impact of stroke include prevention and treatment with thrombolytic and, possibly,. nelJroprotective agents. The success of preventive measures will depend on the identification of risk factors and means to modulate their impact.

Although some risk factors for stroke are not modifiable, such as age and family history, other underlying pathology or risk factors of stroke such as atherosclerosis, hypertension, smoking, diabetes, aneurysm, and atrial fibrillation, are chronic and amenable to effective life-style, medical, and surgical treatments. Early recognition of patients with these risk factors, and especially those with a family history, with a non- invasive test of genetic markers will enable physicians to target the highest risk individuals for aggressive risk reduction.

Statin Treatment Coronary heart disease (CHD) accounts for approximately two-thirds of cardiovascular mortality in the United States, with CHD accounting for 1 in every 5 deaths in 1998, which makes it the largest single cause of morality (American Heart Association. 2001 Heart and Stroke Statistical Update. Dallas, TX. American Heart Association. 82000). Stroke is the third leading cause of death, accounting for 1 of every 15 deaths. Reduction of coronary and cerebrovascular events and total mortality by treatment with HMG-CoA reductase inhibitors (statins) has been demonstrated in a

number of randomized, double blinded, placebo controlled prospective trials (Waters, D. D., nat do the statin trials tell us ? Clin Cardiol, 2001. 24 (8 Suppl) : p. ni3-7, Singh, B. K. and J. L. Mehta, Management of dyslipidemia in the primary prevention of coronary heart disease. Curr Opin Cardiol, 2002.17 (5): p. 503-11). These drugs have their primary effect through the inhibition of hepatic cholesterol synthesis, thereby upregulating LDL receptor in the liver. The resultant increase in LDL catabolism results in decreased circulating LDL, a major risk factor for cardiovascular disease. In addition, statins cause relatively small reductions in triglyceride levels (5 to 10%) and elevations in HDL cholesterol (5 to 10%). In a 5 year primary intervention trial (WOSCOPS), pravastatin decreased clinical events 29% compared to placebo in hypercholesterolemic subjects, achieving a 26% reduction in LDL-cholesterol (LDL-C) (Shepherd, J. , et al., Prevention of coronary heart disease with pravastatin in men with hypercholesterolemia.

West of Scotland Coronary Prevention Study Group ; N Engl J Med, 1995.333 (20): p.

1301-7). In a similar primary prevention trial (AFCAPS/TexCAPS) (Downs, J. R. , et al., Primary prevention of acute coronary events with lovastatin in men and women with average cholesterol levels : results of AFCAPSJTexCAPS. Air FoeelTexas Coronary Atherosclerosis Prevention Study. Jama, 1998. 279 (20): p. 1615-22) in which subjects with average cholesterol levels were treated with lovastatin, LDL-C was reduced an average of 25% and events decreased by 37%.

Secondary prevention statin trials include the CARE (Sacks, F. M., et al. , the effect of pravastatin on coronary events after myocardial infarction in patients with average cholesterol levels. Cholesterol and Recurrent Events Trial investigators. N Engl J Med, 1996.335 (14): p. 1001-9) and LIPID (treatment with pravastatin) (Prevention of cardiovascular events and death with pravastatin inpatients with coronary heart disease and a broad range of initial cholesterol levels. The Long-Term Intervention with Pravastatin in Iscliaemic Disease (LIPID) Study Group. N Engl J Med, 1998. 339 (19): p.

1349-57), and 4S (treatment with simvastatin) (Randomised trial of cholesterol lowering in 4444 patients with coronary heart disease : the Scandinavian Simvastatifz Survival Study (4S). Lancet, 1994.344 (8934): p. 1383-9) studies. In these trials, clinical event risk was reduced from between 23% and 34% with achieved LDL-C lowering ranging between 25% and 35%.

In addition to LDL-lowering, a variety of potential non-lipid lowering effects have been suggested to play a role in cardiovascular risk reduction by statins. These include anti-inflammatory effects on various vascular cell types including foam cell macrophages, improved endothelial responses, inhibition of platelet reactivity thereby, decreasing hypercoaguability, and many others (Puddu, P., G. M. Puddu, and A. Muscari, Current thinking in statin therapy. Acta Cardiol, 2001.56 (4): p. 225-31, Albert, M. A. , et al., Effect of statin therapy on C-rective protein levels: the pravastatin inflammationlCRP evaluation (PRINCE) : a randomized trial and cohort study. Jama, 2001.286 (1) : p. 64-70, Rosenson, R. S., Non-lipid-lowering effects ofstatins on atherosclerosis. Curr Cardiol Rep, 1i999. 1 (3): p. 225-32, Dangas, G. , et al., Pravastatin : an arztithrombotic effect independent of the cholesterol-lowering effect. Thromb Haemost, 2000.83 (5): p. 688-92, Crisby, M., Modulation of the inflammatory process by statins Drugs Today (Barc), 2003.39 (2): p. 137-43, Liao, J. K., Role ofstatin pleiotropism in acute coronary syndromes and stroke. Int J Clin Pract Suppl, 2003 (134) : p. 51-7). However, because hypercholesterolemia is a factor in many of these additional pathophysiologic mechanisms that are reversed by statins, many of these statin benefits may be a consequence of LDL lowering.

Statins as a class of drug are generally well tolerated. The most common side effects include a variety of muscle-related complaints or myopathies. While the incidence of muscle side effects are low, the most serious side effect, myositis with rhabdomyolysis, is life threatening. This adverse effect has been highlighted by the recent withdrawal of cerevastatin when the drug was found to be associated with a relatively high level of rhabdomyolysis-related deaths. In addition, the development of a high dose sustained release formulation of simvastatin was discontinued for rhabdomyolysis-related issues (Davidson, M. H. , et al., The efficacy and six-week tolerability of simvastatin 80 and 160 mg,/day. Am J Cardiol, 1997.79 (1) : p. 38-42).

Statins can be divided into two types according to their physicochemical and pharmacokinetic properties. Statins such as lovastatin, simvastatin, atorvastatin, and cerevastatin are hydrophobic in nature and, as such, diffuse across membranes and thus are highly cell permeable. Hydrophilic statins such as pravastatin are more polar, such that they require specific cell surface transporters for cellular uptake (Ziegler, K. and W.

Stunkel, Tissue-selective action of pravastatin due to hepatocellular uptake via a sodium- independent bile acid transporter. Biochim Biophys Acta, 1992.1139 (3): p. 203-9, Yamazaki, M. , et al., Na (+)-independent multispecific anion transporter mediates active transport ofpravastatin into rat liver. Am J Physio, 1993.264 (1 Pt 1) : p. G36-44, Komai, T. , et al., Carrier-mediated uptake ofpravastatiti by rat hepatocytes in prinzaiy culture. Biochem Pharmacol, 1992.43 (4): p. 667-70). The latter statin utilizes a transporter, OATP2, whose tissue distribution is confined to the liver and, therefore, they are relatively hepato-specific inhibitors (Hsiang, B. , et al., A novel human hepatic organic anion transportingpolypeptide (OATP2). Identification of a liver-specific human organic anion transporting polypeptide and identification of rat and human . . hydroxymethylglutaryl-CoA reductase inhibitor transporters. J Biol Chem, 1999.

274 (52): p. 37161-8). The former statins, not requiring specific transport mechanisms, are available to all cells and they can-directly impact a much broader spectrum of cells and tissues. These differences in properties may influence the spectrum of activities that each statin posesses. Pravastatin, for instance, has a low myopathic potential in animal models and myocyte cultures compared to other hydrophobic statins (Masters, B. A. , et al. , In vitro myotoxicity of the 3-hydroxy-3-metlaylglutaryl coenzyme A reductase inhibitors, pravastatin, lovastatin, and simvastatin, using neonatal rat skeletal myocytes.

Toxicol Appl Pharmacol, 1995. 131 (1): p. 163-74. Nakahara, K. , et al., Myopathy induced by HMG-CoA reductase inhibitors in rabbits : a pathological, electrophysiological, and biochemical study. Toxicol Appl Pharmacol, 1998.152 (1) : p.

99-106, Reijneveld, J. C., et al. , Differential effects of 3-hydroxy-3-methylglutaryl- coenzyme A reductase inhibitors on the development of myopathy in young rats. Pediatr Res, 1996.39 (6): p. 1028-35).

Cardiovascular mortality in developed countries has decreased sharply in recent decades (Tunstall-Pedoe, H. , et al., Estimation of contribution of changes in coronary care to improving survival, event rates, and coronary heart disease mortality across the WHO MONICA Project populations. Lancet, 2000. 355 (9205): p. 688-700). This is likely due to the development and use of efficaceous hypertension, thrombolytic and lipid lowering therapies (Kuulasmaa, K. , et al., Estimation of contribution of changes in classic risk factors to trends in coronary-event rates across the WHO MONICA Project

populations. Lancet, 2000.355 (9205): p. 675-87). Nevertheless, cardiovascular diseases remain the major cause of death in industrialized countries, at least in part due to the presence of highly prevalent risk factors and insufficient treatment (Wong, M. D. , et al., Contribution of major diseases to disparities in mortality. N Engl J Med, 2002.347 (20): p. 1585-92). Even with appropriate therapy, not all patients. respond equally well to statin treatment. Despite the overwhelming evidence that statins decrease risk for cardiovascular disease, both in primary and secondary intervention settings, statin therapy clearly only achieves partial risk reduction. While a decrease in risk of 23 to 37% seen in the above trials is substantial and extremely important clinically, the majority of events still are not prevented by statin treatment. This'is. not surprising given the complexity of cardiovascular disease etiology, which influenced by.-genetics, environment, and a variety of additional risk factors including dyslipidemia, age, gender, hypertension, diabetes, obesity, and smoking. It is reasonable to assume that all of these multi-factorial risks modify statin responses and determine the final benefit that each individual achieves from therapy. Furthermore, with the increasing incidence of Type 2 diabetes and obesity in Western countries (Flegal, K. M. , et al., Prevalence and trends in obesity among US adults, 1999-2000. Jama, 2002. 288 (14): p. 1723-7 ; Boyle, J. P., et al., Projection of diabetes burden through 2050 : impact of changing demography and disease prevalence in the U. S. Diabetes Care, 2001.24 (11) : p. 1936-40), which are two major risk factors for coronary artery disease, and the emergence. of greater cardiovascular risk factors in the developing world (Yusuf, S. , et al., Global burden of cardiovascular diseases : Part II.- variations in cardiovascular disease by specific ethnic groups and geographic regions andprevention strategies. Circulation, 2001.104 (23): p. 2855-64, Yusuf, S. , et al., Global burden of cardiovascular diseases : part I : general considerations, the epidemiologic transition, riskfactors, and impact of urbanization. Circulation, 2001.

104 (22): p. 2746-53), the need for ever more effective treatment of CHD is predicted to steadily increase.

Thus, there is a growing need for ways to better identify people who have the highest chance to benefit from statins, and those who have the lowest risk of developing side-effects. As indicated above, severe myopathies represent a significant risk for a low percentage of the patient population. This would be particularly true for patients that

may be treated more aggressively with statins in the future. There are currently at least three studies in progress that are investigating whether treatments aimed at lowering LDL-C to levels below current NCEP goals by administering higher statin doses to patients further reduces CHD risk or provides additional cardiovascular benefits (reviewed in Clark, L. T., Treating dyslipidemia with statins : the risk-benefit profile. Am Heart J, 2003.145 (3): p. 387-96). It is possible that more aggressive statin therapy than is currently standard practice will become the norm in the future if additional benefit is observed in such trials. More aggressive statin therapy will likely increase the incidence of the above adverse events as well as elevate the cost of treatment. Thus, increased emphasis will be placed on stratifying responder and ! non responder patients in order for maximum benefit-risk ratios to be achieved at the lowest-cost.

The Third Report of the Expert Panel on Detection, Evaluation and Treatment of High Blood Cholesterol in Adults. (ATPIU) contains current recommendations for the management of high serum cholesterol (Executive Summary of The Third Report of The : National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, And Treatment of High Blood Cholesterol In Adults (Adult Treatment Panel Ill). Jama, 2001. 285 (19): p. 2486-97). A meta-analysis of 38 primary and secondary prevention trials found that for every 10% decrease in serum cholesterol, CHD mortality was reduced by 15%. These guidelines took into account additional risk factors beyond serum cholesterol when making recommendations for lipid lowering strategies. After considering additional risk factors and updated information on lipid lowering clinical trials, more patients are classified in the highest risk category of CHD or CHD risk equivalent than before and are recommended to decrease their LDL to less than 100 mg/dl. As a consequence, more aggressive therapy is recommended and drug therapy is recommended for 36.5 million Americans. In implementing these recommendations, cost-effectiveness of treatments is a primary concern. In lower risk populations, the cost of reducing one event may exceed $125,000 compared with around $25,000 per event in a high-risk patient group (Singh, B. K. and J. L. Mehta, Management of dyslipidemia in the primary prevention of coronary heart disease. Curr Opin Cardiol, 2002.17 (5): p.

503-11). The cost of preventing an event in a very low risk patient may exceed $1 million. In the context of cost-containment, further risk stratification of patients will help

to avoid unnecessary treatment of patients. In addition to the various clinical endpoints that are currently considered in determining overall risk, the determination of who and who not to treat with statins based on"statin response"genotypes could substantially increase the precision of these determinations in the future.

Evidence from gene association studies is accumulating to indicate that responses to drugs are, indeed, at least partly under genetic control. As such, pharmacogenetics- the study of variability in drug responses attributed to hereditary factors in different populations-may significantly assist in providing answers toward meeting this challenge (Roses, A. D., Pharmacogenetics and the practice of medicine. Nature, 2000.405 (6788) : p. 857-65, Mooser, V. , et al., Cardiovascular pharmacogenetics in the SNP era. J Thromb Haemost, 2003. 1 (7): p. 1398-1402, Humma, L. M. and S. G. Terra, Pharmacogenetics and cardiovascular disease : impact on drug response and {applications to disease management. Am. J. Health., SystPharm,.. 2002.59 (13): p. 1241Jz 52) Numerous associations have been reported between selected genotypes, as defined by SNPs and other sequence variations and specific responses to cardiovascular drugs.

Polymorphisms in several genes have been suggested to influence responses to statins including CETP (Kuivenhoven, J. A. , et al., The role ofa common variant of the cholesteryl ester transfer protein gene in the progression of coronary atherosclerosis.

The Regression Growth Evaluation Statin Study Group. N Engl J Med, 1998. 338 (2) : p.

86-93), beta-fibrinogen (de Maat, M. P. , et al.,-455G/S polymorphism of the beta- fibrinogen gene is associated with the progression of coronary atherosclerosis in symptomatic men : proposed role for an acute-phase reaction pattern of fibrinogen.

REGRESS group. Arterioscler Thromb Vase Biol, 1998. 18 (2): p. 265-71), hepatic lipase (ambon, A., et al., Common hepatic lipase gene promoter variant determines clinical response to intensive lipid-lowering treatment. Circulation, 2001.103 (6): p. 792-8, lipoprotein lipase (Jukema, J. W. , et al., The Asp9 Asn mutation in the lipoprotein lipase gene is associated with increased progression of coronary atherosclerosis. REGRESS Study Group, Interuniversity Cardiology Institute, Utrecht, The Netherlands. Regression Growth Evaluation Statin Study. Circulation, 1996.94 (8): p. 1913-8), glycoprotein IIIa (Bray, P. F., et al., The platelet Pl (A2) and angiotensin-converting enzyme (ACE) D allele polymorphisms and the risk of recurrent events after acute myocardial infarction. Am J

Cardiol, 2001. 88 (4): p. 347-52), stromelysin-1 (de Maat, M. P. , et al., Effect of the stromelysin-l promoter on ecacy ofpravastatin in coronay atherosclerosis and restenosis. Am J Cardiol, 1999. 83 (6): p. 852-6), and apolipoprotein E (Gerdes, L. U. , et al. , The apolipoprotein epsilon4 allele determines prognosis and the effect on prognosis ofsimvastatin in survivors ofmyocardial itifarction : a substudy of tile Scandinavian simvastatin survival study. Circulation, 2000.101 (12): p. 1366-71, Pedro-Botet, J. , et al., Apolipoprotein E genotype affects plasma lipid response to atorvastatin in a gender specific manner. Atherosclerosis, 2001.158 (1) : p. 183-93).

Some of these variants were shown to effect clinical events while others were associated with changes in surrogate endpoints. The CETP variant alleles B1 and B2 were shown to be correlated with HDL cholesterol levels. Patients with B1B1 and B1B2 genotypes have lower HDL cholesterol and greater progression of angiographically- ieterminedatherosclerosis than B2B2 subjects-whenlon placebo during the pravastatin REGRESS clinical trial. Furthermore, B1B1 and B1B2 had significantly less progression of atherosclerosis when on pravastatin whereas B2B2 patients derived no benefit.

Similarly, beta-fibrinogen promoter sequence variants were also associated with disease progression and response to pravastatin in the same study as were Stomelysin-1 promoter variants. In the Cholesterol and Recurrent Events (CARE) trial, a pravastatin secondary intervention study, glycoprotein Villa variants were also associated with clinical event response to pravastatin. In all of the above cases, genetic subgroups of placebo-treated patients with CHD were identified who had increased risk for major coronary events.

Treatment with pravastatin abolished the harmful effects associated with the"riskier" genotype, while having little effect on patients with genotypes that were associated with less risk. Finally, the impact of the apolipoprotein 4 genotype on prognosis and the response to simvastatin or placebo was investigated in the Scandanavian Simvastatin Survival Study (Pedro-Botet, J. , et al., Apolipoprotein E genotype affects plasma lipid response to atorvastatin in a gender specific manner. Atherosclerosis, 2001. 158 (1) : p.

183-93). Patients with at least one apolipoprotein 4 allele had a higher risk for all cause death than those lacking the allele. As was the case with pravastatin treatment, simvastatin reversed this detrimental effect of the"riskier allele". These results suggest that, in general, high-risk patients with ischemic heart disease derive the greatest benefit

from statin therapy. However, these initial observations should be repeated in other cohorts to further support the predictive value of these specific genotypes. Although it is likely that additional genes beyond the five examples above impact the final outcome of an individual's response to statins, these five examples serve to illustrate that it is possible to identify genes that associate with statin clinical responses that could be used to predict which patients will benefit from statin treatment and which will not.

SNPs The genomes of all organisms undergo spontaneous mutation in the course of their continuing evolution, generating variant forms of progenitor genetic sequences -(Gusella, Ann. Rev. Biochem. 55, 831-854 (1986) ). A variant form may confer an evolutionary advantage or disadvantage relative to a progenitor form or may be neutral, In some'instances, a variant form confers'ah evolutionary advantage to the species and is eventually incorporated into the DNA of many or most members of the species and effectively becomes the progenitor form. Additionally, the effects of a variant form may be both beneficial and detrimental, depending on the circumstances. For example, a heterozygous sickle cell mutation confers resistance to malaria, but a homozygous sickle cell mutation is usually lethal. In many cases, both progenitor and variant forms survive and co-exist in a species population. The coexistence of multiple forms of a genetic sequence gives rise to genetic polymorphisms, including SNPs.

Approximately 90% of all polymorphisms in the human genome are SNPs. SNPs are single base positions in DNA at which different alleles, or alternative nucleotides, exist in a population. The SNP position (interchangeably referred to herein as SNP, SNP site, SNP locus, SNP marker, or marker) is usually preceded by and followed by highly conserved sequences of the allele (e. g. , sequences that vary in less than 1/100 or 1/1000 members of the populations). An individual may be homozygous or heterozygous for an allele at each SNP position. A SNP can, in some instances, be referred to as a"cSNP"to denote that the nucleotide sequence containing the SNP is an amino acid coding sequence.

A SNP may arise from a substitution of one nucleotide for another at the polymorphic site. Substitutions can be transitions or transversions. A transition is the

replacement of one purine nucleotide by another purine nucleotide, or one pyrimidine by another pyrimidine. A transversion is the replacement of a purine by a pyrimidine, or vice versa. A SNP may also be a single base insertion or deletion variant referred to as an"indel" (Weber et al.,"Human diallelic insertion/deletion polymorphisms", Am JHum Genet 2002 Oct; 71 (4): 854-62).

A synonymous codon change, or silent mutation/SNP (terms such as"SNP", "polymorphism","mutation","mutant","variation", and"variant"are used herein interchangeably), is one that does not result in a change of amino acid due to the degeneracy of the genetic code. A substitution that changes a codon coding for one amino acid to a codon coding for a different amino acid (i. e. , a non-synonymous codon change) is referred to as a missense mutation. A nonsense mutation results in a type'of non-synonymous codon change in which a stop codon is formed, thereby leading to premature termination of a polypeptide chain and a truncated protein. A read-through mutation is another type of non-synonymous codon change that causes the destruction of a stop codon, thereby resulting in an extended polypeptide product. While SNPs can be bi-, tri-, or tetra-allelic, the vast majority of the SNPs are bi-allelic, and are thus often . referred to as"bi-allelic markers", or"di-allelic markers".

As used herein, references to SNPs and SNP genotypes include individual SNPs and/or haplotypes, which are groups of SNPs that are generally inherited together.

Haplotypes can have stronger correlations with diseases or other phenotypic effects compared with individual SNPs, and therefore may provide increased diagnostic accuracy in some cases (Stephens et al. Science 293, 489-493, 20 July 2001).

Causative SNPs are those SNPs that produce alterations in gene expression or in the expression, structure, and/or function of a gene product, and therefore are most predictive of a possible clinical phenotype. One such class includes SNPs falling within regions of genes encoding a polypeptide product, i. e. cSNPs. These SNPs may result in an alteration of the amino acid sequence of the polypeptide product (i. e. , non- synonymous codon changes) and give rise to the expression of a defective or other variant protein. Furthermore, in the case of nonsense mutations, a SNP may lead to premature termination of a polypeptide product. Such variant products can result in a

pathological condition, e. g. , genetic disease. Examples of genes in which a SNP within a coding sequence causes a genetic disease include sickle cell anemia and cystic fibrosis.

Causative SNPs do not necessarily have to occur in coding regions; causative SNPs can occur in, for example, any genetic region that can ultimately affect the expression, structure, and/or activity of the protein encoded by a nucleic acid. Such genetic regions include, for example, those involved in transcription, such as SNPs in transcription factor binding domains, SNPs in promoter regions, in areas involved in transcript processing, such as SNPs at intron-exon boundaries that may cause defective splicing, or SNPs in mRNA processing signal sequences such as polyadenylation signal regions.. Some SNPs that are not causative SNPs nevertheless are in close association with, and therefore segregate with, a disease-causing sequence. In this situation, the. presence of a SNP correlates with the presence of, or predisposition to, or an increased risk in developing the disease. These SNPs, although. not causative, are nonetheless also useful for diagnostics, disease predisposition screening, and other uses.

An association study of a SNP and a specific disorder involves determining the presence or frequency of the SNP allele in biological samples from individuals with the disorder of interest, such as those individuals who respond to statin treatment ("responders") or those individuals who do not respond to statin treatment ("non- responders"), and comparing the information to that of controls (i. e. , individuals who do not have the disorder; controls may be also referred to as"healthy"or"normal" individuals) who are preferably of similar age and race. The appropriate selection of patients and controls is important to the success of SNP association studies. Therefore, a pool of individuals with well-characterized phenotypes is extremely desirable.

A SNP may be screened in diseased tissue samples or any biological sample obtained from a diseased individual, and compared to control samples, and selected for its increased (or decreased) occurrence in a specific phenotype, such as response or non- response to statin treatment of cardiovascular disease. Once a statistically significant association is established between one or more SNP (s) and a pathological condition (or other phenotype) of interest, then the region around the SNP can optionally be thoroughly screened to identify the causative genetic locus/sequence (s) (e. g. , causative SNP/mutation, gene, regulatory region, etc. ) that influences the pathological condition or

phenotype. Association studies may be conducted within the general population and are not limited to studies performed on related individuals in affected families (linkage studies).

Clinical trials have shown that patient response to treatment with pharmaceuticals is often heterogeneous. There is a continuing need to improve pharmaceutical agent design and therapy. In that regard, SNPs can be used to identify patients most suited to therapy with particular pharmaceutical agents such as statins (this is often termed "pharmacogenomics"). Similarly, SNPs can be used to exclude patients from certain treatment due to the patient's increased likelihood of developing toxic side effects or their likelihood of not responding to the treatment. Pharmacogenomics can also be used in i ; pharmaceutical research to assist the drug development and selection process. (Linder, et al. (1997), Clinical Chemistry, 43,254 ; Marshal (1997), Nature Biotechnology, 15, 1249; International Patent Application WO 97/404627 Spe tra Biomedical ; and Schaferet :. al. (1998), Nature Biotechnology, 16,, 3).

SUMMARY OF THE INVENTION The present invention relates to the identification of novel SNPs, unique combinations of such SNPs, and haplotypes of SNPs that are associated with cardiovascular disorders and/or drug response, particularly acute coronary events (e. g., myocardial infarction and stroke) and response to statins for-the treatment (including preventive treatment) of cardiovascular disorders such as acute coronary events. The polymorphisms disclosed herein are directly useful as targets for the design of diagnostic reagents and the development of therapeutic agents for use in the diagnosis and treatment of cardiovascular disorders and related pathologies, particularly acute coronary events.

Based on the identification of SNPs associated with cardiovascular disorders, particularly acute coronary events, and/or response to statin treatment, the present invention also provides methods of detecting these variants as well as the design and preparation of detection reagents needed to accomplish this task. The invention specifically provides, for example, novel SNPs in genetic sequences involved in cardiovascular disorders and/or responsiveness to statin treatment, isolated nucleic acid molecules (including, for example, DNA and RNA molecules) containing these SNPs,

variant proteins encoded by nucleic acid molecules containing such SNPs, antibodies to the encoded variant proteins, computer-based and data storage systems containing the novel SNP information, methods of detecting these SNPs in a test sample, methods of determining the risk of an individual of experiencing a first or recurring acute coronary event, methods for prognosing the severity or consequences of the acute coronary event, methods of treating an individual who has an increased risk of experiencing an acute coronary event, methods of identifying individuals who have an altered (i. e. , increased or decreased) likelihood of responding to statin treatment based on the presence or absence of one or more particular nucleotides (alleles) at one or more SNP sites disclosed herein or the detection of one or more encoded variant products (e. g., variant mRNA transcripts or variant proteins), methods of identifying individuals who are more or less likely to respond to a treatment, particularly statin treatment of a cardiovascular disorder such as an acute. coronary event (or more or less likely to experience undesirable side effects from a treatment, etc. ), methods of screening for compounds useful in the treatment of a disorder associated with a variant gene/protein, compounds identified by these methods, methods of treating disorders mediated by a variant gene/protein, methods of using the novel SNPs of the present invention for human identification, etc.

Since cardiovascular disorders/diseases share certain similar features that may be due to common genetic factors that are involved in their underlying mechanisms, the SNPs identified herein as being particularly associated with acute coronary events and/or statin response may be used as diagnostic/prognostic markers or therapeutic targets for a broad spectrum of cardiovascular diseases such as coronary heart disease (CHD), atherosclerosis, cerebrovascular disease, congestive heart failure, congenital heart disease, and pathologies and symptoms associated with various heart diseases (e. g., angina, hypertension), as well as for predicting responses to a variety of HMG-CoA reductase inhibitors with lipid-lowering activities (statins), and even drugs other than statins that are used to treat cardiovascular diseases. In addition, the SNPs of the present invention are useful for predicting primary acute coronary events, as well as their reoccurrence.

The present invention further provides methods for selecting or formulating a treatment regimen (e. g. , methods for determining whether or not to administer statin

treatment to an individual having cardiovascular disease, methods for selecting a particular statin-based treatment regimen such as dosage and frequency of administration of statin, or a particular form/type of statin such as a particular pharmaceutical formulation or compound, methods for administering an alternative, non-statin-based treatment to individuals who are predicted to be unlikely to respond positively to statin treatment, etc. ), and methods for determining the likelihood of experiencing toxicity or other undesirable side effects from statin treatment, etc. The present invention also provides methods for selecting individuals to whom a statin or other therapeutic will be administered based on the individual's genotype, and methods for selecting individuals for a clinical trial of a statin or other therapeutic agent based on the genotypes of the individuals (e. g. , selecting individuals to participate in the trial who are most likely to respond positively from the statin treatment). Furthermore, the SNPs of the invention are useful for predicting treatment responsiveness at any stage of CID, including. the. initial. decision : for prescribing : treatment before the occurrence of the. first acute coronary event. *s In Tables 1-2, the present invention provides gene information, transcript sequences (SEQ ID NOS: 1-517), encoded amino acid sequences (SEQ ID NOS: 518- 1034), genomic sequences (SEQ ID NOS: 13, 194-1S, 514), transcript-based context sequences (SEQ ID NOS: 1035-13, 193) and genomic-based context sequences (SEQ ID NOS: 13, 515-85, 090) that contain the SNPs of the present invention, and extensive SNP information that includes observed alleles, allele frequencies, populations/ethnic groups in which alleles have been observed, information about the type of SNP and corresponding functional effect, and, for cSNPs, information about the encoded polypeptide product. The transcript sequences (SEQ ID NOS: 1-517), amino acid sequences (SEQ IID NOS: 518-1034), genomic sequences (SEQ ID NOS : 13,194-13, 514), transcript-based SNP context sequences (SEQ ID NOS: 1035-13,193), and genomic- based SNP context sequences (SEQ ID NOS: 13, 515-85, 090) are also provided in the Sequence Listing.

In a specific embodiment of the present invention, SNPs that occur naturally in the human genome are provided as isolated nucleic acid molecules. These SNPs are associated with cardiovascular disorders, particular acute coronary events, and/or response to statin treatment, such that they can have a variety of uses in the diagnosis

and/or treatment of cardiovascular disorders and related pathologies and particularly in the treatment of cardiovascular disorders with statins. One aspect of the present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence in which at least one nucleotide is a SNP disclosed in Tables 3 and/or 4. In an alternative embodiment, a nucleic acid of the invention is an amplified polynucleotide, which is produced by amplification of a SNP-containing nucleic acid template. In another embodiment, the invention provides for a variant protein which is encoded by a nucleic acid molecule containing a SNP disclosed herein.

In yet another embodiment of the invention, a reagent for detecting a SNP in the context of its naturally-occurring flanking nucleotide sequences (which can be, e. g., either DNA or mRNA) is provided. In particular, such a reagent may be in the form of, for example, a hybridization probe or an amplification primer that is useful in the specific . detection of a SNP of interest. In an alternative embodiment, a protein detection reagent' is used to detect a variant protein that is encoded by a nucleic acid molecule containing a SNP disclosed herein. A preferred embodiment of a protein detection reagent is an antibody or an antigen-reactive antibody fragment.

Various embodiments of the invention also provide kits comprising SNP detection reagents, and methods for detecting the SNPs disclosed herein by employing detection reagents. In a specific embodiment, the present inventionprovides for a method of identifying an individual having an increased or decreased risk of developing a cardiovascular disorder (e. g. experiencing an acute coronary event) by detecting the presence or absence of one or more SNP alleles disclosed herein. The present invention also provides methods for evaluating whether an individual is likely (or unlikely) to respond to statin treatment of cardiovascular disease by detecting the presence or absence of one or more SNP alleles disclosed herein.

The nucleic acid molecules of the invention can be inserted in an expression vector, such as to produce a variant protein in a host cell. Thus, the present invention also provides for a vector comprising a SNP-containing nucleic acid molecule, genetically-engineered host cells containing the vector, and methods for expressing a recombinant variant protein using such host cells. In another specific embodiment, the host cells, SNP-containing nucleic acid molecules, and/or variant proteins can be used as

targets in a method for screening and identifying therapeutic agents or pharmaceutical compounds useful in the treatment of cardiovascular diseases.

An aspect of this invention is a method for treating cardiovascular disorders, particular acute coronary events, in a human subject wherein said human subject harbors a SNP, gene, transcript, and/or encoded protein identified in Tables 1-2, which method comprises administering to said human subject a therapeutically or prophylactically effective amount of one or more agents (e. g. statins) counteracting the effects of the disorder, such as by inhibiting (or stimulating) the activity of the gene, transcript, and/or encoded protein identified in Tables 1-2.

Another aspect of this invention is. a method, for identifying an agent useful in therapeutically or prophylactically treating cardiovascular disorders, particular acute coronary events, in a human subject wherein said human subject harbors a SNP, gene, transcript, and/or encoded protein identified mTables 1-2, which method comprises' contacting the gene, transcript, or-encoded protein with a candidate agent (e. g., statin) under conditions suitable to allow formation of a binding complex between the gene, transcript, or encoded protein and the candidate agent (such as a statin) and detecting the formation of the binding complex, wherein. the presence of the. complex identifies said agent.

Another aspect of this invention is a method for treating a cardiovascular disorder in a human subject, which method comprises: (i) determining that said human subject harbors a SNP, gene, transcript, and/or encoded protein identified in Tables 1-2, and (ii) administering to said subject a therapeutically or prophylactically effective amount of one or more agents (such as a statin) counteracting the effects of the disease.

Many other uses and advantages of the present invention will be apparent to those skilled in the art upon review of the detailed description of the preferred embodiments herein. Solely for clarity of discussion, the invention is described in the sections below by way of non-limiting examples.

DESCRIPTION OF THE FILES CONTAINED ON THE CD-R NAMED CL001559CDR

The CD-R named CL001559CDR contains the following five text (ASCII) files : 1) File SEQLIST 1559. txt provides the Sequence Listing. The Sequence Listing provides the transcript sequences (SEQ ID NOS: 1-517) and protein sequences (SEQ ID NOS: 518-1034) as shown in Table 1, and genomic sequences (SEQ ID NOS: 13,194-13, 514) as shown in Table 2, for each gene that contains one or more SNPs of the present invention. Also provided in the Sequence Listing are context sequences flanking each SNP, including both transcript-based context sequences as shown in Table 1 (SEQ ID NOS: 1035-13, 193) and genomic-based context sequences as shown in Table 2 (SEQ ID NOS: 13, 515-85, 090). The context sequences generally provide 100bp upstream (5') and 100bp downstream (3') of each SNP, with'the SNP in the middle of the context sequence, for a total of 200bp of context sequence surrounding each SNP. File SEQLIST 1559. txt is 56,606 KB in size, and was created on November 18, 2004.

2) File TABLE1_1559. txt., provides Table 1. File. TABLED ! 559. txt is 9, 85 : KB in size, and was created on November 17,2004.

3) File TABLE2_1559. txt provides Table 2. File TABLE2_1559. txt is 52, 843 KB in size, and was created on November 18, 2004.

4) File TABLE3_1559. txt provides Table 3. File TABLE3_1559. txt is 59 KB in size, and was created on November 17,2004.

5) File TABLE4-1559. txt provides Table 4. File TABLE4_1559. txt is 105 KB in size, and was created on November 18,. 2004.

The material contained on the CD-R labeled CL001559CDR is hereby incorporated by reference pursuant to 37 CFR 1.77 (b) (4).

DESCRIPTION OF TABLE 1 AND TABLE 2 Table 1 and Table 2 (both provided on the CD-R) disclose the SNP and associated gene/transcript/protein information of the present invention. For each gene, Table 1 and Table 2 each provide a header containing gene/transcript/protein information, followed by a transcript and protein sequence (in Table 1) or genomic sequence (in Table 2), and then SNP information regarding each SNP found in that gene/transcript.

NOTE: SNPs may be included in both Table 1 and Table 2; Table 1 presents the SNPs relative to their transcript sequences and encoded protein sequences, whereas Table

2 presents the SNPs relative to their genomic sequences (in some instances Table 2 may also include, after the last gene sequence, genomic sequences of one or more intergenic regions, as well as SNP context sequences and other SNP information for any SNPs that lie within these intergenic regions). SNPs can readily be cross-referenced between Tables based on their hCV (or, in some instances, hDV) identification numbers.

The gene/transcript/protein information includes: - a gene number (1 through n, where n = the total number of genes in the Table) - a Celera hCG and UID internal identification numbers for the gene - a Celera hCT and UID internal identification numbers for the transcript (Table 1 only) - a public Genbank accession number (e. g., RefSeq NM number) for the transcript (Table 1 only) - a Celera hCP and UID internal identification numbers for the protein encoded by the hCT transcript (Table 1 only) - a public Genbank accession number (e. g., RefSeq NP number) for the protein (Table 1 only) - an art-known gene symbol - an art-known gene/protein name - Celera genomic axis position (indicating start nucleotide position-stop nucleotide position) - the chromosome number of the chromosome on which the gene is located - an OMIM (Online Mendelian Inheritance in Man; Johns Hopkins UniversitylNCBl) public reference number for obtaining further information regarding the medical significance of each gene - alternative gene/protein name (s) and/or symbol (s) in the OMIM entry NOTE: Due to the presence of alternative splice forms, multiple transcript/protein entries can be provided for a single gene entry in Table 1; i. e. , for a single Gene Number, multiple entries may be provided in series that differ in their transcript/protein information and sequences.

Following the gene/transcript/protein information is a transcript sequence and protein sequence (in Table 1), or a genomic sequence (in Table 2), for each gene, as follows: - transcript sequence (Table 1 only) (corresponding to SEQ ID NOS: 1-517 of the Sequence Listing), with SNPs identified by their IUB codes (transcript sequences can include 5'UTR, protein coding, and 3'UTR regions). (NOTE: If there are differences between the nucleotide sequence of the hCT transcript and the corresponding public transcript sequence identified by the Genbank accession number, the hCT transcript sequence (and encoded protein) is provided, unless the public sequence is a RefSeq transcript sequence identified by an NM number, in. which case the RefSeq NM transcript sequence (and encoded protein) is provided. However, whether the hCT transcript or RefSeq NM transcript is used as the transcript sequence, the disclosed SNPs are represented by their IUB codes within the transcript.) - the encoded protein sequence (Table 1 only) (corresponding to SEQ ID NOS: 518-1034 of the Sequence Listing) - the genomic sequence of the gene (Table 2 only), including 6kb on each side of the gene boundaries (i. e. , 6kb on the 5'side of the gene plus 6kb on the 3'side of the. gene) (corresponding to SEQ ID NOS: 13,194-13, 514 of the Sequence Listing).

After the last gene sequence, Table 2 may include additional genomic sequences of intergenic regions (in such instances, these sequences are identified as"Intergenic region :" followed by a numerical identification number), as well as SNP context sequences and other SNP information for any SNPs that lie within each intergenic region (and such SNPs are identified as"INTERGENIC"for SNP type).

NOTE: The transcript, protein, and transcript-based SNP context sequences are provided in both Table 1 and in the Sequence Listing. The genomic and genomic-based SNP context sequences are provided in both Table 2 and in the Sequence Listing. SEQ ID NOS are indicated in Table 1 for each transcript sequence (SEQ ID NOS: 1-517), protein sequence (SEQ ID NOS: 518-1034), and transcript-based SNP context sequence (SEQ ID NOS: 1035-13, 193), and SEQ ID NOS are indicated in Table 2 for each genomic sequence (SEQ ID NOS: 13,194-13, 514), and genomic-based SNP context sequence (SEQ ID NOS: 13, 515-85, 090).

The SNP information includes: - context sequence (taken from the transcript sequence in Table 1, and taken from the genomic sequence in Table 2) with the SNP represented by its IUB code, including 100 bp upstream (5') of the SNP position plus 100 bp downstream (3') of the SNP position (the transcript-based SNP context sequences in Table 1 are provided in the Sequence Listing as SEQ ID NOS: 1035-13,193 ; the genomic-based SNP context sequences in Table 2 are provided in the Sequence Listing as SEQ ID NOS: 13,515- 85,090).

-. Celera hCV internal identification number for the SNP (in some instances, an "hDV"number is given instead of an"hCV"number) - SNP position [position of the SNP within the given transcript sequence (Table 1) or within the given genomic sequence (Table 2) ] - SNP source (may include any. combination of one. or more of the following five codes, depending on which internal sequencing projects and/or public databases the SNP has been observed in :"Applera"= SNP observed during the re-sequencing of genes and . regulatory regions of 39 individuals, "Celera"= SNP observed during shotgun sequencing and assembly of the Celera human genome sequence, "Celera Diagnostics" SNP observed during re-sequencing of nucleic acid samples from individuals who have cardiovascular disorders (e. g. , experienced an. acute coronary event), and/or have undergone statin treatment,"dbSNP"= SNP observed in the dbSNP public database, "HGBASE"= SNP observed in the HGBASE public database, "HGMD"= SNP observed in the Human Gene Mutation Database (HGMD) public database,"HapMap"= SNP observed in the International HapMap Project public database, "CSNP"= SNP observed in an internal Applied Biosystems (Foster City, CA) database of coding SNPS (cSNPs) ) (NOTE: multiple"Applera"source entries for a single SNP indicate that the same SNP was covered by multiple overlapping amplification products and the re- sequencing results (e. g. , observed allele counts) from each of these amplification products is being provided) - Population/allele/allele count information in the format of [populationl (first allele, countlsecond allele, count) population2 (first_alleleXcountlsecond_

allele, count) total (first-allele, total countlsecond allele, total count)]. The information in this field includes populations/ethnic groups in which particular SNP alleles have been observed ("cau"= Caucasian,"his"= Hispanic, "chn"= Chinese, and"afr"= African- American,"jpn"= Japanese,"ind"= Indian, "mex"= Mexican,"ain"="American Indian,"cra"= Celera donor,"no_pop"= no population information available), identified SNP alleles, and observed allele counts (within each population group and total allele counts), where available ["-"in the allele field represents a deletion allele of an insertion/deletion ("indel") polymorphism (in which case the corresponding insertion allele, which may be comprised of one or more nucleotides, is indicated in the allele field on the opposite side of the"") ; "-"in the count field indicates that allele count information is not available]. For certain SNPs from the public dbSNP database, population/ethnic information is indicated as follows (this population information is publicly available in dbSNP) :"HISP1"-human individual DNA (anonymized samples) from 23 individuals of self-described-HISPANIC heritage ;"PAC1"= human individual DNA (anonymized samples) from 24 individuals of self-described PACIFIC RIM heritage ;"CA1"= human individual DNA (anonymized samples) from 31 individuals of self-described CAUCASIAN heritage ;"AFR1"= human individual DNA (anonymized samples) from 24 individuals of self-described AFRICAN/AFRICAN AMERICAN heritage ;"P1"= human individual DNA (anonymized samples) from 102 individuals ofself-described'heritage ;"PA130299515" ;"SC12A"= SANGER 12 DNAs of Asian origin from Corielle cell repositories, 6 of which are male and 6 female; "SC12C"= SANGER 12 DNAs of Caucasian origin from Corielle cell repositories from the CEPH/UTAH library. Six male and 6 female ;"SC12AA"= SANGER 12 DNAs of African-American origin from Corielle cell repositories 6 of which are male and 6 female ;"SC_95_C"= SANGER 95 DNAs of Caucasian origin from Corielle cell repositories from the CEPHIUTAH library; and"SC12CA"= Caucasians-12 DNAs from Corielle cell repositories that are from the CEPH/UTAH library. Six male and 6 female.

NOTE: For SNPs of"Applera"SNP source, genes/regulatory regions of 39 individuals (20 Caucasians and 19 African Americans) were re-sequenced and, since each SNP position is represented by two chromosomes in each individual (with the exception

of SNPs on X and Y chromosomes in males, for which each SNP position is represented by a single chromosome), up to 78 chromosomes were genotyped for each SNP position.

Thus, the sum of the African-American ("afr") allele counts is up to 38, the sum of the Caucasian allele counts ("cau") is up to 40, and the total sum of all allele counts is up to 78.

(NOTE: semicolons separate population/allele/count information corresponding to each indicated SNP source; i. e. , if four SNP sources are indicated, such as"Celera", "dbSNP", "HGBASE", and"HGMD", then population/allele/count information is provided in four groups which are separated by semicolons and listed in the same order as the listing of SNP sources, with each population/allele/count information group corresponding to the respective SNP source based on order; thus, in this example, the first population/allele/count information group would correspond to the first listed SNP source (Celera) and the third populatiori/allele/count information'group separated by semicolons would correspond to the third listed SNP source (HGBASE) ; if population/allele/count information is not available for any particular SNP source, then a pair of semicolons is still inserted as a place-holder in order to maintain correspondence between the list of SNP sources and the corresponding listing of population/allele/count information) - SNP type (e. g. , location within gene/transcript and/or predicted functional effect) ["MIS-SENSE MUTATION"= SNP causes a change in the encoded amino acid (i. e. , a non-synonymous coding SNP) ; "SILENT MUTATION"= SNP does not cause a change in the encoded amino acid (i. e. , a synonymous coding SNP);"STOP CODON MUTATION"= SNP is located in a stop codon ;"NONSENSE MUTATION"= SNP creates or destroys a stop codon ;"UTR 5"= SNP is located in a 5'UTR of a transcript; "UTR 3"= SNP is located in a 3'UTR of a transcript;"PUTATIVE UTR 5"= SNP is located in a putative 5'UTR ; "PUTATIVE UTR 3"= SNP is located in a putative 3' UTR;"DONOR SPLICE SITE"= SNP is located in a donor splice site (5'intron boundary);"ACCEPTOR SPLICE SITE"= SNP is located in an acceptor splice site (3' intron boundary);"CODING REGION"= SNP is located in a protein-coding region of the transcript;"EXON"= SNP is located in an exon ;"INTRO"= SNP is located in an intron ; "hmCS"= SNP is located in a human-mouse conserved segment;"TFBS"= SNP

is located in a transcription factor binding site ;"UNKNOWN"= SNP type is not defined; "INTERGENIC"= SNP is intergenic, i. e. , outside of any gene boundary] - Protein coding information (Table 1 only), where relevant, in the format of [protein SEQ ID NO : #, amino acid position, (amino acid-1, codonl) (amino acid-2, codon2) ]. The information in this field includes SEQ ID NO of the encoded protein sequence, position of the amino acid residue within the protein identified by the SEQ ID NO that is encoded by the codon containing the SNP, amino acids (represented by one- letter amino acid codes) that are encoded by the alternative SNP alleles (in the case of stop codons, "X"is used for the one-letter amino acid code), and alternative codons containing the alternative SNP nucleotides which encode the amino acid residues (thus, for example, for missense mutation-type SNPs ; at least two different amino acids and at least two different codons are generally indicated; for silent mutation-type SNPs, one amino acid and at least two different codons are generally indicated, etc.). In instances where the SNP is located outside of a protein-coding region (e. g. , in a UTR region), "None"is indicated following the protein SEQ ID NO.

DESCRIPTION OF TABLE 3 AND TABLE 4 Tables 3 and 4 (both provided on the CD-R) provide a list of a subset of SNPs from Table 1 (in the case of Table 3) or Table 2 (in the case of Table 4) for which the SNP source falls into one of the following three categories: 1) SNPs for which the SNP source is only"Applera"and none other, 2) SNPs for which the SNP source is only "Celera Diagnostics"and none other, and 3) SNPs for which the SNP source is both "Applera"and"Celera Diagnostics"but none other.

These SNPs have not been observed in any of the public databases (dbSNP, HGBASE, and HGMD), and were also not observed during shotgun sequencing and assembly of the Celera human genome sequence (i. e.,"Celera"SNP source). Tables 3 and 4 provide the hCV identification number (or hDV identification number for SNPs having"Celera Diagnostics"SNP source) and the SEQ ID NO of the context sequence for each of these SNPs.

DESCRIPTION OF TABLE 5

Table 5 provides sequences (SEQ ID NOS: 85,091-85, 702) of primers that have been synthesized and used in the laboratory to carry out allele-specific PCR reactions in order to assay the SNPs disclosed in Tables 6-15 during the course of association studies to verify the association of these SNPs with cardiovascular disorders (particularly acute coronary events such as myocardial infarction and stroke) and statin response.

Table 5 provides the following: - the column labeled"Marker"provides an hCV identification number for each SNP site - the column labeled"Alleles"designates the two alternative alleles at the SNP site identified by the hCV identification number that are targeted by the allele-specific primers (the allele-specific primers are shown as"Sequence A"and"Sequence B") [NOTE: Alleles may be presented in Table 5 based on a different orientation (i. e. , the reverse complement) relative to how the same alleles are presented in Tables 1-2].

- the column labeled"Sequence A (allele-specific. primer)"provides an allele- specific primer that is specific for an allele designated in the"Alleles"column - the column labeled"Sequence B (allele-specific primer) "provides an allele- specific primer that is specific for the'other allele designated in the"Alleles"column - the column labeled"Sequence C (common primer) "provides a common primer that is used in conjunction with each of the allele-specific primers (the"Sequence A" primer and the"Sequence B"primer) and which hybridizes at a site away from the SNP. position.

All primer sequences are given in the 5'to 3'direction.

Each of the nucleotides designated in the"Alleles"column matches or is the reverse complement of (depending on the orientation of the primer relative to the designated allele) the 3'nucleotide of the allele-specific primer (either"Sequence A"or "Sequence B") that is specific for that allele.

DESCRIPTION OF TABLES 6-15 Tables 6-15 provide results of statistical analyses for SNPs disclosed in Tables 1- 4 (SNPs can be cross-referenced between tables based on their hCV identification numbers), and the association of these SNPs with various cardiovascular disease clinical

endpoints or drug response traits. The statistical results shown in Tables 6-15 provide support for the association of these SNPs with cardiovascular disorders, particularly acute coronary events such as myocardial infarction and stroke, and/or the association of these SNPs with response to statin treatment, such as statin treatment administered as a preventive treatment for acute coronary events. For example, the statistical results provided in Tables 6-15 show that the association of these SNPs with acute coronary events and/or response to statin treatment is supported by p-values < 0.05 in an allelic association test.

Table 6 presents statistical associations of SNPs with various trial endpoints.

Table 7 presents statistical associations of SNPs with clinical variables such as lab tests at base line and at the end of a trial.. Table 8 presents statistical, associations of SNPs with cardiovascular endpoints prevention (SNPs predictive response to statins as a preventive treatment). Table 9 shows the association of SMs with adverse coronary^ events : such as RMI and stroke in CARE samples. This association of certain SNPs with adverse coronary events could also be replicated by comparing associations in samples between initial analysis and replication (see example section). Table 10 shows association of SNPs predictive of statin response with cardiovascular events prevention under statin treatment, justified by stepwise logistic regression analysis with an adjustment for conventional risk factors such as age, sex, smoking status, baseline glucose levels, body mass index (BMI), history of hypertension, etc (this adjustment supports independence of the SNP association from conventional risk factors). The statistical results provided in Table 11 demonstrate association of a SNP in the CD6 gene that is predictive of statin response in the prevention of RMI, justified as a significant difference in risk associated with the SNP between placebo and Statin treated strata (Breslow Day p-values < 0.05). Table 11 presents the results observed in samples taken from both the CARE and WOSCOP studies. In both studies the individuals homozygous for the minor allele were statistically different from heterozygous and major allele homozygous individuals in the pravastatin treated group vs. the placebo treated group.

Table 12 shows the association of a SNP in the FCAR gene that is predictive of MI risk and response to statin treatment. Individuals who participated in both the CARE and WOSCOPS studies, who did not receive pravastatin treatment and who were

heterozygous or homozygous for the major allele had a significantly higher risk of having an MI vs. individuals who were homozygous for the minor allele. However, individuals in the CARE study who were heterozygous or homozygous for the FCAR major allele were also statistically significantly protected by pravastatin treatment against an adverse coronary event relative to the individuals homozygous for the minor allele.

NOTE: SNPs can be cross-referenced between all tables herein based on the hCV identification number of each SNP. However, eleven of the SNPs that are included in the tables may possess two different hCV identification numbers, as follows: - hCV15871020 is equivalent to hCV22273027 - hCV15962586 is equivalent to hCV22274323 -hCV16192174 is equivalent to hCV22271999 - hCV22273204 is equivalent to hCV16179443 .-hCV25617571 is equivalent to hCV15943347.

- hCV25637308 is equivalent to hCV27501-445 - hCV25637309 is equivalent to hCV27469009 - hCV25640926 is equivalent to hCV9485713 -hCV7499900 is equivalent to hCV25620145 - hCV16172571 is equivalent to hCV25474627 - hCV16273460 is equivalent to hCV26165616 Table 6 column Definition heading Public Locus Link HUGO approved gene symbol for the gene that contains the tested SNP Marker Internal hCV identification number for the tested SNP Stratum Subpopulation used for analysis Phenotype Disease endpoints (definitions of entries in this column are provided below) Overall* Result of the Overall Score Test (chi-square test) for the logistic Chi-square Test: regression model in which the qualitative phenotype is a statistic/function of SNP genotype (based on placebo patients only) p-value SNP effect** Result of the chi-square test of the SNP effect (based on the Chi-square Test: logistic regression model for placebo patients only) statistic/ p-value Placebo Patients"n"is the number of placebo patients with no rare alleles n/total (%) genotype for investigated phenotype. The"total"is the total 0 Rare Alleles number of placebo patients with this genotype, and"%"is the percentage of placebo patients with this genotype. Placebo Patients"n"is the number of placebo patients with one rare allele n/total (%) genotype for investigated phenotype. The"total"is the total 1 Rare Allele number of placebo patients with this genotype, and"%"is the percentage of placebo patients with this genotype. Placebo Patients"n"is the number of placebo patients with two rare alleles n/total (%) genotype for investigated phenotype. The"total"is the total 2 Rare Alleles number of placebo patients with this genotype, and"%"is the percentage of placebo patiehts"with mis genotype. - Odd Ratio (95% C1)"Odds ratio"indicates the odds of having this phenotype given 2 Rare Alleles vs. that genotype contains two rare alleles of a SNP versus the odds 0 Rare Alleles of having this phenotype given a genotype containing no rare alleles. "95% Cl" is the 95% confidence interval. v..-. ; .. Odd Ratio (95% C1)"Odds ratio"indicates the odds of having this phenotype given 1 Rare Alleles vs. that genotype contains one rare allele versus the odds of having 0 Rare Alleles this phenotype given a genotype containing no rare alleles. "95% Cl" is the 95% confidence interval Significance Level"Significance Level"indicates the summary of the result of the "Overall Score Test (chi-square test) "for the logistic regression model and the result of the"chi-square test of the SNP effect". If both p-values are less than 0.05,"<0. 05" is indicated. If both p- values are less than 0.005,"<0. 005" is indicated. Definition Table 7 column heading Public Locus Link HUGO approved gene symbol for the gene that contains the tested SNP Marker Internal hCV identification number for the tested SNP Stratum Subpopulation used for analysis Phenotype (at Clinical quantitative variables-lab test results at baseline or Baseline) change from baseline discharge (definitions of entries in this column are provided below) Overall* Results of the Overall F-Test for the analysis of variance model F-Test: in which the quantitative phenotype is a function of SNP statistic/genotype (based on placebo patients only) 3-value SNP effect** Results of the F-test of the SNP effect (based on the analysis of F-Test : variance model for placebo patients only) statistic/ p-value Placebo Patients"n"is the number of placebo patients with a tested SNP Mean (se) # (N) genotype (zero rare alleles) and presented phenotype."Mean"is 0 Rare Alleles the least squares estimate of the mean phenotype result for placebo patients with this genotype."se"is the least squares estimate of the standard error of the mean phenotype for placebo patients with 0 rare allele genotype Placebo Patients"n"is the number of placebo patients with a tested SNP ted'n (se) # (N) genotype (one rare allele) and presented phenotype. Mean is the' 1 Rare Allele least squares estimate of the mean phenotype result for placebo patients with this genotype. se, is the least squares estimate of the standard error of the mean phenotype for placebo patients 1 rare allele genotype Placebo Patients"n"is the number of placebo patients with a tested SNP Mean (se) # (N) genotype (one rare allele) and presented phenotype. Mean is the 2 Rare Alleles least squares estimate of the mean phenotype result for placebo patients with this genotype. se is the least squares estimate of the standard error of the mean phenotype for placebo patients 2 rare alleles genotype Significance Level"Significance Level"indicates the summary of the result of the "Overall F-Test"for the analysis of variance model and the result of the"F-test of the SNP effect". If both p-values are less than 0.05,"<0. 05" is indicated. If both p-values are less than 0.005, "<0.005" is indicated Table 8 column Definition heading Public Locus Link HUGO approved gene symbol for the gene that contains the tested SNP Marker Internal hCV identification number for the tested SNP Stratum Subpopulation used for analysis WO 2005/056837 PCT/US2004/039576 Phenotype Disease endpoints (definitions of entries in this column are provided below) Overall* Results of the Overall Score Test (chi-square test) for the Chi-square Test: regression model in which the qualitative phenotype is a statistic/function of the SNP genotype, treatment group, and the p-value interaction between SNP genotype and treatment group Interaction Effect** Results of the chi-square test of the interaction between SNP Chi-square Test: genotype and treatment group (based on the logistic regression statistic/model). p-value . 0 Rare Alleles Results for patients under pravastatin keatment."n"is the n/total (%) number of pravastatin patients with no rare allele genotype and Prava the investigated phenotype. e. The"total"is the total number of pravastatin patients with this genotype."%"is the percentage of pravastatin patients. with this genotype who. had the investigated phenotype. 0 Rare Alleles Results for patients under placebo."n"is the number of placebo n/total (%) patients with no rare allele genotype and investigated phenotype. Placebo"Total"is the total number of placebo patients with the genotype. "%"is the percentage of placebo, patients with no rare allele genotype and the investigated phenotype. 1 Rare Allele Results for patients under pravastatin treatment."n"is the nltotal (%) number of patients under pravastatin with one rare allele Prava genotype and the investigated phenotype. The"total"is the total number of pravastatin patients with the genotype. "%"is the percentage of pravastatin patients with one rare allele genotype and the investigated phenotype. 1 Rare Allele Results for patients on placebo."n"is the number of placebo n/total (%) patients with one rare allele genotype and the investigated Placebo phenotype. The"total"is the total number of pravastatin patients with the genotype. "%"is the percentage of pravastatin patients with one rare allele genotype and the investigated phenotype. 2 Rare Alleles Results for patients under pravastatin treatment."n"is the n/total (%) number of patients under pravastatin with two rare allele Prava genotype and the investigated phenotype. The"total"is the total number of pravastatin patients with the genotype. "%"is the percentage of pravastatin patients with two rare allele genotypes and the investigated phenotype 2 Rare Alleles Results for patients on placebo."n"is the number of placebo n/total (%) patients with two rare allele genotype and the investigated Placebo phenotype. The"total"is the total number of pravastatin patients with the genotype."%"is the percentage of pravastatin patients with two rare allele genotypes and the investigated phenotype Prava vs Placebo Odds ratio and its 95% confidence interval for patients with no Odds Ratio rare allele genotype, the odd ratios of having the event given (95% Cl) pravastatin use versus the odds of having the event on placebo 0 Rare Alleles Prava vs Placebo Odds ratio and its 95% con pro Odds Ratio rare allele genotype, the odd ratios of having the event given (95% Cl) pravastatin use versus the odds of having the event on placebo t Rare Allele Prava vs Placebo Odds ratio and its 95% confidence interval for patients with two. Odds Ratio rare alleles genotype, the odd ratio of having the event given (95% Cl) pravastatin use versus the odds of having the event on placebo 2 Rare Alleles Significance Level"Significance Level"indicates the summary of the result of the "Overall Score Test (chi-square test)"for the regression model and the result of the"chi-square test of the interaction". If both p-values are less than 0.05,"<0. 05"is indicated. If both p- values are less than 0.005,"<0. 005" is indicated. Table 9 column Definition heading Endpoint Endpoint measured in study Public Locus Link HUGO approved gene symbol for the gene that contains the tested SNP Marker Internal hCV identification number for the SNP that is tested Genotype/mode Effect seen in major homozygous ("Maj. Hom"), minor homozygous ("Min Hom") or heterozygous (Het")/recessive ("Rec") or dominant ("Dom") Strata Indicates whether the analysis of the dataset has been stratified by genotypes, such as major homozygote ("Maj Hom"), minor homozygote ("Min Hom"), and heterozygote ("Het") Confounders Variables that change the marker risk estimates by 5% P risk est. Significance of risk estimated by Wald Test RR Relative risk 95% Cl 95% confidence interval for relative risk case Number of patients (with the corresponding genotype or mode) developed recurrent MI or Stroke during 5 years follow up Case AF (%) The allele frequency of patients (with the corresponding genotype or mode) that developed recurrent MI during 6 years follow up Control Number of patients (with the corresponding genotype or mode) that had MI C. ontrol AF (%) The allele frequency of patients (with the corresponding genotype or mode) that had MI Analysis 1 Statistics are based on initial analysis (see examples). Analysis 2 Statistics ar based on replication analysis (see examples) Table 10 See Table footnotes and Examples section Table 11 See Table footnotes and Examples section Table 12 See Table footnotes and Examples section Table 13 See Table footnotes and Examples section Table 14 See Table footnotes and Examples section Table 15 See Table footnotes and Examples section Definition of entries in the"Phenotype"column of Table 6: Phenotype Definite Nonfatal MI Fatal CHD/Definite Nonfatal Mi CARE MI : Q-Wave Mi Mi (Fatal/Nonfatal) Fatal Coronary Heart Disease Total Mortality Cardiovascular Mortality Fatal Atherosclerotic Cardiovascular Disease History of Diabetes Stroke Percutaneous Transluminal Coronary Angioplasty Hosp. for Cardiovascular Disease Fatal/Nonfatal Cerebrovascular Disease Hosp. for Unstable Angina Total Cardiovascular Disease Events Any Report of Stroke Prior to or During CARE Any Report of Stroke During CARE 1 st Stroke Occurred During CARE Fatal/Nonfatal Mi (def & prob) History of Congestive Heart Failure (AE) Nonfatal Mit (Probable/Definite) Nonfatal MI def & rob Fatal/Nonfatal Atherosclerotic CV Disease Coronary Artery Bypass Graft Coronary Artery Bypass or Revascularization Congestive Heart Failure Hosp. for Peripheral Arterial Disease History of Coronary Artery Bypass Graft CARE MI : Non Q-Wave Mi Fatal MI History of Percutaneous Transluminal Coronary Angioplasty Catheterization Total Coronary Heart Disease Events History of Angina Pectoris More Than 1 Prior MI Family History of CV Disease History of Hypertension History of Stroke Definition of entries in the"Phenotype (at Baseline)"column of Table 7: Phenotype (at Base) ine) Change from Baseline in Urinary Glucose (at LOCF) Change from Baseline in Urinary Glucose (at LOCF) Baseline HDL Baseline Lymphocytes, Absolute (k/cumm) Baseline HDL Definition of entries in the"Phenotype"column of Table 8: Phenotype Catheterization Nonfatal MI (Probable/Definite) Nonfatal Mi (def & prob) Family History of CV Disease MI (Fatal/Nonfatal) Definite Nonfatal Ml Fatal/Nonfatal Mi (def & prob) Fatal Coronary Heart Disease Total Mortality Total Coronary Heart Disease Events Cardiovascular Mortality Fatal Atherosclerotic Cardiovascular Disease Fatal/Nonfatal Atherosclerotic CV Disease Hosp. for Cardiovascular Disease Total Cardiovascular Disease Events History of Angina Pectoris Fatal CHD/Definite Nonfatal Ml Coronary Artery Bypass or Revascularization Coronary Artery Bypass Graft Hospitalization for Unstable Angina <BR> <BR> Percutaneous Transluminal Coronary Angioplasts Fatal/Nonfatal Cerebrovascular Disease Stroke

DESCRIPTION OF THE FIGURE Figure 1 provides a diagrammatic representation of a computer-based discovery system containing the SNP information of the present invention in computer readable form.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides SNPs associated with cardiovascular disorders, particularly acute coronary events such as myocardial infarction and stroke (including

recurrent acute coronary events such as recurrent myocardial infarction), and SNPs that are associated with an individual's responsiveness to therapeutic agents, particularly lipid-lowering compounds such as statins, that are used for the treatment (including preventive treatment) of cardiovascular disorders, particularly treatment of acute ) coronary events. The present invention further provides nucleic acid molecules containing these SNPs, methods and reagents for the detection of the SNPs disclosed herein, uses of these SNPs for the development of detection reagents, and assays or kits that utilize such reagents. The acute coronary event-associated SNPs and statin response- associated SNPs disclosed herein are useful for diagnosing, screening for, and evaluating an individual's increased or decreased risk of developing cardiovascular disease as well as their responsiveness to drug treatment. Furthermore, such SNPs and their encoded products are useful targets for the development of therapeutic agents.

A large number of SNPs have been identified from re-sequencing DNA from 39 individuals, and they are indicated as"Applera"SNP source in Tables 1-2. Their allele frequencies observed in each of the Caucasian and African-American ethnic groups are provided. Additional SNPs included herein were previously identified during shotgun sequencing and assembly of the human genome, and they are indicated as"Celera"S. NP source in Tables 1-2. Furthermore, the information provided in Table 1-2, particularly the allele frequency information obtained from 39 individuals and the identification of the precise position of each SNP within each gene/transcript, allows haplotypes (i. e. , groups of SNPs that are co-inherited) to be readily inferred. The present invention encompasses SNP haplotypes, as well as individual SNPs.

Thus, the present invention provides individual SNPs associated with cardiovascular disorders, particularly acute coronary events, and SNPs associated with responsiveness to statin for the treatment of cardiovascular diseases, as well as combinations of SNPs and haplotypes in genetic regions associated with cardiovascular disorders and/or statin response, polymorphic/variant transcript sequences (SEQ ID NOS: 1-517) and genomic sequences (SEQ ID NOS: 13,194-13, 514) containing SNPs, encoded amino acid sequences (SEQ ID NOS: 518-1034), and both transcript-based SNP context sequences (SEQ ID NOS: 1035-13,193) and genomic-based SNP context sequences (SEQ ID NOS: 13,515-85, 090) (transcript sequences, protein sequences, and

transcript-based SNP context sequences are provided in Table 1 and the Sequence Listing ; genomic sequences and genomic-based SNP context sequences are provided in Table 2 and the Sequence Listing), methods of detecting these polymorphisms in a test sample, methods of determining the risk of an individual of having or developing a cardiovascular disorder such as an acute coronary event, methods of determining response to statin treatment of cardiovascular disease, methods of screening for compounds useful for treating cardiovascular disease, compounds identified by these screening methods, methods of using the disclosed SNPs to select a treatment strategy, methods of treating a disorder associated with a variant gene/protein (i. e. , therapeutic methods), and methods of using the SNPs of the present invention for human identification.

Since cardiovascular disorders/diseases share certain similar features that may be due to common genetic factors. that are involved in their underlying mechanisms, the SNPs identified herein as being particularly associated with acute coronary events arid% or statin response may be used as diagnostic/prognostic markers or therapeutic targets for a broad spectrum of cardiovascular diseases such as coronary heart disease (CHD), atherosclerosis, cerebrovascular disease, congestive heart failure, congenital heart disease, and pathologies and symptoms associated with various heart diseases (e. g., angina, hypertension), as well as for predicting responses to drugs other than statins that are used to treat cardiovascular diseases.

The present invention further provides methods for selecting or formulating a treatment regimen (e. g. , methods for determining whether or not to administer statin treatment to an individual having cardiovascular disease, methods for selecting a particular statin-based treatment regimen such as dosage and frequency of administration of statin, or a particular form/type of statin such as a particular pharmaceutical formulation or compound, methods for administering an alternative, non-statin-based treatment to individuals who are predicted to be unlikely to respond positively to statin treatment, etc. ), and methods for determining the likelihood of experiencing toxicity or other undesirable side effects from statin treatment, etc. The present invention also provides methods for selecting individuals to whom a statin or other therapeutic will be administered based on the individual's genotype, and methods for selecting individuals for

a clinical trial of a statin or other therapeutic agent based on the genotypes of the individuals (e. g. , selecting individuals to participate in the trial who are most likely to respond positively from the statin treatment).

The present invention provides novel SNPs associated with cardiovascular disorders and/or response to statin treatment, as well as SNPs that were previously known in the art, but were not previously known to be associated with cardiovascular disorders and/or statin response. Accordingly, the present invention provides novel compositions and methods based on the novel SNPs disclosed herein, and also provides novel methods of using the known, but previously unassociated, SNPs in methods relating to evaluating an individual's likelihood of having or developing a cardiovascular disorder, predicting the likelihood of an individual experiencing a reoccurrence of a cardiovascular disorder (e. g. , experiencing recurrent myocardial ihfarctions), prognosing the severity of a cardiovascular disorder in an individual, or prognosing an individual's recovery from a cardiovascular disorder, and methods relating to evaluating an individual's likelihood of responding to statin treatment for cardiovascular disease. In Tables 1-2, known SNPs are identified based on the public database in which they have been observed, which is indicated as one or more of the following SNP types:"dbSNP"= SNP observed in dbSNP, "HGBASE"= SNP observed in HGBASE, and"HGMD"= SNP observed in the Human Gene Mutation Database (HGMD). Novel SNPs for which the SNP source is only"Applera"and none other, i. e. , those that have not been observed in any public databases and which were also not observed during shotgun sequencing and assembly of the Celera human genome sequence (i. e. ,"Celera"SNP source), are indicated in Tables 3-4.

Particular SNP alleles of the present invention can be associated with either an increased risk of having a cardiovascular disorder (e. g. , experiencing an acute coronary event) or of responding to statin treatment of cardiovascular disease, or a decreased likelihood of having a cardiovascular disorder or of responding to statin treatment of cardiovascular disease. Thus, whereas certain SNPs (or their encoded products) can be assayed to determine whether an individual possesses a SNP allele that is indicative of an increased likelihood of experiencing a coronary event or of responding to statin treatment, other SNPs (or their encoded products) can be assayed to determine whether

an individual possesses a SNP allele that is indicative of a decreased likelihood of experiencing a coronary event or of responding to statin treatment. Similarly, particular SNP alleles of the present invention can be associated with either an increased or decreased likelihood of having a reoccurrence of a cardiovascular disorder, of fully recovering from a cardiovascular disorder, of experiencing toxic effects from a particular treatment or therapeutic compound, etc. The term"altered"may be used herein to encompass either of these two possibilities (e. g. , an increased or a decreased risk/likelihood). SNP alleles that are associated with a decreased risk of having or developing a cardiovascular disorder such as myocardial infarction may be referred to as "protective"alleles, and SNP alleles that are associated with an increased risk of having or developing a cardiovascular disorder may be referred to as"susceptibility"alleles, "risk"alleles, or"risk factors".

Those skilled in the art will readily recognize that nucleic acid molecules may be double-stranded molecules and that reference to a particular site on one strand refers, as well, to the corresponding site on a complementary strand. In defining a SNP position, SNP allele, or nucleotide sequence, reference to an adenine, a thymine (uridine), a cytosine, or a guanine at a particular, site on one strand of a nucleic acid molecule also defines the thymine (uridine), adenine, guanine, or cytosine (respectively) at the corresponding site on a complementary strand of the nucleic acid molecule. Thus, reference may be made to either strand in order to refer to a particular SNP position, SNP allele, or nucleotide sequence. Probes and primers, may be designed to hybridize to either strand and SNP genotyping methods disclosed herein may generally target either strand. Throughout the specification, in identifying a SNP position, reference is generally made to the protein-encoding strand, only for the purpose of convenience.

References to variant peptides, polypeptides, or proteins of the present invention include peptides, polypeptides, proteins, or fragments thereof, that contain at least one amino acid residue that differs from the corresponding amino acid sequence of the art- known peptide/polypeptide/protein (the art-known protein may be interchangeably referred to as the"wild-type","reference", or"normal"protein). Such variant peptides/polypeptides/proteins can result from a codon change caused by a nonsynonymous nucleotide substitution at a protein-coding SNP position (i. e. , a missense

mutation) disclosed by the present invention. Variant peptides/polypeptides/proteins of the present invention can also result from a nonsense mutation, i. e. a SNP that creates a premature stop codon, a SNP that generates a read-through mutation by abolishing a stop codon, or due to any SNP disclosed by the present invention that otherwise alters the structure, function/activity, or expression of a protein, such as a SNP in a regulatory region (e. g. a promoter or enhancer) or a SNP that leads to alternative or defective splicing, such as a SNP in an intron or a SNP at an exon/intron boundary. As used herein, the terms"polypeptide","peptide", and"protein"are used interchangeably.

ISOLATED NUCLEIC ACID MOLECULES AND SNP DETECTION REAGENTS & KITS Tables 1 and 2 provide a variety of information about each SNP of the present invention that is associated with cardiovascular disorders (e. g., acute coronary events such as myocardial infarction and stroke) and/or responsiveness to statin treatment, including the transcript sequences (SEQ ID NOS: 1-517), genomic sequences (SEQ ID NOS: 13,194-13, 514), and protein sequences (SEQ ID NOS: 518-1034) of the encoded gene products (with the SNPs indicated by IUB codes in the nucleic acid sequences). In addition, Tables 1 and 2 include SNP context sequences, which generally include 100 nucleotide upstream (5') plus 100 nucleotides downstream (3') of each SNP position (SEQ ID NOS: 1035-13, 193 correspond to transcript-based SNP context sequences disclosed in Table 1, and SEQ ID NOS: 13,515-85, 090 correspond to genomic-based context sequences disclosed in Table 2), the alternative nucleotides (alleles) at each SNP position, and additional information about the variant where relevant, such as SNP type (coding, missense, splice site, UTR, etc. ), human populations in which the SNP was observed, observed allele frequencies, information about the encoded protein, etc.

Isolated Nucleic Acid Molecules The present invention provides isolated nucleic acid molecules that contain one or more SNPs disclosed Table 1 and/or Table 2. Preferred isolated nucleic acid molecules contain one or more SNPs identified in Table 3 and/or Table 4. Isolated nucleic acid molecules containing one or more SNPs disclosed in at least one of Tables 1-4 may be

interchangeably referred to throughout the present text as"SNP-containing nucleic acid molecules". Isolated nucleic acid molecules may optionally encode a full-length variant protein or fragment thereof. The isolated nucleic acid molecules of the present invention also include probes and primers (which are described in greater detail below in the section entitled"SNP Detection Reagents"), which may be used for assaying the disclosed SNPs, and isolated full-length genes, transcripts, cDNA molecules, and fragments thereof, which may be used for such purposes as expressing an encoded protein.

As used herein, an"isolated nucleic acid molecule"generally is one that contains a SNP of the present invention or one that hybridizes to such molecule such as a nucleic acid with a complementary sequence, and'is separated from most other nucleic acids present in the natural source of the nucleic acid molecule. Moreover, an"isolated"nucleic acid molecule, such as a cDNA molecule containing a SNP ofthe : present invention, can be substantially free of other cellular material, or culture medium'when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized. A nucleic acid molecule can be fused to other coding or regulatory sequences and still be considered"isolated". Nucleic acidmolecules present in non-human transgenic animals, which do not naturally occur in the animal, are also considered"isolated". For example, recombinant DNA molecules contained in a vector are considered"isolated".

Further examples of"isolated"DNA molecules include recombinant DNA molecules maintained in heterologous host cells, and purified (partially or substantially) DNA molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the isolated SNP-containing DNA molecules of the present invention. Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.

Generally, an isolated SNP-containing nucleic acid molecule comprises one or more SNP positions disclosed by the present invention with flanking nucleotide sequences on either side of the SNP positions. A flanking sequence can include nucleotide residues that are naturally associated with the SNP site and/or heterologous nucleotide sequences.

Preferably the flanking sequence is up to about 500,300, 100,60, 50,30, 25,20, 15,10, 8, or 4 nucleotides (or any other length in-between) on either side of a SNP position, or as long

as the full-length gene or entire protein-coding sequence (or any portion thereof such as an exon), especially if the SNP-containing nucleic acid molecule is to be used to produce a protein or protein fragment.

For full-length genes and entire protein-coding sequences, a SNP flanking sequence can be, for example, up to about 5KB, 4KB, 3KB, 2KB, 1KB on either side of the SNP.

Furthermore, in such instances, the isolated nucleic acid molecule comprises exonic sequences (including protein-coding and/or non-coding exonic sequences), but may also include intronic sequences. Thus, any protein coding sequence may be either contiguous or separated by introns. The important point is. that the nucleic acid is isolated from remote and unimportant flanking sequences and is of appropriate length such that it can be subjected to the specific manipulations or uses described herein such-as recombinant protein expression, preparation of probes and primers for assaying the SNP position, and other uses specific to the SNP-containing nucleic acid sequences.

An isolated SNP-contammg nucleic acid molecule can comprise, for example, a full- length gene or transcript, such as a gene isolated from genomic DNA (e. g. , by cloning or PCR amplification), a cDNA molecule, or an mRNA transcript molecule. Polymorphic transcript sequences are provided in Table 1 and in the Sequence Listing (SEQ ID NOS: 1- 517), and polymorphic genomic sequences are provided in Table 2 and in the Sequence Listing (SEQ ID NOS: 13,194-13, 514). Furthermore, fragments of such full-length genes and transcripts that contain one or more SNPs disclosed herein are also encompassed by the ; present invention, and such fragments maybe used, for example, to express any part of a protein, such as a particular functional domain or an antigenic epitope.

Thus, the present invention also encompasses fragments of the nucleic acid sequences provided in Tables 1-2 (transcript sequences are provided in Table 1 as SEQ ID NOS: 1-517, genomic sequences are provided in Table 2 as SEQ ID NOS: 13,194-13, 514, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO : 1035- 13,193, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO : 13,515-85, 090) and their complements. A fragment typically comprises a contiguous nucleotide sequence at least about 8 or more nucleotides, more preferably at least about 12 or more nucleotides, and even more preferably at least about 16 or more nucleotides.

Further, a fragment could comprise at least about 18, 20,22, 25,30, 40,50, 60, 80, 100,150,

200, 250 or 500 (or any other number in-between) nucleotides in length. The length of the fragment will be based on its intended use. For example, the fragment can encode epitope- bearing regions of a variant peptide or regions of a variant peptide that differ from the normal/wild-type protein, or can be useful as a polynucleotide probe or primer. Such fragments can be isolated using the nucleotide sequences provided in Table 1 and/or Table 2 for the synthesis of a polynucleotide probe. A labeled probe can then be used, for example, to screen a cDNA library, genomic DNA library, or mRNA to isolate nucleic acid corresponding to the coding region. Further, primers can be used in amplification reactions, such as for purposes of assaying one or more SNPs sites or for cloning specific regions of a gene.

An isolated nucleic acid molecule of the present invention further encompasses a SNP-containing polynucleotide that is the product of any one of a variety of nucleic acid amplification methods, which are used to increase. the copy numbers ofapolynuclcotide of interest in a nucleic acid sample. YSuch amplification methods are well known in the ; art, and they include but are not limited to, polymerase chain reaction (PCR) (U. S. Patent Nos. 4, 683, 195; and 4,683, 202; PCR Technology : Principles and Applications forDNA Amplification, ed. H. A. Erlich, Freeman Press, NY. ; NY, 1992), ligase chain reaction (LCR) (Wu and Wallace, Genomics 4: 560, 1989 ; Landegren et al., Science 241: 1077, 1988), strand displacement amplification (SDA) (U. S. Patent Nos. 5,270, 184; and 5,422, 252), transcription-mediated amplification. (TMA) (U. S. Patent No. 5, 399, 491), linked linear amplification (LLA) (U. S. Patent No. 6,027, 923), and the like, and isothermal amplification methods such as nucleic acid sequence based amplification (NASBA), and self-sustained sequence replication (Guatelli et al., Proc. Natl. Acad. Sci.

USA 87: 1874, 1990). Based on such methodologies, a person skilled in the art can readily design primers in any suitable regions 5'and 3'to a SNP disclosed herein. Such primers may be used to amplify DNA of any length so long that it contains the SNP of interest in its sequence.

As used herein, an"amplified polynucleotide"of the invention is a SNP- containing nucleic acid molecule whose amount has been increased at least two fold by any nucleic acid amplification method performed in vitro as compared to its starting amount in a test sample. In other preferred embodiments, an amplified polynucleotide is

the result of at least ten fold, fifty fold, one hundred fold, one thousand fold, or even ten thousand fold increase as compared to its starting amount in a test sample. In a typical PCR amplification, a polynucleotide of interest is often amplified at least fifty thousand fold in amount over the unamplified genomic DNA, but the precise amount of amplification needed for an assay depends on the sensitivity of the subsequent detection method used.

Generally, an amplified polynucleotide is at least about 16 nucleotides in length.

More typically, an amplified polynucleotide is at least about 20 nucleotides in length. In a preferred embodiment of the invention, an amplified polynucleotide is at least about 30 nucleotides in length. In a more preferred embodiment of the invention, an amplified polynucleotide is at least about 32,40, 45, 50 ; or 60 nucleotides'in length, m yet another preferred embodiment of the invention, an amplified polynucleotide is at least about 100 ; 200, 300, 400, or 500 nucleotides, in length. While. the total length of an amplified polynucleotide of the invention can be as long as : an exon, an intron or the entire gene where the SNP of interest resides, an amplified product is typically up to about 1,000 nucleotides in length (although certain amplification methods may generate amplified products greater than 1000 nucleotides in length). More preferably, an amplified polynucleotide is not greater than about 600-700 nucleotides in length. It is understood that irrespective of the length of an amplified polynucleotide, a SNP of interest may be located anywhere along its sequence.

In a specific embodiment of the invention, the amplified product is at least about 201 nucleotides in length, comprises one of the transcript-based context sequences or the genomic-based context sequences shown in Tables 1-2. Such a product may have additional sequences on its 5'end or 3'end or both. In another embodiment, the amplified product is about 101 nucleotides in length, and it contains a SNP disclosed herein. Preferably, the SNP is located at the middle of the amplified product (e. g. , at position 101 in an amplified product that is 201 nucleotides in length, or at position 51 in an amplified product that is 101 nucleotides in length), or within 1,2, 3,4, 5,6, 7,8, 9, 10, 12,15, or 20 nucleotides from the middle of the amplified product (however, as indicated above, the SNP of interest may be located anywhere along the length of the amplified product).

The present invention provides isolated nucleic acid molecules that comprise, consist of, or consist essentially of one or more polynucleotide sequences that contain one or more SNPs disclosed herein, complements thereof, and SNP-containing fragments thereof.

Accordingly, the present invention provides nucleic acid molecules that consist of any of the nucleotide sequences shown in Table 1 and/or Table 2 (transcript sequences are provided in Table 1 as SEQ ID NOS: 1-517, genomic sequences are provided in Table 2 as SEQ ID NOS: 13,194-13, 514, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO : 1035-13,193, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO : 13,515-85, 090), or any nucleic acid molecule that encodes any of the variant proteins provided in Table 1 (SEQ ID NOS: 518-1034). A nucleic acid molecule consists of a : nucleotide sequence when the nucleotide : sequence is the complete nucleotide sequence of the nucleic acid molecule.

The present invention further provides nucleic acid molecules that consist essentially of any of the nucleotide sequences shown in Table 1 andXor Table, 2 (transcript sequences are provided in Table 1 as SEQ ID NOS: 1-517, genomic sequences are provided in Table 2 as SEQ ID NOS: 13,194-13, 514, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO : 1035-13, 193, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO: 13, 515-85, 090), or any nucleic acid molecule that encodes any of the variant proteins provided in Table 1 (SEQ ID NOS: 518-1034). A nucleic acid molecule consists essentially of a nucleotide sequence when such a nucleotide sequence is present with only a few additional nucleotide residues in the final nucleic acid molecule.

The present invention further provides nucleic acid molecules that comprise any of the nucleotide sequences shown in Table 1 and/or Table 2 or a SNP-containing fragment thereof (transcript sequences are provided in Table 1 as SEQ ID NOS: 1-517, genomic sequences are provided in Table 2 as SEQ ID NOS: 13,194-13, 514, transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO : 1035-13, 193, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO : 13,515-85, 090), or any nucleic acid molecule that encodes any of the variant proteins provided in Table 1 (SEQ ID NOS: 518-1034). A nucleic acid molecule comprises a nucleotide sequence when the nucleotide sequence is at least part of the final nucleotide sequence of the nucleic acid

molecule. In such a fashion, the nucleic acid molecule can be only the nucleotide sequence or have additional nucleotide residues, such as residues that are naturally associated with it or heterologous nucleotide sequences. Such a nucleic acid molecule can have one to a few additional nucleotides or can comprise many more additional nucleotides. A brief description of how various types of these nucleic acid molecules can be readily made and isolated is provided below, and such techniques are well known to those of ordinary skill in the art (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY).

The isolated nucleic acid molecules can encode mature proteins plus additional amino or carboxyl-terminal amino acids or both, or amino acids interior to the mature peptide (when the mature form has more than one peptide chain, for instance). Such sequences may play a role in processing of a protein from precursor to a mature form, facilitate protein trafficking, prolong or shorten protein half-life, or facilitate manipulation of a protein for assay or production. As generally is the case in situ, the additional amino acids may be processed away from the mature protein by cellular enzymes.

Thus, the isolated nucleic acid molecules include, but are not limited to, nucleic acid molecules having a sequence encoding a peptide alone, a sequence encoding a mature peptide and additional coding sequences such as a leader or secretory sequence (e. g., a pre- pro or pro-protein sequence), a sequence encoding a mature peptide with or without additional coding sequences, plus additional non-coding sequences, for example introns and non-coding 5'and 3'sequences such as transcribed but untranslated sequences that play a role in, for example, transcription, mRNA processing (including splicing and polyadenylation signals), ribosome binding, and/or stability of mRNA. In addition, the nucleic acid molecules may be fused to heterologous marker sequences encoding, for example, a peptide that facilitates purification.

Isolated nucleic acid molecules can be in the form of RNA, such as mRNA, or in the form DNA, including cDNA and genomic DNA, which may be obtained, for example, by molecular cloning or produced by chemical synthetic techniques or by a combination thereof (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY). Furthermore, isolated nucleic acid molecules, particularly SNP detection reagents such as probes and primers, can also be partially or

completely in the form of one or more types of nucleic acid analogs, such as peptide nucleic acid (PNA) (U. S. Patent Nos. 5,539, 082; 5,527, 675 ; 5,623, 049; 5,714, 331). The nucleic acid, especially DNA, can be double-stranded or single-stranded. Single-stranded nucleic acid can be the coding strand (sense strand) or the complementary non-coding strand (anti-sense strand). DNA, RNA, or PNA segments can be assembled, for example, from fragments of the human genome (in the case of DNA or RNA) or single nucleotides, short oligonucleotide linkers, or from a series of oligonucleotides, to provide a synthetic nucleic acid molecule. Nucleic acid molecules can be readily synthesized using the sequences provided herein as a reference; oligonucleotide and PNA oligomer synthesis techniques are well known in the art (see, e. g., Corey,"Peptide nucleic acids : expanding the scope of nucleic acid recognition", Trends Biotechnol. 1997 Jun; 15 (6): 224-9, and Hyrup et al.,"Peptide nucleic acids (PNA): synthesis, properties and potential . applications", Bioorg Med Chem. 1996 ; 0an74 (1} : 5-23). (Furthermore, large-scale automated oligonucleotide/PNA synthesis (including synthesis on an array or bead surface or other solid support) can readily be accomplished using commercially available nucleic acid synthesizers, such as the Applied Biosystems (Foster City, CA) 3900 High- Throughput DNA Synthesizer or Expedite 8909 Nucleic Acid Synthesis System, and the sequence information provided herein.

The present invention encompasses nucleic acid analogs that contain modified, synthetic, or non-naturally occurring nucleotides or structural elements or other alternative/modified nucleic acid chemistries known in the art. Such nucleic acid analogs are useful, for example, as detection reagents (e. g. , primers/probes) for detecting one or more SNPs identified in Table 1 and/or Table 2. Furthermore, kits/systems (such as beads, arrays, etc. ) that include these analogs are also encompassed by the present invention. For example, PNA oligomers that are based on the polymorphic sequences of the present invention are specifically contemplated. PNA oligomers are analogs of DNA in which the phosphate backbone is replaced with a peptide-like backbone (Lagriffoul et al., Bioorganic & Medicinal Chemistry Letters, 4: 1081-1082 (1994), Petersen et al., Bioorganic & Medicinal Chemistry Letters, 6: 793-796 (1996), Kumar et al., Organic Letters 3 (9): 1269-1272 (2001), W096/04000). PNA hybridizes to complementary RNA or DNA with higher affinity and specificity than conventional oligonucleotides and

oligonucleotide analogs. The properties of PNA enable novel molecular biology and biochemistry applications unachievable with traditional oligonucleotides and peptides.

Additional examples of nucleic acid modifications that improve the binding properties and/or stability of a nucleic acid include the use of base analogs such as inosine, intercalators (U. S. Patent No. 4,835, 263) and the minor groove binders (U. S.

Patent No. 5,801, 115). Thus, references herein to nucleic acid molecules, SNP- containing nucleic acid molecules, SNP detection reagents (e. g. , probes and primers), oligonucleotides/polynucleotides include PNA oligomers and other nucleic acid analogs.

Other examples of nucleic acid analogs and alternative/modified nucleic acid chemistries known in the art are described in Current Protocols in Nucleic Acid Chemistry, John Wiley & Sons, N. Y. (2002).

The present invention further provides nucleic acid molecules that encode fragments of the variant polypeptides disclosed'herein as well as nucleic acid molecules that encode obvious variants of such variant polypeptides. Such nucleic acid molecules may be naturally occurring, such as paralogs (different locus) and orthologs (different organism), or may be constructed by recombinant DNA methods or by chemical synthesis. Non-naturally occurring variants may be made by mutagenesis techniques, including those applied to nucleic acid molecules, cells, or organisms. Accordingly, the variants can contain nucleotide substitutions, deletions, inversions and insertions (in addition to the SNPs disclosed in Tables 1-2). Variation can occur in either or both the coding and non-coding regions. The variations can produce conservative and/or non- conservative amino acid substitutions.

Further variants of the nucleic acid molecules disclosed in Tables 1-2, such as naturally occurring allelic variants (as well as orthologs and paralogs) and synthetic variants produced by mutagenesis techniques, can be identified and/or produced using methods well known in the art. Such further variants can comprise a nucleotide sequence that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with a nucleic acid sequence disclosed in Table 1 and/or Table 2 (or a fragment thereof) and that includes a novel SNP allele disclosed in Table 1 and/or Table 2. Further, variants can comprise a nucleotide sequence that encodes a polypeptide that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%,

96%, 97%, 98%, or 99% sequence identity with a polypeptide sequence disclosed in Table 1 (or a fragment thereof) and that includes a novel SNP allele disclosed in Table 1 and/or Table 2. Thus, an aspect of the present invention that is specifically contemplated are isolated nucleic acid molecules that have a certain degree of sequence variation compared with the sequences shown in Tables 1-2, but that contain a novel SNP allele disclosed herein. In other words, as long as an isolated nucleic acid molecule contains a novel SNP allele disclosed herein, other portions of the nucleic acid molecule that flank the novel SNP allele can vary to some degree from the specific transcript, genomic, and context sequences shown in Tables 1-2, and can encode a polypeptide that varies to some degree from the specific polypeptide sequences shown in Table l.

To determine the percent identity of two amino acid sequences or two nucleotide sequences of two molecules that share sequence homology, the sequences are aligned for . optimal. comparison purposes (e g :, gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more of the length of a reference sequence. is aligned for comparison purposes. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein, amino acid or nucleic acid"identity"is equivalent to amino acid or nucleic acid"homology"). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988 ; Biocomputing : Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; ComputerAnalysis of SequenceData, Part 1, Griffin, A. M. , and Griffin, H. G., eds. , Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von

Heinje, G. , Academic Press, 1987 ; and Sequence Analysis Primer, Gribskov, M. and Devereux, J. , eds. , M Stockton Press, New York, 1991). In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch algorithm (J. Mol. Biol. (48) : 444-453 (1970) ) which has been incorporated into the GAP program in the GCG software package, using either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16,14, 12,10, 8, 6, or 4 and a length weight of 1, 2,3, 4,5, or 6.

In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (Devereux, J., et al., Nucleic Acids Res. 12 (1) : 387 (1984)), using a NWSgapdna. CMP matrix and a gap weight of 40,50, 60,70, or 80 and a length weight of 1,2, 3,4, 5, or 6.

In another embodiment, the percent identity between two amino acid or nucleotide sequences is determined using the-algorithm of E. Myers and W. Miller ((: ABIOS, 4: 11- 17 (1989)) which has been incorporated into, the ALIGN program (version 2.0), using-a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4.

The nucleotide and amino acid sequences of the present invention can further be used as a"query sequence"to perform a search against sequence databases to, for example, identify other family members or related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (J.

Mol. bols 215: 403-10 (1990) ). BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to the proteins of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (Nucleic Acids Res. 25 (17): 3389-3402 (1997) ). When utilizing BLAST and gapped BLAST programs, the default parameters of the respective programs (e g., XBLAST and NBLAST) can be used. In addition to BLAST, examples of other search and sequence comparison programs used in the art include, but are not limited to, FASTA (Pearson, Methods Mol. Biol. 25,365-389 (1994) ) and KERR (Dufresne et al., Nat

Biotechnol 2002 Dec; 20 (12): 1269-71). For further information regarding bioinformatics techniques, see Current Protocols in Bioinformatics, John Wiley & Sons, Inc. , N. Y.

The present invention further provides non-coding fragments of the nucleic acid molecules disclosed in Table 1 and/or Table 2. Preferred non-coding fragments include, but are not limited to, promoter sequences, enhancer sequences, intronic sequences, 5' untranslated regions (UTRs), 3'untranslated regions, gene modulating sequences and gene termination sequences. Such fragments are useful, for example, in controlling heterologous gene expression and in developing screens to identify gene-modulating agents.

SNP Detection Reagents In a specific aspect of the present invention, the SNPs disclosed in Table 1 and/or Table 2, and their associated transcript sequences (provided in Table l as SEQ ID NOS : 1- 517), genomic sequences (providedin Table 2 as SEQ ID NOS : 1S, 194-13, 514), and context sequences (transcript-based context sequences are provided in Table 1 as SEQ ID NOS: 1035-13,193 ; genomic-based context sequences are provided in Table 2 as SEQ ID NOS: 13,515-85, 090), can be used for the design of SNP detection reagents. As used herein, a"SNP detection reagent"is a reagent that specifically detects a specific target SNP position disclosed herein, and that is preferably specific for a particular nucleotide (allele) of the target SNP position (i. e. , the detection reagent preferably can differentiate between different alternative nucleotides at a target SNP position, thereby allowing the identity of the nucleotide present at the target SNP position to be determined). Typically, such detection reagent hybridizes to a target SNP-containing nucleic acid molecule by complementary base-pairing in a sequence specific manner, and discriminates the target variant sequence from other nucleic acid sequences such as an art-known form in a test sample. An example of a detection reagent is a probe that hybridizes to a target nucleic acid containing one or more of the SNPs provided in Table 1 and/or Table 2. In a preferred embodiment, such a N probe can differentiate between nucleic acids having a particular nucleotide (allele) at a target SNP position from other nucleic acids that have a different nucleotide at the same target SNP position. In addition, a detection reagent may hybridize to a specific region 5' and/or 3'to a SNP position, particularly a region corresponding to the context sequences

provided in Table 1 and/or Table 2 (transcript-based context sequences are provided in Table 1 as SEQ BD NOS : 1035-13, 193; genomic-based context sequences are provided in Table 2 as SEQ ID NOS : 13,515-85, 090). Another example of a detection reagent is a primer which acts as an initiation point of nucleotide extension along a complementary strand of a target polynucleotide. The SNP sequence information provided herein is also useful for designing primers, e. g. allele-specific primers, to amplify (e. g. , using PCR) any SNP of the present invention.

In one preferred embodiment of the invention, a SNP detection reagent is an isolated or synthetic DNA or RNA polynucleotide probe or primer or PNA oligomer, or a combination of DNA, RNA and/or PNA, that hybridizes to a segment of a target nucleic acid molecule containing a SNP identified in Table 1 and/or Table 2. A detection reagent in the form of a polynucleotide may optionally contain modified base analogs, intercalators or minor groove binders. Multiple detßction, reagents such as probes may be, for example, affixed to a solid support (e. g. , arrays or beads) or supplied in solution (e. g. , probe/primer sets for enzymatic reactions such as PCR, RT-PCR, TaqMan assays, or primer-extension reactions) to form a SNP detection kit.

A probe or primer typically is a substantially-,, purified oligonucleotide or PNA oligomer. Such oligonucleotide typically comprises a region of complementary nucleotide sequence that hybridizes under stringent conditions tu at least about 8,10, 12,16, 18,20, 22, 25,30, 40,50, 55,60, 65,70, 80,90, 100,120 (or any other number in-between) or more consecutive nucleotides in a target nucleic acid molecule. Depending on the particular assay, the consecutive nucleotides can either include the target SNP position, or be a specific region in close enough proximity 5'and/or 3'to the SNP position to carry out the desired assay.

Other preferred primer and probe sequences can readily be determined using the transcript sequences (SEQ ID NOS: 1-517), genomic sequences (SEQ ID NOS: 13,194- 13,514), and SNP context sequences (transcript-based context sequences are provided in Table 1 as SEQ ID NOS: 1035-13, 193; genomic-based context sequences are provided in Table 2 as SEQ ID NOS: 13,515-85, 090) disclosed in the Sequence Listing and in Tables 1-2. It will be apparent to one of skill in the art that such primers and probes are directly

useful as reagents for genotyping the SNPs of the present invention, and can be incorporated into any kit/system format.

In order to produce a probe or primer specific for a target SNP-containing sequence, the gene/transcript and/or context sequence surrounding the SNP of interest is typically examined using a computer algorithm which starts at the 5'or at the 3'end of the nucleotide sequence. Typical algorithms will then identify oligomers of defined length that are unique to the gene/SNP context sequence, have a GC content within a range suitable for hybridization, lack predicted secondary structure that may interfere with hybridization, and/or possess other desired characteristics or that lack other undesired characteristics.

A primer or probe of the present : invention is typically at least about 8 nucleotides in length. In one embodiment of the invention, a primer or a probe is at least about 10 nucleotides in length. In a preferred embodimenta'primer or a probe is at least about 12 nucleotides in length. In a more preferred embodiment, a primer or probe is at least, about 16,17, 18,19, 20,21, 22,23, 24 or 25 nucleotides in length. While the maximal length of a probe can be as long as the target sequence to be detected, depending on the type of assay in which it is employed, it is typically less than about 50, 60,65, or 70 nucleotides in length. In the case of a primer, it is typically less than about 30 nucleotides in length.

In a specific preferred embodiment of the invention, a primer or a probe is within the -length of about 18 and about 28 nucleotides. However, in other embodiments, such as nucleic acid arrays and other embodiments in which probes are affixed to a substrate, the probes can be longer, such as on the order of 30-70,75, 80,90, 100, or more nucleotides in length (see the section below entitled"SNP Detection Kits and Systems").

For analyzing SNPs, it may be appropriate to use oligonucleotides specific for alternative SNP alleles. Such oligonucleotides which detect single nucleotide variations in target sequences maybe referred to by such terms as"allele-specific oligonucleotides", "allele-specific probes", or"allele-specific primers". The design and use of allele-specific probes for analyzing polymorphisms is described in, e. g., Mutation Detection A Practical Approach, ed. Cotton et al. Oxford University Press, 1998; Saiki et al., Nature 324,163- 166 (1986); Dattagupta, EP235, 726; and Saiki, WO 89/11548.

While the design of each allele-specific primer or probe depends on variables such as the precise composition of the nucleotide sequences flanking a SNP position in a target nucleic acid molecule, and the length of the primer or probe, another factor in the use of primers and probes is the stringency of the condition under which the hybridization between the probe or primer and the target sequence is performed. Higher stringency conditions utilize buffers with lower ionic strength and/or a higher reaction temperature, and tend to require a more perfect match between probe/primer and a target sequence in order to form a stable duplex. If the stringency is too high, however, hybridization may not occur at all. In contrast, lower stringency conditions utilize buffers with higher ionic strength and/or a lower reaction temperature, and permit the formation of stable duplexes with more mismatched bases between a probe/prirner and a target sequence. By way of example and not limitation, exemplary conditions for high stringency hybridization conditions using an allele-specific. probe are as fbllowsPrchybridization with a solution : containing 5X standard saline phosphate EDTA (SSPE) ; 0.5% NaDodSO4 (SDS) at 55°C, and incubating probe with target nucleic acid molecules in the same solution at the same temperature, followed by washing with a solution containing 2X SSPE, and 0. 1% SDS at 55°C or room temperature.

Moderate stringency hybridization conditions may be used for allele-specific primer extension reactions with a solution containing, e. g., about 50mM KC1 at about 46°C. Alternatively, the reaction may be carried out at an elevated temperature such as 60°C. In another embodiment, a moderately stringent hybridization condition suitable for oligonucleotide ligation assay (OLA) reactions wherein two probes are ligated if they are completely complementary to the target sequence may utilize a solution of about 100mM KC1 at a temperature of 46°C.

In a hybridization-based assay, allele-specific probes can be designed that hybridize to a segment of target DNA from one individual but do not hybridize to the corresponding segment from another individual due to the presence of different polymorphic forms (e. g. , alternative SNP alleles/nucleotides) in the respective DNA segments from the two individuals. Hybridization conditions should be sufficiently stringent that there is a significant detectable difference in hybridization intensity between alleles, and preferably an essentially binary response, whereby a probe

hybridizes to only one of the alleles or significantly more strongly to one allele. While a probe may be designed to hybridize to a target sequence that contains a SNP site such that the SNP site aligns anywhere along the sequence of the probe, the probe is preferably designed to hybridize to a segment of the target sequence such that the SNP site aligns with a central position of the probe (e. g. , a position within the probe that is at least three nucleotides from either end of the probe). This design of probe generally achieves good discrimination in hybridization between different allelic forms.

In another embodiment, a probe or primer may be designed to hybridize to a segment of target DNA such that the SNP aligns with either the 5'most end or the 3' most end of the probe or primer. In a specific preferred embodiment that is particularly suitable for use in a oligonucleotide ligation. assay (U. S : Patent No. 4,988, 617), the 3'most nucleotide of the probe aligns with the SNP position in the target sequence.

Oligonucleotide probes and primers may be prepared by methods well known in the art. Chemical synthetic methods include, but are limited to, the phosphotriester method described by Narang et al., 1979, Methods in Enzymology 68: 90; the phosphodiester method described by Brown et al., 1979, Methods in Enzymology 68: 109, the diethylphosphoamidate method described by Beaucage et al., 1981, Tetrahedron Letters 22: 1859; and the solid support method described in U. S. Patent No.

4,458, 066.

Allele-specific probes are often used. in pairs (or, less commonly, in sets of 3 or 4, such as if a SNP position is known to have 3 or 4 alleles, respectively, or to assay both strands of a nucleic acid molecule for a target SNP allele), and such pairs may be identical except for a one nucleotide mismatch that represents the allelic variants at the SNP position.

Commonly, one member of a pair perfectly matches a reference form of a target sequence that has a more common SNP allele (i. e. , the allele that is more frequent in the target population) and the other member of the pair perfectly matches a form of the target sequence that has a less common SNP allele (i. e. , the allele that is rarer in the target population). In the case of an array, multiple pairs of probes can be immobilized on the same support for simultaneous analysis of multiple different polymorphisms.

In one type of PCR-based assay, an allele-specific primer hybridizes to a region on a target nucleic acid molecule that overlaps a SNP position and only primes

amplification of an allelic form to which the primer exhibits perfect complementarity (Gibbs, 1989, Nucleic Acid Res. 17 2427-2448). Typically, the primer's 3'-most nucleotide is aligned with and complementary to the SNP position of the target nucleic acid molecule. This primer is used in conjunction with a second primer that hybridizes at a distal site. Amplification proceeds from the two primers, producing a detectable product that indicates which allelic form is present in the test sample. A control is usually performed with a second pair of primers, one of which shows a single base mismatch at the polymorphic site and the other of which exhibits perfect complementarity to a distal site. The single-base mismatch prevents amplification or substantially reduces amplification efficiency, so that either'no detectable product is formed or it is formed in lower amounts or at a slower pace. The method generally works most effectively when the mismatch is at the 3'-most position of the oligonucleotide (i e., the 3'-most position of the oligonucleotide aligns with the target SNP position) because this position is most destabilizing to elongation from the primer (see, e. g., WO 93/22456). This PCR-based assay can be utilized as part of the TaqMan assay, described below.

In a specific embodiment of the invention, a primer of the invention contains a sequence substantially complementary to a segment of a target SNP-containing nucleic acid molecule except that the primer has a mismatched nucleotide in one of the three nucleotide positions at the 3'-most end of the primer, such that the mismatched nucleotide does not base pair with a particular allele at the SNP site. In a preferred embodiment, the mismatched nucleotide in the primer is the second from the last nucleotide at the 3'-most position of the primer. In a more preferred embodiment, the mismatched nucleotide in the primer is the last nucleotide at the 3'-most position of the primer.

In another embodiment of the invention, a SNP detection reagent of the invention is labeled with a fluorogenic reporter dye that emits a detectable signal. While the preferred reporter dye is a fluorescent dye, any reporter dye that can be attached to a detection reagent such as an oligonucleotide probe or primer is suitable for use in the invention. Such dyes include, but are not limited to, Acridine, AMCA, BODIPY, Cascade Blue, Cy2, Cy3, Cy5, Cy7, Dabcyl, Edans, Eosin, Erythrosin, Fluorescein, 6-Fam, Tet, Joe, Hex, Oregon Green, Rhodamine, Rhodol Green, Tamra, Rox, and Texas Red.

In yet another embodiment of the invention, the detection reagent may be further labeled with a quencher dye such as Tamra, especially when the reagent is used as a self- quenching probe such as a TaqMan (U. S. Patent Nos. 5,210, 015 and 5,538, 848) or Molecular Beacon probe (U. S. Patent Nos. 5, 118, 801 and 5, 312,728), or other stemless or linear beacon probe (Livak et al., 1995, PCR Method Appl. 4: 357-362; Tyagi et al., 1996, Nature Biotechnology 14: 303-308; Nazarenko et al., 1997, Nucl. Acids Res. 25: 2516-2521; U. S. Patent Nos. 5,866, 336 and 6,117, 635).

The detection reagents of the invention may also contain other labels, including but not limited to, biotin for streptavidin binding, hapten for antibody binding, and oligonucleotide for binding to another complementary oligonucleotide such as pairs of zipcodes.

The present invention also contemplates reagents that do not contain (or that are complementary to) a SNP nucleotide identified herein. but that are used to assay one orìi) more SNPs disclosed herein. For example, primers that'flank, but do not hybridize directly to a target SNP position provided herein are useful in primer extension reactions in which the primers hybridize to a region adjacent to the target SNP position (i. e. , within one or more nucleotides from the target SNP site). During the primer extension reaction, a primer is typically not able to extend past a target SNP site if a particular nucleotide (allele) is present at that target SNP site, and the primer extension product can be detected in order to determine which SNP allele is present at the. target SNP site. For example, particular ddNTPs are typically used in the primer extension reaction to terminate primer extension once a ddNTP is incorporated into the extension product (a primer extension product which includes a ddNTP at the 3'-most end of the primer extension product, and in which the ddNTP is a nucleotide of a SNP disclosed herein, is a composition that is specifically contemplated by the present invention). Thus, reagents that bind to a nucleic acid molecule in a region adjacent to a SNP site and that are used for assaying the SNP site, even though the bound sequences do not necessarily include the SNP site itself, are also contemplated by the present invention.

SNP Detection Kits and Systems A person skilled in the art will recognize that, based on the SNP and associated sequence information disclosed herein, detection reagents can be developed and used to assay any SNP of the present invention individually or in combination, and such detection reagents can be readily incorporated into one of the established kit or system formats which are well known in the art. The terms"kits"and"systems", as used herein in the context of SNP detection reagents, are intended to refer to such things as combinations of multiple SNP detection reagents, or one or more SNP detection reagents . in combination with one or more other types of elements or components (e. g. , other types of biochemical reagents, containers, packages such as packaging intended for commercial sale, substrates to which SNP detection reagents are attached, electronic hardware componentsj etc.). Accordingly, tthe present invention further provides SNP detection. kits and systems, including but not limited to, packaged probe4 and primer sets (erg., TaqMan probe/primer sets), arrays/microarrays of nucleic acid molecules, and beads that contain one or more probes, primers, or other detection reagents for detecting one or more SNPstof the present invention. The kits/systems can optionally include various electronic hardware components ; for example, arrays ("DNA chips") and microfluidic systems ("lab-on-a-chip"systems) provided by various manufacturers typically comprise hardware components. Other kits/systems (e. g., probe/primer sets) may not include electronic hardware components, but may be comprised of, for example, one or more SNP detection reagents (along with, optionally, other biochemical reagents) packaged in one or more containers.

In some embodiments, a SNP detection kit typically contains one or more detection reagents and other components (e. g. , a buffer, enzymes such as DNA polymerases or ligases, chain extension nucleotides such as deoxynucleotide triphosphates, and in the case of Sanger-type DNA sequencing reactions, chain terminating nucleotides, positive control sequences, negative control sequences, and the like) necessary to carry out an assay or reaction, such as amplification and/or detection of a SNP-containing nucleic acid molecule. A kit may further contain means for determining the amount of a target nucleic acid, and means for comparing the amount

with a standard, and can comprise instructions for using the kit to detect the SNP- containing nucleic acid molecule of interest. In one embodiment of the present invention, kits are provided which contain the necessary reagents to carry out one or more assays to detect one or more SNPs disclosed herein. In a preferred embodiment of the present invention, SNP detection kits/systems are in the form of nucleic acid arrays, or compartmentalized kits, including microfluidic/lab-on-a-chip systems.

SNP detection kits/systems may contain, for example, one or more probes, or pairs of probes, that hybridize to a nucleic acid molecule at or near each target SNP position. Multiple pairs of allele-specific probes may be included in the kit/system to simultaneously assay large numbers of SNPs, at least one of which is a SNP of the . present : invention. In some kits/systems, the allele-specific probes are immobilized to a substrate such as an array or bead. For example, the same substrate can comprise allele- specific. probes for detecting at least 1 ; 10 ; 100 ; 1000 ; 10, 000 ; ¢100, 000 (or any other. number in-between) or substantially all of the SNPs shown in Table 1 and/or Table 2.

The terms"arrays", "microarrays", and"DNA chips"are used herein interchangeably to refer to an array of distinct polynucleotides affixed to a substrate, such as glass, plastic, paper, nylon or other type of membrane, filter, chip, or any other suitable solid support. The polynucleotides can be synthesized directly on the substrate, or synthesized separate from the substrate and then affixed to the substrate. In one embodiment, the microarray is prepared and used according to the methods described in U. S. Patent No. 5, 837, 832, Chee et al. , PCT application W095/11995 (Chee et al.), Lockhart, D. J. et al. (1996 ; Nat. Biotech. 14: 1675-1680) and Schena, M. et al. (1996; Proc. Natl. Acad. Sci. 93: 10614-10619), all of which are incorporated herein in their entirety by reference. In other embodiments, such arrays are produced by the methods described by Brown et al. , U. S. Patent No. 5, 807, 522.

Nucleic acid arrays are reviewed in the following references: Zammatteo et al., "New chips for molecular biology and diagnostics", Biotechnol Annu Rev. 2002 ; 8: 85- 101 ; Sosnowski et al. ,"Active microelectronic array system for DNA hybridization, genotyping andphannacogenomic applications", Psychiatr Genet. 2002 Dec; 12 (4): 181- 92; Heller, "DNA microarray technology: devices, systems, and applications", Annu Rev Biomed Eng. 2002; 4: 129-53. Epub 2002 Mar 22; Kolchinsky et al. ,"Analysis of SNPs

and other genomic variations using gel-based chips", Hum Mutat. 2002 Apr; 19 (4): 343- 60; and McGall et al. ,"High-density genechip oligonucleotide probe arrays", Adv Biochem Eng Biotechnol. 2002; 77: 21-42.

Any number of probes, such as allele-specific probes, may be implemented in an array, and each probe or pair of probes can hybridize to a different SNP position. In the case of polynucleotide probes, they can be synthesized at designated areas (or synthesized separately and then affixed to designated areas) on a substrate using a light-directed chemical process. Each DNA chip can contain, for example, thousands to millions of individual synthetic polynucleotide probes arranged in a grid-like pattern and miniaturized (e. g. , to the size of a dime). Preferably, probes are attached to a solid support in an ordered, addressable array.

A microarray can be composed of a large number of unique, single-stranded polynucleotides, usually either synthetic antisense polynucleotides or fragments of cDNAs, fixed to a solid support. Typical polynucleotides are preferably about 6-60 nucleotides in length, more preferably about 15-30 nucleotides in length, and most preferably about 18-25 nucleotides in length. For certain types of microarrays or other detection kits/systems, it may be preferable to use oligonucleotides that are only about : 7- 20 nucleotides in length. In other types of arrays, such as arrays used in conjunction with chemiluminescent detection technology, preferred probe lengths can be, for example, about 15-80 nucleotides in length, preferably about 50-70 nucleotides in length, more preferably about 55-65 nucleotides in length, and most preferably about 60 nucleotides in length. The microarray or detection kit can contain polynucleotides that cover the known 5'or 3'sequence of a gene/transcript or target SNP site, sequential polynucleotides that cover the full-length sequence of a gene/transcript ; or unique polynucleotides selected from particular areas along the length of a target gene/transcript sequence, particularly areas corresponding to one or more SNPs disclosed in Table 1 and/or Table 2.

Polynucleotides used in the microarray or detection kit can be specific to a SNP or SNPs of interest (e. g. , specific to a particular SNP allele at a target SNP site, or specific to particular SNP alleles at multiple different SNP sites), or specific to a polymorphic gene/transcript or genes/transcripts of interest.

Hybridization assays based on polynucleotide arrays rely on the differences in hybridization stability of the probes to perfectly matched and mismatched target sequence variants. For SNP genotyping, it is generally preferable that stringency conditions used in hybridization assays are high enough such that nucleic acid molecules that differ from one another at as little as a single SNP position can be differentiated (e. g. , typical SNP hybridization assays are designed so that hybridization will occur only if one particular nucleotide is present at a SNP position, but will not occur if an alternative nucleotide is present at that SNP position). Such high stringency conditions may be preferable when using, for example, nucleic acid arrays of allele-specific probes for SNP detection. Such high stringency conditions are described in the preceding section, and are well known : to those skilled in the art and can be found in, for example, Current Protocols in Molecular Biology, John Wiley & Sons, N. Y. (1989), 6. 3,. 1-6.-3. 6-.

In other embodiments, the : arrays are. used in conjunction with chemiluminescent detection technology. The following patents and patent applications, which are all hereby incorporated by reference, provide additional information pertaining to chemiluminescent detection: U. S. patent applications 10/620332 and 10/620333 describe chemiluminescent approaches, for microarray detection ; U. S. Patent Nos. 6124478, 6107024,5994073, 5981768,5871938, 5843681,5800999, and 5773628 describe methods and compositions of dioxetane for performing chemiluminescent detection; and U. S. published application US2002/0110828 discloses methods and compositions for microarray controls.

In one embodiment of the invention, a nucleic acid array can comprise an array of probes of about 15-25 nucleotides in length. In further embodiments, a nucleic acid array can comprise any number of probes, in which at least one probe is capable of detecting one or more SNPs disclosed in Table 1 and/or Table 2, and/or at least one probe comprises a fragment of one of the sequences selected from the group consisting of those disclosed in Table 1, Table 2, the Sequence Listing, and sequences complementary thereto, said fragment comprising at least about 8 consecutive nucleotides, preferably 10, 12,15, 16,18, 20, more preferably 22,25, 30,40, 47,50, 55,60, 65,70, 80,90, 100, or more consecutive nucleotides (or any other number in-between) and containing (or being complementary to) a novel SNP allele disclosed in Table 1 and/or Table 2. In some

embodiments, the nucleotide complementary to the SNP site is within 5,4, 3,2, or 1 nucleotide from the center of the probe, more preferably at the center of said probe.

A polynucleotide probe can be synthesized on the surface of the substrate by using a chemical coupling procedure and an ink jet application apparatus, as described in PCT application W095/251116 (Baldeschweiler et al. ) which is incorporated herein in its entirety by reference. In another aspect, a"gridded"array analogous to a dot (or slot) blot may be used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedures. An array, such as those described above, may be produced by hand or by using available devices (slot blot or dot blot apparatus), materials (any suitable solid support), and machines (including robotic instruments), and may contain, 8, 24,96, 384, 1536,6144 or more polynucleotides, or any other number which lends itself to the efficient use of commercially available instrumentation.

Using such arrays or other kits/systems, the present invention provides methods of identifying the SNPs disclosed herein in a test sample. Such methods typically involve incubating a test sample of nucleic acids with an array comprising one or more probes corresponding to at least one SNP position of the present invention, and assaying for binding of a nucleic acid from the test sample with one or more of the probes. Conditions for incubating a SNP detection reagent (or a kit/system that employs one or more such SNP detection reagents) with a test sample vary. Incubation conditions depend on such factors as the format employed in the assay, the detection methods employed, and the type and nature of the detection reagents used in the assay. One skilled in the art will recognize that any one of the commonly available hybridization, amplification and array assay formats can readily be adapted to detect the SNPs disclosed herein.

A SNP detection kit/system of the present invention may include components that are used to prepare nucleic acids from a test sample for the subsequent amplification . and/or detection of a SNP-containing nucleic acid molecule. Such sample preparation components can be used to produce nucleic acid extracts (including DNA and/or RNA), proteins or membrane extracts from any bodily fluids (such as blood, serum, plasma, urine, saliva, phlegm, gastric juices, semen, tears, sweat, etc. ), skin, hair, cells (especially nucleated cells), biopsies, buccal swabs or tissue specimens. The test samples used in the

above-described methods will vary based on such factors as the assay format, nature of the detection method, and the specific tissues, cells or extracts used as the test sample to be assayed. Methods of preparing nucleic acids, proteins, and cell extracts are well known in the art and can be readily adapted to obtain a sample that is compatible with the system utilized. Automated sample preparation systems for extracting nucleic acids from a test sample are commercially available, and examples are Qiagen's BioRobot 9600, Applied Biosystems'PRISM 6700, and Roche Molecular Systems'COBAS AmpliPrep System.

Another form of kit contemplated by the present invention is a compartmentalized kit. A compartmentalized kit includes any kit in which reagents are contained in separate containers. Such containers include, for example, small glass containers, plastic containers, strips of plastic, glass or paper, or arraying material such as silica. Such containers allow one to efficiently transfer reagents from one compartment to another compartment such that the test samples and reagents are not cross-contaminated, or from one container to another vessel not included in the kit, and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another or to another vessel. Such containers may include,, for example, one or more containers which will accept the test sample, one or more containers which contain at least one probe or other SNP detection reagent for detecting one. or more SNPs of the present invention, one or more containers which contain wash reagents (such as phosphate buffered saline, Tris- buffers, etc. ), and one or more containers which contain the reagents used to reveal the presence of the bound probe or other SNP detection reagents. The kit can optionally further comprise compartments and/or reagents for, for example, nucleic acid amplification or other enzymatic reactions such as primer extension reactions, hybridization, ligation, electrophoresis (preferably capillary electrophoresis), mass spectrometry, and/or laser- induced fluorescent detection. The kit may also include instructions for using the kit.

Exemplary compartmentalized kits include microfluidic devices known in the art (see, e. g., Weigl et al.,"Lab-on-a-chip for drug development", Adv Drug Deliv Rev. 2003 Feb 24; 55 (3): 349-77). In such microfluidic devices, the containers may be referred to as, for example, microfluidic"compartments","chambers", or"channels".

Microfluidic devices, which may also be referred to as"lab-on-a-chip"systems, biomedical micro-electro-mechanical systems (bioMEMs), or multicomponent integrated systems, are exemplary kits/systems of the present invention for analyzing SNPs. Such systems miniaturize and compartmentalize processes such as probe/target hybridization, nucleic acid amplification, and capillary electrophoresis reactions in a single functional device. Such microfluidic devices typically utilize detection reagents in at least one aspect of the system, and such detection reagents may be used to detect one or more SNPs of the present invention. One example of a microfluidic system is disclosed in U. S.

Patent No. 5,589, 136, which describes the integration of PCR amplification and capillary electrophoresis in chips. Exemplary microfluidic systems comprise a pattern of microchannels designed onto a glass, silicon, quartz, or plastic. wafer included on a microchip. The movements of the samples may be controlled by electric, electroosmotic or hydrostatic forces applied across different areas of the microchip to create functional microscopic valves and pumps with no moving parts. Varying the voltage can be used as a means to control the liquid flow at intersections between the micro-machined channels and to change the liquid flow rate for pumping across different sections of the microchip.

See, for example, U. S. Patent Nos. 6,153, 073> Dubrow et al., and 6, 156, 181, Parce et al.

For genotyping SNPs, an exemplary microfluidic system may integrate, for example, nucleic acid amplification, primer extension, capillary electrophoresis, and a detection method such as laser induced fluorescence detection. In a first step of an exemplary process for using such an exemplary system, nucleic acid samples are amplified, preferably by PCR. Then, the amplification products are subjected to automated primer extension reactions using ddNTPs (specific fluorescence for each ddNTP) and the appropriate oligonucleotide primers to carry out primer extension reactions which hybridize just upstream of the targeted SNP. Once the extension at the 3' 9 end is completed, the primers are separated from the unincorporated fluorescent ddNTPs by capillary electrophoresis. The separation medium used in capillary electrophoresis can be, for example, polyacrylamide, polyethyleneglycol or dextran. The incorporated ddNTPs in the single nucleotide primer extension products are identified by laser-induced fluorescence detection. Such an exemplary microchip can be used to process, for example, at least 96 to 384 samples, or more, in parallel.

USES OF NUCLEIC ACID MOLECULES The nucleic acid molecules of the present invention have a variety of uses, especially in predicting an individual's risk for developing a cardiovascular disorder (particularly the risk for experiencing a first or recurrent acute coronary event such as a myocardial infarction or stroke), for prognosing the progression of a cardiovascular disorder in an individual (e. g., the severity or consequences of an acute coronary event), in evaluating the likelihood of an individual who has a cardiovascular disorder of responding to treatment of the cardiovascular disorder with statin, and/or predicting the likelihood that the individual will experience toxicity or other undesirable side effects from the statin treatment, etc. For example, the nucleic acid molecules are useful as hybridization probes, such as for genotyping SNPs in messenger RNA, transcript, cDNA, genomic DNA, amplified DNA or other nucleic acid molecules, and for isolating full-length cDNA and genomic clones encoding the variant peptides disclosed in Table 1 as well as their orthologs.

A probe can hybridize to any nucleotide sequence along the entire length of a nucleic acid molecule provided in Table 1 and/or Table 2. Preferably, a probe of the present invention hybridizes to a region of a target sequence that encompasses a SNP position indicated in Table 1 and/or Table 2. More preferably, a probe hybridizes to a SNP- containing target sequence in a sequence-specific manner such that it distinguishes the target sequence from other nucleotide sequences which vary from the target sequence only by which nucleotide is present at the SNP site. Such a probe is particularly useful for detecting the presence of a SNP-containing nucleic acid in a test sample, or for determining which nucleotide (allele) is present at a particular SNP site (i. e. , genotyping the SNP site).

A nucleic acid hybridization probe may be used for determining the presence, level, form, and/or distribution of nucleic acid expression. The nucleic acid whose level is determined can be DNA or RNA. Accordingly, probes specific for the SNPs described herein can be used to assess the presence, expression and/or gene copy number in a given cell, tissue, or organism. These uses are relevant for diagnosis of disorders involving an increase or decrease in gene expression relative to normal levels. Iii vitro techniques for detection of mRNA include, for example, Northern blot hybridizations and in situ hybridizations. In vitro techniques for detecting DNA include Southern blot

hybridizations and in situ hybridizations (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY).

Probes can be used as part of a diagnostic test kit for identifying cells or tissues in which a variant protein is expressed, such as by measuring the level of a variant protein- encoding nucleic acid (e. g., mRNA) in a sample of cells from a subject or determining if a polynucleotide contains a SNP of interest.

Thus, the nucleic acid molecules of the invention can be used as hybridization probes to detect the SNPs disclosed herein, thereby determining whether an individual with the polymorphisms is likely or unlikely to develop a cardiovascular disorder such as an acute coronary event, or the likelihood that an individual will respond positively to statin treatment of a cardiovascular disorder. Detection of a SNP associated with a disease pnenotype provides a diagnostic tool for an active disease and/or genetic predisposition to the disease.

. Furthermore, the nucleic acid molecules of the invention are therefore useful for detecting a gene (gene information is disclosed in Table 2, for example) which contains a SNP disclosed herein and/or products of such genes, such as expressed mRNA transcript molecules (transcript information is disclosed in Table 1, for example), and are thus useful for detecting gene expression. The nucleic acid molecules can optionally be implemented in, for example, an array or kit format for use in detecting gene expression.

The nucleic acid molecules of the invention are also useful as primers to amplify any given region of a nucleic acid molecule, particularly a region containing a SNP identified in Table 1 and/or Table 2.

The nucleic acid molecules of the invention are also useful for constructing recombinant vectors (described in greater detail below). Such vectors include expression vectors that express a portion of, or all of, any of the variant peptide sequences provided in Table 1. Vectors also include insertion vectors, used to integrate into another nucleic acid molecule sequence, such as into the cellular genome, to alter in situ expression of a gene and/or gene product. For example, an endogenous coding sequence can be replaced via homologous recombination with all or part of the coding region containing one or more specifically introduced SNPs.

The nucleic acid molecules of the invention are also useful for expressing antigenic portions of the variant proteins, particularly antigenic portions that contain a variant amino acid sequence (e. g. , an amino acid substitution) caused by a SNP disclosed in Table 1 and/or Table 2.

The nucleic acid molecules of the invention are also useful for constructing vectors containing a gene regulatory region of the nucleic acid molecules of the present invention.

The nucleic acid molecules of the invention are also useful for designing ribozymes corresponding to all, or a part, of an mRNA molecule expressed from a SNP-containing nucleic acid molecule described herein.

The nucleic acid molecules of the invention are also useful for constructing host cells expressing a part, or all, of the nucleic acid molecules and variant peptides.

The nucleic acid molecules of the invention are also useful for constructing transgenic animals expressing all, or a part, of the nucleic acid molecules and variant peptides. The production of recombinant cells. and transgenic animals having nucleic acid,, molecules which contain the SNPs disclosed in Table 1 and/or Table 2 allow, for example, effective clinical design of treatment compounds and dosage regimens.

The nucleic acid molecules of the invention are also useful in assays for drug screening to identify compounds that, for example, modulate nucleic acid expression.

The nucleic acid molecules of the invention are also useful in gene therapy in patients whose cells have aberrant gene expression. Thus, recombinant cells, which include a patient's cells that have been engineered ex vivo and returned to the patient, can be introduced into an individual where the recombinant cells produce the desired protein to treat the individual.

SNP Genotyping Methods The process of determining which specific nucleotide (i. e. , allele) is present at each of one or more SNP positions, such as a SNP position in a nucleic acid molecule disclosed in Table 1 and/or Table 2, is referred to as SNP genotyping. The present invention provides methods of SNP genotyping, such as for use in evaluating an individual's risk for developing a cardiovascular disease-particularly an acute coronary event (such as myocardial infarction or stroke) and for evaluating an individual's prognosis for disease

severity and recovery, for predicting the likelihood that an individual who has previously experienced an acute coronary event will experience one or more recurrent acute coronary events, for implementing a preventive or treatment regimen for an individual based on that individual having an increased susceptibility for developing a cardiovascular disorder (e. g., increased risk for experiencing one or more myocardial infarctions or strokes), in evaluating an individual's likelihood of responding to statin treatment for cardiovascular disease, in selecting a treatment regimen (e. g. , in deciding whether or not to administer statin treatment to an individual having a cardiovascular disease, or in formulating or selecting a particular statin-based treatment regimen such as dosage and/or frequency of administration of statin treatment or choosing which form/type of statin to be administered such as a particular pharmaceutical composition or compound, etc.), determining the likelihood of experiencing toxicity or other undesirable side effects from the statin treatment, or selecting individuals for a clinical trial of a statin (e. g., selecting individuals to participate in the trial who are most likely to respond positively from the statin treatment), etc.

Nucleic acid samples can be genotyped to determine which allele (s) is/are present at any given genetic region (e. g. , SNP position) of interest by methods well known in the art. The neighboring sequence can be used to design SNP, detection reagents such as oligonucleotide probes, which may optionally be implemented in a kit format. Exemplary SNP genotyping methods are described in Chen et al.,"Single nucleotide polymorphism genotyping: biochemistry, protocol, cost and throughput", Phannaeogetzomics J.

2003; 3 (2): 77-96; Kwok et al. ,"Detection of single nucleotide polymorphisms", Curr Issues Mol Biol. 2003 Apr; 5 (2): 43-60; Shi, "Technologies for individual genotyping: detection of genetic polymorphisms in drug targets and disease genes", Am JPharmacogenomics.

2002; 2 (3): 197-205; and Kwok, "Methods for genotyping single nucleotide polymorphisms", Annu Rev Genomics Hum Genet 2001; 2: 235-58. Exemplary techniques for high-throughput SNP genotyping are described in Marnellos,"High-throughput SNP analysis for genetic association studies", Curr Opin DrugDisco. vDevel. 2003 May; 6 (3): 317-21. Common SNP genotyping methods include, but are not limited to, TaqMan assays, molecular beacon assays, nucleic acid arrays, allele-specific primer extension, allele-specific PCR, arrayed primer extension, homogeneous primer extension assays, primer extension with detection by mass spectrometry, pyrosequencing, multiplex primer extension sorted on genetic arrays,

ligation with rolling circle amplification, homogeneous ligation, OLA (U. S. Patent No.

4,988, 167), multiplex ligation reaction sorted on genetic arrays, restriction-fragment length polymorphism, single base extension-tag assays, and the Invader assay. Such methods may be used in combination with detection mechanisms such as, for example, luminescence or chemiluminescence detection, fluorescence detection, time-resolved fluorescence detection, fluorescence resonance energy transfer, fluorescence polarization, mass spectrometry, and electrical detection.

Various methods for detecting polymorphisms include, but are not limited to, methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA duplexes (Myers et al., Science 230 : 1242 (1985) ; Cotton et al., PNAS 85 : 4397 (1988); and Saleeba et al., Meth. Enzymol. 2177 : 286-295 (1992)), comparison of the electrophoretic mobility of variant and wild type nucleic acid molecules (Orita et al., PNA-S 86 : 2766 (1989); Cotton er al., Mutat. Res. 285 : 125-144 : (1993) ; and Hayashi et al :, Genet. Anal. Tech. Appl. 9 : 73-79 (1992)), and assaying the movement of polymorphic or wild-type fragments in polyacrylamide gels containing a gradient of denaturant using denaturing gradient gel electrophoresis (DGGE) (Myers et al., Nature 313 : 495 (1985)).

Sequence variations at specific locations can also be assessed by nuclease protection assays s such as RNase and S1 protection or chemical cleavage methods.

In a preferred embodiment, SNP genotyping is performed using the TaqMan assay, which is also known as the 5'nuclease assay (U. S : Patent Nos. 5,210, 015 and 5,538, 848). The TaqMan assay detects the accumulation of a specific amplified product during PCR. The TaqMan assay utilizes an oligonucleotide probe labeled with a fluorescent reporter dye and a quencher dye. The reporter dye is excited by irradiation at an appropriate wavelength, it transfers energy to the quencher dye in the same probe via a process called fluorescence resonance energy transfer (FRET). When attached to the probe, the excited reporter dye does not emit a signal. The proximity of the quencher dye to the reporter dye in the intact probe maintains a reduced fluorescence for the reporter.

The reporter dye and quencher dye may be at the 5'most and the 3'most ends, respectively, or vice versa. Alternatively, the reporter dye may be at the 5'or 3'most end while the quencher dye is attached to an internal nucleotide, or vice versa. In yet another embodiment, both the reporter and the quencher may be attached to internal

nucleotides at a distance from each other such that fluorescence of the reporter is reduced.

During PCR, the 5'nuclease activity of DNA polymerase cleaves the probe, thereby separating the reporter dye and the quencher dye and resulting in increased fluorescence of the reporter. Accumulation of PCR product is detected directly by monitoring the increase in fluorescence of the reporter dye. The DNA polymerase cleaves the probe between the reporter dye and the quencher dye only if the probe hybridizes to the target SNP-containing template which is amplified during PCR, and the probe is designed to hybridize to the target SNP site only if a particular SNP allele is . present.

Preferred TaqMan primet and probe sequences can readily be determined using the SNP and associated nucleic acid sequence information provided herein. A number of computer programs, such as Primer : Expres (lpplied Biosystems ; Foster City, CA) ; can be used to rapidly obtain optimal primer/probe sets. It will be apparent to one of skill in the art that such primers and probes for detecting the SNPs of the present invention are useful in screening for individuals who are susceptible to developing a cardiovascular disorder (e. g. , an acute coronary event) or in screening individuals who have a cardiovascular disorder for their likelihood of responding to statin treatment. These probes and primers can be readily incorporated into a kit format. The present invention also includes modifications of the Taqman assay well known in the art such as the use of Molecular Beacon probes (U. S. Patent Nos. 5, 118,801 and 5,312, 728) and other variant formats (U. S. Patent Nos. 5,866, 336 and 6,117, 635).

Another preferred method for genotyping the SNPs of the present invention is the use of two oligonucleotide probes in an OLA (see, e. g. , U. S. Patent No. 4, 988, 617). In this method, one probe hybridizes to a segment of a target nucleic acid with its 3'most end aligned with the SNP site. A second probe hybridizes to an adjacent segment of the target nucleic acid molecule directly 3'to the first probe. The two juxtaposed probes hybridize to the target nucleic acid molecule, and are ligated in the presence of a linking agent such as a ligase if there is perfect complementarity between the 3'most nucleotide of the first probe with the SNP site. If there is a mismatch, ligation would not occur.

After the reaction, the ligated probes are separated from the target nucleic acid molecule, and detected as indicators of the presence of a SNP.

The following patents, patent applications, and published international patent applications, which are all hereby incorporated by reference, provide additional information pertaining to techniques for carrying out various types of OLA: U. S. Patent Nos. 6027889,6268148, 5494810, 5830711, and 6054564 describe OLA strategies for performing SNP detection; WO 97/31256 and WO 00/56927 describe OLA strategies for performing SNP detection using universal arrays, wherein a zipcode sequence can be introduced into one of the hybridization probes, and the resulting product, or amplified product, hybridized to a universal zip code array; U. S. application US01/17329 (and 09/584, 905) describes OLA (or LDR) followed by PCR, wherein zipcodes are incorporated into OLA probes, and amplified PCR products are determined by electrophoretic or universal zipcode array readout ; U. S. ! applications 60/427818, 60/445636, and 60/445494 describe SNPlex methods and software for multiplexed SNP- detection using OLA followed by PCR, wherein zipcodes are incorporated into OLA probes, and amplified PCR products are hybridized with a zipchute reagent, and the identity of the SNP determined from electrophoretic readout of the zipchute. In some embodiments, OLA is carried out prior to PCR (or another method of nucleic acid amplification). In other embodiments, PCR (or another method of nucleic acid amplification) is carried out prior to OLA.

Another method for SNP genotyping is based on mass spectrometry. Mass spectrometry takes advantage of the unique mass of each of the four nucleotides of DNA.

SNPs can be unambiguously genotyped by mass spectrometry by measuring the differences in the mass of nucleic acids having alternative SNP alleles. MALDI-TOF (Matrix Assisted Laser Desorption Ionization-Time of Flight) mass spectrometry technology is preferred for extremely precise determinations of molecular mass, such as SNPs. Numerous approaches to SNP analysis have been developed based on mass spectrometry. Preferred mass spectrometry-based methods of SNP genotyping include primer extension assays, which can also be utilized in combination with other approaches, such as traditional gel-based formats and microarrays.

Typically, the primer extension assay involves designing and annealing a primer to a template PCR amplicon upstream (5') from a target SNP position. A mix of dideoxynucleotide triphosphates (ddNTPs) and/or deoxynucleotide triphosphates (dNTPs) are added to a reaction mixture containing template (e. g. , a SNP-containing nucleic acid molecule which has typically been amplified, such as by PCR), primer, and DNA polymerase. Extension of the primer terminates at the first position in the template where a nucleotide complementary to one of the ddNTPs in the mix occurs. The primer can be either immediately adjacent (i. e. , the nucleotide at the 3'end of the primer hybridizes to the nucleotide next to the target SNP site) or two or more nucleotides removed from the SNP position. If the primer is several nucleotides removed from the target SNP position, the only limitation is that the template sequence between the 3'end of the primer and the SNP position cannot contain a nucleotide of the same type as the one to be detected, or this will cause premature termination of the extension primer.

Alternatively, if all four ddNTPs alone, with noadNTPs, are added to the reaction mixture, the primer will always be extended by only one nucleotide, corresponding to the target SNP position. In this instance, primers are designed to bind one nucleotide upstream from the SNP position (i. e. , the nucleotide at the 3'end of the primer hybridizes to the nucleotide that is immediately adjacent to the target SNP site on the 5'side of the target SNP site). Extension by only one nucleotide is preferable, as it minimizes the overall mass of the extended primer, thereby increasing the resolution of mass differences between alternative SNP nucleotides. Furthermore, mass-tagged ddNTPs can be employed in the primer extension reactions in place of unmodified ddNTPs. This increases the mass difference between primers extended with these ddNTPs, thereby providing increased sensitivity and accuracy, and is particularly useful for typing heterozygous base positions. Mass-tagging also alleviates the need for intensive sample- preparation procedures and decreases the necessary resolving power of the mass spectrometer.

The extended primers can then be purified and analyzed by MALDI-TOF mass spectrometry to determine the identity of the nucleotide present at the target SNP position. In one method of analysis, the products from the primer extension reaction are combined with light absorbing crystals that form a matrix. The matrix is then hit with an

energy source such as a laser to ionize and desorb the nucleic acid molecules into the gas- phase. The ionized molecules are then ejected into a flight tube and accelerated down the tube towards a detector. The time between the ionization event, such as a laser pulse, and collision of the molecule with the detector is the time of flight of that molecule. The time of flight is precisely correlated with the mass-to-charge ratio (m/z) of the ionized molecule. Ions with smaller m/z travel down the tube faster than ions with larger m/z and therefore the lighter ions reach the detector before the heavier ions. The time-of-flight is then converted into a corresponding, and highly precise, m/z. In this manner, SNPs can be identified based on the slight differences in mass, and the corresponding time of flight differences, inherent in nucleic acid molecules having different nucleotides at a single' base. position. For further information regarding the use of primer extension assays in conjunction with MALDI-TOF mass speetrometry for SNP genotyping, see, e. g., Wise et al. b"A standard protocol for single nucleotide. primer extension in the human genome using matrix-assisted laser desorption/iomzationitime-of-flight mass spectrometry" Rapid Commun Mass Spectrom. 2003; 17 (11): 1195-202.

The following references provide further information describing mass spectrometry-based methods for SNP genotyping: Bocker, "SNP and mutation discovery using base-specific cleavage and MALDI-TOF mass spectrometry", Bioinformatics. 2003 Jul ; 19 Suppl 1: 144-153 ; Storm et al.,"MALDI-TOF mass spectrometry-based SNP genotyping", Methods Mol Biol. 2003; 212: 241-62; Jurinke et al. ,"The use of MassARRAY technology for high throughput genotyping", Adv Biochem Eng Biotechnol. 2002; 77: 57-74; and Jurinke et al. ,"Automated genotyping using the DNA MassArray technology", Methods Mol Biol. 2002; 187: 179-92.

SNPs can also be scored by direct DNA sequencing. A variety of automated sequencing procedures can be utilized ( (1995) Biotechniques 19 : 448), including sequencing by mass spectrometry (see, e. g. , PCT International Publication No. W094/16101 ; Cohen et al., Adv. Chromatogr. 36: 127-162 (1996); and Griffin et al., Appl. Biochem. Biotechnol.

38: 147-159 (1993) ). The nucleic acid sequences of the present invention enable one of ordinary skill in the art to readily design sequencing primers for such automated sequencing procedures. Commercial instrumentation, such as the Applied Biosystems

377,3100, 3700, 3730, and 3730x1 DNA Analyzers (Foster City, CA), is commonly used in the art for automated sequencing.

Other methods that can be used to genotype the SNPs of the present invention include single-strand conformational polymorphism (SSCP), and denaturing gradient gel' electrophoresis (DGGE) (Myers et al., Nature 313: 495 (1985)). SSCP identifies base differences by alteration in electrophoretic migration of single stranded PCR products, as described in Orita et al., Proc. Nat. Acad. Single-stranded PCR products can be generated by heating or otherwise denaturing double stranded PCR products. Single- stranded nucleic acids may refold or form secondary structures that are partially dependent on the base sequence. The different electrophoretic mobilities of single- stranded amplification products are related to base-sequence'differences at SNP positions. DGGE differentiates SNP alleles based on the different sequence-dependent stabilities and melting properties inherent in polymorphic DNA. and the corresponding differences in electrophoretic migration patterns in a denaturing gradient gel (Erlich, eds, PCR Technology, Principles and Applications for DNA Amplification, W. H. Freeman and Co, New York, 1992, Chapter 7).

Sequence-specific ribozymes (U. S. Patent No. 5,498, 531) can also be used to score SNPs based on the development or loss of a ribozyme cleavage site. Perfectly matched sequences can be distinguished-from mismatched sequences by nuclease cleavage digestion assays or by differences in melting temperature. If the SNP affects a restriction enzyme cleavage site, the SNP can be identified by alterations in restriction enzyme digestion patterns, and the corresponding changes in nucleic acid fragment lengths determined by gel electrophoresis SNP genotyping can include the steps of, for example, collecting a biological sample from a human subject (e. g. , sample of tissues, cells, fluids, secretions, etc.), isolating nucleic acids (e. g. , genomic DNA, mRNA or both) from the cells of the sample, contacting the nucleic acids with one or more primers which specifically hybridize to a region of the isolated nucleic acid containing a target SNP under conditions such that hybridization and amplification of the target nucleic acid region occurs, and determining the nucleotide present at the SNP position of interest, or, in some assays, detecting the presence or absence of an amplification product (assays can be designed so that

hybridization and/or amplification will only occur if a particular SNP allele is present or absent). In some assays, the size of the amplification product is detected and compared to the length of a control sample; for example, deletions and insertions can be detected by a change in size of the amplified product compared to a normal genotype.

SNP genotyping is useful for numerous practical applications, as described below.

Examples of such applications include, but are not limited to, SNP-disease association analysis, disease predisposition screening, disease diagnosis, disease prognosis, disease progression monitoring, determining therapeutic strategies based on an individual's genotype ("pharmacogenomics"), developing therapeutic agents based on SNP genotypes associated with a disease or likelihood of responding to a drug, : stratifying a patient population for clinical trial for a treatment regimen, predicting the likelihood that an individual will experience toxic side effects from a therapeutic agent, and human identification applications such as forensic.

Analysis of Genetic Association Between SNPs and Phenotypic Traits SNP genotyping for disease diagnosis, disease predisposition screening, disease prognosis, determining drug responsiveness (pharmacogenomics), drug toxicity screening, and other uses described herein, typically relies on initially establishing a genetic association between one or more specific SNPs and the particular phenotypic traits of interest.

Different study designs may be used for genetic association studies (Modern EpidemioloOgy, Lippincott Williams & Wilkins (1998), 609-622). Observational studies are most frequently carried out in which the response of the patients is not interfered with. The first type of observational study identifies a sample of persons in whom the suspected cause of the disease is present and another sample of persons in whom the suspected cause is absent, and then the frequency of development of disease in the two samples is compared. These sampled populations are called cohorts, and the study is a prospective study. The other type of observational study is case-control or a retrospective study. In typical case-control studies, samples are collected from individuals with the phenotype of interest (cases) such as certain manifestations of a disease, and from individuals without the phenotype (controls) in a population (target population) that

conclusions are to be drawn from. Then the possible causes of the disease are investigated retrospectively. As the time and costs of collecting samples in case-control studies are considerably less than those for prospective studies, case-control studies are the more commonly used study design in genetic association studies, at least during the exploration and discovery stage.

In both types of observational studies, there may be potential confounding factors that should be taken into consideration. Confounding factors are those that are associated with both the real cause (s) of the disease and the disease itself, and they include demographic information such as age, gender, ethnicity as well as environmental factors.

When confounding factors are not matched in cases and controls in a study, and are not controlled properly, spurious association results can arise. If potential confounding factors are identified, they should be controlled for by analysis methods explained below.

In a genetic association study, the cause of interest to be tested is a certain allele or a SNP or a combination of alleles or a haplotype from several SNPs. Thus, tissue specimens (e. g., whole blood) from the sampled individuals may be collected and genomic DNA genotyped for the SNP (s) of interest. In addition to the phenotypic trait of interest, other information such as demographic (e. g., age, gender, ethnicity, etc.), clinical, and environmental information that may influence the outcome of the trait can be collected to further characterize and define the sample'set. In many cases, these factors are known to be associated with diseases and/or SNP allele frequencies. There are likely gene-environment and/or gene-gene interactions as well. Analysis methods to address gene-environment and gene-gene interactions (for example, the effects of the presence of both susceptibility alleles at two different genes can be greater than the effects of the individual alleles at two genes combined) are discussed below.

After all the relevant phenotypic and genotypic information has been obtained, statistical analyses are carried out to determine if there is any significant correlation between the presence of an allele or a genotype with the phenotypic characteristics of an individual. Preferably, data inspection and cleaning are first performed before carrying out statistical tests for genetic association. Epidemiological and clinical data of the samples can be summarized by descriptive statistics with tables and graphs. Data validation is preferably performed to check for data completion, inconsistent entries, and

outliers. Chi-squared tests and t-tests (Wilcoxon rank-sum tests if distributions are not normal) may then be used to check for significant differences between cases and controls for discrete and continuous variables, respectively. To ensure genotyping quality, Hardy- Weinberg disequilibrium tests can be performed on cases and controls separately.

Significant deviation from Hardy-Weinberg equilibrium (HWE) in both cases and controls for individual markers can be indicative of genotyping errors. If HWE is violated in a majority of markers, it is indicative of population substructure that should be further investigated. Moreover, Hardy-Weinberg disequilibrium in cases only can indicate genetic association of the markers with the disease (Genetic Data Analysis, Weir B. , Sinauer (1990)).

To test whether an allele of a single'SNP is. associated with the case or control status of a phenotypic trait, one skilled in the art can compare allele frequencies in cases and controls. Standard chi-squared tests and Fisher. exact, testsLcan be carried out onta, 2x2 table (2 SNP alleles x 2 outcomes in the categorical trait of interest). To test whether genotypes of a SNP are associated, chi-squared tests can be carried out on a 3x2 table (3 genotypes x 2 outcomes). Score tests are also carried out for genotypic association to contrast the three genotypic frequencies (major homozygotes7lheterozygotes and minor homozygotes) in cases and controls, and to look for trends using 3 different modes of inheritance, namely dominant (with contrast coefficients 2,-lys-1), additive (with contrast coefficients 1, 0,-1) and recessive (with contrast coefficients 1, 1,-2). Odds ratios for minor versus major alleles, and odds ratios for heterozygote and homozygote variants versus the wild type genotypes are calculated with the desired confidence limits, usually 95%.

In order to control for confounders and to test for interaction and effect modifiers, stratified analyses may be performed using stratified factors that are likely to be confounding, including demographic information such as age, ethnicity, and gender, or an interacting element or effect modifier, such as a known major gene (e. g., APOE for Alzheimer's disease or HLA genes for autoimmune diseases), or environmental factors such as smoking in lung cancer. Stratified association tests may be carried out using Cochran-Mantel-Haenszel tests that take into account the ordinal nature of genotypes with 0,1, and 2 variant alleles. Exact tests by StatXact may also be performed when

computationally possible. Another way to adjust for confounding effects and test for interactions i5 to perform stepwise multiple logistic regression analysis using statistical packages such as SAS or R. Logistic regression is a model-building technique in which the best fitting and most parsimonious model is built to describe the relation between the dichotomous outcome (for instance, getting a certain disease or not) and a set of independent variables (for instance, genotypes of different associated genes, and the associated demographic and environmental factors). The most common model is one in which the logit transformation of the odds ratios is expressed as a linear combination of the variables (main effects) and their cross-product terms (interactions) (Applied Logistic Regression, Hosmer and Lemeshow, Wiley (2000) ). To test whether a certain variable or interaction is significantly associated with the outcome, coefficients in the model are first estimated and then tested for statistical significance of their departure from zero.

In addition to performing association tests one marker. at a time, haplotype association analysis may also be perfermed to study a number of markers that are closely linked together. Haplotype association tests can have better power than genotypic or allelic association tests when the tested markers are not the disease-causing mutations themselves but are in linkage disequilibrium with such mutations. The test will even be more powerful if the disease is indeed caused by a combination of alleles on a haplotype (e. g. , APOE is a haplotype formed by 2 SNPs that are very close to each other). In order to perform haplotype association effectively, marker-marker linkage disequilibrium measures, both D'and R, are typically calculated for the markers within a gene to elucidate the haplotype structure. Recent studies (Daly et al, Nature Genetics, 29,232- 235,2001) in linkage disequilibrium indicate that SNPs within a gene are organized in block pattern, and a high degree of linkage disequilibrium exists within blocks and very little linkage disequilibrium exists between blocks. Haplotype association with the disease status can be performed using such blocks once they have been elucidated.

Haplotype association tests can be carried out in a similar fashion as the allelic and genotypic association tests. Each haplotype in a gene is analogous to an allele in a multi-allelic marker. One skilled in the art can either compare the haplotype frequencies in cases and controls or test genetic association with different pairs of haplotypes. It has been proposed (Schaid et al, Am. J. Hum. Genet., 70,425-434, 2002) that score tests can

be done on haplotypes using the program"haplo. score". In that method, haplotypes are first inferred by EM algorithm and score tests are carried out with a generalized linear model (GLM) framework that allows the adjustment of other factors.

An important decision in the performance of genetic association tests is the determination of the significance level at which significant association can be declared when the p-value of the tests reaches that level. In an exploratory analysis where positive hits will be followed up in subsequent confirmatory testing, an unadjusted p-value <0.1 (a significance level on the lenient side) may be used for generating hypotheses for significant : association of a SNP with certain phenotypic characteristics of a disease. It is preferred that a p-value < 0.05 (a significance level traditionally used in the art) is achieved in order for a SNP to be considered to have an association with a disease. sIt is more preferred that a p-value <0. 01 (a significance level on the stringent side) is achieved for an association to be declared. When hits are. followed up in confirmatory analyses in more samples. of the same source or in different samples from different sources, adjustment for multiple testing will be performed as to avoid excess number of hits while maintaining the experiment-wise error rates at 0.05. While there are different methods to adjust for multiple testing to control for different kinds of error rates, a commonly used but rather conservative method is Bonferroni correction to control the experiment-wise or family-wise error rate (Multiple comparisons and multiple tests, Westfall et al, SAS Institute (1999)). Permutation tests to control. for the false discovery rates, FDR, can be more powerful (Benjamini and Hochberg, Journal of the Royal Statistical Society, Series B 57,1289-1300, 1995, Resampling-based Multiple Testing, Westfall and Young, Wiley (1993) ). Such methods to control for multiplicity would be preferred when the tests are dependent and controlling for false discovery rates is sufficient as opposed to controlling for the experiment-wise error rates.

In replication studies using samples from different populations after statistically significant markers have been identified in the exploratory stage, meta-analyses can then be performed by combining evidence of different studies (Modern Epidemiology, Lippincott Williams & Wilkins, 1998,643-673). If available, association results known in the art for the same SNPs can be included in the meta-analyses.

Since both genotyping and disease status classification can involve errors, sensitivity analyses may be performed to see how odds ratios and p-values would change upon various estimates on genotyping and disease classification error rates.

It has been well known that subpopulation-based sampling bias between cases and controls can lead to spurious results in case-control association studies (Ewens and Spielman, Am. J. Hum. Genet. 62, 450-458, 1995) when prevalence of the disease is associated with different subpopulation groups. Such bias can also lead to a loss of statistical power in genetic association studies. To detect population stratification, Pritchard and Rosenberg (Pritchard et al. Am. J. Hum. Gen.. 1999, 65: 220-228) suggested typing markers that are unlinked to the disease and using results of association tests on those markers to determine whether there is any population-stratification. When stratification is detected, the genomic control (GC) method as proposed by Devlin and Roeder (Devlin et al. Biometrics. 1999, 55: 997-1004) can be used to adjust for the inflation of test statistics due to population stratification. GC method is robust to changes in population structure levels as well as being applicable to DNA pooling designs (Devlin et al. Genet. Epidem. 20001,21 : 273-284).

While Pritchard's method recommended using 15-2Gunlinked microsatellite markers, it suggested using more than 30 biallelic markers to get enough power to detect population stratification. For the GC method, it has been shown (Bacanu et al. Am. J.

Hum. Genet. 2000,66 : 1933-1944) that about 60-70-biallelic markers are sufficient to estimate the inflation factor for the test statistics due to population stratification. Hence, 70 intergenic SNPs can be chosen in unlinked regions as indicated in a genome scan (Kehoe et al. Hum. Mol. Genet. 1999,8 : 237-245).

Once individual risk factors, genetic or non-genetic, have been found for the predisposition to disease, the next step is to set up a classification/prediction scheme to predict the category (for instance, disease or no-disease) that an individual will be in depending on his genotypes of associated SNPs and other non-genetic risk factors.

Logistic regression for discrete trait and linear regression for continuous trait are standard techniques for such tasks (Xpplied ReOression Analysis, Draper and Smith, Wiley (1998) ). Moreover, other techniques can also be used for setting up classification. Such techniques include, but are not limited to, MART, CART, neural network, and

discriminant analyses that are suitable for use in comparing the performance of different methods (The Elements of Statistical Learning, Hastie, Tibshirani & Friedman, Springer (2002)).

Disease Diagnosis and Predisposition Screening Information on association/correlation between genotypes and disease-related phenotypes can be exploited in several ways. For example, in the case of a highly statistically significant association between one or more SNPs with predisposition to a disease for which treatment is available, detection of such a genotype pattern in an individual may justify immediate administration of treatment, or at least the institution of regular monitoring of the individual. Detection of the susceptibility alleles associated with serious disease in a couple contemplating having children may also be valuable to the couple in their reproductive decisions : In the case of a-weaker but still statistically significant association between a SNP and a human disease, immediate therapeutic intervention or monitoring may not be justified after detecting the susceptibility allele or SNP. Nevertheless, the subject can be motivated to begin simple life-style changes (e. g., diet, exercise) that can be accomplished at little or no cost to the individual but would confer potential benefits in reducing the risk of developing conditions for which that individual may have an increased risk by virtue of having the susceptibility allele (s).

The SNPs of the invention may contribute to cardiovascular disorders such as acute coronary events, or to responsiveness of an individual to statin treatment, in different ways. Some polymorphisms occur within a protein coding sequence and contribute to disease phenotype by affecting protein structure. Other polymorphisms occur in noncoding regions but may exert phenotypic effects indirectly via influence on, for example, replication, transcription, and/or translation. A single SNP may affect more than one phenotypic trait. Likewise, a single phenotypic trait may be affected by multiple SNPs in different genes.

As used herein, the terms"diagnose", "diagnosis", and"diagnostics"include, but are not limited to any of the following: detection of a cardiovascular disorders that an individual may presently have, predisposition/susceptibility screening (e. g., determining whether an individual has an increased risk of experiencing an acute coronary event in

the future, or determining whether an individual has a decreased risk of experiencing an acute coronary event in the future), determining a particular type or subclass of cardiovascular disorder in an individual known to currently have or to have previously experienced a cardiovascular disorder, confirming or reinforcing a previously made diagnosis of a cardiovascular disorder, evaluating an individual's likelihood of responding to statin treatment for cardiovascular disorders, predisposition screening (e. g., evaluating an individual's likelihood of responding to statin treatment if the individual were to develop a cardiovascular disorder in the future), determining a particular type or subclass of responder/non-responder in an individual known to respond or not respond to statin treatment, confirming or reinforcing a previously made classification of an. individual as a responder/non-responder to statin treatment, pharmacogenomic evaluation of an individual to determine which therapeutic strategy that individual is most likely to positively respond to or to predict whether a : patient is likely to respond to a particular treatment such as statin treatment, predicting whether a patient is likely to experience toxic effects from a particular treatment or therapeutic compound, and evaluating the future prognosis of an individual having a cardiovascular disorder. Such diagnostic uses are based on the SNPs individually or in a unique combination or SNP haplotypes of the present invention.

Haplotypes are particularly useful, in that, for example, fewer SNPs can be genotyped to determine if a particular genomic region harbors a locus that influences a particular phenotype, such as in linkage disequilibrium-based SNP association analysis.

Linkage disequilibrium (LD) refers to the co-inheritance of alleles (e. g., alternative nucleotides) at two or more different SNP sites at frequencies greater than would be expected from the separate frequencies of occurrence of each allele in a given population. The expected frequency of co-occurrence of two alleles that are inherited independently is the frequency of the first allele multiplied by the frequency of the second allele. Alleles that co-occur at expected frequencies are said to be in"linkage equilibrium". In contrast, LD refers to any non-random genetic association between allele (s) at two or more different SNP sites, which is generally due to the physical proximity of the two loci along a chromosome. LD can occur when two or more SNPs sites are in close physical proximity to each other on a given chromosome and therefore

alleles at these SNP sites will tend to remain unseparated for multiple generations with the consequence that a particular nucleotide (allele) at one SNP site will show a non- random association with a particular nucleotide (allele) at a different SNP site located nearby. Hence, genotyping one of the SNP sites will give almost the same information as genotyping the other SNP site that is in LD.

Various degrees of LD can be encountered between two or more SNPs with the result being that some SNPs are more closely associated (i. e. , in stronger LD) than others.

Furthermore, the physical distance over which LD extends along a chromosome differs between different regions of the genome, and therefore the degree of physical separation between two or more SNP sites necessary for LD to-occur can differ between different regions of the genome.

For diagnostic purposes and similar uses, if a particular SNP site is found to be useful for, for example, predicting an individual's susceptibility. to an acute coronary event or an individual's response to statimtreatment, then the skilled artisan would recognize that other SNP sites which are in LD with this SNP site would also be useful for predicting an individual's response to statin treatment. Various degrees of LD can be encountered between two or more SNPs with the result being that some SNPs are more closely associated (i. e. , in stronger LD) than others. Furthermore, the physical distance over which LD extends along a chromosome differs between different regions of the genome, and therefore the degree of physical separation between two or more SNP sites necessary for LD to occur can differ between different regions of the genome. Thus, polymorphisms (e. g. , SNPs and/or haplotypes) that are not the actual disease-causing (causative) polymorphisms, but are in LD with such causative polymorphisms, are also useful. In such instances, the genotype of the polymorphism (s) that is/are in LD with the causative polymorphism is predictive of the genotype of the causative polymorphism and, consequently, predictive of the phenotype (e. g. , responder/non-responder to statin treatment) that is influenced by the causative SNP (s). Therefore, polymorphic markers that are in LD with causative polymorphisms are useful as diagnostic markers, and are particularly useful when the actual causative polymorphism (s) is/are unknown.

Examples of polymorphisms that can be in LD with one or more causative polymorphisms (and/or in LD with one or more polymorphisms that have a significant

statistical association with a condition) and therefore useful for diagnosing the same condition that the causative/associated SNP (s) is used to diagnose, include, for example, other SNPs in the same gene, protein-coding, or mRNA transcript-coding region as the causative/associated SNP, other SNPs in the same exon or same intron as the causative/associated SNP, other SNPs in the same haplotype block as the causative/associated SNP, other SNPs in the same intergenic region as the causative/associated SNP, SNPs that are outside but near a gene (e. g. , within 6kb on either side, 5'or 3', of a gene boundary) that harbors a causative/associated SNP, etc.

Such useful LD SNPs can be selected from among the SNPs disclosed in Tables 1-2, for example.

Linkage disequilibrium in the human genome is reviewed in: Wall et al. , "Haplotype blocks and linkage disequilibrium in the human genome", Nat Rev Genet ; 2003 Aug; 4 (8) : 587-97 gainer et al.,"On selectingZmarkers for association studies: patterns of linkage disequilibrium between two and three diallelic loci", Genet Epidemiol.

2003 Jan; 24 (1) : 57-67; Ardlie et al. ,"Patterns of linkage disequilibrium in the human genome", Nat Rev Genet. 2002 Apr; 3 (4): 299-309 (erratum in Nat Rev Genet 2002 Jul ; 3 (7): 566); and. Remm et al.,"High-density genotyping and linkage disequilibrium in. the human genome using chromosome 22 as a model" ; Curr Opin Chem Biol. 2002 Feb; 6 (1) : 24-30.

The contribution or association of particular SNPs and/or SNP haplotypes with disease phenotypes, such as susceptibility to acute coronary events or responsiveness to statin treatment, enables the SNPs of the present invention to be used to develop superior diagnostic tests capable of identifying individuals who express a detectable trait, such as predisposition to acute coronary events or responder/non-responder to statin treatment, as the result of a specific genotype, or individuals whose genotype places them at an increased or decreased risk of developing a detectable trait at a subsequent time as compared to individuals who do not have that genotype. As described herein, diagnostics may be based on a single SNP or a group of SNPs. Combined detection of a plurality of SNPs (for example, 2,3, 4,5, 6,7, 8,9, 10,11, 12,13, 14,15, 16,17, 18, 19,20, 24,25, 30,32, 48, 50,64, 96,100, or any other number in-between, or more, of the SNPs provided in Table 1 and/or Table 2) typically increases the probability of an accurate

diagnosis. For example, the presence of a single SNP known to correlate with response to statin treatment might indicate a probability of 20% that an individual will respond to statin treatment, whereas detection of five SNPs, each of which correlates with response to statin treatment, might indicate a probability of 80% that an individual will respond to statin treatment. To further increase the accuracy of diagnosis or predisposition screening, analysis of the SNPs of the present invention can be combined with that of other polymorphisms or other risk factors that correlate with disease risk and response to statin treatment, such as family history.

- It will, of course, be understood by practitioners skilled in the treatment or diagnosis of cardiovascular disorders that the present invention generally does not intend , to provide an absolute identification of individuals who will or will not experience an acute coronary event or develop another cardiovascular disorder, or those individuals who will or will not respond to statin treatment : of cardiovascular disorders, but rather to. indicate a certain increased (or decreased) degree or likelihood of developing an acute' coronary event or responding to statin treatment based on statistically significant association results. However, this information is extremely valuable as it can, for example, indicate that an individual having a cardiovascular disorder should follow a particular statin-based treatment regimen, or should follow an alternative treatment regimen that does not involve statin. This information can also be used to initiate preventive treatments or to allow an individual carrying one or more significant SNPs or SNP haplotypes to foresee warning signs such as minor clinical symptoms of cardiovascular disease, or to have regularly scheduled physical exams to monitor for cardiovascular disorders in order to identify and begin treatment of the disorder at an early stage. Particularly with diseases that are extremely debilitating or fatal if not treated on time, the knowledge of a potential predisposition to the disease or likelihood of responding to available treatments, even if this predisposition or likelihood is not absolute, would likely contribute in a very significant manner to treatment efficacy.

The diagnostic techniques of the present invention may employ a variety of methodologies to determine whether a test subject has a SNP or a SNP pattern associated with an increased or decreased risk of developing a detectable trait or whether the individual suffers from a detectable trait as a result of a particular

polymorphism/mutation, including, for example, methods which enable the analysis of individual chromosomes for haplotyping, family studies, single sperm DNA analysis, or somatic hybrids. The trait analyzed using the diagnostics of the invention may be any detectable trait that is commonly observed in cardiovascular disorders or during the course of statin treatment.

Another aspect of the present invention relates to a method of determining whether an individual is at risk (or less at risk) of developing one or more traits or whether an individual expresses one or more traits as a consequence of possessing a particular trait-causing or trait-influencing allele. These methods generally involve obtaining a nucleic acid sample from an individual and assaying the nucleic acid sample to determine which nucleotide (s) is/are present at, one or more SNP positions, wherein the assayed nucleotide (s) is/are indicative of an increased or decreased risk of developing the trait or indicative that the individual expresses the trait. as a result of possessing a particular : trait-causing or trait-influencing allele.

In another embodiment, the SNP detection reagents of the present invention are used to determine whether an individual has one or more SNP allele (s) affecting the level (e. g. , the concentration of mRNA or protein in a sample, etc. ) or pattern (e. g. , the kinetics of expression, rate of decomposition, stability profile, Km, Vmax, etc. ) of gene expression (collectively, the"gene response"of a cell or bodily fluid). Such a determination can be accomplished by screening for mRNA or protein expression (e. g., by using nucleic acid arrays, RT-PCR, TaqMan assays, or mass spectrometry), identifying genes having altered expression in an individual, genotyping SNPs disclosed in Table 1 and/or Table 2 that could affect the expression of the genes having altered expression (e. g. , SNPs that are in and/or around the gene (s) having altered expression, SNPs in regulatory/control regions, SNPs in and/or around other genes that are involved in pathways that could affect the expression of the gene (s) having altered expression, or all SNPs could be genotyped), and correlating SNP genotypes with altered gene expression. In this manner, specific SNP alleles at particular SNP sites can be identified that affect gene expression.

Pharmacogenomics and Therapeutics/Drug Development The present invention provides methods for assessing the pharmacogenomics of a subject harboring particular SNP alleles or haplotypes to a particular therapeutic agent or pharmaceutical compound, or to a class of such compounds. Pharmacogenomics deals with the roles which clinically significant hereditary variations (e. g., SNPs) play in the response to drugs due to altered drug disposition and/or abnormal action in affected persons.

See, e. g. , Roses, Nature 405, 857-865 (2000); Gould Rothberg, Nature Biotechnology 19, 209-211 (2001); Eichelbaum, Clin. Exp. Pharmacol. Physiol. 23 (10-11) : 983-985 (1996); and Linder, Clin. Chem. 43 (2): 254-266 (1997). The clinical outcomes of these variations can result in severe toxicity of therapeutic drugs in certain individuals or therapeutic failure of drugs in certain individuals as a result of individual vatiation in metabolism. Thus, the SNP genotype of an individual can determine the way a therapeutic compound acts on the body or the way the body metabolizes the compound. For example, SNPs in drug metabolizing enzymes can affect the activity of these enzymes, which in turn can affect both the intensity and duration of drug action, as well as drug metabolism and clearance.

The discovery of SNPs in drug metabolizing enzymes, drug transporters, proteins for pharmaceutical agents, and other drug targets has explained why some patients do not obtain the expected drug effects, show an exaggerated drug effect, or experience serious toxicity from standard drug dosages. SNPs can be expressed in the phenotype of the extensive metabolizer and in the phenotype of the poor metabolizer. Accordingly, SNPs may lead to allelic variants of a protein in which one or more of the protein functions in one population are different from those in another population. SNPs and the encoded variant peptides thus provide targets to ascertain a genetic predisposition that can affect treatment modality. For example, in a ligand-based treatment, SNPs may give rise to amino terminal extracellular domains and/or other ligand-binding regions of a receptor that are more or less active in ligand binding, thereby affecting subsequent protein activation. Accordingly, ligand dosage would necessarily be modified to maximize the therapeutic effect within a given population containing particular SNP alleles or haplotypes.

As an alternative to genotyping, specific variant proteins containing variant amino acid sequences encoded by alternative SNP alleles could be identified. Thus, pharmacogenomic characterization of an individual permits the selection of effective

compounds and effective dosages of such compounds for prophylactic or therapeutic uses based on the individual's SNP genotype, thereby enhancing and optimizing the effectiveness of the therapy. Furthermore, the production of recombinant cells and transgenic animals containing particular SNPs/haplotypes allow effective clinical design and testing of treatment compounds and dosage regimens. For example, transgenic animals can be produced that differ only in specific SNP alleles in a gene that is orthologous to a human disease susceptibility gene.

Pharmacogenomic uses of the SNPs of the present invention provide several significant advantages for patient care, particularly in predicting an individual's predisposition to acute coronary events and other cardiovascular disorders and in predicting an individual's responsiveness to the. use of statin for treating cardiovascular disease.

Pharmacogenomic characterization of an individual, based on an-individual's SNP genotype, can identify those individuals unlikely'to respond to treatment with a particular medication and thereby allows physicians to avoid prescribing the ineffective medication to those individuals. On the other hand, SNP genotyping of an individual may enable physicians to select the appropriate medication and dosage regimen that will be most effective based on an individual's SNP genotype. This information increases a physician's confidence in prescribing medications and motivates patients to comply with their drug regimens. Furthermore, pharmacogenomics may identify patients predisposed to toxicity and adverse reactions to particular drugs or drug dosages. Adverse drug reactions lead to more than 100,000 avoidable deaths per year in the United States alone and therefore represent a significant cause of hospitalization and death, as well as a significant economic burden on the healthcare system (Pfost et. al., Trends in Biotechnology, Aug. 2000. ). Thus, pharmacogenomics based on the SNPs disclosed herein has the potential to both save lives and reduce healthcare costs substantially.

Pharmacogenomics in general is discussed further in Rose et al., "Pharmacogenetic analysis of clinically relevant genetic polymorphisms", Methods Mol Med. 2003; 85: 225-37. Pharmacogenomics as it relates to Alzheimer's disease and other neurodegenerative disorders is discussed in Cacabelos,"Pharmacogenomics for the treatment of dementia", Ann Med. 2002; 34 (5): 357-79, Maimone et al., "Pharmacogenomics of neurodegenerative diseases", Eur JPharmacol. 2001 Feb

9; 413 (1) : 11-29, and Poirier, "Apolipoprotein E: a pharmacogenetic target for the treatment of Alzheimer's disease", Mol Diagn. 1999 Dec; 4 (4): 335-41.

Pharmacogenomics as it relates to cardiovascular disorders is discussed in Siest et al., "Pharmacogenomics of drugs affecting the cardiovascular system", Clin Chem Lab Med.

2003 Apr; 41 (4): 590-9, Mukherjee et al.,"Pharmacogenomics in cardiovascular diseases", Prog Cardiovasc Dis. 2002 May-Jun; 44 (6): 479-98, and Mooser et al.,"Cardiovascular pharmacogenetics in the SNP era", JThromb Haemost. 2003 Jul ; l (7): 1398-402.

Pharmacogenomics as it relates to cancer is discussed in McLeod et al.,"Cancer pharmacogenomics : SNPs, chips, and the individual patient", Cancer Invest.

2003; 21 (4): 630-40 and Watters et al.,"Cancer pharmacogenomics : current and future applications", BiochimBiophysActa. 2003 Mar 17 ; 1603 (2): 99-111.

The SNPs of the present invention also can be used to identify novel therapeutic targets for cardiovascular disorders. For example ; genes containing the disease- ^associated variants ("variant genes") or their products, as well. as : genes or their products that are directly or indirectly regulated by or interacting with these variant genes or their products, can be targeted for the development of therapeutics that, for example, treat the disease or prevent or delay disease onset. The therapeuticsimay be composed of, for example, small molecules, proteins, protein fragments or peptides, antibodies, nucleic acids, or their derivatives or mimetics which modulate the functions or levels of the target genes or gene products.

The SNP-containing nucleic acid molecules disclosed herein, and their complementary nucleic acid molecules, may be used as antisense constructs to control gene expression in cells, tissues, and organisms. Antisense technology is well established in the art and extensively reviewed in Antisense Drug Technology : Principles, Strategies, and Applications, Crooke (ed.), Marcel Dekker, Inc.: New York (2001). An antisense nucleic acid molecule is generally designed to be complementary to a region of mRNA expressed by a gene so that the antisense molecule hybridizes to the mRNA and thereby blocks translation of mRNA into protein. Various classes of antisense oligonucleotides are used in the art, two of which are cleavers and blockers. Cleavers, by binding to target RNAs, activate intracellular nucleases (e. g. , RNaseH or RNase L) that cleave the target RNA. Blockers, which also bind to target RNAs, inhibit protein translation through steric

hindrance of ribosomes. Exemplary blockers include peptide nucleic acids, morpholinos, locked nucleic acids, and methylphosphonates (see, e. g. , Thompson, Drug Discovery Today, 7 (17): 912-917 (2002) ). Antisense oligonucleotides are directly useful as therapeutic agents, and are also useful for determining and validating gene function (e. g., in gene knock-out or knock-down experiments).

Antisense technology is further reviewed in: Lavery et al. ,"Antisense and RNAi : powerful tools in drug target discovery and validation", Curr Opin Drug Discov Devel.

2003 Jul ; 6 (4): 561-9; Stephens et al. ,"Antisense oligonucleotide therapy in cancer", Curr Opin Mol Ther. 2003 Apr; 5 (2): 118-22; Kurreck,"Antisense technologies. Improvement through novel chemical modifications", Eur JBiochen. 2003 Apr; 270 (8): 1628-44 ; Dias et al. ,"Antisense oligonucleotides basic concepts and mechanisms", Mol Cancer Sher.

2002 Mar ; 1 (5): 347-55; Chen, "Clinical development of antisense oligonucleotides as anti-cancer. therapeutics", Methods Mol Med. 2003975 : 621-36 ; Wang$t al. ,"Antisense anticancer oligonucleotide therapeutics", Curr Cance7nDrug Targets. 2001 Nov; 1 (3): 177- 96; and Bennett,"Efficiency of antisense oligonucleotide drug discovery", Antisense NucleicAcidDrugDev. 2002 Jun; 12 (3): 215-24.

The SNPs of the present invention are particularly useful for designing antisense reagents that are specific for particular nucleic acid variants. Based on the SNP information disclosed herein, antisense oligonucleotides can be produced that specifically target mRNA molecules that contain one or more particular SNP nucleotides. In this manner, expression of mRNA molecules that contain one or more undesired polymorphisms (e. g. , SNP nucleotides that lead to a defective protein such as an amino acid substitution in a catalytic domain) can be inhibited or completely blocked. Thus, antisense oligonucleotides can be used to specifically bind a particular polymorphic form (e. g. , a SNP allele that encodes a defective protein), thereby inhibiting translation of this form, but which do not bind an alternative polymorphic form (e. g. , an alternative SNP nucleotide that encodes a protein having normal function).

Antisense molecules can be used to inactivate mRNA in order to inhibit gene expression and production of defective proteins. Accordingly, these molecules can be used to treat a disorder, such as a cardiovascular disorder, characterized by abnormal or undesired gene expression or expression of certain defective proteins. This technique can

involve cleavage by means of ribozymes containing nucleotide sequences complementary to one or more regions in the mRNA that attenuate the ability of the mRNA to be translated. Possible mRNA regions include, for example, protein-coding regions and particularly protein-coding regions corresponding to catalytic activities, substrate/ligand binding, or other functional activities of a protein.

The SNPs of the present invention are also useful for designing RNA interference reagents that specifically target nucleic acid molecules having particular SNP variants.

RNA interference (RNAi), also referred to as gene silencing, is based on using double- stranded RNA (dsRNA) molecules to turn genes off. s When introduced into a cell, dsRNAs are processed by the cell into short fragments' (generally about 21,22, or 23 nucleotides in length) known as small interfering RNAs : (siRNAs) which the cell uses in a sequence-specific manner to recognize and destroy complementary RNAs (Thompson, DrugDiscovery Today, 7 (17) : 912-917. (2002)). Accordingly, ah aspect of the present. invention specifically contemplates isolated nucleic acid molecules that are about 18-26 nucleotides in length, preferably 19-25 nucleotides in length, and more preferably 20, 21, 22, or 23 nucleotides in length, and the use of these nucleic acid molecules for RNAi.

Because RNAi molecules, including siRNAs, act in. a sequence-specific manner, the SNPs of the present invention can be used to design RNAi reagents that recognize and destroy nucleic acid molecules having specific SNP alleles/nucleotides (such as deleterious alleles that lead to the production of defective proteins), while not affecting nucleic acid molecules having alternative SNP alleles (such as alleles that encode proteins having normal function). As with antisense reagents, RNAi reagents may be directly useful as therapeutic agents (e. g. , for turning off defective, disease-causing genes), and are also useful for characterizing and validating gene function (e. g. , in gene knock-out or knock-down experiments).

The following references provide a further review of RNAi : Reynolds et al., "Rational siRNA design for RNA interference", Nat Biotechnol. 2004 Mar ; 22 (3): 326-30.

Epub 2004 Feb 01 ; Chi et al.,"Genomewide view of gene silencing by small interfering RNAs", PNAS 100 (11) : 6343-6346,2003 ; Vickers et al. ,"Efficient Reduction of Target RNAs by Small Interfering RNA and RNase H-dependent Antisense Agents", J. Biol.

Chem. 278: 7108-7118,2003 ; Agami,"RNAi and related mechanisms and their potential

use for therapy", Curr Opin Chem Biol. 2002 Dec; 6 (6): 829-34; Lavery et al.,"Antisense and RNAi : powerful tools in drug target discovery and validation", Curr Opin Drug Discov Devel. 2003 Jul ; 6 (4): 561-9 ; Shi,"Mammalian RNAi for the masses", Trends Genet 2003 Jan; 19 (1) : 9-12), Shuey et al.,"R ; NAi : gene-silencing in therapeutic intervention", Drug Discovery Today 2002 Oct; 7 (20) : 1040-1046 ; McManus et al., Nat Rev Genet 2002 Oct; 3 (10): 737-47; Xia et al., NatBiotechnol 2002 Oct; 20 (10): 1006-10 ; Plasterk et al., Curr Opin Genet Dev 2000 Oct ; 10 (5): 562-7 ; Bosher et al., Nat Cell Biol 2000 Feb ; 2 (2): E31-6; and Hunter, Curr Biol 1999 Jun 17; 9 (12) : R440-2).

A subject suffering from a pathological condition, such as a cardiovascular disorder, ascribed to a SNP may be treated so as to correct the genetic defect (see Kren et al., Proc. >Natl. Acad. Sci. USA 96: 10349-10354., (1999)). Such a subject can be identified. by any method that can detect the polymorphism in a biological sample drawn from the subject. Such a genetic defect may be permanently corrected by administering to such a- subject a nucleic acid fragment incorporating a'repair, sequence that supplies the normal/wild-type nucleotide at the position of the SNP. This site-specific repair sequence can encompass an RNA/DNA oligonucleotide that operates to promote . endogenous repair of a subject's genomic DNA. The site-specific repair sequence is administered in an appropriate vehicle, such as a complex with polyethylenimine, encapsulated in anionic liposomes, a viral vector such as an adenovirus, or other pharmaceutical composition that promotes intracellular uptake of the administered nucleic acid. A genetic defect leading to an inborn pathology may then be overcome, as the chimeric oligonucleotides induce incorporation of the normal sequence into the subject's genome. Upon incorporation, the normal gene product is expressed, and the replacement is propagated, thereby engendering a permanent repair and therapeutic enhancement of the clinical condition of the subject.

In cases in which a cSNP results in a variant protein that is ascribed to be the cause of, or a contributing factor to, a pathological condition, a method of treating such a condition can include administering to a subject experiencing the pathology the wild- type/normal cognate of the variant protein. Once administered in an effective dosing regimen, the wild-type cognate provides complementation or remediation of the pathological condition.

The invention further provides a method for identifying a compound or agent that can be used to treat cardiovascular disorders. The SNPs disclosed herein are useful as targets for the identification and/or development of therapeutic agents. A method for identifying a therapeutic agent or compound typically includes assaying the ability of the agent or compound to modulate the activity and/or expression of a SNP-containing nucleic acid or the encoded product and thus identifying an agent or a compound that can be used to treat a disorder characterized by undesired activity or expression of the SNP-containing nucleic acid or the encoded product. The assays can be performed in cell-based and cell- free systems. Cell-based assays can include cells naturally expressing the nucleic acid molecules of interest or recombinant cells genetically engineered to express certain nucleic acid molecules.

Variant gene expression in a patient having a cardiovascular disorder or undergoing statin treatment can include, for example, either expression of a SNP-containing nucleictacid sequence (for instance, a gene that contains a SNP can be transcribed into an mRNA transcript molecule containing the SNP, which can in turn be translated into a variant protein) or altered expression of a normal/wild-type nucleic acid sequence due to one or more. SNPs (for instance, a regulatory/control region can contain a SNP that affects the levels or pattern of expression of a normal transcript).

Assays for variant gene expression can involve direct assays of nucleic acid levels (e. g., mRNA levels), expressed protein levels, or of collateral compounds involved in a signal pathway. Further, the expression of genes that are up-or down-regulated in response to the signal pathway can also be assayed. In this embodiment, the regulatory regions of these genes can be operably linked to a reporter gene such as luciferase.

Modulators of variant gene expression can be identified in a method wherein, for example, a cell is contacted with a candidate compound/agent and the expression of mRNA determined. The level of expression of mRNA in the presence of the candidate compound is compared to the level of expression of mRNA in the absence of the candidate compound.

The candidate compound can then be identified as a modulator of variant gene expression based on this comparison and be used to treat a disorder such as a cardiovascular disorder that is characterized by variant gene expression (e. g. , either expression of a SNP-containing nucleic acid or altered expression of a normal/wild-type nucleic acid molecule due to one or

more SNPs that affect expression of the nucleic acid molecule) due to one or more SNPs of the present invention. When expression of mRNA is statistically significantly greater in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of nucleic acid expression. When nucleic acid expression is statistically significantly less in the presence of the candidate compound than in its absence, the candidate compound is identified as an inhibitor of nucleic acid expression.

The invention further provides methods of treatment, with the SNP or associated nucleic acid domain (e. g., catalytic domain, ligand/substrate-binding domain, regulatory/control region, etc. ) or gene, or the encoded mRNA transcript, as a target, using a compound identified through drug screening as a gene modulator to modulate variant- nucleic acid expression. Modulation can include either up-regulation (i. e. , activation or agonization) or down-regulation (i. e. , suppression or antagonization) of nucleic acid expression.

Expression of mRNA transcripts and encoded proteins ; =either. wild type or variant, may be altered in individuals with a particular SNP allele in a regulatory/control element, such as a promoter or transcription factor binding domain, that regulates expression. In this situation, methods of treatment and compounds can be identified, as discussed herein, that' regulate or overcome the variant regulatory/control element, thereby generating normal, or healthy, expression levels of either the wild type or variant protein.

The SNP-containing nucleic acid molecules of the present invention are also useful for monitoring the effectiveness of modulating compounds on the expression or activity of a variant gene, or encoded product, in clinical trials or in a treatment regimen. Thus, the gene expression pattern can serve as an indicator for the continuing effectiveness of treatment with the compound, particularly with compounds to which a patient can develop resistance, as well as an indicator for toxicities. The gene expression pattern can also serve as a marker indicative of a physiological response of the affected cells to the compound. Accordingly, such monitoring would allow either increased administration of the compound or the administration of alternative compounds to which the patient has not become resistant.

Similarly, if the level of nucleic acid expression falls below a desirable level, administration of the compound could be commensurately decreased.

In another aspect of the present invention, there is provided a pharmaceutical pack comprising a therapeutic agent (e. g. , a small molecule drug, antibody, peptide, antisense or RNAi nucleic acid molecule, etc.) and a set of instructions for administration of the therapeutic agent to humans diagnostically tested for one or more SNPs or SNP haplotypes provided by the present invention.

The SNPs/haplotypes of the present invention are also useful for improving many different aspects of the drug development process. For instance, an aspect of the present invention includes selecting individuals for clinical trials based on their SNP genotype.

'For example, individuals with SNP genotypes that indicate that they are likely to positively respond to a drug can be included in the trials, whereas those individuals whose SNP genotypes indicate that they are less likely to or would not respond to the drug, or who are at risk for suffering toxic effects or other adverse reactions, can be excluded from the clinical trials. This not only can improve the safety of clinical trials, but also can enhance the chances that the. trial will demonstrate statistically significant efficacy. Furthermore, the SNPs of the present invention may explain why certain previously developed drugs performed poorly in clinical trials and may help identify a subset of the population that would benefit from a drug that had previously performed poorly in clinical trials, thereby"rescuing"previously developed drugs, and enabling the drug to be made available to a particular patient population that can benefit from it.

SNPs have many important uses in drug discovery, screening, and development.

A high probability exists that, for any gene/protein selected as a potential drug target, variants of that gene/protein will exist in a patient population. Thus, determining the impact of gene/protein variants on the selection and delivery of a therapeutic agent should be an integral aspect of the drug discovery and development process. (Jazwinska, A Trends Guide to Genetic Variation and Genomic Medicine, 2002 Mar; S30-S36).

Knowledge of variants (e. g. , SNPs and any corresponding amino acid polymorphisms) of a particular therapeutic target (e. g. , a gene, mRNA transcript, or protein) enables parallel screening of the variants in order to identify therapeutic candidates (e. g. , small molecule compounds, antibodies, antisense or RNAi nucleic acid compounds, etc.) that demonstrate efficacy across variants (Rothberg, Nat Biotechnol 2001 Mar; 19 (3): 209-11). Such therapeutic candidates would be expected to show equal

efficacy across a larger segment of the patient population, thereby leading to a larger potential market for the therapeutic candidate.

Furthermore, identifying variants of a potential therapeutic target enables the most common form of the target to be used for selection of therapeutic candidates, thereby helping to ensure that the experimental activity that is observed for the selected candidates reflects the real activity expected in the largest proportion of a patient population (Jazwinska, A Trends Guide to Genetic Variation and Genomic Medicine, 2002 Mar; S30-S36).

Additionally, screening therapeutic candidates against all known variants of a target can enable the early identification of potential toxicities and adverse reactions relating to particular variants. For example, variability in drug absorption, distribution, metabolism and excretion (ADME) caused by, for example, SNPs in therapeutic targets or drug metabolizing genes, can be identified, and this information can be utilized during the drug development process to minimize variability in drug disposition and develop therapeutic agents that are safer across a wider range of a patient population. The SNPs of the present invention, including the variant proteins and encoding polymorphic nucleic acid molecules provided in Tables 1-2, are useful in conjunction with a variety of toxicology methods established in the art, such as those set forth in Current Protocols in Toxicology, John Wiley & Sons, Inc., N. Y.

Furthermore, therapeutic agents that target any art-known proteins (or nucleic acid molecules, either RNA or DNA) may cross-react with the variant proteins (or polymorphic nucleic acid molecules) disclosed in Table 1, thereby significantly affecting the pharmacokinetic properties of the drug. Consequently, the protein variants and the SNP-containing nucleic acid molecules disclosed in Tables 1-2 are useful in developing, screening, and evaluating therapeutic agents that target corresponding art-known protein forms (or nucleic acid molecules). Additionally, as discussed above, knowledge of all polymorphic forms of a particular drug target enables the design of therapeutic agents that are effective against most or all such polymorphic forms of the drug target.

Pharmaceutical Compositions and Administration Thereof

Any of the cardiovascular disease and/or statin response-associated proteins, and encoding nucleic acid molecules, disclosed herein can be used as therapeutic targets (or directly used themselves as therapeutic compounds) for treating cardiovascular disorders and related pathologies, and the present disclosure enables therapeutic compounds (e. g., small molecules, antibodies, therapeutic proteins, RNAi and antisense molecules, etc. ) to be developed that target (or are comprised of) any of these therapeutic targets.

In general, a therapeutic compound will be administered in a therapeutically effective amount by any of the accepted modes of administration for agents that serve similar utilities. The actual amount of the therapeutic compound of this invention, i. e., the active ingredient, will depend upon numerous factors such as the severity of the disease to be treated, the age and relative health of the subject, the potency of the compound used, the route and form of administration, and other factors.

Therapeutically effective amounts of therapeutic compounds may range from, for example, approximately 0.01-50 mg per kilogram body weight of the recipient per day ; preferably about 0.1-20 mg/kg/day. Thus, as an example, for administration to a 70 kg person, the dosage range would most preferably be about 7 mg to 1.4 g per day.

In general, therapeutic compounds will be administered as pharmaceutical compositions by any one of the following routes: oral, systemic (e. g., transdermal, intranasal, or by suppository), or parenteral (e. g. , intramuscular, intravenous, or subcutaneous) administration. The preferred manner of administration is oral or parenteral using a convenient daily dosage regimen, which can be adjusted according to the degree of affliction. Oral compositions can take the form of tablets, pills, capsules, semisolids, powders, sustained release formulations, solutions, suspensions, elixirs, aerosols, or any other appropriate compositions.

The choice of formulation depends on various factors such as the mode of drug administration (e. g. , for oral administration, formulations in the form of tablets, pills, or capsules are preferred) and the bioavailability of the drug substance. Recently, pharmaceutical formulations have been developed especially for drugs that show poor bioavailability based upon the principle that bioavailability can be increased by increasing the surface area, i. e. , decreasing particle size. For example, U. S. Patent No.

4,107, 288 describes a pharmaceutical formulation having particles in the size range from

10 to 1,000 nm in which the active material is supported on a cross-linked matrix of macromolecules. U. S. Patent No. 5,145, 684 describes the production of a pharmaceutical formulation in which the drug substance is pulverized to nanoparticles (average particle size of 400 nm) in the presence of a surface modifier and then dispersed in a liquid medium to give a pharmaceutical formulation that exhibits remarkably high bioavailability.

Pharmaceutical compositions are comprised of, in general, a therapeutic compound in combination with at least one pharmaceutically acceptable excipient.

Acceptable excipients are non-toxic, aid administration, and do not adversely affect the therapeutic benefit of the therapeutic compound. Such excipients may be any solid, liquid, semi-solid or, in the case of an aerosol composition, gaseous excipient that is generally available to one skilled in the art.

Solid pharmaceutical excipients include starch,. cellulose,; talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate ; glycerol monostearate, sodium chloride, dried skim milk and the like. Liquid and semisolid excipients may be selected from glycerol, propylene glycol, water, ethanol and various oils, including those of petroleum, animal, vegetable or synthetic origin, e. g., peanut oil, soybean oil, mineral oil, sesame oil, etc. Preferred liquid carriers, particularly for injectable solutions, include water, saline, aqueous dextrose, and glycols.

Compressed gases may be used to disperse a compound of this invention in aerosol form. Inert gases suitable for this purpose are nitrogen, carbon dioxide, etc.

Other suitable pharmaceutical excipients and their formulations are described in Remington's Pharmaceutical Sciences, edited by E. W. Martin (Mack Publishing Company, 18th ed., 1990).

The amount of the therapeutic compound, in a formulation can vary within the full range employed by those skilled in the art. Typically, the formulation will contain, on a weight percent (wt %) basis, from about 0.01-99. 99 wt % of the therapeutic compound based on the total formulation, with the balance being one or more suitable pharmaceutical excipients. Preferably, the compound is present at a level of about 1-80 wt%.

Therapeutic compounds can be administered alone or in combination with other therapeutic compounds or in combination with one or more other active ingredient (s).

For example, an inhibitor or stimulator of a cardiovascular disorder-associated protein can be administered in combination with another agent that inhibits or stimulates the activity of the same or a different cardiovascular disorder-associated protein to thereby counteract the affects of a cardiovascular disorder.

For further information regarding pharmacology, see Current Protocols in Pharmacology, John Wiley & Sons, Inc., N. Y.

Human Identification Applications In addition to their diagnostic and therapeutic usesdn cardiovascular disorders and statin treatment of cardiovascular disorders, the SNPs provided by the present invention are also useful as human identificationmarkers for suchtapplications as forensic, paternity testing, and biometrics (see, e. g., Gill ;"An assessment of the. utility of single nucleotide polymorphisms (SNPs) for forensic purposes", Int JLegal Med. 2001 ; 114 (4 5): 204-10). Genetic variations in the nucleic acid sequences between individuals can be used as genetic markers to identify individuals. and to associate a biological sample with an individual. Determination of which nucleotides occupy a set of SNP positions in an individual identifies a set of SNP markers that distinguishes the individual. The more SNP positions that are analyzed, the lower the probability that the set of SNPs in one individual is the same as that in an unrelated individual. Preferably, if multiple sites are analyzed, the sites are unlinked (i. e. , inherited independently). Thus, preferred sets of SNPs can be selected from among the SNPs disclosed herein, which may include SNPs on different chromosomes, SNPs on different chromosome arms, and/or SNPs that are dispersed over substantial distances along the same chromosome arm.

Furthermore, among the SNPs disclosed herein, preferred SNPs for use in certain forensic/human identification applications include SNPs located at degenerate codon positions (i. e. , the third position in certain codons which can be one of two or more alternative nucleotides and still encode the same amino acid), since these SNPs do not affect the encoded protein. SNPs that do not affect the encoded protein are expected to be under less selective pressure and are therefore expected to be more polymorphic in a

population, which is typically an advantage for forensic/human identification applications. However, for certain forensics/human identification applications, such as predicting phenotypic characteristics (e. g. , inferring ancestry or inferring one or more physical characteristics of an individual) from a DNA sample, it may be desirable to utilize SNPs that affect the encoded protein.

For many of the SNPs disclosed in Tables 1-2 (which are identified as"Applera" SNP source), Tables 1-2 provide SNP allele frequencies obtained by re-sequencing the DNA of chromosomes from 39 individuals (Tables 1-2 also provide allele frequency information for"Celera"source SNPs and, where available, public SNPs from dbEST, HGBASE, and/or HGMD). The allele frequencies provided in Tables 1-2 enable these SNPs to be readily used for human identification applications. (Although any SNP disclosed in Table 1 and/or Table 2 could be used for human identification, the closer that the frequency of the minor allele. at a particular SNPsite. is to 50% ; the greater the ability of that SNP to discriminate between different-individuals in a population since it becomes increasingly likely that two randomly selected individuals would have different alleles at that SNP site. Using the SNP allele frequencies provided in Tables 1-2, one of ordinary skill in the art could readily select a subset of SNPs for which the frequency of the minor allele is, for example, at least 1%, 2%, 5%, 10%, 20%, 25%, 30%, 40%, 45%, or 50%, or any other frequency in-between. Thus, since Tables 1-2 provide allele frequencies based on the re-sequencing of the chromosomes from 39 individuals, a subset of SNPs could readily be selected for human identification in which the total allele count of the minor allele at a particular SNP site is, for example, at least 1,2, 4,8, 10,16, 20,24, 30,32, 36, 38, 39, 40, or any other number in-between.

Furthermore, Tables 1-2 also provide population group (interchangeably referred to herein as ethnic or racial groups) information coupled with the extensive allele frequency information. For example, the group of 39 individuals whose DNA was re- sequenced was made-up of 20 Caucasians and 19 African-Americans. This population group information enables further refinement of SNP selection for human identification.

For example, preferred SNPs for human identification can be selected from Tables 1-2 that have similar allele frequencies in both the Caucasian and African-American populations; thus, for example, SNPs can be selected that have equally high

discriminatory power in both populations. Alternatively, SNPs can be selected for which there is a statistically significant difference in allele frequencies between the Caucasian and African-American populations (as an extreme example, a particular allele may be observed only in either the Caucasian or the African-American population group but not observed in the other population group); such SNPs are useful, for example, for predicting the race/ethnicity of an unknown perpetrator from a biological sample such as a hair or blood stain recovered at a crime scene. For a discussion of using SNPs to predict ancestry from a DNA sample, including statistical methods, see Frudakis et al., "A Classifier for the SNP-Based Inference of Ancestry", Journal of Forensic Sciences 2003; 48 (4): 771-782.

SNPs have numerous advantages over other types of polymorphic markers, such as short tandem repeats (STRs). For example, SNPs can be easily scored and are amenable to automation, making SNPs the markers of choicesfbr large-scale forensic databases. SNPs are found in much greater abundance throughout the genome than repeat polymorphisms. Population frequencies of two polymorphic forms can usually be determined with greater accuracy than those of multiple polymorphic forms at multi- allelic loci. SNPs are mutationaly more stable than repeat polymorphisms. SNPs are not susceptible to artefacts such as stutter bands that can hinder analysis. Stutter bands are frequently encountered when analyzing repeat polymorphisms, and are particularly troublesome when analyzing samples such as crime scene samples that may contain mixtures of DNA from multiple sources. Another significant advantage of SNP markers over STR markers is the much shorter length of nucleic acid needed to score a SNP. For example, STR markers are generally several hundred base pairs in length. A SNP, on the other hand, comprises a single nucleotide, and generally a short conserved region on either side of the SNP position for primer and/or probe binding. This makes SNPs more amenable to typing in highly degraded or aged biological samples that are frequently encountered in forensic casework in which DNA may be fragmented into short pieces.

SNPs also are not subject to microvariant and"off-ladder"alleles frequently encountered when analyzing STR loci. Microvariants are deletions or insertions within a repeat unit that change the size of the amplified DNA product so that the amplified product does not migrate at the same rate as reference alleles with normal sized repeat

units. When separated by size, such as by electrophoresis on a polyacrylamide gel, microvariants do not align with a reference allelic ladder of standard sized repeat units, but rather migrate between the reference alleles. The reference allelic ladder is used for precise sizing of alleles for allele classification; therefore alleles that do not align with the reference allelic ladder lead to substantial analysis problems. Furthermore, when analyzing multi-allelic repeat polymorphisms, occasionally an allele is found that consists of more or less repeat units than has been previously seen in the population, or more or less repeat alleles than are included in a reference allelic ladder. These alleles will migrate outside the size range of known alleles in a reference allelic ladder, and therefore are referred to as"off-ladder"alleles. In extreme cases, the allele may contain so few or so many repeats that it migrates well out. of the range of the reference allelic ladder. In this situation, the allele may not even be observed, or, with multiplex analysis, it may migrate within or close to the size range for another-locus, farther confounding analysis.

SNP analysis avoids the problems of microvariants and off-ladder alleles encountered in STR analysis. Importantly, microvariants and off-ladder alleles may provide significant problems, and may be completely missed, when using analysis methods such as oligonucleotide hybridization arrays, which. utilize oligonucleotide probes specific for certain known alleles. Furthermore, off-ladder alleles and microvariants encountered with STR analysis, even when correctly typed, may lead to improper statistical analysis, since their frequencies in the population are generally unknown or poorly characterized, and therefore the statistical significance of a matching genotype may be questionable. All these advantages of SNP analysis are considerable in light of the consequences of most DNA identification cases, which may lead to life imprisonment for an individual, or re-association of remains to the family of a deceased individual.

DNA can be isolated from biological samples such as blood, bone, hair, saliva, or semen, and compared with the DNA from a reference source at particular SNP positions.

Multiple SNP markers can be assayed simultaneously in order to increase the power of discrimination and the statistical significance of a matching genotype. For example, oligonucleotide arrays can be used to genotype a large number of SNPs simultaneously.

The SNPs provided by the present invention can be assayed in combination with other

polymorphic genetic markers, such as other SNPs known in the art or STRs, in order to identify an individual or to associate an individual with a particular biological sample.

Furthermore, the SNPs provided by the present invention can be genotyped for inclusion in a database of DNA genotypes, for example, a criminal DNA databank such as the FBI's Combined DNA Index System (CODIS) database. A genotype obtained from a biological sample of unknown source can then be queried against the database to find a matching genotype, with the SNPs of the present invention providing nucleotide positions at which to compare the known and unknown DNA sequences for identity.

Accordingly, the present invention provides a database comprising novel SNPs or SNP alleles of the present invention (e. g. , the database can comprise information indicating which alleles are possessed by individual members of a population at one or more novel SNP sites of the present invention). such as for use in forensic, biometrics, or other human. identification applications. Such a database typically comprises a computer-based ; system in which the SNPs or SNP alleles ofthe. present invention are recorded on a computer readable medium (see the section of the present specification entitled "Computer-Related Embodiments").

The SNPs of the present invention can also be assayed for use in paternity testing.

The object of paternity testing is usually to determine whether a male is the father of a child. In most cases, the mother of the child is known and thus, 3the mother's contribution to the child's genotype can be traced. Paternity. testing investigates whether the part of the child's genotype not attributable to the mother is consistent with that of the putative father. Paternity testing can be performed by analyzing sets of polymorphisms in the putative father and the child, with the SNPs of the present invention providing nucleotide positions at which to compare the putative father's and child's DNA sequences for identity. If the set of polymorphisms in the child attributable to the father does not match the set of polymorphisms of the putative father, it can be concluded, barring experimental error, that the putative father is not the father of the child. If the set of polymorphisms in the child attributable to the father match the set of polymorphisms of the putative father, a statistical calculation can be performed to determine the probability of coincidental match, and a conclusion drawn as to the likelihood that the putative father is the true biological father of the child.

In addition to paternity testing, SNPs are also useful for other types of kinship testing, such as for verifying familial relationships for immigration purposes, or for cases in which an individual alleges to be related to a deceased individual in order to claim an inheritance from the deceased individual, etc. For further information regarding the utility of SNPs for paternity testing and other types of kinship testing, including methods for statistical analysis, see Krawczak,"Informativity assessment for biallelic single nucleotide polymorphisms", Electrophoresis 1999 Jun ; 20 (8) : 1676-81.

The use of the SNPs of the present invention for human identification further extends to various authentication systems, commonly referred to as biometric systems, which typically convert physical characteristics of humans : (or other organisms) into digital data. Biometric systems include various technological devices that measure such unique anatomical or physiological characteristics as finger, thumb, or palm prints; hand geometry; vein patterning on the back of the hand ; blood vessel patterning of the retina and color and texture of the iris; facial characteristics; voice patterns ; signature and typing dynamics ; and DNA. Such physiological measurements can be used to verify identity and, for example, restrict or allow access based on the identification. Examples of applications for biometrics -include physical area security, computer and network security, aircraft passenger check-in and boarding, financial transactions, medical records access, government benefit , distribution, voting, law enforcement, passports, visas and immigration, prisons, various military applications, and for restricting access to expensive or dangerous items, such as automobiles or guns (see, for example, O'Connor, Stanford Technology Law Review and U. S. Patent No. 6,119, 096).

: Groups of SNPs, particularly the SNPs provided by the present invention, can be typed to uniquely identify an individual for biometric applications such as those described above. Such SNP typing can readily be accomplished using, for example, DNA chips/arrays. Preferably, a minimally invasive means for obtaining a DNA sample is utilized. For example, PCR amplification enables sufficient quantities of DNA for analysis to be obtained from buccal swabs or fingerprints, which contain DNA-containing skin cells and oils that are naturally transferred during contact.

Further information regarding techniques for using SNPs in forensic/human identification applications can be found in, for example, Current Protocols in Human Genetics, John Wiley & Sons, N. Y. (2002), 14.1-14. 7.

VARIANT PROTEINS, ANTIBODIES, VECTORS & HOST CELLS, & USES THEREOF Variant Proteins Encoded by SNP-Containing Nucleic Acid Molecules The present invention provides SNP-containing nucleic acid molecules, many of which encode proteins having variant amino acid sequences as.. compared to the art-known (i. e. , wild-type) proteins. Amino acid sequences encoded by the polymorphic nucleic acid molecules of the present invention are provided as SEQ It S : 518-1034 in Table 1. and the Sequence Listing. These variants-will generally be ? referred to herein as variant proteins/peptides/polypeptides, or polymorphic proteins/peptides/polypeptides of the present invention. The terms"protein","peptide", and"polypeptide"are used herein interchangeably.

A variant protein of the present invention may be encoded by, for example, a nonsynonymous nucleotide substitution at any one of the cSNP positions disclosed herein. In addition, variant proteins may also include proteins whose expression, structure, and/or function is altered by a SNP disclosed herein, such as a SNP that creates or destroys a stop codon, a SNP that affects splicing, and a SNP in control/regulatory elements, e. g. promoters, enhancers, or transcription factor binding domains.

As used herein, a protein or peptide is said to be"isolated"or"purified"when it is substantially free of cellular material or chemical precursors or other chemicals. The variant proteins of the present invention can be purified to homogeneity or other lower degrees of purity. The level of purification will be based on the intended use. The key feature is that the preparation allows for the desired function of the variant protein, even if in the presence of considerable amounts of other components.

As used herein, "substantially free of cellular material"includes preparations of the variant protein having less than about 30% (by dry weight) other proteins (i. e.,

contaminating protein), less than about 20% other proteins, less than about 10% other proteins, or less than about 5% other proteins. When the variant protein is recombinantly produced, it can also be substantially free of culture medium, i. e. , culture medium represents less than about 20% of the volume of the protein preparation.

The language"substantially free of chemical precursors or other chemicals"includes preparations of the variant protein in which it is separated from chemical precursors or other chemicals that are involved in its synthesis. In one embodiment, the language"substantially free of chemical precursors or other chemicals"includes preparations of the variant protein having less than about 30% (by dry weight) chemical precursors or other. : chemicals, less than about 20% chemical precursors or other chemicals, less than about 10% chemical. precursors or other chemicals, or less than about 5% chemical precursors or other chemicals.

An isolated variant protein may be purified from cells that naturally express it, purified from cells that have been altered to express it (recombinant host. cells), or synthesized using known protein synthesis methods. For example,', a'nucleic acid molecule containing SNP (s) encoding the variant protein can be cloned into an expression vector, the expression vector introduced into a host cell, and the variant protein expressed in the host cell. The variant protein can then be isolated from the cells by any appropriate purification scheme using standard protein purification techniques. Examples of these techniques are described in detail below (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

The present invention provides isolated variant proteins that comprise, consist of or consist essentially of amino acid sequences that contain one or more variant amino acids encoded by one or more codons which contain a SNP of the present invention.

Accordingly, the present invention provides variant proteins that consist of amino acid sequences that contain one or more amino acid polymorphisms (or truncations or extensions due to creation or destruction of a stop codon, respectively) encoded by the SNPs provided in Table 1 and/or Table 2. A protein consists of an amino acid sequence when the amino acid sequence is the entire amino acid sequence of the protein.

The present invention further provides variant proteins that consist essentially of amino acid sequences that contain one or more amino acid polymorphisms (or truncations or extensions due to creation or destruction of a stop codon, respectively) encoded by the SNPs

provided in Table 1 and/or Table 2. A protein consists essentially of an amino acid sequence when such an amino acid sequence is present with only a few additional amino acid residues in the final protein.

The present invention further provides variant proteins that comprise amino acid sequences that contain one or more amino acid polymorphisms (or truncations or extensions due to creation or destruction of a stop codon, respectively) encoded by the SNPs provided in Table 1 and/or Table 2. A protein comprises an amino acid sequence when the amino acid sequence is at least part of the final amino acid sequence of the protein. In such a fashion, the protein may contain only the variant amino acid sequence or have additional amino acid residues, such as a contiguous encoded sequence that is naturally associated with it or heterologous amino acid residues. Such a protein can have a few additional amino acid residues or can comprise many more additional amino acids. A brief description of how various types of these proteins can be madeUand isolated istprovided below.

The variant proteins of the present. invention can be attached to heterologous sequences to form chimeric or fusion proteins. Such chimeric and fusion proteins comprise a variant protein operatively linked to a heterologous protein having an amino acid sequence not substantially homologous to the variant protein."Operatively linked" indicates that the coding sequences for the variant protein and the heterologous protein are ligated in-frame. The heterologous protein can be fused to the N-terminus or C- terminus of the variant protein. In another embodiment, the fusion protein is encoded by a fusion polynucleotide that is synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and re-amplified to generate a chimeric gene sequence (see Ausubel et al., Current Protocols in Molecular Biology, 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e. g. , a GST protein). A variant protein-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in- frame to the variant protein.

In many uses, the fusion protein does not affect the activity of the variant protein.

The fusion protein can include, but is not limited to, enzymatic fusion proteins, for example,

beta-galactosidase fusions, yeast two-hybrid GAL fusions, poly-His fusions, MYC-tagged, HI-tagged and Ig fusions. Such fusion proteins, particularly poly-His fusions, can facilitate their purification following recombinant expression. In certain host cells (e. g., mammalian host cells), expression and/or secretion of a protein can be increased by using a heterologous signal sequence. Fusion proteins are further described in, for example, Terpe, "Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems", Appl Microbiol Biotechnol. 2003 Jan; 60 (5): 523-33. Epub 2002 Nov 07; Graddis et al., "Designing proteins that work using recombinant technologies", Curr Phare Biotechnol.

2002 Dec ; 3 (4): 285-97; and Nilsson et al.,"Affinity fusion strategies for detection, purification, and immobilization of recombinantproteins", Protein ExprPurif. 1997 Oct; 11(1):1-16.

The present invention also relates to further obvious variants of the variant polypeptides of the present invention, such as naturally-occurrihgmature forms (e. g., alleleic variants), non-naturally occurring recombinantly-derived variants, and orthologs and paralogs of such proteins that share sequence homology. Such variants can readily be generated using art-known techniques in the fields of recombinant nucleic acid technology and protein biochemistry. It is understood, however, that variants exclude those known in ; the prior art before the present invention.

Further variants of the variant polypeptides disclosed in Table 1 can comprise an amino acid sequence that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with an amino acid sequence disclosed in Table 1 (or a fragment thereof) and that includes a novel amino acid residue (allele) disclosed in Table 1 (which is encoded by a novel SNP allele). Thus, an aspect of the present invention that is specifically contemplated are polypeptides that have a certain degree of sequence variation compared with the polypeptide sequences shown in Table 1, but that contain a novel amino acid residue (allele) encoded by a novel SNP allele disclosed herein. In other words, as long as a polypeptide contains a novel amino acid residue disclosed herein, other portions of the polypeptide that flank the novel amino acid residue can vary to some degree from the polypeptide sequences shown in Table 1.

Full-length pre-processed forms, as well as mature processed forms, of proteins that comprise one of the amino acid sequences disclosed herein can readily be identified

as having complete sequence identity to one of the variant proteins of the present invention as well as being encoded by the same genetic locus as the variant proteins provided herein.

Orthologs of a variant peptide can readily be identified as having some degree of significant sequence homology/identity to at least a portion of a variant peptide as well as being encoded by a gene from another organism. Preferred orthologs will be isolated from non-human mammals, lpreferablyprimates, for the development of human therapeutic targets and agents. Such orthologs can be encoded by a nucleic acid sequence that hybridizes to a variant peptide-encoding nucleic acid molecule under moderate to stringent conditions depending on the degree of relatedness of the two organisms yielding the homologous proteins.

Variant proteins include, but are not limited to, proteins containing deletions, additions and substitutions in the amino acid sequence caused by the SNPs of the present invention. One class of substitutions is conserved amino acid substitutions in which a given amino acid in a polypeptide is substituted for another amino acid of like characteristics.

Typical conservative substitutions are replacements, one for another, among the aliphatic amino acids Ala, Val, Leu, and ne ; interchange ofthe hydroxyl residues Ser and Thr; exchange of the acidic residues Asp and Glu; substitution between the amide residues Asn and Gln ; exchange of the basic residues Lys and Arg; and replacements among the aromatic residues Phe and Tyr. Guidance concerning which amino acid changes are likely to be phenotypically silent are found in, for example, Bowie et al., Science 247 : 1306-1310 (1990).

Variant proteins can be fully functional or can lack function in one or more activities, e. g. ability to bind another molecule, ability to catalyze a substrate, ability to mediate signaling, etc. Fully functional variants typically contain only conservative variations or variations in non-critical residues or in non-critical regions. Functional variants can also contain substitution of similar amino acids that result in no change or an insignificant change in function. Alternatively, such substitutions may positively or negatively affect function to some degree. Non-functional variants typically contain one or more non-conservative amino acid substitutions, deletions, insertions, inversions,

truncations or extensions, or a substitution, insertion, inversion, or deletion of a critical residue or in a critical region.

Amino acids that are essential for function of a protein can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham et al., Science 244 : 1081-1085 (1989) ), particularly using the amino acid sequence and polymorphism information provided in Table 1. The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as enzyme activity or in assays such as an in vitro proliferative activity. Sites that are critical for binding partner/substrate binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., I. Mol. Biol. 24 : 899-904 (1992) ; de Vos et aL Science 255 : 306-312 (1992)).

Polypeptides can contain amino acids other than'the 20 gamine acids commonly referred to. as the 20 naturally occurring amino acids. Further, many amino acids, including the terminal amino acids, may be modified by natural processes, such as processing and other post-translational modifications, or by chemical modification techniques well known in the art. Accordingly, the variant proteins of the present invention also encompass derivatives or analogs in which a substituted amino acid residue is not one encoded by the genetic. code, in which a substituent group is included, in which the mature polypeptide is fused with another compound ; such as a compound to increase the half-life of the polypeptide (e. g. , polyethylene glycol), or in which additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence for purification of the mature polypeptide or a pro-protein sequence.

Known protein modifications include, but are not limited to, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent crosslinks, formation of cystine, formation of pyroglutamate, formylation, gamma carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation,

racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.

Such protein modifications are well known to those of skill in the art and have been described in great detail in the scientific literature. Several particularly common modifications, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation, for instance, are described in most basic texts, such as Proteins-Structure and Molecular Properties, 2nd Ed. , T. E. Creighton, W. H.

Freeman and Company, New York (1993); Wold, F., Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed. , Academic Press, New York 1-12 (1983); Seiner et al., Meth. Enzymol. 182 : 626-646 (1990); and Rattan et al., Ann. N. Y. Acad. Sci.

663 : 48-62 (1992).

The present invention further provides fragments of the variant proteins in which the fragments contain one or more amino acid sequence vadations- (e. g. , substitutions, or truncations or extensions due to creation or destruction of a'stop-codon) encoded by one or more SNPs disclosed herein. The fragments to which the invention pertains, however, are not to be construed as encompassing fragments that have been disclosed in the prior art before the present invention.

As used herein, a fragment may comprise at least about 4, 8, 10,12, 14,16, 18, 20, 25,30, 50,100 (or any other number in-between) or more contiguous amino acid residues from a variant protein, wherein at least one amino acid residue is affected by a SNP of the present invention, e. g. , a variant amino acid residue encoded by a nonsynonymous nucleotide substitution at a cSNP position provided by the present invention. The variant amino acid encoded by a cSNP may occupy any residue position along the sequence of the fragment. Such fragments can be chosen based on the ability to retain one or more of the biological activities of the variant protein or the ability to perform a function, e. g. , act as an immunogen. Particularly important fragments are biologically active fragments. Such fragments will typically comprise a domain or motif of a variant protein of the present invention, e. g. , active site, transmembrane domain, or ligand/substrate binding domain.

Other fragments include, but are not limited to, domain or motif-containing fragments, soluble peptide fragments, and fragments containing immunogenic structures. Predicted domains and functional sites are readily identifiable by computer programs well known to

those of skill in the art (e. g., PROSITE analysis) (Current Protocols in Protein Science, John Wiley & Sons, N. Y. (2002)).

Uses of Variant Proteins The variant proteins of the present invention can be used in a variety of ways, including but not limited to, in assays to determine the biological activity of a variant protein, such as in a panel of multiple proteins for high-throughput screening; to raise antibodies or to elicit another type of immune response; as a reagent (including the labeled reagent) in assays designed to quantitatively determine levels of the variant protein (or its binding partner) in biological fluids; as a marker for cells or tissues in which it is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in a disease state); as a target for screening for a therapeutic agent ; and as a direct therapeutic agent to be4adtninistered into a human subject. Any of the variant proteins disclosed herein may be developed into reagent grade or kit format for commercialization as research products. Methods for performing the uses listed above are well known to those skilled in the art (see, e. g., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Sambrook and Russell, 2000, and Methods in Enzymology : Guide to Molecular Cloning Techniques, Academic Press, Berger, S. L. and A. R. Kimmel eds., 1987).

In a specific embodiment of the invention, the methods of the present invention include detection of one or more variant proteins disclosed herein. Variant proteins are disclosed in Table 1 and in the Sequence Listing as SEQ ID NOS: 518-1034. Detection of such proteins can be accomplished using, for example, antibodies, small molecule compounds, aptamers, ligands/substrates, other proteins or protein fragments, or other protein-binding agents. Preferably, protein detection agents are specific for a variant protein of the present invention and can therefore discriminate between a variant protein of the present invention and the wild-type protein or another variant form. This can generally be accomplished by, for example, selecting or designing detection agents that bind to the region of a protein that differs between the variant and wild-type protein, such as a region of a protein that contains one or more amino acid substitutions that is/are encoded by a non-synonymous cSNP of the present invention, or a region of a protein

that follows a nonsense mutation-type SNP that creates a stop codon thereby leading to a shorter polypeptide, or a region of a protein that follows a read-through mutation-type SNP that destroys a stop codon thereby leading to a longer polypeptide in which a portion of the polypeptide is present in one version of the polypeptide but not the other.

In another specific aspect of the invention, the variant proteins of the present invention are used as targets for evaluating an individual's predisposition to developing a cardiovascular disorder, particularly an acute coronary event such as myocardial infarction, or stroke, for treating and/or preventing cardiovascular disorders, of for predicting an individuals response to statin treatment af cardiovascular disorders, etc. Accordingly, the invention provides methods for detecting the presence of, or levels of, one or more variant proteins of the present invention in a cell, tissue, or organism. Such methods typically involve contacting a test sample with an agent (e. g., an antibody, small molecule compound, or ; peptide) capable of interacting with the variant proteunsuch : that specinc binding of the agent to the variant protein can be detected. Such an assay can be ! provided in a singles detection format or a multi-detection format such as an array, for example, an antibody or aptamer array (arrays for protein detection may also be referred to as"protein chips"). The variant protein of interest can be isolated from a test sample and assayed for the presence of a variant amino acid sequence encoded by one or more SNPs disclosed by the present invention. The SNPs may cause changes to the protein and the corresponding protein function/activity, such as through non-synonymous substitutions in protein coding regions that can lead to amino acid substitutions, deletions, insertions, and/or rearrangements; formation or destruction of stop codons; or alteration of control elements such as promoters.

SNPs may also cause inappropriate post-translational modifications.

One preferred agent for detecting a variant protein in a sample is an antibody capable of selectively binding to a variant form of the protein (antibodies are described in greater detail in the next section). Such samples include, for example, tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject.

In vitro methods for detection of the variant proteins associated with cardiovascular disorders and/or statin response that are disclosed herein and fragments thereof include, but are not limited to, enzyme linked immunosorbent assays (ELISAs), radioimmunoassays

(RIA), Western blots, immunoprecipitations, immunofluorescence, and protein arrays/chips (e. g. , arrays of antibodies or aptamers). For further information regarding immunoassays and related protein detection methods, see Current Protocols in Immunology, John Wiley & Sons, N. Y. , and Hage,"Immunoassays", Anal Chem. 1999 Jun 15; 71 (12): 294R-304R.

Additional analytic methods of detecting amino acid variants include, but are not limited to, altered electrophoretic mobility, altered tryptic peptide digest, altered protein activity in cell-based or cell-free assay, alteration in ligand or antibody-binding pattern, altered isoelectric point, and direct amino acid sequencing.

Alternatively, variant proteins can be detected in vivo in a subject by introducing into the subject a labeled antibody (or : other type of detection reagent) specific for a variant protein : For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.

Other uses of the variant peptides of the present invention are based on the class or action of the protein. For example, proteins isolated from humans and their mammalian orthologs serve as targets for identifying agents (e. g. , small molecule drugs or antibodies) for use in therapeutic applications, particularly for modulating a biological or pathological response in a cell or tissue that expresses the protein. Pharmaceutical agents can be developed that modulate protein activity.

As an alternative to modulating gene expression, therapeutic compounds can be developed that modulate protein function. For example, many SNPs disclosed herein affect the amino acid sequence of the encoded protein (e. g. , non-synonymous cSNPs and nonsense mutation-type SNPs). Such alterations in the encoded amino acid sequence may affect protein function, particularly if such amino acid sequence variations occur in functional protein domains, such as catalytic domains, ATP-binding domains, or ligand/substrate binding domains. It is well established in the art that variant proteins having amino acid sequence variations in functional domains can cause or influence pathological conditions.

In such instances, compounds (e. g. , small molecule drugs or antibodies) can be developed that target the variant protein and modulate (e. g. , up-or down-regulate) protein function/activity.

The therapeutic methods of the present invention further include methods that target one or more variant proteins of the present invention. Variant proteins can be

targeted using, for example, small molecule compounds, antibodies, aptamers, ligands/substrates, other proteins, or other protein-binding agents. Additionally, the skilled artisan will recognize that the novel protein variants (and polymorphic nucleic acid molecules) disclosed in Table 1 may themselves be directly used as therapeutic agents by acting as competitive inhibitors of corresponding art-known proteins (or nucleic acid molecules such as mRNA molecules).

The variant proteins of the present invention are particularly useful in drug screening assays, in cell-based or cell-free systems. Cell-based systems can utilize cells that naturally express the protein, a biopsy specimen, or cell cultures ; In one embodiment, cell-based assays involve recombinant host cells expressing the variant protein. Cell-free assays can be used to detect-the ability of a compound to directly bind to a variant protein or to the corresponding SNP-containing nucleic acid fragment that encodes the variant protein.

A variant protein of the present invention, as well as appropriate fragments thereof, . can be used in high-throughput screening assays to test candidate compounds for the ability to bind and/or modulate the activity of the variant protein. These candidate compounds can be further screened against a protein having normal function (e. g. , a wild-type/non-variant protein) to further determine the effect of the compound-on the protein activity.

Furthermore, these compounds can be tested in animal or invertebrate systems to determine in vivo activity/effectiveness. Compounds can be identified that activate (agonists) or inactivate (antagonists) the variant protein, and different compounds can be identified that cause various degrees of activation or inactivation of the variant protein.

Further, the variant proteins can be used to screen a compound for the ability to stimulate or inhibit interaction between the variant protein and a target molecule that normally interacts with the protein. The target can be a ligand, a substrate or a binding partner that the protein normally interacts with (for example, epinephrine or norepinephrine). Such assays typically include the steps of combining the variant protein with a candidate compound under conditions that allow the variant protein, or fragment thereof, to interact with the target molecule, and to detect the formation of a complex between the protein and the target or to detect the biochemical consequence of the interaction with the variant protein and the target, such as any of the associated effects of signal transduction.

Candidate compounds include, for example, 1) peptides such as soluble peptides, including Ig-tailed fusion peptides and members of random peptide libraries (see, e. g., Lam et al., Nature 354 : 82-84 (1991); Houghten et al., Nature 354 : 84-86 (1991) ) and combinatorial chemistry-derived molecular libraries made of D-and/or L-configuration amino acids; 2) phosphopeptides (e. g. , members of random and partially degenerate, directed phosphopeptide libraries, see, e. g. , Songyang et al., Cell 72 : 767-778 (1993) ) ; 3) antibodies (e. g., polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, and single chain antibodies as well as Fab, F (ab') 2, Fab expression library fragments, and epitope- binding fragments of antibodies); and 4) small organic and inorganic molecules (e. g., molecules obtained from combinatorial and natural product libraries).

One candidate compound is a soluble fragment of the variant protein that competes for ligand binding. Other candidate compounds include mutant proteins or appropriate fragments containing mutations mat affect variant protein function and thus compete for ligand. Accordingly, a fragment that competes for ligand, for example with a higher affinity, or a fragment that binds ligand but does not allow release, is encompassed by the invention.

The invention further includes other end point assays to identify compounds that modulate (stimulate or inhibit) variant protein activity. The assays typically involve an assay of events in the signal transduction pathway that indicate protein activity. Thus, the expression of genes that are up or down-regulated in response to the variant protein dependent signal cascade can be assayed. In one embodiment, the regulatory region of such genes can be operably linked to a marker that is easily detectable, such as luciferase.

Alternatively, phosphorylation of the variant protein, or a variant protein target, could also be measured. Any of the biological or biochemical functions mediated by the variant protein can be used as an endpoint assay. These include all of the biochemical or biological events described herein, in the references cited herein, incorporated by reference for these endpoint assay targets, and other functions known to those of ordinary skill in the art.

Binding and/or activating compounds can also be screened by using chimeric variant proteins in which an amino terminal extracellular domain or parts thereof, an entire transmembrane domain or subregions, and/or the carboxyl terminal intracellular domain or parts thereof, can be replaced by heterologous domains or subregions. For example, a

substrate-binding region can be used that interacts with a different substrate than that which is normally recognized by a variant protein. Accordingly, a different set of signal transduction components is available as an end-point assay for activation. This allows for assays to be performed in other than the specific host cell from which the variant protein is derived.

The variant proteins are also useful in competition binding assays in methods designed to discover compounds that interact with the variant protein. Thus, a compound can be exposed to a variant protein under conditions that allow the compound to bind or to otherwise interact with the variant protein. A binding partner, such as ligand, that normally interacts with the variant protein is also added to the mixture : If the test compound interacts with the variant protein or its binding partner, it decreasesthe amount of complex formed or activity from the variant protein. This type of assay is particularly useful in screening for t compounds that interact with specific regions of the variant protein (Hodgson, -Bioltechnology, 1992, Sept 10 (9), 973-80).

To perform cell-free drug screening assays, it is sometimes desirable to immobilize either the variant protein or a fragment thereof, or its target molecule, to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Any method for immobilizing proteins on matrices can be. used in drug screening assays. In one embodiment, a fusion protein containing an added domain allows the protein to be bound to a matrix. For example, glutathione-S- transferase/l25I fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or glutathione derivatized microtitre plates, which are then combined with the cell lysates (e. g., 35S-labeled) and a candidate compound, such as a drug candidate, and the mixture incubated under conditions conducive to complex formation (e. g. , at physiological conditions for salt and pH). Following incubation, the beads can be washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly, or in the supernatant after the complexes are dissociated. Alternatively, the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of bound material found in the bead fraction quantitated from the gel using standard electrophoretic techniques.

Either the variant protein or its target molecule can be immobilized utilizing conjugation of biotin and streptavidin. Alternatively, antibodies reactive with the variant protein but which do not interfere with binding of the variant protein to its target molecule can be derivatized to the wells of the plate, and the variant protein trapped in the wells by antibody conjugation. Preparations of the target molecule and a candidate compound are incubated in the variant protein-presenting wells and the amount of complex trapped in the well can be quantitated. Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the protein target molecule, or-which are reactive with variant protein and compete with the target molecule, and enzyme-linked assays that rely on detecting an enzymatic activity associated with the target molecule.

Modulators of variant protein activity identified-according to these drug screening assays can be used to treat a subject with a disorder mediated by the protein pathway, such as cardiovascular disease. These « methods of treatment typically include the steps of administering the modulators of protein activity in a pharmaceutical composition to a subject in need of such treatment.

The variant proteins, or fragments thereof, disclosed herein can themselves be directly used to treat a disorder characterized by an absence of, inappropriate, or unwanted expression or activity of the variant protein. Accordingly, methods for treatment include the use of a variant protein disclosed herein or fragments thereof.

In yet another aspect of the invention, variant proteins can be used as"bait proteins"in a two-hybrid assay or three-hybrid assay (see, e. g. , U. S. Patent No.

5,283, 317; Zervos et al. (1993) Cell 72 : 223-232; Madura et al. (1993) J. Biol. Chem.

268: 12046-12054; Bartel et al. (1993) Biotechniques 14 : 920-924 ; Iwabuchi et al. (1993) Oncogene 8: 1693-1696; and Brent W094/10300) to identify other proteins that bind to or interact with the variant protein and are involved in variant protein activity. Such variant protein-binding proteins are also likely to be involved in the propagation of signals by the variant proteins or variant protein targets as, for example, elements of a protein-mediated signaling pathway. Alternatively, such variant protein-binding proteins are inhibitors of the variant protein.

The two-hybrid system is based on the modular nature of most transcription factors, which typically consist of separable DNA-binding and activation domains.

Briefly, the assay typically utilizes two different DNA constructs. In one construct, the gene that codes for a variant protein is fused to a gene encoding the DNA binding domain of a known transcription factor (e. g. , GAL-4). In the other construct, a DNA sequence, from a library of DNA sequences, that encodes an unidentified protein ("prey"or "sample") is fused to a gene that codes for the activation domain of the known transcription factor. If the"bait"and the"prey"proteins are able to interact, in vivo, forming a variant protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e. g., LacZ) that is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the ; functional transcription factor can be isolated and used to obtain the cloned gene ; that encodes the protein that interacts with the variant protein.

Antibodies Directed to Variant Proteins The present invention also provides antibodies that selectively bind to the variant proteins disclosed herein and fragments thereof. Such antibodies may be used to quantitatively or qualitatively detect the variant proteins of the present invention. As used herein, an antibody selectively binds a target variant protein when it binds the variant protein and does not significantly bind to non-variant proteins, i. e. , the antibody does not significantly bind to normal, wild-type, or art-known proteins that do not contain a variant amino acid sequence due to one or more SNPs of the present invention (variant amino acid sequences may be due to, for example, nonsynonymous cSNPs, nonsense SNPs that create a stop codon, thereby causing a truncation of a polypeptide or SNPs that cause read-through mutations resulting in an extension of a polypeptide).

As used herein, an antibody is defined in terms consistent with that recognized in the art: they are multi-subunit proteins produced by an organism in response to an antigen challenge. The antibodies of the present invention include both monoclonal antibodies and polyclonal antibodies, as well as antigen-reactive proteolytic fragments of such antibodies,

such as Fab, F (ab)'2, and Fv fragments. In addition, an antibody of the present invention further includes any of a variety of engineered antigen-binding molecules such as a chimeric antibody (U. S. Patent Nos. 4, 816, 567 and 4,816, 397; Morrison et al., Proc. Natl. Acad. Sci.

USA, 81: 6851, 1984 ; Neuberger et al., Nature 312: 604,1984), a humanized antibody (U. S.

Patent Nos. 5,693, 762; 5, 585, 089; and 5,565, 332), a single-chain Fv (U. S. Patent No.

4,946, 778 ; Ward et al., Nature 334: 544,1989), a bispecific antibody with two binding specificities (Segal etal., J. Imrnunol. Methods 248: 1,2001 ; Carter, J. Immunol. Methods 248: 7,2001), a diabody, a triabody, and a tetrabody (Todorovska et al., J. Immunol.

Methods, 248: 47, 2001), as well as a Fab conjugate (dimer or trimer), and a minibody.

Many methods are known in the art for generating and/or identifying antibodies to a given target antigen (Harlow, Antibodies, Cold Spring Harbor Press, (1989)). In general, an isolated peptide (e. g. , a variant protein of the present invention) is used as an immunogen and is administered to a mammalian organism, such as. a rat, rabbit, hamster or mouse.

Either a full-length protein, an antigenic peptide fragment (eg., a peptide fragment containing a region that varies between a variant protein and a corresponding wild-type protein), or a fusion protein can be used. A protein used as an immunogen may be naturally-occurring, synthetic or recombinantly produced, and may be administered in combination with an adjuvant, including but not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substance such as lysolecithin, pluronic polyols, polyanions, peptides ; oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and the like.

Monoclonal antibodies can be produced by hybridoma technology (Kohler and Milstein, Nature, 256: 495, 1975), which immortalizes cells secreting a specific monoclonal antibody. The immortalized cell lines can be created in vitro by fusing two different cell types, typically lymphocytes, and tumor cells. The hybridoma cells may be cultivated in vitro or in vivo. Additionally, fully human antibodies can be generated by transgenic animals (He et al., J. Immunol., 169: 595,2002). Fd phage and Fd phagemid technologies may be used to generate and select recombinant antibodies in vitro (Hoogenboom and Chames, Immunol. Today 21: 371, 2000 ; Liu et al., J. Mol. Biol.

315: 1063,2002). The complementarity-determining regions of an antibody can be

identified, and synthetic peptides corresponding to such regions may be used to mediate antigen binding (U. S. Patent No. 5,637, 677).

Antibodies are preferably prepared against regions or discrete fragments of a variant protein containing a variant amino acid sequence as compared to the corresponding wild-type protein (e. g. , a region of a variant protein that includes an amino acid encoded by a nonsynonymous cSNP, a region affected by truncation caused by a nonsense SNP that creates a stop codon, or a region resulting from the destruction of a stop codon due to read-through mutation caused by a SNP). Furthermore, preferred regions will include those involved in function/activity and/or proteinibinding partner interaction. Such fragments can be selected on a physical property, such as fragments corresponding to regions that are located on the surface of the protein, e. g., hydrophilic regions, or can be selected based on sequence uniqueness, or based on the position of the variant amino acid residue (s) encoded by. the SNPs provided. by the present invention. Ah antigenic fragment will typically comprise at least about contiguous amino acid residues in which at least one of the amino acid residues is an amino acid affected by a SNP disclosed herein. The antigenic peptide can comprise, however, at least 12,14, 16,20, 25, 50, 100 (or any other number in-between) or more amino acid residues, provided that at least one amino acid is affected by a SNP disclosed herein.

Detection of an antibody of the present invention can be facilitated by coupling (i. e., physically linking) the antibody or an antigen-reactive fragment thereof to a detectable substance. Detectable substances include, but are not limited to, various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, p-galactosidase, or acetylcholinesterase ; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerytluin ; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include I, I, S or H.

Antibodies, particularly the use of antibodies as therapeutic agents, are reviewed in: Morgan, "Antibody therapy for Alzheimer's disease", Expert Rev Vaccines. 2003 Feb; 2 (1) : 53-9; Ross et al.,"Anticancer antibodies", Am JClin Pathol. 2003 Apr; 119 (4): 472- 85 ; Goldenberg,"Advancing role of radiolabeled antibodies in the therapy of cancer", CancerImmunol Immunother. 2003 May ; 52 (5): 281-96. Epub 2003 Mar 11; Ross et al., "Antibody-based therapeutics in oncology", Expert Rev Anticancer Ther. 2003 Feb; 3 (1) : 107-21; Cao et al.,"Bispecific antibody conjugates in therapeutics", Adv Drug Deliv Rev. 2003 Feb 10; 55 (2): 171-97; von Mehren et al.,"Monoclonal antibody therapy for cancer", Annu Rev Med. 2003; 54: 343-69. Epub 2001 Dec 03; Hudson et al.,"Engineered antibodies", NatMed. 2003 Jan; 9 (1) : 129-34 ; Brekke et al.,"Therapeutic antibodies for human diseases at the dawn of the twenty-first century", NatRev. DrugDiscov. 2003 Jan; 2 (1) : 52-62 (Erratum in : NatRevDrugDiscov. 2003 Mar; 2 (3): 240); Houdebine, "Antibody manufacture in transgenic animals and comparisons with other systems", Curr Opin Biotechnol. 2002 Dec; 13 (6): 625-9; Andreakos et al.,"Monoclonal antibodies in immune and inflammatory diseases", Curr Opin Biotechnol. 2002 Dec; 13 (6): 615-20; Kellermann et al.,"Antibody discovery: the use of transgenic mice to generate human monoclonal antibodies for therapeutics" ;. Curr Opin Biotechnol. 2002 Dec; 13 (6): 593-7; Pini et al.,"Phage display and colony filter screening for high-throughput selection of antibody libraries", Comb Chem High Throughput : Screen. 2002 Nov; 5 (7): 503-10; Batra et al., "Pharmacokinetics and biodistribution of genetically engineered antibodies", Curr Opin Biotechnol. 2002 Dec; 13 (6): 603-8 ; and Tangri et al. ,"Rationally engineered proteins or antibodies with absent or reduced immunogenicity", Curr Med Chem. 2002 Dec; 9 (24): 2191-9.

Uses of Antibodies Antibodies can be used to isolate the variant proteins of the present invention from a natural cell source or from recombinant host cells by standard techniques, such as affinity chromatography or immunoprecipitation. In addition, antibodies are useful for detecting the presence of a variant protein of the present invention in cells or tissues to determine the pattern of expression of the variant protein among various tissues in an organism and over the course of normal development or disease progression. Further, antibodies can be used to

detect variant protein in situ, in vitro, in a bodily fluid, or in a cell lysate or supernatant in order to evaluate the amount and pattern of expression. Also, antibodies can be used to assess abnormal tissue distribution, abnormal expression during development, or expression in an abnormal condition, such as in a cardiovascular disorder or during statin treatment.

Additionally, antibody detection of circulating fragments of the full-length variant protein can be used to identify turnover.

Antibodies to the variant proteins of the present invention are also useful in pharmacogenomic analysis. Thus, antibodies against variant proteins encoded by alternative SNP alleles can be used to identify individuals that require modified treatment modalities.

Further, antibodies can be used to assess expression of the variant protein in disease states such as in active stages of the disease or in an individual with a predisposition to a disease related to the protein's function, such as a cardiovascular disorder, or during the course of a treatment regime, such as during statin treatment.. Antibodies. specific for a variant protein encoded by a SNP-containing nucleic acid molecule of the present invention can be used to assay for the presence of the variant protein, such as to predict an individual's response to statin treatment or predisposition/susceptibility to an acute coronary event, as indicated by the presence of the variant protein.

Antibodies are also useful as diagnostic tools for evaluating the variant proteins in conjunction with analysis by electrophoretic mobility, isoelectric point, tryptic peptide digest, and other physical assays well known in the art.

Antibodies are also useful for tissue typing. Thus, where a specific variant protein has been correlated with expression in a specific tissue, antibodies that are specific for this protein can be used to identify a tissue type.

Antibodies can also be used to assess aberrant subcellular localization of a variant protein in cells in various tissues. The diagnostic uses can be applied, not only in genetic testing, but also in monitoring a treatment modality. Accordingly, where treatment is ultimately aimed at correcting the expression level or the presence of variant protein or aberrant tissue distribution or developmental expression of a variant protein, antibodies directed against the variant protein or relevant fragments can be used to monitor therapeutic efficacy.

The antibodies are also useful for inhibiting variant protein function, for example, by blocking the binding of a variant protein to a binding partner. These uses can also be applied in a therapeutic context in which treatment involves inhibiting a variant protein's function. An antibody can be used, for example, to block or competitively inhibit binding, thus modulating (agonizing or antagonizing) the activity of a variant protein. Antibodies can be prepared against specific variant protein fragments containing sites required for function or against an intact variant protein that is associated with a cell or cell membrane.

For in Two administration, an antibody may be linked with an additional therapeutic payload such as a radionuclide, an enzyme, an immunogenic epitope, or a cytotoxic agent. Suitable cytotoxic agents include, but are not limited to, bacterial toxin such as diphtheria, and plant toxin such as ricin. The in vivo half-life of an antibody or a fragment thereof may be lengthened by pegylation through conjugation to polyethylene glycol (Leong et al., Cytokine 16 : 106,. 2001).

The invention also encompasses kits for using antibodies, such as kits for detecting the presence of a variant protein in a test sample. An exemplary kit can comprise antibodies such as a labeled or labelable antibody and a compound or agent for detecting variant proteins in a biological sample; means for determining the amount, or presence/absence of variant protein in the sample; means for comparing the amount of variant protein in the sample with a standard; and instructions for use.

Vectors and Host Cells The present invention also provides vectors containing the SNP-containing nucleic acid molecules described herein. The term"vector"refers to a vehicle, preferably a nucleic acid molecule, which can transport a SNP-containing nucleic acid molecule. When the vector is a nucleic acid molecule, the SNP-containing nucleic acid molecule can be covalently linked to the vector nucleic acid. Such vectors include, but are not limited to, a plasmid, single or double stranded phage, a single or double stranded RNA or DNA viral vector, or artificial chromosome, such as a BAC, PAC, YAC, or MAC.

A vector can be maintained in a host cell as an extrachromosomal element where it replicates and produces additional copies of the SNP-containing nucleic acid molecules.

Alternatively, the vector may integrate into the host cell genome and produce additional copies of the SNP-containing nucleic acid molecules when the host cell replicates.

The invention provides vectors for the maintenance (cloning vectors) or vectors for expression (expression vectors) of the SNP-containing nucleic acid molecules. The vectors can function in prokaryotic or eukaryotic cells or in both (shuttle vectors).

Expression vectors typically contain cis-acting regulatory regions that are operably linked in the vector to the SNP-containing nucleic acid molecules such that transcription of the SNP-containing nucleic acid molecules is allowed in a host cell. The SNP-containing nucleic acid molecules can also be introduced into the host cell with a separate nucleic acid molecule capable of affecting transcription. Thus, the second nucleic acid molecule may : provide a trans-acting factor interacting withithehcis-regulatory control region to allow transcription of the SNP-containing nucleic acid molecules from the vector. Alternatively, a trans-acting factor may be supplied by the host cell. Finally, a trans-acting factor can be produced from the vector itself. It is understood ; however, that in some embodiments, r transcription and/or translation of the nucleic acid molecules can occur in a cell-free system.

The regulatory sequences to which the SNP-containing nucleic acid molecules described herein can be operably linked, include promoters for directing mRNA transcription. These include, but are not limited to, the left promoter from bacteriophage the lac, TRP, and TAC promoters from E. coli, the early and late promoters from SV40, the CMV immediate early promoter, the adenovirus early and late promoters, and retrovirus long-terminal repeats.

In addition to control regions that promote transcription, expression vectors may also include regions that modulate transcription, such as repressor binding sites and enhancers.

Examples include the SV40 enhancer, the cytomegalovirus immediate early enhancer, polyoma enhancer, adenovirus enhancers, and retrovirus LTR enhancers.

In addition to containing sites for transcription initiation and control, expression vectors can also contain sequences necessary for transcription termination and, in the transcribed region, a ribosome-binding site for translation. Other regulatory control elements for expression include initiation and termination codons as well as polyadenylation signals. A person of ordinary skill in the art would be aware of the numerous regulatory sequences that are useful in expression vectors (see, e. g. , Sambrook and Russell, 2000,

Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

A variety of expression vectors can be used to express a SNP-containing nucleic acid molecule. Such vectors include chromosomal, episomal, and virus-derived vectors, for example, vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elements, including yeast artificial chromosomes, from viruses such as baculoviruses, papovaviruses such as SV40, Vaccinia viruses, adenoviruses, poxviruses, pseudorabies viruses, and retroviruses. Vectors can also be derived from combinations of these sources such as those derived from plasmid and bacteriophage genetic elements, e. g. , cosmids and phagemids. Appropriate cloning and expression vectors for prokaryotic and eukaryotic hosts are described in Sambrook. and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, .. NY.

Jhe regulatory sequence in a vector may provide constitutive expression in one or more host cells (e. g. , tissue specific expression) or may provide for inducible expression in one or more cell types such as by temperature, nutrient additive, or exogenous factor, e. g. , a hormone or other ligand. A variety of vectors that provide constitutive or inducible expression of a nucleic acid sequence in prokaryotic and eukaryotic host cells are well known to those of ordinary skill in the art.

A, SNP-containing nucleic acid molecule can be inserted into the vector by methodology well-known in the art. Generally, the SNP-containing nucleic acid molecule that will ultimately be expressed is joined to an expression vector by cleaving the SNP- containing nucleic acid molecule and the expression vector with one or more restriction enzymes and then ligating the fragments together. Procedures for restriction enzyme digestion and ligation are well known to those of ordinary skill in the art.

The vector containing the appropriate nucleic acid molecule can be introduced into an appropriate host cell for propagation or expression using well-known techniques.

Bacterial host cells include, but are not limited to, E. coli, Streptomyces, and Salmonella typhimurium. Eukaryotic host cells include, but are not limited to, yeast, insect cells such as Drosophila, animal cells such as COS and CHO cells, and plant cells.

As described herein, it may be desirable to express the variant peptide as a fusion protein. Accordingly, the invention provides fusion vectors that allow for the production of the variant peptides. Fusion vectors can, for example, increase the expression of a recombinant protein, increase the solubility of the recombinant protein, and aid in the purification of the protein by acting, for example, as a ligand for affinity purification. A proteolytic cleavage site may be introduced at the junction of the fusion moiety so that the desired variant peptide can ultimately be separated from the fusion moiety. Proteolytic enzymes suitable for such use include, but are not limited to, factor Xa, thrombin, and enterokinase. Typical fusion expression vectors include pGEX (Smith et al., Gene 67: 31-40 (1988)), pMAL (New England Biolabs, Beverly, MA) and pRITS (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein. Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al., Gene 69: 301-315 (1988)) and pET . 11 d (Studier et al., Gene Expression Technology : Methods in Enzymology 185: 60-89 (1990)).

Recombinant protein expression can be maximized in a bacterial host by providing a genetic background wherein the host cell has an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology : Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119-128). Alternatively, the sequence of the SNP-containing nucleic acid molecule of interest can be altered to provide preferential codon usage for a specific host cell, for example, E. coli (Wada et al., Nucleic Acids Res. 20: 2111-2118 (1992))., The SNP-containing nucleic acid molecules can also be expressed by expression vectors that are operative in yeast. Examples of vectors for expression in yeast (e. g., S. cerevisiae) include pYepSecl (Baldari, et al., EMBO J. 6: 229-234 (1987)), pMFa (Kurjan et al. , Cell 30: 933-943 (1982) ), pJRY88 (Schultz et al., Gene 54: 113-123 (1987)), andpYES2 (mvitrogen Corporation, San Diego, CA).

The SNP-containing nucleic acid molecules can also be expressed in insect cells using, for example, baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e. g., Sf 9 cells) include the pAc series (Smith

et al., Mol. Cell Biol. 3: 2156-2165 (1983) ) and the pVL series (Lucklow et al., Virology 170: 31-39 (1989)).

In certain embodiments of the invention, the SNP-containing nucleic acid molecules described herein are expressed in mammalian cells using mammalian expression vectors.

Examples of mammalian expression vectors include pCDM8 (Seed, B. Nature 329: 840 (1987)) and pMT2PC (KauErnan et al., EMBO J. 6: 187-195 (1987)).

The invention also encompasses vectors in which the SNP-containing nucleic acid molecules described herein are cloned into the vector in reverse orientation, but operably linked to a regulatory sequence that permits transcription of antisense RNA. Thus, an antisense transcript can be produced to the SNP-containing nucleic acid sequences described herein, including both coding and non-coding regions. Expression of this antisense RNA is subject to each of the parameters described above in relation to expression of the sense RNA (regulatory sequences, constitutive or inducible expression, tissue-specific expression).

The invention also relates to recombinant host cells containing the vectors described herein. Host cells therefore include, for example, prokaryotic cells, lower eukaryotic cells such as yeast, other eukaryotic cells such as insect cells, and higher eukaryotic cells such as mammalian cells.

The recombinant host cells can be prepared by introducing the vector constructs described herein into the cells by techniques readily available to persons of ordinary skill in the art. These include, but are not limited to, calcium phosphate transfection, DEAE- dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, lipofection, and other techniques such as those described in Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

Host cells can contain more than one vector. Thus, different SNP-containing nucleotide sequences can be introduced in different vectors into the same cell. Similarly, the SNP-containing nucleic acid molecules can be introduced either alone or with other nucleic acid molecules that are not related to the SNP-containing nucleic acid molecules, such as those providing trans-acting factors for expression vectors. When more than one vector is introduced into a cell, the vectors can be introduced independently, co-introduced, or joined to the nucleic acid molecule vector.

In the case of bacteriophage and viral vectors, these can be introduced into cells as packaged or encapsulated virus by standard procedures for infection and transduction. Viral vectors can be replication-competent or replication-defective. In the case in which viral replication is defective, replication can occur in host cells that provide functions that complement the defects.

Vectors generally include selectable markers that enable the selection of the subpopulation of cells that contain the recombinant vector constructs. The marker can be inserted in the same vector that contains the SNP-containing nucleic acid molecules described herein or may be in a separate vector. Markers include, for example, tetracycline or ampicillin-resistance genes for prokaryotic host cells, and-dihydrofolate reductase or neomycin resistance genes for eukaryotic host cells. However, any marker that provides selection for a phenotypic trait can be effective.

While the mature variant proteins can be produced, in bacteria, yeast, mammalian cells, and other cells under the control of the appropriate. regulatory sequences, cell-free transcription and translation systems can also be used to produce these variant proteins using RNA derived from the DNA constructs described herein.

Where secretion of the variant protein is desired, which is difficult to achieve with multi-transmembrane domain containing proteins such as G-protein-coupled receptors (GPCRs), appropriate secretion signals can be incorporated into the vector. The signal sequence can be endogenous to the peptides or heterologous to these peptides.

Where the variant protein is not secreted into the medium, the protein can be isolated from the host cell by standard disruption procedures, including freeze/thaw, sonication,. mechanical disruption, use of lysing agents, and the like. The variant protein can then be recovered and purified by well-known purification methods including, for example, ammonium sulfate precipitation, acid extraction, anion or cationic exchange chromatography, phosphocellulose chromatography, hydrophobic-interaction chromatography, affinity chromatography, hydroxylapatite chromatography, lectin chromatography, or high performance liquid chromatography.

It is also understood that, depending upon the host cell in which recombinant production of the variant proteins described herein occurs, they can have various glycosylation patterns, or may be non-glycosylated, as when produced in bacteria. In

addition, the variant proteins may include an initial modified methionine in some cases as a result of a host-mediated process.

For further information regarding vectors and host cells, see Current Protocols in Molecular Biology, John Wiley & Sons, N. Y.

Uses of Vectors and Host Cells, and Transgenic Animals Recombinant host cells that express the variant proteins described herein have a variety of uses. For example, the cells are useful for producing a variant protein that can be further purified into a preparation of desired amounts of the variant protein or fragments thereof. Thus, host cells containing expression vectors are useful for variant protein . production.

Host cells are also useful for conducting cell-based assays involving the variant protein or variant protein fragments, such as those described above as well as other formats known in the art. Thus, a recombinant host cell expressing a variant protein is useful for assaying compounds that stimulate or inhibit variant protein function. Such an ability of a compound to modulate variant protein function may not be apparent from assays of the compound on the native/wild-type protein, or from cell-free assays of the compound. Recombinant host cells are also useful for assaying functional alterations in the variant proteins as compared with a known function.

Genetically-engineered host cells can be further used to produce non-human transgenic animals. A transgenic animal is preferably a non-human mammal, for example, a rodent, such as a rat or mouse, in which one or more of the cells of the animal include a transgene. A transgene is exogenous DNA containing a SNP of the present invention which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal in one or more of its cell types or tissues. Such animals are useful for studying the function of a variant protein in vivo, and identifying and evaluating modulators of variant protein activity. Other examples of transgenic animals include, but are not limited to, non-human primates, sheep, dogs, cows, goats, chickens, and amphibians. Transgenic non-human mammals such as cows and goats can be used to produce variant proteins which can be secreted in the animal's milk and then recovered.

A transgenic animal can be produced by introducing a SNP-containing nucleic acid molecule into the male pronuclei of a fertilized oocyte, e. g. , by microinjection or retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal.

Any nucleic acid molecules that contain one or more SNPs of the present invention can potentially be introduced as a transgene into the genome of a non-human animal.

Any of the regulatory or other sequences useful in expression vectors can form part of the transgenic sequence. This includes intronic sequences and polyadenylation signals, if not already included. A tissue-specific regulatory sequence (s) can be operably linked to the transgene to direct expression of the variant protein in particular cells or tissues.

Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described in, for example, U. S. Patent Nos. 4,736, 866 and 4, 870, 009, both by Leder et al., U. S. Patent No. 4, 873, 191 by Wagner et al., >and in IIogan, B ;, tManipulating the Mòuse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of the transgene in its genome and/or expression oftransgenic mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene can further be bred to other transgenic animals carrying other transgenes. A transgenic animal also includes a non-human animal in which the entire animal or tissues in the animal have been produced using the homologously recombinant host cells described herein.

In another embodiment, transgenic non-human animals can be produced which contain selected systems that allow for regulated expression of the transgene. One example of such a system is the cre/loxP recombinase system of bacteriophage P1 (Lakso et al. PNAS 89: 6232-6236 (1992) ). Another example of a recombinase system is the FLP recombinase system of S. eerevisiae (O'Gorman et al. Science 251: 1351-1355 (1991) ). If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are generally needed.

Such animals can be provided through the construction of"double"transgenic animals, e. g.,

by mating two transgenic animals, one containing a transgene encoding a selected variant protein and the other containing a transgene encoding a recombinase.

Clones of the non-human transgenic animals described herein can also be produced according to the methods described in, for example, Wilmut, I. et al. Nature 385: 810-813 (1997) and PCT International Publication Nos. WO 97/07668 and WO 97/07669. In brief, a cell (e. g. , a somatic cell) from the transgenic animal can be isolated and induced to exit the growth cycle and enter Go phase. The quiescent cell can then be fused, e. g. , through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated. The reconstructed oocyte is then cultured such that it develops to morula or blastocyst and then transferred to pseudopregnant female foster animal. The offspring-born of this female foster animal will be a clone of the animal from which the cell (e. g. , a somatic cell) is isolated.

Transgenic animals containing recombinant cells that express the variant proteins described herein are useful for conducting the assays described herein in an in vivo context.

Accordingly, the various physiological factors that are present in vivo and that could influence ligand or substrate binding, variant protein activation, signal transduction, or other processes or interactions, may not be evident from in vitro cell-free or cell-based assays.

Thus, non-human transgenic animals of the present invention may be used to assay in vivo variant protein function as well as the activities of a therapeutic agent or compound that modulates variant protein function/activity or expression. Such animals are also suitable for assessing the effects of null mutations (i. e. , mutations that substantially or completely eliminate one or more variant protein functions).

For further information regarding transgenic animals, see Houdebine,"Antibody manufacture in transgenic animals and comparisons with other systems", Curr Opin Biotechnol. 2002 Dec; 13 (6): 625-9; Petters et al. ,"Transgenic animals as models for human disease", Transgenic Res. 2000; 9 (4-5): 347-51 ; discussion 345-6; Wolfet al.,'IJse of transgenic animals in understanding molecular mechanisms of toxicity", JPharm Pharynacol. 1998 Jun; 50 (6): 567-74; Echelard, "Recombinant protein production in transgenic animals", Curr Opina Biotechnol. 1996 Oct; 7 (5): 536-40; Houdebine, "Transgenic animal bioreactors", Transgenic Res. 2000; 9 (4-5): 305-20; Pirity et al. ,"Embryonic stem cells, creating transgenic animals", Methods Cell Biol. 1998 ; 57: 279-93; and Robl et al. ,

"Artificial chromosome vectors and expression of complex proteins in transgenic animals", Theriogenology. 2003 Jan 1; 59 (1) : 107-13.

COMPUTER-RELATED EMBODIMENTS The SNPs provided in the present invention may be"provided"in a variety of mediums to facilitate use thereof. As used in this section,"provided"refers to a manufacture, other than an isolated nucleic acid molecule, that contains SNP information of the present invention. Such a manufacture provides the SNP information in a form that allows a skilled artisan to examine the manufacture using means not directly applicable to examining the SNPs or a subset thereof as they exist in nature or in purified form. The SNP information that may. be provided in such a form includes any of the SNP information provided by the present invention such as, for example, polymorphic nucleic acid and/or amino acid sequence infonnation such as SEQp ED NOS: 1-517, SEQ ID NOS : 518-1034, SEQ ID NOS: 13, 194-13, 514, SEQ 1213 NOS : 1035-13, 193, and SEQ ID NOS: 13,515-85, 090; information about observed SNP alleles, alternative codons, populations, allele frequencies, SNP types, and/or affected proteins; or any other information provided by the present invention in Tables 1-2 and/or the Sequence Listing.

In one application of this embodiment, the SNPs of the present invention can be recorded on a computer readable medium. As used herein, "computer readable medium" refers to any medium that can be read and accessed directly by a computer. Such media include, but are not limited to: magnetic storage media, such as floppy discs, hard disc storage medium, and magnetic tape; optical storage media such as CD-ROM; electrical storage media such as RAM and ROM; and hybrids of these categories such as magnetic/optical storage media. A skilled artisan can readily appreciate how any of the presently known computer readable media can be used to create a manufacture comprising computer readable medium having recorded thereon a nucleotide sequence of the present invention. One such medium is provided with the present application, namely, the present application contains computer readable medium (CD-R) that has nucleic acid sequences (and encoded protein sequences) containing SNPs provided/recorded thereon in ASCII text format in a Sequence Listing along with accompanying Tables that contain detailed SNP and sequence information (transcript

sequences are provided as SEQ ID NOS: 1-517, protein sequences are provided as SEQ ID NOS : 518-1034, genomic sequences are provided as SEQ ID NOS: 13,194-13, 514, transcript-based context sequences are provided as SEQ ID NOS : 1035-13,193, and genomic-based context sequences are provided as SEQ ID NOS: 13,515-85, 090).

As used herein, "recorded"refers to a process for storing information on computer readable medium. A skilled artisan can readily adopt any of the presently known methods for recording information on computer readable medium to generate manufactures comprising the SNP information of the present invention.

A variety of data storage structures are available to a skilled artisan for creating a computer readable medium having recorded thereon a nucleotide or amino acid sequence of the present invention. The choice of the data storage structure will generally be based on the means chosen to access the stored information. In addition, a variety of data processor programs and formats can be used to. store the nucleotide/amino acid sequence information of the present invention on computer readable medium. For example, the sequence information can be represented in a word processing text file, formatted in commercially-available software such as WordPerfect and Microsoft Word, represented in the form of an ASCII file, or stored in : a database application, such as OB2, Sybase, Oracle, or the like. A skilled artisan can readily adapt any number of data processor structuring formats (e. g. , text file or database) in order to obtain computer readable medium having recorded thereon the SNP information of the present invention.

By providing the SNPs of the present invention in computer readable form, a skilled artisan can routinely access the SNP information for a variety of purposes.

Computer software is publicly available which allows a skilled artisan to access sequence information provided in a computer readable medium. Examples of publicly available computer software include BLAST (Altschul et at, J. Mol. Biol. 215: 403-410 (1990)) and BLAZE (Brutlag et at, Comp. Chem. 17: 203-207 (1993) ) search algorithms.

The present invention further provides systems, particularly computer-based systems, which contain the SNP information described herein. Such systems may be designed to store and/or analyze information on, for example, a large number of SNP positions, or information on SNP genotypes from a large number of individuals. The SNP information of the present invention represents a valuable information source. The SNP

information of the present invention stored/analyzed in a computer-based system may be used for such computer-intensive applications as determining or analyzing SNP allele frequencies in a population, mapping disease genes, genotype-phenotype association studies, grouping SNPs into haplotypes, correlating SNP haplotypes with response to particular drugs, or for various other bioinformatic, pharmacogenomic, drug development, or human identification/forensic applications.

As used herein, "a computer-based system"refers to the hardware means, software means, and data storage means used to analyze the SNP information of the present invention. The minimum hardware means of the computer-based systems of the present invention typically comprises a central processing unit (CPU), input means, output means, and data storage means. A skilled artisan scan readily appreciate that any one of the currently available computer-based systems are suitable for use in the present invention. Such a system can be changed into asystem ofthe. presentanvention by utilizing the SNP information provided on the CD-R, or a subset thereof, ; without any experimentation.

As stated above, the computer-based systems of the present invention comprise a data storage means having stored therein SNPs of the present invention and the necessary hardware means and software means for supporting and implementing a search means.

As used herein, "data storage means"refers to memory which can store SNP information of the present invention, or a memory access means which can access manufactures having recorded thereon the SNP information of the present invention.

As used herein, "search means"refers to one or more programs or algorithms that are implemented on the computer-based system to identify or analyze SNPs in a target sequence based on the SNP information stored within the data storage means. Search means can be used to determine which nucleotide is present at a particular SNP position in the target sequence. As used herein, a"target sequence"can be any DNA sequence containing the SNP position (s) to be searched or queried.

As used herein, "a target structural motif,"or"target motif,"refers to any rationally selected sequence or combination of sequences containing a SNP position in which the sequence (s) is chosen based on a three-dimensional configuration that is formed upon the folding of the target motif. There are a variety of target motifs known in

the art. Protein target motifs include, but are not limited to, enzymatic active sites and signal sequences. Nucleic acid target motifs include, but are not limited to, promoter sequences, hairpin structures, and inducible expression elements (protein binding sequences).

A variety of structural formats for the input and output means can be used to input and output the information in the computer-based systems of the present invention. An exemplary format for an output means is a display that depicts the presence or absence of specified nucleotides (alleles) at particular SNP positions of interest. Such presentation can provide a rapid, binary scoring system for many SNPs simultaneously.

One exemplary embodiment of a computer-based system comprising SNP information of the present invention. is provided in Figure 1. Figure 1 provides a block diagram of a computer system 102 that can be used to implement the present invention.

The computer system 102 includes a processor l06 connected to a bus 104. Also connected to the bus 104 are a main memory 108 (preferably implemented as random access memory, RAM) and a variety of secondary storage devices 110, such as a hard drive 112 and a removable medium storage device 114. The removable medium storage device 114 may represent, for example, a floppy disk drive, a CD-ROM drive, a magnetic tape drive, etc. A removable storage medium 116 (such as a floppy disk, a compact disk, a magnetic tape, etc. ) containing control logic and/or data recorded therein may be inserted into the removable medium storage device 114. The computer system'102 includes appropriate software for reading the control logic and/or the data from the removable storage medium 116 once inserted in the removable medium storage device 114.

The SNP information of the present invention may be stored in a well-known manner in the main memory 108, any of the secondary storage devices 110, and/or a removable storage medium 116. Software for accessing and processing the SNP information (such as SNP scoring tools, search tools, comparing tools, etc. ) preferably resides in main memory 108 during execution.

EXAMPLES The following examples are offered to illustrate, but not to limit the claimed invention.

Example 1: Statistical Analysis of SNP Allele Association with Cardiovascular Disorders and Statin Response Study design In order to identify genetic markers associated with acute coronary events (e. g.

MI, stroke, unstable angina, congestive heart failure, etc. ) or response to statin treatment for the prevention of coronary events ; samples from the Cholesterol and Recurrent Events (CARE) study (a randomized multicentral double-blinded trial on secondary prevention of acute coronary events with pravastatin) (Sacks et al., I 991, Am. J. Cardiol. 68: 1436- 1446) were genotyped. A well-documented myocardial infafction (MI) was one of iet '6nr6lhnent criteria for for entry into the CARE we CARE trial from 80 participating study centers. Men and post-menopausal women were eligible for the trial if they had had an acute MI between 3 and 20 months prior to randomization, were 21 to 75 years of age, and had plasma total cholesterol levels of less than 240 mg/deciliter, LDL cholesterol levels of 115 to 174 mgs/deciliter, fasting triglyceride levels of less than 350 mgs/deciliter, fasting glucdse levels of no more than 220 mgs/deciliter, left ventricular ejection fractions of no less than 25 %, and no symptomatic congestive heart failure. Patients were randomized to receive either 40 mg of pravastatin once daily or a matching placebo. The primary endpoint of the trial was death from coronary heart disease and the median duration of follow-up was 5.0 years (range, 4.0 to 6.2 years). Patients enrolled in the CARE study who received placebo had a 5 year risk of having a recurrent MI (RMI) of 9.5% while those patients enrolled in the study that received pravastatin had a 5 year risk of having a RMI of only 7.2% (PLogRank =0.0234) (25% reduction in risk for RMI in treatment vs. placebo groups, Cox Proportional Hazard Ratio [HRage-adjusted] =0. 75 [95% CI: 0.58-0. 97, p=0.0256]).

Secondary endpoints of other related cardiovascular or metabolic disease events, and changes in clinical variables were also recorded in pravastatin-treated and placebo groups. Examples of secondary endpoints are listed in Tables 6-8. All individuals

included in the study had signed a written informed consent form and the study protocol was approved by the respective Institutional Review Boards (IRBs).

For genotyping SNPs in CARE patient samples, DNA was extracted from blood samples using conventional DNA extraction methods such as the QIA-amp kit from Qiagen. Allele specific primers were designed for detecting each SNP and they are shown in Table 5. Genotypes were obtained on an ABI PRISM@ 7900HT Sequence Detection PCR system (Applied Biosystems, Foster City, CA) by kinetic allele-specific PCR, similar to the method described by Germer et al. (Germer S. , Holland M. J. , Higuchi R. 2000, GenomeRes. 10: 258-266).

In the first analysis of samples obtained from patients enrolled in the CARE study, SNP genotype frequencies in a group of 264. patients who had a second MI during the 5 years of CARE follow-up (cases) were compared with the frequencies in the group . of 1255. CARE patients who had not experienced second MI « (conkols). Logistic regression was used to adjust for the major epidemiologic risk factors with the specific emphasis on the interaction between the risk factors and tested SNPs to identify SNPs significantly associated with RMI when patients were stratified by sex, family history, smoking status, body mass index (BMI), ApoE., status or hypertension.

To replicate initial findings, a second group of 394 CARE patients were analyzed who had a history of an MI prior to the MI at CARE enrolment (i. e., patients who had experienced a RMI at enrollment) but who had not experienced an MI during trial follow- up (cases), and 1221 of CARE MI patients without second MI were used as controls. No patients from first analysis (cases or controls) were used in this second analysis (cases or controls). There are significant clinical differences between the two analyses e. g. , in the first analysis, all MI patients were in a carefully monitored clinical environment prior to their second MI, which could modulate effect of genetic polymorphisms, whereas in the second analysis, only a small portion of patients were treated by lipid lowering drugs prior to second MI. Despite these differences, numerous markers associated with RMI in the first analysis were also found to be associated with RMI in the second analysis (see Table 9).

Additionally, genetic markers identified as associated with acute coronary events or response to statin treatment for the prevention of coronary events in the CARE

samples were also genotyped in a second sample set, the West of Scotland Coronary Prevention Study (WOSCOPS) sample set. The design of the original WOSCOPS cohort and the nested case-control study have been described (Shepherd et. al, N. Eng. J. Med., Nov. 16: 333 (20), pp. 1301-7 1995; Packard et. al. N. Eng. J. Med. , Oct. 19: 343 (16), pp. 1148-55,2000). The objective of the WOSCOPS trial was to assess pravastatin efficacy at reducing risk of primary MI or coronary death among Scottish men with hypercholesterolemia (fasting LDL cholesterol > 155 mg/dl). Participants in the WOSCOPS study were 45-64 years of age and followed for an average of 4.9 years for coronary events. The nested case-control study included as cases all WOSCOPS patients who experienced a coronary event (confirmed nonfatal MI, death from coronary heart . disease, or a revascularization procedure; N=580).. GohtrolsweKe 1160 age and smoking status-matched unaffected patients. All individuals included in the study had signed a written informed consent form and the study protocol, was approved by IRBs. DNA was extracted and : genotyped as described above.

Statistical analysis for association of SNPs with specific clinical endpoints Qualitative phenotypes of the patients who were genotyped (Table 6) were analyzed using an overall logistic regression model that included an intercept, a parameter for the effect of a genotype containing two rare alleles versus a genotype containing no rare alleles, and a parameter for the effect of a genotype containing one rare allele versus a genotype containing no rare alleles. The test of the overall model is a chi-square test with five degrees of freedom for analyses containing all three genotypes, and four degrees of freedom for analyses containing two genotypes. An example of a SNP associated with increased risk for RMI is hCV529710 (Table 6). hCV529710 is strongly associated with Fatal CHD (Coronary Heart Disease) /Non-fatal MI and Fatal Atherosclerotic Cardiovascular Disease (Relative Risk = 1. 5 and 2.3, and p-values <0.05 and <0.005, respectively.

Quantitative phenotypes of the patients who were genotyped (Table 7) were also analyzed using an overall generalized linear model (GLM) that included an intercept, a parameter for the effect of a genotype containing two rare alleles, and a parameter for the

effect of a genotype containing one rare allele. The test of the overall GLM model is an F-test.

Effect sizes for association of SNPs with endpoints were estimated through odds ratios in placebo treated patients only, separately for carriers of each genotype (groups of 0,1, and 2 minor allele carriers). The effect was considered to be significant if the p- value for testing whether any of the SNP genotype parameters in overall model was < 0.05. An example of a SNP associated with increased risk for a quantitative phenotype such as very low density lipoproteins (VLDL) is hCV22274624 with a p value <0. 0005.

Statistical analysis for association of SNPs with, pravastatin treatment in cardiovascular events prevention (Table 8) was carried out using an overall logistic regression model that included an intercept, a parameter for the effect of a genotype containing two rare alleles versus a genotype containing no rare alleles, a parameter for the effect,. of a genotype containing one rare allele versus a genotype containing no rare alleles, a parameter for the effect of use of pravastatin versus the use of placebo, and parameters for the interaction effects between SNP genotypes and pravastatin use. The test of the overall model is a chi-square test with two degrees of freedom for analyses , containing all three genotypes, and one degree of freedom for analyses containing two genotypes.

Effect sizes were estimated through odds ratios (pravastatin group versus placebo) for carriers of each genotype (groups of 0, 1, and 2 minor allele carriers). The effect was considered to be significant if p-value for testing whether any of the interactions between SNP genotypes and pravastatin use were < 0.05. An example of a SNP associated with a response to statin treatment in preventing an adverse coronary event is hCV2741051.

When the pravastatin group is compared to the control group, individuals with one or two of the rare alleles had odds ratios of 0.43 and 0.26 respectively with a p-value of <0. 05.

This particular SNP is also associated with a reduced risk of stroke in the pravastatin treated group when one or two rare alleles are present in a patient (odds rations of 0.21 and 0.23 p<0.05). Odds ratios less than one indicate that the specific SNP allele has a protective effect and odds ratios greater than one indicate that the specific SNP allele has an adverse effect.

Statistical analysis for the association of SNPs with RMI or stroke (Table 9) was also carried out using stepwise logistic regression. Relative risk (RR) and 95% confidence intervals (CI) s-5-6 years relative risk of a RMI event or stroke given the SNP genotype were calculated by the Wald test. Certain SNPs show association of SNPs with adverse coronary events such as RMI and stroke in CARE samples. This association of certain SNPs with adverse coronary events could also be replicated by comparing associations observed in the first analysis of the CARE samples and the second analysis of the CARE samples (see above). An example of SNPs associated with increased risk for RMI are hCV517658 and hCV 8722981 with RR of 1.34 and 2.01 respectively. RR values <1 are associated with a reduced risk of the indicated outcome and RR values >1 are associated with an increased risk of the indicated, outcome. An example of a SNP associated with decreased risk for RMI that replicated between the first and second analysis of the CARE data is h (: V761961 that had ORs of 0. 5 and 0. 5 in the. first and second analyses respectively. An example of a SNP associated with increased risk for RMI that replicated in the first and second analyses is hCV8851080 that had ORs of 2.7 and 1.9 in the first and second analyses respectively. An example of a SNP associated with increased risk for stroke that replicated in the first and second analyses. ! of the CARE data is hCV11482766 that had ORs of 3.5 and 3.3 in the first and second analyses respectively.

For statistical analysis of association of SNPs with pravastatin treatment in RMI prevention (Table 10), effect sizes were estimated through genotypic RR, including 95% CIs. Homogeneity of Cochran-Mantel-Haenszel odds ratios was tested across pravastatin and placebo strata using the Wald test. A SNP was considered to have a significant association with response to pravastatin treatment if it exhibited Wald p-value < 0.05 in the allelic association test or in any of the 3 genotypic tests (dominant, recessive, additive). Table 10 shows association of SNPs predictive of statin response with cardiovascular events prevention under statin treatment, with an adjustment for conventional risk factors such as age, sex, smoking status, baseline glucose levels, BMI, history of hypertension, etc. (this adjustment supports independence of the SNP association from conventional risk factors). This table also provides the frequency data for the at risk allele in the columns labeled"Case Y PRIMER ALLELE Nucleotide

Frequency"and"Control Y PRIMER ALLELE Nucleotide Frequency". Allele frequencies for the cases and controls 0. 49 indicate that the at-risk allele is the minor allele. Allele frequencies 20. 50 indicate that the at-risk allele is the major allele. An example of a SNP associated with increased risk for an adverse cardiovascular event in the placebo group using a dominant genotypic test is hCV25644901. The dominant genotype (GG or GA) had a RR of 1.92 of being associated with an adverse cardiovascular event in the placebo group. However, this same SNP was protective in the statin treated group with a RR of 0.58. An example of a SNP associated with an adverse cardiovascular event in the placebo group using the allelic association. test is hCV16044337 with a RR of 1.87 for the homozygous AA genotype. This same genotype was protective in the statin treated group with a RR of 0.56.

The statistical results provided in Table 11 demonstrate association of a SNP in the CD6 gene (hCV2553030) that is predictive of statin response in the prevention of RMI, justified as a significant difference in risk associated with the SNP between placebo and statin treated strata (Breslow Day p-values < 0.05). Table 11 presents the results observed in samples taken from both the CARE and WOSCOP studies. In both studies the individuals homozygous for the minor allele were statistically different from heterozygous and major allele homozygous individuals in the pravastatin treated group vs. the placebo treated group. This SNP was associated with a reduced risk of an adverse coronary event in the CARE and WOSCOPS studies with RR or OR of 0.13 and 0.23 respectively in the two studies. Therefore, SNPs identified as useful for predicting RMI may also be useful for predicting increased risk for developing primary MI.

Table 12 shows the association of a SNP in the FCAR gene (hCV7841642) that is predictive of MI risk and response to statin treatment. Individuals who participated in both the CARE and WOSCOPS studies, who did not receive pravastatin treatment and who were heterozygous or homozygous for the major allele (AG or GG) (OR of 1. 58, 1.52, 1.5, 1.47 in the respective studies) had a significantly higher risk of having an MI vs. individuals who were homozygous for the minor allele. However, individuals in the CARE study who were heterozygous or homozygous for the FCAR major allele were also statistically significantly protected by pravastatin treatment against an adverse coronary event relative to the individuals homozygous for the minor allele (OR 0. 31,

0.79). Therefore, an allele found to be associated with risk for MI, RMI, stroke, or other adverse cardiovascular event, may also be useful for predicting responsiveness to statin treatment. SNPs associated with treatment response to pravastatin may also be predictive of responsiveness of an individual to other statins as a class.

The data presented in Table 8 based on an association of genotypes with pravastatin efficacy of the CARE samples were further analyzed and presented in Table 13. The further analysis was performed to align the data obtained from the analysis of the CARE samples, which was a prospective study, to the analysis of the WOSCOP samples, which was a case/control study. Table 13 also presents an analysis of the association of genotypes with pravastatin efficacy in the WOSCOPs samples. Relative to the analysis performed on the data presented in Table 8, there are two significant differences to determine if the SNP influenced pravastatin efficacy. Data obtained from the CARE samples were separated by study idesigndnto two groups, those in the prospective study design group and those in me case/control study design group. The original care study contained 16 protocol defined cardiovascular disease defined endpoints and 150 other phenotypes. The prospective study design presented in Table 13 only looks at two possible end points, those individuals who had a fatal MI, sudden death, or a definite non-fatal MI, or those individuals who had a fatal or non-fatal MI (probable or definite). In the case/control study design, in addition to only looking at cases that fell into the two possible endpoints defined above, cases were only compared to matched controls, ie. controls matched by age, smoking status and did not have any adverse coronary events or died due to other causes. The control groups used to compare the data were also divided into two groups, the"all possible"control group and the"cleaner" control group. The all possible control group consists of all of the controls that were white males and were matched for age and smoking status but had any disease outcome.

The cleaner control group were also matched for age and smoking status but were further restricted to only those individuals that had MI as an outcome. Because the participants in the WOSCOPs trial were all white males, only data obtained from white males in the CARE study were analysed. Data from the"all possible"and"cleaner"controls were compared to data obtained from the cases in the prospective study design while only data from"cleaner"controls were compared to cases in the case/control study design. The

data from the case/control cohorts were analysed using conditional logistic regression (as opposed to logistic regression used for the original anaylsis).

An example of a SNP associated with fatal MI/sudden death/non-fatal MI using data from the CARE study is hCV2442143. Patients with 0 rare alleles (or patients homozygous for the dominant allele) had an OR of 0.42 of being associated with the adverse outcome in the presence of statin treatment. Patients with one or two rare alleles had ORs of 0.78 and 1.16 respectively of being associated with the adverse outcome.

However the 95% CI for these two genotypes makes the result not statistically significant.

The data presented in Table 6 based on an association of genotypes with adverse cardiovascular outcomes such as fatal or non-fatal MI were further analyzed and presented in Table 14. Similar to the data presented in Table 13, the analysis was modified to align the data obtained from., the CARE samples-, to-data obtained from the WOSCOPs samples. In addition, Table. 14 also presents an analysis of-the association of genotypes with adverse cardiovascular outcomes observed in the WOSCOPs samples.

As above, there are two significant differences. Data obtained from the CARE samples were separated by study design into a prospective or a case/control study design group as defined above. Secondly, as above the control groups were divided into the all possible controls and the cleaner controls. Controls were age matched for age and smoking status with the cases. The all possible controls include individuals as defined above-and the cleaner controls also use individuals as defined above. As above, only data obtained from samples from white males were analysed and are presented in Table 14.

An example of a SNP associated with an adverse cardiovascular event such as a fatal MI or non-fatal MI using data from the CARE study is hCV529706. Patients with 2 rare alleles vs. 0 rare alleles had an OR of 2. 08 of having the adverse event (p, 0.05).

The statistical results provided in Table 15 demonstrate the association of a SNP in the PON1 gene (hCV2548962) with pravastatin efficacy in both the CARE and WOSCOPs sample sets. The anaylsis was refined as described for both Tables 13 and 14. The data show that patients with 2 rare alleles were significantly protected against a fatal or non-fatal MI when treated with pravastatin (ORs 0.28-0. 34, p< 0.05).

Example 2: Statistical Analysis of SNP Combinations. Associated with RMI and Predictive of Response to Statin Treatment Multiple markers were identified in the CARE study as associated with the ability of a patient to respond to statin treatment by having. a reduced risk of RMI (specifically see Tables 8 and 10). The data presented in those Tables, especially Table 10 indicate that the minor alleles of NPC1 (hCV25472673) and HSPG2 (hCV1603656) and the major allele of ABCA1 (hCV2741051) are protective against RMI in patients that receive statin treatment. The data also show that certain genotypes of the alleles identified in Table 10 are protective against RMI in patients that receive statin treatment. The homozygous minor allele or the heterozygous minor and major allele of the NPC1 gene (CC, CT) and the HSPG2 gene (TT, TC) are protective genotypes (low risk genotypes) against RMI in patients that receive statin treatment.. The ; homozygous major allele of the.

ABCA1 gene (CC) is a protective genotype (low risk genotype) in patients that receive statin treatment.

The genotype data generated from the DNA of patients who participated in the CARE study was analyzed to determine the effect that pravastatin treatment had on the occurrence of RMI in patients with each of the potential genotypes (low risk, protective or high risk, non-protective) for the ABCA1 gene, the NPC1 gene and the HSPG1 gene independently. The data are presented in Table 16.

Table 16 Age-Adjusted pravastatin effect (by genotype group) N Label RR 95% CI p-value 1366 High risk ABCA1 0. 9567 0. 6709 1.3644 0. 807 genotype 1441 Low risk ABCA1 genotype 0. 5883 0. 4249 0.8145 0. 0014 Total = 2807 1045 High risk NPC1 genotype 1. 0824 0. 7265 1. 6127 0. 6971 1755 Low risk NPC1 genotype 0. 5938 0. 4388 0. 8035 0. 0007 Total = 2800 2375 High risk HSPG2 genotype 0.8097 0. 6271 1. 0453 0. 1053 428 Low risk HSPG2 genotype 0. 3934 0. 2002 0. 7729 0. 0068 Total = 2803

The data show that the low risk genotypes of the ABCA1 gene, the NPC1 gene and the HSPG2 gene are protective against RMI in patients that have received statin treatment.

The effect of pravastatin treatment on the occurrence of RMI in patients with each of the potential genotypes (protective, low risk genotype or non-protective, high risk genotype) for each of the ABCA1 gene, NPC1 gene, and HSPG2 gene alone, and combinations with the other two genes thereof are presented in Table 17.

Table 17 Age-adjusted pravastatin effect (by genotype group) N Label''RR 95% CI p-value 436 High risk, non-protective genotypes 1. 7175 0. 877 3.3637 0.1148 447 Low risk, protective ABCA1 only 0. 8765 0. 4848 1. 5848 0.6627 701 Low risk, protective NPC1 only 0. 8954 0. 5543 1. 4462 0.6514 83 Low risk, protective HSPG2 only 0. 2487 0. 0304 2.0372 0.1947 784 Low risk ABCA1 and NPC1 only 0. 5258 0. 3343 0.8271 0.0054 (pattern 2 genotype) 77 Low risk ABCA1 and HSPG2 only 1. 0054 0. 2593 3. 8982 0.9938 144 Low risk NPC1 and HSPG2 only 0. 2964 0. 0652 1.3482 0.1156 122 Low risk ABCA1, NPC1 and HSPG2 0. 2399 0. 0704 0. 8177 0.0225 (pattern 3 genotype) Total =2794

The data show that patients that have a combination of the ABCA1 and NPC1 low risk genotypes (pattern 2) or patients that have a combination of the ABCA1, NPC1 and the HSPG2 low risk genotypes (pattern 3) have a significantly reduced risk of RMI if they receive pravastatin treatment relative to those patients who received placebo.

Patients in the CARE trial that had a high risk, non-protective genotype for the ABCA1 gene, the NPC1 gene and the HSPG2 gene, had the low risk ABCA1 genotype only, had the low risk ABCA1 and HSPG2 genotypes only, had the low risk NPC1 genotype only, had the low risk HSPG2 genotype only, or had the low risk NPC1 and HSPG1 genotype are collectively called pattern 0 patients. Patients in the CARE trial that had the pattern 0 genotype and received placebo had a 5. year risk of a RMI of 8 lui%.

Patients in the trial that had the pattern 2 genotype and received placebo had a 5 year risk of a RMI of 12.5%, or a 64 % increase over those patients that had the pattern 0 genotypes. Patients in the trial that had the pattern 3 genotype and received placebo had a 5 year risk of a RMI of 19.3 % or a 138% increase over those patients that had the pattern 0 genotypes. These data show that patients that do not receive statin treatment and have the pattern 2 or the pattern 3 genotypes have a 64% or a 138% increased risk of a RMI in a 5 year period over patients with a pattern 0 genotype (LogRank p-value = 0.0013).

Patients in the CARE trial with pattern 0 genotypes who did not receive statin treatment had a 5 year risk of a RMI of 8. 1%. Patients in the CARE trial with pattern 0 genotypes who did receive pravastatin treatment had a 5 year risk of a RMI of 7.9% (N = 1888,67. 6% of the CARE population, LogRank p-value = 0.9345). Patients in the trial with pattern 2 genotypes, who did not receive statin treatment had a 5 year risk of a RMI of 12.5%. Patients in the trial with pattern 2 genotypes who did receive pravastatin treatment had a 5 year risk of a RMI of 6. 8% (HR = 0.53, 95% CI: 0.33-0. 85, p = 0.0081, N = 784,28. 1 % of the CARE population). This is a 50% reduction in risk over a 5 year period for RMI. Patients in the trial with pattern the 3 genotype, who did not receive statin treatment had a 5 year risk of a RMI of 19.3%. Patients in the trial with the pattern

3 genotype who did receive pravastatin had a 5 year risk of a RMI of 4.6% (HR = 0.2, 95% CI = 0.06-0. 8, p = 0209, N = 122, 4.4% of the CARE population). This is an 80% reduction in risk over a 5 year period for RMI. These data are summarized in Table 18.

Table 18 RMI No RMI Risk RRstatin RDsm All Pravastatin 106 1367 0. 072 0. 76 0. 023 Placebo 137 1303 0. 095 Pattern 0 Pravastatin 78 906 0. 079 0. 98 0. 001. Placebo 73 831 0.081 Pattern 2 Pravastatin 25 342 0.068 0.55 0.057 Placebo 52 365 0 ; 125 Pattern 3 Pravastatin 3 62 0. 046 0. 24 0. 147 Placebo 11 46'0 : 193

Measures of prognostic value were calculated from the above data. The positive predictive value (PPV) of each genotype pattern can be calculated by dividing the number of individuals with that genotype who received placebo and had a RMI by the total number of individuals who had that genotype and received placebo. The PPV of the pattern 3 genotype is 19.3% and the PPV of the pattern 2 genotype is 12.5%. The negative predictive value (NPV) of each genotype can be calculated by dividing the total number of individuals who had those genotypes, received placebo and did not have a RMI by the total number of individuals who had that genotype and received placebo.

The NPV of pattern 0 is 91.9%. From these calculations, the entire population can be broken down into different absolute risk groups. The over all risk of the population to have a RMI after having an MI is 9.5%. However, for individuals with the pattern 0 genotype, the risk of a RMI is reduced to 8.1%. Individuals with pattern 2 and pattern 3 genotypes have a 12.5% and 19. 3% risk of a RMI.

All publications and patents cited in this specification are herein incorporated by reference in their entirety. Various modifications and variations of the described compositions, methods and systems of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments and certain working examples, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described modes for carrying out the invention that are obvious to those skilled in the field of molecular biology, genetics and related fields are intended to be within the scope of the following claims.

TABLE 5, page 1 of 4 Marker A ! Mes Sequence A (allele-sDeafic Primer) Seauence B (allele-specific primerl Sequence C (common primer) hCV1085600 CIG AGCTGTTCGTGTTCTATGATC (SEQ ID NO : 85091) AGCTGTTCGTGTTCTATGATG (SEQ ID NO : 85092) GAAGTCAACAGTGAACATGTGA (SEQ ID NO : 85093) hCV1088055 A/G CACTCACACTGGGGAAGA (SEQ ID NO : 85094) ACTCACACTGGGGAAGG (SEQ ID NO : 85095) CCTTCCAGGTGAAGGTCAC (SEQ ID NO : 85096) hCV11225994 A/G TCCCAATCCCAGGACA (SEQ ID NO : 85097) CCCAATCCCAGGACG (SEQ ! NO : 85098) TGACATTGCACTCTCAAATATTT (SEQ ID NO : 85099) hCV11359098 C/G CAAAATGTAGAAGGTTCATATGAG (SEQID NO : 85100) CAAAATGTAGAAGGTTCATATGAC (SEQ ID NO : 85101) GAGCTGTGTGTTfCTTTGTTCTA (SEQ ID NO : 85102) hCV11482766 CIT GCGCACCCAGGTCAG (SEQ ID NO : 85103) GCGCACCCAGGTCAA (SEQ ID NO : 85104) CCACGTTCTGGTCGATCTT (SEQ ID NO : 85105) hCV11571465 CIG GCTGGAGTTCATGTCGC (SEQ ID NO : 85106) GCTGGAGTTCATGTCGG (SEQ 0 NO : 85107) CCTTGGCTGTGTGGTACAG (SEQ ID NO : 85108) hCV11696920 AIG GTCTTTAGAAGCCTCTTCAGAATA (SEQ ID NO : 85109) CTTTAGAAGCCTCTTCAGAATG (SEQ ID NO : 85110) CGGCTTTGGCCTACAAG (SEQ) DNO : 85111) hCV1180648 GIA GGGTAAAATTCAGTAAGGTTGG (SEQ ID NO : 85112) AGGGTAAAATTCAGTAAGGTTGA (SEQ ID NO : 85113) TCGCTATCCAAGTGAACATATC (SEQ ID NO : 85114) hCV11852251 CIG GGCTGTTGTCTCACCCTC (SEQ ID NO : 85115) GGCTGTTGTCTCACCCTG (SEQ ID NO : 85116) TGTCATCAGATGAAGAAGAGAGAA (SEQ ID NO : 85117) hCV11889257 A/G CTCTCTTTCTAGAAACTGAAGAAATT (SEQ ID NO : 85118) TCTCTTTCTAGAAACTGAAGAAATC (SEQID NO : 85119) GGGCAGGGCTAGGAGTAG (SEQID NO : 85120) hCV11942529 Crr ACTGTCACCTGTTGGGG (SEQ ID NO : 85121) GACTGTCACCTGTTGGGA (SEQ ID NO : 85122) CCAGGGTTGGGCTACTG (SEQ ID NO : 85123) hCV11951095 TiC CGTGACCCTGCCGT (SEQ ID NO : 85124) CGTGACCCTGCCGC (SEQ ID NO : 85125)'GGGCCAGCATGTGGAC (SEQ ID NO : 85126) hCV11975296 T/C CAGTCCATGGTTCCTTCAT (SEQ ID NO : 85127) CAGTCCATGGTTCCTTCAC (SEQ ID NO : 85128) CTCCACCTGCATTTCAGAG (SEQ ID NO : 85129) hCV12020339 efT GGACCCCCGAAGGC (SEQ ID NO : 85130) TGGACCCCCGMGGA (SEQ ID NO : 85131) GGCCCCAACAGTTGACTG (SEQ ID NO : 85132) hCV1202883 A/G GCGTGATGATGAAATCGA (SEQ ID NO : 85133) GCGTGATGATGAAATCGG (SEQ ID NO : 85134) AGCCTCTCCTGACTGTCATC (SEQ ID NO : 85135) hCV1207994 A/C GCAGCAGTCGCCCTT (SEQ ID NO : 85136) GCAGCAGTCGCCCTG (SEQ ID NO : 85137) CATTTTGCTGATGTffGTTTCTAG (SEQ ID NO : 85138) hCV12102850 CIT GGTTACAGGCTCCAGGAC (SEQ ID NO : 85139) GGTTACAGGCTCCAGGAT (SEQ ID NO : 85140) CTGATGGCCAAAAGAAGAGT (SEQ ID NO : 85141) hCV121 OB245 AtG GCCCTACAGCGGGT (SEQ ID NO : 85142) CCTACAGCGGGC (SEQ ID NO : 85143) GACGGATCTGACAGAATCTTTC (SEQ ID NO : 85144) hCV12114319 A/G GACACTGCCCTCATCGT (SEQ ID NO : 85145) CACTGCCCTCATCGC (SEQ ID NO : 85146) CCTGTCCTTGAGGTCTGATC (SEQ ID NO : 85147) hCV12120554 CIT ACTGTCCTGTCTCTCCTCG (SEQ ID NO : 85148) GACTGTCCTGTCTCTCCTCA (SEQ ID NO : 85149) TTGCCAGCCATGACTAGA (SEQ ID NO : 85150) hCV1253630 AIG TCGCAGGTGTCCCTA (SEQ ID NO : 85151) CGCAGGTGTCCCTG (SEQ ID NO : 85152) CCCCATCCCTTCTCA (SEQ ID NO : 85153) hCV1260328 A/G TCCACGTGGACCAGGT (SEQ ID NO : 85154) CCACGTGGACCAGGC (SEQ ID NO : 85155) GCCCAGGTATTTCATCAGC (SEQ ID NO : 85156) hCV1345898 CIT CAG77CCATGGGTTCTACTAC (SEQ ID NO : 85157) CAGTTTTCCATGGGTTCTACTAT (SEQ ID NO : 65158) TTATGAAATGGTACAGACAAGTGAT (SEQ ID NO : 65159) hCV1345898 T/C CAGTTTTCCATGGGTTCTACTAT (SEQID NO : 85160) CAGTTTTCCATGGGTTCTACTAC (SEQID NO : 85161) TTATGAAATGGTACAGACAAGTGAT (SEQ ID NO : 85162) hCV1361979 A/G CCAGTTTTGGTGTCAACTAGAAA (SEQID NO : 85163) CCAGTTTTGGTGTCAACTAGAAG/SEQID NO : 85164) TTGCAACCTGAAAAACATAACTA (SEQ ID NO : 85165) hCV1366366 A/G TCCCTTAGTCCGGATGAT (SEQ ID NO : 85166) TCCCTTAGTCCGGATGAC (SEQ ID NO : 85167) GACTCTnTGCAGGAATGTGT (SEQ ID NO : 851ES) hCV1376137 A/G CTCCATCATTGCAGACCA (SEQ IDNO : 85169) TCCATCATTGCAGACCG (SEQ ID NO : 85170) CCAATTCCCCTGATGTTAAA (SEQ ID NO : 85171) hCV1403468 A/C ACTGGCCCCTTGCAT (SEQ ID NO : 85172) ACTGGCCCCTTGCAG (SEQ ID NO : 85173) AGGAGGGAACCAAACCTTA (SEQ ID NO : 85174) hCV1466546 AUG TCTGGCTTCCGGGAA (SEQ ID NO : 85175) TCTGGCTTCCGGGAG (SEQ ID NO : 85176) CGTAGCTGTTGACCATCATTTA (SEQ ID NO : 85177) hCV15757745 GIG AGATTTTCACCCATCCATG (SEQ D NO : 85178) GAGATTTTCACCCATCCATC (SEQ ID NO : 85179) TGCCGACTCAGAAACTCTCTA (SEQ ID NO : 85180) hCV15760070 AIT TGTCCAGATCCACATAGMCA (SEQ ID NO : 85181) TTGTCCAGATCCACATAGAACT (SEQ) DNO : 85182) CTTTATGCAGCGGACCAT (SEQID NO : 85183) hGV15852235 Cff AAGAGGTCCTGAATCTTCTCTC (SEQ ID NO : 85184) AAGAGGTCCTGAATCTTCTCTT (SEQ ID NO : 85185) ATGAAATGGGTCAACAAAACT (SEQ ID NO : 85186) hCV15871020 GM ATGTGMCTTAGcACmmATCAG (SEQ ID NO : 85187) ATGTGAACTTAGCACTITTATCAA (SEQ ID NO : 85188) AACCTTCCGTGGAAAGAGA (SEQ ID NO : 85189) hCV15B76û71 GM CGACTTMGGGTGTAGTGTGAC (SEQ ID NO : 85190) CGACTTAAGGGTGTAGTGTGAT (SEQ ID NO : 85191) CCGAAAACGGAAGCATC (SEQ ID NO : 85192) hCV15882348 CtT GCTGCTCTGCGCCG (SEQ ID NO : 85193) GCTGCTCTGCGCCA (SEQ ID NO : 85194) GCCCTCTGCGTACCTAAGG (SEQ ID NO : 85195) hCV15943710 AIG CCTCATGGAGATCTTTCA (SEQ ID NO : 85196) CCTCATGGAGATCTTTCG (SEQ ID NO : 85197) GAGGCCAGCGAGGAGA (SEQ ID NO : 85198) hCV15954277 A/G TGTCGGTAAACATGGCA (SEQ ID NO : 85199) GTCGGTAAACATGGCG (SEQ ID NO : 85200) GGTGGGTGGTCTGACTCTC (SEQ ID NO : 85201) hCV15962586 CIT GGCTGTGCCTGGGAC (SEQ ID NO : 85202) GGCTGTGCCTGGGAT (SEQ ID NO : 85203) GAAGGCAGGGACTTTTATCA (SEQ ID NO : 85204) hCV1603656 CtT GCTGCCCTCAGTCCG (SEQ ID NO : 85205) TGCTGCCCTCAGTCCA (SEQ ID NO : 85206) GGGCACTGCCAATTCTTAG (SEQ IDNO : 85207) hCV1603692 crr GGCCTCTAGGGGGCC (SEQ ID NO : 85208) AGGCCTCTAGGGGGCT (SEQ ID NO : 85209) CCCCATTTGCACACAGAC (SEQ ID NO : 85210) hCV1603697 crr CGGCCTGCGTGGAC (SEQ ID NO : 85211) CGGCCTGCGTGGAT (SEQ ID NO : 85212) GCCCAGGGCGTGTTCT (SEQ ID NO : 85213) hCV16044337 AUG TCCGGGTGCACGTATA (SEQ ID NO : 85214) CGGGTGCACGTATG (SEQ ID NO : 85215) TGGAGAGTGTTTGCTCATCTAC (SEQ ID NO : 85216) hCV16047108 AIG TGTTTTCATCCACTTGAACTGT (SEQ ID NO : 85217) TTTTCATCCACTTGAACTGC (SEQ ID NO : 85218) CAATTTTGGCTCCCTTAAAAG (SEQID NO : 85219) hCV16053900 GIT GGACGTGCTCCAGGATG (SEQ ID NO : 85220) GGACGTGCTCCAGGATT (SEQ ID NO : 85221) GGTTCACATTTTGGTTCACAA (SEQ ID NO : 85222) hCV16165996 crr CTGAGGCCTATGTCCTC (SEQ ID NO : 85223) CTGAGGCCTATGTCCTT (SEQ ID NO : 85224) AGCTCTCCTTTGTTGCTACTG (SEQ ID NO : 85225) hCV161 66043 AiG CGGTTGMGTCCTTGAT (SEQ ID NO : 85226) CGGTTGAAGTCCTTGAC (SEQ ID NO : 85227) GGTTGTGCAGAGACATCTGA (SEQ ID NO : 85228) hCV16170435 G ! C ATCTCACAAATGATCGCTATG (SEQ ID NO : 85229) AATCTCACAAATGATCGCTATC (SEQ ID NO : 85230) CAGGCTCCATCTCACAGATAC (SEQ ID NO : 85231) hCV161709D0 AlG CGCACACCAGGTTCTCAT (SEQ ID NO : 85232) CGCACACCAGGTTCTCAC (SEQ ID NO : 85233) GCAACTACCTGGGCCACTATA (SEQ ID NO : 85234) hCV16170911 TIC GGTTTCATTGCATGGTTTCT (SEQ ID NO : 85235) GTTTCATTGCATGGTTTCC (SEQ DNO : 85236) GGGTACTGAATTTTTAAAAGGTTTTA (SEQ ID NO : 95237) hCV16170982 C/G CCCCCACTCTCCAGC (SEQ ID NO : 85238) CCCCCACTCTCCAGG (SEQ ID NO : 85239) GGCAAAAGCACTGTGAAGA (SEQ ID NO : 8524D) hCV16172087 A/C GACTGCCCGTCAGCA (SEQ ID NO : 85241) GACTGCCCGTCAGCC (SEQ ID NO : 85242) GGAGGTCAGGTGGATGTTTA (SEQ ID NO : 85243) hCV16172249 GIG ACTGTAATTTTTTTAAAGGTCCTG (SEQID NO : 85244) ACTGTAATTTTTTTAAAGGTCCTC (SEQID NO : 85245) GGATGTATATCATCTATCTTCACAGTATAT (SEQ ID NO : 85246) hCV16172339 AbT CTGCGGCTCCACCT (SEQ ID NO : 85247) TGCGGCTCCACCA (SEQ ID NO : 85248) TGGCATCTGCCATACTCA (SEQ ID NO : 85249) hCV16172571 A/G GGTACCATGGACTGTACTCACT (SEQ ID NO : 85250) GTACCATGGACTGTACTCACC (SEQ ID NO : 85251) AGGTTGGTTCTGGAGATGAC (SEQ ID NO : 85252) hCV16179493 crr GGGTCCGGCCACAC (SEQ ID NO : 85253) GGGTCCGGCCACAT (SEQ ID NO : 85254) GGGCCCCTCAGTGAAG (SEQ ID NO : 85255) hCV16182835 AIG TGTTCTTCCTTATGATGATGT (SEQ ID NO : 85256) GTTCTTCCTTATGATGATGC (SEQ ID NO : 85257) GGCGTTCCTCTCACCTTAATA (SEQID NO : 85258) hCV16189421 CrT GCCATCATTTGCTTCTAACAC (SEQ ID NO : 85259) GCCATCATTTGCTTCTAACAT (SEQ ID NO : 852EO) GCTTATTTGCCAGAAAACATTT (SEQ ID NO : 8961) hCV16190893 ClT GCAGTACTTGCTTAGGG (SEQID NO : 85262) CGCAGTACTTGCTTAGGA (SEQ ID NO : 85263) GCCACCTTTATfTCTTTAGTGAA (SEQID NO : 85264) hCV16192174 G1A GAGCACCTTAACTATAGATGGTG (SEQID NO : 85265) TGAGCACCTTAACTATAGATGGTA (SEQID NO : 85266) CTTGTCAAGGCACAGAATAATT (SEQ ID NO : 85267) hCV16196014 C/G TGAAGAAGCTAAGGATTGAGG (SEQ ID NO : 85268) TGAAGAAGCTAAGGATTGAGC (SEQ ID NO : 85269) CTCTCCCTGGCTGAGTTG (SEQ ID NO : 85270) hCV16273460 ClT GCACTCTTGGACAAGCG (SEQ ID NO : 85271) TGCACTCTTGGACAAGCA (SEQ ID NO : 85272) AATGACATCCCCTATCTTTCTG (SEQ ID NO : 85273) TABLE 5, page 2 of 4 Marker Alleles Sequence A (allele-spedfic orimerl Sequence B fallele-soecifc orimer) Sequence C fcommon odmer) hCV16276495 C/T GTACCTTCACCCATGGAAC (SEQ ID NO : 85274) GTACCTTCACCCATGGAAT (SEQ ID NO : 85275) TCACmCTGTTGATTACATGAGA (SEQ ID NO : 85276) hCV1647371 C/T CTGGCTGGGTCACTAACC (SEQ ID NO : 85277) GCTGGCTGGGTCACTAACT (SEQ ID NO : 85278) CCTCACCTGCATTCACATTT (SEQ ID NO : 85279) hCV1662671 A/G CAGCCAAGAGCAGGACA (SEQ ID NO : 85280) AGCCAAGAGCAGGAGG (SEQ ID NO : 65281) CCCAAGACACGTTCAGAAAT (SEQ ID NO : 85282) hCV1789791 AVG ACAGAATCAGGCAATATCCA (SEQ ID NO : 85283) CAGAATCAGGCAATATCCG (SEQ ID NO : 85294) TTTGTAGACCAGTGAAGAAGTGAT (SEQ ID NO : 85285) hCV1819516 CfT CCCCTGTTGAGGAGTATTG (SEQ ID NO : 85286) GCCCCTGTTGAGGAGTATTA (SEQ ID NO : 85287) GTTCTGCCAGBEAATCTCTA (SEQ) D NO : 85288) hCV1842400 AJG TTGGTACCTGGCTCTCT (SEQ ID NO : 85289) TGGTACCTGGCTCTCC (SEQ ID NO : 85290) AAACTTCTTAGGACAGAGTGATTAGA (SEQ ID NO : 85291) hCV1SD7E4 C/T TCAAGGCTTAATGCCACTC (SEQ) D N0 : 85292) TCAAGGCTTAATGCCACTT (SEQ ID NO : 85293) CGTAAGTCTGTGATTTGTCAATACT (SEQ ID NO : 85294) hCV2038 GM CACGGCGGTCATGTG (SEQ ID NO : 85295) CCACGGCGGTCATGTA (SEQ ID NO : 85296) GGTGGAGCTTGGTTTCTCA (SEQ ID NO : 86297) hCV2126249 C/T CAGGGGAGTAAAGGTGACTC (SEQ ID NO : 85298) CAGGGGAGTAAAGGTGACTT (SEQ ID NO : 85299) GCTCAGCCAGCCAGAAA (SEQ ID NO : 85300) hCV2188895 AtG AGAGAATGTTACCTCTCCTGA (SEQ ID NO : 85301) GAGAATGTTACCTCTCCTGG (SEQ ID NO : 85302) TTCTCCTGGGTCAGATTCTC (SEQ ID NO : 85303) hCV2200985 C/G GCGCACCAGCTTCAG (SEQ ID NO : 85304) GCGCACCAGCTTCAC (SEQ ID NO : 85305) TGTAATACATGATTTTCAGACACAC (SEQ ID NO : 85306) hCV22271841 C/T CATCACGGAGATCCACC (SEQ ID NO : 85307) ATCATCACGGAGATCCACT (SEQ ID NO : 85308) TCAGCTCCAAGGAGATTCTTAG (SEQ ID NO : 85308) hCV22272267 AIG CTGGCAGCGAATGTTAT (SEQ ID NO : 85310) CTGGCAGCGAATGTTAC (SEQ ! NO : 85311) CCTCTAGAAAGAAAATGGACTGTAT (SEQ ID NO : 85312) hCV22272997 G/A GCGGTAGCAGCAGCG (SEQ ID N0 : 85313) GCGGTAGCAGCAGCA (SEQ ID N0 : 85314) AGGCCCTCCTACCTTTTG (SEQ ID NO : 85315) hCV22273204 AIG TCAGCTTCTTCACTGCTA (SEQ ID NO : 85316) CAGCTTCTTCACTGCTG (SEQ ID NO : 85317) GCTTTGATTTCCTACTCTGATTTTA (SEQ ID NO : 85318) hCV22274624 C/T CCCTACAGAGGATGTCAG (SEQ ID NO : 85319) CCCTACAGAGGATGTCAA (SEQ ID NO : 85320) CAGAGCCTCCCTTGTCAC (SEQ ID NO : 85321) hCV22274632 AIC TGAATGAGCATCCAAAAGAA (SEQ ID NO : 85322) TGAATGAGCATCCAAAAGAC (SEQ ID NO : 85323) GCAGCACGAAGCATTCAT (SEQ ID NO : 85324) hCV2351160 A/G CCACCAGTGGCTATCA (SEQ ID NO : 85325) CCACCAGTGGCTATCG (SEQ ID NO : 85326) GGCAAGCAGGCTTGAGAA (SEQ ID NO : 85327) hCV2442143 CIT ATTTAAGCATCATAGCATACCAC (SEQ ID NO : 85328) ATTTAAGCATCATAGCATACCAT (SEQ ID NO : 85329) TGGTACACCATAAATCTTGACTTAC (SEQ ID NO : 85330) hCV2485037 AUG TGCAAGAGGACTAAGCATGA (SEQ ID NO : 85331) GCAAGAGGACTAAGCATGG (SEQ ID NO : 85332) GCGGCCTTGCACTCA (SEQ ID NO : 85333) hCV2531086 AIG GCCCCCCTCTCTGAAGA (SEQ ID NO : 85334) CCCCCCTCTCTGAAGG (SEQ ID NO : 85335) CCAGTTCGTGGTATGTTCATCT (SEQ ID NO : 85336) hCV2531431 AIG GCCAATGTGGCGGA (SEQ ID NO : 85337) GCCAATGTGGCGGG (SEQ ID NO : 85338) CCTGGACGACGGTTTCA (SEQ ID NO : 85339) hCV25472673 Crr TOGOCTCCATCCCAC (SEQ ID NO : 85340) TGGGCTCCATCCCAT (SEQ ID NO : 85341) CCAATTCTTTTTCTTCTITCAGTT (SEQ ID NO : 85342) hCV25473653 C/T CTCTMCATCACCGTGTACG (SEQ ID NO : 85343) CCTCTAACATCACCGTGTACA (SEQ ID NO : 85344) GAGCTCTGGGTCAGAACTGT (SEQ ID NO : 85345) hCV25474627 AIG GGTACCATGGACTGTACTCACT (SEQ ID NO : 85346) GTACCATGGACTGTACTCACC (SEQ ID NO : 85347) AGGTTGGTTCTGGAGATGAC (SEQ ID NO : 85348) hCV2548962 CIT CAAATACATCTCCCAGGATC (SEQ ID NO : 85349) CAAATACATCTCCCAGGATT (SEQ ID NO : 85350) GTTTTAATTGCAGTTTGAATGATAT (SEQ ID NO : 85351) hCV2553030 CIT CCGGCTTGCACTTCAC (SEQ ID NO : 85352) CCGGCTTGCACTTCAT (SEQ ID NO : 85353) CTTTGTGGCCGCAGTAGT (SEQ ID NO : 85354) hCV25593221 crr GGCAACTCCTAGTAGTACAAC (SEQ ID NO : 85355) GGCAACTCCTAGTAGTACAAT (SEQ ID NO : 85356) GGAAGTTTCCATCCAAATTTAC (SEQ ID NO : 85357) hCV25598594 AfG ATATATTGACCGTTCTCCCAT (SEQ ID NO : 85358) ATATATTGACCGTTCTCCCAC (SEQ ID NO : 85359) GCCACCTCCAACCATATC (SEQ ID NO : 85360) hCV25607108 A ! G CCCTGTACTTTCATAAGATGCT (SEQ ID NO : 85361) CCTGTACTTTCATAAGATGCC (SEQ ID NO : 85362) ACGACGCCAAGGTGATA (SEQ ID N0 : 85363) hCV25610470 AIG CACAATCACCACGGTCT (SEQ ID NO : 85364) ACAATCACCACGGTCC (SEQ ID NO : 85365) CCTTCTGCATCAGCATCTTC (SEQ ID NO : 85366) hCV25610774 C/T GGGTCGGTGCAAGAGG (SEQ ID NO : 65367) GGGTCGGTGCAAGAGA (SEQ ID NO : 85368) GCACCTTGGTGGGTTTGT (SEQ ID NO : 85369) hCV25610819 A/T GGACGTGGACATGGAGT (SEQ ID : B5370) GGACGTGGACATGGAGA (SEQ ID NO : 85371) CGGCGCTCGTAGGTG (SEQ ID NO : 85372) hCV25613493 CYST CGGCCCTCAGGACC (SEQ ID NO : 85373) CCGGCCCTCAGGACT (SEQ ID NO : 85374) GCGGAAGGTACCAAGTTTG (SEQ ID NO : 85375) hCV25614474 AUG CTGTTGTCCTGCTTCCAA (SEQ ID NO : 85376) CTGTTGTCCTGCTTCCAG (SEQ ID NO : 85377) GTTTCTGCATCAGTGAGATTTT (SEQ ID N0 : 85378) hCV25615376 G/A ATTTAACACCACTATACTCTCAG (SEQ ID NO : 85379) ATTTAACACCACTATACTCTCAA (SEQ ID NO : 85380) GGATATGCCTTCTTTGGAAATA (SEQ ID NO : 85381) hCV25615626 AUG AATATACCATTCTGTTAGGACTTA (SEQ ID NO : 85382) ATATACCATTCTGTTAGGACTTG (SEQ ID NO : 85383) GTGGTGGTGGGTCAGTATG (SEQ ID NO : 85384) hCV25617571 C/T CCAGCAGTATGGACG (SEQ ID NO : 85385) TGCCAGCAGTATGGACA (SEQ ID NO : 85386) CCATCCAGCCTCAGGAAC (SEQ ID NO : 85387) hCV25620145 AUG CACACCAGCAATGATGAAACT (SEQ ID NO : 85388) CACCAGCAATGATGAAACC (SEQ ID NO : 85389) GGGCTAACTCTTTGCATGTTC (SEQ ID NO : 85390) hCV25620774 C/T CACCCTGGCTGGAGAG (SEQ ID NO : 85391) CACCCTGGCTGGAGAA (SEQ ID NO : 85392) CTCCCTGTCCCAAAAAGAC (SEQ ID NO : 85393) hCV25623265 AIG TGGAGGCTGATGGGTA (SEQ ID NO : 85394) GGAGGCTGATGGGTG (SEQ ID NO : E5395) CGCTTTGCAGCCATAACT (SEQ ID NO : 85396) hCV25627634 C/G CACCCTGCAGATGGAAC (SEQ ID NO : 85397) CACCCTGCAGATGGAAG (SEQ ID NO : 85398) CAAGACTCCTTCATCCTCAATAGT (SEQ ID NO : 85399) hCV25629492 A/G CCCACAGCCTGCGAT (SEQ ID NO : 85400) CCCACAGCCTGCGAC (SEQ ID NO : 85401) CCGCTTGAGGTCCACATA (SEQ ID NO : 85402) hCV25630499 C/T CATTGCTGGTTTCCACG (SEQ ID NO : 85403) CATTGCTGGTTTCCACA (SEQ ID NO : 85404) GGCAGTGGCACACAATCT (SEQ ID NO : 85405) hCV25630686 CIT AGGTTGTACCTGTAGCACTAAGAC (SEQ ID NO : 85406) TAGGTTGTACCTGTAGCACTAAGAT (SEQ ID NO : 85407) TGGGCTCCTCAGAGAAAATAT (SEQ ID NO : 85408) hCV25631989 CIT AAGATAAGCCTGTCACTGGTC (SEQ ID NO : 85409) AAGATAAGCCTGTCACTGGTT (SEQ ID NO : 85410) CAAGCCAGCCTAATAAACATAA (SEQ ID NO : 85411) hCV25637308 A/G CAGAAGGAAGACTACCATTAT (SEQ ID NO : 85412) CAGAAGGAAGACTACCATTAC (SEQ ID NO : 85413) CCTCCCCCTATTTATTTTTACAT (SEQ ID NO : 85414) hCV25637309 AfT GGCCACTTTGCCTGAATA (SEQ ID NO : 85415) GGCCACTTTGCCTGAATT (SEQ ID NO : 85416) CGAAATGTTCATTnTAAAGTCAGA (SEQ ID NO : 85417) hCV25640505 A/G GATGCCCAGATTCCTAA (SEQ ID NO : 85418) GATGCCCAGATTCCTAG (SEQ ID NO : 85419) GCTCCATGCCTTGATTCT (SEQ ID NO : 85420) hGV25640926 A/G GCCCAGAGACAGGAAAAT (SEQ ID N0 : 85421) GCCCAGAGACAGGAAAAC (SEQ ID NO : 85422) GCCTGCCCTCTGTTCA (SEQ ID NO : 85423) hCV25644901 A/G CAGACCTGCAGCTTCA (SEQ ID NO : 85424) AGACCTGCAGCTTCG (SEQ ID NO : 85425) TGTAACCCATCAACTCTGTTTATC (SEQ ID NO : 85426) hCV25651174 AIG CGCTGCAGGGTCAT (SEQ ID NO : 85427) CGCTGCAGGGTCAC (SEQ ID NO : 85428) CCTCCCCGCAGAGAATTA (SEQ ID NO : 85429) hCV25654217 C/G CCMTAGTCGI IGTTGG (SEQ ID NO : 85430) CCAATAGTCGTTTTTTGTTGC (SEQ ID NO : 85431) GCTGTGTGGGAAGTCAGAAC (SEQ ID NO : 85432) hCV25751017 C/A CTTATTTTCAGCGAAAGGC (SEQ ID NO : 85433) CCTTATnTCAGCGAAAGGA (SEQ ID NO : 85434) CCAATGGTCGTCATCTCC (SEQ ID NO : 85435) hCV25761292 CIG GGGCAGCTCACCTCTCTAG (SEQ ID N0 : 85436) GGGCAGCTCACCTCTCTAC (SEQ 10 NO : 85437) GAGTGACTGCCAGAATTGTCT (SEQ ID NO : 85438) hCV25922320 A/G CTCGCAGCGGTCAGT (SEQ ID NO : 85439) TCGCAGCGGTCAGC (SEQ ID NO : 85440) GCTGGCGGGAATTTCT (SEQ ID NO : 85441) hCV25922816 AfG TGGCAGTCAGGGGAT (SEO ID NO : 85442) TGGCACTCAGGGCAC (SEQ ID NO : 85443) CCAAAGAGGACTGACAACTGTA (SEQ ID NO : 85444) hCV25926178 C/G GCTTTATCAGAGACTCTGAAGC (SEQ ID NO : 85445) GCTTTATCAGAGACTCTGAAGG (SEQ ID NO : 85446) CCAAGGCCACGGATATC (SEQ ID NO : 85447) hCV25926771 CIT GGCCTTGGTCTCGC (SEQ ID NO : E5448) TGGCCTTGGTCTCGT (SEQ ID NO : 85449) TGCAGATCAGCTTGAAGAACTA (SEQ ID NO : 85450) hCV25930271 C/T GAATCTCATGTTCAGGAAATG (SEQ ID NO : 85461) CGAATCTCATGTTCAGGAAATA (SEQ ID NO : 85452) GCCATGGCCCATAAAAC (SEQ ID NO : 85453) hCV25942539 GIA GGATCCGACCGTTGAG (SEQ ID NO : 85454) GGATCCGACCGTTGAA (SEQ ID NO : 85455) TCATfTTGAACTCATTTTTTCTAGA (SEQ ID NO : E5458) TABLE 5, page 3 of 4 Marker Alleles Sequence A (allele-soecific Primer) Seauence B (allele-specific pdmer) Sefluence C (common primer) hCV25943544 C/G ATGTCCTGAAATACACGTATGAC (SEQ ID NO : 85457) ATGTCCTGAAATACACGTATGAG (SEQID NO : 85458) TCCCAACGTCAATTTCATATT (SEQID NO : 85459) hCV25956925 A/G GCTTCCCTGGGCTTCT (SEQ ID NO : 85460) CTTCCCTGGGCTTCC (SEQ ID NO : 85461) TGCTCATCATGAGTTTGAAACT (SEQIDNO : 85462) hCV25990513 G/A AGATAATCATAAGCTGGAGAACAC (SEQ ID NO : 85463) AGATAATCATAAGCTGGAGAACAT (SEQ ! D NO : 85464) TGATTATGCATCTTCTGTCTTGTAG (SEQ ID NO : 85485) hCV2715953 C/G CATTGGGGCCAATGAC (SEQ ID NO : 85466) ATTGGGGCCAATGAG (SEQ ID NO : 85467) ATGCATTTCATGTGAAAACTCT (SEQ ID NO : 85468) hCV2741051 CIi GCAGCCAGTTTCTCCC (SEQID NO : 85469) TGCAGCCAGTTTCTCCT (SEQID NO : 85470) CATGAAATGCTTCCAGGTATT (SEQID NO : 85471) hCV2741083 C/T GTTCCAACCAGAAGAGAATG (SEQiD NO : 85472) GGTTCCAACCAGAAGAGAATA (SEQID NO : 85473) CTTGCCCCCAACAGTTAG (SEQ ID NO : 85474) hCV276û554/VG TCCGTTGTTCTCAGGGAT (SEQ ID NO : 85475) TCCGTTGTTCTCAGGGAC (SEQ ID NO : 85476) GGTTCCTGGAGGCATGTC (SEQ ID NO : 85477) hCV2782570 A/G CCAGCAAACTATGATGAATAAT (SEQ ID NO : 85478) CCAGCAAACTATGATGAATAAC (SEQ ID NO : 85479) TGGGATGACTCTAGCCACTTAC (SEQ ID NO : 85480) hCV2811372 AUG CAGCTGGACGACGAACA (SEQ ID NO : 85481) AGCTGGACGACGAACG (SEQ ID NO : 85482) CGGCTCTCCTTGATGAG (SEQ ID NO : 85483) hCV2983035 A/G TTGGACCCTCACATGAAA (SEQ ID NO : 65484) TTGGACCCTCACATGAAG (SEQ ID NO : 85485) GCCATTTTCCACAATAAATATTT (SEQ ID NO : 85486) hCV2992252 T/C CCCTGTGATTGGCCAT (SEQ) D NO : 85487) CCCTGTGATTGGCCAC (SEQ ID NO : 85488) CCTGCTCGCTCTGTCAC (SEQ ID NO : 85489) hCV3020386 G/T AGAATTGTGTCCAAAGAAGTTG (SEQ ID NO : 85490) AAGAATTGTGTCCAAAGAAGTTT (SEQ ID NO : 85491) AACTGGTATAATTTGAATCACATAAAT (SEQID NO : 85492) hCV3023236 A/G CAGTTGGTTTTGTGGT (SEQ ID NO : 85493) AGTTGGTTTTGTGGC (SEQ ID NO : 85494) TGCTTCGTGGAGGTCAAT (SEQ ID NO : 85495) hCV3026206 C/G CCGTCTGGTAATTGTCCAC (SEQ ID NO : 85496) CCGTCTGGTAATTGTCCAG (SEQ ID NO : 85497) TCAAGCCCTTGGCTAAGA (SEQ ID NO : 85498) hCV3084793 CrF CCCGGCTGGGCGCGGACATGGAGGACGTTC (SEQIDNO : 85499) CCCGGCTGGGCGCGGACATGGAGGACGTTT (SEQ ID NO : 85500) CAGCTTGCGCAGGTG (SEQ ID NO : 85501) hCV3112686 CIG ACTTTGCTTCCCGAAGATAG (SEQ ID NO : 85502) ACmGCTTCCCGMGATAG (SEQ ID NO : 85503) TCACCGCTCCACAGACTT (SEQ ID NO : 85504) hCV3135085 GrT CTGGAAATGGTTATGGGC (SEQ ID NO : 85505) TACTGGAAATGGTTATGGGA (SEQ ID NO : 85506) TTTATAGGCGTGAAACTAATTCTC (SEQ ID NO : 85507) hCV3187716 A/C CCTTCAATTCTGAAAAGTAGCTAAT (SEQ ID NO : 85508) CCTTCAATTCTGAAAAGTAGCTAAG (SEQ ID NO : 85509) TTTGAGGTTGAGTGACATGTTC (SEQ ID NO : 85510) hCV3210838 crr CTGCATTATTTCTATGACGC (SEQ ID NO : 85511) TTCTGCATTATTTCTATGACGT (SEQID NO : 85512) CAAAAAATGCCAACAGTTTAGA (SEQ ID NO : 85513) hCV3212009 A/G GTTCTCCCCTTTCAGTGTCT (SEQ ID NO : 85514) TCTCCCCTTTCAGTGTCC (SEQID NO : 55515) TGTCGGTGACTGTTCTGTTAA (SEQID NO : 85516) hCV3215409 A/G GTGGCTCATTACCAATCTCTT (SEQID NO : 85517) GTGGCTCATTACCAATCTCTC (SEQ ID NO : 85518) GGGCTCCATCAACATCAC (SEQ ID NO : 85519) hCV3223182 C/T TCGCAACTCACATCACTG (SEQ ID NO : 85520) GTCGCAACTCACATCACTA (SEQ ID NO : 85521) AGTTCTTGGAGGCATCTCAT (SEQ ID NO : 85522) hCV3275199 AUG CCATGCAACCAAACCAT (SEQ ID NO : 85523) CCATGCAACCAAACCAC (SEQ ID NO : 85524) CCTCTCATCCCTCTCATCTTT (SEQID NO : 85525) hCV334226 A/G GAGCCTGGGCCAAAT (SEQ ID NO : 85526) GAGCCTGGGCCAAAC (SEQ ID NO : 85527) CCTAAGAGGCTGGAAAGATAGAG (SEQ ID NO : 85528) hCV517658 T/C AATGGCCTTGGACTTGAT (SEQ ID NO : 85529) AATGGCCTTGGACTTGAC (SEQ ID NO : 85530) CTCTGCCATGCAAAACAC (SEQ ID NO : 85531) hCV529706 C/G GCGAGGACGAAGGGG (SEQ ID NO : 85532) GCGAGGACGAAGGGC (SEQ ID NO : 85533) GGAGGATGAATGGACAGACAA (SEQIDNO : 85534) hCV529710 CIG CCGACCCGAACTAAAGG (SEQ ID NO : 85535) CCGACCCGAACTAAAGC (SEQ ID NO : 85536) CGCGTTCCCCATGTC (SEQ ID NO : 85537) hCV549926 C/T ACCATGBTCACCCTGB (SEQ ID NO : 85538) CACCATGGTCACCCTGA (SEQ ID NO : 85539) GGACTGAAAGCAATGTGAGAG (SEQ ID NO : 85540) hCV5687 A/G GCCCTCAGTGTGACTGAGAT (SEQ ID NO : 85541) GCCCTCAGTGTGACTGAGAC (SEQID NO : 85542) CCAGGCATTTCCCATACAG (SEQ ID NO : 85543) hCV57888 A/G GCATAAAGCCAAGGTAGAAA (SEQ ID NO : 85544) GCATAAAGCCAAGGTAGAAG (SEQ m NO : 85545) CCACTGGAACACTCACACAT (SEQ ID NO : 85546) hCV600632 A/C CGTCAATGCCCTCATCT (SEQID NO : 85547) GTCAATGCCCTCATCG (SEQID NO : 85548) GAGACTGCGATGTCTGAATAGT (SEQ ID NO : 85549) hCV7429784 A/G GGGTCATGGTACTCAATGAA (SEQ ID NO : 85550) GGGTCATGGTACTCAATGAG (SEQ ID NO : 85551) TGTACAAAAATGTTGTCACATACAG (SEQ ID NO : 85552) hCV7443062 T/C GGAGCAGGATGGTGAT (SEQ ID NO : 85553) GGAGCAGGATGGTGAC (SEQ ID NO : 85554) GGAAATATCTCGTTCTTGTTCTCT (SEQ ID NO : 85555) hCV7449808 A/G GGCTTACCTGGCCCAGT (SEQ ID NO : 85556) GCTTACCTGGCCCAGC (SEQ ID NO : 85557) CCTTCAGCCTCCAACATGA (SEQ ID NO : 85558) hCV7481138 A/C CGGATCTCTCGCAA (SEQ ID NO : 85559) CGGATCTCTCGCAC (SEQ ID NO : 85560) TGGAGGAGGTGATTCA (SEQ ID NO : 85561) hCV7490135 CIT GCAGTCCTGAACAAAGTAGATG (SEQ ID NO : 85562) CGCAGTCCTGAACAAAGTAGATA (SEQ ID NO : 85563) CGTGCATGTTTTGAAAAATGTA (SEQ ID NO : 85564) hCV7492597 CIT TACCTGAGCCAGTTGCAC (SEQ ID NO : 85565) TACCTGAGCCAGTTGCAT (SEQ ID NO : 85566) GGCTTCAGCTGAAGAAAGAG (SEQ ID NO : 85567) hCV7492601 T/A AAGGAGGTCTGCCTAAGGA (SEQ ID NO : 85568) AAGGAGGTCTGCCTAAGGT (SEQ ID NO : 05569) TACCTGCCTTTAAAGAACATTACT (SEQ ID NO : 85570) hCV7494810 C/G CCCGAGCGGACAGTG (SEQ ID NO : 85571) CCCGAGCGGACAGTC (SEQ ID NO : 85572) CAACTGCTGGCAGAATCTTC (SEQ ID NO : 85573) hCV7499900 T/C CACACCAGCAATGATGAAACT (SEQ ID NO : 85574) CACCAGCAATGATGAAACC (SEQ ID NO : 85575) GGCGGGTTCCAGACAA (SEQ ID NO : 85576) hCT7509650 CIT GCTCAGGACTATCTGCAGTG (SEQ ID NO : 85577) GGCTCAGGACTATCTGCAGTA (SEQ ID NO : 65578) TCCAAGCATGACTTCAGATTC (SEQ ID NO : 85579) hCV7514692 A/C GCCCCAACACCAGAGAA (SEQ ID NO : 85580) GCCCCAACACCAGAGAC (SEQ ID NO : 85581) CCACCACCACTCACCAGA (SEQ ID NO : 85582) hCV7514879 A/G GGCTGAACCCCGTCCT (SEQ ID NO : 85583) GCTGAACCCCGTCCC (SEQ ID NO : 85584) C s CCTGCATCCTGTCT (SEQ ID NO : 85585) hCV7580070 C ! f TCCCATGCTTAAGGAAATG (SEQID NO : 85586) GATCCCATGCTTAAGGAAATA (SEQ ID NO : 85587) TGAGTGTACAATTCTAATTCTCAGACT (SEQID NO : 85588) hCV7582933 CIT CCAAAGGGTGTCAAGGC (SEQ ID NO : 85589) TCCAAAGGGTGTCAAGGT (SEQ ID NO : 85590) GCTGCTGGAATATGTTTGAGA (SEQ ID NO : 85591) hCV761961 crr CACAGTCAAAGAATCAAGCG (SEQ ID NO : 85592) TCACAGTCAAAGAATCAAGCA (SEQ ID NO : 85593) AAATTCTTACCCTGAGTTCAGTTC (SEQ ID NO : 85594) hCV7686234 CIT GAGCGCTCTTTCTTGAC (SEQ ID NO : 85595) GAGCGCTCTTTCTTGAT (SEQ ID NO : 85596) GCGGAGGCCCTCTGTA (SEQ ID NO : 85597) hCV7798230 GIC GAGCGAGGGCTCAGG (SEQ ID NO : 85598) GAGCGAGGGCTCAGC (SEQ ID NO : 85599) CCTCCCTGGAGAATACTGTG (SEQ ID NO : EssoD) hCV783184 Grr TGCGAGTCAAATCTCAAGAC (SEQ ID NO : 85601) TGCGAGTCAAATCTCAAGAA (SEQ ID NO : 85602) CCTATTCCCGGCACTTCT (SEQ ID NO : 85603) hCW841642 AIG ACCAGCTCCAGGGTGTT (SEQ ID NO : 85604) ACCAGCTCCAGGGTGTC (SEQ ID NO : 85605) TGAAGTMGGAATGAGACTGAT (SEQ ID NO : 85606) hCW900503 (yr CGTCTCCABGAAAATCATAAC (SEQ) D NO : 85607) CGTCTCCAGGAAAATCATAAT (SEQ ID NO : 85608) TGAGTTATTGCTACTTCAGAATCAT (SEQ ID NO : 85609) hCV791476 GT CAGAAAGTTCATGGTTTCG (SEQ ID NO : 85610) GCAGAAAGTTCATGGTTTCA (SEQ ID NO : 85611) CCGGGGAGGAAGAGTAG (SEQ ID NO : 85612) hCV795442 AIG CCATTCAATGCAATACGTCA (SEQ ID NO : 85613) CATTCAATGCAATACGTCG (SEQ ID NO : 85614) CCTCTCCTTCCAGAACCAGT (SEQ ID N0 : 65615) hCV8022252 AUG CACTGGTCTCAGATGTGATGT (SEQ ID NO : 85616) ACTGGTCTCAGATGTGATGC (SEQ ID N0 : 85617) GGGCTGGCAGGGTATAG (SEQ ID NO : E5616) hCV8339791 C/T TTCTACAACGTGGACATGG (SEQ ID NO : 85619) ACTTCTACAACGTGGACATGA (SEQ ID NO : 85620) GCCTGCCACTCACATTACA (SEQ ID NO : 85621) hCT8400571 A/G TTGTTAACATATACTTACTGGAGA (SEQID NO : 85622) TGTTAACATATACTTACTGGAGG (SEQ ID NO : 85623) TGCCTCTTCTTTATTTATGTC (SEQID NO : 85624) hCV8705506 C/G CCACTTCGGGTTCCTC (SEQ ID NO : 85625) CCACTTCGGGTTCCTG (SEQ ID NO : 85626) CCCTGGCTTCAACATGA (SEQ ID NO : 85627) hCV8708473 AlG GCAACAGGACACCTGAA (SEQ ID NO : 85628) GCAACAGGACACCTGAG (SEQ ID NO : 85629) GAGTGACAGGAGGCTGCTTA (SEQ ID NO : 85630) hCV8718197 AIG CCTCTGAGGCCTGAGAAA (SEQ ID NO : 85631) CCTCTGAGGCCTGAGAAG (SEQ ID NO : 85632) GTCCTGATTCCTCATTTCTTTC (SEQ ID NO : 85633) hCV8722981 CIT GCGCTGGTTTGGAGG (SEQ ID NO : 85634) GCGCTGGTTTGGAGA (SEQ ID NO : 85635) TGGCACAGGCAGTATTAAGTAG (SEQ ID NO : 85636) hCV8726331 AUG TGGTCTGTTCCCTGGACA (SEQ ID NO : B5637) GGTCTSTTCCCTGGACG (SEQ ID NO : 8563B) TGCGGTCACACTGACTGAG (SEQ ID NO : 85639) TABLE 5, page 4 of 4 Marker Alleles Sequence A (allele-soecific primer) Seauence B (allele-soeciFc orimer) Se_4uence C (common ormer) hCV8726337 AVG CACATTCACGGTCACCTT (SEQID NO : 85640) CACATTCACGGTCACCTC (SEQ ID NO : 85641) CATTGCCCGAGCTCAA (SEQ ID NO : 65642) hCV8737990 CIT GTCCTTGCMGTATCCG (SEQ ID NO : 85643) GGTCCTTGCAAGTATCCA (SEQ ID NO : 85644) GCACTACAGCTGAGTCCTTTTC (SEQ ID NO : 85645) hCV8815434 G/T GGTGGTCCCTTTGG (SEQ ID NO : 85646) ACGGTGGTCCCTTTGT (SEQ ID NO : 85647) CCTCGCAGGCCTTCTC (SEQ ID NO : 85648) hCV8827241 C/G TCAAGAGGACAGTGATGGTG (SEQ ID NO : 85649) TCAAGAGGACAGTGATGGTC (SEQ ID NO : 85650) TGGTTAGAATCTGTGAAGGAACTA (SEQ ID NO : 85651) hCV8849004 A/G AGAGAGTGCACAGTAGATGT (SEQ ID NO : 85652) GAGAGTGCACAGTAGATGC (SEQ ID NO : 85653) AAACCTGAGTTTTAACTTGGTGA (SEQ ID NO : 85654) hCV8851080 A/G GGCACTGCCCGCTT (SEQ ID NO : 85655) GGCACTGCCCGCTC (SEQ ID NO : 85656) CGCTTCCTGGAGAGATACATC (SEQ ID NO : 85657) hCV8851084 AIG CAGTGCCGGACAGGA (SEQ ID NO : 85658) CAGTGCCGGACAGGG (SEQ ID NO : 85559) CCGCCCGGCACTAAB (SEQ ID NO : 85660) hCV8851085 A/G GCTCGTAGTTGTGTCTGCAT (SEQ ID NO : 85661) GCTCGTAGTTGTGTCTGCAC (SEQ ID NO : 85662) CGCTTCCTGGAGAGATACAT (SEQ ID NO : 85663) hCV8895373 A/G AGGACTTCCGTGTCTT (SEQ ID NO : 85664) AGGACTTCCGTGTCTC (SEQ ID NO : 85665) ACAGATGCCAGCAATACAGA (SEQ ID NO : 85666) hCV8907537 C/G GCCTATCCATCCTGCC (SEQ ID NO : 85667) GCCTATCCATCCTGCG (SEQ ID NO : 85668) GGTAGGAGAGCACTGAGAATACT (SEQ ID NO : 85669) hCV8921137 AFT CAGAGCCTGCACATCAAT (SEQ ID NO : 85670) CAGAGCCTGCACATCAAA (SEQ IDNO : 85671) GGCAAGGTCTCTGATCTGTAA (SEQ ID NO : 85672) hCV8921288 C/A CCGCAGAGGTGTGGG (SEQ ID NO : 85673) CCGCAGAGGTGTGGT (SEQ ID NO : 85674) CATITfGCGGTGGAAATG (SEQ ID NO : 85675) hCV8931357 AIG TTATTGACACTTTCCAGTAAATAATT (SEQ ID NO : 85676) TTATTGACACTTTCCAGTAAATAATC (SEQ ID NO : 85677) AGGCACAAGCTGCAGATAA (SEQ ID NO : 85678) hCV8952817 C/G CGCATCCAGAACATTCTATG (SEQ ID NO : 85679) CGCATCCAGAACATTCTATC (SEQ ID NO : 85680) GCAGCTTCCCATCATACACT (SEQ ID NO : 85681) hCV905013 G/T ACACCTCGCCCAGTAATC (SEQ ID NO : 85682) GACACCTCGCCCAGTAATA (SEQ ID NO : B56B3) CCCCCTCTCCAGATTACATT (SEQ ID NO : 85684) hCV9077561 G/A AGAAGGTGGGATCCAAAC (SEQ ID NO : 85685) AGAAGGTGGGATCCAAAT (SEQ ID NO : 85686) AGAAACCATCATGCTGAGGT (SEQ ID NO : 85687) hCV9485713 T/C GCCCAGAGACAGGAAAAT (SEQ ID NO : 85688) GCCCAGAGACAGGAAAAC (SEQ ID NO : 85689) GCCTGCCCTCTGTTCA (SEQ ID NO : 85690) hCV9506149 AfT CTGCTGGCCGTCCT (SEQ ID NO : 85691) TGCTGGCCGTCCA (SEQ ID NO : 85692) ACTCACGCTTGCTTTGACT (SEQ ID NO : 85693) hCV9546471 A/C CTCAGGAAGCTAAAAGGTGA (SEQ ID NO : 85694) TCAGGAAGCTAAAAGGTGC (SEQ ID NO : 85695) CCTAATATCCCCTCCAGAACTAT (SEQ ID NO : 85696) hCV9546517 G/A ACATTTCAGAACCTATCTTCTTC (SEQ ID NO : 85697) ACATTTCAGAACCTATCTTCTTT (SEQ ID NO : 85698) AGTTCATATGGACCAGACATCA (SEQ ID NO : 85699) hCV9698595 A'GCTGGTCATCCTCATCCA (SEQ ID NO : 85700) TGCTGGTCATCCTCATCCT (SEQ ID NO : 85701) ACCGTCCTGGCTTTTAAAG (SEQ ID NO : 85702) TABLE 6, page 1 of 7 Significant Associations Between SNP Genotypes and Qualitatlve Phenotypes Overall'SNP Effect"Placebo Patients Odds Ratio (95% Cl) ChfSquareTest Chi-SquareTest n/total (%) 2RareAllelesvs. 0 1 Rare AlIele vs. 0 Significance Public Ma-Icer Sfratum Phenotvoe statlstic pvane stalisltc o-value D Rare Alleles RareTAIIeies 2 Rare Alleles Rae Alleles Rare Alleles level ACACB hCV16166043 All Patients Fatal Coronary Heart Disease 7. 5339 0. 0231 6. 6562 0. 0099 34/989 (3. 4%) 17/432 (3. 9%) 543 (11-6%) 1. 15 (0. 62 to 2. 05) 3. 70 (1. 22 to 923) p < 0. 05 ACACB hCV16166043 Ail Patients Coronary Artery Bypass or Revasculartzatlon 10. 3188 0. 0057 9. 2088 0. 0023 2lé/989 (21. 8%) 64/432 (14. 6%) 9/43 (14. 0%) 0. 62 (0. 46tu0. 84) 0. 58 (022 to 1. 30) p<0. 005 ACACB hCV16166043 Ail Patients Hosp. for Unstable Ang (na 13. 330S 0. 0013 9. 466 0. 0021 201/999 (20. 3%) 58/432 (13. 4%) 3343 (7. 0%) 0. 61 (0. 44 in 0. 83) 0. 29 (0. 07 to 0. 82) p < 0. 005 ACACB hCV16166043 Ail Patients Family Htstory of CV Dfsease 8. 0471 0. 0179 6. 7129 0. 0096 430/989 (43. 5%) 156/432 (36. 1%) 14143 (32. 6%) 0. 74 (0. 68toO. S3) 0. 63 (0. 32 to 1. 18) p 0. 05 ACE hCV11942529 All Patients Fatal Coronary Heart Dfsease 14. 0826 0. 0009 5. 2478 0. 022 54/1454 (3. 7%) 2/18 (11. 1%) 1l2 (50. 0%) 3. 24 (0. 51 to 11. 78) 25. 93 (1. 02 to 660. 87) p < 0. 05 ACE hCVt 1942529 All Palients Cardtovascuiar Mortality 12. 0994 0. 0024 4. 8517 0. 0276 61/1454 (4. 2%) 2/18 (11. 1%) 112 (50. 0%) 2. 86 (0. 45 to 10. 34) 22. 84 (0. 90toS81-53) p<0. 05 ACE hCV11942529 AII Pa9ents Fatal AtherosclemUc Cardlovascular Disease 12. 0994 0. 0024 4. 8517 0. 0276 61/1454 (4. 2%) 2/18 (11. 1%) 1/2 (50. 0%) 2. 86 (0. 45 to 10. 34) 22. 84 (0. 90 to 581. 53) p < 0. 05 ADAMTS1 hCV529706 All Patlenis Fatal CHD/Definite Non-fatal MI 7. 3723 0. 0251 6. 6766 0. 0103 62/872 (10. 6%) 78/611 (15. 3%) 14fed (15. 6%) 1. 53 (1. 10 to2. 11) 1. 56 (0. 82 to 2. 79) p < 0. 05 ADAPTS1 hCV529706 All Patients Fatal Coronary Heart Disease 7. 4845 0. 0237 7. 1633 0. 0074 24/872 (2. 8%) 29/511 (5. 7%) 4/90 (4. 4%) 2. 13 (1. 23 to 3. 72) 1. e4 (0. 48 to 4. 38) p < 0. 05 ADAMTS1 hCV529706 All Patients Total Modality 12. 4705 0. 002 12. 00290. 0005 40/872 (4. 6%) 48/5in (9. 4%) 6190 (6. 7%) 2. 16 (1. 40 to 3. 34) 1. 49 (0. 55 to 3. 36) p < 0. 005 ADAMTS7 hCV529706 Ali Pat(entS Cardiovascula Mortality 10. 455 0. 0054 9. 947 0. 0016 26/872 (3. 0%) 34/511 (0. 7%) 4790 (4. 4%) 2. 32 (1. 38 to 3. 94) 1. 51 (0. 44 to 4. 00) p<0. 005 ADAPTS1 hCV529706 Ali Patients Fatal Atharosclerotic Cardlovascuiar D (sease 10. 456 0-0064 9. 947 0. 0016 26/872 (3. 0%) 34/511 (6. 7%) 4/90 (4. 4%) 2. 32 (1. 38 to 3. 94) 1. 51 (0. 44 to 4. 00) p<0. 005 ANXA9 hCV8022252 Ail Paltents Hosp. for Unstable Angina 8. 1528 0. 017 4. 6114 0. 0318 179/1089 (16. 4%) 75/353 (212%) 10132 (31. 3%) 1. 37 (1. 01to1. 85) 2. 31 (1. 03 to 4. 84) p < 0. 05 ANXA9 hCV8022252 Ail Patients CARE MI : NonQ-WaveM ! 10373 0. 0057 9. 0759 0. 0026 9311089 (8. 5%) 31/352 (8. 0%) B/32 (25. 0%) 1. 03 (0. 67 to 1. 57) 3. 57 (1. 47 to 7. 85) p < 0. 005 APOA4 hCV11482766 Ail Paltents FafaI/Non-fatal Cerebrovascular Disease 7. 0664 0. 0292 6. 169 0. 013 72N1106 (6. 5%) 23/347 (6. 6%) 5/25 (20. 0%) 1. 02 (0. 62 to 1. 63) 3. 59 (1. 17 to 9. 17) p<0. 05 APOA4 hCV11482766 All Pallenis Any Report of 5lroke During CARE 9. 6951 0. 0078 7. 46 0. 0063 4311106 (3. 9%) 12/347 (3. 5%) 4/25 (16. 0%) 0. 89 (0. 44 to 1. 65) 4. 71 (1. 33 to 13. 04) p<0. 05 APOA4 hCV11482766 All PaItenLS 1st Stroke Occurred During CARE 11. 7036 0. 0029 9. 2108 0. 0024 36/1106 (3. 3%) 12/347 (3. 6%) 4/26 (16. 0%) 1. 07 (0. 53 to 2. 01) 5. 66 (1. 59 to 15. 83) p < 0. 005 APOC3 hCV8907537 All Patients FataVNon-fatal Cerebrovascular Disease 13. 3844 0. 0012 9. 6921 0. 0019 75/1211 (6. 2%) 21/255 (8, 2%) 4/13 (30. 8%) 1. 36 (0. 80to2. 21) 6. 73 (1. 79 to 21. 19) p 0. 005 APOE3 hCV8907537 All Paltents FataI/Non-fatal Alherosclerotic CV Disease 7. 2676 0. 0264 4. 0221 0. 044A 48611211 (40. 1*4) 89/255 (34. 9%) 9/13 (69. 2%) 0. 80 (0. 60 to 1. 06) 3. 36 (1. 09to12. 44) p<0. 05 APOC3 hCV8907537 AlI Patients Nlstory of Percutaneous Transluminal Coronary Angioplasty 6. 1599 0. 046 5. 9094 0. 0151 375/1211 (31. 0%) s9/255 (38. 8%) 5113 (38. 5%) 1. 42 (1. 07 to'1. 87 1. 39 (0. 42 to 420) p 0. 05 APOC3 hCV8907537 All Pa4ents Any Report of Stroke Prior to or Dudng CARE 6. 6883 0. 0353 5. 5134 0. 0189 7111211 (5. 9%) 16) 255 (6-3%) 3/13 (23. 1%) 1. 08 (0. 59tu1. 83) 4. 82 (1. 06 to 16. 16) p < 0. 05 APOC3 hCV8907537 All Palfents Any Report af Stroke During CARE 12. 4845 0. 0019 9. 0194 0. 0027 4611211 (3. 8%) 10/255 (3. 9%) 3/13 (23. 1%) 1. 03 (0. 49to1. 99) 7. 60 (1. 66 to 25. 83) p<0. 005 APOC3 hCVB907537 All Palfents st Stmke Occurred Dur (nA CARE 15. 0987 0. 0005 10. 5154 0. 0012 3911211 (3. 2%) 10255 (3. 9%) 3/13 (23. 1%) 1. 23 (0. 57 to 2. 40) 9. 02 (1. 97 to 30. B5) P 0. 005 APOE hCV3084793 All Paltents FataI/Non-fatal Cerebrovascular Disease 6. 6129 0. 0385 5. 792 0. 0161 7011074 (6. 5%) 24/368 (6. 5%) 6/34 (17. 6%%) 1_00 (0_61 to 1. 59) 3. 07 (1. 1210 720) p < 0. 05 CASP1 hCV16276495 All Palients Fatal CHDlOettntte Non-fat21 MI 71. 6894 0. 0006 11. 4335 0. 0007 132/1167 (11. 1%) 53/285 (18. 6%) 0/0 (0. 0%) 1. 83 (1. 28 to 2. 50) p 0. 006 CASP1 hCV16276495 AII Pailents Fatal Coronary Heart Disease 7. 4141 0. 0065 7. 0957 0. 0077 3811187 (32%) 19/285 (6. 7 %) 0/0 (0. 0%) 2. 16 (1. 20to3. 76) p<0. 05 CASP7 hCV16276495 All Palients Non-fatal MI (def & prob) 7. 3586 0. 0067 7. 2496 0. 0071 134/1187 (11. 3%) 49/285 (17. 2%) 0/0 (0. 0%) 1. 63 (1. 13 to 2. 32) p < 0. 05 CASP1 hCV16276495 All Palients FataVNon-fatal MI (def & pmb) 10. 8754 0. 001 10. 672 0. 0011 14811187 (12. 5%) 57/285 (20. 0%) 0/0 (0. 0%) 1. 76 (1. 25 to 2. 45) p<0. 005 CASP7 hCV16270495 AII Paftents Cardfovascular Mortaiity 6. 0571 0. 0139 5. 858 0. 0166 44N1187 (3. 7%) 201286 (7. 0%) 0/0 (0. 0%) 1. 96 (1. 12 t 3. 34) p < 0. 05 CASP1 hCV16276495 All Patients Fatal Atherosclerotic Cardovascular Disease 6. 0571 0. 0139 5. 858 0. 0155 4411187 (3. 7%) 20/285 (7. 0%) 0/0 (0. 0%) 1. 96 (1. 12 to 3. 34) p < 0. 05 CCR5 hCV9698595 All Patients Fatal CHDIDeHnite Non-fatal MI 9. 0507 0. 0108 4. 5709 0. 0325 17711398 (12. 7%) 5/61 (82 %) 2I3 (66. 7%) 0. 62 (0. 21 to 1. 42) 13. 79 (1. 32 to 297. 56) p < 0. 05 CCR5 hCV969B595 All Patients Fatal Coronary Heart Disease 7. 7729 0. 0205 4. 1219 0. 0423 5511398 (3. 9%) 1/61 (1. 8%%) 1l3 (33. 3%) 0. 41 (0. 02 to 1. 90) 12. 21 (0. 56 to 12927) p < 0. 05 CCR5 hCV9698595 All Patients FataUNon-fatal MI (deF & prob) 7255 0. 0266 4. 1925 0. 0406 19511398 (13. 9%) 7/61 (11. 5%) 213 (66. 7%) 0. 80 (0. 33 to 1. 67) 12. 34 (1. 18 to 266. 05) p < 0. 05 CCR5 hCV9698595 All Patients More Than I Prior MI 7. 4573 0. 024 3. 9999 0. 0458 20511398 (14. 7%) 12/61 (19. 7%) 213 (66. 7%) 1. 43 (0. 71 to 2. 64) 11. 62 (1. 11 to 250. 94) p 10. 05 CCRL2 hCV256373D8 Ail PaOents Fatal CHDfDeMite Non-fatal MI 9. 2116 0. 01 6. 3488 0. 0117 151f1278 (11. 8%) 29/184 (15. 8%) 5114 (35. 7%) 1. 40 (0. 89 to 2. 12) 4. 15 (1. 26 to 12. 17) p < 0. 05 CCRL2 hCV25637309 All Pattents Fatal CHD/Oefinite Non-fatal Mi 8. 5218 0. 0141 7. 8587 0. 0051 751531 (14. 1%) 92/689 (13. 4%) 17/244 (7. 0%) 0. 94 (0. 68 to 1. 30) 0. 46 (0. 26 to 0. 77) p<0. 05 CCRL2 hCV25637309 AII Palients FataIINon-fatal MI (def & prob) 7. 0061 0. 0301 5. 4247 0. 0199 78f531 (14. 7%) 105/689 (152%) 211244 (S. 6Y) 1. 04 (0. 76 to 1. 44) 0. 55 (0. 32to0. 89) p<0. 05 CD44 hCV25593221 Ali Patlents FataUNon-fatal Cerebrovascular Disease 6. 5508 0. 0105 5. 9272 0. 0149 9411446 (6. 5%) 6/34 (17. 6%) 0/0 (0. 0%) 3. 08 (1. 13 to 7. 15) p<0. 05 CD44 hCV25593221 All PaBents Any RepoA of Stroke Prior to or udng CARE 4. 5325 0. 0393 4. 1751 0. 041 8511446 (5. 9%) 5134 (14. 7%) 0/0 (0. 0%) 2. 76 (0. 92to6. 74) p<0. 05 C44 hCV25593221 All Paltents Any Report of Stroke During CARE 5. 6006 0. 019 4. 8895 0. 027 5511446 (3. 8%) 4/34 (11. 8%) 0/0 (0. 0%) 3. 37 (0. 98 to 8. 92) p < 0. 05 CD44 hCV25593221 Ail Patients 1st Stroke Occurred OunA CARE 6. 9887 0. 0082 6. 0383 0. 014 4811446 (3. 3%) 4/34 (11. 8%) 0/0 (0. 0%) 3. 88 (1. 12 to tU. 33) p<0. 05 CHUK hCV134589B Ail Patfents Hosp. for Unstable Angina 12. 3061 0. 0021 11. 583 0. 0007 511407 (12. 5%) 1361724 (18. 8%) 73/331 (22. 1%) 1. 62 (1. 15 to 2. 30) 1. 98 (1. 34 to 2. 94) p<0. 005 CHUK hCV1345898 All Patients History of Coronary Artery Bypass Graft 6. 4389 0. 04 5. 8619 0. 0155 129/407 (31. 0%) 176l724 (24. 3%) 82/331 (24. 8%) 0. 72 (0. 55 to 0. 94) 0. 73 (0. 53 to 1. 02) p < 0. 05 CHUK hCV1345898 All Patlents Family H (story of CV Disease 6. 7236 0. 0347 6. 0525 0. 0139 179/407 (44. 0%) 305l724 (421 %%) 116/331 (35. 0%) 0. 93 (0. 73 to 1. 19) 0. 69 (0. 51 to 0. 93) p < 0. 05 COL6A2 hCV2811372 All Patients Non-fatal MI (def & prob) 7. 6547 0. 0218 6. 8555 0. 0088 541372 (14. 5%) 1001755 (13. 2%) 29/352 (8. 2%) 0. 90 (0. 63 to 1. 29) 0. 53 (0. 33 to 0. 85) p < 0. 05 COL6A2 hCV28111372 All Patients FatallNon-fatal MI (def & prob) 7. 0498 0. 0295 6. 1008 0. 0135 591372 (15. 9%) 1121755 (14. 8%) 341352 (9. 7%) 0. 92 (0. 66 to 1. 31) 0. 57f0. 3Bto0. 88) p<0. 05 COL6A2 hCV2811372 All Patients CARE MI : Non Q-Wave MI 6. 441 0. 0399 5. 9297 0. 0149 40f372 (10. 8%) 72l754 (9. 5%) 20/352 (5. 7%) 0. 88 (0. 59 to 1. 33) 0. 50 (0. 28 to 0. 86) p < 0. 05 CTSB hCV8339791 All Patients Fatal Coronary Heart Disease 7. 8799 0. 0194 6. 4458 0. 0111 41/1107 (3. 7%) 12/340 (3. 5%) 4/29 (13. 8%) 0. 95 (0. 47 to 1. 78) 4. 16 (1. 19 to 11. 34) p<0. 05 CTSB hCV8339791 All Patients Cardiovascular Morlaiity 11. 9462 0. 0025 9. 3211 0. 0023 46tri 107 (4. 2%) 13/340 (3. 8%) 5/29 (172%) 0. 92 (0. 47 to 1. 67) 4. 81 (1. 56 to 12. 23) p < 0. 005 CTSB hCV8339791 All Patients Fatal Atherosclerotic Cardiovascular ISease 11. 9462 0. 0025 9. 3211 0. 0023 4bit 107 (4. 2%) 131340 (3. 8%) 529 (17. 2%) 0. 92 (0. 47 to 1. 67) 4. ai (1. 56 to 12. 23) p<0. 006 CUBN hCV3135085 All Patients Congestive Heart Failure 6-8723 0. 0322 6. 4807 0. 0109 38/636 (6. 0%) 521629 (8. 3%) 22/191 (11. 5%) 1. 42 (0. 92 to 2. 20) 2. 05f1. 1Bto3. 53) p < 0. 05 CUBN hCV3135085 All Patients History of Diabetes 11. 8699 0. 0026 11. 07730. 0009 751r. 36 (11. 8%) 100/629 (15. 9N) 41N91 (21. 5) 1. 41 (1. 03 to 1. 96) 2. 05 ; 1. 33to3. 10) p<0. 005 CUBAN hCV3135085 All Patients Insulin 11. 1304 0. 0038 10. 0331 0. 0015 91636 (1. 4%) 191629 (3. 0%) 111191 (5. 8%) 2. 17 (1. 00 to 5. 07) 4. 26 (1. 74 to 10. 71) p<0. 005 CX3CRI hCV5687 All Patients HDsp. for Cardiovascular Disease 15. 5209 0. 0004 13. 3955 0. 0003 458f1000 (45. 8%) 2001427 (46. 8%) 31/40 (77. 5%) 1. 04 (0. 83 to 1. 31) 4. 08 (2. 00 to 9. 18) p < 0. 0005 CX3CR7 hCV5687 All Patfents Hosp. for Unstable Angina 10. 6459 0. 0049 8. 7005 0. 0032 16411000 (16. 4%) 85/427 (19. 9%) 14/40 (35. 0%) 1. 27 (0. 95 to 1. 69) 2. 75 (1. 37 tao 5. 29) p, 0, 005 CX3CR1 hCV5687 All PatfenLS Total Cardiovascular Disease Events 14. 0718 0. 0009 12272 0. 0005 47311000 (47. 3%) 205/427 (48. 0%) 31/40 (77. 5%) 1. 03 (0. 82 to 129) 3. 84 (1. 88 to 8. 64) p < 0. 005 CX3CR7 hCV5687 All Palients FataUNon-fatal Atheroscierottc CV Disease 7. 2089 0. 0272 6. 7757 0. 0092 38911000 (38. 9%) 167/427 (39. 1%) 2440 (60. 0%) 1. 01 (0. 80 to 1. 27) 2. 36 (1. 25 to 4. 57) p 0. 05 CX3CRI hCV5687 All Parents CARE MI : Q-Wave Mi 8. 8339 0. 0121 5299 0-0213 61411000 (61. 4 %) 286/427 (67. 0%) 32l40 (80. 0%) 1. 28 (1. 01 to 1. 62) 2. 52 (1. 20 to 5. 91) p < 0. 05 CX3CR1 hCV7900503 Ali Patients Fatal CHDlDefinite Non-fatal MI 9. 487 C. CD87 8. 1574 0. 0043 1101756 (14. 6%) 571606 (9. 4%) 17/105 (16. 2Y) 0. 61 (0. 43 to 0. 85) 1. 14 (0. 63 to 1. 94) p<0. 006 CX3CR1 hCV790D503 All Patients Non-fatal MI (def & prob) 11. 6633 0. 0029 7. 2394 0-0071 106/756 (14. 0%) 56/606 (9. 2%) 20/105 (19. 0%) 0. 62 (0. 44 to 0. 88) 1. 44 (0. 63 to 2. 41) p < 0. 05 CX3CR1 hCV7900503 All Patfents FaLaVNon-fatal MI (def & prob) 14. 5731 0. 0007 8. 7401 0. 0031 119/756 (15. 7%) 62/606 (10. 2-/.) 23/105 (21. 9%) 0. 61 (0. 44 to 0. 84) 1. 50 (0. 89 to 2. 45) p < 0. 005 CX3CR1 hCV7900503 All Patients Coronary Artery Bypass or Revasalarization 6. 8382 0. 0327 4. 3331 0. 0374 149/756 (19. 7%) 107/606 (17. 7%) 30/105 (28. 6%) U. 87 (0. 6610 1. 15) 1. 63 (1. 02 to 2. 55) p < 0. 05 CX3CR1 hCV7900503 All Patients Hosp. for Cardiovascular Disease 12. 0615 O. C024 9. 2554 0. 0023 354l766 (46. 8%) 2701606 (44. 6%) 66/105 (62. 9%) 0. 91 (0. 74 to 1. 13) 1. 92 (1. 27tu2. 95) p < 0. 005 TABLE 6, page 2 of 7 CX3CR7 hCV7900503 All PaUents Hosp. far Unstable Angina 7. 7014 0. 0213 7. 5098 0. 0061 125/766 (16. 5%) 109/608 (18. 0%) 29/105 (27. 6%) 1. 11 (0. 83 to 1. 47) 1. 93 (1. 19 to 3. 05) p O. 05 CX3CR1 hCV7900503 All PaOents Tota1 Coronary HeaA Disease Events 11. 1872 0. 0037 6. 8372 0. 0089 267R756 (35. 3%) 193f606 (31. 8%) 51/105 (48. 6%) 0. 89 (0. 68 to 1. 07) 1. 73 (1. 15to2. 61j p<0. 05 CX3CR1 hCV7900503 All Patients Total CardIovascularDlseas0 Events 11. 9681 0. 0025 8. 402 0. 0037 367/756 (48. 5%) 276/606 (45. 5°%) 67/105 (63. 8%) 0. 89 (0. 72 to 1. 10) 1. 87 (1. 23 to 2. 87) p<0. 005 CX3CR7 hCV7900503 NI Patients Fatal/Non-fatal Atherosciero8c CV Disease 11. 5446 0. 038 6. 4222 0. 0113 304l756 (40. 2Y)) Zol66 (36, 3) SfiI105 (53. 3%) 0. 85 (0. 68 to 1. 06) 1. 70 (1. 13 to 2. 57) p<0. 05 DBH hCV12020339 All Patients Fatal CHD/Defintte Non-fatal MI 6. 3707 0. 0414 4. 6966 0. 0304 160/1261 (12. 7%) 21/198 (10. 6%) 4/11 (36. A%) 0. 82 (0. 49 to 1. 29) 3. 93 (1. 02 to 13. 17) p < 0. 05 DBH hCV12020339 P1 PaUents Fataf Coranary Heart Dfsease 6. 4202 0. 0404 4. 5927 0. 0321 49/1261 (3. 9%) 6I198 (3. 0%) 2 (tt (182%) 0. 77 (029 to 1. 69) 5. 50 (0. 82 tu 22. 04) p<=0. 05 ELN hCV1253630 AII Patlents Fatal CHD/Deftnile Non-fatal MI 7. 0192 0. 0299 5. 8657 0. 0154 77/507 (15. 2%)) 84721 (11. 7%) 21/241 (8. 7%) 0. 74 (0. 53) 01. 03) 0. 53 (0. 31 to 0. 87) p<0. 05 ELN hCV1253630 AII Palients Non-fatai MI (def & prob) 6. 4509 0. 0397 6. 2418 0. 0125 73/57 (14. 4%) 66/721 (12. 2% y 191241 p. 9%) 0. 83 (0. 59 tao 1. 16) 0. 51 (0. 29 to 0. 85) p 0. 06 F8 hCV11359098 All Patients CARE MI : Non Q-Wave MI 11. 1257 0. 0038 7. 548 0. 006 109/1200 (9. 1%) 19/2637. 2%) 4111 (36. 4%) 0. 78 (0. 46 tao 1. 26) 5. 72 (1. 48 to 1925) p 0. 05 FGB hCV7429784 All Palients Cardiovascular Mortality 8. 2697 0. 0435 52663 0. 0217 35/1006 (3. 5%) 261418 (6. 2%) 33/40 (7. 5%) 1. 84 (1. 08to3. 09) 2. 25 (0. 53 to 6. 63) p < 0. 05 FGB hCV7429784 Ail Patlents Fatal Atherosclerofic Card (ovascular Disease 6. 2xi97 0. 0435 5. 2663 0. 0217 35/1006 (3. 5%) 26/418 (6. 2%) 3/40 (7. 5%) 1. 84 (1. OB l0 3. 09) 2. 25 (0. 53 to 6. 63) p < 0. 05 HDLf3P hGV22274624 All Patients Hosp. forUnstabteAngina 6. 3052 0. 0427 5. 2308 0. 0222 1571802 (19. 6%) 91f545 (16. 7% y 12/114 (10. 5%) 0. 82 (0. 62 to 1. 09) 0. 48 (0. 25100. 87) p 0. 06 HFE hCV1085600 All Patfents History of AnAina Pectoris 6. 147 0. 0463 5. 3105 0. 0212 199/1086 (18. 3%) 85/355 (23. 9%) 10/39 (25. 6%) 1. 40 (1. 05 to 1. 87) 1. 54 (0. 70 to 3. 10) p 4 0. 05 HFE hCV1085600 Ail Patients HSstory of Diabetes 11. 6431 0. 003 6. 3752 0. 011S 166/1086 (15. 3%) 40/355 (11. 3%) 12/39 (30. 8%) 0. 70 (0. 48 to 1. 01) 2. 46 (1. 18 tao 4. 85) p'-O. OS HLA-DPA1 hCV15760070 All Patients Tofal Mortality 6. 6793 0. 0354 6. 1772 0. 0129 57/894 (5. 7%) 29/429 (6. 8%) 8/56 (14. 3%) 1. 19 (0. 74 to 1. 88) 2. 74 (1. 16 tao 5. 78) pu 0. 05 HLA-DPAS hCV15760070 All Patients Coronary Artery Bypass or Revasculadzation 9. 3862 0. 0092 7. 003 0. 0081 200/994 (20. 1°/) 861429 (20. 0%) 2/56 (3. 6%) 1. 00 (0. 75 l01. 32) 0. 15 (0. 02 to 0. 48) p < 0. 05 HLA-DPAt hCV15760070 Atl Pattents History of Percutaneous Transluminal CoronaryAngoPasty 8. 325 0. 0156 7. 753 0. 0054 315/994 (31. 7%) 135/429 (31. 5%) 28/56 (50. 0%) 0. 99 (0. 78 to 1. 26) 2. 16 (1. 25 to 3. 71) p < 0. 05 HLA-DPBt hCV2565177A AIt Patients Non-fatal MI (def & prob) 7. 4596 0. 024 6. 6238 0. 009 981708 (139°/%) 781632 (12. 3%) 7/132 (5. 3%) 0. 88 (0. 64) 01. 20) 0. 35 (0. 14 to 0. 72) p 0. 05 HLA-DP81 hCV25651174 All Patients Coronary Artery Bypass orRevasculazation 9. 7527 0. 0076 6. 5581 0. 0104 137/708 (19. 4%) 137/632 (21. 7%) 13/192 (9. 8%) 1. 15 (0. 88 to 1. 51) 0_46 (0. 24 to 0. 80) p <0. 05 HLA-DPBi hCV25651174 A11 Patients Hosp. forCardiovascufar Disease 10. 6608 0. 0048 7. 5713 0. 0059 3341708 (47. 2%) 314/632 (49. 7%) 49/132 (34. 1%) 1. 11 (0. 89 to 1. 37) 0. 58 (0. 39 to 0. 85) p<0. 05 HLA-DPB1 hCV25651114 AII Patfents Total Coronary Heart Oisease Events 9. 49 0. 0087 9. 0492 0, 0026 258/708 (36. 4%) 225/632 (35. 6%) 30/132 (22. 7%) 0. 96 (0. 77 to 1. 21) 0. 51 (0. 33tu0. 78) p < 0. 005 HLA-DPBt hCV25651174 NI Patients Tota1 Cardiovascular Disease Events 7. 7145 0. 0211 6. 0912 0. 0136 3461708 (48. 9%) 318/932 (50. 3%) 49/132 (37. 1%) 1. 06 (0, 06 to 1. 31) 0. 62 (0. 42 to 0. 90) p<0. 05 HLA-DPBI hCV25551174 All Patients FataYNon-fatal Athemscierolic CV Disease 9. 2044 0. 01 8. 7506 0. 0031 291/708 (41. 1%) 266/632 (40. 3%) 36/132 (27. 3%) 0. 97 (0. 78 to 121) 0. 54 (0. 35 to 0. 80) p < 0. 005 HLA-DPB1 hCV8851084 Ail Pattents Tota1 Coronary HeaA Disease Events 8. S6Q3 0. 0199 7. 9839 0. 0047 342l950 (36. %) 161l465 (34. fi%) 11162 (17. 7%) 0. 94 (0. 75to1. 19) 0. 38 (0. 19 to 0. 72) p<0. 006 HLA-OPBI hCV88510B4 AII patients FataI/Non-fatal Athemscieroltc CV Disease 7. 3278 0. 0256 6. 5972 0. 0102 390/950 (41. 1 %) 178/465 (38. 3%) 15/62 (24. 2%) 0. 89 (0. 71 to 1. 12) 0. 45 (0. 26 to 0. 81) p-0. 05 HLA-pPB1 hCV88510H5 ASI Patients Comnary Artery BypaSS or Revascufanza9on 7. 4082 0. 0246 5. 7094 0. 0169 174/694 (18. 5' !.) 107/506 (21. 1%) 6/76 (7. 9%) 1. 11 (0. 86) 01. 46) 0. 36 (0. 14 to 0. 77) p O05 HLA-DPB1 hCV8851085 All Patients Hosp. for Cardiovascular ISease 7. 6098 0. 0223 7-2388 0. 0071 428/894 (47. 9%) 241/506 (47. 6%) 24176 (31. 6%) 0. 99 (0. 80 tao 1. 23) 0. 50 (0. 30 to 0. 82) p<0. 05 HLA-DPB7 hCV88510H5 All Patfents Total Cotonary Heart Disease Events 8. 0929 0. 0175 7. 7109 0. 0055 3211894 (35. 9 !) 17775U6 (35. 0%) 15176 (19. 7%) 0. 95 (0. 76 to 1. 21) 0. 44 (0. 24to0. 76) p<0. 05 HLA-DPB1 hCV8851085 All Pattents Total CardiovascularOtsease Events 6. 441 0. 0399 6. 2467 0. 0124 4411894 (49. 3%) 246/506 (48. 6%) 26f76 (34. 2%) 0. 97 (0. 78to1. 21) 0. 53 (0. 32 to 0. B7) p < 0. 05 HLA-DPSI hCV8851055 All Patients FolaUNon-fatal Athemscievolic CV Disease 8. 9261 0. 0115 8. 4377 0. 0037 367/894 (41. 1%) 197/506 (38. 9%) 18/76 (23. 7%%) 0. 92 (0. 73 to 1. 14) 0. 45 (D. 25 to D. 75) p<0. 006 HSPG2 hCV16D3656 All PatienLS Hosp. for Unsta6la Mgfna 7. 3564 0. 0253 5. 9731 0. 0145 217/1246 (17. 4% j 42/223 (18. 8%) 5110 (50. 0%) 1. 10 (0. 76to1. S7) 4. 74 (1. 31 to 17. 18) p < 0. 05 HSPC2 hCV1603655 Ail Patients History of Angina Pectoms 16. 9406 0. 0002 10. 423 0. 0012 248/1246 (19. 9%) 38/223 (17. 0%) 7/10 (70. 0%) 0. 93 (0. 56 tao 1. 19) 9. 39 (2. 59 tao 43. 80) p < 0. 005 HSPG2 hCV1603697 All Patfents CoronaryArtery Bypass or RevasculazaHon 6. 4646 0. 0395 4. 1122 0. 0426 249/1313 (19. 0°6) 36/159 (22. 6%) 3I5 (60. 0 %) 1. 25 (0. 83 to 1. 84) 6. 40 (1. 06 to 48. 5) p < 0. 05 HSP02 hCV1603697 Afl Patlents Hosp. for Unstabie Angtna 8. 9933 0. 0111 4. 6813 0. 0305 225/1313 (17. 1%) 36/159 (22. 6%) 3/5 (60. zu 1. 42 (0. 94 to 2. 09) 7. 25 (120 l0 55. 30) p < 0. 05 HSPG2 hCV1603697 Ail Patients Hfstory of Angina Pectoris 11. 8532 0. 0027 6. 1384 0. 0132 262/1313 (20. 0%) 28/159 (17. 6%) 4/5 (80. 0%) 0. 86 (0. 55 to 1. 30) 16. 03 (2. 36 to 314. 38) p 4 0. 05 HSPG2 hCV1603697 All PalteMs Htstory of Stsoke 6. 362 0. 0415 4. 1405 0. 0419 32/1313 (2. 4%%) 51159 (3. 1%) 1/5 (20. 0 %) 1. 30 (0. 44 to 3. 11) 10. 01 (0. 50 to 70. 04) p<0. 05 IGF1R hCV8722981 All Patlenis Fatal CHD/Definae Non-fatal MI 12. 0129 0. 0025 8. 8843 O. OD29 169/1418 (11. 9%) 15/59 (25-4%) 112 (50. 0%) 2. 52 (1. 33 to 4. 53) 7. 39 (0. 29 to 187. 3D) p < O. 005 IGF1 R hCV8722981 Atl Patients Fatal Comnary Heacl D (sease 11. 536 0. 0031 5. 1641 0. 0231 54/1418 (3. 8%) 2/59 (3. 4%) 1/2 (50. 0%) 0. 89 (0. 14tu2. 95) 25. 26 (0. 99to643. 88) p<0. 05 IGF1 R hCV8722981 All Pallents FataPNon-fatal MI deF & prob) 7. 2529 0. 0266 4-8925 0-027 19011418 (13. 4%) 14/59 (23. 7%) 1/2 (50. 01/.) 2. 01 (1. 05 to 3. 64) 6. 46 (0. 26 to 163. 75) p < 0. 05 IGF1 R hCV8722981 All Patients Cacdiovascuhdr Mortaltty 10. 1906 0. 0061 4. 8293 0. 028 60/1418 (4. 2%) 3/59 (5. 1%) 1/2 (50. 0%) 1. 21 (029 to 3. 41) 22. 68 (0. 89 to 576. 45) p < 0. 05 MA hCV9546471 All Patients Cardiovascular Mortality 6. 9523 0. 0309 5. 6644 0. 0173 22/739 (3. 0%) 33/584 (6. 7%) 9/144 (6. 3%) 1. 95 (1. 13 to 3. 43) 2. 17 (0. 93 to 4. 68) p < 0. 05 IL1A hCV9546471 All Pallents Fat2l AthemscletoUc Catdiovascuhar Disease 6. 9523 0. 0309 6. 6644 0. 0173 221739 (3. 0%) 33/684 (5. z 9/144 (6. 3-/) 1. 95 (1. 13 to 3. 43) 2. 17 (0. 93 to 4. 68) p < 0. 05 PLIA hCV9546471 Ail PaUents History of Congestfve Heart Failure (AE) 6. 1271 0. 0467 5. 9334 0. 0149 41/739 (5. 5%) 39/584 (6. 7%) 16/144 (11. 1%) 1. 22 (0. 77 to 1. 92) 2. 13 (1. 13 to 3. 84) p < 0. 05 IL78 hCV9546517 Ali Patients Cardiovascular Mortality 6. xi302 0. 0363 6. 0667 0. 0138 281886 (3. 2%) 30/504 (6. 0%) 5/87 (6. 7%) 1. 94 (1. 14 to 3. 30) 1. 87 (0. 62 to 4. 58) p < 0. 05 IL1B hCV9546517 All Palfentc Fafal Atheroscierotfc Cardiovascular Disease 6. 6302 0. 0363 6. 0667 0. 0138 281886 (3. 2%) 30/504 (6. 0%) 5187/5. 7% 1. 94 (1. 14to3. 30) 1. 87 (0. 62 to 4. 58) p 4 0. 05 SL4R hCV2769554 Atl Patients Fatal CHDIDeBnite Non-fatal MI 10. 0029 0. 0067 6. 8027 0. 0091 63/471 (13. 4%) 99/691 (14. 3%) 23/313 (7. 3%) 1. 08 (0. 77 to 1. 53) 0. 51 (0. 31 to 0. 84) p < 0. 05 IL4R hCV2769554 All Patients FahaVNon-fatal MI (def & prob) 8. 0376 0. 01B 7. 0306 0. 008 73/471 (15. 5%) 103/661 (14. 9%) 281313 (8. 9%) 0. 96 (0. fi9 to 1. 33) 0. 54 (0. 33 to 0. 84) p<0. 05 ITGAE hCV222T3204 AA Patfents Coronary Artery Bypass or Revaswlarization 7. 2966 0. 026 6. 6147 0. 0101 165/869 (19. 0%) 94/502 (18. 7%) 29196 (30. 2%) 0. 98 (0. 74) 01. 30) 1. 85 (1. 14 to 2. 92) p < 0. 05 ITGAE hCV22273204 All Patients Family History of CV tsease 7. 7796 0. 0204 7. 012 0. 0081 339/869 (39. 0%) 214/502 (42. 6%) 51/99 (53. 1%) 1. 16 (0. 03 to 1. 45) 1. 77 (1. 16 to 2. 71) p<0. 06 1TGB2 hCV5086055 ASI Patients FataVNon-fat21 Ce2bovasculer Oisease 6. 3122 0. 0426 4. 9703 0. 0258 401648 (6. 2%) 39/645 (6. 0%) 20/180 (11. 1%) 0. 98 (0. 62 to 1. 54) 1. 90 (1. 06 to 3. 30) p<0. 05 KL hCV2983035 All Patients Total Mortality 9. 639 0. 0081 8. 3919 0. 0036 62/1079 (5. 7%) 24/364 (6. 6%) 6/31 (19. 4%) 1. 16 (0. 70 to 1. 86) 3. 94 (1. 42 to 9. 37) p< 0. 005 1AMA2 hCV259905f 3 All Paltents CongestWe Heat Failure 7. 5478 0. 023 4. 4464 0. 035 70/1058 (6. 6%) 37/379 (9. 6%) 6/38 (15. 8%) 1. 53 (1. 00 to 2. 30) 2. 65 (0. 97 to 6. 13) p<0. 05 LAMB2 hCV25630499 AII Patients Congesttve Heart Failure 10. 1403 0. 0063 6. 2037 0. 0127 102/1351 p. 5 %) 9/117 p. 7%) 2/4 (60. 0%) 1. 02 (0. 47tu1. 97) 12. 23 (1. 46 to 102. 87) p < 0. 05 L8P hCV25617571 A11 Patients Fata ! CHDfOefinite Non-fata4 Ml 6. 4704 0. 0394 4. 2567 0. 0391 148/1262 (11. 7%) 331194 (17. 0%) 3/11 (27. 3%) 1. 54 (1. 01 to 2. 30) 2. 82 (0. 61 tao 9. 88) p<0. 06 LBP hCV25617571 AII PaBents Fatal Coronary Heat Disease 13. 1539 0. 0014 6. 9038 0. 0086 41/1262 (3. 2%) 14/194 (7. 2%) 2/11 (182%) 2. 32 (1. 20 to 4. 23) 6. 62 (0. 99 to 26. 71) p < 0. 05 LBP hCV25617571 A ! I Patients Total Mortality 7. 0693 0. 0292 4. 45BO 0. 0347 73/1262 (5. 8%) 19/194 (9. 8%) 2/11 (18. 2%) 1. 77 (1. 02 to 2. 94) 3. 62 (0. 55 to 14. 37) p<0. 05 LBP hCV25617571 AII Patients Cardiovascular Martaiity 9. 7674 0. 0076 4. 7106 0. 03 48/1262 (3. 8%) 14/194 (7. 2%) 2/11 (18. 2%) 1. 97 (1. 03 to 3. 55) 5. 62 (0. 84 to 22. 55) p 0. 05 LBP hCV256t7571 All Pattents Fatal Atherosderatic Cardlovascufar Oisease 9. 7674 0. 0076 4. 710B 0. 03 48/1262 (3. 8%) 14/194 (7. 2Y ) 2/11 (18. 2%) 1. 97 (1. 03 to 3. 55) 5. 62 (0. 84 to 22. 56) p < 0. 05 LPA hCV25930271 All PaBents FaIaI/Non-falal Cerebrovascular Disease 6. 1113 0. 0134 5J793 0. 0162 89N393 (6. 4% 7 10/72 (13. 9%) 0/0 (0. 0%) 2. 36 (1. 11 to 4. 57) p < 0. 05 LPA hCV2593a271 AIIPaUents HistoryofStroke 10. 3748 0. 0013 8. 9305 0. 0028 31N3393 (22%) 6/72 (8. 3%) 0/0 (0. 0%) 4-00 (1. 46to9. 28) p<0. 005 LPA hCV25930271 All Paffents My Report oF Siroke Prior to or uring CARE 8. 1023 0. 0044 7. 5172 0. 0061 79/1393 (5. 7%) 10/72 (13. 9%) 0/0 (0. 0%) 2. ru (1. 25 to 6. 22) p < 0. 05 LRPB hCV190754 All Padents Hosp. for Unsta6le Mgina 6. 2202 0. 0446 6. 3814 0. 0204 83l557 (14. 9%) 130/687 (18. 9%) 51/235 (21. 7%) 1. 33 (0. 99 to 1. 81) 1. 58 (1. 07 to 2. 33) p < 0. 05 LRPB hCV190754 Ail Patients Hislory of Coronary AAery Bypass Graft 15. 2786 0. 0005 14. 3188 0. 0002 120/557 (21. 5%) 214/687 (31. 1%) 57/235 (24. 3%) 1. 65 (1. 27 to 2. 14) 1. 17 (0. 8toto1. 67) p<0. 0005 LTA hCV16172487 AII Patfents Coronary Adery Bypass or Revascularfzation 6. 3807 0. 0412 6. 0148 0. 0251 243N1259 (19. 3%) 38/199 (19. 1%) 4I7 (57. 1 %) 0. 99 (0. 67 to 1. 43) 5. 57 (1. 22 to 28. 45) p<0. 05 MARCO hCV2126249 AII Patfents Hosp. for Cardtovascular isease 9. 4031 0. 0091 4. 6978 0. 0302 601/1286 (46. 7%) 85/161 (52. 8%) 1/12 (6. 3%) 1. 28 (0. 92 to 1. 77) 0. iD 0. 01 to 0. 54) p < 0. 05 MARCO hCV2126249 AII Pattents Total Cardfovascular Disease Events 9. 8232 0. 0074 4. 9202 0. 0265 61811286 (48. 1%) 87/161 (54. 0 %) 1/12 (8. 3%) 1. 27 (0. 92 to 1. 77) 0. 10 (0. 01 to 0. 51) p < 0. 05 MC1R hCV71951095 AiI Patients Hosp. for Unstable Angina 7. 4068 0. 0246 5. 644B 0. 0175232/1310 (17. 7%) 26/161 (17. 4%) 4/7 (57. 1%) 0. 98 (0. 62 to 1. 49) 6. 19 (1. 36 to 31. 62) p < 0. 05 MMP27 hCV1366366 All Pattenis History of Percutaneous Tcanslumtaal Coronacy Angioplasty 7. 9408 0. 0189 7. 7188 0. 0055 314/1006 (31. 2%) 125/381 (32. 8%) 38/82 (46. 3%) 1. 08 (0. 84 to 1. 38) 1. 9D (12 to 3. 00) p < 0. 05 TABLE 6, page 3 of 7 MSR1 hCV16172249 All Pattents Fatal CHDIDefinite Non-fatal MI 6. 6741 0. 0355 4. 5804 0. 0323 165/1304 (12. 7%) 16/157 (10. 2%) 3i7 (42. zu 0. 78 (0. 44 to 1. 31) 5. 18 (1. 01 to 23. 68) p < 0. 05 MSR1 hCV1B172249 All Patfents Fatal Coronary Heart Disease 13. 1069 0. 0014 7. 1248 0. 0076 52/1304 (4. 0%) 3/167 (1. 9%) 2f7 (28. 6%) 0. 47 (0. 11 to 1. 29) 9. 63 (1. 36 to 45. 84) p<0. 05 MSR7 hCV16172249 AlI Paltents Cardiovascular Mortality tU. 3616 0. 0056 6. 6501 0. 0105 57/1304 (4. 4%) 5/157 (3. 2%) 2/7 (26. 6%) 0. 72 (0. 25 to 1. 66) 8. 75 (1. 24 to A1. 56) p < 0. 05 MSR1 hCV16172249 All Pattents Fatal Atherosclero8c Cardfovascular Oisease 10. 3616 0. 0056 B. 5501 0. 0105 57/1304 (4. 4%) 5/157 (32% 2fl (28. 6%) 0. 72 (0. 25to1. 66) 8. 75 (1. 24 to 41. 56) p < 0. 05 MTHFD1 hCV1376137 All Patients Hosp. for Peripheral Arterial Disease 7. 6444 0. 0219 6. 96 0. 0083 61443 (1. 4%) 221732 (3. 0%) 141291 (4. 8%) 2. 26 (0. 97to6. 17) 3. 68 (1. 46 to 10. 50) p<0. 05 MTHFR hCV1202B83 All PaHents Congestive Heart Failure 6. 0848 0. 0477 5. 4632 0. 0194 56 (650 (8. 6Y) 52/667 (7. 8%) 4/149 (2. 7%) 0. 90 (0. 60 to 1. 33) 0. 29 (0. 09 to 0. 73) p<0. 05 MYH11 hCV334226 All Patfents Fatal CHDIDeBnile Non-fatal MI 6. 8287 0. 0329 4. 0068 0. 0453 1039938 (11. 0%) 71/485 (14. 6%) 11155 (20. 0 h) 1. 39 (1. 00 to 1. 92) 2. 03 (0. 97 to 3. 91) p<O. OS MI I hCV334226 All Palients Non-fatal MI (def & prob) 9. 5875 0. 0083 7. 7575 0. 0053 102/938 (10. 9%) 68/485 (14. 0%) 13f55 (23. 6%) 1. 34 (0. 96 to 1. 85) 2. 54 (1. 27 to 4. 76) p < 0. 05 MY71 hCV334226 All Patients FataVNon-fatal MI (def & prob) 7. 4812 0. 0237 5. 5795 0. 0182 116/938 (12. 4%) 76/485 (15. 7%) 13155 (23. 6%) 1. 32 (0. 96 tao 1. 80) 2. 19 (1. 10to4. 10) p<O. OS MY71 hCV334226 All Patients CARE MI : O-Wave MI 10. 088 0. 0064 7. 3943 0. 0065 616/938 (65. 7%) 293/485 (60. 4%) 26f55 (47. 3%) 0. 80 (0. 64 to 1. 00) 0. 47 (0. 27 to 0. 81) p < 0. 05 NOS2A hCV11889257 Ail PaOents Total Coronary Heart Disease Events 8. 4422 0. 0147 6. 5846 0. 0103 340/980 (34. 7%) 165/445 (37. 1%) 9/53 (17. 0%) 1. 11 (0. 88to1. 40) 0. 39 (0. 17 to 0. 76) p<0. 05 NOS2A hCV11889257 All Patients FataI/Non-fatal Atherosclerotic CV Dfsease 6. 5972 0. 0369 5. 927 0. 0149 390/980 (39. 8%) 181/445 (40. 7%) 12/53 (22. 6%) 1. 04 (0. 83 to 1. 30) 0. 44 (0. 22 po 0. 83) p 0. 05 NPC1 hCV25472673 All Patfents Hosp. for Cardiovascular Disease 14. 1028 0. 0009 13. 6581 0. 0002 244/560 (43. 6%) 323/697 (46. 3%) 122/208 (58. 7%) 1. 12 (0. 89 ta 1. 407 1. 84 (1. 33 to 2. 54) p < 0. 0005 NPC1 hCV25472673 Ail Patients Tohal Coronary Heart Olsease Events 6. 9104 0. 0316 6. 8509 0. 0089 180/560 (32. 1%) 242/697 (34. 7%) 88/208 (42. 3%) 1. 12 (0. 89 to 1. 42) 1. 55 (1. 12 to 2. 15) p<0. 05 NPC1 hCV25472673 Ail Patients Total Cardiovascular Disease Events 13. 7798 0. 001 13. 0217 0. 0003 254/560 (45. 4%) 330/697 (47. 3%) 1251208 (60. 1%) 1. 08 (0. 87tu1. 35) 1. 81 (1. 32 fo 2. 51) p < 0. 005 NPCt hCV25472673 All Pattents FataIINon-fatal Atherosclerotic CV Dtsease 9. 3597 0. 0093 9. 2405 0. 0024 204560 (36. 4%) 274/697 (39. 3%) 101/208 (48. 6%) 1. 13 (0. 90 to 1. 42) 1. 66 (1. 19 to 227) p < 0. 005 P2RY4 hCV8815434 All Pattents FataI CHDIDeOnite Non-fatal MI 6. 9422 0. 0311 5. 1647 0. 023 147/1231 (11. 9%) 34/234 (14. 5%) 4/11 (36. 4%) 1. 25 (0. 83101. 85) 4. 21 (1. D9 to 14. 13) p < 0. 05 P2RY4 hCV8815434 AII Patlents Fatal Coonary Heart Disease 6. 7934 0. 0335 5. 0538 0. 0246 44/1231 (3. 6%) 11/234 (4. 7%) 2/11 (18. 2%) 1. 33 (0. 64to2. 62) 6. 00 (0. 90 to 24. 13) p < 0. 05 P2RY4 hCV8815434 AII Paitents Cardlovascuiar Mortality 7. 1799 0. 0276 4. 5705 0. 0325 48/1231 (3. 9%) 14/234 (6. 0%) 2/11 (. 2%) 1. 57 (0. 62tu2. 82) 5. 48 (0. 82 to 21. 98) p < 0. 05 P2RY4 hCV8815434 All PaUents Fatal Alherosclerottc Cardiovascuiar D (sease 7. 1799 0. 0276 4. 5705 0. 0325 48/1231 (3. 9%) 14/234 (6. 0%) 2/11 (18. 2%) 1. 57 (0. 82 to 2. 82) 5. 48 (0. 82 to 21, 98) p < 0. 05 PDGFRA hCV22271841 All Pa9ents Fatal CHDlDefinite Non-fatal MI 16. 9486 0. 0002 13. 3442 0. 0003140/1161 (12. 1%) 36/288 (12. 5%) 8/18 (44. 4%) 1. 04 (0. 70 to 1. 53) 5. 83 (2. 19 tu 15. 04) p<0. 0005 PDGFRA hCV22271841 All Pa6ents Non-fatal MI (def & prob) 11. 957 0. 0025 9. 9467 0. 0016 138/1161 (11. 9%) 371288 (12. 8%) 7/18 (36. 6%) 1. 09 (0. 13 tao 1. 60) 4. 72 (1. 71 to 12. 18) p < 0. 005 PDGFRA hCV22271841 All Patients FataI/Non-fatal MI (deF & prob) 10. 0356 0. 0066 8. 4264 0. 0037 154/1161 (13. 3%) 43/288 (14. 9%) 7/18 (38. 9%) 1. 15 (0. 79 to 1. 64) 4. 16 (1. 51 to 10. 73) p < 0. 005 PET hCV7443062 All Patfents FataI/Non-fatal Atheroscierotic CV D (sease 6. 0125 0. 0495 5. 466 0. 0194 193/462 (41. 8%) 299/739 (40. 5%) 91/275 (33. 1%) 0. 95 (0. 75 to 1. 20) 0. 69 (0. 50 tao 0. 94) p < 0. 05 PLA2G4C hCV16196014 All Patients CongesGve Heart Failure 9. 2587 0. 0098 4. 6217 0. 0316 95/1334 p. 1 %) 15/127 (11. 8%) 2f6 (33. 3%) 1. 75 (0. 95 to 3. 03) 6. 53 (0. 90 to 33. 85) p-0. 05 PLA2G7 hCV7582933 All Palfents FataUNon-fatal Cerebmvascular Disease 20. 7612 <0001 18. 7233 <. 0001 421834 (5. D%) 41/534 (7. 7%) 17/101 (16. 8%) 1. 57 (1. 00 to 2. 45) 3. 82 (2. 04 to 6. 90) p < 0. 0005 PLAZG7 hCV7582933 All Patients Any Report of Stroke Prior to or Dudng CARE 7. 7806 0. 0204 5. 2256 0. 0223 39/834 (4. 7%) 41/534 (7. 7%) 101101 (9. 9%) 1. 70 (1. 08 to 2. 67) 2. 24 (1. 03 to 4. 47) p < 0. 05 PLA2G7 hCV7582933 All Patients My Report oF Stroke uring CARE 13. 9046 0. 001 10. 38040. 0013 21/834 (2. 5%) 29/534 (5. 4%) 9/101 (8. 9%) 2. 22 (1. 26 to 3. 99) 3. 79 (1. 61 l0 8. 28) p 0. 005 PLA2G7 hCV7582933 All Pattents tst SWke Occurred Durtng CARE 18. 5507 <0001 13. 9535 0. 0002 16/834 (1. 9%) 27/534 (6. 1%) 9/101 (8. 9%) 2. 72 (1. 47 to 5. 21) 5. 00 (2. 07 to 11. 43) pO. 0005 PLAT hCV3212009 All Patients Hosp. for Cardiovascular Disease 6. 4go4 0. 039 6. 3891 0. 0115 548/1125 (48. 7%) 1321324 (40. 7%) 10f20 (50. 0%) 0. 72 (0. 56 to 0. 93) 1. 05 (0. 43 0 2. 59), p < 0. 05 PLAT hCV3212009 All Patlents Hosp. for Unstable Angina 6. 0758 0. 0479 5. 6512 0. 0147 216N1125 (19. 2%) 43/324 (13. 3%) 4/20 (20. 0%) 0. 64 (0. 45 to 0. 91) 1. 05 (0. 30<o2. SO) p<0. 05 PLAT hCV3212009 All Patients Total Coronary Heart Disease Events 7. 506 0. 0234 7. 4548 0. 0063 412/1125 (36. 6%) 92/324 (28. 4%) 7/20 (35. 0%) 0. 69 (0. 52 to 0. 90) 0. 93 (0. 35 to 2. 29) p<0. 06 PLAT hCV3212009 Ali Patients Tohal Cardiovascular Disease Events 6. 7267 0-0346 6. 675 0. 0098 564/1125 (50. 1%) 136/324 (42. 0%) 10f20 (50. 0%) 0. 72 (0. 56 to 0. 92) 1. 00 (0. 4Ho2. 44) p<0. 05 PLAT hCV3212009 All Pa9enis FataIINon-fatal AtheroscleroGc CV Disease 8. 814 0. 0122 8. 5038 0. 0035 466/1 M (41. 4%) 105/324 (32, 4%) 9/20 (45. 0%) 0. 68 (0. 52 tu 0. 88) 1. 16 (0. 46 to 2. 82) p<0. 005 PLAT hCV3212009 Au patents CARE MtQ-WaveM ! 6. 2617 0. 0437 4. 8823 0. 0271 712/1125 (63. 3%) 2021324 (62. 3%) 18120 (90. 0%) 0. 96 (0. 75 to 1. 24) 5. 22 (1. 50 to 32. 94) p<0. 05 PLAU hCV1B273460 Ail Patients Hosp. for Peripheral Arterial Disease 7. 0124 0. 03 6. 2128 0. 0127 22/888 (2. 6%) 141499 (2. 8%) 6fob (7. 7% ) 1. 14 (0. 56 to 2. 22) 3. 28 (1. 18 po 7. 88) p < 0. 05 PLG hCV25614474 Ail Patients Hosp. for Peripheral Arterial Disease 6. 5529 0. 0378 5. 2289 0. 0222 14f738 (1. 9%) 22/622 (3. 5%) 6/105 (5. 7%) 1. 90 (0. 97 to 3. 82) 3. 13 (1. 09 la 8. 01) p-0. 05 PON1 hCV2548962 All Patients History of Stroke 7. 762 0. 0206 6. 2747 0. 0122 28/753 (3. 7Y) SI579 (1. 4%) 2/133 (1. 5%) 0-36 (0. 15 to 0. 77) 0. 40 (0. 06 to 1. 34) p < 0. 05 PON1 hCV2548962 All Patfents Any Report of StOke Ouring CARE 18. 3981 0. 0001 15. 8161 <. ou1 16/753 (2. zu 39/579 (6. 7%) 4/133 (3. 0%) 3. 33 (1. 88 tu 6. 18) 1. 43 (0. 40 tu 3. 97) p<0. 0005 PON1 hCV2548962 All Patients 1st Stroke Ocwrred Dudng CARE 15. 5223 0. 0004 13. 6541 0, 0002 141753 (1. 9%) 34/579 (5. 9%) 4/133 (3. 0%) 3. 29 (1. 79 to 6. 40) 1. 64 (0. 40 tu 4. 65) p < 0. 0005 PRKCQ hCVt5954277 All Patients Fatal CHDIDefinite Non-fatal MI 7. 6114 0. 0222 8. 39D9 0. 0115 11M817 (14. 0%) 651546 (il. 9%) 5/106 (4. 7%) 0. 83 (0. 60 to 1. 15) 0. 31 (0. 11 to 0. 69) p<0. 06 PRKCQ hCV15954277 Ail Patients History of Percutaneous Translumtnal Coronary Angioplasty 7. 1755 0. 0277 6. 1643 0. 013 248/817 (30. 4%) 201/546 (36. 8%) 30/106 (28. 3%) 1. 34 (1. 06 to 7. 68) 0. 91 (0. 57) 01. 40) p<0. 05 PROCR hCV25620145 All Patlents Congestive Heart Failure 8. 8085 0. 0122 7. 09 0. 0078 90/1206 (7. 5%) 18/248 (7. 3%) 4/14 (28. 6%) 0. 97 (0. 66 to 1. 60) 4. 96 (1. 34 to 15. 16) p<0. 05 PROCR hCV25620145 All Padents Hosp_ for Peripheral Arterial Disease 18. 4984 <. 0001 12. 2481 0. 0005 30/1206 (2. 5%) 9/248 (3. 6%) 3114 (21. 4%) 1. 48 (0. 65 to 3. 03) 10. 69 (2. 33) 036. 36) p< 0. 005 PROCR hCV25020145 Ail Pa4ents History of Congestive Heart Fafiure (AE) 7. 8606 0. 0196 3. 8993 0. 0483 83/1206 (6. 9%) 10/248 (4. 0%) 3/14 (21. 4%) 0. 57 (0. 27 to 1. 06) 3. 69 (0. 82 to 12-09) p < 0-05 PROCR hCV25620145 All Patients History of Dtabetes 10. 7224 0. 0047 7. 0162 0. 0081 181/1206 (15. 0%) 29/248 (11. 7%) 6/14 (42. 9%) 0. 75 (0. 49to1. 12) 4. 25 (1. 38 to 12. 35) p<0. 05 PROCR hCV25620145 All Patlents More'fhan 1 PriorMl 9. 2085 0. 01 7. 533 0. 0061 173/1206 (14. 3%) 40/248 (16. 1%) 6/14 (42. 9%) 1-15 (0. 78 to 1. 66) 4. 48 (1. 46 to 13. 03) p < 0. 05 PROCR hCV7499900 All Patients Hosp. for Periphe2l Merial Oisease 8. 569 0. 0138 6. 1406 0. 0132 3011200 (2. 5%) 9/248 (3. 6%) 2/13 (15. 4%) 1. 47 (0. 65 to 3. 01) 7. 09 (1. 07 to 27. 93) p < 0. 05 PROCR hCV7499900 Ail PaOents More lhan 7 PrIorMl 6. 3048 0. 0427 5. 2347 0. 0221 172/1200 (14. 3%) 40/248 (16. 1%) 5113 (38. 5%) 1. 15 (0. 78 to 1. 66) 3. 74 (1. 12 to 11. 33) p < 0. 05 PSMB9 hCV8849004 Ail Patients Hosp. for Unstable Angina 6. 1961 0. 0451 4. 8294 0. 028 153/773 (19. 8 %) 99/595 (16. 6%) 12/110 (10. 9%) 0. 81 (0. 61 to 1. 07) 0. 50 (0. 25 to 0. 89) p 0. 05 SCARF7 hCV25613493 All Patients Congestive Heart Figure 7. 751 0. 0207 7. 3777 0. 0066 94/1070 (8. 8%) 16/369 (4. 3%) 2/3a (6. 7%) 0. 47 (0. 26 to 0. 79) 0. 74 (0. 12 to 2. 52) p < 0. 05 SCARF1 hCV25613493 All Patients History of Stroke 10. 3312 0. 0057 7. 0201 0. 0081 21/1070 (2. 0*4) 14/369 (3. 8%) 3/30 (10. 0%) 1. 97 (0. 97 to 3. 88) 6. 55 (1. 26 to 17. 38) p < 0. 05 SELL hCV16172571 Ail Patients Congestive Heart Failure 10. 7046 0. 0047 92061 0. 0024 70/1074 p. 3%) 271362 (7. 5%) 7/30 (23. 3*4) 1. 03 (0. 64 to 1. 60) 3. 89 (1. 5010 8. 91) p < 0. 005 SELL hCVi6172571 All Patients History of Angina Pectos 6. 4757 0. 0392 4. 5067 0. 0338 197N074 (18. 3%) 85/362 (23. 5%) 9/30 (30. 0*4) 1. 37 (1. 02 to 1. 82) 1. 91 (0. 82 to 4. 11) p<0. 05 SELL hCV25474627 All Patients Congestive Heart Failure 10. 9187 0. 0043 9. 3741 0. 0022 77/1073 (7. 2%) 27/365 (7. 4%) 7/30 (23. 3%) 1. 03 (0. 65 to 1. 61) 3. 94 (1. 52 tu 9. 03) p < 0. 005 SELL hCV25474627 All Patients History of Angina Pectoris 6. 1573 0. 046 4. 1763 0. 041 187N073 (18. 4%) 85/365 (23. 3%) 9/30 (30. 0%) 1. 35 (1. 01to1. 60) 1. 91 (0. 82 to 4. 10) p < 0. 05 SELP hCVt 1975296 AII Patfents Coronary AAery Bypass or RevascularizaHon 7. 9917 0. 0184 5. 884 0. 0153 205/996 (20. 6%) 78/422 (18. 5%) 2147 (4. 3%) 0. 88 (0. 65 tao 1. 17) 0. 17 (0. 03 to 0. 56) p<0. 05 SERPINA1 hCV1260328 All Pattents FataI/Non-falal Cerebmvascular Disease 8. 1188 0. 0173 7. 4562 0. 0063 53/915 (5. 8%) 36/486 (7. 4%%) 11f79 (13. 9%) 1. 30 (0. 83 to 2. 01) 2. 63 (125 tao 5. 10) p < 0. 05 SERPINA10 hCV15943710 All Patients Hosp. for Peripheral Arterial O (sease 6. 8119 0. 0091 5. 6794 0. 0172 39/1451 (2. 7%) 3/27 (11. 1%) 0/0 (0. 0%) 4. 53 (1. 05 to 13. 67) p<0. 05 SERPINA3 hCV2188895 Ail Patients Fatal Coronary Heart Disease 9. 6621 0. 008 8. 2548 0. 0041 24/407 (5. 9%) 281724 (3. 9%) 5/338 (1. 5%) 0. 64 (0. 37 to 1. 13) 0. 24 (0. 08 to 0. 59) p < 0. 005 SERPINA3 hCV2188895 All Patfents Cardlovascular Mortality 13. 1924 0. 0014 10. 5191 0. 0012 26/407 (6. 9%) 30/724 (4. 1%) 5/338 (1. 5%) 0. 59 (0. 34 tu 1. 00) 0. 20 (0. 07 to 0. 49) p < 0. 005 SERPINA3 hCV2188695 Atl Patients Falal Atherosclerotic Cardiovascular Disease 13_1924 0. 0014 10. 5191 0. 0012 26/407 (M%) 30/724 (4. 1 %) 5/338 (1. 6%) 0. 59 (0. 34 to 1. 00) 0. 20 (0. 07 to 0. 49) p < 0. 005 SERPINA3 hCV2108895 Ail Patients History of Dtabetes-7. 4219 0. 0245 7. 0093 0. 0081 70/407 (17. 2%) in2, 724 (15. 5%) 35/338 (10. 4*4) 0. 88 (0. 64 tu 1. 23) 0. 56 (0. 36 to 0. 85) p, 0. 05 SERPINA3 hCV2188895 Ail Patients More Than t Prior MI 8. 7112 0. 0128 8. 6032 0. 0034 771407 (18. 9%) 90/724 (12. 4%) 50/338 (14. 8%) 0. 61 (0. 44tu0. 85) 0. 74 (0. 50 to 1. 10) p<0. 005 SERPINB2 hCV8931357 All Pafients Fatal Coronary Heart Disease 6. 1008 0. 0473 5. 8986 0. 0152 26/893 (2. 9*4) 28/503 (5. 6%) 3f7O (4. 3%) 1. 97 (1. 14 to 3. 41) 1. 49 (0. 35 to 4. 38) p<0. 05 SERPINB2 hCV8937357 All Pattenls Ist Stroke Occurred Dudng CARE 6. 4019 0. 0407 5. 3677 0. 0205 23/893 (2. 6%) 25/503 (5. 0%) 4fed (5. 7%) 1. 98 (1. 17 tao 3. 54) 2. 29 (0. 66 to 6. 18) p < 0. 05 SMTN hCV25627634 Ail Patients Fatal/Non-fatal MI (def & prob) 6. 1622 0. 0459 4. 8023 0. 0284 70/617 (11. 3%) 104/669 (15. 5%) 30/178 (16. 9%) 1. 44 (1. 04to2. 00) 1. 58 (0. 98 to 2. 50) p < 0. 05 SREBF2 hCV16170982 All Patfents Non-fatal MI (def & prob) 6. 5833 0. 0372 4. 1648 0. 0413 149/1263 (11. 8%) 30/196 (15. 3%) 318 (37. 5%) 1. 35 (0. 87 to 2. 04) 4. 49 (0. 91 tao 78. 47) p<0. 05 TABLE 6, page 4 of 7 SREBF2 hCV16170982 All Patients CARE MI : Q-Wave MI 6. 4495 0. 0398 3. 9908 0. 0457 797/1263 (63. 1%) 132/196 (67. 3%) 2/8 (25. 0%) 1. 21 (0. 88 to 1. 67) 0. 20 (0. 03 to 0. 85) p < 0. 05 TAPE hCV25630686 AM Patients Congestive Heart Failure 15. 1025 O. OOS 6. 8656 0. 0088 10211379 (7. 4%) 7/92 (7. 6%) 2/3 (66. 7%) 1. 03 (0. 42 to 2. 14) 25. 04 (2. 38 to 541. 07) p < 0. 05 TGFB1 hCV8708473 All Patients Cardiovascular Mortality 6. 3933 0. 0409 5. 0113 0. 0252 20f686 (2. 9%) 34/629 (5. 4%) 101t62 (6. 2%) 1. 90 (1. 09to3. 40) 2. 19 (0. 97 to 4. 67) p<0. 05 TGFB hCV8708473 All Patients Fatal Alhemsclerottc Cardfovascular Ofsease 6. 3933 0. 0409 5. 0113 0. 0252 201686 (2. 9%) 34/629 (5. 4%) 10/162 (6. 2%) 1. 90 (1. 09 to 3. 40) 2. 19 (0. 97 to 4. 67) p<0. 05 TUF81 hCV8708473 All Patients More Than 1 Prior MI 10. 1295 0. 0063 8. 4286 0. 0037 81/6B6 (11. 8%) 110/629 (17. 9%) 30/162 (18. 5%) 1. 58 (1. 19tu2. 16) 1. 70 (1. 08 to 2. 66) p < 0. 005 TGFB7 hCV8708473 Ail Patlents My Reporf of Stroke Durfng CARE 8. 1211 0. 0172 6. 0819 0. 0137 24f686 (3. 5%) 21/629 (3. 3%) 13/162 (8. 0%) 0. 95 (0. 52 tu 1. 73) 2. 41 (1. 17 to 4. 76) p < 0. 05 TGFB1 hCV8708473 All Patients Ist Stroke Occurred During CARE 8. 5461 0. 0139 6. 7848 0. 0092 201888 (2. 9%) 19/629 (3. 0%) 121182 (7. 4%) 1. 04 (0. 55 to 1. 97) 2. 06 (1. 24 to 5. 50) p<0. 05 THBD hCV2531431 All Patients Fatal CHD/Definite Non-fatal MI 10. 6922 0. 0048 8. 0919 0. 0044 113/1025 (11. 0%) 58/394 (14. 7%) 12/48 (25. 0%) 1. 39 (0. 99 to 1. 95) 2. 69 (1. 31 to 5. 18) p < 0. 005 THBD hCV2531431 All Patlents Coronary Artery Bypass or RevasculaBraUon 7. 5952 0. 0224 7. 1945 0. 0073 180/1025 (17. 6%) 94/394 (23. 9%) 11/48 (22. 9%) 1. 47 (1. 11 to 1. 95) 1. 40 (0. 67 to 2. 70) p<0. 05 THBD hCV2531431 All Palients History of Percutaneous Translumfnai Comnary Angioplasty 12. 6379 00018 10. 8371 0. 001 315/1025 (30. 7%) 137/394 (34. 8%) 26/48 (54. 2%) 1120 (0. 94to154) 2. 66 (1-49 to 4-81) p < 0. 005 THBS1 hCV16170900 All Patlents Coronary Artery Bypass or Revascuiarization 11. 2439 0. 0038 8. 0265 0. 003 217/1194 (18. 2%) 67/254 (26. 4%) 1/18 (5. 6%) 1. 61 (1. 17 to 2. 20) 0. 27 (0. 02 to 1. 30) p<0. 005 THBS1 hCV16170900 All Patients History of Angina Pectoris 10. 3425 0. 0057 8. 823 0. 003 233/1194 (19. 5%) 50/254 (19. 7%) 9/18 (50. 0%) 1. 01 (0. 71 to 1. 41) 4. 12 (1. 59 to 10. 68) p < 0. 005 TIMP2 hCV1466548 All PatienLS Fatal CHD/Defintte Non-fatal MI 92264 0. 0099 6. 5997 0. 0102 45/451 (10. 0%) 1091715 (152%) 30/300 (10. o%) 1. 62 (1. 13 to 2. 37) 1. 00 (0. 61 to 1. 62) p<0. 05 TIMP2 hCV1466546 All Patients Famlly History of CV Dfsease 6. 153 0. 0461 6. 1285 0. 0133 1681451 (37. 3%) 2941715 (41. 1%) 1391300 (46. 3%) 1. 18 (0. 92 to 1. 60) 1. 45 (1. 08 tao 1. 96) p < 0. 05 TLR5 hCV15871D20 All PaGents Coronary Artery Bypass or Revasculazation 8. 072 0. 0177 7. 2739 0. 007 199/1070 (18. 6%) 76/371 (20. 6%) 12/31 (38. 7%) 1. 13 (0. 84 to 1. 51) 2. 76 (1. 29 to 5. 72) pu 0. 05 TLR5 hCV15871020 All Patients Total Coonary Heart Disease Events 8. 5655 0. 0138 7. 3782 U. OUTE 360/1070 (33. 6%) 136/371 (36. 7%) 18/31 (58. 1%) 1. 14 (0. 89tu1. 46) 2. 73 (1. 33 to 5. 75) pu 0. 05 TLR6 hCV15871020 All Palients Total C ; ardtovascuiar Oisease Events 6. 1316 0. 0466 4. 8612 0. 0275 504/1070 (47. 1%) 18//371 (50. 7%) 21/31 (67. 7%) 1. 15 (0-91to1. 46) 2. 36 (1. 13to5. 27) p<005 TLR5 hCV15871020 All Patients FataYNon-fatal AthemsclemUc CV Disease 7. 0228 0. 0299 6. 2028 0. 0128 411/1070 (38. 4%) 152/371 (41. 0%) 19/31 (61. 3%) 1. 1. 1 (0. 87 to 1. 42) 2. 54 (1. 23 to 5. 43) p<0. 05 TNF hCV7514879 All Patients Total Mortaiity 8. 8535 0. 012 6. 0624 0. 0138 56/1036 (5. 4%) 33/411 (8. 0%) 5/30 (16. 7%) 1. 53 (0. 97 to 2. 37) 3. 50 (1. 15 to 8. 79) p < 0. 05 TNF hCV7514879 AlI Patients Hosp. for Cardiovascular Dtsease 8. 6699 0. 0131 7. 5339 0. 0061 483/1036 (46. 6%) 188/411 (45. 7%) 22f30 (73. 3%) 0. 97 (0. 77tu1. 21) 3. 15 (1. 44 to 7. 60) p<0. 06 TNF hCV7514879 Ail Patients Total Cardtovascular Dlsease Events 7. 8468 0. 0198 6. 789 0. 0092 498/1036 (48. 1%) 193/411 (47. 0%) 22f30 p3. 3%) 0. 90 (0. 76 tao 1. 20) 2. 97 (1. 36 tao 7. 17) p<0. 0 : TNF hCV7514879 Ail Palients CARE MI : O-Wave Mi 7. 9203 0. 0191 5. 6008 0. 018 673/1036 (65. 0%) 248/411 (60. 3%) 13/30 (43. 3%) 0. 82 (0. 65 to 1. 04) 0. 41 (0. 19 to 0-86) p 0. 05 TNFRSF10A hCV12102850 Ail Patienis Total Morfality 7. 7139 0. 0211 6. 2178 0. 0126 19I448 (4. 2%) 57/710 (8. 0%) 16/317 (5. 0%) 1. 97 (1. 15to3. 44) 1. 20 (0. 60 to 2. 37) p < 0. 05 TNFRSFt 0A hCV12102850 All Patients More Than 1 Pdor MI 6. 6427 0. 0361 4. 852 0. 0276 56/448 (12. 5%) 123/710 (17. 3%) 40/317 (12. 6%) 1. 47 (1. 05 to 2. 08) 1. 01 (0. 65 tao 1. 56) p < 0. 05 TNFRSF10A hCV12102850 AII Pattents Any Report of Stroke During CARE 10. 989 0. 0041 9. 6137 0. 0019 7/448 (1. 6%) 33/710 (4. 6%) 19/317 (6. 0%) 3. 07 (1. 43 to 7. 62) 4. 02 (1. 74 to 10. 39) p<0. 005 TNFRSF10A hCV12102850 All Patlents lstStroke Occurred During CARE 15. 4596 0. 0004 12. 4232 0. 0004 4/448 (0. 9%) 29/710 (4. 1%) 19/317 (6. 0%) 4. 73 (1. 85 to 16. 02) 7. 08 (2. 63 to 24. 59) p< O. OOD5 VWF hCV8921137 All Patients Fatal Coronary Heart Disease 10. 8514 0. 0044 8. 2057 0. 0042 46/1351 (3. 4%) 10/110 (9. 1%) 1 7 (14. 3%) 2-84 (1. 32 to 5. 57) 4. 73 (0. 25 to 28. 47) p < 0. 005 VWF hCV8921137 AlI Pafients FataI/tNon-fatal Cerebrovascular Disease 7. 2772 0. 0263 4. 3481 0. 0371 87/1351 (6. 4%) 11/110 (10. 0%) 217 (28. 6%) 1. 61 (0. 79 to 3. 00) 5. 81 (O. BZ to 27. 39) p 0. 05 V WF hCV8921137 Ail Patients Cardiovasailar Mortaliy 8. 1772 0. 0168 6. 1886 0. 0129 53/1351 (3. 9%) 101110 (9. 1%) 1I7 (14. 3%) 2-45 (1. 14 to 4. 76) 4. 08 (021 to 24. 49) p c 0. 05 VWF hCV8921137 All Pat (ents Fatal Atherosclerottc Cardiovascuiar isease 8. 1772 0. 0168 6. 1886 0. 0129 53/1351 (3. 9%) 10/110 (9. 1%) 1I7 (14. 3%) 245 (l. ta to 4. 76) 4. 06 (0. 21to24. 49) p<0. 05 W WOX hCV25654217 All Patients FataUNon-fata Cerebrovascular Disease 9. 8699 0. 0072 5. 7737 0. 0163 89/1305 (6. 8%) 8/167 (4. 8%) 2/5 (40. 0%) 0. 69 (0. 30 to 1. 36) 9. 11 (1. 19 to 55. 63) p < 0. 05 W WOX hCV25654217 All Patients Any Report of Stroke Prtorto or During CARE 10. 3168 0. 0058 6. 5212 0. 0107 78/1305 (6. 0%) 9/167 (5. 4%) 2/5 (40. 0%) 0. 90 (0. 41 to 1. 73) 10. 49 (1. 37 to 64. 15) p < 0. 05 W WOX hCV25654217 Ail Pat (ents Any Report of Stroke During CARE 17. 6324 0. 0001 9. 1628 0. 0025 51/1305 (3. 9%) 5/167 (3_0 %) 2/5 (40. ou) 0. 76 (026 to 1. 76) 16. 39 (2. 13 to 100. 97) p< 0. 005 W WOX hCV25654217 Ail PaUents Ist Stroka Occurred During CARE 21. 4279 <. 0001 9. 8532 0. 0017 46/1305 (3. 5%) 3/167 (1. 8 %%) 2/5 (40. 0%) 0. 50 (0. 12 to 1. 39) 18. 25 (2. 36 to 112. 63) p<0. 005 WO hCV57888 All Patlents Total Comnary Heart D (sease Events 6. 3913 0. 0409 6. 2902 0. 0121 1491479 (31. 1%) 253/T18 (352 %) 113/282 (40. 1%) 1. 21 (0. 94 to 1. 54) 1. 48 (1. 09 to 2. 01) p < 0. 05 WO hCV57888 Ali Pallents FataUNon-fatal Atherosclerotic CV Otsease 7. 3501 0. 0253 7. 2682 0. 007 1701479 (35. 5%) 286/718 (39. 8%) 128/282 (45. 4%) 1. 20 (0. 95 to 1. 53) 1. 51 (1. 12 to 2. 04) p < 0. 05 ABCC6 hCV25620774 All Patients Definite Nonfatal MI fi. 4478 0. 0111 6. 0215 0. 0141 12811408 (9. 1%) 9/44 (20. 5%) 2. 57 (1. 14 to 5. 25) p < 0. 05 ABCCB hCV25620774 All Patients Fatal CHD/Definfte Nonfatal MI 4. 3789 0. 0364 4. 1898 0. 0407 171/1408 (12. 1%) 10/44 (22. 7%) 2. 13 (0. 98 to 4. 23) p < 0. 05 ABCC6 hCV25620774 All Patients CARE MI : Q-Wave MI 6. 0048 0. 0143 5. 7616 0. 0164 895/1408 (63. 6%) 20/44 (45. 5%) 0. 48 (0. 26 to 0. 87) p<0. 05 ABO hCV25610774 All Patients MI (FataI/Nonfatal) 6. 5033 0. 0387 5. 5359 0. 0186 136/856 (16. 9%) 62/545 (11. 4%) 8177 (10. 4%) 0. 61 (0. 27 to 1. 23) D. 68 (0-49 to 0-93) p < 0. 05 A80 hCV2561 W74 All Patients FatatCHD/DefMteNonfataMt 6. 6893 0. 0353 4. 3471 0. 0371 1201856 (14. 0%) 60/545 (11. 0%) 4/77 (5. 2%) 0. 34 (0. 10 to 0. 83) 0. 70 (0. 54 to 1. 05) p<0. 05 ABO hCV25610819 All Patients Fatai CHD/Detinfle Nonfatal MI 6_7297 0. 0346 4. 7025 0. 0301 119f847 (14_o%) 61/542 (11. 3%) 4/80 (5. 0%) 0. 32 (0. 10 to 0. 79) 0. 78 (0. 56 to 1. 07) p < 0. 05 ADAMTS1 hCV529710 All Patients Fatat CHD/Definite Nonfatal MI 7. 5605 0. 0228 6. 7732 0. 0093 92/873 (70. 5% ) 79/516 (15. 3%) 14/90 (15. 6%) 1. 56 (0. 82 to 2. 80) 1. 53 (1. 11 to 2. 12) p<0. 05 ADAMTS1 hCV529710 All Patients Fatal Coronary Heart Disease 7. 3045 0. 0259 6. 9927 0. 0082 24f873 (2. 7%) 29/516 (5. 6%) 4/90 (4. 4%) 1. 65 (O. 4 to 4. 38) 2. 11 (1. 21 to 3. 69) p < 0. 05 ADAMTSt hCV529710 All Patients Total Mortality 12. 1574 0. 0023 11. 7126 0. 0006 401873 (4. 6%) 48/516 (9. 3%) 6/90 (6. 7%) 1. 49 (0. 55 to 3. 36) 2. 14 (1. 38 to 3. 31) p 0. 005 ADAMTS1 hCV529710 All Patients Cardfovasaiar Mortality 10. 2172 0. 006 9. 7327 0. 0018 261873 (3. 0%) 341516 (6. 6%) 4/90 (4. 4%) 1. 52 (0. 44 to 4. 00) 2. 30 (1. 37 to 3. 91) p 0. 005 ADAMTS7 hCV529710 All PaUents Fata Atheroscterotlc Cardtovascular tsease 10. 2172 0. a06 9. 7327 0. 0018 261873 (3. 0%) 34/516 (6. 6%) 4/90 (4. 4%) 1. 52 (0. A4 to 4. 00) 2. 30 (1. 37 to 3-91) p < 0. 005 ADAMTS1 hCV529710 All Patients Hislory of Diabetes 6. 9684 0. 0307 6. 9003 0. 0086 112/673 (12. 8%) 931516 (18. 0%) 13/90 (14. 4%) 1. 15 (0. 59 to 2. 07) 1. 49 (1. 11 to 2. 01) p < 0. 05 APOBEC1 hCV15757745 Ail Patients Stroke 17. 213 0. 0002 15295 <. 0001 32/1131 (2. 8%) 25/318 (7. 9%) 2/27 (7. 4%) 2. 75 (0. 43 to 9. 79) 2. 93 (1. 70to5. D1) p<0. 0005 APOBEC1 hCV15757745 All Pafients Percutaneous Transluminai Coronary Angioplasty 6. 9765 0. 0306 5. 2376 0. 0221 128/1132 (11. 1%) 30/319 (9. 4%) 7127 (25. 9%) 2. 80 (1. 08 to 6. 45) 0. 83 (0. 54 to 1. 24) p<0. 05 APOBEC1 hCV15757745 All Patients Hosp. forCardiovascular Isease 6. 3026 0. 0428 4. 6198 0. 0316 512/1132 (45. 2%) 1661319 (52. 0%) 16/27 (59. 3%) 1. 76 (0. 82 to 3. 94) 1. 31 (1. 02 to 1. 69) pu 0. 05 APOBEC1 hCV15757775 AII Patients FafaIINonfatal Cerebrovascuiar Disease 11. 5495 0. 0031 11. 1298 0. 0008 6311132 (5. 6%) 35/319 (11. 0%) 2/27 (7. 4%) 1. 36 (0. 22to4. 70) 2. 09 (1. 34 to 3. 21) p<O. OOS APOBECt hCV75757745 All Patients Hosp. for Unsta6le Angina 7. 827 0. 02 5. 8787 0. 0153 204/1132 (18. 0%) 50/319 (15. 7%) 10/27 (37. 0%) 2. 68 (1. 17top4) 0. 85 (0. 50 to 1. 18) p < 0. 05 APOBEC1 hCV15757745 All Patients Total Cardiovascvlar Qisease Events 6. 2745 0. 0434 4. 9393 0. 0263 527/1132 (46. 6%) 1711319 (63. 6%) 16/27 (59. 3%) 1. 67 (0. 77 to 3. 73) 1. 33 (1. 03 to 1. 70) p<=O. OE APOBECI hCV1 57M45 All Patients Any Report of Stmke Prior to or DuKng CARE 17. 6174 0. 0001 13. 6085 0. 0002 53/1132 (4. 7%) 33/319 (10. 3 %) 4127 (14. 8%) 3. 54 (1. 01 to 9. 61) 2. 35 (1. 48 to 3. 68) p < 0. 0005 APOBEC7 hCV15757745 NI Pat (ents Any Report of Stroke During CARE 14. 6273 0. 0007 13. 0337 0. 0003 33/1132 (2. 9%) 24/319 (7. 5%) 2/27 (7. 4%) 2. 66 (0. 42 to 9. 47) 2. 71 (1. 56 to 4. 64) p<0. 0005 APOBEC1 hCV15157745 All PatIents 1st StrOkB OCCUrteU Durlng CARE 15. 5685 0. 0004 13. 4449 0. 0002 29/1132 (2. 5%) 22/319 (6. 9%) 2/27 (7. 4%) 3. 15 (0. 49 to 11. 33) 2. 92 (1. 63 to 5. 17) p<0. 0005 ASAH1 hCV2442143 All Pafients MI (FataIINonfatal) 6. 5487 0. 0378 6. 0662 0. 0138 64/397 (16. 1%) 108/735 (14. 7%) 34/343 (9. 9%) 0. 57 (0. 36tu0. 89) O. 90 (. 64 to 12fi) p < 0. 05 ASAH1 hCV2442143 AII Patients Definite Nonfatal MI 7. 1575 0. 0279 6. 9682 0. 0083 47/397 (11. 8%) tu735 (9. 8%) 21/343 (6. 1%) 0. 49 (0. 28 to 0. 82) 0. 81 (0. 55 to 1. 20) pu 0. 05 ASAH1 hCV2442143 Ail Patients Fatal CHD/Definite Nonfatal MI 7. 3704 0. 025 7. 0385 0. 008 591397 (14. 9%) 96/735 (13. 1 °) 29/343 (8. 5%) 0. 53 (0. 33 to 0. 84) 0. 86 (0. 61 to 1. 23) p < 0. 05 ASAHt hCV2442143 All Patients FataUNonfatai MI (Uef & prob) 6. 1285 0. 0467 5. 639 0. 0176 63/397 (15. 9%) 107/T35 (14. 6%) 34/343 (9. 9%) 0. 58 (0. 37 to 0. 90) 0. 90 (0. 65 to 1. 27) p<0. 05 BAT2 hCV7514682 All Pattents Fatal Coronary Heart Disease 7. 3974 0. 0248 6. 1273 0. 0133 28/796 (3. 5%) 20/575 (3. 5%) 9/101 (8. 9%) 268 (1. 16 0 5. 66) 0. 99 (0. 54 to 1. 76) p<005 BAT2 hCV7514692 Ail Patients Cardiovascular Mortalily 8. 2365 0. 0163 8. 0975 0. 0135 33/796 (4. 1%) 21/575 (3. 7%) 10/101 (9. 9%) 2-54 (1. 15 to 5. 15) 0. 88 (0. 49 to 1. 52) p < 0. 05 BAT2 hCV7514692 All Patients Fatal AtheroscleroAC Cardtovascular Otsease-82365 0. 0163 6. 0975 0. 0135 331796 (4. 1%) 21/575 (3. 7%) 10/101 (9. 9%) 2. 54 (1. 15 to 5. 15) 0. 88 (0. 49 (01. 52) p < 0. 05 BAT2 hCV7514692 All Patients History of Congestive HeaA Failure (AE) 9. 0538 0. 0708 8. 3932 0. 0038 421796 (5. 3%) 41/575 (7. 1%) 13l101 (12. 9%) 266 (1. 32 to 5. 01) 1. 38 (0. 88 to 2. 15) p 0. 005 BCL2A1 hCV7509650 All Palfents Nonfatal MI (Probabie/Definite) 6. 0311 0. 049 5. 7126 0. 0168 1221807 (15. 1%) 61/572 (10. 7%) 11/95 (11. 6%) 0. 74 (0. 36 to 1. 36) 0. 67 (0. 48 to 0. 93) p < 0. 05 BCL2A1 hCV7509650 Ail Palfents Nonfatal MI (def & pmb) 7. 9668 0. 0186 7. 7732 0. 0053 1171807 (14. 5%) 64/572 (9. 4%) 11/95 (11. 6%%) 0. 77 (0. 38 to 1. 43) 0. 61 (0. 43 to 0. 86) p < 0. 05 CCL4 hCV12120554 All Patients Fatal CHD/Definite Nonfatal MI 5. 9309 0. 0149 5. 884 0. 0163118/1059 (11. 1%) 65/411 (15. 8%) 1. 50 (1. 08 to 2. 07) p-0. 05 TABLE 6, page 5 of 7 CCL4 HCVI 2120554 All Patients Fatal Coronary Heart Disease 13. 1864 0. 0003 12. 3436 0. 0004 29/1059 (2. 7%) 28/411 (6. 8%) 2. 60 (1. 52 to 4. 43) p < 0. 0005 CCL4 hCV12120554 AlI Paltents Total Mortality 9. 1271 0. 0025 8. 8684 0. 0029 55/1059 (5. 2%) 39/411 (9. 5%) 1. 91 (124 to 2. 92) p<0. 005 CCL4 hCV12120554 AlI PafienLs CardiovascularMortaiify 13. 9315 0. 0002 13. D944 0. 0003 33/1089 (3. 1%) 31/411 (7. 5%) 2. 54 (1. 53 to 420) p < 0. 0005 CCL4 hCV72120554 AlI Patients FalalAtherosderotic Cardiovascular Dtsease 13. 9315 0. 0002 13. 09440. 0003 33lions9 (3. 1%) 31/411 (7. 5%) 2. 54 (1. 53 to 4. 20) p<0. 0005 CCL4 hCV12120554 Ail Patients FafaUNonFatal Atherosclerottc CV oisease 4. 0079 0. 0453 4. 0002 0. 0455 401/1059 (37. 9%) 179/411 (43. 6%) 127 (1. 00 to 1. 59) p < 0. 05 CD22 hCV2631086 All PaNents Coronary Artery Bypass Graft iD. 9893 0. 0041 10. 0168 0. 0016 8&930 (9. 5%) 60/496 (10. 1%) 12/60 (24. 0%) 3. 02 (1. 47to6. 84) 1. 07 (0. 74to1. E4) p<0. 006 CD22 hCV2531086 AII Paitents Coronary Artery Bypass or Revasculartzatlon 7. 0879 0. 0289 6. 6326 0. 01 179930 (18. 8%) 94/496 (19. ou) 77150 (34. 0%) 2. 22 (1. 19 to 4. 03) 1. 01 (0. 76 to 1. 33) p < 0. 05 CD22 hCV2531086 All Patients Hosp. for Unstable Angina 7. 0207 0. 0299 6. 4786 0. 0109 162/930 (17. 4%) 86/496 (17. 3%) 16two (32. 0%) 2. 23 (1. 17 to 4. 08) 0. 99 (0. 74 to 1. 32) p<0. 05 CD hCV2553030 All Patients Congestive Heart Failure 7. 2236 0. 027 4. 9062 0. 0288 5&888 (6. 3%) 47/512 (9. 2%) lof76 (13. 2%) 2. 25 (1. 04 to 4. 44) 1. 50 (1. 00 to 225) p 10. 05 CD6 hCV2553030 All Patients Hosp. for Peripheral Arterial Disease 7. 4666 0. 0239 6. 4999 0. 0108 22/888 (2- %%) 14/512 (2. 7%) 6f76 (7. 9%) 3. 37 (1. 21 to 8. 12) 1. 11 (0. 55 to 2. 16) p < 0. 05 CDB hCV2559W0 All Patfenls History of Coronary Arlery Bypass GraR 1D. 2377 0. 006 10. 0806 0. 0015 210/888 (23. 8%) 161/512 (31. 4%) 19170 (25. 0%) 1. 08 (0. 61 to 1. 82) 1. 48 (1. 16 to 1. 89) p < 0. 005 C06 hCV2553030 Ail Patienis CARE MI : Non Q-Wave MI 6. 7337 0. 0345 5. 7915 0. 0161 69/888 p. 8 % J 51/512 (10. D) 12175 (16. 0%) 2. 26 (1. 12 to 4. 26) 1. 31 (0. 90 to 1. 92) p < 0. 05 CTSH hCV75882348 Ail Patients Percutaneous Transluminal CoronaryAngfapiasty 7. 1211 0. 0284 5. 6616 0. 0173131/1166 (11. 0%) 26/270 (9. 6%) 6/21 (28. 6%) 3. 22 (1. 13 to 8. 08) 0. 86 (0. 54 to 1. 32) p < 0. 05 CTSS hCV1789791 Ail Patients Fatal MI 8. 2495 0. 0162 4. 7645 0. 0291 5/606 (0. 8%) 5/673 (0. 7%) 6/196 (3. 1%) 3. 80 (1. 131013. 30) 0. 90 (0. 25 to 3. 25) p < 0. 05 CTSS hCV1789791 All Pa9ents H (story of Percutaneous Translumtnal Coronary Mgfoplasty 6. 4861 0. 039 5. 2065 0. 0225 1761606 (29. 0%) 229/673 (34. 0%) 74/166 (37. 8%) 1. 48 (1. 05 to 2. 07) 126 (0. 99 to 1. 60) p<0. 05 CYP4F2 hCV16179493 All Pa6ents Fafat Coronary Heart tsease 9. 3585 0. 0093 8. 497 0. 0036 39f720 (5. 4%) 14/629 (2. 2%) 4/125 (3. 2%) 0. 58 (0. 17 to 1. 47) 0. 40 (021 to 0. 72) p < 0. 005 CYP4F2 hCV76179493 All PaSents Tofal Mortalily 9. 4509 0. 0089 6. fui827 0. 0097 60/720 (8. 3%) 3D/629 (4. 8%) 4/125 (3. 2%) 0. 36 (0. 11 to 0. 90) 0. 55 (0. 35 to 0. 86) p<0. 05 CYP4F2 hCV16179493 AII Patients Congestive Heart Failure 7. 5512 0. 0229 4. 7724 0. 0269 68I720 (9. 4%) 39/629 (6. 2%) 5/125 (4. 0%) 0. 40 (0. 14 to 0. 92) 0. 63 (0. 42 to 0. 95) p<O. OS CYP4F2 hCV76179493 Ali Patfents Hosp. for Unstable Angina 8. 1794 0. 0167 3. 8637 0. 0493 138l720 (19. 2%) 95/629 (15. 1%) 31/125 (24. 8%) 1. 39 (0. 88to2. 15) 0. 75 (0. 56 to I. 00) p < 0. 05 CYP4F2 hCV18179493 All PaUents Cardiovascular Mortaiity 9. 0892 0. 0107 8. 0291 0. 0046 431720 (6. 0%) 17/829 (2. 7%) 4/125 (3. 2%) 0. 52 (0. 15 to 1. 31) 0. 44 (0. 24to0. 76) p<0. 005 CYP4F2 hCV16179493 All Pa4ents Fatal Atherosclerottc Cardiovascular Disease 9-a692 0. 0107 8. 0291 0_0046 43/720 (6. ou) 171629 (2. 7%) 4/125 (3. 2%) 0. 52 (0. 15 to 1. 31) 0-44 (024 to 0. 76) pu 0. 005 DDEF7 hCV7686234 All Patfents Fatal Coronary Heart Disease 9. 6484 0. 00B 9. 0687 0. 0026 26/464 (6. 0%) 18/727 (2. 5%) 1 lui283 (3. 9%) 0. 63 (0. 30 to 1. 25) 0. 40 (021 to 0. 72) p<O. OOS DDEF1 hCV7686234 All Patfents History oF Percutaneous T2nslumtnal Coronary Mgtoplasty 7. 0086 0. 0301 6. 9582 0. 0083 172/464 (37. 1%) 2161727 (29. 7%) 91/2/3 (32. 2%) 0. 80 (0. 59 to 1. 10) 0. 72 (0. 56 to 0. 92) p < 0. 05 EDN3 hCV3223182 All Patients Congestive Heart Failure 9. 3292 0. 0094 8. 0301 0. 0046 39/435 (9. 0%) 63/744 (8. 6%) 101204 (3. 4%) 0. 36 (0. 17 to 0. 70) 0. 94 (0. 62 to 1. 44) pu 0. 005 FCGR2A hCV9077561 All Patients Fatal Coronary Heart Disease 9. 2868 0. 0096 7. 4361 0. 0064 23 (363 (6. 3%) 26/737 (3. 5%) 8/377 (2. 1%) 0. 32 (0. 13 to 0. 70) 0. 54 (0. 30 to 0. 97) p<0. 05 FCGR2A hCV9077561 Ail Patients Total Mortaiity 8. 9741 0. 0113 8. 4427 0. 0037 33/363 (9. 1%) 47/737 (6. 4%) 14/377 (3. 7%) 0. 39 (0. 20 to 0. 72) 0. 68 (0. 43 to 1. 09) p < 0. 005 FCGR2A hCV9077561 All Padents Cardiovascular Mortalily 10. 1866 0. 0061 8. 823 0. 003 25/363 (6. 9%) 311737 (4. 2%) 8/377 (2. 1%) 0. 29 (0. 12to0. 63) 0. 59 (0. 35 to 1. 03) p<0. 005 FCGR2A hCV9077561 AiIPalients FatalAtherosderoticCarcJiovascularDisease 10. 1666 0. 0061 8. 823 0. 003 25/363 (6. 9%) 311737 (42%) 8/377 (2. 1%) 0. 29 (0. 12to0. 63) 0. 59 (0. 35101. 03) p<o. 0o5 IL12A hCV1403468 All Patients Coronary Artery Bypass Graft 0. 5881 0. 0083 9. 4081 0. 0022 91/1035 (8. 8%) 56/381 (14. 4%) 4/38 (tU. 5%) 1. 22 (0. 36 to 3. 15) 1. 75 (1. 22 to 2. 49) p<0. 005 IL12A hCV16053900 All Patients Stroke 6215 0. 0447 5. 596 0. 018 24/458 (5. 2%) 30/717 (4. 2%) 4/267 (1. 5%) 0. 28 (0. 08 to 0. 72) 0. 79 (0. 46tu1. 38) n<O. OS IL12A hCV16053900 All PaOents Catheterization 9. 2674 0. 0097 7. 7503 0. 0054 75/459 (16. 3%) 77/718 (10. 7%) 28/267 (10. 5%) 0. 60 (0. 37 to 0. 94) 0. 62 (osa4 to 0. 87) pu 0. 05 IL12A hCV76053900 All Patients Coronary Artery Bypass or Revascularizatton 9. 1727 0. 0102 7. 8217 0. 0052 1091459 (23. 7%) 133/718 (18. 5%) 40/267 (15. 0%) 0. 57 (0. 38 to 0. z 0. 73 (0. 55 to 0. 97) p<0. 05 IL12A hCV16053900 All Patients Total Coronary Heart Disease Events 5. 9977 0. 0498 5. 7793 0. 0162 171/459 (37. 3 %) 2531718 (35. 2%) 76/267 (28. 5%) 0. 67 (0. 48 to 0-93) 0. 92 (0. 72 to 1. 17) p<0. 05 IL12A hCV16053900 All Patfents FataVNonfatal Alherosclerotic CV Disease 9. 1922 0. 0101 8. 9378 0. 0028 1961459 (42. 7%) 286/716 (39. 8%) 84/267 (31. 5%) O. B2 (0. 45tu0. 84) 0. 89 (0. 70 to 1. 13) p<0. 005 IL12A hCVt 6053900 All PatfenLS Any Report of Stroke During CARE 8. 2797 0. 0159 6. 9438 0. 0084 25/459 (5. 4) 301718 (42 %) 3/267 (1. 1%) 0. 20 (0. 05 to 0. 57) 0. 76 (0. 44tu1. 31) p < 0. 05 IL12A hCV7fi053900 All Patients tst Stroke Occurred Dung CARE 6. 7045 0. 035 5. 7565 0. 0164 221459 (4. B%) 26/718 (3. 6%) 3/267 (1. 1%) 0. 23 (0. 05 to 0. 66) 0. 75 (0. 42tu1. 34) p < 0. 05 IL1RL1 hCV25607108 All PaHents DeMite Nonfatal MI 11. 894 0. 0026 5. 7708 0. 0163 531564 (9. 4%) 52/679 (7. 7%) 36/235 (15. 3%) 1. 74 (1. 10 to 2-74) 0. 80 (0. 54 to 1. 19) p<0. 05 IL1RL1 hCV25607108 All PaOents Fatal MI 7. 5954 0. 0224 5. 6238 0. 0149 2/664 (0. 4%) 8/679 (1. 2 ! 4) 6/236 (2. 6%) 7. 36 (1. 68 to 50. 40) 3. 35 (0. 84 to 22. 26) p 10. 05 IL1 RL1 hCV25607108 Ail Patlents Fatal CHD/Definlte Nonfatal MI 8. 5336 0. 014 6. 7904 0. 0092 64/564 (11. 3%) 781679 (11. 5%) 43235 (18. 3%) 1. 75 (1. 14 to 2. 66) 1. 01 (0. 71 to 1. 44) p<0. 05 IL1RL1 hCV25607108 All Pattents Fatal Coronary Heart Dtsease 6. 188 0. 0453 5. A909 0. 0152 131554 (23%) 34/679 (5. 0%) ion235 (4. 3%) 1. 88 (0. 79 to 434) 223 (120 to 4-43) p < 0. 05 IL1 RL1 hCV25607108 All Pattents Total Mortaliy 7. 1672 0. 0278 6. 9439 0. 0084 241554 (4. 3%) 54/679 (8. 0%) 16/235 (6. 8%) 1. 64 (0. 84 to 3. 13) 1. 94 (120 to 3. 24) p < 0. 05 IL1RL1 hCV25607108 All Patlents Hosp. for Unstable Angina 9. 0023 0. 0111 8. 4372 0. 0037 111/554 (19. 7%) 127/679 (18. 7%) 26/235 (11. 1%) 0. 51 (0. 32 to 0. 79) O. 94 (0. 71 to 1. 25) p < 0. 005 IL1RL1 hCV25607108 AII Patients Cardiovascular Mortality 7. 0779 0. 029 6. 7239 0. 0095 151554 (2. 7%) 39/679 (5. 7%) lOi235 (4. 3%) 1. 63 (0. 70 to 3. 64) 2. 23 (1. 24 to 421) p < 0. 05 IL1RL1 hCV25607108 All Pallents Fat21 Atherosclerolic Cardiovascular Dfsease 7. 0779 0. 029 6. 7239 0. 0095 15/554 (2. 7%) 39/679 (5-7%) 10/235 (4. 3%) 1. 63 (0. 70 to 3. 64) 2. 23 (1. 24 to 421)1) p < 0. 05 KIAA0329 hCV1662671 AII Patlents Stroke 6. 2709 0. 0435 3. 9375 0. 0472 35/639 (5. 2%) 21/620 (3. 4%) 2/157 (1. 3%) 0. 23 (0. 04to0. 78) 0. 64 (0. 36 to 1. 09) p<0. 05 IA0329 hCV1662671 All Palfents My Report oF Stroke DurinA CARE 6. 5108 0. 0386 4. 0999 0. 0429 361670 (5. 4%) 19/620 (3. 1%) 3/158 (1. 9%) 0. 34 (0. 08 to 0. 96) 0. 56 (0. 31 to 0. 97) p<0. 05 KIAA0329 hCV25751017 All Patlents MI (FataIlNonfatal) 9. 6857 0. 002 9. 1277 0. 0025 180N1365 (13. 2%) 20178 (25. 6%) 2. 27 (1. 30 to 3. 80) p<0. 005 KIAAU329 hCV25751017 All Patients Nonfatal MI (Pro6a61e/Definite) 9. 3425 0. 0022 8. 8902 0. 0029169/1365 (12. 4%) 19/78 (24. 4%) 2. 28 (1. 30 to 3. 85) p<0. 005 KIAA0329 hCV25751017 Ail Patlents Fatal CHD/Deflnite Nonfatal MI 6. 6912 0. 0097 6. 4342 0. 0112 162N365 (11. 9Y)'17178 (21. 8%) 2. 07 (1_15 to 3. 55) p < 0. 05 KIAA0329 hCV25751017 Ail Pallents Nonfatal MI (def & prob) 7. 0931 0. 0077 6. 8051 0. 0091 159/1365 (11. 6%) 17/78 (21. 6%) 2. 11 (1. 17 to 3. 63) p<0. 05 KIAA0329 hCV2575l017 All Patients FataUNonfatal Mi (def & prob) 9. 8958 0. 0017 9. 4086 0. 0022 178/1365 (13. 0%) 20/78 (25. 6%) 230 (1. 32 to 3-85) p < 0. 005 KIAA0329 hCV25751017 All Palfents History oF Angina Pectods 5. 8485 0. 0156 5. 6948 0. 017 266/1365 (19. 5%) 24/78 (90. 6%) 1. 84 (1. 10 to 2. 99) p < 0. 05 KIAA0329 hCV25751017 All Patients History of CongesHve Heart Failure (AE) 14. 6298 0. 0001 13. 1769 0. 0003 79/1365 (5. 8%) 13/78 (16. 7%) 3. 26 (1. 66 tao 5. 98) p < 0. 0005 KIAA0329 hCV25751017 All Patients Mor'Than 1 PdorMl 9. 2578 O. OD23 8. 8444 0. 0029 195/1365 (14. 3%) 21/78 (26. 9%) 2. 21 (128 to 3. 67) p<O. OOB KLK1 hCV8705506 All Patlents Congestive Heart Failure 8. 9138 0. 0116 7. 7742 0. 0053 441660 (6. 7%) 47/664 (7. 1%) 21/155 (13. 5%) 2. 19 (1. 24 to 3. 77) 1. 07 (0. 70 to 1. 64) p < 0. 05 KLK1 hCV8705506 All Patients More'ihan 1 Prior MI 11. 8625 O. OD27 7. 535 0. 0061 97/660 (14. 7%) 86/664 (13. 0%) 37/155 (23. 9%) 1. 82 (1. 18 to 2. 77) 0. 86 (0. 63 to 1. 18) p<0. 05 KLK14 hCV16044337 All Pallents MI (FataIlNonfatal) 11. 9595 0. 0025 11. 623 0. 0007 81/685 (11. 8%) 89/629 (14. 1%) 35/156 (22. 4 ) 2, 76 (1. 37 to 3. 33) 1. 23 (0. 89 to 1. 70) p < 0. 005 KLK14 hCV16O44337 All Patients Nonfatal MI (Probable/Deflnite) 10. 3731 0. 0086 9. 8772 0. 0017 79/685 (11. 5%) 81/629 (12. 9%) 33/156 (21. 2%) 2. 06 (1. 30 to 3. 20) 1. 13 (0. 81 to 1. 58) p<0. 005 KLK14 hCV16044337 All Patlents Definite Nonfafal MI 8. 8701 0. 0119 8. 2722 0. 004 57f685 (8. 3%) 58/629 (9. 2%) 25/159 (16. 0%) 2. 10 (1. 25 to 3. 45) 1. 12 (0. 78 tao 1. 64) p- : 0. 005 KLK14 hCV16044337 All Palients Fatal MI 11. 2134 0. 0037 8. 3119 0. 0039 2/685 (0. 3%) 9/629 (1. 4%) 5/156 (3. 2%) 11. 31 (2. 41 to 79. 44 : 4. 96 (1. 27 to 32. 60) p<0. 005 KLK14 hCV16044337 Ail Patlents Coronary Artery Bypass Graft 6. 4727 0. 0393 6. 2691 0. 0123 571685 (8. 3%) 791629 (12. 6%) 15/156 (9. 6%) 1. 17 (0. 62 to 2. 08) 1. 58 (1. 11 to 2. 27) p<0. 05 KLK14 hCV16644437 AII Patlents Fatal CHD/DeM (te Nonfatal MI 112734 0. 0036 10. 8986 0. 001 731685 (10. 7%) 79/629 (12. 6%) 32/156 (20-5%) 2-16 (1. 35 to 3-40) 1-20 (0. 86 to 1. 69) p < 0. 005 KLK14 hCV16044337 All Patients Nonfatal MI (def & pmb) 11. 0705 0. 0039 10. 1263 0. 0015 75/665 (10. 9% i 74/629 (11. 8%) 32/156 (20. 5%) 2. 10 (1. 32 to 3. 29) 1. 08 (0. 77 to 1. 53) p < 0. 005 KLK14 hCV16044337 All Patlents FataIINonfatal MI (def & prob) 12. 3831 0. 002 12. 0168 0. 0005 80/685 (11. 7%) 88/629 (14. 0%) 35il56 (22. 4%) 2. 19 (1. 39 to 3. 38) 1. 23 (0. 89 to 1. 70) p < 0. 005 KLK14 hCV16044337 All Palients Hfstory of iabetes 7. 2874 0. 0262 7. 1207 0. 0076 91/685 (13. 3% ) 93/629 (14. 8%) 341156 (21. 8%) 1. 82 (1. 16 to 2. 80) 1. 13 (0. 83 to 1. 55) p < 0. 05 KLK14 hCV16o44337 All Patlents Famlly History of CV Dfsease 7. 7839 0. 0204 7. 6659 0. 0056 294/685 (42. 9%) 258/629 (41. 0%) 48/156 (30. 8%) 0. 59 (0. 40 to 0. 85) 0. 92 (0. 74 to 1. 15) p < 0. 05 LAMA2 hCV1819516 All Patlents Hosp. for Unstabie Angina 6. 7501 0. 0342 5. 5114 0. 0189 1341769 (17. 4%) 98/588 (16. 7%) 32/121 (26. 4%) 1. 70 (1. OB to 2. 64) 0. 95 (0. 71 tM. 26) p 0. 05 MARK3 hCV25926178 Ail Patienls MI (FataUNonfatal) 8. 101 0. 0174 7. 1106 0. 0077 62/573 (10. 8%) 104/643 (16. 1%) 37/228 (16. 2%) 1. 60 (1. 02 to 2. 47) 1. 58 (1. 13 fui 2. 22) p<0. 05 TABLE 6, page 6 of 7 MARK3 hCV25926178 All Patients Nonfatal MI (ProbabIelDefinite) 8. 8132 0. 0122 7. 3651 0. 0067 57/573 (9. 9%) 9B1646 (15. 2%) 36f228 (15. 8%) 1. 70 (1. 08 to 2. 65) 1. 62 (1. 15 to 230) p < 0. 05 MARK3 hCV25926178 All Patten4s efinite Nonfatal MI 6. 5601 0. 0376 6. 4606 0. 011 41/573 p. 2%) 74/646 (11. 5%) 22/229 (9. 6%) 1. 39 (0. 79 to 2. 36) 1. 68 (1. 13 to 2. 52) p < 0. 05 MARK3 hCV25826178 AII Patients Nonfatat MI (def & prob) 9. 5045 0. 0086 8. 4948 0. 0036 52/573 (9. 1%) 94/646 (14. 6%) 3331228 (14. 5%) 1. 70 (1-06 to 2. 69) 1. 71 (1. 20 to 2. 46) p < 0. 005 MARK3 hCV25926178 All Paltents FataVNonfaal MI (def & pmb) 8. 3633 0. 0153 7. 2345 0. 0072 but1573 (10. 6%) 1031848 (15. 9 %) 37f228 (16. 2%) 1. 63 (1. 04 to 2. 52) 1. 59 (1. 14 to 2. 24) p<0. 06 MARK3 hCV25926771 Ail PaHenLS MI (FataVNonfatal) 10. 7762 0. 001 10. 5972 0. 0011 58/566 (10. 2%) 1441879 (16. 4%) 1. 72 (1. 25 to 2. 39) p<0. 005 MARK3 hCV25926771 All Patients Nonfatal MI (Proba6le/Defin (le) 12. 7866 0. 0003 12. 5077 0. 0004 521566 (9. 2%) 138/879 (15. 7%) 1. 84 (1. 32 to 2. 60) p< 0. 0005 MARK3 hCV25926771 All Patients Definite Nonfatal MI 9. 3959 0. 0022 9. 1721 0. 0025 37/566 (6. 6%) 100/879 (11. 4%) 1. 84 (1. 25 to 2. 75) p <0. 005 MARK3 hCV25926771 Ail Patlents Fatal CH/Definite Nonfalal MI 5. 8825 0. 0153 5. 8181 0. 0159 56/566 (9. 9%) 125f879 (14. 2%) 1-51 (1. 09 to 2. 12) p<O. OS MARK3 hCV25926771 All Patlents Nonfatal MI (def & prob) 12. 688 0. 0004 12. 38640. 0004 AS/566 (8. 5%) 1301879 (14. 8%) 1. 87 (1. 33 to 2. 68) p< 0. 0005 MARK3 hCV25926777 All Patienls FataVNonfalal MI (def & prob) 11. 0905 0. 0009 10. 8977 0-001 57/566 (10. 1%) 1431879 (16. 3%) 1. 74 (1. 26 to 2. 42) p < 0. 005 MARK3 hCV25926771 All Patients 1st Stroke Occurred During CARE 4. 1518 0. 0416 4. 0167 0. 045 13/566 (2. 3%) 38/679 (4. 3%) 1. 92 (1. 04 to 3. 78) p<O. OS MMP27 hCV7492597 All Palients Percufaneous Transiuminal Coronary Mgloplasty 6. 0292 0. 0491 5. 8699 0. 0154 59l668 (8. 8%) 84/645 (13. 0%) 19/160 (11. 9%) 1. 39 (0. 79 to 2. 37) 1. 55 (1. 09 to 2. 21) p < 0. 05 MMP27 hCV7492601 All Patfents Percutaneous Transiuminal Coronary Anglopasty 8. 7778 0. 0124 8. 6086 0. 0033 36/449 (8. 0%) 81/715 (11. 3%) 46l310 (14. 8%) 2. 00 (1. 26to3. 19) 1. 47 (0. 98 to 2. 23) p<0. 005 MMP27 hCV7492601 All Pattents Cathetezation 8. 8894 0. 0117 7. 5393 0. 006 47/449 (10. 5%) 84in15 (11. 7%) 54/310 (17. 4%) 1. 80 (1. 18 to 2. 76) 1. 14 (0. 78 to 1. 07) p 0. 05 MMP27 hCV7492601 All Patfents Total Mortality 6. 5936 0. 037 5. 9846 0. 0144 38/449 (8. 5%) 44f715 (6. 2%) 12/310 (3. 9%) 0. 44 (021 to 0. 82) 0. 71 (0. 45 to 1. 12) pu 0. 05 NUDT6 hCV25956925 All Pattents Htstory of Hypertension 9. 7172 0. 0078 8. 9124 0. 0028 317/789 (40. 4%) 254/571 (44. 5%) 651t18 (55. 1%) 1. 81 (1. 23 ta 2. 88) 1. 18 (0. 95 to 1. 47) p<0. 005 PLAT hCV12108245MPauentsComnaryArteryBypa6sorRevascuMzat) on 4. 9189 0. 0266 4. 5384 0. 0331 280/1407 (19. 9%) 5160 (8. 3%) 0. 37 (0. 13 to 0. 84) p < 0. 05 PON2 hCV8952817 All Patients CARE MI : Q-WaveM) 9. 1S57 0. 0401 4. 9557 0. 026 570/872 (65. 4%) 3221524 (81. 5%) 44/83 (53. 0%) 0. 60 (0. 38 to 0. 94) 0. 84 (0. 67 to 1. 06) p < 0. 05 PPOX hCV25922816 All Palients Percutaneous Transluminal Coronary Angioplasty 9. 1866 0. 0101 4. 8253 0. 028 129/1264 (10. 2%) 28/178 (15. 7%) 2/5 (40. 0%) 5. 87 (0. 77 to 35. 70) 1. 64 (1. 04 to 2. 52) p < 0. 05 PPOX hCV25922816 All Palfents Coronary Artery Bypass or Revascuiarizatton 12. 759 0. 0017 7. 4351 0. 0064 23111264 (18. 3%) 46/178 (27. 0%) 3/5 (60. 0%) 6. 70 (1. 11 to 51. 14) 1. 65 (1. 14 to 2. 35) p<0. 05 PPOX hCV25922816 All Paltents Hosp. for Cardiovasaiar Disease 7. 7482 0. 0208 5. 5017 0. 019 57711264 (45. 6%) 98/176 (55. 1%) 4/5 (80. 0%) 4. 76 (0. 70 to 9324) 1. 46 (1. 06 to 2. 00) p < 0. 05 PPOX hCV25922816MPanentsHosp. forUnstab) eAngha 7. 8955 0. 0193 7. 7455 0. 0054 21111264 (16. 7%) 45/178 (25. 3%) 1/5 (20. 0%) 1. 25 (0. 06 to 8. 48) 1. 69 (1. 16 to 2. 43) p < 0. 05 PPOX hCV25922816 All Patients Total Coronary Heart Disease Events 9. 8483 O. OO73 8. 3457 0. 0039 42lf264 (33. 3%) 791178 (44. 4%) 3/5 (60. 0%) 3. 00 ( (1. 50 to 22. 87) 1. 60 (1. 16 to 2. 19) p< 0. 005 PPOX hCV25922816 Ail Pattents Total Cardiovascular Disease Events 8. 7618 0. 0125 6. 6786 0. 0098 593/1264 (46. 9%) 1021178 (57. 3%) 4/5 (80. 0%) 4. 53 (0. 67 to 88. 61) 1. 52 (1. 11 to 2. 09) p 0. 05 PPOX hCV25922816 Ail Pa11ents FataI/Nonfatal Atherosclerollc CV Disease 10. 5783 O. U05 7. 0358 0. 008 479/1264 (37. 9%) 86/178 (48. 3%) 4/5 (80. 0%) 9. 56 (0. 97) 0128. 35 : 1. 53 (1. 12 to 2. 10) p<0. 05 PRG7 hCV1842400 All Patients Fatal MI 11. 4732 0. 0032 82891 0-0121 1111007 (1. 1 %) 2/415 (0. 5%) 3/54 (5. 6%) 5. 33 (1. 18 to 17. 69) 0. 44 (0. 07 to 1. 64) p < 0. 05 PRG1 hCV1842400 All Patients Fatal Coronary Heart Dtsease 8. 8239 0. 0121 7. 7888 0. 0053 33/1007 (3. 3%) 181415 (4. 3%) 6/54 (11. 1 %) 3. 69 (1. 34 tao 8. 66) 1. 34 (0. 73 to 2 30) p 0. 05 PRG1 hCV1842400 All Patients FataUNonfatal MI (deF & prab) 6. 2693 0. 0435 3. 8612 0. 0494 143/1007 (14. 2%) 49/416 (11. 8%) 13/54 (24. 1%) 1. 92 (0. 97 to 3. 57) 0. 81 (0. 51 to 1. 14) p < 0. 05 PRGI hCV1842400 AlI Patients Cardiovascular Mortality 6. 555 0. 0377 5. 9856 0. 0144 39/1007 (3. 9%) 191415 (4. 6%) 6/64 (11. 1%) 3. 10 (1. 14 to 7. 19) 1. 19 (0. 67 to 206) p < O. 05 PRG1 hCV1842400 All Patients Fatal Atherosclerotic Cardiavascular Disease 6. 555 0. 0377 5. 9856 0. 0144 3911007 (3. 9%) 191415 (4. 6%) 6154 (11. 1 %) 3. 10 (1. 14 to 7. 19) 1. 19 (0. 67 to 2. 06) p, 0. 05 PTGIS hCV2782570 All Patients FalaUNonfatal Cerebrovascular Disease 7. 804 0. 0202 6. 0104 0. 0142 51/558 (9. 1%) 371674 (5. 5%) 12/238 (5. 0%) 0. 53 (0. 26 to 0. 98) 0. 58 (0. 37 to 0. 89) p < 0. 05 PTGIS hCV2782570 Ail Pattents My Report of Strake PBOr to or During CARE 7. 068 0. 0292 6. 1437 0. 0132 46/556 (8. 2%) 321674 (4. 7%) 12/238 (5. 0%) 0. 59 (0. 29 to 1. 10) 0. 55 (0. 35 to 0. 88) p<0. 05 PTPN21 hCV16182835 All Pattents Stroke 12. 2467 0-0022 11. 12650-0009 14/615 (2. 3%) 31/671 (4. 6%) 13N62 (8. 0%) 3. 75 (1. 70 to 8. 18) 2. 08 (1. 12 to 4. 07) p < 0. 005 PTPN21 hCV16182035 Ail Patienls FalaVNonfatal Cerebrovaswlar Disease 6. 7201 0. 0347 5. 5243 0. 0188 30/615 (4. 9%) 511673 (7. 6%) 16/162 (9. 9%) 2. 14 (1. 11to3. S7) 1. 60 (1. 01 tD 2. 67) p < 0. 05 PTPN21 hCV16182835 All Patients Any Report a (Stroke Prior to or DurinHCARE 11. 8249 0. 0027 10. 3066 0. 0013 24/615 (3. 9%) 481673 p. 1 %) 171762 (10. 5%) 2. 69 (1. 49 to 5. 49) 1. 69 (1. 16 to 3. 17) p < 0. 005 PTPN21 hCV16182835 NI PaGents Any Report of Stroke During CARE 12. 2355 0. 0022 11. 1265 0. 0009 14/615 (23%) 311673 (4. 6%) 13/162 (8. 0%) 3. 75 (1. 70to8. 18) 2. 07 (1. 11to4. 05) p<0. 005 PTPN21 hCV16182835 Ail Patienis 1sl 5troke OccurreU DurinACARE 12. 1541 0. 0023 11. 0615 0. 0009 12/615 (2. 0%) 27/673 (4. 0%) 12/162 (7. 4%) 4. 02 (1. 75 to 9. 22) 2. 10 (1. 08to4. 34) p<0. 005 PTPN21 hCV25942539 All Patients Siroke 9. 372 0. 0OB2 8. 6113 0. 0033 16/620 (2. 6%) 311671 (4. 6%) 72N555 (7. 7%) 3. 17 (1. 44 to 6. 81) 1. 83 (1. 00to3. 46) p < 0. 005 PTPN21 hCV25942539 All Patients Any Report of Stroke Prior to or During CARE 9. 804 0. 0074 8. 5121 0. 0035 261620 (4. 2%) 481673 (7. 1%) 16/155 (10. 3%) 2. 63 (1. 35 to 4. 99) 1. 75 (1. 08 to 2. 90) p<0. 005 PTPN21 hCV25942539 All Patients Any Report of Stroke During CARE 9. 3606 0. 0093 8. 6114 0. 0033 161620 (2. 6%) 31/673 (4-6%) 12/155 (7. 7%) 3. 17 (1. 44) 06. 81) 1. 82 (1. 00 to 3. 45) p < 0. 005 PTPN21 hCV25942539 AII Patlenls 1st Stroke Occurred Dudng CARE 9. 0284 0. 011 8. 367 0. 0038 141620 (2. 3%) 27/673 (4. 0%) 11/155 (7. 1%) 3. 31 (1. 44 to 7. 42) 1. 81 (0. 95 to 3. 58) p < 0. 005 PTPRJ hCV25943544 All Patfents Stroke 8. 0699 0. 0177 4. 9043 0. 0268 15/455 (33%) 23f709 (32%) 21/307 (6. 8%) 2. 15 (1. 10 to 4. 32) 0. 98 (0. 61 to 1. 94) p < 0. 05 PTPRJ hCV25943544 All Patients Any Report of Stroke During CARE 12. 2226 0. 0022 6. 4092 0. 0114 16/455 (3. 3%) 211710 (3. 0%) 23/308 (7. 5%) 2. 37 (1. 23 to 4. 71) 0. 89 (0. 46 to 1. 78) p < 0. 05 SCARFt hCV12114319 All Paitents Percutaneous Translumfnal Coronary Angtoplasty 6. 3674 0. 0414 5. 0636 0. 0244 51/520 (9. 8%) 70/694 (10. 1%) 40/261 (15. 3%) 1. 66 (1. 06 to 2. 59) 1. 03 (0. 77 to 1. 51) p < 0. 05 SERPINA1 hCV25640505 AII Patients Coronary Artery Bypass raft 6. 8645 0. 0323 6. 6037 0. 0102 86f7O5 (12. 2%) 43/413 (10. 4%) 18/277 (6. 5%) 0. 50 (0. 29to0. 83) 0. 84 (0. 56 to 1. 23) p<0. 05 SERPINA1 hCV25640505 All Palfents Any Report of Stroke Pdor to or Dudng CARE 6. 1297 0. 0467 4. 7864 0. 0287 48/705 (6. 8%) 151413 (3. 6%) 21/277 p. s%) 1. 12 (0. 65 to 1. 89) 0. 52 (0. 28 to 0. 91) p 0. 05 SERPINB6 hCV16190893 All Patients FataI/Nonfatal Cerebrovascular Dfsease 10. 0396 0. 0066 3. 9528 0. 0468 53/732 (7. 2%) 301603 (5. 0%) 17/138 (12. 3%) 1. 80 (0. 98 tu 3. 15) 0. 67 (0. 42 to 1. 06) p < 0. 05 SERPINB6 hCV16190893 All Pattents FataUNonfatal Atherosclerotic CV oisease 7. 2903 0. 0291 6. 6856 0. 0171 2861732 (39. 1%) 227/603 (37. 6%) 69in38 (50. 0%) 1. 56 (1. 08 to 2. 25) 0. 94 (0. 75 to 1. 18) p < 0. 05 SERPINBB hCV3023236 All Pat (ents MI (Fatal/Nonfatal) 9. 4616 0. 0088 6. 3892 0. 0115 91/515 (17. 7%) 85/683 (12. 4%) 301277 (10. 8%) 0. 57 (0. 36 to 0. 87) 0. 66 (0. 48 to 0. 91) p < 0. 05 SERPINBB hCV3023236 Ail Pat7ents Nonfatal MI (Probable/Definite) 8. 0517 0. 0178 5. 6357 0. 0176 85/515 (16. 5%) 80/683 (11. 7%) 29/277 (10. 5%) 0. 59 (0. 37 to 0. 92) 0. 67 (0. 48 tao 0. 93) p < 0. 05 SERIN38 hCV3023236 All Patients Nonfatal Mi (def & prcib) 7. 7449 0. 0208 5. 3663 0. 0206 80/515 (15. 5%) 75/683 (11. 0%) 27/277 (9. 7%) 0. 59 (0. 36 tu 0. 92) 0. 67 (0. 48tu0. 94) p < 0. 05 SERPINBB hCV3023236 Ail PaHenls FataIINonfatal MI (deF & prob) 8. ut7 0. 0155 5. 772 0. 0163 891515 (17. 3%) 85/683 (12. 4%) 30/277 (10. 8%) 0. 58 (0. 37 to 0. 90) 0. 68 (0. 49 to 0. 94) p-0. 05 SERPINB8 hCV3023236 All Patients FataIMonfatal Atherosclerotic CV Oisease 6. 6908 0. 0352 4. 0053 0. 0454 214/515 (41. 6%) 2451683 (35. 9%) 121/277 (43. 7%) 1. 09 (0. 81 to 1. 47) 0. 79 (0. 62 to 1. 00) p < 0. 05 SN hCV25623265 All Palienis Percutaneous Transluminal Coronary Angiopiasty 7. 1386 0. 0282 5. 7749 0. 0163 57/396 (14. 4%) 76/745 (10. 2%) 29/337 (8. 6%) 0. 56 (0. 35 to 0. 89) 0. 68 (0. 47 to 0. 98) p<0. 05 SN hCV25623265 All Patients Cathelerizatfon 14. 4805 0. 0007 124057 0. 0004 71/396 (17. 9%) 76/745 (10. 5%) 36/337 (10. 7%) 0. 55 (0. 35 to 0. 84) 0. 54 (0. 38 to 0. 76) p < 0. 0005 SN hCV25623265 Ail Patients Coranary Artery Bypass or Revascularization 11. 6208 0. 003 9. 3889 0. 0022 99/396 (25. 0%) 135/745 (18. 1%) 531337 (15. 7%) 0. 56 (0. 38 to 0. 81) 0. 66 (0. 50 to 0. 89) p<0. 005 SN hCV25623265 All PatieOlS Hosp. for CaMtovascular DIsease 6. 7526 0. 0342 5. 2835 0. 0215 2011395 (50. 8%) 3251745 (43. 6%) 1ou337 (49. 9%) 0. 96 (0. 72 to 1. 29) 0. 75 (0. 59 tv 0. 9B) p < 0. 05 SN hCV25623265 Ail Patients Hosp. for Unstable Angina 7. 1878 0. 0275 6. 7216 0. 0095 861396 (21. 7%) 1291745 (17. 3%) 481337 (14. 2%) 0. 60 (0. 40 to 0. 88) 0. 75 (0. 56 to 1. 03) p < 0. 05 SN hCV25623285 All Patfenls History of Siroke 8. 5497 0. 0139 6. 7929 0. 0092 31396 (D. B9b) 27f745 (3. 6%) 81337 (2. 4%) 3. 19 (0. 91 to 14. 63) 4. 93 (1. 73 to 20. 71) p<0. 05 SN hCV2992252 All Patients Coronary Artery Bypass Graft 6. 3825 0. 0411 5. 345 0. 0208 691539 (12. 8%) 62f710 (8. 7%) 19/224 (8. 5%) 0. 63 (0. 36 to 1. 06) 0. 65 (0. 45 to 0. 94) p < 0. 05 SN hCV2992252 All Patienis Cathetezatlon 9. 4523 0. 0089 7. 3988 0. OOfi5 8615539 (16. 0%) 76/710 (10. 7%) 22/224 (9. 8%) 0. 57 (0. 34 to 0. 93) 0. 63 (0. 45) 00. 88) p<0. 05 SN hCV2992252 Afl Patients Coronary Artery Bypass af RevascuarizaHon 9. 8313 0. 0073 7. 0387 O. OOB 126/539 (23. 4%) 1261710 (17. 7%) 33/224 (14. 7%) 0. 57 (0. 37 to 0. 85) 0. 71 (0. 54 to 0. 93) p < 0. 05 SN hCV2992252 All Patients Hosp. for Unstable Angina 6. 0158 0. 0494 5. 3573 0. 0206 111/539 (20. 6%) 1221710 (17. 2%) 30/224 (13. 4%) 0. 60 (0. 38 to 0. 91) 0. 80 (0. 60 to 1. 07) p<0. 05 SOAT2 hCV15962586 All Patienis Coronary Artery Bypass Graft 6. 397 0. 0408 5. 9871 0. 0144 98f1007 (9. 7%) 45/430 (10. 5%) 9/41 (22. 0%) 2. 61 (1. 14 to 5. 41) 1. 08 (0. 74 to 1. 56) p<0. 05 SOAT2 hCV15962586 AII Palients Total Mortality 6. 4718 0. 0393 5. 1538 0. 0232 75fol 007 (7. 4%) 18/430 (4. 2%) 1/41 (2. 4%) 0. 31 (0. 02 to 1. 46) 0. 54 (0. 37 to 0. 90) p < 0. 05 SPARCL7 hCV8827241 All Patients MI (FataVNonfatal) 10. 1729 0. 0062 6. 3913 0. 0115 77l577 (13. 3%) 82/675 (12. 1%) 45/218 (20. 6%) 1. 69 (1. 12 to 2. 53) 0. 90 (0. 64 to 1. 25) p<0. 05 SPARCL1 hCV8827241 All Patients Nonfatal Mi (Probable/Definite) 7-4988 0-0235 5-4507 0-0196 711577 (12-3%) 80/675 (11. 9%) 41/218 (13. 8%) 1. 65 (1. OB to 2-50) 0-96 (0. 68 to 1. 35) p < 0. 05 SPARCL1 hCV8827241 AlI Palients Nonfatal Ml (def & prob) 9. 0581 0. 0108 6. 0662 0. 0138 671577 (11. 6%) 73/675 (10. 8%) 40/218 (18. 3%) 1. 71 (1. 11 to 2. 61) 0. 92 (0. 65 to 1. 31) p < 0. 05 TABLE 6, page 7 of 7 SPARCL1 hCV8827241 AllPauenls FabaUNonfablMl (def&prob) 9. 436 0. 0089 5. 6592 0. 0174 77/577 (13. 3%) 81/675 (12. 0%) 44/218 (20. 2%) 1. 64 (1. 09 to 2. 46) 0. 89 (0. 63 to 1. 24) p<0. 05 SPARCL1 hCV8827241 All Totel Coranary Heart Disease Events 8. 9684 0. 0113 8. 2806 0. 004 188/577 (32. 6%) 2281675 (33. 8%) 95/218 (43. 6 %) 7. 60 (i. i6 to 220) 1. 06 (0. 83 to 1. 34) p < 0. 005 SPARCL1 hCV8827241 Ail Patients Total Cardiovascular D (sease Events 5. 9975 0. 0498 4. 5295 0. 0333 274/577 (47. 5%) 3151675 (46. 7%) 122/218 (56. 0%) 1. 41 (1. 03 to 1. 93) 0. 97 (0. 77 to 1. 21) p<0. 05 SPARCL1 hCV8827241 Ali Patients More Than 1 Prior MI 7. 4735 0. 0238 5. 1023 0. 0239 96/577 (16. 6%) 82/675 (12. 1%) 4ol218 (1a3%) 1. 13 (0. 74 to 1. 68) 0. 69 (0. 50 to 0. 95) p 0. 05 SPATA7 hCV2485037 All FabUNonmblCerebwvascularDisease 7. 2724 0. 0264 5. 2324 0. 0222 43/465 (9. 2%) 4A1725 (6. 1%) 111250 (4A-6) 0. 45 (0. 22 to 0. 86) 0. 63 (0. 41toO. 96) p 0. 05 SPATA7 hCV2485037 Ail Patienls History of Percufaneous Transluminal Coronary Angioplasty 6. 9271 0. 0313 5. 2953 0. 0214 171/465 (36. 8%) 2201725 (30. 3%) 721250 (28. 8%) 0. 70 (0. 50 to 0. 97) 0. 75 (0. 59 to 0. 96) p < 0. 05 SPATA7 hCV2485037 AllPaüents AnyRepodofStwkePdortoorDudngCARE 9. 9552 0. 0069 7. 3899 0. OOB6 41/465 (8. 8%) 40/725 (5. 5%) el2sO (32%) 0. 34 (0. 15to0. 70) 0. 60 (0. 38 to 0. 95) p < 0. 05 SPATA7 hCV2485037 All Patients Any Report of SWke During CARE 9. 8656 0. 0072 6. 823 D. 009 29/465 (6. 2%) 261725 (3. 6%) 41250 (1-6%) 0. 24 (0. 07 to 0. 63) 0. 5s (0. 32 to o. ss) p < 0. 05 SPATA7 hCV2485037 All Patients Ist Stroke Occurred During CARE 7. 4687 0. 0239 5. 2807 0. 0216 25/465 (5. 4%) 23n25 (32%) 41250 (1. 6%) 0. 29 (0. 08 to 0. 75) 0. 58 (0. 32 to 1. 03) p 0. 05 TGFB1 hGV22272997 All Patients Total Mortality 7. 6472 0. 023 6. 5204 0. 0107 221538 (4. 1%) 52/6787. 7%} 20/2547. 9%) 2. 00 (1. 07to3. 75) 1. 95 (1. 18 to 3. 31) p < 0. 05 TGFB1 hCV22272997 Ail Palients Card (ovascutar Mortality 7. 8062 0. 0202 6. 1764 0. 0129 13/538 (2. 4%) 36/678 (5. 3%) 15/254 (5. 9%) 2. 53 (1. 19 to 5. 49) 2. 26 (1. 22to4. 47) p<0. 05 TGFB1 hCV22272997 All Patients Fatal Atherosclerotic Cardavascular Disease 7. 8082 0. 0202 6. 1764 0. 0129 13/538 (2. 4%) 36/678 (5. 3%) 15/254 (5. 9%) 2. 53 (1. 19to5b49) 226 (1. 22to4. 47) p 0. 05 TGFB1 hCV22272997 All Palients More Than 1 Pdor MI 8. 2241 0. 0164 7272 0_007 631538 (11. 7% j 109/678 (16. 1%) 48/254 (18. 9%) 1. 76 (1. 16to2. 64) 1. 44 (1. 04to2. 02) p 0. 05 TGOLN2 hCV25615626 All PaHents Percutaneous Transluminal CoronaryMgtoplasty 12. 3407 0. 0021 10. 0079 0. 0016 52/548 (9. 5%) 68/676 (10. 1%) 43/246 (17. 5%) 2. 02 (1. 30to3. 12) 1. 07 (0. 73to1. 57) p 0. 005 TGOLN2 hCV25615626AUPaUents CoronarYAreryBypassorRevasculadzabon 8. 9099 0. 0116 8. 6407 0. 0033 93/548 (17. 0%) 130/676 (19. 2%) 64/246 (26. 0%) 1. 72 (1. 20to2. 47) 1. 16 (0. 87 to 1. 57) p < 0. 005 TGOLN2 hCV25615626 All Patients Hosp. for Unstable ngina 7. 1053 0. 0286 5. 8082 0. 016 80/545 (14. 6%) 130/676 (19. 2%) 53/246 (21. 5%) 1. 61 (1. 09to2. 36) 1. 39 (1. 03to1. 89) p 0. 05 TGOLN2 hCV25615626 All Palients History of Angina Pectofss . 2218 0. 027 6. 5235 0. 0106 99/548 (18. 1%) 129/676 (19. 1%) 64/246 (26. 0%) 1. 60 (1. 11to2. 28) 1. 07 (0. 80to1. 43) p 0. 05 TGOLN2 hCV25615626 All Patients History of Stroke 9. 4434 0. 0089 5. 15 0. 0232 22/548 (4. 0%) 15/676 (2. 2%) 1/246 (0. 4%) 0. 10 (0. 01 to 0. 47) 0. 54 (0. 27to1. 05) p<0. 05 TGOLN2 hCV25615626 All Patients Any Report of Stroke Prior to or During CARE 7. 8803 0. 0194 5. 2621 0. 0218 45/548 (8. 2%) 35/676 (5. 2%) 9/246 (3. 7%) 0. 42 (0. 19 to 0. 84) 0. 61 38to096) p 0. 05 TLR6 hCY25615376 AllPattents CaüteteNzaEon 5. 1613 0. 0231 4. 9743 0. 0257 17211407 (12. 2%) 14/64 (21. 9%) 2. 01 (1. 05 to 3. 62) p<0. 05 TLR6 hCV25615376 AII Pafients CARE MI : Q-Wave MI 5. 1695 0. 023 4. 9974 0. 0254 880/1407 (62. 5%) 49/64 (76. 6%) 1. 96 (1. 11 to 3. 64) p < 0. 05 TNFRSF10A hCV11852251 AllPaUents AnyRePodoFStrokeDuHngCARE 10. 8967 0. 0043 9. 2159 0-0024 7/453 (1. 5%) 34/712 (4. 8%) 181309 (5. 8%) 3. 94 (1. 69to10. 24) 3. 20 (1. 49to7. 92) p<0. 005 TNFRSF1DA hCV11852251 AllPaüents 1stStwkeOccumdDudngCARE 15. 0864 0. OOD5 12. 0652 0. 0005 4/453 (0. 9%) 30/712 (4. 2%) 181309 (5. 8%) 6. 94 (2. 56 to 24. 21) 4. 94 (1. 93to16. 71) p 0. OD5 TNFRSF10A hCV15852235 Ail PaBents Percutaneous Transluminat CoronaryAngtoplasty 11. 2081 0. 0037 10. 0042 0. 0016 106/1055 (10. 0%) 45/378 (11. 9%) 11142 (26. 2%) 3. 18 (1. 49to6. 33) 1. 21 (0. 83to1. 74) p < 0. 005 TNFRSF10A hCV15852235 All PaHents Tofal Coronary Heart Disease Events 6. 479 0. 0392 6. 0116 0. 0142 355/1055 (33. 6%) 135/378 (35. 7%) 22t42 (52. 4%) 2. 17 (1. 17 to 4. 06) 1. 10 (0. 86 to 1. 40) p 0. 05 TNFRSF10A hCV15852235 Ali Patients Cardlovascular Mortaiity 6. 169 0. 0458 5. 3279 0. 021 43/1055 (4. 1%) 15/378 (4. 0%) 5/42 (11. 9%) 3. 18 (1. 05to7. 84) 0. 97 (0. 52 to 1. 73) p<0. 05 TNFRSF10A hCV15852235 AlI Patients Fatal AtherosderoticCartiiovascularDisease 6. 169 0. 0458 5. 3279 0. 021 43/1055 (4. 1%) 15/378 (4. 0%) 5/42 (11. 9%) 3. 18 (1. OS to 7. 84) 0. 97 (0. 52 to 1. 73) p 0. 05 TNFRSF10A hCV15852235 All Patients History of Angina Pectods 8. 8876 0. 0118 8. 7922 0. 003 190/1055 (18. 0%) 95/378 (25. 1%) 8/42 (19. 0%) 1. 07 (0. 46 to 2. 24) 1. 53 (1. 15to2. 02) p<0. 005 TNFRSF1A hCV15852235 Ali PaHents Family Hislory of CV isease 10. 6888 0. 0048 10. 3253 0. 0013 405/1055 (38. 4%) 181/378 (47. 9%) 19142 (45. 2%) 1. 33 (0. 71 to 2. 46) 1. 47 (1. 16to1. 87) p<0. 005 VEGF hCV1S47371 All PaUents Fatal CHDlDefinite NoniSt Mt 9 3214 0. 0095 8. 6915 0. 0032 103/673 (15. 3%) 60/913 (9. 8%) 18/164 (11. 0%) 0. 68 (0. 39 to 1. 14) 0. 60 (0. 43 to 0. 84) p < 0. 005 VEGF hCV1647371 All Patients Fatal Coronary Heart Disease 8. 2873 0. 0159 7. 3006 0. 0069 371673 (5. 5° ! 0)'15/6'13 (2. 4 %) 5/164 (3. 0 %) 0. 54 (0.'18 to 1. 28) 0. 43 (023 to 0. 78) p < 0. 05 VEGF hCV1647371 All Patients CoronaryArtery Bypass or Revascuiarization 1D. 0627 0. 0065 8. 2097 0. 0042 1361673 (20. 2%) 130/613 (21. 2%) 17/164 (10. 4%) 0. 46 (0. 26toD. 76) 1. 0S (0. S1to1. 39) p O. OD5 VEGF hCV1647371 All Patents Total Coronary Heart Disease Events 12. 4873 0. 0019 11. 905 0. 0006 249/673 (37. 0%) 219/613 (35. 7%) 37/164 (22. 6%) 0. 50 (0. 33 to 0. 73) 0. 95 (0. 75to1. 19) p < 0. 005 VEGF hCV1647371 All Palfents Cardiovascular Morlality 6. 3554 0. 0417 5. 2451 0. 022 39/673 (5. 8%) 19/613 (3. 1%) 5/164 (3. 0%) 0. 51 (0. 17to1. 20) 0. 52 (029 to 0. 90) p < 0. 05 VEGF hCV1647371 All Patients Fatal Atherosclerotic Cardiovascular Disease 6. 3554 0. 0417 5. 2451 0. 022 39t673 (5. 8%) 19/613 (3. 1%) 5/164 (3. 0%) 0. 51 (0. 17 to 1. 20) 0. 52 (0. 29 to 0. 90) p < 0. 05 VEGF hCV1647371 Ail Patfents FafailNonfatal AtheroscleroticCV isease 8. 0612 0. 0178 7. 7403 0. 0054 277/673 (41. 2%) 246/613 (40. 1 %) 48/164 (29. 3%) 0. 59 (0. 41 to 0. 85) 0. 96 (0. 77 to 120) p < 0. 05 VEGF hCV791476 All Patients Fatal Coronary Heart Disease 7. 3992 0. 0247 6. 9861 0. 0082 32/1030 (3. 1%) 24/384 (8. 3%) li34 (2. 9%) 0. 95 (0. 05 to 4. 61) 2. 08 (1. 20 to 3. 57) p < 0. 05 VEGF hCV1791476 AllPaUents FabUNonfablCeretwvascularDisease 6. 5892 0. 0371 5. 9563 0. 0147 66/1030 (6. 4%) 26/384 (6. 8%) 6/34 (17. 6%) 3. 13 (1. 14 to 7-35) 1. 06 65to1. 68) p<0. 05 VEGF hCV791476 All Patients Cardiovascular Mortality 9. 5492 0. 0084 9. 008 0. 0027 34/1030 (3. 3%) 27/384 (7. 0%) 2134 (5. 9%) 1. 83 (0. 29 to 6. 39) 2. 22 (1. 31to3. 72) p O. 005 VEGF hCV791476 All Patients Fatal Atherosclerotic Cardiovascular Disease 9. 5492 0. 0D84 9. 0ü8. 0. 0027 34/103D (3. 3%) 27ß6Ai7. 0%) 2134 (5. 9%) 1. 83 (0. 29to6. 39) 2. 22 (1. 31 to 3. 72) p<0. 005 VWF hCV7481138 AllPatients Ml (FabUNonfabl) 4. 2053 0. 0403 4. 1604 0. 0416 178/1199 (14. 8%) 28/277 (10. 1%) 0. 65 (0. 42 to 0. 97) p 0. 05 VWF hCV7481138 All Patients Nonfatal Mi (Probable/Deflnite) 5. 9933 0. 0144 5. 8657 0. 0154 170/1199 (14. 2%) 24/277 (8. 7%) 0. 57 (0. 36 to 0. 88) p<0. 05 VWF hCV7481138 AllPatienbs DeñniteNonbablMI 4. 4518 0. 0349 4. 3509 0. 037 123/1199 (10. 3%) 17/277 (6. 1%) 0. 57 (0. 33to0. 94) p O. 05 VWF hCV7481138 AllPaüents NonfablMl (defSpwb) 6. 0747 0. 0137 5. 9319 0. 0149 160/1199 (13. 3%) 22/277 (7. 9%) 0. 56 (0. 34 to 0. 87) p < 0. 05 VWF hCV7481138 AII Patlents FataUNonfatal MI (def & prob) 3_9465 0. 047 3. 898 0. 0483 176/1199 (14. 7%) 28/277 (10. 1%) 0. 65 (0. 42 to 0. 98) p<0. 05 VWF hCV7481138 All Patients Htstory of Dtabetes 4. 3405 0. 0372 4. 3128 0. 0378 166/1199 (13. 8%) 52/277 (18. 8%) 1. 44 (1. 01 to 2. 02) p < 0. 05 VWF hCV7481138 All Patients CARE MI : Non Q-Wave MI 4. 14 0. 0419 4. 047 0. 0443 116/1199 (9. 7%) 16/276 (5. 8%) 0. 57 (0. 32 to 0. 96) p < 0. 05 "Results of the Overall Score Test (chi-square test) fort the logistic regression modelin which the<BR> quallative phenotype is a function of SNP genotype (based on piacebo patients only).<BR> <P>"Results of the chi-square test of the SNP effect (based on the logislic regression model for placebo<BR> patients only).

TABLE 7. page 1 of 1 Overall SNP Effect Placebo Patients Significant Associations Between SNP Genotypes and Quantitative Phenotypes F-Test F-Test mean (se) ff (N) Significance Pubic Marker Strlum Phenotvpe fat Baseline) statisttc o-value statistic D-value 0 Rare AlIeles 1 Rare Allele 2 Rare Alleles Level HDLBP hCV22274624 All PaUents Ln (friglycedes) 5. 55 0. 004 5. 5479 0. 004 4. 955 (0. 014) (N=802) 4. 998 (0. 016) (N=545) 5. 073 (0. 036) (N=114) p O. 005 HDLBP hCVZ274624 All PaUent5 VLDL 8 0. 0004 7. 9953 0. 0004 25. ses (0. 56A) (N= 8D2) 27. 873 (0. 695) (N= 544) 32. 000 (1. 497) (N=114) p < 0. 0005 HFE hCV1085600 All Patients Bilirubin. Total 3. 93 0. 0198 3. 9303 0. 0198 0. 479 (0. 007) (N=1083) 0. 509 (0. 013) (N=354) 0. 561 (0. 039) (N= 39) p<0. 05 HFE hCV1085600 All Patients Hemoglobin (gms%) 7. 39 0. 0007 7. 3625 0. 0007 14. 808 (0. 035) (N=1071) 15. 040 (0. 060) (N= 353) 15. 213 (D. 181) (N= 39) p 0. 005 HFE hCV1085600 All Palfents Mean Cell Hemoglobin 15. 49 <. 0001 15. 4903 c. 0001 30. 398 (0. 054) (N=1071) 30. 956 (0. 093) (N=353) 31. 113 (0. 281) (N= 39) p0. 0005 LAMA2 hCV25990513 All Palients LeflVentdcularEjecuon Fnaction (%) 6. 95 0. 001 6. 9481 0. 001 53. 735 (0. 376) (N=1058) 52. 591 (0. 628} (N= 379) 46. 632 (1. 984) (N= 38) p 0. 005 PLG hCV25614474 AllPatfenls SystolicBloodPressure (mmHg) 6. 21 0. 0021 6. 2083 0. 0021 130. 051 (0. 671) (N=738) 128. 934 (0. 731) (N=622) 123. 371 (1. 790) (N=105) p- : 0. 005 MARK3 hCV25926178 All Palients Change from Baseline in Urinary Glucose (at LOCF) 4. 43 0. 0121 4. 4318 0. 0121 0. 053 (0. 026) (N= 561) 0. 101 (0. 024) (N=637) 0. 196 (0. 041) (N=224) p<0. 05 MARK3 hCV25926178 ChangetwmBaselinelnUdnaryGlucose (at5Years) 6. 31 0. 0019 6. 3069 0. 0019 0. 069 (0. 035) (N=334) 0. 064@. D34) (N=350) 0. 277 (0. 054) (N=141) p O. 005 MARK3 hCV25926771 AllPallents ChangefwmBaselinelnUdnaryGlucose (atLOCF) 526 o. o1e5 5. 7578 0. 0165 0. 050 (0. 026) (M=555) 0. 130 (0. 021) (N=864) p 0. 05 PON2 hCV952817 All Patients Baseline HDL 4. 65 0. 0097 4. 6545 0. 0097 38A86 (D. 304) (N= 872) 39. 530 (0. 393) (N= 524) 41. 122 (0. 986) (N= 83) p 0. 05 SN hCV2992252 All Pattents Baseline Lymphocyles, Absolute (Wcumm) 5. 24 0. OOS4 5. 242 0. 0054 2. 334 (0. 033) (N= 532) 2. 282 (0. 029) (N=704) 2. 135 (0. 052) (N=218) p<0. 05 SOAT2 hCV15962588 AllPaüenks BasellneHDL 3. 41 0. 0335 3. 4055 0. 0335 38. 723 (0. 283) (N=1007) 39. 362 (0. 434) (N=430) 42. 191 (1. 405) (N= 41) p < 0. 05 SOAT2 hCV15962586 All Patients Baseline Ln (Triglyceddes) 3. 9 0. 0204 3. 9027 0. 0204 4. 995 (0. 012) (N=1007) 4. 957 (0. 019) (N=430) 4. 847 (0. 060) (N= 41) p 0. 05 SOAT2 hCV15962586 All Patients Baseline 3. 82 0. 0222 3. 8167 0. 0222 27. 787 (0. 504) (N=1006) 25. 888 (0. 771) (N=430) 22. 581 (2. 497) (N= 41) p < 0. 05 SOAT2 hCV15962586 All Patients Baseltne VLDL-Triglycefides 4. 05 0. 0175 4. 0544 0. 0175 125. 268 (2. 044) (N=1004) 117. 305 (3. 123) (N=430) 103. 537 (10. 114) (N= 41) p < 0. 05 "Results of the Overall F-Test for the analysis of variance model in which the quantitalive phenotype is a function of SNP<BR> genotype (based on placobo pationls only).<BR> <P>"Results of the F-lest of the SNP effect (based on the analysis of variance model for placsbo patients only).<BR> <P>&num Leastsquares estimates of the mean and its slandard error based on the analysis of variance model TABLE 8,page 1 of 3 Overali'InteracdonEffect"ORareAlleles iRareAliele 2RareAlleles Pravavs. Placebo Slgnificant interacttons Between SNP Genotypes and PnvastaUn Efticacy ChiSqua2 Test ChSquare Motal (95) Ntatal (°h) Ntatai (Yo) Odds Ratio (95°6 Cp Sfgnificance Public Marker trat Phenotvoe atistic vvalue stat-n ; c ime-ov rav Pla,-cebo Prava lacebrava laCebo ORareAlleles lRareAlleles 2RareAllele5 Level ABCAI hC\t2741051 All Patients F2taYNorfatal Cerebmvasmlar Disease 19. 4853 0. 0018 7. 5666 0. 0227 511730 (7. 0°I) 53Pd8 (7. 1%) 18/651 (2. 896) 381615 (8. 2Y) 3/127 (2. 4%) 9/107 (6. 4%) 0. 98 (0. 66 to 1. 46) D. 43 (0. 18 to 1-01) 0. 26 (0. 06 to 1. 15) p < 0. 05 ABCA1 hCV2747051 Ali Patients Any Report of Stmke ouring CARE 20. 2702 0. 0011 8. 3498 0. 0154 271730 (3. 7%) 30/749 (4. 0%) 51651 (0. 8%) 22/915 (3. 6%) 2/127 (1. 6%) 7/107 (6. 5%) 0. 92 (0. 54 to 1. 56) D. 21 (0. 00 to 0. 75) 0. 23 (0. 04to1. 36) p<0. 95 ABCAI hCV2741051 All Paflenls lst Slmke Ouctrred During CARE 19. 1074 0. 0018 7. 1772 0. 0276 26f730 (3. 6%) 27/749 (3. 6%) 5/651 (0. 8%) 181615 (2. 9) 2/127 (1. 6Y) 7N07 8. 5Y) 0. 98 (0. 57 tu 1. 70) 0. 26 (0. 07 to 0. 96) 0. 23 (0. 04 tu 1. 40) p<0. 05 AGTRt hCV3187716 All Patienls Fatal CHD/Dnite Non-fatal MI 172108 0. 0047 75875 0. 0224 631769 (8. 2%) 911735 (12. 4%) 72/625 (11. 5%) 711588 (12. 1%)-51120 (4. 2%) 231150 (15. 3%) 0. 63 (0. 45 to 0. 89) 0. 95 (0. 50 to 1. 78) 0. 24 (0. 08) 00. 74) p<0. 05 AGTR1 hCV318777 f6 All Patients Hosp. for Unsta6le Angina 11. 9501 0. 0355 7. 86 0. 0228 120I7769 (15. 6%) 1261735 (17. 1%) 1031525 (16. 5%) tOfi1590 (18. 0%) 8/120 (8. 7%) 31/150 (20. 7%) 0. 89 (0. 68 to 1. 17) 0. 90 (0. 531 1. 52) 0. 27 (0. 11 to 0. 69) p < 0. 05 AGTR1 hCV318771B AII Pattenls Total Cooanary Heart Disease Events 20. 7576 0. 0999 6. 1362 0. 04B5 227/769 (29%) 252/73S (M%) 194/625 (31. 9%) 206/586 (35. 4%) 20/120 (16. 7%) 52/t50 (34. 7%) 0. 80 (0. 65 to 1. 00) 0. 82 (0. 5410125) 0. 38 (0. 19 tu 0. 74) p<0. 95 CCL11 hCV7449808 All Palienis Hosp. forCaidiovasCtdar Disease 31. 6672 <. 0001 11. 562 0. 0031 423/7a25 (41. 3%) 433/1008 (4&OY)) 781448 (39. 3%) 171/412 (41. 5%) 9/34 (26. 5%) 34l49 (A. 4%) 0. 76 (0. 64 tu 0. 91) 0. 91 (0. 62to 1. 35) 0. 16 (0. 08 tao 0. 44) p<0. 00 : C P CCL11 hCV7449808 All Palfents Tofal Coranary Heart Disease Events 19. 3552 0. 0017 6. 9364 0. 0311 31011025 (30. 2%) 355/1006 (35. 3%) 1271448 (28. 3%) 1321412 (32. OV.) 4134 22149 (44. 8%) 0. 60 (0. 88 ro 0. 96) 0. 84 (0. 56to 1. 27) 0. 16 (0. aS to 0. 56) p < 0. 05 CCL71 hCV7449808 NI Patlents Total Cardavasctlar Disease Events 32. zu 0001 12. 1479 0. 0023 436/1025 (42. 5%) 494/1006 (49. 1%) 1tA1/448 (40. 4%) 1791412 (d3. 44%) 9134 (26. 5%) 35549 (71. Yo) 0. 77 (0. fiA to 0. 91) 0. 86 (0. BD to 1. 30) 0. 14 (0. 05 to 0. 4 (l) p-0. 005 CCL11 hCV7449808 AII Patfents FataIlNofFfatal AtherosdemcCV Disease 24. 1297 0. 0002 6. 6941 0. 0352 35911025 405/1006 (40. 9°h) 139/44A (31. 0%) 146/412 (35, 496) 7/34 (20. 6-A) 27149 (55. 1%) 0. 60 (0. 67 to 0-96) 0. 82 (0_5 to 1. 22) 021 (0. 07 to 0. 60) p<0. 05 CHUK hCV1345898 All Patients Noo-fatal MI (def !. pub) 19. 6478 0. 0015 7. 1993 0. 0273 47/413 (11. 4%) 531407 (13. 0%) fi9I734 (9. 4%) bu24 (11. 8°%) 17/354 (4. 8%) 43/331 (13. 0%) 0. 86 (0. 58 tao 1. 30) 0. 77 (0. 37tu1. 61) 0. 34 (0. 14 to 0. 81) p < 0. 05 CHUK hCV1345898 NI Patients Hosp. forlJnsta6le Angfna 17. 1525 0. 0042 9. 4908 0. 0087 68/413 (16. 5%) 51/407 (12. 5%) 110l734 (15. 0%) 1381724 (18. 8%) 51/354 (14. 4%) 73/331 (22. 1%) 1. 38 (0. 93 to 2. 04) 0. 76 (0. 38 to 1. 51) 0. 59 (0. 28 to 1. 25) p 0. 05 CRt hCV25598594 NI Patiertts Fatal CHDloefinite Non-fatal MI 15. 4324 0. 0015 5. 4753 O. OtB3 139/1445 (9. 6%) 173/1413 (12. 2%) 1/72 (1. 4%) 12l66 (18. 2%) 0 0 (0. 0°) O10 (0. 0%) 0. 76 (0. 60 to D. 97) 0. 06 (0. 01 to 0. 52) p<0. 05 CR1 hCV25598594 All Patients Noo-fatal MI (def & pmb) 16. 765 O. OOOB 5. 429) 0. 01B8 132/1445 (9. 1%) 170/1413 (12. Oh) 2l72 (2. 8%) 13/66 (19. 7%) 0I0 (0. 0%) 0/0 (0. 0%) 0. 74 (0. 58 to 0. 93) 0. 12 (0. 02 to 0. 56) p<0. 05 CRi hCV25598594 AilPatients CoronaryAAeryBypassarRevascuiarizatian 22. 1A47 <. 0001 5. 672B 0. 0172 21211445 (14. 796) 2B7N413 (18. 9%) 7/72 (9. 7%) 21/66 (31. 6%) 0/0 (0. 0%) 0/0 (0. 0%) 0. 74 (0. 61tao0. 90) 0. 23 (0. 09to0. 62) p0. 0. 5 CR1 hCV2559&594 All Patients Hosp. forCaMiovascNar Disease 20. 4621 0. 0001 5. 917 0. 015 580/1445 (40. 6%) 656/1413 (46. 4%) 23/72 (31. 9%)) 30f66 (59. 1%) 010 (O. 0%) 0/0 (0. 0%) 0-79 (0. 63 to 0-91) 0. 33 (0. 16 to 0. 68) p < 0. 05 CR1 hCV25598594 All Paltenis Hosp. forllnstabie Angina 10. 6553 0. 0137 4. 760B 0. 0291 22311445 (15. 4h) 245/1413 (17. 3%) 8l72 (11. 1%) 19166 (28. 9%) 0/0 (0. 0%) 0/0 (0. 0%) 0. 87 (0. 7ho1. 06) 0. 31 (0. 12 ta 0. 81) p < 0. 05 CRt hCV25598594 Ali Pattents Total Coranary Heart Disease Events 21. 4023 <, 00o1'10. 0244 0. 0015 431/1445 (29. 8%) 465/1413 (34. 3%) 11/72 (15. 3%) 30/66 (45. 5%) 0/0 (0. 0%) 0/0 (0. 0%) 0. 81 (0. 69 to 0. 95) 022 (0. 09 to 0. 50) p<0. 00 ! CR1 hCV25598594 All Patients Totat CarCiavascular Dlsease Events 21. 0450 0. 0007 5. 6723 0. 0154 603/1445 (41. 7%) 675/1413 (47. 8%) 24l72 (33. 3%) 4N66 (60. 6%) 0 ! 0 (0. 0%) 0/0 (0. n%) 0. 78 (0. 68 to 0. 91) 0. 33 (0. 16 ta 0. 68) p < 0. 05 CR1 hCV25598594 Ali Patients FatallNofFfatal AthefosdemiCCV Dfsease 21. 607 <. 0001 9. 255 0. 023 491/1445 (34. 0%) 550/1413 (36. 9%) 15/72 (20. 6%) 34/66 (51. 5%) 0/0 (0. 0%) 0/0 (0. 0%) 0. 81 (0. 89 to 0. 94) 0. 25 (0. 11 to 0. 54) p 0. 005 CXCL16 hCV8718197 All Patfents Fatal CHD/Definite Nofatal MI 19. 0205 0. 0018 7. 6339 0. 022 36468 (7. 7%) 74/469 (15. 8%) 66/742 (9. 2%) 79/722 (10. 9%) 34/292 (11. 6/) 31278 (11. 2%) 0. 44 (0. 28 to 0. 88) 0. 82 (0. 40 to 1. 70) 1. 05 (0. 46 to 2AO) p < 0. 05 CXCL16 hCV8718197 All Patfents FataMorrfatal MI (deF 6 pmb) 23. 7086 0. 0002 9. 3715 0. 00B2 33/468 (7. 1%) 76/469 (16-6%) 75/742 (10. 1%) 69/722 (12. 3%) 36/292 (12. 3%) 37/276 (13. 3%) 0. 38 (0. 25 fo 0. 58) O. AO (0. 39 to 1. 66) 0. 92 (0. 40 to 2. 08) p < 0. 05 CXCL16 hCV8718197 NI Patients ComnaryArtery Bypass orRevaSCUlaAZatian 23. 6046 0. 0003 9. 8539 0. 0072 56f468 (12. 0%) 106/459 (23. 0%) 119/742 (16. 0%) 123/722 (17. 0%) 43/292 (14. 7%) 55/278 (19. 8%) 0. 45 (0. 32 to 0. 65) 0. 93 (0. 51 to 1. 71) 0. 70 (0. 35 to 1. 41) p < 0. 05 hCV8718197 All Patlents Hos. for Card'rovascular Disease 20. 8072 O. OD09 6. 1046 0. 0473 177/466 (37. 8%) 239/459 (51. 0%) 3051742 (41. 1%) 3las22 (44. 0%) 124/292 42. 5%) 133l278 (47. 8%) 0. 59 (0. 45) 00. 76) 0. 69 (0. 58 tao 1. 40) 0. 80 (0. 48 to 1. 36) p < 0. 05 CXCLt6 P CXCL16 hCV8718197 All Patients Total Coronary Heart Disease Events 20. 8149 0. 0009 8. 6483 0. 0328 125/468 (26. 7%) 192/459 (366%) 220/742 (29. 6%) 227/722 (31. 4%) 94/292 (322% 1 102/278 (36. 7%) 0. 57 (0. 44100. 76) 0. 92 (0. 58 tao 1. 50) 0. 82 (0. 47 to 1. 43) p 0. 05 CXCL16 hCV8718197 All Patients Cardrovascular Monality 11. 7405 0. 0385 7. 955B 0. 0167 12/466 (2. 6%) 26/469 (5. S%) 24/742 (3. 2%) 29/722 (4. 0%) 19/292 (6. 5%) 9/276 (3. 2%) 0. 45 (022 to 0. 90) 0. 00 (D. 24 to 264) 2. 08 (0. 55 to 7. 91) p < 0. 05 CXCL16 hCV8718197 AII Patients Toial CaNrovascula Disease Events 23. 8178 O. OD02 7. BOB 0. 0202 1801468 (38. 5%) 247/489 (52. 7%) 314/742 (423) 325/722 (45. OW,) 13M292 (44. 5%) 138/278 (49. 6%) 0. 56 (0. 43 to 0. 73) 0. 9A (D. 57 to 1. 42) 0. 81 (0. 48 to 1. 38) p < 0. 05 CXCL18 hCVB718197 All Patfents Fatai Atheoosdentic Cardiovascular Disease 12266s 0. 0313 8. 0102 0. 0182 121468 (2. 6%) 26469 (5. 5%) 23/742 (3. 1%) 29f122 (4. 0'Y) 191292 (6. 5%) 9/278 (32%) 0. 45 (0. 22 to 0. 90) 0. 76 (D. 23 to 253) 2. 08 (0. 55 ta 7. 91) p < 0. 05 ELN hCV1253630 All Pattents Fatal CHD/Definite Norfatal MI 1&1317 O. OD28 8. 1533 0. 017 45/543 (8. 3%) 77/507 (15. 2%) 65l724 (9. 0%) 841721 (it_7%) 29i245 (11. 8%) 21/247 (8. 7%) 0. 50 (0. 34) 00. 75) 0. 75 (D. 37to1. 49) 1. 41 (O. BOto3. 27) p<0. 05 ELM hCV1253630 Ail Patients Nofatal MI (def & pmb) 20 ? 262 0. 0011 10. 3191 0. 0057 42/543 (T. 7) 731507 (14. 4%) 62/724 (B. 6%) 881721 (12. 2j 301245 (12. 2%) 191241 (7. 9%) 0. 60 (0. 33 to 0. 74) 0. 67 (0. 33 to 1. 37) 1. 63 (0. 69 to 3. 87) p 0. 05 ELN hCV1253630 All Patients FataNJori-fatal MI (deF & pmb) 27. 6399 <. 0001 13. 5987 0. 0011 45/543 (8. 3%) 88/507 (17. 0%) 68/724 (9. 4%) 951721 (1323 33/245 (13. 5 h) 21/241 (8. 7%) 0. 44 (0. 30 to O. B5) 0. 66 (0. 35 to 1. 34) 1. 63 (0. 71 to 3. 72) p < 0. 005 ELN hCV1253630 AII Patients Hosp. forCardfovascutar Disease 21. 4078 0. 0007 7. 3688 0. 0251 204/543 (37. 6%) 248/507 (48. 99%) 291/724 (40. 2%) 339/721 (47. 0%) 113/245 (46.) %) 163/241 (42. 7%) O. 63 (0. 49to0. 60) 0. 76 (0. 49to1. 16) 1. 15 (0. fiB to 1. 95) p 0. 05 ELM hCV1253630 All Patients Total Coronary Heart Disease Events 19. 635 0. 0015 8. 2358 0. 0163 1461543 (26. 9%)'182/507 (35. 9%) 208f724 (26. 5%) 254/721 (35. 296) 88/245 (35. 9%) 74/241 (30. 7%) 0. 66 (O. Si to D. BS) 0. 73 (0. 48 to 1. 17) 1. 26 (0. 72 to 221) p < 0. 05 ELN hCV1253630 All Patients Total Cardiovascular Disease Events 21. 3232 0. 0007 6. 4222 0. 0403 212/543 (39. 0%) 255/507 (50. 3%) 298/724 (41. 2) 3481721 (48. 3%) 1151245 (48. 9%) 1071241 (44. 4%) 0. 63 (0. 50tu0. 61) 0. 75 (0. 48 to 1. 16) 1. 11 (0. sS to 1. 88) p < 0. 05 HLA-DPA1 hCV15780070 All Patients ComnaryArtery Bypass or Revaswlazation 24. 365 0. 0002 7. 073 0. 0291 143/1oi9 (14. 0%) 200t994 (20. 1%) 67/443 (15. 1%) 861429 (20. 0%) 9/52 (17. 3%) 2t5B (3. 6%) 0. 65 (0. 51 to 0. 52) 0. 71 (0. 43top. 18) 5. 65 (1. 11to26. 71) p < 0. 05 HLA-DPAthCV1576Q070 An Patients Tolal Comna Heart Disease Events 20. 3365 0. 0011 9. 1406 O. D704 28511019 (28. 0%) 357/994 (35. 9%) 136/443 (30. 7%) 146/429 (34. 0%) 21/52 (40. 4%) 72156 (21. 4%) 0. 69 (0. 57 to 0. 84) 0. 86 (0. 57 to 1. 29) 2. 48 (1. 01 to 6. 08) p < 0. 05 HLA-PA1 Y HLA-DP81 hCV256511T4 All Patierts Fatal CHD/Definite Non-fatal MI 15. 7588 0_O076 69829 0. 0305 581733 (7. 9%) 931708 (13. 1%) 621632 (9. 8%) 811632 (12. 8%) 20/144 (13. 9%) 11/132 (8. 3%) 0. 57 (0. 40tu0. 60) 0. 74 (0. 39 to 1. 40) 1. 77 (0. fi9 to 4. 56) p 0. 05 HLA-DPB7 hCV25651774 Ail Patients Narfatal MI (det 8 pob) 19. 2761 0. 0017 7. 1578 0. 0279 63/733 (8. 6%) 981708 (13. 8%) 551632 (8. 7%) 781632 (12. 3%) 16/144 (11. 1%) 7/132 (5. 3%) 0. 59 (0. 42tu0. 62) 0. 68 (0. 36 to 1. 28) 2. 23 (0. 77 to 6. 43) p 0. 05 HLA-DPBt hCV25651174 All Patie (Its FataVNOn-fatal MI (def 6 pfob) 22. 2201 0. 0005 8. 6158 0. 0135 65/733 (6. 9%) 106/708 (15. 3%) but1632 (9. 7%) 871632 (13. 8%) 20/144 (13. 9%) 19/132 (7. 6%) 0. 54 (0. 39 to 0. 75) 0. 67 (0. 36 to 1. 24) 1. 97 (0. 78 tao 5. 07) p<0. 05 HLA-DPB1 hCV256511T4AiIPaUeMS Corona Arte BypassorRevasmularizatlon 26. 9fi6i9 <. 0001 10. 9893 0. 0041 1031733 (14. 1%) 1371708 (19. 4%) 87/632 (13. 8%) 137f632 (21. 7%) 271144 (18. 8%) 131132 (9. 8%) D. 68 (0. 52to0. 90) 0. 58 (0. 34 to 0. 08) 2-11 (0. 92to4. 86) p<0. 005 HLA 1I Y HLA-DP81 hCV25&511T4 All Patients Hosp. forCaNfovascuiar Disease 27. 7297 <. 006t 7. 3005 0. 026 282/733 (36. 5%) 334/708 (47. 2%) 259f632 (41. 0%) 314/632 (49. 7%) 6t/144 (42. 4%) 451132 (34. 1%) 0. 70 ( (1. 57 to 0. 86) 0. 70 (0. 47 to 1. 05) 1. 42 (0. 79to 2. 58) p < 0. 05 HLA-DPB7 hCV25651114 Ail Patieflt5 Tota1 Comnary HAetf Diseas0 Events 23. 6497 0. 0003 11. 0762 0. 0039 207/733 (28. 2%) 258/708 (38. 4%) 1821632 (28. A9%) 225/632 (35. 6%) 50/144 (34. 7%) 301132 (22. 7%) 0. 69 (0. 55 to 0. 86) 0. 73 (0. 48 to 1. 12) 1. 81 (0. 96 to 3. 42) p < 0. 005 H HLA-DPB1 hCV25651174 Ail PatieMS Total Carcliovascular Disease Events 25. 4895 0. 0001 6. 5985 0. 0369 291fun3 (39. 7%) 3461708 (48. 9%) 265f632 (41. 9%) 318/632 (50. 3 %) 64/144 (44. 4%) 491132 (37. 1%) 0. 69 (0. 56 to 0. 85) 0. 71 (0. 48 to 1. 06) 1. 35 (0. 78 tao 2. 43) p 0. 05 H HLA-DPB1 hCV25fi51174 AII PatieMS FataUNo'rfatal AtheasGerotic CV Disease 24. 828 0. 0002 10. 0154 0. 0067 23Of733 (31. 4%) 291/708 (41. 1%) 2181632 (345%) 2551632 (40. 3/.) 541144 (37. 5%) 36f132 (27. 3%) 0. 66 (0. 53 to 0. 81) 0. 78 (0. 52 to 1. 17) 1. 60 (0. 87 to 2. 95) p 0. 05 HLA-DP81 hCV8851085 All Pattents FataIINOo-fatal MI (def & pmb) 18. 9046 0. a02 8. 073s 0. 048 82/s19 (8. 9%) 132/894 (14. 8 ) 53/521 (10. 2%) 66/as/5ofi (i3. a%) 11/73 (15. 1%) 6876 (7. W=) 0. 57 (0. 42 to 0-76) 0. 75 (0. 42to1. 37) 2. 07 (0. 86tu6. 51) p 0. 05 HLA-DPBI hCV8a5lOB5 All Patients Coronary Artery Bypass or Revasmiarization 26. 07'75 <. OAO 11. 1434 0. 0036 129/919 (14. 0%) 174/894 (19. 5%) 72J521 (13. 8°,%) 1071506 (21. 1%) 17/73 (23. 3%) 6176 p. 95%) 0. 68 (0. 53 to 0. 87) 0. 60 (0. 98 to 0. 99) 3. 54 (1. 22 to 10. 31) p < 0. 005 ry HLA-DPB7 hCV8851085 All Patients Hos. for CaNiovascuiar Disease 23. 3669 0. 0003 6. 8274 0. 0329 363/919 (39. 5%) 4281894 (47. 9%) 2091521 (40. 1%) 241/506 (47. 6%) 33/73 (45. 2%) 24l76 (31. 6 ! 0) D. 71 (0. 59 W 0. 86) 0. 74 (OSO W 1. 08) 1. 79 (0. 88to 3. 71) p-0. 05 P HLA-DPB1 hCVB&51085 All PaUeMS Total Comnary Heart Disease Events 21. 0571 0. 0008 8. 5864 0. 0137 263/919 (28. 6%) 321/B94 (35. 9%) 161/521 (29. 0%) 177/506 (35. 0%) 28/73 (35. 6%) 15/76 (19. 7%) 0. 72 (0. 59 to 0. 87) 0. 76 (0. 50 tu 1. 14) 2. 25 (1. 01 to 5. 02) p < 0. 05 LA-DPB1 hCV8851085 All PatieMS Total CardiovascUlar Uisease Events 23. 3123 0. 0003 9. 9817 0. 0308 374/919 (40. 7%) 441/B94 (49. 3% j 2141521 (41. 1%) 2481508 (48. BYo) 35/73 (47. 9%) 26/76 (34. 2%) 0. 70 (0. 59 to 0. 85) 0. 74 (0. 50 to 1. 08) 1. 77 (0. 86 to 3. 65) p < 0. 05 H HLA-DPB1 hCV8851085 AII PaBeMS Fatal/Noo-fatai Atherosderottc CV Dfsease 22. 7355 0. 0004 B. 8922 0. 0117 301/919 (32. 8°0) 367/094 (41. 1%) 174/521 (33. 4%) 197/506 (38. 9%) 29/73 (39. 7%) 18/76 (23. 7%) D. 70 (0. 58 to 0, 85) 0. 79 (0. 53 to 1. 17) 2. 12 (0. 98 to 4. 67) p 0. 05 ICAM7 hCV872633T AlI PalIents Nondatal Ml (def 8 pmb) 16. 3028 0. 0026 6. 2192 0. 0164 281495 (5. 7%) 61/460 (13. 3%) 7636 (10. 3%) 91/749 (12. 1%) 30/262 (10. 6%) 30/268 (11. 2%) 0. 39 (0. 25 to 0. 63) 0. 83 (0. 38 to 1. 82) 0. 94 (0. 39 to 2. 31) p<0. 05 ICAM1 hCV8726337 All Palfents FalaVNofl-fatal MI (def & pmb) 21. 403 0. 007 8. 3848 0. 0151 31/495 (8. 3%) 681460 (14. 6%) 84/736 (11. 4%) 99/749 (13. 2%) 31/262 (11. 0%) 371268 (13. 8%) 0. 39 (0. 25 to 0. 60) 0. 85 (0. 40 tao 1. 79) 0. 77 (0. 33 to 1. 80) p<0. 05 h V25473853 Ail Patients Total Cartliovascutar Disease Events 23. 2012 0. 0003 8. 7475 0. 0343 3761924 (40. 7%) 4291874 (49. 1%) 2301511 (45. 0%) 247/527 (46. 990) 19f70 (27. 1%) 31/62 (50. 9%) 0. 71 (0. 58 to 0. 86) 0. 93 (0. 83 to 1. 36) 0. 37 (0. 17 to 0. 82) p < 0. 05 ICAM3 C M3 hGV25473653 All Patients FataI/Noirtatal Atherosdemtic CV Disease 21. 6115 0. 0006 7. 3162 0. 0258 2991924 (324 . 6) 352/874 (40. 3%) 191/511 (37. 4%) 201/527 (38. 1%) 14/70 (M. O%) 25/62 (40. 3%) 0. 71 (9. 58) 00. 89) 0. 97 (0. 65 to 1. 44) 0. 37 (0. 18to 0. 85) p < 0. 05 ICA IGF2R hrV22MgBS All Patients Hasp. for Cardiovascular Disease 23. 7283 0. 0002 8. 0478 0. 0179 465/7775 (39. fi !) 510I1093 (46. 7%) 137Y316 (43. 4%) 1871358 (48. 8) 5/24 (20. 6%) 15122 (682%) 0. 75 (0. 63 to 0. 88) 0. 88 (0. 59 to 1. 31) 0. 12 (0. 03 to 0. 48) pu 0. 05 IL1A hCV9546471 AII PatfeMS Total Mortality 12. 1611 0. 0326 1D. 3878 0. 0058 52l159 (6. 9°6) 371139 (5. 0%) 2&617 (4. 5) 43/584 p. 4%) 4/132 (3. 0%) 14/144 (9. 7%) 1. 40 (O. 90 0 2. 15) 0. 60 (0. 25) 01. 40) 0. 29 (0. 08 to 1. 10) p < 0. 05 ILIRN hCV8737990 All Pattents Fatal GHD/Definlte Norrfatal MI 16. 7149 0. 0051 7. 1816 0. 0276 80/609 (9. 9%) 1001786 (1Z. 7Yo) 44f55 (7. 5%) 771568 (13. 6%) 15/121 (12. 49) 8B115 (7. 0%) 0. 75 (0. 55 to 1. 03) 0. 52 (0. 28 to 0. 97) 1. 89 (0. 68 to 5. 27) p O. 05 IL1RN hCV873798D All Patienls Non (atal MI (def !, pmb) 20. 9801 9. 9008 7. 2412 0. 0268 68/809 (8. 45%) 931788 (11. 8%) 45/585 (7. 7%) 7bisou (13. 7%) 201121 (16. 5%) 12/115 (10. 4%) 0. 68 (0. 49 to 0. 95) 0. 52 (028 to 1. 00) 1. 70 (O. fiB ta 428) p < 0. 05 ILIRN hCV0737090 All Patients FataVNofatal Mi (def & pmb) 22-5713 0. 9094 7. 6202 0. 0221 79/809 (9. 4%) 107/786 (13. 6%) 49/565 (6. 4%) 66/568 (15. 1%) 201121 (16. 5%) 12 (115 (10. 4%) 0. 68 (0. 48 to 0. 90) 0. 51 (02B to A. 94) 1. 70 (0. 69 b 4. 21) p < 0. 05 L1 RN hCV8737990 All Patients Hosp. for CaNtovascular D (sease 25. 4952 0. U001 7. 7fui53 0. 0278 315/809 (38. 9%) 357/786 (45. 4%) 232/565 (39. 7%) 266/568 (59. 7%) 60/121 (49. 6%) 46/115 (41. 7%) 0. 77 (0. 63 to 0. 94) 0. 64 (0. 43 to 0. 95) 1. 37 (0. 15 ta 2. 5 ) p 0. 05 i P IL1RN hCV8737990 All Patients Total ComnayHeart Disease Events 23. 5824 0. O0O3 10. 6112 0. 005 226/809 (28. 2%) 272/786 (34. 6%) 167/565 (28. 5%) 213/569 (37. 5%) 45/121 (37. 2%) 281115 (24. 3%) 0. 74 (0. 80 to 0. 92) 0. 67 (0. 44 to 1. 01) 1. 84 (0. 88 ta 3. 54) D < 0. 05 LRN hCV8737990 All PaOents Total Cardfovascular IsPase EvenLS 24. 6656 0. 0092 6. 7649 0. 0336 325/609 (40. 2Yo) 370l788 (47. 1%) 23915&5 (40. 9 !) 293/568 (51. 6%) 81/i21 (5U. 4%) 491715 (42. 6%) 0. 75 (0. 62 to 0. 92) 0. 65 (0. 44 to 0. 96) 1. 37 (0. 75 to 2. 50) p < 0. 05 I 1R IL1 RN hCV8737990 AII Patients Fatal/Noirfatal Athemscierolic CV Disease 24. 3476 0. 0002 9. 5892 0. 0083 26U1809 (32. 1 %) 3031786 (38. 5%) 193/535 (33. 0%) 2431568 (42. 8%) 51/121 (42. 1%) 351115 (30. 4%) 0. 75 (0. 61 to 0. 93) 0. 66 (0. 44 to 0. 99) 1. 07 (D. 89 to 3. 12) p < 0. 05 IL6ST hOV18170435 All Patients Hosp. for Cardiovascular Disease 20. 5539 0. 001 6. 1236 0. 0466 450/1131 (39. 8%) 593/1060 (46. 9%) 139/340 (40. 9%) 173/352 (49. 1%) 19137 (51. 4%) 11/37 (29. 7%) 0. 75 (0. 631o O. 89) 0. 72 (0. 4810 7. 07) 2. 49 (D. 93 to 8. 72) p < 0. 05 I P L6ST hCV16170435 AII Patfents Total CaNiovascular isease Events 21. 8497 0. 0006 6. 4073 0. 0408 48517131 (47. 1 %) 519/7080 (48. 1%) 1421340 (41. 8%) 180/352 (51. 1%%) 19f37 (51. 4%) 11/37 (29. 7%) 0. 75 (0. 64 to 0. 89) 0. 69 (0. 48 to 1. 02) 2. 49 (0. 93 to &72) p < 0. 05 I LRP hCV190754 All Patients Hosp. for Unstable Angina 14. 1312 0. 0148 9. 6697 0. 0079 9&550 (77. 5%) 831557 (14. 9%) 1001712 (14. 0%) 1301687 (18. 9%) 321244 (13. 1%) 51/235 (21. 7%) 1. 21 (0. 88 to 1. 67) 0. 70 (0. 39 to 1. 25) 0. 54 (0. 27 to 1. 10) p-0. 05 MTRR hCV7580070 Ail PaHenls Hosp. for Cabiovascuiar Disease 25. 4655 0. 0001 7. 7684 0. 0206 466/1201 (38. 8%) 544/1157 (47. 0%) 135/2B4 (47. 5%) 127/273 (48. 5%) 5/22 (22. 7%) 16/2B (57. 1%) 0. 71 (0. 81 to 0. 84) 1-04 (0. 68 to 1. 59) 0. 22 (0. 08 to 0. 79) p<O. OS MTRR hCV7560070 All Patients Total Comnmy Heart Disease Events 22. 029 0. 0005 7. 6985 0. 0213 338/1201 (28. 1%) 403/1157 (34. 8%) 96/284 (34. 5%) 94/273 (34. 4°fo) 2J22 (9. 1) 13/28 (48. 4%) 0. 73 (0. 82 to 0. 87) 1. 00 (0. 64 to 1. 56) 0. 12 (0. 02 to 0. 60) p < 0. 05 MTRR hCV7580070 AII Patients Total Caodiovascuiar isease Events 25. 947 <. 0001 7. 2212 0. 027 4bu11201 (40. 0%) 58N1/1157 (48°, 0) 137/284 (482%) 1311273 (48. 0%) 5122 (22. 7%) 16/28 (57. 1%) 0. 71 (0. 60 to 0. 84) 1. 01 (0. 66 to 1. 64) 0. 22 (0. OB ta 0. 79) p < 0. 05 MTRR hCV7580070 All Petienls FataIINon-fatal AtherosGefatiC CV DIsease 25. 0449 O. OQ01 8. 5401 0. 014 390/12 (11 (32. 5%) 455il157 (39. 3%) 110/264 (38. 7%) 109/273 (39. 9Y) 2122 (9. 1°I%) 15/28 (53. 6%) 0. 74 (0. 63 to 0. 88) 0. 95 (0. 62 to 1. 46) 0. 09 (0. 02 to 0. 45) p-0. 05 TABLE 8, page 2 of 3 NPC1 hCV25472673 All Patients Falal CHD/Definite Nofatal MI 16. 7713 0. 005 6. 9147 0. 0315 65/596 (10. 9%) 61/560 (10. 9%) 56f664 (8. 4%) 86/697 (12. 3%) 19/242 (7. 9%) 36) 206 (17%) 1. 00 (0. A9 to 1. 45) 0. 65 (0. 33 to 1. 30) 0. 41 (0. 18 to 0. 94) p < 0. 05 NPC1 hCV25472873 AII Patients Hosp. for CaN'rovascular Disease 33. 7727 <, pp01 16. 69i6 0. 0002 262/596 (44. 0%) 244/580 (43. BYo) 2551684 (30. 490) 3231697 (46. 3%) B9/242 (36. 4%) 122/208 (58. 7y 1. 02 (0. 81 tao 120) 0. 72 (0. 47 to 1. 11) 0. 40 (0. 24 to 0. 68) p < O. OODS NPCi hCV25472673 AII PatieIlts Total Colonary Heart Disease EVents 23. 8979 0. 0002 12. 324 0. 0021 193/598 (32. 455) 100/5560 (321%) 18f61664 (28. 0%) 242/697 (34. 7%) 59/242 (24. 4%) 881208 (42. 3%) 1. 01 (0. 79 to 729) 0. 73 (0. 48 to 1. 15) 0. 44 (0. 25 to 0. 77) p<0. 005 NPCi hCV25472873 AII Patients Total CaN'rovascutar Disease Events 36. 5639 <. 0001 18. 2761 0. 0001 274/596 (46. 0%) 254/560 (45. 4%) 259f6B4 (39. 0%) 330/697 (47. 3%) 90/242 (37. 2%) 1251208 (60. 1%) 7. 03 (0. 81 tao 129) 0. 71 (0. 49 to 1. 09) 0. 39 (0. 23 to 0. 67) p< 0. 000 ! NPC1 hCV25472673 AII Patients FataIMomfatal Atherosdevtic CV Disease 28. 4984 <. 0001 15. 5441 0. 0004 221/596 (37. 1%) 2045560 (36. 4) 213f664 (32. 1%) 274/697 (39. 3%) 68/242 (28. 1%) 101/208 (48. 6%) 1. 03 (0. 81 to 1. 31) 0. 73 (0. 47 to 1. 13) 0. 41 (0. 24to0. 7t) p<MOO ! NPC7 hCV7490135 All Patient5 Hosp. fDI CardioV25CUlaf Disease 23. 7333 0. 0002 9. 7365 0. 0077 194/43T (44. 4 %) 181f410 (44. 1%) 295l742 (39. BYa) 3331718 (48. 4%) 117/324 (36. 1%) 174/335 (51. 9%) 1. 01 (0. 77 to 1. 32) 0. 76 (0. 47 to 1. 23) 0. 52 (0. 31 to O. A9) p 0. 05 NPC7 hCV74A0735 AII Patients Totat Comnary Heart DLsease EvenLS 19. 1385 0. 0018 7. BB24 0. 0185 148143T (33_4°6) 1311410 (32. 0%) 2) 3/742 (28. 7%) 257/716 (35. 6%) 81/324 (25. 0%) 122/335 (36. 4D/.) 1. 07 (0. 80 to 1. 42) 0. 72 (0. 44 to'1. 20) 0. 58 (0. 33 to 1. 03) p<0. 05 NPCt hCV7490135 Ail Patlents Cardtovascutar MoAality 13. 4221 0. 0197 7. 0589 0. 0293 261437 (5. 9%) 19/410 (4. 6%) 26/742 (3. 5%) 30/716 (4. 2%) 3/324 (0. 9%) 15/335 (4. su) 1. 30 (0. 71 (02. 39) 0. 83 (027 tu 2. 53) 0. 20 (0. 04 to 0. 97) p-0. 05 NPC7 hCV7490135 Ail Patfents Total Cardiovascular Disease Events 25. 0799 0. 0001 10. 2093 0. 00B1 2021437 (48. 2%) 188/410 (45. 9Yo) 3U3l742 (40. 896) 3431178 (47. 8 h) 119/324 (36. 7%) 177/335 (52. 6%) 1. 02 (0. 77 to 1. 33) 0. 75 (0. 47 to 1. 21) 0. 52 (0. 30 to 0. BB) p < 0. 05 NPC1 hCV7490135 Ail Patients Fatal Athemsderotic CadiovascularDfsease 12. 5678 0. 0278 6. 6963 0. 0351 25/437 (5. 7%) 19/410 (4. 6%) 261742 (3. 596) 30f118 (4296) 3/324 (0. 9%) 15/335 (4. 5%) 1. 25 (0. 68 to 2. 30) 0. 83 (027 to 2. 55) 0.z0 (O. moo. 98) p<0. 05 NPC hCV7490135 Ail Pattents FataIINon-fatal Alherosdeootfc CV Disease 21. 1468 0. 0008 9. 33367 0. 0094 165/437 (37. 8-/.) 148/410 (36. 1%) 2461742 (332'Y) 290R718 40. 4Y) 93/324 (28-7%) 140/335 (41. 8%) 1. 07 (0-81 to 1. 42) 0. 73 (0. 45 to 1. 20) 0. 56 (0. 32 to 0. 97) p < 0. 05 PEMT hCV7443082 Ail Patients Fata CHD/DeMile Nofatal MI 17. 656 0. 0034 8. 5923 0. 0138 341478 (7. 1%) 711462 (15. 4Y%) 72l735 (9. 8%) 82/739 (11. 1%) 34/305 (11. 1%) 31/275 (11. 3%) 0. 42 (027 tao 0. 65) 0. 87 (0. 42 to t. A2) 0. 99 (0. 43 to 2. 28) p-0. 05 PLAU hCV16273460 All Patfents FataI/Non-fatat Atherosdemtic CV Disease 18. 1127 0. 0028 6. 1227 0. 0468 301/903 (33. 3%) 350/688 (39. 4%) 1851527 (35. 1%) 192/499 (38. 5%) 19in7 (24. 7%) 38/76 (46. 7%) 0. 77 (0. 63 to 0. 93) U. 85 (0. 58 to 1. 29) 0. 35 (0. 16 to 0. 73) p<0. 05 PONt hCV2548962 All Patients Total Coronary Heart Disease Events 16. 8056 0. 0049 6. 2165 0. 0447 217/736 (29. 5%) 266/753 (35. 3%) 1901625 (30. 4%) 1891579 (32. 6%) 33/144 (22. 9%) 541133 (40. 6%) 0. 77 (0. 62 to 0. 95) 0. 90 (0. 59 to 1. 37) 0. 44 (0. 23 to 0. 81) p < 0. 05 PONi hCV2548982 All Patients Any Report of Stroke Durg CARE 34. 8995 . 0001 7. 1404 0. 0281 13/73B (1. 8%) 161753 (2. 1%) 14/025 (2. 2%) 391579 (6. T%) 7/144 (4. 9%) 4fol33 (3. 0%) 0. 83 (0. 40 to 1. 73) 0. 32 (0. 09 to 1. 18) 1. 65 (0. 30 to 9. 06)-p < 0. 05 PONi hCV2548962 AII Patlents 7st Stroke OccurteU urirg CARE 20. 2289 <. ppp7 6. 8104 0. 0332 lR36 (1. 8%) 14/753 (1. 9%) 13/625 (2. 1%) 34/579 (5. 9%) 7/144 (4. 9%) 4/133 (3. 0%) 0. 95 (0. 44 to 2. 03) 0. 34 (0. 09 to 1. 33) 1. 65 (0. 29 to 9. 33) p < U. 05 SELP hCV1197529B AII Patients Coronary Artery Bypass or Revascularization 24. 9318 0. 0001 7. 3621 0. 0249 146/969 (15. 1 %%) 205/996 (20. 6%) 60/476 (12. 6%) 79/422 (18. 5%) 12/59 (20. 3%) 2/47 (4. 3%%) 0. 68 (0. 54 to 0. 86) 0. 63 (0. 38 to 1. 06) 5. 74 (1. 17 to 28. 28) p < 0. 05 SELP hCV11975298 AII Patienis Hasp. for Cardrovasudar Disease 27. 7519 <. 0001 6. 7453 0. 0343 415/969 (42. 8) 479/998 (48. tYo) 1641478 (94. 3Yo) 193/422 (45. 7%) 29159 (49296) 17147 (36. 2°. 6) 0. 61 (0. 88 ta 0. 97) 0. 62 (0. 42 to 0. 91) 1. 71 (0. 74to 3. 92) p<0. 05 SELP hCV11975298 All Patients Hasp. for Unstable Angtna 15. 1132 0. 0099 8. 9591 0. 0113 150/969 (15. 5%) 181/996 (18. 2%) 65/478 (13. 6%) 78422 (19. 5%) 16/59 (27. 1%) 3147 (6. 4%) 0. 82 (0. 65 to 1. 05) 0. 69 (0. 41 tao 1. 16) 5. 45 (1. 41 to 21. 13) p<0. 05 SERPINA1 hCV1260328 All Patients FataVNon-fatal CerebrovascularDisease 21. 6532 O. OOOB 11. 1964 0. 0037 56/942 (6-9%) 531915 (5-8%) 14/502 (2-8-/.) 36/486 (7-4%) 2/73 (2. 7%) 1 lf (13. 9%) 1. 03 (0. 70 to 1b1) 0. 36 (0. 15 to 0. 8B) 0. 17 (0. 03 to 0. 92) p<0. 005 SERPINA1 hCV1260320 All Patients Any Reportaf Stroke During CARE 15. 254 0. 0093 7. 0558 0. 0294 27le42 (2. 9%) 30/915 (3. 3%) 6/502 (1. 2%) 24/486 (4. 9%) 1/73 (1. 4%) 5/79 (6. 3%) 0. 87 (0. 51 to 1. 48) 0. 23 (0. 07 to 0. 79) 0. 21 (0. 02tao 2. 10) p < 0. 05 TAP7 hCV549926 All PaUents Fatal CHD/Definife NDn-fatal MI 16. 2424 0. 0062 6. 4631 0. 0391 1041in42 (10. 0%) 11711013 (11. 5%) 34/414 (6. 2%) 56/407 (14. 3%) 2/49 (4. 1%) 9/42 (21. 4%) 0. 65 (0. 64to1. 12) 0. 54 (0. 29 to 1. 01) 0. 16 (0. 03 to O. s2) p 0. 05 TGFBi hCV8708473 All Paenls Fatal Comnary Heart ISease 19. 8613 0. 0013 16. 4945 0. 0003 36/704 (5. f %) 201f686 (2. 95oj B/852 (1. 2%) 29f629 (4. 6%) 4/162 (2 (25Yo) 8162 (4. 9°/) 1. 19 (1. 03 to 3. 13) 0. 26 (0. 08 tu 0. 85) 0. 49 (0. 1'I to 223) p < 0. 000 : TGFB1 hCV8748473 All PatienLS Tolal Mortality 12. 6344 0. 0271 lu. 4639 0. 0032 51/704 (7. 2%) 341686 (5. 0%) 251652 (3. 8%) 48/629 (7. 6%) 8/162 (4. 9%) 12/162 (7. 4%) 1. 50 (0. 98 tao 2. 34) 0. 48 (0. 20 to 1. 16) 0. 65 (0. 20 to Zoo) p 0. 005 TGFB1 hCV97o8473 All PaGerts Total Comnary Heart Disease Events 27. 3046 <. 0001 8. 436 0. 0147 2261704 (327W, 234/686 (34. 1%) 156f652 (23. 9%) 220/629 (35. 0°h) 601162 (3T. 0%) 60f162 (37. au) 0. 91 (0. 73 to 1. 14) 0. 58 (0. 30 tao 0. 90) 1. 00 (0. 56 to 1, TT) p 0. 05 TGFB1 hCV8708473 All Patients CardtovascularMortaltty 212405 0-0007 18. 5606 <. 0001 391704 (5. 5°/%) 20/688 (2. 9%) 11/652 (1. 7%) 34/629 (5. 4%) 51162 (3. 1%) 10/162 (6. 2%) 1. 95 (1. 13 to 3. 38) 0. 30 (0. 10 tu 0. 93) 0. 48 (0. 12tn 1. 99) p 0. 000 : TGFBt hCV8708473 All PalfeiAs Fatal Athemsclemtlc CardovascularDisease 20. 614 0. 001 17. 9247 0. 0001 38fIA4 (5. 4%) 20/666 (2. 9%) 11f652 (1. 7%) 34/629 (6. 4%) 5/162 (3. 1%) 10/162 (6. 2%) 1. 90 (1. 0A to 3. 30) 0. 30 (0. 10 to 0. 93) 0. 48 (0. 12 tu 2. 00) p e O. OOOE TGF81 hCV8708473 AII Patierrts Fata INOo-fatat ANerosderutic CV Disease 27. 9483 <. 0001 8. 0319 0. 018 282l704 (37. 2%) 265/686 (38. 6%) 182/652 (27. 9%) 248/629 (39. 4%) 621162 (30. 3%) 70f162 (432%) 0. 94 (0. 78 to 1. 17) 0. 59 (0. 39 to 0. 9D) 0. 81 (0. 47 to 1. 43) p 0. 05 TGFB1 hCV8708473 Ali Patienis More Than 1 Prior MI 14. 8325 0. 0111 12. 9873 0. 0015 122/704 (17. 3%) 811686 (11. 8%) 861652 (13. 2) 110/629 (17. 5%) 27/162 (16. 7%) 301162 (18. 5%) 1. 57 (1. 16 to 2. 12) 0. 72 (0. 40 to 1. 27) 0. 8B (0. 41 to 1. 87) p < 0. 005 TGFB hCV8708473 All Patiards History of Stmke 22. 4625 A. 0004 7. 6B03 0. 0214 38/704 (5. 4%) 18/686 (2. 8%) BI652 (1. 2%) 16/629 (2. 5%) 5/162 (3. 1%) 3f162 (1. 990) 2. 00 (1. 14 to 3S1) 0. 48 (0. 14 to 1. 67) 1. 69 (0. 30 to 9. 36) p < 0. 05 TGF81 hCV8708473 All PatieMS Any Report of Stroke PAor to or Durrng CARE 13. 4403 0. 0196 7. 6397 0. 0219 53/704 p. 5Y%) 38/BBB (5. 7%) 25tu52 (3. 6%) 35/626 (5. 6%) 0/162 (3. 7%) 15/162 (9. 3%) 1. 35 (0. 00 to 2. 07) 0. 68 (0. 29 to 1. 61) 0. 38 (0. 11 to 1. 24) p 0. 05 TLR5 hCV15871020 Ail Patients Hosp. forCardfovascular Dfsease 282057 <. 0001 12. 2152 0. 0022 444f1087 (40. 8%) 49211070 (46. 0%) 159f390 (40. 8%) 181/371 (48. 6%) 5/34 (14. 7%) 20/31 (64. 5%) 0. 81 (o. sB to 0. 96) 0. 72 (0. 49tu1. 07) 0. 09 (0. 03 to 0. 32) p<0. 005 TLRS hCV15B71020 AlI Patfents Total Comnary Heart Disease Events 26. 4624 . 0001 13. 2013 0. 0014 331/1067 (30. 5%) 360N1070 (33. 6%) 1061390 (2729) 136/371 (36. 7%) 4/34 (11. 8%) 18/31 (58. tu) 0. 86 (0. 72 to 1. 03) 0. 64 (0. 42 to 0. 98) 0. 10 (0. 03 to 0. 35) p<0. 005 TLRS hCV15871020 Ail Patients Total CaNiovascular Disease Events 28. 9522 <. 0001 12. 4869 0. 0019 457/1067 (42. OY) 50411070 (47. 1%) 163f390 (41. 8%) 188/371 (50. 7%) 6/34 (17. 6%) 21/31 (67. 7%) D. 81 (0. 69 ta 0. 97) 0. 70 (0. 47 to 1. 04) 0. 10 (0. 03 to 0. 34) p < 0. 005 TLR5 hCV15871020 All Pattents FataVNorfatal Atheiasderolic CV Dtsease 23. 7163 0. 0002 10. 5837 0. 005 374f1087 (34. 4%) 411f1070 (38. 4%) 125f390 (32. 1%) 152/371 (41. 0%) e134 (17. 6%) 18/31 (61. 3%) D. 84 (0. 71 to 1. 00) 0. 6B (0. 45 to 1. 02) 0. 14 (0. 04 to 0. 44) pu 0. 05 TNF hCV7514B79 All Patients Total Mortality 11. 4977 0. 0424 6. 8371 0. 0328 63/1057 (6. 0%) 56/1036 (5. 4%) 19/401 (4. 7%) 33/411 (8. 0%) 2/58 (3. 6%) 5130 (16. 7-1.) 1. 11 (0. 77 tao 1. 61) 0. 57 (0. 25 to 1. 30) 0. 19 (0. 03 tao 1. 13) p < 0. 05 TNF hCV7514879 All Patients FataVNoo-fatal MI (def & pmb) 21. 2263 o. ao07 7. 2562 0. 0266 11111a57 (10. 59 ;) 132Ito38 (12. 7%) 31401 (7. 7%) 66411 (16. 1%) 4/56 (7. 1%) 7/30 (23. 3%) 0. 80 (0. 61 to 1. 05) 0. 44 (0. 24 to 0. 81) 0. 25 (0. 08 to i. 0i) p < 0. 05 TNF hCN514B78 All PaUeNs Hosp. tor Cardiovascular Dtsease 23. 6156 0. 0003 776 0. 0283 432f1057 (40. 9%) 48311038 (48. 6%) 1561401 (38. 9%) 18BI411 (45. 7%) 20/56 (35. 7%) 22/30 (73. 3%) 0. 79 (0. 97 to 0. 94) 0. 76 (0. 51 to 1. 12) 0. 20 (0. 07 to 0, 50) p 0. 05 TNF hCV7514879 Ail PatieMS Total Cardfovascular Dlsease Evenis 24. 2211 0. 0002 7. 3706 0. 0251 448f1057 (42. 4%) 49811036 (48. 1%) 158f401 (39. 4%) 193/411 (47. 0°I) 20156 (35. 7%) 22/30 (73. 3%) 0. 79 (0. 67 to 0. 94) 0. 73 (0. 50 to 1. 08) 0. 20 (0. 07 to 0. 58) p < 0. 05 ABCCB hCV600632 All Patlents Calheterization 13. zu 0. 016 9. 5561 0. 0084 74f615 (12. 0%) 61811599 (102%) etfe96 (8. 8%) 1001877 (14. 8) 20l197 (10. 2%) 24f197 (12. 2Y) 1. 21 (0. A4 to 1. 73y 0. S5 (0. 28 to . 08) 0. 81 (0. 35 to 1. 91) p < 0. 05 ADAMTS13hCV715714fi5 All Patients Nonfatal MI (Pmbablel0efinite) 17. 5811 0. 0035 6. 1707 0. 0457 46508 (9. 1%) 761548 (13. 9Y) 75/728 (1D. 3%) 771687 (11. 5%) 18/274 (6. 6%) 40/259 (15. 4%) 0. 62 (0. 42 to 0. 91) O. BB (0. 44 tao 1. 76) 0. 38 (0. 17 to 0. 89) p < 0. 05 ADAMTS13hCV11571485 All Patients Nonfatal MI (def & 06) 17. 3392 0. 0039 6. 5756 0. 0373 48/508 (9. 1%) 731548 (13. 3%) 70f726 (9. 8°h) 701687 (10. 5%) 171274 (6. 2%) 39f259 (15. 1%) 0. 65 (0. 44 to 0. 96) 0. 91 (0. 45 to 1. 83) 0. 37 (0. 18 tao 0. 87) p- : 0. 05 ADAMTSI3hCV11571485AllPatients FamOyHistoryofCVDfsease 14. 4524 0. 013 11. 1981 0. 0037 191/508 (37. 6%) 2351548 (429Y) 2631726 (362) 277/667 (41. su) 127/274 (46. 4%) 93/259 (35. zu 80 (0. A3to1. 03) 0. 8U (0. 51 tu 1. 25) 1. 54 (0. 92 tu 2. 60) p<0. 005 ALOE hCV905013 All Patients Nonfatal MI (Pmbable (Definite) 18. 7262 0. 0022 6. 2818 0. 0437 33/395 (8. 4%) 575375 (15. 2%) 781749 (10. 4Yo) 81l712 (11. 4Y) 291373 (7. BYo) 571390 (14. 6%) 0. 51 (0. 32 to 0. 80) 0. 91 (0. 42 to 1. 97) 0. 49 (0. 21 to 1. 15) p 0. 05 BCL2A1 hCV7509650 Ail PatieMS MI (FataIfNonfatal) 20. 7271 0. 0009 7. 0B92 0. 0289 751828 (9. 1%) 127/807 (15. 7%) 66/579 (11. 4%) 665572 (11. 5%) 7/102 (6. 9%) 13/95 (13. 7%) 0. 53 (0. 39 tao 0. 72) 0. 99 (0. 55 to 1. 78) 0. 46 (0. 18 to 1. 38) p < 0. 05 BCL2A1 hCV7509850 All PalienAS Defnite Nonfatal MI 16. 791 0. 0075 7. 0988 0. 0287 52/828 (6. 3%) 86/807 (10. 9) 4&579 (7. 9%) 42/572 (7. 3%) 4/102 (3. 0%) 10/95 (10. 5%) 0. 55 (0. 38 0 0. 78) 1. 09 (0. 54 to 2. 20) 0. 35 (0. OBto 1. 29) p A. 05 BCL2A1 hCV7509650 All Patlents Nonfatal MI (def & pmb) 21. 0159 0. 0008 8. 5271 0. 0141 67/828 (B. 1%) 117/607 (14. 5%) 59/579 (10. 2%) 54/572 (9. 4%) 7/102 (6. 9%) 11/95 (11. 6%) 0. 52 (0. 36 to 0. 71) 1. 09 (0. 56 tua 2. 03j 0. 56 (0. 19 to 1. 70) p<0. 05 BCL2A1 hCV509650 All Patients FataIINonfat2l MI (def 8 po6) 21. 9831 0. 0005 6. 1075 0. 0174 72/828 (8. 7%) 126l807 (15. 8%) B6I579 (11. 4%) 651572 (11. 4-/.) 7/102 (6. 9%) 13/95 ; 13. 7%) 0. 51 (0. 38 fi 0. 70) 1. 00 (0. 55 to 1. 82) 0. 40 (0. 16 to 1. 36) p < 0. 05 CCL4 hCV12120554AlIPatieMS FataIComnaryHeartisease 17. 031 0. 0007 9. 227 0. 0024 3811093 (3. 5%) 29/1059 (2. 7%) 01402 (2. 2Y) 28/411 (6. 8%) 1. 28 (0. 78 tu 2. 09) 0. 31 (0. 10to0. 94) p<0. 005 CCL4 hCV12120554 All Patieris Total Mortaliry 13. 1127 0. 0044 9. 1894 0. 0024 66f1093 (6. 0%) 55I105B (52%) 16f402 (4. 0Y) 39/411 (8. 5%) 1. 17 (0. 81 to 1. 70) 0. 40 (0. 17 to 0. 91) p<0. 005 CCL4 hCV12120554 AIIPatients TotaICoronaryHeartDIseaseEVents 17. 7584 0. 0005 6. 5BB9 0. 0103 333f1093 (30. 5%) 35511059 (33. 5%) 101f402 (25. 1%) 156/411 (38. 0-/.) D. 87 (0. 72 tu 1. 04) 0. 55 (0. 36 tu 0. 83) p<0. 05 CCL4 hCV12120554AlIPatierAS CardtovascvlarMortality 18. 0677 0. 0004 10. 6031 0. 0011 4411093 (4. 0%) 3311059 (3. 1%) 10f402 (2. 5%) 31/411 (7. 5%) 1. 30 (0. 82to2. 06) 0. 31 (0. 1lto0. 88) p<0. 005 CCL4 hCV12120554AiIPatlerns FatalAtherosGeotIcCardiovasailarisease 19. 0598 0. 0003 11. 5967 0. 0007 44fiv93 (4. 0%) 3311059 (3. 1%) 9y402 (2. 22h) 31/411Q. 595) 1. 30 (0. 82to206) 0. 28 (0. 10 tu 0. 81) p<0. 005 CCL4 hCV12120554 All Pattents FataiINonfatal AtherosUemtICCV Utsease 19. 4099 0. 0002 6. 6292 0. 01 3761ID93 (34. 4%) 401f1059 (37. 9%) 1201402 (29. 9%) 179/411 (43. 6Y) U. 86 (0. 72 to 1. 03) 0. 55 (0. 37 tu 0. 82) p<0. 05 CDB hCV2553030 All Patiems Hasp. for Cardiovasalar Disease 20. 6DO3 0. 001 6. 0387 0. 0489 351/845 (41. 5%) 44151888 (4&7%) 2201551 (39. 9%) 236/512 (46. 1%) 36/115 (31. 3%) 42/76 (55. 3%) 0. 81 (0. 67to0. 98) 0. 78 (0. 53 to . 14) 0. 37 (0. 19 tao 0. 72) pu 0. 05 CDB hCV2553030 AII PatienS Total Cardiovascular Disease Events 21. 3941 0. 0007 &0B79 0. 0476 3651845 (432%) 425/888 (47. 9%) 222/551 (40. 3%) 245/512 (47. 9%) 33/115 (33. 0%) 43176 (58. 6%) 0. 83 (0. 69 to 1. 00) 0. 74 (0. 50 to I. OB) 0. 38 (0. 19 to 0. 74) p<0. 05 CD6 hCV2553030 All PaUents History of Anglna Pectolis 12. 5002 0. 0285 11. 4198 0. 0033 tua01845 (21. 3%) 1B1/888 (20. 4%) 125/551 (22. 7%) 91/512 (17. 6%) 14/115 (12. 2%) 22l76 (28. 9%) 1. 06 (0. 84 to 1. 33) 1. 36 (0. 84 to 2. 18) D. 34 (0. 15 to 0. 78) pO. 005 CD6 hCV25922320 All Patients Definite Nonfatal Mi 15. 6195 0. 008 6. 8415 0. 0327 57J995 (5. 7) 971935 (10. 4) 4214 (9. 2%) 39/471 (8. 3%) 3/62 (4. 8%) 5/67 (7. 5%) 0. 52 (0. 37 to 0. 74) 1. 12 (0. 56 tao 2. 25j 0. 63 (0. 13 (03. 02) p<0. 05 COB hCV25922320 All Patients Fatal CHDIDefinite t4onfatal Mi 17. 6754 0. 0034 &.308 0. 014 77/985 Q. 196j 28/935 (13. 5%) 56/457 (12. 3%) 52/471 (11. 0%) 6/62 (9. 7%) 7/67 (10. 4°. 6) 0. 54 (0. 40 to 0. 73) 1. 13 (0. 61 to 2. 08) 0. 92 (027 to 3. 17) p < 0. 05 COL71A1 hGV8400671 AII PatieUts MI (FataIfNOnfatap 18. bu9 0. 002 6. 1759 0. 0456 10ef1007 (10. 7%) 122/966 (12. 6%) 36/417 (8. 6%) 70/426 (16. 4%) 3l73 (4. 1%) 8I60 (13. 3%) 0. 83 (0. 63 to 1. 09) 0. 48 (0. 26 to 0. 88 0. 28 (0. 07 to 1. 10) p < 0. 05 COL11A1 hCV8400871 All Patienis Nonfatal MI (def & pmb) 19. 0171 0. 0019 7A511 0. 0241 9711ou7 (9. 6%) 103/966 (10. 7%) 32t4l7 (7. 7%) 661426 (15. 5Y) 3lI3 (4. 1%) 7f60 (11. 7Y) 0. 89 (0. 67 to 1. 20) 0. 45 (0. 24 tao 0. 88) 0. 32 (0. 07 to 1. 42) p<0. 05 COL11A1 hCV8400671 All PatieMS Fatal/Nonfatal MI (def & pmb) 20. 2734 0. 0011 7. 2186 0. 0271 107f1007 (10. 6%) 120/966 (12. 4%) 34/417 (8. 2%) 70/426 (16. 4%) 3/73 (4. 1%) 8f60 (13. 3%) 0. 84 (0. 84 to 7. 11) 0. 45 (0. 24 to 0. 84) 0. 28 (0. 07 to 1. 18) p < 0. 05 CYP4F2 hCV7B179493 Ali Patients Catheterization 16. 4595 0. OOSB 8. 206 0. 01 76f724 (10. 5%) 100Y720 (13. 9%) 551639 (B. BYo) 77/629 (12. 2%) 24/144 (16. 7%) 9/125 (7. 2Y ) 0. 73 (0. 53 to 1. 00) 0. fi8 (0. 36 to 1. 25) 2. 58 (1. 00 (06. 65) p' : 0. 05 CYP4F2 hCV16179493 AII Pattents Fafal Coronary Heart Dfsease 14. 8471 0. 011 11. 1596 0. 0038 18/724 (2. 5%) 391720 (5. 4%) 271639 (4. 2%) 14/629 (2. 2%) 3/144 (2. 1Y) 41125 (3. 2%) 0. 45 (0. 25 to 0. 79) 1. 94 (0. 65 po 5. 74) D. 64 (0. 17 to 3. 69) p < 0. 005 CYP4F2 hCV16179493 All Patients Total MorL-Alty 13. 9492 0. 0159 &7397 0. 0127 34/724 (4. 7%) 601720 (8. 3%) 421639 (6. 6%) 30/629 (4. 8%) 6/144 (427.) 41125 (3. 2%) 0. 54 (0. 35 to 0. 84) 1. 40 (0. 62tu3. 20) 1. 32 (0. 31 to 5. 62) p<0. 05 CYP4F2 hCV18179493 AI Palfems CaNiovascularMortaGty 12. 7875 0. 0255 7. 6593 0. 0217 24/724 (3. 3%) 431720 (8. 0%) 281639 (4. 4% y 771829 (2. 7%) 31144 (2. 190) 41125 (32 i d. 54 (0. 32 tao 0. 90) 1. 65 (0. 61 to 4. 47) 0. 64 (0. 12 to 3. 55) p<O. OS CYP4F2 hCV16119493 Ail PaUents Fatai Atherosderotic CardiovascularDlsease 13. 275 0. 0209 ex1604 0. 0169 23/724 (3. 2%) 43720 (6. 0% ) 281639 (4. 4-A) 17/629 (2. 7%) 3/144 (2. 1%) 44125 (3. 2%) 0. 52 (0. 31 to 0. 87) 1. 65 (0. 81 to 4. 50) 0. 64 (0. 12 to 3. 56) p<0. 05 FCGR2A hCV9077561 All Palients Catheterization 17. 7696 O. OD32 12. 6158 0. 0018 431372 (li. 6%) 451363 (12. 4%) 8au783 (11. 2%) 7go737 (10. 7%) 24/355 (6. 8%) 627377 (16. 4%) 0. 92 (0. 59 to 1. 44) 1. 05 (0. 49 to 2. 29) 0. 37 (0. 18 tao 0. 87) p 0. 005 FCGR2A hCV9077587 All Patlents ComnaryArtery Aypass or Revasculaizatlon 21. 2433 O. OD 7. 357 0. 0253 601372 (16. 1%) 64f363 (17. 6%) 116f783 (14. 6%) 134/737 (18. 2%) 42/355 (11. 8%) 88f377 (23. 3%) 0. 90 (0. 61 to 7. 32) 0. 78 (0. 40 to 1. 53) 0. 44 (0. 21 to 0. 91) p 0. 05 GAPD hCV8921288 All PalfenLs MI (FataIINDnfatal) 19. 0929 0. 0016 7. 4744 0. 0238 10fi1975 (f 0. 9) 114/932 (122%) 3914477 B. 7%) 751451 (16. 6%) 4B2 (6. 5%) 11/60 (18. 3%) 0. 88 (0. 66 to 1. 16) 0. 48 (0. 26 to 0. 88) 0. 31 (0. 09 ta 1. 11) p < 0. 05 GAPD hCV8921288 All PaHents Nonfatal MI (Pmba61e/Definrie) 17. 0899 0. 0043 6. 5106 0. 0388 100/97 (10. 3%) 108/932 (11. 8°,'0) 361447 (A. 1%) 71/451 (15. 7%) 4/62 (6. 5%) 9/60 (15. 0%) 0. 87 (0. 65 to 1. 16) 0. 47 (0. 25 to 0. 87) 0. 39 (0. 10 to 1. 46) p 0. 05 GAPD hCV09212e8 All PatierNS Fatal CHD/elinite Nonfatal MI id5634 O. OD23 10. 4472 0. 0054 lO2f975 (10. 5%) 9au932 (10. 5%) 331447 (7. 4%) 701451 (15. 5Y) 5B2 (8. 1%) 10/BD (16. 7%) 0. 99 (0. 74 to 1. 33) 0. 43 (0. 23 to 0. 82) 0. 44 (0. 13 to 1. 50) p<0. 05 GAPD hCV8921288 Ali Patferrts Nonfatal MI (def & pmb) 14. 4084 0. 0132 6. 4562 0. 0396 97/975 (9. 9) 1031932 (71. 1) 341447 p. 6) 64/451 (14296) 3/62 (4. 8%) 9f60 (15. ou 1 0. 89 (0. 66 tu 1. 19) 0. 50 (0. 26 to 0. 94) 0. 29 (0. 07 to 1. 21) p < 0. 05 GAPD hCV8921288 AII Patfents FataUNonfatat MI (def 8 pmb) 19. 0127 0. 0019 6. 6952 0. 0352 103/975 (10. 6%) 1131932 (12. 1%) 391447 (8. 7%) 74/451 (16. 4%) 4/62 (6. 5%) 11/60 (18. 3%) 0. 86 (0. 64to1. 14) 0. 49 (0. 27 to 0. 89) 0. 31 (0. 08 to 1. 11) p c 0. 05 TABLE 8, page 3 of 3 IL12A hCV1605390U All Patients Coronary Artery Bypass Graft 18. 6303 0. 0022 8. 9976 0. 0111 22/453 (4. 9%) 56/459 (122% j 681761 (8. 9%) 721778 (10. 0%) 2277 p. 2%) 191267 p. 1%) 0. 37 (0. 22 to 0. 61) 0. 88 (0. 38 to 2. 06) 1. 02 (0. 37 to 7 80) p < 0. 05 IL72A hCV76053900 AlI Patients ConnaryArtery Bypass ar Revaswlaizatfon 29. 621 <. 0001 13. 1691 0. 0014 50/453 (11 0g6) t0B145B (23. 7%) 123f76l (IR2%) 133/718 (18. 5%) 411277 (14. 9%) 40/267 (15. 0%) OAO (0. 28 to 0. 67) 0. 85 (OA6 to 1. 68) 029 (OA7 to 2. 05) p 0, 005 IL9 hCV3275199 All PaHents MI (FataI/Nonfatal) 22. 6018 0. 0004 10. 1051 0. 0064 12511129 (11. 1%) 153/1151 (13. 3%) 21/346 (6. 0%) 49/302 (16. 2%) 2/33 (0. 1%) 5/24 (20. 6%) 0. 81 (0. 63 to 1. 04) 0. 33 (0. 17 to 0. 65) 0. 25 (0. 04 to 1. 45) p<0. 05 ILB hCV327619A Ail Palients Nonfatal MI (ProbableJDefinite) 23. 2912 0. 0003 11. 1902 0. 0037 117/1129 (10. 4%) 141/1151 (12. 3%) 20/346 (5. 7%) 49/302 (16. 2%) 2/33 (8. 1°. 6) 5/24 (20. 8%) 0. 83 (0. 84 tu 1. 07) 0. 31 (0. 18 tu 0. 62) 0. 25 (0. 04 t0 1. 46) p < 0. 005 M HCV3275199 AnPatlents NonfatalMUdeUpmb) 19. 7567 0. 0014 9. 2262 0. 0099 111/1129 (9. 6%) 133/1151 (11. 6%) 20/348 (5. 7%) 45/302 (14. 9%) 2/33 (6. 1%) 5/24 (20. 8%) 0. 83 (0-64 to 1-09) 0-35 (0, 17 to 0. 70) 0. 25 (0. 04 to 1. 46) p 0. 05 IL9 hCV3275199 All Patlents FataUNonfatal MI (def & pmb) 22. 278 0. 0005 9. 1717 0. 0102 122/1129 (10. 8%) 152/1151 (13. 2%) 21/348 (6. 0%) 48/302 (16. 9%) 2/33 (6. 1%) 5/24 (20. 8%) 0. 80 (0. 62tu1. 03) 0. 34 (0. 17 to 0. 66) 0. 25 (0. 04 to 1. 46) p<0. 05 KLK14 hCV16044337 All Patients Mi (FoLeVNonfatal) 27. 4658 <. 0001 0. 606 0. 0135 70/093 (10. 1%) 81/665 (11. 6%) 67/657 (10%) 89/629 (14. 1%) 111160 (6. 9%) 35/156 (22. 4%) 0. 64 (0. 60to 1. 18) 0. 69 (0. 37 to 1. 29) 0. 26 (0. 10 to 0. 62) p < 0. 0. 5 KLK14 hCV16044337 Ail PatienLS Nonfatal MI (PmbabIeJDenNte) 25. 1331 0. 0001 8. 1765 0. 016 67/693 (9. 7%) 7a/665 (11. 5%) 62/657 (9. 4%) 81/629 (12. 9°/%) 101160 (6. 3%) 33/156 (21. 2%) 0. 82 (0. 58 to'1. 16) 0. 70 (037top. 34) 0. 25 (0. 10 to 0. 62) p < 0. 05 KLK14 hCV16044337 AII Patlents Definie Nonfatal MI 18. 9028 O. D02 6. 7602 0. 034 49/693 (. tY) 57/B85 (83°3%) 47/857 (7. 2%) 58/629 (92) 7/1fi0 (4. 4%) 25/156 (16. 0%) 0. 84 (0. 56 to 1. 25) 0. 76 (0. 36 to 1. 68) 0. 24 (0. 08 to 0. 70) p<0. 05 KLK14 hCV16044337 AII Patients Comnary Artery Bypass G2ft 18. 8672 0. 002 8. 7354 0. 0127 60/693 (8. 7%) 577/685 (8. 3%) 41/657 (B. 2%) 79/628 (12. 6Yo) 91160 (5. BY) 15/15B (9. 8%) 1. 04 (0. 71 tu 1. 53) 0. 46 (023 to 0. 95) 0. 56 (0. 20 tu 1. 60) p 0. 05 KLK14 hCV16044337 AII Patlents Fatal CHDIDefnite Nonfatal MI 23. 3389 0. 0003 9. 6221 0. 0061 66/693 (9. 5%) 73/665 (10. 7%) 65/657 (9. 9%) 79/fui29 (12. 6%) 91160 (5. 6%) 32/156 (20. 5%) 0. 88 (0. 62tao 125) 0. 76 (0. 40 tu 1. 47) 0. 23 (0. 09t0 0. 60) p < 0. 05 KLK14 hCV16044337 All Patients Nonfatai MI (def & pmb) 23. 6296 0. 0003 7. 6653 0. 0217 63/693 (9. 1%) 751685 (f10. 9%) 6N657 (9. 1%) 74/629 (11. 6%) 10/160 (6. 3%) 32/156 (20. 5%) 0. 81 (0. 57 to 1. 16) 0. 75 (0. 39 to f. 48) 026 (0. 10100. 66) p<0. 05 KLK14 hCV16044337 Ail PatieMS FataUNonfatal MI (def & pmb) 28. zu 0001 8. 3321 0. 0155 66/693 (9. 8%) 80/665 (11. 7%) 66/657 (10. 0%) 88f629 (14. 0%) 111160 (6. 9°h) 551158 (22A%) 0. 82 (0. 58 to 1. 16) 0. 69 (0. 38 to 1. 30) 026 (0. 10 to 0. 63) p 10. 05 LAMAS hCV25629482 All Patients Definite Nonfatal MI 17. 052 0. 0044 8. 4868 0. 0144 551622 (8. 8%) 53/616 (B. 6%) 36 (654 (5. 4%) 64/639 (10. 0Yo)'-9/221 (4. 1%) 23/215 (10. 7%) 1. 03 (0. 69 tao 1. 53) 0. 52 (0. 2410 1. 10) 0. 35 (0. 13 to 0. 97) p 0. 05 LAMAS hCV25629492 All Patlents Nanfatal MI (0ef 3 pmb) 19. 6962 0. 0014 8. 0144 0. 0182 7N622 (11. 3%) 71/616 (11. 5%) 491664 (7. 4%)) 84f639 (13. 1%) 121M (5. 4%) 27/215 (12. 6%) 0. 97 (0. 69 to 1. 38) 0. 53 (0. 27 to 1. 03) 0. 40 (D. l6to 0. 98) p < 0. 05 LAMAS hCV25629492 All Patienls FataI/Nonfatal MI (deF& pmb) 21-1343 0. 0008 6. 1961 0. 0451 75/622 (12. 1%) 821616 (13. 3%) 51/664 (7. 7%) 901639 (14. 1%) 171221 (7. 7%) 32/215 (14. 9%) O. BB (0. 84tao 125) 0. 51 (027 to 0. 96) 0. 48 (021 to 1. 0B) p < 0. 05 MARK3 hCV25926771 All PatieMS Defin (te Nonfatal MI 17. 5176 0. 0015 3. 6996 0. 0463 39/578 (6. 7%) 37/566 (6. 5%) 63/906 (7. 0%) 100/679 (11. 4%) 1. 03 (0. 65101. 65) 0. 58 (026 to 1. 31) p < 0. 05 MARK3 hCV25926771 All Patienis Fatal CHDIDefinite Nonfatal MI 14. 4978 O. OOS9 4. 1405 0. 0419 57/578 (9. 9%) 56/566 (9. 9%) 8219DB (9. 1%) 125/679 (14. 2%) 1. D0 (0. 68 to 1. 47) 0. 60 (0. 30 to 1. 19) p < 0. 05 MJD hCV18189421 AII Patients MI (FataIMonfata) 16. 398 0. 6056 6. 2348 0. 0443 731845 (8. 6%) 123/828 (14. 9y 6&547 (12. 1%) 61/506 (12. 1%) 10/89 (11. 2°. 6) 15/100 (15. 0%) 0. 54 (0. 40 to 0. 74) 1. 00 (0. 55to1. 63) 0. 72 (0. 27to1. 91) p<0. 05 MJD hCV16189421 Ail Palients Nonfatal MI (ProbaMeIDeCNte) 16. 5163 0. 0055 7. 157 0. 0279 68/845 (8. 0%) 118/828 (14. 3%) 621547 (11. 396) 5fiI506 (11. 17.) 10/89 (11. 2%) 131100 (13. 0%) 0. 53 (0. 38 to 0. 72) 1. 03 (0. 55 to 1. 91) 0. 85 (0. 31 to 231) p < 0. 05 MJD hCV16189427 AII Patfents Nanfatal MI (def prob) 17. 6259 0. 0035 9. 9522 0. 0069 63/645 (7. 5%) 113/626 (13. 6%) 61/547 (11. 2%) 50/506 (9. 9%) 10/89 (11. 2%) 12/100 (12. 0%) 0. 51 (0-37 to 0. 71) 1. 14 (0. 61 to 2. 16) 0-93 (0, 33 to 2 58) p 4 0. 05 MJD hCV16189421 AII PallenLS Fatal/Nonfatal MI (def(8 pmb) 16. 78B O. OD49 631 0. 0426 71/845 (8. 4%) 1221828 (14. 7%) 65/547 (11. 9%) 61/506 (12. 19) 10l89 (11. 2%) 14100 (14. 0%) 0. 53 (0. 39tu0. 72) bob (0. 54tu1. 80) 0. 78 (0. 29 to 2. 09) p < 0. 05 MJD hCV16189421 All Pattents Hasp. for Unsta6le Angfna 11. 229 0. 047 6. 7739 0. 0338 122/845 (14. 4ky 181/828 (19. 4Yo) 88/547 (17. 6%) 79/506 (15. 6%) 9/89 (10. 1%) 181100 (18. 0%) 0. 70 (0. 54 to 0. 9U) 1. 15 (0. 69 tao 1. 93) 0. 51 (0. 20 to 1. 32) p < 0. 05 MMP27 hCV7492601 AII PatlenLS PerManeaus TransIUrNnai Coranary AngioWa 73284 O. PL09 fi. 4349 0. 0401 42/432 (9. 7%) 36/449 (B. 0%) 681746 (9. 1°/a) B11715 (f 1. 3) 27/331 (82%) 461310 (14. 8%) 1. 24 (0. 78 to l. 97) 0. 7A (035 to 1. 78) 0. 5(021 to 1. 25) p<0. 05 NID2 hCV15776071 AII Patfents FataI/Nonfatal Cerelxovascular isease 13. 2979 0. 0207 7. 6501 0. 0218 47/A30 (5. 7%) 47/836 (6. 6%) 23/661 (4. 1%) 44/649 (6. 0%) 2/115 (1. 7%) 8/88 (9. 1%) 1. 01 (0. 66 to 1. 53) 0. 49 (021 to 1. 13) 0. 18 (0. a3 to 0. 98) p < 0. 05 PECAM1 hCV16170811 AII Patfents Stmke 16. 5925 0. 0053 7. 4054 0. 0239 714T6 (1. 5%) 17/443 (3. B%) 22f716 (3. 1%) 22/679 (3. 6%) 3/318 (0. 9%) 19/351 (5. 4%) 0. 37 (0. 15100. 91) 0. 95 (0. 22 to 4. 14) 0. 17 (0. 03 to 1. 03) p<0. 05 PLAB hCV7494810 Ail Patients MI (FalaIlNOnfatal) 21. 5216 O. OOM 6. 8687 0. 0322 891876 (71. 3%) 109/A36 (13. 0%) 44/551 (8. 0%) 87/542 (16. 1%) 5/87 (5. 7%) 11/98 (11. 2%) 0. 65 (0. 64) 01-14) 0. 45 (0. 25 to 0. 82) 0. 48 (0. 15 to 1. 59) p<0. 05 PLAB hCV7494810 All Patients Nonfatal Mi (Pmbable/Definite) 19. 4685 0. 0018 6. 2388 0. 0442 931876 (10. 6%) 1031836 (123 %) 411551 p. 4Y,) 811542 (14. 9%) 5/87 (5. 7%) 11/98 (11. 2%) 0. 85 (0. 63to01. 14) 0. 46 (0. 25 to 0. 85) A. 48 (0. 15 to 1. 59) p 0. 05 PLAB hCV7494810 Ali Paffentc DeMite Nonfatal MI 19. 0198 0. 0019 8. 9516 0. 0114 69/876 p. 9) 7N838 (8. 4Yo3 281551 (5. 1%) 65I542 (12. 0%) 5/67 (5. 7%) 6/96 (6. 1%) 0. 94 (0. 66 to 7. 32) 0. 39 (0. 19 to 0. 80) 0. 93 (024 tao 3. 57) p<0. 05 PLAB hCV7494810 All Patients Fatal CHD/Definite Nonfatal MI 18. 025 O. OO29 6. 5222 0. 0383 91/676 (10. 4%) 96f836 (11. 5%) 421551 (7. 6%) blot542 (14. 9%) 6/67 (6. 9%) 6/68 (6. 2%) 0. 89 (0. 66 to 1. 21) 0. 47 (025 to 0. 87) 0. 83 (025 to 2. 77) p<0. 05 PLA6 hCV7494810 All Patie t5 Nonfalal MI (UM 6 06J 10. 3495 0. 0025 6. 8182 0. 0331 891876 (102Yo) 95I83B (11. 4%) 39f551 (7. 1%) 7au542 (14. 4%) 5/87 (5. 7%) 10/98 (10. 2%) 0. 88 (0. 65tu1. 20) 0. 45 (0. 24 to 0. 85) 0. 54 (0. 16 to 1. 81) p 0. 05 PLAB hCV7494810 All Patients FataUNonfatal MI (def & pmb) 21. 1333 0. 0008 6. 0322 0. 049 961076 (11. 0%) 108/838 (i28Yo 44f551 (8. 0%) Bai542 (15. 9%) 5/67 (5. 7%) 11/96 (11. 2%) 0. 63 (0. 62to1. l1) 0. 46 (0. 25tu0. 64) 0. 48 (0. 15 to l59) p 0. 05 PTPN21 hCV16182835 All Patients FataVNonfatal Cerebmvascuiar Disease 15. 5999 0. 0081 &. 6004 0. 0136 381661 (5. 7%) 30/615 (4. 9%) 2516413 (4. 0%) 51/873 p. 655) 8/177 (3. 496) 1fi1162 (9. 9%) 1. 19 (0. 73 to 1. 95) 0. 51 (0. 20 to 1. 29) 0. 32 (0. 09 to 1. 11) p 0. 05 PTPNZI hGV25942539 All Patients FataitNonfatal Cerebmvasmlw Disease 14. 0688 0. 0152 7. 0712 0. 0291 38/672 (5. 7%) 32/620 (52) 2fif642 (4. OY) 51/873 p. 6%) 6/172 (3. 5%) 16/155 (9. 7%) 1. 10 (0. 88 tao 1. 79) 0. 51 (0. 21 to 1. 28) D. 34 (0. 10 to 1. 17) p < 0. 05 QSCNB hCV25761292 All Patients Comnary Artery Bypass Graft 19. 4949 0. 0016 7. 7634 0. 0204 63f1085 (5. 8%) 10711024 (10. 4%) 41/376 (10. 0%) 39/405 (9. 6%) 5/38 (13. 2%) 5142 (11. 9%) 0. 53 (0. 38 to 0. 73) 1. 15 (0. 58 to 2. 27) 1. 12 (0. 27 to 4. 62) p < 0. 05 SERPINA1 hCV256405A5 Ail PatienLS Coronary Artery 0ypass Graft 20. zu 0. 0009 7. 2a73 0. 0262 44/724 (B. 1%) 86f70. 5 (122°2%) 381420 (9. oh) 431413 (10. 4%) 22f2A8 (7. 4%) 18/277 (6. 5%) 0. 47 (0. 32 to 0. 66) 0. 86 (0. 41 to 1. 8D) 1. 15 (0. 48 to 2. 74) p<0. 05 SERPIN88 hCV181B0893 AII Palients FataVNonfatal AthelosderotiC CV Disease 21. 4112 0. 0007 6. 2956 0. 0429 266f/62 (34. 9%) 286/732 (39. 1%) 198f612 (32. 4%) 227/603 (37. 6%) 41/138 (29. 7%) 691138 (50. 0%) 0. 84 (0 fiB8to01. 03) 0. 79 (0. 53 to 1. 19) 0. 42 (023 to 0. 77) p < 0. 05 SN hCV25623265 All Patients Definite Nonfatal Mi 17. 7417 0. 0033 8. 3114 0. 0157 33/401 (6. 2%) 41f396 (10. 4%) 60/766 (7. 6%) 65/745 (6. 0%) 9/326 (2. 8%) 341337 (10. 1%) 0. 78 (0. 48 to 128) 0. 65 (0. 37to1. 96) 0. 25 (0. 09to0. 73) p<0. 05 SN hCV25623265 All Patients Percutaneous T=sluminal Coronary Angiopla, 12. 2825 0. 0311 7. 1824 0. 0275 30/401 (7. 5%) 571398 (14. 4%) 751788 (9. 5Yo) 7BI745 (102Yo) 32I32B (8. 8h) 29/337 (8. 6%) 0. 48 (0. 30 to 0. 77) 0. 93 (0. 42 to 2. 05) l. in (0. 47 to 2. 81) p < 0. 05 SN hCV25823285 All Patierrts Fatal CHDIDetinite Nanfatal MI 1 &5351 0. 0023 8. 1295 0. 0172 39/401 (9. 7%) 53f396 (13. 4%) 85/766 (10. 8%) 89/745 (11. 9%) 15/326 (4. fi%) 431337 (12E) 0. 70 (0. 45 to 1. 08) 0. 89 (DA2 to 1. 90) 0. 33 (0. 13 to 0. 82) pu 0. 05 SN hCV25623265 All PaUentS CotunatyArtery Bypass o Revasdilarizalion 27. 1389 <-0001 8. 407 0. 0149 521401 (13. 0%) 991396 (25. 0%) 1171786 (14. 9%) 135/745 (16. 1%) 49/326 (15. 0%) 53/337 (15. 7%) 0. 45 (0. 31 to 0. 65) 0. 79 (0. 42 to 1. 49) 0. 95 (0. 47 to 1. 93) pu 0. 05 SN hCV25623265 All Pattents Tolal Comnary Heart Dfsease Events 18. 45 0. 0024 6. 233 O. O443 109/401 (272 o) 157/398 (99. 6%) 2401786 (30. 5%) 243/745 (32. 6%) 92/326 (28. 2%) 114/337 (33. 8%) 0. 57 (0. 42 to 0. 77) 0. 91 (0. 54 to 1. 52) 0. 77 (0. 43 ta 1. 36) p < 0. 05 TGF81 hCV22272997 Ail PatieNS Fatal Cooonary Heart oisease 172829 0. 004 14. 9163 0. 0006 29/554 (5. 2%) 13/536 (2. 4%) 141712 (2. 0%) 321678 (4. 7%) 5/244 (2. 0%) 121254 (4. 7%) 2. 23 (1. 15 to 4. 34) 0. 40 (0. 11 to 1. 43) 0. 42 (0. 09to 1. 93) p < 0. 005 TGF81 hCV22272997 All PatientsTo181 Mortality 15. 1303 O. DD 13. 5508 O. DOll 41/554 (7. 4%) 22/538 (4. 1%) 33f7l2 (4. 6%) 52/678 (7. 7%) 9/244 (3. 79b) 20/254 p. 9Y) 1. 87 (1. 10 to 3. 19) 0. 59 (0. 22 to 1. 55) 0. 45 (0. 14 to 7 AB) p < 0. 00. 5 TGF81 hCV22272997 AII Patients Total Comnary Heart Disease Events 22. 2798 O. ODOS 8. 4079 0. 0149 180/554 (32. 5%) 183/538 (34. 0%) 178/712 (25. 0%) 243/878 (35. 6%) 61/244 (33. 2%) 66/254 (33. 9%) 0. 93 (0. 73 to 10 20) 0. 60 (0. 38 to 0. 95) D. 97 (0. 58 to 1. 67) p c 0. 05 TGF01 hCV22272997 AlI Palienls Card'rovaswlarMoAality 10. 1724 O. OD27 16. asaB 0. 0003 31/554 (5. 6%) 13/538 (2. 4%) 181712 (25%) 3Bi678 (5. 3%) 6/244 (2. 5%) 151254 (5. 9%) 2. 39 (1. 24 to 4. 63) 0. 46 (0. 14 to 1. 58) 0. 40 (0. 09 to 1. 71) p < 0. 0005 TGFB7 hCV22272887 All Pattents Fatat Athensderatlc CardiovascularD'sease 19. 1187 0. 0018 16. 6966 0. 0002 31/554 (5. 6%) 131538 (2. 4%) 17/712 (2496) 381878 (5. 3%) 6/244 (2. 5%) 15/254 (5. 9%) 239 (t24 to 4. 63) 0. 44 (0. 13 to 1. 49) 0. 40 (O. OD to 1. 71) p<0. 0005 TLRB hCV1180648 All Patients Fatal Coronary Head Disease 17. 8186 0. 0032 9. 4953 0. 0087 18I546 (3. 3%) 28/532 (5. 3%) 131692 (1. 9%) 24/689 (3. 5%) 17/276 zu 5/253 (2. 0%) 0. 61 (0. 39 tao 1. 12) 0. 53 (0. 17 to 1. 89) 3. 26 (0. 82 to 12. 92) p 0. 05 TLRB hCV1 18D648 All Patients CardiovascularMorlality 17. 2547 0. 004 10. 936 0. 0042 19/548 (3. 5%) 30/532 (5. 6%) 17I692 (2. 5%) 29/689 (4. 2%) 19/276 (8. 9%) 5I253 (20) 0. 60 (0. 33 to 1. 08) 0. 57 (0. 19to 1. 71) 3. 67 (0. 95tot4. 17) p 0. 005 TLRB hCV116D648 Ali Pattents FatalAtheosclemtic CarlovascularDfsease 15. 9494 0. 007 10. 159 0. 0062 19154A (3. 5Yy 301532 (5. 6%) 17/692 (2-5%) 21/689 (4. 2%) 18/276 (6. 5%) 6/253 (2. 0%) 0. 60 (0. 33 to 1. 08) 0. 57 (0. 19 to 1. 71) 3. 46 (0. 69tot3. 42) p<0. 05 VEGF hCV791476 All Patfents CaodiovascularMorlality. 13. 8606 0. 0165 9. 7311 0. 0077 45/1067 (42%) 04/1030 (3. 3%) 91372 (2Alo) 27/384 (7. oye) 1151 (2. 0%) 2/34 (5. 9%) 1. 29 (0. 82 to 2. D3) 0. 33 (0. 11 to 0. 94) 0. 32 (0. 03 to4. 09) p<0. 05 VEGF hCV791476 AII Pa4ents FalalAtheroscleotic CardiovascularDisease 13. 8845 0. 0164 9. 3771 0. 0092 44/7067 (4. 1%) 34/1030 (3. 3%) 9f372 (2. 4) 27/3B4 (7. 0%) 1/51 (2. 0%) 2f34 (5. 9%) 1. 26 (0. 80 to 1. 99) 0. 33 (D. 1lto 0. 95) 0. 32 (0. 03 tA 4. 09) p < 0. 05 "Results of the Overall Scone Test (chl-square lest) for the logistic regression modelin which the qualitative<BR> phenotype is a function of SNP genotype, treatment group, and the interaction between SNP genotype and<BR> Ineatment group.<BR> <P>"Results of the chi-square test of the interaction between SNP genotype and treatment group (based on the<BR> logistic regression model).

TABLE 9, page 1 of 3<BR> RMI_Logistic Regression EndOo (nt Publlc Marker Genotvpelmod2 Str4ta Confounder Prik,. t RRb 9B% CIç cased AFt%)-control'ControlAP (% f RMI (fatal Mi, confimed non-fatal MI) A2M hCV517658 Het (CT) Ail statin, hx_Smoke'. 026 1. 34 1. 04-1. 71 130 51. 8 t 137 44. 8 RMI (fatal MI, conftrmed non-fatal Mp ENPP1 hCV1207994 Het (CA) All statin 0. 0706 1. 28 0. 98-1. 65 73 28. 9 616 24. 2 RMI (fatal MI, conftrtned non-fatal MI) IGF1R hCVB722981 Het (fC) All stafln 0. 0039 2. 01 1. 26-3. 06 17 6. 7 SO 3. 1 RMI (fatal MI, confirmed non-fatal MI) IRF3 hCV7798230 Rec (GG) All statin 0. 0071 1. 61 1. 14-2. 23 42 16. 5 257 10. 1 RMI (fatal MI, confirmed non-fatal MI) LRP2 hCV16165996 RecfTT) All 8talin 0. 0324 0. 45 0. 21-0. 93 7 2. 8 160 6. 3 RMI (fatal MI, confirmed non-fatal MI) MC3R hCV22274632 Het (CA) All statin, hx smoke'0. 0565 1. 34 0. 99-1. 78 50 19. 7 397 15. 6 RMI (fatal MI, confirmed non-fatal M) MC3R hCV25640926 Het (GA) All statin, hx_smoke'0. 0264 1. 4 1. 04-1. 85 51 20. 1 389 15. 2 RMI (fatal MI, conflrtned non-fatal MI) MC3R hCV9485713 Het (CT) All staDn hx_smoke 0. 0225 1. 41 1. 051. 87 51 20. 2 388 15. 2 "Pastrory or smoking<BR> a Significance of risk eslimated by Wald test<BR> b Relative risk<BR> c 95% confidence interval for relative risk<BR> d Number of patlents (with the coesponding genotype or mode) developed recurrent MI during 5 years of follow up<BR> e The allele frequency of patients (with the corresponding genolype or mode) developed recurrent MI during 6 years of folow up<BR> f Number of palients (with the corresponding genotype or monde) had MI<BR> g The allele frequency of palients (with the comesponding genotype or monde) hart MI TABLE 9, page 2 of 3<BR> RMI Replication Between CAREand PreCARE Sample Sets _. pnal-'sl's 2 f CARfiSarti I.. Case Contro) Case Controt End oint Pubic Marker Geno e/mode Strata P d. k.. ' ORb 95% CI cased AF %'cantrol AF Y Strata P I-k.. t' OR 95% Cl' case'control, AF (%) g RMI (fatal Mi. confirmed non-fatal MI) FABP2 hCV761961 DomfTC+TT) AGET1 0. 01 0. 50 0. 3-0. 9 19 40. 8 110 25. 2 AGE T1 0. 01 0. 5 0. 3-0. 9 21 26. 6 187 41. 7 RMI (falal MI, confirmed non-fatal MI) HLA-DPB1hCV8851080 Rec (GG) AGET3 0. 037 2. 70 1. 1-6. 7 10 11. 1 11 4. 4 AGE T3 0. 039 1. 9 1. 0-3. 6 19 10. 7 25 58 RMI (fatal conSmmednon-fatalMI) IL12RB1 hCV7BSa42 Allelic (G) BMI>30. 5 0. 06 0. 60 0. 4-1. 0 29 25. 0 104 34. 7 Bomb30. 5 0. 006 0. 5 0. 4-0. 8 33 23. 2 182 35. 7 RMI (btalMI confimmednon-fatalMI) KDR hCV16192174 Allelic (A) HYPY 0. 03 1. 80 1. 1-3. 3 28 23. 5 45 14. 4 HYP Y 0. 03 1. 7 1. 0-2. 7 4 2. 4 2 0. 4 RMl (fablMI conummednon-fatalMI) KLKB1 hCV22272267 Dom (GAtM) HYP Y 0. 025 1. 80 1. 1-3. 1 so 82. 1 223 71. 3 HYP_Y 0. 034 1. 3 1. 0-1. 7 180 53. 6 500 46. 9 RMI (fatal Mi, confirmed non-fatal MI) MMP7 hCV3210838 AllelisfT) AGE_T1 0. 029 0. 60 0. 3-1. 0 21 13. 8 117 21. 8 AGE T1 0. 033 0. 6 0. 4-1. 0 23 14. 6 197 22. 0 RMI (fatal Mi, confirmed non-fatal MI) WRN hCV3020386 RecfTT) AGET1 0. 06 1. 8 1. 0-3. 4 20 26. 3 43 16. 3 AGE_T1 0. 018 1. 9 1. 1-3. 1 30 38. 0 110 24. 7 RMI (fablMI conñmmednon-fatalMI) LRP2 hCV16165996 Rec (TT) M 0. 015 0. 30 0. 1-0. 9 7 2. 8 65 62 All 0. 002 0. 3 0. 1-0. 7 11 2. 8 92 7. 0 RMI (fatal Mi, conrt"ed non-fatal MI) LRPS hCV190754 Hel (TCYDom (TCTT) APOE4 allefe 0. 1 1. 80 0. 9-3. 6 28 124 APOE4 allele 0. 1 1. 5 0. 9-2. 3 60 128 RMI (fatal Mi. confirmed nori-fatal MI) LRPB hCV190764 Hot (TCYDom (TC+TT) APOE4 not 1. 00 0. 7-1. 4 75 389 APOE4 not 0. 98 0. 7-1. 4 154 391 RMI (fatalMl conñmmednon-fatalMI) KDR hCV16192174 Dom (M+AG) APOE4alleta O. O011 2. 60 1. 4-5. 4 18 51 APOE4 allele 0. 2 1. 5 0. 9-2. 6 26 43 RMI (lablMI conñmmednon-fatalMI) KDR hCV16192174 Dom (AA+AG) APOE4 not 0. 70 0. 4-1. 2 25 167 APOE4 not 1. 0 0. 7-1. 37 RMI (falaIMI, confirtnednon-fatalMI) KDR hCV16192174 Dom (AA+AG) APOE4/2 0. 0048 16. 6 1. 2B-158 RMI (falal MI, confirtned non-fatal MI) KDR hCV16192174 Dom (AA+AG). APOE4 not 1. 0 0. 8-1. 42 aSignificance of risk estimated by Wald test<BR> bOdds ralio<BR> c95% confidence interval for odds ratio<BR> dNumber of patients (with the corresponding genotype or mode) developed racurrent MI during 5 years of follow up<BR> eThe allele frequency of patients (with the corresponding genotype or mode) developed recurrent MI during 6 years of follow up<BR> fNumber of patients (with the corresponding genotype or mode) had MI<BR> gThe allele frequency of patients (witht he corresponding genotype or mode) had MI<BR> AGE_T1 indicate that Age<55<BR> AGE_T13 indicate that age>=64<BR> [HYP_Y indicate that patients had history of hypertension TABLE 9, page 3 of 3<BR> Stroke Replication Between CAREand PreCARE Sample Sets am S a s v An is 1 oGAKE. sain ies Mal sis'2 oi CARE Sain les . Case Control Case Control End olnt Public Marker Geno e/made Strata P ask a. P OR° 95 % CI case"AF %'control AF k ° Strata P rnt a. P OR° 95% CI case° AF %'control AF % ° Stroke ACAT2 hCV1361979 Dom (M+GAyAiteitc (G) male 0. 015 1. 7 1. 1-Z7 89 75. 42 715 64. 18 male 0. 013 1. 5 1. 1-2. 2 73 53. 66 926 42. 71 Stroke APOA4 hCV114B2766 Rec (CC) all 0. 016 3. 5 1. 4-9. 1 6 23 16 1. 24 all 0. 05 3. 3 1. 1-9. 8 4 5 20 1. 59 Stroke HTR2A hCV11696920 Rec (M) all 0. 06 5. 8 1. 9-18. 1 5 3. 52 8 0. 62 all 0. 038 4. 9 1. 3-16. 0 3 3. 75 10 0. 79 Stroke ICAM1 hCV8726331 Rec (AA) all 0. 1 3 1. 2-9. 3 5 3. 52 14 1. 09 all 0. 04 26 0. 9-10. B 3 3. 75 16 1. 27 Stroke KAMI hCV8726331 Rec (M) male 0. 01 4. 8 1. 6-14. 3 5 4. 17 10 0. 9 male 0. 06 3. 8 1. 1-13. 8 3 4. 41 13 1. 19 Stroke KCNMBi hCV3026206 Het (GC) mate 0. 019 1. 7 1. 1-2. 7 29 24. 58 176 15. 81 male 0. 074 1. 7 1. 0-2. 9 18 26. 47 193 17. 69 aSignificance of risk estimated by Wald test<BR> bOdds ratio<BR> c95% confidence Interval for odds ratio<BR> dNumber of patients (with the corresponding genotype or mode) developed recurrent MI during 5 years of follow up<BR> eThe allele frequency of patients (with the corresponding genotype or mode) developed recurrent MI during 6 years of follow up<BR> iNumber of patients (with the corresponding genotype or mode) had MI<BR> gThe allele frequency of patients (with the corresponding genotype or mode) had MI TABLE 10, page 1 of 8<BR> Risk of cardiovascular disease events associated with Pravastatin by genotypes Case Y Control Y PRIMER PRIMER ALLELE ALLELE Gene Nucleotide Nucleotide symbol hCV Freq* Freq** Stratum Group ptrenda N affb N unaf RRd RR 95% Cle PSkescf Pmi Covars° ATF6 hCV25631989 0. 04 0. 08 Placebo homtrT) vs. ref (CC) 1 5 1. 49 (0. 25-9. 00) 0. 6624 het (TC) vs. ref (CC) 9 185 0. 42 (0. 22-0. 80) 0. 0089 ref (CC) 128 1018 1. 00 Statin hom (TT) vs. ref (CC) 0 11 NA het (TC) vs. ref (CC) 24 189 1. 53 (0. 99-2. 34) 0. 0535 ref (CC) 85 1066 1. 00 0. 0069 none ref (CC) Statin 85 1066 0. 66 (0. 51-0. 86) 0. 0019 Placebo 128 1018 1. 00 Het (TC) Statin 24 189 2. 43 (1. 165. 10) 0. 0189 Placebo 9 185 1. 00 Min Hom (Tf) Statin 0 11 NA Placebo 1 5 1. 00 LAMA2 hCV16047108 0. 06 0. 07 Placebo hom (GG) vs. ref (AA) 0 7 NA het (GA) vs. ref (AA) 17 147 0. 98 (0. 61-1. 58) 0. 9257 ref (AA) 128 1079 1. 00 Statin hom (GG) vs. ref (AA) 2 4 4. 97 (1. 57-15. 70) 0. 0063 het (GA) vs. ref (AA) 22 140 2. 02 (1. 30-3. 14) 0. 0017 ref (AA) 84 1168 1. 00 0. 0057 none Maj Hom (AA) Statin 84 1168 0. 63 (0. 49-0. 82) 0. 0007 Placebo 128 1079 1. 00 Het (GA) Statin 22 140 1. 31 (0. 72-2. 37) 0. 3732 Placebo 17 147 1. 00 Min Hom (GG) Statin 2 4 NA Placebo 0 7 1. 00 ITGA9 hCV25644901 0. 08 0. 04 Placebo dom (GA+GG) vs. ref (AA) 24 105 1. 92 (1. 29-2. 86) 0. 0013 ref (AA) 121 1129 1. 00- Statin dom (GA+GG) vs. ref (AA) 6 123 0. 58 (0. 26-1. 31) 0. 1904 ref (AA) 103 1192 1. 00-0. 0093 none MajHom (AA) Statin 103 1192 0. 82 (0. 64-1. 06) 0. 1251 Placebo 121 1129 1. 00 Dom (GA+GG) Statin 6 123 0. 25 (0. 11-0. 59) 0. 0016 Placebo 24 105 1. 00 LAMAS hCV25629492 0. 38 0. 36 Placebo hom (GG) vs. ref (AA) 0. 3885 25 172 1. 26 (0. 81-1. 95) 0. 3086 het (GA) vs. ref (AA) 61 532 1. 02 (0. 73-1. 43) 0. 9170 ref (AA)-59 525 1. 00 Statin hom (GG) vs. ref (AA) 0. 0193 13 193 0. 64 (0. 36-1. 14) 0. 1306 het (GA) vs. ref (AA) 36 595 0. 58 (0. 39-0. 86) 0. 0074 ref (AA) 57 520 1. 00 0. 0173 none Maj Hom (AA) Statin 57 520 0. 98 (0. 69-1. 38) 0. 8972 Placebo 59 525 1. 00 Het (GA) Statin 36 595 0. 55 (0. 37-0. 82) 0. 0036 Placebo 61 532 1. 00 Min Hom (GG) Statin 13 193 0. 50 (0. 26-0. 94) 0. 0327 TABLE 1, page 2 of 8 Placebo 25 172 1. 00 KLK14 hCV16044337 0. 62 0. 69 Placebo hom (AA) vs. ref (GG) 0. 0096 23 117 1. 87 (1. 19-2. 92) 0. 0063 het (GA) vs. ref (GG) 64 521 1. 24 (0. 89-1. 75) 0. 2073 ref (GG) 57 591 1. 00 Statin hom (AA) vs. ref (GG) 0. 3371 6 128 0. 56 (0. 25-1. 28) 0. 1678 het (GA) vs. ref (GG) 50 570 1. 01 (0. 69-1. 46) 0. 9629 ref GG) 53 610 1. 00 Maj Hom (GG) Statin 53 610 0. 91 (0. 64-1. 30) 0. 6005 Placebo 57 591 1. 00 Het (GA) Statin 50 570 0. 74 (0. 52-1. 05) 0. 0897 Placebo 64 521 1. 00 Min Hom (AA) Statin 6 128 0. 27 (0. 11-0. 65) 0. 0033 Placebo 23 117 1. 00 GAPD hCV8921288 0. 75 0. 81 Placebo hom (CC) vs. ref (AA) 0. 0239 7. 51 1. 38 (0. 67-2. 86) 0. 3819 het (AC) vs. ref (AA) 55 363 1. 51 (1. 09-2. 09) 0. 0138 ref (AA) 76 795 1. 00 Statin hom (CC) vs. ref (AA) 0. 1309 4 54 0. 81 (0. 31-2. 13) 0. 6634 het (AC) vs. ref (AA) 27 391 0. 76 (0. 50-1. 15) 0. 1924 ref AA) 78 834 1. 00 0. 0209 none Maj Hom (AA) Statin 78 834 0. 98 (0. 72-1. 33) 0. 8966 Placebo 76 795 1. 00 Het (AC) Statin 27 391 0. 49 (0. 32-0. 76) 0. 0015 Placebo 55 363 1. 00 Min Hom (CC) Statin 4 54 0. 57 (0. 18-1. 85) 0. 3499 Placebo 7 51 1. 00 CD6 hCV25922320 0. 82 0. 78 Placebo hom (AA) vs. ref (GG) 0. 0815 4 60 0. 53 (0. 20-1. 38) 0. 1911 het (GA) vs. ref (GG) 43 415 0. 80 (0. 57-1. 12) 0. 1872 ref (GG) 98 756 1. 00 Statin hom (AA) vs. ref (GG) 0. 0860 3 57 0. 79 (0. 25-2. 43) 0. 6753 het (GA) vs. ref (GG) 46 395 1. 65 (1. 14-2. 38) 0. 0077 ref (GG) 59 861 1. 00 HX SM n ndAn Maj Hom (GG) Statin 59 861 0. 55 (0. 40-0. 74) 0. 0001 OKE-1 Placebo 98 756 1. 00 Het (GA) Statin 46 395 1. 13 (0. 76-1. 68) 0. 5393 Placebo 43 415 1. 00 Min Hom (AA) Statin 3 57 0. 82 (0. 19-3. 49) 0. 7846 Placebo 4 60 1. 00 SLC18A1 hCV2715953 0. 88 0. 92 Placebo hom (CC) vs. ref (GG) 0. 0714 4 17 1. 92 (0. 78-4. 71) 0. 1560 het (GC) vs. ref (GG) 26 175 1. 30 (0. 87-1. 94) 0. 1950 ref (GG) 115 1042 1. 00 Statin hom (CC) vs. ref (GG) 0. 1356 0 12 0. 9995 het (GC) vs. ref (GG) 14 229 0. 72 (0. 42-1. 23) 0. 2295 ref (GG) 93 1063 1. 00 0. 0274 none Maj Hom (GG) Statin 93 1063 0. 81 (0. 62-1. 05) 0. 1121 Placebo 115 1042 1. 00 Het (GC) Statin 14 229 0. 45 (0. 24-0. 83) 0. 0109 Placebo 26 175 1. 00 Min Hom (CC) Statin 0 12 Placebo 4 17 1. 00 PTPRJ hCV8895373 0. 86 0. 82 Placebo hom (AA) vs. ref (GG) 0. 1002 2 40 0. 42 (0. 11-1. 65) 0. 2156 TABLE 10, page 3 of 8 het (GA) vs. ref (GG) 36 360 0. 81 (0. 56-1. 15) 0. 2400 ref (GG) 106 834 1. 00 Statin hom (AA) vs. ref (GG) 0. 1045 3 36 1. 14 (0. 37-3. 46) 0. 8192 het (GA) vs. ref (GG) 41 382 1. 43 (0. 99-2. 08) 0. 0585 ref (GG) 65 897 1. 00 0. 0209 none ref (GG) Statin 65 897 0. 60 (0. 45-0. 81) 0. 0007 Placebo 106 834 1. 00 Het (GA) Statin 41 382 1. 07 (0. 70-1. 63) 0. 7862 Placebo 36 360 1. 00 Min Hom (M) Statin 3 36 1. 62 (0. 28-9. 16) 0. 5881 Placebo 2 40 1. 00 IL4R hCV2769554 0. 38 0. 46 Placebo hom (GG) vs. ref (AA) 0. 0207 16 279 0. 47 (0. 27-0. 81) 0. 0067 het (GA) vs. ref (AA) 79 569 1. 06 (0. 76-1. 48) 0. 7287 ref (AA) 50 385 1. 00 Statin hom (GG) vs. ref (AA) 0. 3773 27 292 1. 26 (0. 75-2. 10) 0. 3819 het (GA) vs. ref (AA) 55 646 1. 17 (0. 75-1. 82) 0. 4995 ref (M) 27 374 1. 00 0 0297 none Maj Hom (AA) Statin 27 374 0. 59 (0. 37-0. 92) 0. 0193 Placebo 50 385 1. 00 Het (GA) Statin 55 646 0. 64 (0. 46-0. 89) 0. 0083 Placebo 79 569 1. 00 Min Hom (GG) Statin 27 292 1. 56 (0. 86-2. 84) 0. 1445 Placebo 16 279 1. 00 F7 hCV783184 0. 09 0. 12 Placebo hom (TT) vs. ref (GG) 0. 1044 1 21 0. 41 (0. 06-2. 79) 0. 3616 het (TG) vs. ref (GG) 23 255 0. 74 (0. 49-1. 14) 0. 1737 ref (GG) 120 959 1. 00 Statin hom (TT) vs. ref (GG) 0. 1895 2 15 1. 65 (0. 44-6. 17) 0. 4568 het (TG) vs. ref (GG) 27 270 1. 28 0. 84-1. 94) 0. 2543 ref GG) 79 1029 1. 00 0. 0373 none ref (GG) Statin 79 1029 0. 64 (0. 49-0. 84) 0. 0013 Placebo 120 959 1. 00 Het (TG) Statin 27 270 1. 10 (0. 65-1. 87) 0. 7282 Placebo 23 255 1. 00 Min Hom (TT) Statin 2 15 2. 59 (0. 26-26. 22) 0. 4208 Placebo 1 21 1. 00 EDG3 hCV25610470 0. 95 0. 96 Placebo hom (AA) vs. ref (GG) 0. 5799 0 4 het (GA) vs. ref (GG) 13 83 1. 27 (0. 75-2. 15) 0. 3834 ref (GG) 131 1148 1. 00 Statin hom (AA) vs. ref (GG) 0. 0745 0 3 het (GA) vs. ref (GG) 3 101 0. 37 (0. 12-1. 13) 0. 0818 ref (GG) 105 1205 1. 00 0. 0645 HX SM Maj Hom (GG) Statin 105 1205 0. 77 (0. 61-0. 98) 0. 0390 OKE Placebo 131 1148 1. 00 Het (GA) Statin 3 101 0. 22 (0. 07-0. 76) 0. 0165 Placebo 13 83 1. 00 Min Hom (AA) Statin 0 3 1. 10 Placebo 0 4 1. 00 FCAR hCV7841642 0. 90 0. 93 Placebo hom (AA) vs. ref (GG) 0. 0687 1 11 0. 85 (0. 13-5. 59) 0. 8656 het (GA) vs. ref (GG) 28 159 1. 53 (1. 05-2. 24) 0. 0302 ref (GG) 116 1067 1. 00 TABLE 10, page 4 of 8 Statin hom (AA) vs. ref (GG) 0. 2107 1 8 1. 38 (0. 22-8. 83) 0. 7350 het (GA) vs. ref (GG) 9 178 0. 60 (0. 31-1. 16) 0. 1283 ref (G 99 1129 1. 00 0. 0463 none Maj Hom (GG) Stafin 99 1129 0. 82 (0. 64-1. 06) 0. 1339 Placebo 116 1067 1. 00 Het (GA) Statin 9 178 0. 32 (0. 16-0. 66) 0. 0021 Placebo 28 159 1. 00 Min Hom (AA) Statin 1 8 1. 33 (0. 10-18. 57) 0. 8305 Placebo 1 11 1. 00 PLAB hCV7494810 0. 27 0. 25 Placebo hom (GG) vs. ref (CC) 0. 2988 7 83 0. 85 (0. 41-1. 80) 0. 6778 het (GC) vs. ref (CC) 65 442 1. 39 (1. 01-1. 90) 0. 0408 ref (CC) 73 709 1. 00 Statin hom (GG) vs. ref (CC) 0. 0605 5 78 0. 68 (0. 28-1. 63) 0. 3889 het (GC) vs. ref (CC) 31 491 0. 67 (0. 45-1. 01) 0. 0534 ref (CC) 72 744 1. 00 0. HXSM Maj Hom (CC) Statin 72 744 0. 94 (0. 69-1. 29) 0. 7177 OKE Placebo 73 709 1. 00 Het (GC) Statin 31 491 0. 46 (0. 30-0. 69) 0. 0002 Placebo 65 442 1. 00 Min Hom (GG) Statin 5 78 0. 75 (0. 25-2. 27) 0. 6137 Placebo 7 83 1. 00 LPA hCV11225994 0. 90 0. 86 Placebo hom (AA) vs. ref (GG) 0. 1018 3 21 1. 09 (0. 37-3. 20) 0. 8695 het (GA) vs. ref (GG) 24 300 0. 65 (0. 43-0. 99) 0. 0437 ref (GG) 117 907 1. 00 Statin hom (AA) vs. ref (GG) 0. 2142 5 25 2. 34 (1. 02-5. 35) 0. 0449 het (GA) vs. ref (GG) 24 294 1. 06 (0. 68-1. 64) 0. 8037 ref GG) 76 989 1. 00 0. 0412 none MajHom (GG) Statfn 76 989 0. 62 (0. 47-0. 82) 0. 0008 Placebo 117 907 1. 00 Het (GA) Statin 24 294 1. 02 (0. 59-1. 76) 0. 9463 Placebo 24 300 1. 00 Min Hom (AA) Statin 5 25 1. 33 (0. 35-5. 03) 0. 6709 Placebo 3 21 1. 00 FIN1 hCV9506149 0. 24 0. 28 Placebo hom (TT) vs. ref (AA) 0. 2100 11 91 0. 92 (0. 51-1. 66) 0. 7735 het (TA) vs. ref (AA) 48 500 0. 74 (0. 53-1. 04) 0. 0846 ref (AA) 86 645 1. 00 Statin hom (TT) vs. ref (AA) 0. 0985 13 97 1. 72 (0. 97-3. 06) 0. 0647 het (TA) vs. ref (AA) 45 525 1. 15 (0. 78-1. 69) 0. 4814 ref AA) 51 691 1. 00 0. 0395 none Maj Hom (AA) Statin 51 691 0. 58 (0. 42-0. 81) 0. 0015 Placebo 86 645 1. 00 Het (TA) Statin 45 525 0. 90 (0. 61-1. 33) 0. 6010 Placebo 48 500 1. 00 Min Hom (Tn Statin 13 97 1. 10 (0. 51-2. 33) 0. 8125 Placebo 11 91 1. 00 PPOX hCV25922816 0. 92 0. 94 Placebo hom (AA) vs. ref (GG) 0. 2414 1 4 1. 98 (0. 34-11. 53) 0. 4467 het (GA) vs. ref (GG) 21 146 1. 25 (0. 81-1. 92) 0. 3216) ref (GG) 21 146 1. 00 Statin hom (AA) vs. ref (GG) 0 9 het (GA) vs. ref (GG) 10 179 0. 64 0. 34-1. 20) 0. 1636 TABLE 10, page 5 of 8 ref (GG) 99 1095 1. 00 0. 0463 none ref (GG) 0. 1064 99 1095 0. 82 (0. 64-1. 06) 0. 1294 Placebo 21 146 1. 00 Het (GA) Statin 10 179 0. 42 (0. 20-0. 87) 0. 0191 Placebo 21 146 1. 00 Min Hom (AA) Statin 0 9 Placebo 1 4 1. 00 ITGA9 hCV3215409 0. 48 0. 42 Placebo hom (GG) vs. ref (AA) 0. 0768 34 225 1. 48 (0. 96-2. 28) 0. 0745 het (GA) vs. ref (AA) 71 600 1. 19 (0. 83-1. 72) 0. 3480 ref (AA) 40 411 1. 00 Statin hom (GG) vs. ref (AA) 0. 2483 10 240 0. 54 (0. 27-1. 06) 0. 0744 het (GA) vs. ref (AA) 63 629 1. 22 (0. 82-1. 91) 0. 3180 ref (AA) 36 447 1. 00 0. 0435 none Maj Hom (AA) Statin 36 447 0. 84 (0. 55-1. 29) 0. 4297 Placebo 40 411 1. 00 Het (GA) Statin 63 629 0. 86 (0. 62-1. 19) 0. 3603 Placebo 71 600 1. 00 Min Hom (GG) Statin 10 240 0. 30 (0. 15-0. 60) 0. 0007 Placebo 34 225 1. 00 MACF1 hCV3112686 0. 46 0. 42 Placebo hom (GG) vs. ref (CC) 0. 1260 29 217 1. 38 (0. 88-2. 17) 0. 1603 het (GC) vs. ref (CC) 76 592 1. 32 0. 92-1. 90) 0. 1351 ref (CC) 40 424 1. 00 Statin hom (GG) vs. ref (CC) 0. 1717 12 228 0. 60 (0. 32-1. 12) 0. 1110 het (GC) vs. ref (CC) 55 620 0. 98 (0. 67-1. 44) 0. 9179 ref (CC) 42 466 1. 00 0. 0427 HX SM Maj Hom (CC) Statin 42 466 0. 96 (0. 63-1. 45) 0. 8310 OKE Placebo 40 424 1. 00 Het (GC) Statin 55 620 0. 71 (0. 51-0. 99) 0. 0417 Placebo 76 592 1. 00 Min Hom (GG) Statin-12 228 0. 42 (0. 22-0. 80) 0. 0082 Placebo 29 217 1. 00 IL4R hCV2351160 0. 23 0. 20 Placebo hom (GG) vs. ref (AA) 0. 0514 8 46 1. 46 (0. 75-2. 85) 0. 2677 het (GA) vs. ref (AA) 50 393 1. 13 (0. 82-1. 57) 0. 4552 ref (AA) 86 789 1. 00 Statin hom (GG) vs. ref (AA) 0. 1343 3 56 0. 61 (0. 20-1. 88) 0. 3887 het (GA) vs. ref (AA) 31 447 0. 76 (0. 51-1. 14) 0. 1889 ref (M) 75 811 1. 00 0 0570 HX_ Maj Hom (AA) Statin 75 811 0. 85 (0. 63-1. 14) 0. 2842 OKE Placebo 86 789 1. 00 Het (GA) Statin 31 447 0. 57 (0. 37-0. 88) 0. 0109 Placebo 50 393 1. 00 Min Hom (GG) Statin 3 56 0. 36 (0. 10-1. 27) 0. 1118 'Placebo 8 46 1. 00 ABCA1 hCV2741051 0. 21 0. 28 Placebo hom (TT) vs. ref (CC) 0. 0149 6 84 0. 54 (0. 24-1. 16) 0. 1188 het (TC) vs. ref (CC) 49 516 0. 70 (0. 50-0. 97) 0. 0338 ref (CC) 90 637 1. 00 Statin hom (TT) vs. ref (CC) 0. 5954 9 99 1. 14 (0. 57-2. 19) 0. 6981 het (TC) vs. ref (CC) 48 555 1. 09 (0. 75-1. 58) 0. 6440 ref (CC) 52 662 1. 00 0. 0369 none Maj Hom (CC) Statin 52 662 0. 59 (0. 42-0. 82) 0. 0013 TABLE 10, page 6 of 8 Placebo 90 637 1. 00 Het (TC) Statin 48 555 0. 92 (0. 62-1. 34) 0. 6594 Placebo 49 516 1. 00 Min Hom (TT) Statin 9 99 1. 25 (0. 45-3. 15) 0. 6596 Placebo 6 84 1. 00 ABCA1 hCV2741083 0. 93 0. 87 Placebo hom (CC) vs. ref (TT) 0. 0054 1 18 0. 15 (0. 06-2. 51) 0. 395 het (TC) vs. ref (TT) 18 275 0. 52 (0. 32-0. 84) 0. 0063 ref (TT) 126 943 1. 00 Statin hom (CC) vs. ref (TT) 0. 3109 2 26 1. 00 (0. 25-3. 46) 0. 9946 het (TC) vs. ref (TT) 30 294 1. 29 (0. 86-1. 91) 0. 2178 ref 77 996 1. 00 0. 0051 none Maj Hom (TT) Statin 77 996 0. 61 (0. 46-0. 80) 0. 0003 Placebo 126 943 1. 00 Het (TC) Statin 30 294 1. 51 (0. 86-2. 57) 0. 1517 Placebo 18 275 1. 00 Min Hom (CC) Statin 2 26 1. 36 (0. 12-9. 07) 0. 7966 Placebo 1 18 1. 00 CYBA hCV2038 0. 33 0. 34 Placebo hom (AA) vs. ref (GG) 0. 6072 14 149 0. 81 (0. 46-1. 40) 0. 4414 het (AG) vs. ref (GG) 68 555 1. 05 (0. 76-1. 44) 0. 7862 ref (GG) 63 533 1. 00 Statin hom (AA) vs. ref (GG) 0. 0086 18 132 2. 02 (1. 18-3. 44) 0. 0102 het (AG) vs. ref (GG) 55 612 1. 40 (0. 94-2. 10) 0. 1009 refer) 36 571 1. 00 Maj Hom (GG) Statin 36 571 0. 55 (0. 37-0. 82) 0. 0031 0. 02601X smok Placebo 63 533 1. 00 Het (AG) Statin 55 612 0. 74 (0. 53-1. 04) 0. 0821 Placebo 68 555 1. 00 Min Hom (AA) Statin 18 132 1. 38 (0. 72-2. 68) 0. 3354 Placebo 14 149 1. 00 HLA-DPB1 hCV8851085 0. 81 0. 77 Placebo hom (AA) vs. ref (GG) 0. 2553 4 66 0. 53 (0. 19-1. 34) 0. 6898 het (GA) vs. ref (GG) 48 424 0. 93 (0. 66-1. 29) 0. 6823 ref (GG) 92 745 1. 00 Statin hom (AA) vs. ref (GG) 0. 021 8 53 1. 97 (0. 96-3. 77) 0. 0645 het (GA) vs. ref (GG) 43 445 1. 40 (0. 95-2. 02) 0. 085 rez gag 58 814 1. 00 ref (GG) 58 8-4 058 (042-0. 80) 0. 0009 0. 0154nx smok Placebo 92 745 1. 00 Het (GA) Statin 43 445 0. 87 (0. 58-1. 29) 0. 0501 Placebo 48 424 1. 00 Min Hom (AA) Statin 8 53 2. 19 (0. 68-5. 87) 0. 1805 Placebo 4 66 1. 00 HSPG2 hCV1603656 0. 10 0. 08 Placebo hom (TT) vs. ref (CC) 0. 1704 2 6 2. 46 (0. 60-6. 24) 0. 1954 het (TC) vs. ref (CC) 25 177 1. 23 (0. 81-1. 83) 0. 3189 ref (CC) 118 1054 1. 00 Statin hom (TT) vs. ref (CC) 0. 1033 0 11 N/A 0. 9771 het (TC) vs. ref (CC) 11 196 0. 65 (0. 35-1. 18) 0. 1607 ref (CC) 98 1105 1. 00 Maj Hom (CC) Statin 98 1105 0. 80 (0. 62-1. 04) 0. 0908 Placebo 118 1054 1. 00 Het (TC) Statin 11 196 0. 42 (0. 21-0. 84) 0. 013 TABLE 10, page 7 of 8 Placebo 25 177 1. 00 Min Hom (TT) Statin 0 11 N/A 0. 9745 Placebo 2 6 1. ou HSPG2 hCV1603692 0. 08 0. 06 Placebo hom (TT) vs. ref (CC) 0. 1106 1 4 1. 98 (0. 27-6. 86) 0. 4769 het (TC) vs. ref (CC) 21 130 1. 37 (0. 88-2. 07) 0. 1542 ref (CC) 123 1093 1. 00 Statin hom (lT) vs. ref (CC) 0. 1801 0 6 N/A 0. 9829 het (TC) vs. ref (CC) 8 146 0. 65 (0. 22-1. 28) 0. 2175 rez cl 101 1157 1. 00 0. 0427 none Maj Hom (CC) Statin 101 1157 0. 79 (0. 61-1. 02) 0. 0712 Placebo 123 1093 1. 00 Het (TC) Statin 8 146 0. 37 (0. 17-0. 82) 0. 0125 Placebo 21 130 1. 00 Min Hom (ll) Statin 0 6 N/A 0. 9814 Placebo 1 4 1. 00 HSPG2 hCV1603697 0. 08 0. 06 Placebo hom (TT) vs. ref (CC) 0. 0951 1 4 1. 99 (0. 34-11. 59) 0. 4431 het (TC) vs. ref (CC) 21 129 1. 39 (0. 91-2. 14) 0. 1303 ref (CC) 123 1102 1. 00 Statin hom (TT) vs. ref (CC) 0. 1749 0 6 N/A 0. 9994 het (TC) vs. ref (CC) 8 145 0. 65 (0. 32-1. 32) 0. 2342 ref (CC) 101 1162 1. 00 0 0447 none Maj Hom (CC) Statin 101 1162 0. 80 (0. 62-1. 02) 0. 0757. Placebo 123 1102 1. 00 Het (TC) Statin 8 145 0. 37 (0. 17-0. 82) 0. 0136 Placebo 21 129 1. 00 Min Hom (TT) Statin 0-6 N/A 0. 9994 Placebo 1 4 1. 00 HSPG2 hCV16172339 0. 08 0. 06 Placebo hom (TT) vs. ref (CC) 0. 0927 1 4 2. 00 (0. 27-6. 94) 0. 4689 het (TC) vs. ref (CC) 21 128 1. 41 (0. 91-2. 13) 0. 1233 ref (CC) 122 1100 1. 00 Statin hom (TT) vs. ref (CC) 0. 1728 0 6 N/A 0. 983 het (TC) vs. ref (CC) 8 144 0. 66 (0. 32-1. 30) 0. 2343 ref (CC) 101 1160 1. 00 0 0927 Maj Hom (CC) Statin 101 1160 0. 80 (0. 62-1. 03) 0. 086 Placebo 122 1100 1. 00 Het (TC) Statin 8 144 0. 37 (0. 16-0. 82) 0. 0124 Placebo 21 128 1. 00 Min Hom (TT) Statin 0 6 N/A 0. 9815 Placebo 1 4 1. 00 NPC1 hCV25472673 0. 53 0. 62 Placebo hom (CC) vs. ref (TT) 0. 0037 33 173 1. 96 (1. 28-2. 91) 0. 0023 het (TC) vs. ref (TT) 70 602 1. 28 (0. 88-1. 82) 0. 1935 ref (TT) 41 461 1. 00 Statin hom (CC) vs. ref (TT) 0. 4107 18 215 0. 87 (0. 51-1. 45) 0. 6102 het (TC) vs. ref (TT) 43 601 0. 76 (0. 50-1. 12) 0. 1642 ref 48 495 1. 00 0. 0093 none Maj Hom (TT) Statin 48 495 1. 08 (0. 72-1. 60) 0. 6973 Placebo 41 461 1. 00 Het (TC) Statin 43 601 0. 61 (0. 44-0. 92) 0. 013 Placebo 70 602 1. 00 Min Hom (CC) Statin 18 215 0. 48 (0. 27-0. 83) 0. 008 TABLE 10, page 8 of 8 Placebo 33 173 1. 00 NPC1 hCV7490135 0. 48 0. 53 Placebo hom (CC) vs. ref (TT) 0. 0754 41 273 1. 47 (0. 96-2. 27) 0. 0763 het (TC) vs. ref (TT) 70 608 1. 17 (0. 79-1. 72) 0. 4402 ref (TT) 34 350 1. 00 Statin hom (CC) vs. ref (TT) 0. 2055 23 283 0. 77 (0. 47-1. 26) 0. 3024 het (TC) vs. ref (TT) 46 657 0. 67 (0. 45-1. 01) 0. 0552 rif 40 371 1. 00 0. 0347 none Maj Hom (TT) Statin 40 371 1. 10 (0. 71-1. 70) 0. 6704 Placebo 34 350 1. 00 Het (TC) Statin 46 657 0. 63 (0. 44-0. 91) 0. 0122 Placebo 70 608 1. 00 Min Hom (CC) Statin 23 283 0. 58 (0. 35-0. 94) 0. 0258 Placebo 41 273 1. 00 aP value for trend<BR> bNumber of patients developed recurrent MI during 5 years of follow up<BR> cNumber of patients and MI<BR> dRelative risk for RMI<BR> e95% confidence interval for realtive risk<BR> fSignificance of risk estimated by Wald test<BR> gP vale for interaction<BR> hConfounders<BR> *Y primer nucleotide frequency for cases*<BR> *Y primer nucleotide frequency for controls** TABLE 11, page 1 of 1 Risk of cardiovascular disease events associated with Pravastatin, by CD6 genotype, CARE and WOSCOPS N Endpoint Gene Marker Study CD6 genotype RMIa MIb RRe 95%Cl p-valueg BP p valueh RMI CD6 hCV2553030 CARE Minor hom (TT) 2 108 0.13 0.03-0.60 0.016 0.0342 28 159 Het (TC) 41 489 0.76 0.51-1.12 0.1735 50 442 Major hom (CC) 65 713 0.8 0.59-1.09 0.1518 85 728 recessive (TT) 2 108 0.13 0.03-0.60 0.0016 0.009 10 64 recessive (TT+CC)ref* 106 1202 0.78 0.61-1.00 0.0478 135 1170 Csc Cnd ORf 95%Cl p-valueg BP p valueh WOSCOPS Minor hom (TT) 7 38 0.23 0.09-0.64 0.0033 0.1126 19 24 Het(TC) 62 198 0.71 0.49-1.04 0.0789 88 200 Major hom (CC) 120 305 0.66 0.50-0.87 0.0036 179 300 recessive (TT) 7 38 0.23 0.09-0.64 0.0033 0.0388 19 24 recessive TC+CC)ref* 182 503 0.68 0.54-0.85 0.0007 267 500 *Heterozygote and major homozygote was used as reference<BR> aPatients developed recurrent MI during 5years follow up<BR> bpatients had MI before entry but didn't developed current MI during 5 years follow up<BR> cPatients had MI<BR> dPatients had no MI<BR> erelative risk<BR> fOdds ratio<BR> gWald test<BR> hBreslow's Day p value TABLE 12, age 1 of 1<BR> Risk of cardiovascular disease events associated with FCAR genotype in untreated arms, CARE and WOSCOPS Adjusted for Age, Smoking status, Gender, hypertension, Adjusted for Age, Smoking BMI, diabetes, baseline LDLD FCARgenotype N Unadjusted status, Gender * and HDL', t Endpoint Gene Marker RMII mil OR 95% cl P OR 95% Cl P OR 95% Cl P RMI FCAR hCV7841642 CARE AA 1 11 0. 84 (0. 11-654) 0. 87 0. 74 (0. 09-5. 89) 0. 78 0. 86 (0. 11-6. 71) 0. 88 AG 28 159 1. 62 (1. 04-2. 53) 0. 034 1. 58 (1. 01-2. 48) 0. 063 1. 58 (1. 02-2. 46) 0. 041 AA+AG 29 170 1. 57 (1. 01-2. 43) 0. 044 1. 52 (0. 98-2. 37) 0. 063 1. 58 (1. 02-2. 46) 0. 041 GG) 1 116 1067 1 {ref) 1 (ref) 1 (ref) Mi WOSCoPS § C5c cnd AA 1 3 0. 67 (0. 07-6. 52) 0. 73 0. 68 (0. 07-6. 75) 0. 75 AG 54 70 15 (1. 01-2. 22) 0. 04S 1. 49 (1. 00-222) 0. 05 AA+AG 55 73 1. 47 (1. 00-2. 16) 0. 053 1. 46 (0. 98-2. 16) 0. 061 GG 11 _-233 456 1 (ref) 1 (ref) low-delipoprotein; HDL, high-density lipoprotein; OR, odds ratio; Cl, confidence interval<BR> *Adjusted for age (continuous for CARE, 5-year age groups for WOSCOPS), smoking (never, former, current) and gender (all male in WOSCOPS)<BR> #Further adjusted for history of hypertension, BMI (continuous), history of diabetes, baseline LDL level (continuous), and baseline HDL level (continuous)<BR> #Wald test<BR> Conditional logistic regression used to account for matching of WOSCOPS cases and controls (all male) on smoking and age<BR> # Major homozygote (AspAsp) was used as reference<BR> aPatients developed recurrent MI during 5 years follow up<BR> bpatients had MI before entry but didn't developed current MI during 6 years follow up<BR> cPatients had MI<BR> dPatients had no MI<BR> Risk of cardiovascular disease events associated with Pravastatin, by FCAR genotype, CARE and WOSCOPS Adjusted for Age, Smoking status. Gender, hypertension, FCAR Adjusted forAge, Smoking BMt, diabetes, baseline LDLD Endpoint Gene Marker Study genotype Unadjusted status. Gender * and HDL'. fi "OR 95% Ci P"OR 95% CI P"OR 95% CI Pt RMI FCAR hCV7841642 CARE AAAG 0. 32 (0. 15-0. 67) 0. 0016 0. 31 0, 0021 0. 31 (0. 15-0. 67) 0. 0026 GG 0. 81 (0. 61-1. 07) 0. 13 0. 79 (0. 60-1. 06) 0. 12 0. 79 (0. 60-1. 05) 0. 11 p interaction : 0. 0163 interaction : 0. 0151 interaction : 0. 0193 § mi WOSCOPS)) AA+AG 0. 87 (0. 34-0. 95) 0. 031 0. 55 (0. 32-0. 93) 0. 025 GG 0. 66 (0. 52-0. 84) 0. 0008 0. 65 (0. 51-0. 83) 0. 0006 p interaction : 0. 5851 § p interaction : 0. 5480 § lipoprHDL, high-density lipoprotein; OR, odds ratio; Cl, confidence interval; BMI, body-mass index (kg/m2)<BR> *Adjusted for age (continuous in CARE, 5-year age groups in WOSCOPS), smoking (never, former, current) and gender (all male in WOSCOPS)<BR> # Further adjusted for history of hypertension, BMI (continuous), history of diabetes, baseline LDL level (continuous), and baseline HDL level (continuous)<BR> #Wald test<BR> Likelihood ratio test of interaction between treatment and FCAR genotype<BR> # Conditional logistic regression used to account for matching of WOSCOPS cases and controls on smoking and age<BR> **Placebo group was used as reference TABLE 13, page 1 of 5 $btlsdGIlySIpNtICamIMW ctlonaBlhwanSNVGenotypc ind Mvaualln Efllaey oI'fwo CVO Ce1 Wllnltloinc Falai » ttSta [im [MMhtmOnhtMn-ftt) M ! m (tfm ! fNDn-hM OMn'CM-Effed"CM. ORMMa ! M tRtmAMe : f) am*t ! M , e est reTesl Mot l rJWW Ma al PravestaMnv PlaeeDoOddsRat G5% G Cons palbft puam Ptkft patiffft pabom Faa A301m All. l. 5 pgCp1 hCV2T ; 10 CARE V8 FMIfSINFMI Gieanet WM 161 P. OOBA 7A8 0. 02f5 BOfA30 127l6 11315T5 7&7 ! 7 30f1E2156ii 11110. 10316 ? H7 118% vb n'16 05B IIMOBt B 071105. 053 Oa4m788 P<=uo. 5 , AeCAt hCV2TNO83 GPE CosdCanlml FMIlSMFM1 GAnef l2oa OPG91 95a uo9T '2Dl6 tt31b72 19AAL 90H90 15A% 1T 1D7% 7118 1257fi I5 9 : 080 0441n0A9 153 080te201 07 ! a5tf1101 POU5 Gap6 AppMfSt 52Wpg CApE CpseW rtml FMIISOMFMI Cleaner WM 1279 0751 BIf 003BB 887410 1389fi 871131 154% 1219U5 198% S1I25A 1A8% 1f50 BO'% 1 42 2B9% U91 oC2tU32 E' 04Dto101 020 008to0 P<=00. 5 ANIMiSI 1 CV52W10 f : I. RE fasB'CbnGN FM151MFMI CManet VHA 1917 OO1C7 B5l U018 171 73 E71415 15. t% 07 0'% SPR6E 202% B vd2 g% 00t A910t. 39 OB/OIa08D OTfI U8tnO8A P=015 AG7R1 inCV318771e CAHE Pm n FMUSDINFMI AIIPOIGa WM 22270 875 olA2 50rE12 A2% 851578 112% 5T521 tU 96 191188 i4% . JIAa S. aK ta 1B4% 070 0 BbtOV 11A O61MS D27 OOBto0i0 P as AG7Rt hL1l31aT716 CFRE Pm dive FMIlSDINFMI C7ear tlit OOflf 765 OG21A 501195 12576 170% 5TIA915TK 15% 5I0A 2% aN8 816t089 013to0B f. 020A91n22A 029 001NU7 P'-005 AGTR1 hCV3fB7718 CARE FMIIS MI ClEiner Wt. 1 7197 Oa2 A. B9 00919 6N10 126§6 851981 180%)573Sp 15A% 18118 115E%'S19 . 54 0 l3moo7 103 088b16H 028 OBto011 P « ASAHt i L12S2143 CAPE Pra He FMUSDIfMI Gecner 75E2 UWB 023 OoN5 21l1nf 1a496 98N98 10% 't tBU% Qte9B1191% 282 132 : 21l1B7 17 ! ! 4 042 02Am073 a. 70 U291o219 I18 a9A1o350 Pc-aS GPG hCV1595f2D2URE f. NCnnud FMO MI Geanet M 1221 OA311 157 007 ? 1 9PJ847 » S9 915917% t&6G 5% 32l1B0 UB% y1l 1x tl 8394 OE1 O6BIO1 2 03 UtAmoTt 535 014to61. 87 P « O0. 5 CAPN70 1o1 GREPms a FMIl501NFMlWIPnbieWM 1118 U6121 883 OU721 7Q8U7819i m91&3912M) 8'39311T75 2e. 7% I99 % 8l301oa16 OB3OA8IO000 0751oa9B o99at9me27 P=O05 CAPN10 hCY75A 4018CARE Pm ve FMIISOYtMI aeaer WM 142B 0. 0138 62B 0018 701581 12u% y624 19T96 38290110Y. 6flBB 12. 8% 928 115% 9/71 1499i 058 0401no78 1 ! 2 0851oS0A 07A a1310175 Pcc005 Po =1. 17,,,, CAME Cl 11 1552 0005 023 00445 21riQ 4311005 19% SZ414 (15 mmU W4@-M 13 2% 21/181 116% C, 201 P. 20 GaPH2 hGY10135a W Cas1'v. aNe FMIISNNFMI dIIPOlO WM 2T51 0901 1088 004N H7I434 i549L 1241N2 281% BN2B8 NC 87f. iY 0'% 141 11% 18759 BA% 08 oa t0A BJ3fo180 OSB 0221of12 P OOS non (. AP [J2 IICV781559 W Geacl6oo1 PMISC/NFhl1 Ctecnar WM'07H e000M1D11 HT/JBE 1749L 121ldB6 1H% % Q f28fMe% 10130 B lAll1 13A9G 015 U92bOB3 1D3 IBOID15 09 1700111 P--0. W GofnNl FM45d1'FMI kIIPOSSda WM C266 DOOO4 00A 00f08 50T 5F51 28 3rDa 15B% 3% 7rL6 TN. 1R1 l8% 4710 A5 0 1311008 057 U SI7777 P005 ctttt , cuT4aaoe W CasefCantml FMIIS t Cleaner vrnf zaae oooof foau ooess aW sx tox iva B. 96 3 17 W na e W e ssx oes o4amoes oae e f07co02 Po°5 CD103 hCV7At528 CARE P rve FMItSINFMI NIPaSSnNe VIM 1205 00341 8. 01 Oitl 10396 A 10. 846 10t245 t1'G 31I21A 128% 12U% 111 a OBT 7Eto1. 0 08u 11210012 t17 016101992 y0 CD1B9 t£81528 CARE Pn e FMVSOINFMI Cleaner NM 1l18 0012D TA5 218 9&89B 153% 8651 11J9G d m efHBA7187% 312015. 09G 11E 181% 088 MW1 D28 0111oD69 AB8 007b11M P=U5 In 18 CARE-1312 OUM Bll 00173 7WT4 12-2msli (pl&9 hCV59f52B CARE CsselCatml FMIf50/NFMI Cleaet WN 1508 001 801 0071 9d'&1 155% 2175% 10188%0'. 6 91/7, IB8 Yt0 15olfi 118 16. 7% O88 0&Ifa1 027 0131a057 08 OOAInII P4005 CD8 hC1IT55930 CARE Ploe e FMUSO1NFMI AIIPOSida WM 1151 OOL22 88e 00373 BN656 o% 13IABT 1059G I37i70 1R d »'. » ' 58% OB7 BBb1 081 38b16B 008 U011o62 PDOS py pV1553030 GRE Pma e F VSOINFMI kane WN 158 000T2 78 00 02 E8'Ia9 t51% 7f131 tB8% 191323 1S3l6 62M 17e1f 1f83 i896 Orl7 '. aeB oA2m12 07 93tn15C OOt 000tu03B P005 pg hy1553p3p CIV (iE CBSAlCoMm FMUS1NFMI FJIPa : enNa WN 1222 OQ31B 1218 0002 9BB5014% 731BA3 1U79L 3tA5 4z8 9 18 % 10f62 101% 081 0Bb1 OBU o. 61to123 DuE 001ta014 P005 mg hCW530. 9n CI1HE Cue/Camm FMIISOMFMI Cleansr-WN 1602 UOOBB 1318 0001 H2 TSa% 73N2 1T1% 510 3t% fA1210 176% 1782 1-696 N3 27 DC2 O01U132 OBB Od3ai0B 004 OG1b03B Ft05 6p8 hV ? 39227T0 CIIRE ve FMUSGNF t AnPOSIHe WM f215 UG721 82T omeP 59i1'A2 % 89t19D t229i 4BI3oY f22% 91It08 G154 SI40 102% 5153 1% 05A Ultla82 131 DB71a291 1uA U2atn15. 5 Pa3 : nLM ? M) tim L tmol uscmpM 5r-S : r' ST o<mt 7N. <BM MfmtM <mtM (3 ! 7 eMBMmxmcMjMmmwMTtnwomMn. M ostcxzt. cao iMfOHmiTi) . om Su S pp hCU252320 GRE CuelCamtol FMUSO FMI AiIPossICin WM 1218 002A D31 0061 59If85 5 ! L 891721 123% IBf381 12fi% 971981 0476 5I4A 1GE'% St52 8% 10081 13 088to221 10A 0$AIO106 P4U05 , pg ICV25292o CARE CadCaMml FMI501NFlAI aemer WM 17. 05 U03 1205 Uai 5 » 1% ' 1A3% A/t54 1&0 ! G 9712t0 51l6 517E 11B9i fJ3 181% OAA o9ifoD10 136 ella2TD 1i 49EtU5T1 P 05 Mai as 28 CARE F IP.. Ib. m 1297 00247 10440 29mg (104%) 085 054t. CG A, 12 hCV2Bt197 : IN01 FMISUfNFMt Ge ar WM E2f4'0a06t 728 OA2 PAH71 16T% 1 6AI713 7765707f 5 ZGB% 9tiB 7N, 1T6 eli 0 021m0e, 5 069 12100& 0i OB31 17i P=0A5 Rt nCV2550e5w CARE P aa FlAIISMF611 A1 WM 95 O. UiET 498 00905 11f/11T7 N6 12 ? J1113 f0T% 16B 11% 01 UNG 0'0 00% 00T OBBIn4li OOB 0lIO0 2 y255y ;, 5g ; pppE Pr Wve FMIISOMFMI CMner WM 12 O. IlM9 52 U75 17VBOZ ii8% 171 15 t7t% 79 ! 9% 91A 10% 01 001G. 09i 07B A59tu103 000 DIb057 0s_p05 CARE 0 D072 a00202 gW449 (15 1%)-004 18 01 to 0 441 ERt hCV255 I FMISOMFMI Geana WM tBT OOD7A 762 0U052 111RGt 1t0l6 1Tl170E 17. 994 1C1A 29% 9rL0 lU9i Of a% D09t 098 059ro1. 04 001 Of (o057 Paoi Cf1. 78 tnCVE7161G1 CAHE Pm ve FMIISMFMI Gsanu W1 750 0A075 EBB 0011 28160 700% fi71391 5% 5Elltl 1. 1% 5NJAO 152% 271f5117 23110 1B1% 03E AYdIn081 082 9810233 108 l7fDSB PrOQS CXd. fs hCVBTtAIAI CAPE 6eCOI FMIISMF'MI Gnana WH 157 00018 925 00098 2758 f02X 5ZfIlB 7219. SBilu91139G SBIdBt 151% 2T155 fi1 23H78 187. 6 038 T9toU81 091 etto197 112 B01n20 POOS r hLy1753p70 CARE Pto e FMIlSfNFM1 Geana NH 1302 U. U015 aTe OQCiIC 9 81 109% 1BlT52 19o7 EEJI 134% ASIA2 tAW : 2U1321E 19123 122% 0. 2 0321u0A1 071 EolOtTS 1GU SSIUIB PUOS EW tiGW253N0 GAAE CasoCONmI FMItSWNFMI GAaner WM 1191 0. 877 00378 97T1A1 710'A ABrLlB lB. t% /I0E 197% 85/. i5G 181% 11I19i 183 19721 12% 053 032100 070 01TIO105 tA4 Aoto9 Pe065 so C FCAR hCV18i1042 CARE e FMIISOINFMI dnanv WM 191 00218 A22 00115 109173i 10'16 101 1B3% 6 94 ZS ? 7L 11A 126% It a& 0 11 Ua 01010073 Ot3 02mAfl PK OS FGB ItGV712o7&1 W, Cmed (7onIN FMUSOINFMI SOPOmnbis WM T40s 00002 B1G 153 GS1512 teEl6 f4T1988 0% m 15 b7l21B 0UIG ane OO % °' g 43 0&t 311 8f101211 PcoCb GAIC 2CV59HGRE Ye FMYSCINFMICIeonet WM 1121 00189 721 02T3 Bl5fiB1150l6 8r1u3215g% 20Z0 Tx'78 ' » M' 519. % OBfO. EAWf9D 03A0171oUt6 11201Bb71E POl6 4APD hCS18A21 AB W CefNCamfO FMIISOINFNI MPOS5Ide WM 27. A2 OOUU2 eet U0312 75M51 186l6 1A531 7% 522 2DU% StaN 221% 10E 85% s'32 01% 060 09TIa0B0 OW Ofi71a185 15B 0521oIbB POaS GAPD rtGVeD21288 W CaseGHro FMVSDINFMI Oaane WM 21C2 « 018 000T5 iW115 181% 14BI188 ! B% 522T1 A9f. 5AR1T 249% 1d23 19916 1% OIe 09lto0B1 U 081tct 192 0E210589 PrOC6 H (A. ppg7 nGY150. 51114CARE Gm FMIi6D1P1FMl AIIPoesmte WM 150t OO1D2 182 00015 1&60B 876 77159512t% t8's 6 ! .. &Sd '' » » 5 'f'058 OIOIOABe 08103B1u182 11A f17m157B PG005 P 1 CU25fi51171 CAftE Pite a PMUSDMFMI Geanr WM 2014 UOOt 12a3 OOA2 18/196 7 f310 182% 81b 7f 2% . 19T% 17 ! ! 7 1% tA69 58u, 062 03510078 032 039fu 1G0 1B0 iS2to173B P<oP. S NLa. oPA1 7174 ECm AllVOesIOU W tev7 aaoAS 106 o. 0olA el 1 7A A7% 59NB211t14 TIf10155% 1N9i276 06009Atn0 ael05Afe1 512t013B2 P<=p HU40P81 MI26&5117t CAHE F IISMFMI CIlnef WM 20E5 D. OOD iB75 ODOU9 4AlN0111. 2% 7113A 1B9% 19L1M 1l4% 1ilTl 77 4f0T ao7b o5f asmo7 075 ota_ts aol 5ato c. 00U5 HLA. OPet ECYBe51oB5 GRE P ne FMUSOMFM1 A Pnhls WA1 1992 OOtBt a. B 9012 IBIB41 I'. 7B 14' 51602102% 480 1i1% 13788 'JlBT 4 OB2 l. 1tu082 OBB OAON503 ABS 1f11e2059 P<a005 CATZ p PAUSDINP M, u 5Q. GW-t On 0 03cs llifili ? ? (04% 1221114 iNA If 7'Al 2 (17. 31*1 (um (U us) 7 uvr uwtoit HIJ4PB1 LV8851085 CARE Cace'Cnn FMItSlNFMI AdPossWa WM tICS 00f09 121 O. Of21 IBI&AA 59 771E20 18 511141 14% IEY N9% 19I6B 1 Sl85 5 060 NtoOBA 0A7 058101. 7 502137fo1BM P OS ---CMMM S--CConmt'UttSOMFM ! a. : mr--m) !' : 9 OCtN : 679 OCH ! CMMmnt) SMMMM M ! MmMt7M) 7nS) 1) S<m<W HBtMti 0.) ! imMOK. MNMNtM) OMmMMBSt) . « M Iilq. ppBt hCV8851084 C1AE P rv FMIlSIlJFMI CIB7ner WM 12A1 UOZN 821 00N6 8854t 125% 6N1T6 19Dl6 97rt8311tX 3BI2311B7% 7181 e1 ! 2I358 081 019tu00B 08203010175 4A1 &1tn27&1 P=00. i ! A-OPBf hCVEB51084 CARE CxeON FMUSOMFMI Claaner 134 OVL01 ! 54 OOfl9 BBI53817X iN1 191% J712AU f12% 391t2E S119G 7131 8% 5olf 08Q012mOB5 004051N1. 3B 6A910Bm3155 POS HtJ40PBt hCVABfi OBS CARE Ptm a F I15ID1FMI deanx M 1385 U01 A BT 01AE 81 5012A% ABt152140% 4W ltB9i 112151A79f 9% 3iu A76 0 0 E0089 B. n OtUolE3 119OEGNtB28 P « U05 HLA. UPHt hCVBAS1UA5 CARe CaselCatmi FMIi50 ! NFMI Cleoner WM f128 CU13G 965 oocB't Bff502 12296 89'i. 0 fAtY. i3i281 1i89G atf2u 19G BI35 A% 3f13 0'% OfiT lUto0B2 B'1 rt5ltn11 IAB t ta1o80 PG00., HU4081ACV94fl4170 GR Rx e FMUSNNFMIAIIPaoiNaWM 1115 OAIEi AE9 00131 B5BIO11% 8NB1010216 271181% 4l31'BE'X » 5% OBB072n135 042019EO09f 20AO. It1o10 ? 5 P « 005 Fn. MO08111CV84&147Q CARE Pme e FMIfSDINFMI CIeBnr WM 1411 00118 B51 Oa112 &J57B 14876 Ea'320 1B5% 27J211 iP, i 4 ? lIBB 1'Y'f y' 2'B7 6J'mt2t Ua8011m083 21E Olt1ot19i P 0. 5 HLA-nCAt nCVWGt4fo CA0. E 1 FMI1SGMFMI WIVOdv6ie M 117 OO991 G12 00 BW 27 f0. 99f. s81076 f044 A 2% 1369L 5135 113% SItO 008 072to19 010 023IO070 200 441n91B PU0. 5 HIXCCBf hCYD4Q1170 GRE CaeNabW FMUSOAJF I Ceaner WM 1179 071d P71 OUWE &J30 1509i 6AI513 18. 8% 20 2% t711GA 'l'K '2 0610125 03E 020MOE9 272 016N 1UG3 P<=OOS HRC IICV1150C711 W Ga FMIlVNMI 1111Pucuda 11PM YiB O. OOOQ 1lA ODSE 51253 796 Bd211 Zf. 3 5Y361 111G 119f102 B19L 127 2969L 311181 % 056t t2B D41 D2810058 104 6U1u1C1 P « ODS 5pg7//df7fk0i FMIfSLyNFMI Oec WM 2589 <pppl tUE2 000l4 511JZG 2369C 8h2B 27A96 157 t3P. 15T 31T% 301117 5'i 11t6 3% 080 6Sbt2 ! D9A 0'llta0 f05 ODOt Pte0005 FRAR ICK2-08453 i47pw*mo m (lb"W ? 1. 219 00% Me 1500%, og3 4 ? tGo--oa a-D (a I I to 41 as 112 40 Is to 7'at L1A hC1i951A17t W ClSdCerto FMIfSOTIFMI dlIIIf WM 2128 00002 6T9 W35 0z4 O% ZV9u 32% a BN' » X'1 ! f 1158 19 071G00 DB5 050IU123 O88 D70toR61 P=DOG 1L1WJ IGV07319A0 CAftE P Ctvs FMIBIlIFMI deanrer WM 1tl1 00131 782 0072 ! a71151 189G 701383 778% 37J325 89 181% 1 ? J58 14 BI87 119l6 08f1 DE510115 D18 021101PL 182 botu915 P « 05 IL1PN IiCVA137890 CARE CossfCanlml FMII9DINFMI Gnnar WM 7 OAQ3i B52 Om81 A7IIIB 15096 7387 18116 3Y1 BB76 53R7A tA2% 17/57 1 f% 9188 121% 077 051m t t2 OSO 03tIO0BU 1G7 013b531 P « 05 IL1R hCV17BG551 CARE Cs'ltortlmi FMI501NFM1 AIIPOSSids WM 1119 aUt28 878 OOSti 2 B 72% 71891 11896 6N5BA 1E' T3f557 131X 7712&1 B% 101252 03VL 05B 07. Sto0AT OT 0511010 fA8 087W31B P « 05 TABLE 13, page 2 of 5 SMIsUrally Signi5cant lntfracftnt Betwo4n SNP GanDVpol and PFMIUvn Effiacy for TWO CVD Can Doflnloons : Fataj lrdwacuon MI7 SudQen DNth 1 DaBnftv HanGW klami Ftl7 Hontml Overall CN-Ettea"Cn. a RareAlldas t Rxa NINa 2 Rxenneiec u _ _ e 1 _ _ _ fOfItNI | t t J3 : Public AWker Stud Oe n CnsaCoMntan Oelkwlnm"'Statum Srdnshc vahne Suusc vaiue PaneMS PIts PaHerOS Palentt Paertc Fetems RaraAllates Allele RsroAlIeIes Lavd rua PC t hCVs5Ct 427r rZE > FNCU it WU s i 075 O n < 511 m'OS t 40t 0 S i30 11 2 t gt j F ITGAE IvCV121387 G1RE C 1 F V9DMFMt Ckarner WM 130f OD273 88G OU357 Silfit 150% 57173 iB2% 133% 99f10 15L% 7/B7 BMG 1WlZ 2EI% 070 Uditol2U OBI ObSte128 02A OOAMUB1 =005 TAPt t'CY540G20 CARE Fmrsdso r MtiSDtNF M Ct5 insr Wt, t i4 3 0 01M 022 O N47 B : VSTß (t4 SI S1iS5 11ß 04 2Een7 t11 ßX J2t214 t1f tN _ 1tZ (4 «), 524 tS3 SSI 063 tOE3 to 123 0551025 h 110) 0 03teol to O 7rx pe d t6 IfR hCV181B21 4 CARE CaSNCrntmi FMIfSDINFMI A4PosaGe WN 1972 00175 B0 Of7 7AI076 BO% tU71W8 713% 333I7 169G 211208 1D. 1% 1/15 AT% HB 1BT16 066 IB100oU 188 083fu301 091 004to50 Pc : 005 ImR ACV181G2171 CARE GcefClantrd FMIlSDMFMI Geww WM 1855 00061 9x 00091 19168011896 10TI591 181% 33It57 la9G 2f1t91 157'K 1H tU0'S 3111 7139G 58 U11to0A1 18B 091m311 35 0031n421 P<WOS 1 04IM4, 04 vxt am F MUSMF Mi Oa 934 00094 7eM6O Ill S*kl 107151" (15 1% =157 (210% 1 211134 (157%) 2A 1127 2%) 0981042to 168 (0 01 ta3 11) 0 35 to (13 in 4 211 F--O NDR hCV2271099 CARE CassrCmlml FMIfSDMFMI Ge WM lA9e OD052 918 OOOB7 TAf&SD 11. B'h tN588 1B0% 33H59 E12% 21N34 15. 79i 1 (11 1% 3lf1 21396 069 01710091 18H DB1In313 031 03fa371 P< : 00. 5 3 uua KLK11 hCV1801433 CARE Pm a FMUSOINFMi Clasror WM 1A02 00028 727 002&i 5938A 1 ! 2% 5Nd12 1B% 51f101 135% 5N923 17. 89G bH7 oPK 29I18 39G 09T 841011 OTS 32101H1 02 : f DOTto078 P : O05 MICA hCV16011337tP3tE CaadQ4d FMU9 MFMI IJIPasv la WM 07. i8 1OA7 9 ? 2 ODf 671 59 516 5N519 1% 5il5iA A8% 57f502 114% 61119 599G 23lt13. 1' 47102 BSIU1S4 85 U57tot 7 2 D681nOW P<z005 M. ICtt hGV1601133T CARE CasefCaIlVal FMIiSINFMI Cleanx HfM 1BC7 0002 783 AA22 6 ? l59 145% 5UI98 11. 7% 51ldo1 13E% 57fd18 1797G el9J % 23f15 1 09S ObftulSU 074 4Btn112 Oxf 09m062 P=Oa5 NOR IiCV255A1615 W CasefCNrd FMV50ltM A1 a W WM 24 00002 tf 17 00098 1151i52 A% 158821 4% 1W17 tiO% 57l118 2B5% 3lt TS9'111O f3316 078 SAtoi 02D t8IU051 2A0 32ta17&R P=005 AtAt2 _- KLK14 tSv2547 ; W. >HE hAVe FbNF Ml dl FnS4f wtd u M O. Oitt3 005 0. 0407 B500 111 3S 74i517 t14 SS 5 t1 X11 2S Sbl478 1m4 7/140tS 0K1 24/tr, 3 t15M 07ntn Stt7 101 0 9it t04S ta 2 051 u 0 iO 10 tO O S7 Pi : O {S C, _ 7. hCY25 Pm rvE FM50 fiFMl AOPa v le iM 7J. 0 OO f4 A. 9 60 1 105H2a0 BA% f8N1141 11a% 7A A tl 7 21% 010 00% Of0 OD9L 0. T 0571G0 341 14 m12O25 0 PS hCV25B2i88 C. AFiE CaxII aNm FMIISO MI AIf mrble WM 1288 OOOIT 9E1 OU17 10511782 C% 30H12 ( 11C% TI91 72. 49G 1115 2Z% s ss0% a 015 0671eA88 2D5 l9 to1D150 P< : 05 X MYH7 hCV25029386 GARE CaGnlm FMIi9DfNFMI Clears WM 1t74 00021 A7 O. UO'11 1051805 130% 1301707 IHNi 1120 D9G tllA 3B9G OfU UU% Of0 0096 OB7 97to0 110 1S9b10T21 P°A00. 5 NOS9 hCV321M18D CARE Pm B FNIISINFMI ACPOSSIGIe WM 1176 OU392 075 OfLiA2 10133A 8576 5BI528 t08% 8N527 1196 fiB152A 10% BHB 88% 17Hi0 12114 OTA 052fof 1 10l 47f 230 71 OOinOBT P « 005 NOS9 hCV3219l80 CARE Pm ve FMIISMFMI WM 1t89 00118 7. 4T 00238 IB/38112T% SBI51J2% 8UPJ0219W6 SBfS35 73% 81115 2% 171E5 0% U7001e1o10 OBS 42fu21B OP2007to071 P<e00. 5 H053 hCV21 CAR2 OaaelCaIIWI FMUSOMFMI MGmb6le WM 1202 003fE 7/5 00212 81532 86% 4&5181UA% 6N521 1159L 5&521 111% 81184 7% 17111 128% U7A fi01ui1 1W 7ltatsr o aenoo « 005 N0. S3 hCV321G80 GARE W elCaInUnl M150MFMI Cleanef WM if78 0071 798 OO1B5/8355 130% 58618 17E 9 tE796 G&399 11. 49L Alll 3% 11/B5 _0% 007 Qliiol W OBB 691a 1 028 009tc0A3 Pev005 NPCf hCV2572875 CARE Pm ve FMIISUMFMI AllPasetile WM 1f. 68 0 3D4 090 OW00SIBI182 t096 371136 5% 18552 E3% 65515 713% 012a8 B7% 28'173 182% 1. O5 OBUIate Tf72AW . 71 OiG 0 Bb135 P<e00. 5 NPCi 6CV51728i9 CARE Pm ve FMI19INFMI Cfne WM 2t6 A0006 1102 OOG IB 15D 971282 31% IBrJBI 121'h Ba138D 781% 8) 40 1. 2819 5 125 0781G1 a82 25 a7Mi8 091 0720OG8 P=OO05 NPC1 hC125192l7MCARE CaseC ; otnhol FAUlSINFMI Cleer WM 1908 0001 9. 8O A071 f r2G% 187% 9761G 1S9% IBl776M2%) 6 85l5 18. 396 1AI119 12d9 28l0o 1% iZ1 018b1G1 O85 131n09H 034 01 4o0C7 P « 005 FLAV hGVIBIbtO GRE Ro Wve FMIB/NFMI AIIPaIhIe WM 114 OM29 B7 OWR2 T7I108 f02% B718T5 9Hi 5lN. u". 5% U'113 1 376 o12 9% M5 53% 103 078fa14EoOfi2 02 1o A tfit 361oBA4 Pa00. 5 Ion pLAB hCV11A1B 0 CARE Po e FMMISINFMI Clmn W WM 147 00117 OB 00183 17Ja7A 15. 1% 8714 7181% 3t011M. T P1% BIt7 1059C l40 A7% 083 Ob1m133 0160211utOt 124 028b53B P005 PISB hCV7101B10 CCanINI FMII50lNFMI AllP S5i61e VYM 115 00449 7. 3T 0. 0251 7I i1 1% 87188u 102% 31A419 896 B1I38 1 7% Bl72 B G lI 05% 103 791et1 abD 032t0078 102 UlroB05 PaOOS PIAH h V71C1210 CAR CneCaMrol MfISNNFAII Clnnrl WN 14 G 0 111 713 0 2i T71171 15 % H1I411 793% 31/C89111% GOI278 iB% 8l57 1 S%tf 16 7% 095 0680137 04i 02Ato071 145 038105 P<c005 PHKC hGV75A542T1 CARE Pm vn FM1501NFMI AIIPOSSnEia WIA 137 0019 ! 975 000T7 5N5 64 7 1289G 171 70E76 151415e10176 11It0U 110Y, t85 5% OST 01IU0. &1 109 61to228 33A U70bt ! Pa05 PRKC hCV15A542Tf CARE Ve FMIISOMFMI CMaMr W61 1196 0035 60B 0017A SNi25 118 831431 1B4% 51A13 11814 ISf At 17M6 111a2%177% 1 058 03810092 U&5 3Bt0181 280 003fottiB P « OS PRKCO hCV15B5l27T CARE CaselCatltml FMIIS8MFA11 AIIPois hlB W61 12. 3 00304 839 OOU92 501 5 B% 89lB15 1299i S ri85 1f0% 1Jd37 103% M1N8 1129G 51 S 66 058 01 1u081 01 OBBloIfiA 315 d&tu. 71 P< : 005 SERPINAShCVB5A6 G1RE CfelCfru1 FMIISOfNFMI AIIPOasIEk W6A 1227 00115 641 001U5 SN55T 0% 5G15 194 11515 8 857515 12676 211t38 1519i 1N111 00% 088 OSAfot83 457 98l0087 172 071ta988 P<e005 y tICy250 ? 92E5 CARE Pto ve FMIlSrHFMi Cleamx WM 486 00105 861 U014 331720 150% 3BII . 1 108% BAIJ1 19% 5AI382 152% 13H74 5% 351188 % 072 01SM127 09B 0. 87W05B 071 Olo093 P<=00S En 5M5N-SHE c. . iEBSEiE ! !.- ! i ! -i4T.--. -.. r-. <si ? MMi ioM) Ef'M pm. MS -. 37 [Q7SE-BS IhCV74B4810 CARE Pms ve FMIISOINFMt AIIP ssnde WM 13G 0 163 713 00283 851618 8% 811B2G GB% 20CfiH HO%M<719 128% lld9 8% 9133 42% 00 0 3tn1 0 02Blot2 00900710082 P'0 5 TAPt ICSI5f9C2E CAREPm ve FMtf50INFMlCleaner WM 113 0ot3 ! 627 OMl7 815181IR B1t5d518Mi l237itA% d'J1211106L 1125409 &71373 OB80&710129 055025b11B 008OUtfa07G P « 05 TAP1 hCV519D28 CARE CaseICOrEmI FMIISOINFMI AIIPasu6lc WM 13d UG29 91 00008 BSIgiZ 10 % B11717 G% 2B13t7 81l6 P1918 1216 1 38 20% 8139 A2% 09A 071Sa1 8 001 037IOfOt 00 ODI1a070 PO TAP7 hGV518G2E GARE CuseCaiAml FMI50rtiFM1 CYaner WM 12E8 OOPIS et6 00f7 831586 f17% AtfSOt 1A2% 2A2'18119% 1120D 2U1% 1175 U% Brll 3% OLY 089tut 05b 03IO09G OOB 00110072 P005 TIMP2 hCV2582A8B8 CARE CmelCantrol FMIISOINFM Claaner WM 14. 19 OOf31 689 OA352 751501 131% 89513 1889G 3U234 126% M1200 T20l6 112 1A2% tflT 59% 078 051to109 OfiA 093toU83 801 0T4N9288 Ps005 TNF I : V1511B7A CARE ve FMIISOINFMI Ckaner WM t08 0I53 717 00478 8515TB 11T% BEf521 18. 4 3M2 10B% 411211 1i1% 3J. 5 CB% 1N 3% O88 OC3lD12 050 022 vt 10 012 002tn075 Pss005 Sm : .... S=- XifpE ! MM--iB5r-E 7M. u. SET'TtBEh MiN hCV253A5A5 GRE Ptm ve FMIISINF MI AIIPmsihk 1 91 OU2JT 76 00224 35fS10 13% 25E7 B8% 5d 928 E'f6 TI1587 13. 1% 21t28C D9i 37/3BB 11GX 15t UBDto281 U 023tuf81 083 021N1B3 P00. 5 ! N VtN hCV25J8585 CARE Wm ve FMIIS lNFMI Claner WM 11. 1 4011 61t OOf i 35l196 tl. E% x'J21911796 5 Ii26171% 1I 57. 7% 211174 2. 1% 3Y175 1839fi 191 0761u22 O50 20ta98 001 D201o107 Ps0a5 y7N tiCV2536505 CAPE GuSNCOo1 FMIIuOINM1 AiIPmu6te WM ! 9 OU291 712 D02it 361d7 f01% 1i52 % 5AI820 ML 74 : 59 13. % 1 3 f2E3 122l6 161 OB (025B O 0131000t O2B 037b119 Pr 00 5 VfN 538585 GRE CmNCanlml FMIISINFMI CH9nH WM tiBB UO1W 6i3 D0913 35f195 119% 2527a 1f9'% 56424 1i2'A. 7t1252 t. 0% 2fH88 126i 391171 lBIY 1 l 0 09A1u 435fO118 ?'-r005 A9M hCU517850 GFiE CalafCoMm1 8NFM1 All filEte WM 521 UOOBI BBi U03Z7 171526 80% B1/47O 131% 72YS. t01S. 9% T ? PA1 19. 2% 117111. ! % 2N13L 14blL 085 Sb0A3 1a 191n1B A 7 A"u : m2 ! '0 AM hCSI5 7858 CARE CnsafCoMrol FBMFMI Cleanrl WM 1754 0038 BY0 0018 4 ? ld55 it. B% 8AlSlA 20196 72 i 1G. 8% 771d5 5% 111701 1DY% 2dD0 28% Of. 7 094bOBt DSi OBStaz ; . ;''- 4iZt? :. ae°_ ! 2 05 ABCA1 hf. 1274f05 CARE Mos ve F8NFM AIIPmmde WM 13B7 0OtES 78A 00f 7 5 1025 9D1 98B2A 1 396 5Al517 f 1% 5Gl181 1 5% 0 ? 91 2ei 8180 5% 065 03Atn077 OfBWiAtn200 9s.. t ? R ? £ P<=005 AACA1 IIC2Tt1051 CARE PfA V FdNFMI ChalN WM 1C31 OOSG 080 OOHt bAIN4 135% CN47 2% 59A75 1519i 58fM 1f% 1 ? 1G5 IBSfC ! ! 54 11. 416 062 9EfOOTI 0 040M1T1 ^. 9 U 0411 PaUOS ABG1 ACV2741051 GAE Cusa'Cadtol FBNFMI AIIPOmtG1 WM 1337 U. 0202 T86 06219 681812 G2% GAI81A 158% 5975a0 118% 58tI78 111Y. 1719 12G% AIfT 8 ! G D55 38to07A 09B OBBInIIB 17 081104. 83 P-005 ABCA1 IiCV27ttn51 CAHE CasNCoMtol FdNFMI Clavw WM 1591 OOOC1 B25 U611 SBII05 f3895 881410 23456 5 l311 159% 5NtM8 188 1 I8 18B% 8159 113 OfiE BbOTB D 054f01. 2 181 0820528 PsU6s uns ABCA1 InCV2711083 C4HE Pm ve FdNFMI AlIPaStibIA WM 10W OOWB 79A OUf81 4 ? JG31 8. 89 1971827 1485F 12&2 1f0% 18253 5% 429 17. A% 1171 1% 081 U48teA& 152 01tn32A 274 02AIU2B71 P « 005 Gt hCV2T410B3 CAPE Pm va FBNFMI ClaanOr HA 2128 00007 B 00183 B21e42 t1396 191f5B9 9% 31H63181% 97CT tl. f% lllG 11% 115 0% OBS 1210018 118068M32T f07 OAtn1302 PCU05 A8CA1 ICV27ltOC3 CApE CasefCOntmt FdNFMt AIIPOSSiNe 1E04 0. 0052 18 002 fl7JG17 1Q1% 1911015 130% 311178 11. 1X 1fl242 WY 422 B2% 1H5 T% 009 O/G 0& 110 080to287 289 020tD303t P « 05 CAt InCV27t10A3 GAE CaseIWNOI FaNFMI Cleans WM 1867 00022 AS1 02 9IB31 ttM6 1971fio9 0% 1181 182% 19H8011B% 1116 Z9L 1f5 a% 051 13to077 197075tnp5 130012N1A54 W=005 AAMt2 IiCV2592Bt95CAFE CmdCaMml FENFMI PJIPas6le WM 1771 0039 9G2 00315 951741 t28% 8TfI28 13. 3% 25f9B9 84% 117d51 729% 7158 f27% 17151 1 OO8 T2tn139 017 028 07B 47 017tot33 P005 ADAMf2 hCtI25P19135 CA E CxefCflNm ! FENFMI Clnner WM lo5t aoul5 75 0035 851525 te. i o7l78. S% 2vleu 8% 4122 CB'% 7Hf 17t% itf36 Oa% 00 98m125 012 025OA072 097 012tof 1 <-005 12 UC'V155A9e CARE Poae ua FBNF I NIPauls WM 1301 OP3 ES 1456 IT141 114% &1811 105% 88151t 125% 131G8 Tn9B 17Bli tOD OBStu158 082 03BIO1 03A 014W100 P<-005 LOX12 hGVf55eG90 CARE Pms aNve FBNFMI AIIPossBle WM 1872 00211 8lA 000A 18141E 15% 471410 115% &iHIB tOt96 89151 12896 ITlLS9 17. 09G f00 tD1, 51 OOD 035IOt&1 03B 014to100 P « 005 tIOI (15O IiGV25173G5 G1RE FN ! VB FBNFMI AIIPS5IbIa M 71'H1 O. M3 004 G. 01BC A9ISBD 119% 7M517 149% 571511 112% 85fiA8 11. E% 7HI0 50% 217160 15a9. 07A b3teta0 OGA 018 30 01050067 PeepUS GIIoA159 hCV25172115 GRE CaeelCaMml F3NFM1 AIIPaiidd M 1189 00T2 E/O. WOB 03f551 711% T41511 TA5% 67IIPB 11H6 55 ! 75 itB% 71110 5MG 2f15A 1549i U7i 52to1 49D 066 1 7 030 012te073 P=00. 5 CAPN2 hCV7B1658 W CradCoMml F3NFMI AIIPu, smhle WM 2375 00002 802 0115 8N49 ! 18. 1% 1371412 89% 76'IB8 2E196 78820 416 1N/t 11fi 2115 l2Ph uL2 9Btu0T2 i. W OT9roi. 65 OIE 18W1. 13 P=DOS PN2 hC B55H W COfkol FdNFMI Qaaflef WM 28. 05 <pppt 808 011A BN3A 1% 137I4M 2T% T0'25327. 7% 7An2A2 T% 1013D 696 2111107% 051097ta070 1a207N1 03A015to09A Pss005 wu Ctttt hCVT410B0A W Cm7Cama7 FENFMI damer SNM 23tt 00903 1088 0001 t07H81 1% l65f501 OWG 131202219% 151219 2 ! 6 1N2I9fA6 711D105% 08518MOAT 0530 M Y20f82to3911 pecppp5 TABLE 13, page 3 of 5 SptIrikaUy SIpNflant trrtsradlxu Bvhmn SHP Gmtypu. _ _ _. and PmvnWln EMOW (OrTwOCVD C2caDeEniUatic F&MI ltemoon MIlSuddmWalhlOMltNonhaal41 anUFahllNoo-hnl Ovaatt'Clu-Eftett"Ctw ORsrefUleies lRmreAIiek 2RareABales S a eTen S eTest Nmtal SI t2I Mat Psvagatmvs PIaCebo OddsRau B59 C1 camai Gpp PtBVa5f2Gn Plar2b0 P (ava9aun PIaceGo Pravas7aUn Po PaueNtswtho Patenlswahlliare PauAnswIIL2 SIDniAcarce P09c Muker 9t Du CueDaMnion elinHnn"'Snlum StUsda value Stalstc value Pa4ercs PafieMS Paherus PLeNS Pa PstleOs Rtor Aliela Adate RamAlIMea Leva1 Cp167 ACV2i591520 CAHE Pm N 1 ASIPOSSIdE WM l51 00t B22 GUI 1111881 tt576 lt81A38 127X t ?/2, 15 d. 996 37RI8 15096 1125 18 Dt1 f1. 3% OBB D88IO11B ZA 013t006T 14 0. 17OTB4 P « 00. R misa mfB3 hC1fI5581528G4RE C7sdCorthd FdNFMi AAPassihle WM ISQ2 0008 105-00052 1111&D 11T% 1f8lH15 190% 1T1242 50% 11213 15296 d721 1677fi Tfli 119% 088 OB7tO11B 02B 071toD58 123 019ro785 P=D05 C61A3 hCV255D1518GRE CMCn 1 F N MI Clanet 1 72 OOUa 919 A0101 111IBfi0 f7t% 11&589 Ol% 1 % JtBf 2% 87 71 1B% II21 1009L J7 BB% 82 8ttntOD 027 013tD 51 0840091D75 Paa005 cola (DB hCV2565030 GRE Pm Vs FdNFMI Gener WM 17. 2i 00041 78 0021 T7M50 16A 8A 65 796W, <8132 18% 5H2Bi 8 ! 1 1% tOf3 1t1% 082 5901 iS 085 032tot DUA 0021n04 P005 m8 hCV2559030 CARE CueMortml F6NFMI All e WM 124f U0285 8N 00 56 1 8&A02 130l6 A64B3 t0A% 5AII25 SB% ?1! 81 2 (, t0182 101% OBB OG4N1 ? 3 OT1 017W1 012 002t0065 P.=005 W h1f7553D30 CME CaSGrCoHm1 dtJ M Cle nef WLM 771 00011 1D1A OOOBI T7111 1T. 19G BV 2 20 % 1832a 1B% 59280 tt . 2fG 10f9 TO% 081 Ufi9 1 B 083 111nOG A 00 to0421Pdu04 CDLIfAI IiCV81A0Ei1 CARE CaseCantm ! FBNFMI ABPOevd WM 114 001d 71 00247 951015 179G G&IE6125% 3112 0% lCi3 t18 1 5210lt I51 f97% 00 0eero125 O5T os5m003 011 001tu00. 5 Pm05 se cap CpL2A1 hC132 AtB CAHE CasetCatdml F6NFMI d V WN 178E 0. 00Sit 82B 00131 H21 H315 1 t528 17% 27f733 SIB% IAftlS t88% 7l 50lG 1Hl i% OEB 49to0. A1 O80 0351a1 02 720 U711u078t P « 005 CR1 nCV5965GC11HE P s F6NFM1 AIIPnando WA1 11. 12 DOft1 AS 0258 1571177 106% 6711113 12B% T158 4% 11152 12% ON 0% 0' 0a% B1 0821c104 019 0091u007 Pa005 CAt CV255BH5 1 C IRE Pm rF8NFM1 Clerar WN 1921 0. 001 553 OOS T t2 1A18 158% t17R40 t8A% 2td7 5 % 11 (31 5 L 0I0 OU% M 009G 073t5AIO045 010 0 tu055 P « (XMA hC7etM CARE nm) =mFMi aI : !'aJ7BSBStB. jJsmNmMS'SN OM<OSSMt. m) 720 (DT7mB7t9PS20i h 55 CR1 hC1t255BB5L1 CARE CnaNCaHm1 FSfiFHI Cfearat WM t525 OOMd 891 OOdA1 125f9U2 15A% 1 B 2% 7J77 549G 11131 5 OIA 00% NO 0096 OT9 OSAtoa95 Ott 0021a063 PecU05 CXCL78 CV8T181W CNiE P ve F8NFM1 IIQPacsl6k WN 14. 38 0131 902 OA11 2N. 178 8' ! L 58I, iB0 t53% 8A1E11 111%2711581 127% 9f? 137 151 2d2 117% 0. a1 025MD 060 BI 2 t18 Oi5M311 P-v005 CyinLis ievolialat mn-r F&NF cu W&I 1 0 DD14 1087 U 000 5=71245% 1 W42l (lO2%) 74MU1101% 1 3ViB2 (ig8%) 2% 034 to (Ls ?)-081 3 tn20D 103031 C C7CCL1B hCVB1f81A7 CJ1RE CusNCarNO F6NFMI IuIPmslele WIN 1418 00128 IL07 00107 2608 yy'7 156% C97W0 11S% 1V573 128% 371tJ7 137% 2AIttt 120K ott G261o0 OBS De0 122 1tT 467m2U1 Pe : U05 CXGL1C IiCY07tBt9T GRE CaatCmCOI FBNFMI Claaner WN 19G 00011 1178 018 28t255 1D2% 2 96 8N1 ! fB-IY TUJ82 f84% 7IiB0 O% TBIo 108% 09 021w05 OBf SEmt 7 t. tA O61to905 P « c hcv2m CARE CPSWCGRCW IF&NF MI All POSWA WM 12T0 0075A ABt 00987 4E 5 0 i07L 7'. J515 1A8% 5A15B7 1025C 897525 1St : 297135 189Y. 15f132 1 % 057 03AIGU85 a 7 o53Wtt2 1 061to339 pccOpS EFt hCV788a234 W CasdCmHOi F6NFMI AIlPnsSINa WM 7821 00027 BiT 0. OM58 75fldB 7889M BN292 30 N, B3/d86 09G 117785 7A89G 47I17 1% 99752 23796 015 02Bto071 AB8 0l910085 10 0&fo17 F<a005 EW hCV1253B30 CARE P e FdNFMI AIIPasnWo WM 1502 0. 0103 93 DOD95 9HI125 i2f6 Bi1H18 158% 60196 f0m9G 7579 190% 29I7A8 13 % I f101 836 054 035b082 075 dIn9BB tA0 OBAtoA70 « 005 YEIA 71 CYM i ! cSS5-CARE'c. acKnm rmFM ! MmMaaS ! r"T ? ? 5'TT 66< Tm'<MMmm) tMMfx. m' Memm MJ-Bsmmn Mi3tt) BBM iMm<m% Q57<om «) 0 oTotaii :) MmataM p<os EW lCV1253Gi0 CARE CudCOniml FANFMI AllVasshla WN 1B OOOiB015G5 0004 89INTM4 (1 B4%3Bt 182% 80158A 1296 75I5Tt f31% 2012 13 ifiHAT 81% U5 034N00070 tM52tu107 18 oYOta3B5 P « 005 EiN hGV1733B3U G ntN FdNFMI GeanM WM 1818 O. 0o18 lf. OB OOD3D 38I2B7 13. 1% el7 1% 9NIAT tI. 7% 15rd89 s% 281139 11f6 18'121 182% DIB 030toTb O ISIO097 1 097tn3Bl P « 005 Fi2Ai IWZNB CARE CCUlCOMteI FBHFMI ApPacvble HlM t212 OU264 828 OWI33 851 1% 87 : eBe 1889G 481142 t09l6 587428 faE% tA172 1C496 7 ? 9 BB% 083 045WU 076 6210117 22A 08tn812 P<=005 F7 hCV78f3s G1RE Pm erdvs FdNFMf AIIPOSSI6Ie WM 19. E OOlgi 81 001 AfMB 3% 13 ; 11A5T 1 35238 d8% 20729 E% 111 3H6 167% OB ! Oast 084 1W 771oa 8 42 D04tnI75 Pe_905 F7 hGV78 138 GftE Pnm v FfNFMI Geanat WM 158 O00A2 7_t1 0287 81M887 19A1i 1 21. l9 3511 U. B% 20H30 154% IB 11. 196 3112 50% 06B 19IO07E 118 BSto 11 098 OO UiSB Pr_005 hCN83f3B CARE Ca9lCOIttol FdNFMI AIIPWSide WM 12B Oa ? Sf 775 0208 91fA5o 06% f33lA37 1429L 951Y3 50% 22d 89C 1113 318 1B7% 083 04Htn084 5 BTtu284 051 DOSt9594 POS 112rA p 89f98 CARE CasdCmCal F6 FII (yNr WM 4. B 00148 B31 00175 B1fl159 79Q9G 137lBf3 2179G 35I1B8 B% 24'126 1) % 1R 111X 9H2 OK 059 0141nOTG. 31 7 Io25I 03A 03fa. f63 P<e005 m F7 hCV78A184 CARE P we FSNFMI AIIPnmdo WM 11E4 UaiT 6 2 BNG80 0 %31M1A37 74. l19E 3ftbO 531% lKl3i 509 411 14. 3% 1/t1 t844 064 OAAWO85 192 &91n2 B 339 02 te12A7 PeaOOS FRE CasafCantN FpNFMI All omnbla WM 11E5 UG3Q8 cI2 00403 00Nr1 OB% 131I 171496 3lI75B 19 10% . 1 15% llll 9% A6f IEuUe5 72T 73m223 9730 lo4A8 PenOM AI CARE FMI-mi Atil-UMM. WM lllt 09 0E1 9941D 551599 9. 29G 70155614254 5u5at OA% Esl5lf t339G 10) 27 15 7% 041 IZUU89 078 037M15T) B 008mSOU P « A3 W FA9P1 tEf79091 CARE Pmc D FdNFMI CIeGllef W 1591 OUUGS G12 O. OIW 69110 13. 496 7Gf80 1% 59f352 15. 1% CB732 20. 79L 10I 1 O % 11lBt 1 ! 1% 055 030to0 00A 121t1AA 1 5 (0 P<W05 FJlOPt hCV1H173Wt ChFdE CamtCmotml FdNFM CSamcr WM l6lC 0118 Ha2 O102 55If02 137% 7Gt3S5 3% 57816 153% BB324 tUK 1BIB1 2D8% 11182 13A% O58 OAB1o003 O88 044to09B 1. 73 OTBtn39B Ps05 F hG111B1812 f. 4HE CusCaol FpHFMI MPasi6la WM 117E 0038 ei5 00l81 lSf015 110l 1271D9J 121R 11HB0 899G 3Utt2 185% 1fA 125 1f2 89% OBf 841011U 038 14b068 7C 0091a33 0 POS FN1 hCV050 19 CAAE CamfCanUW F8NFM1 AIPastGle WM'194 UtQi EOS U61&f CNE12 3% BiI818 tfi3% 55718P 11A'h 5N4 f0816 12lBT 13. 8% 11181 15A% O6e 01E7D70 40E 0. 72t0163 092-09BIn271 P « 05 6ALC hCV25G2ZI10CARE va FdNFMI Ckmer W 1379 017 81 OOt 3 BAI§D3 7AT% 108f55B tA49L 2Jt09 f059I 131182 5134 4796 T118 1 3% OB3 082lif2 08 18to0B) 172 Di8to70B P<v005 6APD hCY0A212B8 CARE PIOS vE FdNFMt WM 15t OOUBB 6A3 OW13 E516 163% BIf181 tT1% 3517581 511232 A94 It381D576 1U95 80% OB3 EltutZG 048 2ta102 028 D071o11B P<=005 GAPD IGV0B21Z88 GHE CelCatEml F6NFM1 AIPmsbk WM 1138 001t7 614 00. 1&5 88/R81f3% 8if197119L 9 : ui5B987G 51A51 182% 4f53'. Jlf 10152'li2% BB T11of35 57 38M09A 031 DD81a50T p<e005 GAPO hCV9B2128A W (aelCatiml F6NFAU NI IdO WM 1953 UU15 T85 A0218 B61fi1 f08% 181531 30796 831Z8 12% 5421. 1 2% 102A 785% 832 81R 05I 010to073 08B 6B1u11P 15t 5a1n455 Pa005 6APD hCVBA212A8 CARE LsrJConml F6NFMI Cleaner W 1421 D01N 868 OU358 8BI532 165l6 &IldlB 1T5% 1 1389i 5T/Z27 25. 1% i138 706% 1tP33 2H89G DA2 u96b128 Oyt. 32tnOfl3 025 00110093 P< : 005 GAPD hCVBA21286 W CweCmkml F3NFM1 Cimnm WM 2a01 QaDe 1028 OOdiA BAI12C 07Y. t&IN82 30% 831238 85% 5AIB2 A894 IOICf 135% 813 281% 05U U3710087 09B &Sta tA8 1Q 002fo5A3 P<a045 HIAP81 hCV25&51171 E P d (ve FdNFMi MPO Sitle0WM 1351 0 188 T16 00207 5 Ia0 B1% 91585 14256 517514 9Alt 6At505 137% 7 510 15 B198 Et% E5 OIBfn0A3 a70 31tOt42 2 0 OA8t088f1 P « O05 HIABt hC1125a51171 CARE ue FdNFNI Cislef M 2U31 000 1 BBB 00012 59f42G 73896 &71982 17% 57l. 147 1179f 881319 0% f7I17 221% 8111 8596 057 OIOro0A3 UAf 02AIa12B 3N 095tn982 P= 05 HLAOPBt hCV2585f171 CARE GneLCoMmI FdNFMI NIPom6le WM 17A 00183 B 00111 50t5A5 A9% H3i571 H156 517fi04 11i1% 69IfB2 1409i 1TIIW 15 885 fi396 Ofi5 0. 181oA3 G68 01&tatUt 2BB l0Bto787 P005 HLAOPB1 tCV25&51171 GhRE CeeCOmmi FdNFMI Glener WM 2001 OODt2 1158 OOCOt SLN2 tIML 931878 t8% 51f3. t2 t409i BWdOA 2114 I711e 22i1G AfBB BH 8 03GIU082 082 01110099 92t llBtaBBt =0909 HIADP81 tIG11BH51 VS F3HFAl1 AIIPOes0le WM 7128 0013 H35 U015t 89l64 G816 ta5x t&5U2 i8% BAtlAO 14294 SI88 1T1L 5187 57% 070 DooO dCB 032 997 t00tn11 P O55 HtA. nPBt hCVA6510a5 CARE Pim ve F6NFMI deGner WM IA91 00017 D OOOBS 63N53 138% B1401 210% 1W93S 1716 75E 3276 5 231% SI82 81% OBt 021n81 090 02AlotZ5 912 OBDlal PcOQS FMDPBt hCV8855065 CARE CmrICanmt F6HFMt AtlPam4te WM 1494 UGt08 1D01 0087 &V833 100% B5 8 B 379i O/IW 100% ABNAA 1A5% 5BT 17. 2l6 51A7 90% OA8 OIBW09 OBO UNroODT 9b2 121to1021 Pm005 HLADPB7 hC118B51065 GRE CeICard F6tefFMl Clener riM tA39 OOOtB ll. iB OOOJ2 81t445 12% ', 110t 12% 19% ABf301 8% 5164 1% 5l5A B5% 050 011bOe5 0 Ot1f00 7 125to i P<cU0D5 fitA. P8t hCU86510A1 CARE P F6NFM1 CIeLner WM 17 D009G 88 UP32 80"550 114% 108f1G2 22. 076 85 11. 7% 181213 16E% 8lYt S 79. 5J% OBU Od9b082 070 03d10t13 5 0981030 P005 HIA. OPA1 hCV8A5106t CARE CodCootrcl F6NF i ApPosdWe WM i29A 0241 791 D0202 86rIB5 f0. 2% laer757 1396 tOtY. IB788 13 AM2 iB. O'P, P1H 3% OBe oSObOG3 A74 Oi7ml 559 l7Oto2B5 Pm005 HLDPB7 tCV9g5f081 G1RE Cfe Camml FENFMI Ckner WM 1T. A0 0003 B70 0001 86'S18 t/7% 0811Bi 22116 11A% I&237 U5 8I1 a' 713 81'X 059 043m00 U70 031n119 810 f 2Ato3561 Pc005 wu, HIA. pPB1 hGVHaS1085 CAHE P va F6NPIfl1 AIIPo a WM 117R O. W9A 0. 08 OOIB 71 ? GA% 102O2E 140% AAIASt 102% SZ11D7 12. H9S 9152 178R S58 51% OBi 0491COB2 071 30tu1 91 0eUIn 1a Pc0a5 HIA-0P91 hCVBE51A5 CME P1m IYe F6NF I (yeAller WM 17D0 Q0001 S ! 0. 0162 71f525 fI. 1% 10911A8 1B1L. H72C5 f ! B 89G AIlB 5U% N5 8716 059 013fnOA2 0 03A. 4 JC 1 ta2 P005 ! iLMPA1 hCVBB5f085 GAE CdCNt'd FENFMI ABPa e WM 122 00 (fZ2 7. 16 00212 TM33 105% 10 ? JJ17 142% M S03% 5u905 192'% 9151 17H16 f6G. 1% Q89 lGfa001 071 AIBto1 t ! 12s 107roC Pce005 : ILAOPB1 hCIIHA5f08S CaaeCOrdtu FdNFMI Clexbr WM 78. 1 OOG28 tnt n0481 7U579 141% 7D ?/ 1A% 112 15. i% 52/ ! 51 20776 0195 2579G d2 1% 05i 2W083 0011fn10A 594 12AMP2f2 Pb05 ilAOIhGV019147D CARE n FlJiFMI All oxn6le WM 12 1 0 25 a. t 40414 ATf8t 11. 0% 111f8lU 1321i Z f81. 89G 4lf914 ifU G 7t15 0' ! 79f 0 081 06UIatOB 0 025W105 908t06Tta1dfA Pe005 iLA. DGBt hC1104W17U GRE fhae e FBNFAIt Gennr WM 1021 OOa02 635 0M17 18 illN, i. lS 04% 2&247 113% M12U1 1. 9% 7121 2% 9I5 12. U% 0T9 051 099 018 o221n85 302 082M 1 88 P6005 iti. 0ethCV0494. lTD GRE Cn 1 F6NF11 12U1 a09Q d U046 9 ? lB28 111% 1 11823 135% 2&353 B ! 6 4f138 119% 719a d1i l10 6% U81 OEDb109 Oit 03 tn085 2&A OAAtnIOA P005 MGCB hCVG1011T0 CARE mdCOrtml FBNFMI Cleaner WM 1895 00050 aM OSti A ? I5T2 181% 1111598 2f1796 2B2i1 115 1lLI Z% 3125 1209G 07f D55LatU 0. p 02iIO07A 283 A3al3 PeU05 iRC hCV11508111 W G$NGoraW F6NPMi AIIPoasmle WM 1857 00026 T65 ooxi 69/ZB8 89G e6n2t7 29816 65fiA1 18014 12I1I02 B96 35i21 1a% 1711H1 256lG U81 2E 035 (OQBB 1UB 06SIU182 a005 iR hCV7150ET14 M Cieaner WM 7075 UOOW BOG Uli7 5Yt34 252'W 85r221 2B4% 651338 tit% tl. H6A s. 7% a5ltlG TK a71151 78% aao 59mi21 D16 o3. 9m0E6 108 oKitetB9 OCS LtA hCL051B1f1 W Caselvt1 Fd, t. IFMI AIIPauthle WM 20 OOOOG e2 00451 771370 208% 191 ! ! 00 5% 71309 1 881351 1. 5% ILBU 183K 11f81 180% 052 03BW0. 7J 0 OB8to13O dG5 03BIO20 Pa005 L1FN hCVB737AA CAfiE Pms e F6NFMI AAPasvhk) M 19TD OQ20A 811 0017 8N812 103% 61M823 l30%. I : iABA 7% BAlIA ! 119L 17 H717B96 1111Dt tO. G% D77 D 1I01 051 BtOtiB T6 &5to10B POa5 LIpN hCVHIJTBGO CARE P e FdNFMI Cleso2 WM 1822 OOOf7 0. 7fi'OU77 6N151 f49% 61/601 0%. 13i33B 12896 88l1GU 22E% 17IBS 7a9G 1R0 157% OE ! 1810087 0d0 9tC A5 19A 701o6E5 Pa005 LtRN hCYH797AG0 GRE rasaon I NFMI Ceanet WM 1721 OOU1 7. 1A 00276 8B74N 148% 81ldBB 5l6 43xi32 15096 BBRBA 8% 57182 154 111E9 159X O85 a4SbOW 053 035toaA2 198 A821o4&5 P005 TABLE 13, page 4 of 5 shuSi (fS IhSrslgalllrznttni4racDon tin ENP xraotyp _ and pt2vm"ln ENtey for Two Can Gu Wfln0. lone Fapl trderavtan MI J Suddn Dyth I W9nIb Nonfalal MI and Faui I Nomhhl Overcll'CIiF EHacC'Chl-0 ftare Nlekt i Rue Atleb 2 RataAef MI uareTest uaraYest Ntoml Motsf Meta Prevesta4nvs Phdce6oOddsRatlo OS% CI - CAtrtrol amup Prnastatln PxaLO PravJn Plxeto Pnvastalin Plcebo PaUrntsvnlhU Px9ardlwNhIRara Patfenllwtth2 S p H xiee patlwft I Placebo Prgva ! = PIRMBO p2beMn IPtaO : W POVAU VTII bac fhwker P21k* Pabertsn Pgtkft PaUerts R2mAlofes Alein P Ailel.. Lmd ILO PCV9751GA GRE wen ve F8NFM1 CJeonel WM iG7B 00011 tU A 11118H 17. 2% 716581 1B69G 15J1b7 BO% 3Bli6B 201% 1f18 5316 9111 2739i O85 0 tc111 D2B 05100&5 015 011n1T4 POOd'', t9 fiGY3275i8B CARE CaSelCOrtlml FdNFMi AOPomhle WM 17. 71 DOU32 1304 00015 111f899 124R 116170 1289 1512 3t55% 38IL47 758% 1128. 896 Ili t. 59i 085 D72m128 090 010to05B 021 0021a2fA P<=0a05 SM < : V7eMMa CARE'mmM = ! H<) MPmtBs. MMfCLSa 0. 0165 < QtMSi ! 20 « : M « OOi6 ! 59<HE ! f13M a2t6am) MOt9TK) fMtfomH fmmmH OKmsShOm'9ff) 7 : t) MM----------. PM Carte TGA4 hCVIA1AE56 GRE CasetCo FbNFMI AYPOfsl6le WM 1187 00088 5 0. 0183 11183 101% 55111'98 739% 5120 0% 930 87% 010 OD76 Oro 0014 071 035to992 SEE 098ro332B P005 1GA1 hCVTAt8B58 CARE CicelCaldml F8NFM1 Gesnx WM t31 ! 00038 t75 OOIB2 l2NAi7 iiT96 1551110 8% 6 ! ! B 1396 ? It8 11. 7% n% Oro U% OB5 050N0&5 484 74ro2C1B P005 Carte R hGV1A1A211f CAAE e FdNFMI Clmtaf WM 1995 000fi 821 001G5 B7l875 12A% 13N820 tA9G 8W18B 25296 25H41 17996 1110 f003G ? l10 20o1G ofi8 01m075 110 OEBIO2A0 Ot Od91o8t Pr0 R V E1G21T4 CARE CwlCOntiGl FbNFMI AIIPessble WM 102 D001T 1D13 OOOd2 871811 0. 0% 190IW0 1379G 9CI22'7 172% Z5120B 121% 1118 07% 118 ttt% 080 Ot5lnOBt 1A3 A941o2 0A7 OOSloB25 POU5 SBhCV2227tM !) c*RE'mNMM = ! NFM mpoMN. MM Mm ooost B< om74 !) 7<smfem) iMafMC 3 ! <2Mft07%' : m « ttM KMteaM memw ommtTMO tstmnmm o53 (OM<o9a : ! POQ ! i Carte ImR hCV27271ABB CARE ms FdNFIAI Clearer WM 1B9B 000 0 015 00 T 8717i 12. 896 12Bl817 976 3 16T 34% I110 17G% i111 B176 /f0 20D% U58 042ro075 1 ! 0 OBEIn2AA U10 DD3 551 Pe=O 5 Car fiR 6C T1 URE rase'Cmrtm1 FdNFMI deaa WM 21E1 OOOOE 1095 OOW2 87I6 131% 1SA811 11 3AHS2 2419L 25N9C lBt9L tI t% ? l10 009G 054 Of010A7 1E4 OBOt92& 01B 0A3to0p7 P<- 0005 Leu n 4 CV7 337 GRE PN C FdNFMI PJPOSSIO1B WM 207 OU017 77 00212 U9ES tD7% bl BO tOG7Y 57SSB tOD7 905 fM1939f. C7t14 7I1t5 55 OCB DB7tnt3 7 35mt5An 2A In PenS fA.. iCtt hCV18U14337CARE Pm ve FdNFAII f9eaner WN 213A 00007 821 00142 711805L B7/753 79% 57/ot 1W 9c e&33 2ox 7o f2 nBO ax oa asefss oe. v oau fs oso oomuts v=oos Inxfa 1 CnRE CosnlCom FBNFMI NIPosddn WM 201 oaal 7Ge o01A8 801518 1 G% E1751E 111% 571517 104X 985C1 1t6% 9117 8076 Tilla B% 096 00Cmtft 079 057m108 02A 0121n83 P « 5 IA. Kt4 ICY1BW1337 CARE CssNCaMmI F8NFM1 Ckner WM 2221 00005 875 OQ7t3 BN385 tBlB 81f3a0 17596 57/9 13% AAH 1 (179G 9170 1Z9% 27110 2% 002 A2M197 D95 OIIaOO 028 012to0&5 PceA05 lPA hCVtl225G01 rJlRE C7sNCOntm1 F8NFM1 QMnr WM 239 . OODZ e68 Oo 25 BI927 fU% 28585 22796 29ItBe 156% l5118 140 Tfl7 4 'Hi %t11 T3% OSE 111n0 8 1. 13 0831020 2I2 01101285 P=005 Carte CARE D- MYH7 InCV56293GG CARE Pma s F8NFM1 AIPOmWe YY65 iGM 000A3 053 Oao7 1181200 oe% 5u1114 f95X 9t31 o09G ? I4T f9SC ON 00% U ! U 00% 070 511nOG0 8fo 179fo18fl0 P<nppp5 NYH7 IIC1l258'2B3B8 CAHE Pm ! rvE FbNFMI G WM 222 s000t 919 QOD21 518 82B 1 2 154f139 8X 91a 6 9 G 212H 1% ON 051 0 (0 a. 09i OBS IAtoOB2 G00 180b A7 peeUppS MYhl7, hCU ? 582A308 CIIRC CesefCaMml F8NFM1 llOPoss6la WM 1929 00002 116i OOOB 11&1f78 f00% 5N1122 187% af91 AG96 7f45 6L% NO 00% 010 D076 D70 051N09D 880 l7Dto138 P<cppp5 MYH7 hCV ? 582B3G8 GRE CisalCaHml FLNFMI Cinviet 1NN 2058 00001 t0A9 OOOOB 5591815 1SY, 151lf2B 119G Afl1 4099fi Yt7. 496 Ol0 00% Ol0 096 083 I81n083 B IB 161IO1i70 Pr0005 AC'V321A1E CARE ve FBNFMI AIIPasaldn WM 1133 00152 S1 OOI7i 597538 MG E81528 125% 81Ih2T 121% 87628 127% 1N7 5876 231110 184% 07 062to712 O 015to200 092 011foU88 Pr=005 N053 hCV321Cf80 CAIiE P ve F6NFM laaner VtM 1677 OOD97 072 OOSt7 531368 1t4% E&33. 5 tA7% 81738A 175% TI311 lG. ilG tOHIG i% Z31B1 2539G OBG tAtn 1 2 D 8 OOtr71 02 DOito078 P< OS Ab53 hCV321A10 CARE CaSelCarhol F6NFMI AOPat9ide W ! d 119 OONT 05Z OWB9 33152A f009G 8&5t5 128% 011520 123% 871521 12GX 1N181 1% 931134 1 29G D75 OSltet 0 OSi OBBM19A 032 015 070 Pc : 05 N063 hC1I321WB0 CARE CassCordml FdNFLAI deenu Wid 7158 00121 678 UariS 53135414 BBPZi 2% 8ld83 17. E96 87/d2 iG89G 70 (it1 E5% 23IW 05fi OEB OM0o069 090 OBttat32 02B 018to0&1 Pes005 NPG1 IiGV2572873 CARE Pm e FdNFMI Qeaner WN 21. 2A 00002 1008 QOC85 53b07 173 ! 6 1512AD 15. 5% 51I3B8 19296 tld7E 2 59GM22/d 31188 1656 1 ! 071t0175 055 OfItM1 0 037 Oib OG P=0o5 NPC1 hCVZ5472873 CJ1RE CiselGatrtlol FEHFMI CIIf WN 21. 33 o000T A, R Q019A fi91994 1t1% 1.'287 15. 7% S1rd18 13. H6 BVd70 21096 221117 15U% 911DA 956 109 07to 16A 058 Ai T 0 (0 70 P005 nay NPCt hC1I1100135 CARE vs F8 F I Cl amr WM 154 OOOBB E72 00148 t11210 1A3% 36117 I B 5BI108 137% 871387 20A9 2T/iB8 t3. 6% IWiA 0li 13 07to183 OBU 07l0162 OAB 0 7 ot. 1 Pes005 PLAB hCV74D181 CARE 1 F8NRM1 NVPoStIE ! WN 42 1 0098 811 OOl1 GI708 i1C% 87IAT5 121% 88/A55 B4% GBIH3 157% 5R2 E6% 9lIS 07% DB0 07ito735 05U 025to102 003 0174o22B P « OS PLAB IeGVTI ? IB70 CARE CaaNCOnUd FBNFMI AlIPa611d1 WN 1281 002C'1 8A1 009flB d1f8O1 122% B/E8012496 3BIlIA85% BB1137 168% 57f2 B M 1f0% OA0071fe19 019 4. J20o0T5 002 OtAt0202 P9005 PLAB CV11G1H10 CpRL C36NCOruof F6tiFMl Gean2s WM 18SS 0008 B3S OUi21 811191 1759G 8 ? f120 f9. 296 3BI91 ITA% BBr2e1 9B% 5f5B B9lh 8150 19U% 0A0 0&tril2E U11 01Hta0BO 05T A17fn18A PeU05 PPOX hCtI25G22818 CARE Pmyu e FdNFMI AIIPa lde 11. 13 OD135 E78 A. 033B ttEl103) 112% 128IfU1o 12. % 1CY18B 5. G% 25Ht3 1759G ilB 7B7% 115 200 i 088 U67to115 030 0121007 080 UMb11B0 Pr-D05 PP07f hCV15B281E CARE Pm dive FBNFMI Cleanet WM IB35 00025 B92 U0158 11Bt121 19. % 12BlB8'7 19. 2X 1119 BB% 25105 2BtW. 114 39% 12 WPIi OB1 061ro1UB 023 00toAS9 050 UCt1o201B Ps=D05 PPO% hCV25i27H16 CAR2 CasrtCaNmi FdNFAtI M ossible M-Iti 0011 747 0023 11BH0T0 11. i% 12Bf9oD 12B7G 7d181 9. 196 25It39 18O 18 1CT% 1f5 O% 0 7 OBBo 14 02A 0191c083 122 OOBt02131 P « 05 PP07C hGV25G22818 CARE CGSdCOnhn1 F6NFM1 Clencr WM 1505 O. U502 7. 25 OO2BT tt8lT11 t8. 3% 12Bt85B tA. 5% t0I110 A'196 25I8S 301% 1f9 3399G 500% 0. 80 8010 f 0A 028 011tu050 085 0021o355t P< : 003 SELL h 181725T1 G1HE Pma va FBNFMI MPoeabb WM l5sv 00088 703 0 991830 t0E% t 119% ? 3 849 Pl2ot 170% H31 12. 9% tll 9% 088 OASW 118 07 UOto487 28 02BIO272G) 00. 5 SELL hCV10t72575 CAAE CasdCOrMOI F6 FM1 NIPaN WM t5. t7 UUOCT. 2 ! OG298 99PH15 10. 8% tO5IW0 12196 23I28A 8876 571T9D 186% N28 13% 111C 5% O0B 065to 11B UI2 U251a07f 24T 0251o2I0 Pc=005 SELL hCVL517E27 GRE Pm a F6NFh ! MPemtls WM 710 0 108 11 002p 1001830 1089G t01 8B2 11896 9t27 3% 6712AA f77% I30 139f IItA. 3% OCU OQIt0121 012 0201n0E7 271 027fu283T Ps=D09 SELL hCl1 ? 571627 CARE CA1NCUMt01 FBHFMI lUIFasSCle WM 1483 QOtl1 769 OU216 1001015 50. 996 t0U8ED 12096 2 85% SI22B3 1E1% r127 11A% 1HA 639i 090 U87fn120 042 095ta071 2A 0251o21E1 P< : 0. 5 SERPINA1 hCV26&Ia50. 1 CAAE Pm w FdNFMI ds WM 1188 dOtOA An3 OQ191 81YIAA 1B116 9A112T t% 2A1G 11HG 371181 iT796 1U17B B1% IAI117 48%90T9 OSSIO1G O7G 090tu1 02B 011N0 » P<=A05 SERPIHItI hCV28B1950i CARE GomfGaNto1 F6NFMI de7ner WM 11E8 OAtIH 708 0. 3 AO ! ! 81 186% eNHD B% 201fBE t1896 3TH8U 178% 1I11E 8 1 7 E% 078 055IO110 061 OIBIA 12 U7TroU5B P « o05 SERPINAS hGYB5B9B&7 CJIRE F6NFMI AIPaiv Ie WN 758T 0072 G. i OO1W 8N500 10T% 7f8% 4115'1A A416 A17527 f61 9311AT E2% 12l113 108R Ofl0 0621e131 O'0 0211a 0 110135 SERPINA5hC4A596993 CAViE Pros FLNFW Gefnot WM 2050 0, 001 S37 0015G 6a407 9% 5t9E4 1T87G 114 T7% 81 977 240% 291O. i 1276 1IBB l7tX 080 0511ot 1 018 D21 e70a 169 0661ot2P P<c0a5 &ERP7NA5 hGVA. AeAB3 GRE Co. eo7CaNON FdNFMI ACPaodble WM 1898 U0045 A2i 0090 GNS51 f08% 851515 11. 996 NI515 6596 011514 158% 231139 187% 1T1110 1DB% Bt OOZfat OIi 073ro073 165 0T3to3 P<s005 SEfiPIHAShCYA588A8 G1R Cachml F6HFMt Ctea er WM 1895 0013 771 OQ20D BN1U2 110% 'J95B 18t% 1 !/339 13. MG 811993 1. 3% 23lBA 45% 17BI 17o9G10B0 0541D11B 04E Dt 31to07a 110 089ta3 6 P « 005 hCV258MG6 SERSlNBEhCV16S90BgiCli2E Pm ve FBNFM ! ene WM 18. 58 dOLL51 7l 00215 711133 17. 1% A8Il801835i 153t 185 7635 10% &8 5% 211 1 2BI% A92 ABflutD2 OSB 027tu1 027) OGOOOTA P<=OD5 6ERPINB8hCW81ooei GRE CfsmCnnfml F6NFM1 AIIPasude WM tltl 00132 0. 19 00101 745A8 t2. 416 88SG 11. 7% 1511 Td1&1 1429i 81114 0% I1170B 1B4'fi 105 U741n157 OBt D41IO0B1 030 lto071 Pc-0OS S PIN88hGV48190F1A3CARE (WfefCaoNF P6NFMl deenet WM tB. 3 0. 005 8. 91 00193 7MI25 1 1% ABI358186% 5 ! ! 2A 73796 T01327 2f ! % AJ9r 0 21/7 B% 0A2 83faf. 94 080 IOInOBI 02 0101a05A Pc-0D5 S9iPlN12 hCV977A2 CARE Pfoa edlve F6NFM1 AIIPnsstde WM 1188 000. 11 GB4 00081 W/t89 1f. 2% 511t70108% J715B5 A96 06517 teE% 27H8i 11HN. 17f17G 5% 109 BGtotb5 D5o Ut2W11 t2T OIBtn99B PacOUS SFRPiNI2 hCV310TB2 GRE PtU e F6N W daer NfAI 211G 00007 A85 00132 511372 189% 51ft86 111% 51l8 31% BN351 SI 27113D 16A% 17H 8 117% 001 62btU U15 20tu103 110 010fo2 P<e005 &ERPINI2 hCV5707H2 CARE (bmlGnhol FdNFMt AIIPosuGe WM 167 ! OUW9 &BB 0011a SIf177 f1% 5IIl90 11. 1% 51/551 fl2% 8N. n71 1A0% 2L702 1717i 17f7 5 B7% f02 OEBIDISt A50 085100T3 124 06DSO213 P==ODS SERPIN12 tCV91W82 G1F1E Mroi F8NFM1 Clecner WM tB0 G023 101 40f91 511d2E lGA9t 5112A1 ! 73% 511aT1 136lG GGi351 25l14 7l13e 1A2% 1T7113 1509G OAS OE2m11A OA ! OIt0088 ! OA 053tD212 Ps005 TNF hCVT51191Y CARE P1m FdNFMI Cltuner WM tOUB OO1G A55 DU73D BC6GU fA396 10315it 140% 28rs21 129% SOt20 7% BB% StU OK1 0611e11 4E o23to099 000 02to05s a6M S11A7G I 1778 OOOJ J7T U02UE G9l501 tE5% t0 ; Y532 1BS% ZBI7Z'J 2fi9G 5UR1B Z2. 99i 3191 89% 5'10 50096 083 08061. 73 018 2Ato081 O1 OOtnDE1 Pr005 VFN hCV253BSC5 GNG Pra e FdNFMI AtIPasan6ls WM 182D 0002B 752 00232 9A131 116lL 3 ? 1391 BGSL &fA2A tA 8 7 G 73168 tE'x D. 87t0216 0. 56 234ni 071 025fo19B P<c009 YTN hGV2590585 CARe PN ve F3NFMI G wM tsee oaou oGa oaet sYilo tasx o usx eaae a7u GLS7a zlrx zatn lsnx. aaWe tea% 1u ecni o x tot ps : aas hCU ? 5965G5 CARE CmlCOnWI F8NFM1 AlIPOSSiNE WM 7811 DOPLB 7A8 03T 3&371 117% 57 B1% BU820 103% YY1f559 780% 2lJnB 93% 53262 126% 131 080b21 056 4UtoA80 073 041 1. 2A Pe005 VTN hCVT5sE595 CARE taICmwf F3NFMt Ckaner WM 2002 UU012 eA8 OmO5 9926 fe5% 9 ? R1C t89i EU32 1 E% 1. 1% T4t171 tIU' ! i aants 78uri 118 n tro201 OSt 9A1o073 070. oaCeot2s P<=o05 1 1 1 -f __ ___i TABLE 13, page 5 of 5 Statlnlcally51pnI11nMIrtradlant8etwonSNPGenotyps _ _... _. and PmvaMaUn Effla5rforlwoCVO Ga DMltlom : FaW ImwaWan 1d1f9uUdmMatn10a1fnNVHomhWIWanCFahtINOn. fnml OvemtICH. EHecriCN-oRarefJldn lRSreNlele 2PaeAeec NI Tat Teri Mntal Nmlal dlotl Prvastatln vs PlxeboOdd Retb 95% C GO" P12V25= Ff2cato Prdvamn PUINW pi2vastalln Flmbii PabeMVAUiG P"U% iUilRem P"CMWW2 qmlcanra PuDlle lAarker SI Sdd Das n CmabsIiMun Dsllmlwn°'Strafun Stathtk value Sfadstk us PaBenM Pa4ents Patlecds Palles Pahadt Pxirtq RreNIAles Allaln RatBAlleJe ! I. eVAI 'Fortha CARE OtnsspscLVe sludY : resulls nf fhe Ousrail SooreTest (d-aquafe last) fwthe lagwil,-rogrmlon ff4M tnwnch the phmrm (cma definition) Is a tMtftJon orU) a SNP asftotypo, tMaatnent emup, and the tntefcon between SNP uMttaalment Forcasalnvol smdks ; rosltt ot the Ovaall ScaeTnt (chFcqcre tat) Tot tB5 « lrl0 ; 1be ; ; WrFgl ; nlçlf6l ; ; 8nnIIdi ; (BtShCBthôPtænO ; YPe {= ; tt IlacarWllom ! bplWc npmwwn madel In whxh Ne pnaiatype (rass d*Wan) Is 2 fimma of the W conowe, towmerd o'up, ond ft liduawn between SW ggnMM uM tmzfmerit gmup W4 cases am corards hc beenmmdndon Ha -tMrXOttE ww ; *e * rSt d ttU ; orz BtQtO# intenabn 6bwaen SHP GcxtYDS and tm4neM amuD Naved on Ihe loofs6e codon model Forma samnrd naux resux ol uieasquam teud ms meramon tnelwen SNP omiM and ttMmmt trntip (bMed on th* eondtmN) bfMc 'reaknmoa "'MPOSSIGBCAlIlI0liIldllliIICOMIDlfNIIGBfIOtYfCAIi CI071i0f ootmh uekdo mrtrok Nnth perotype detndA wHh no other CVU. felated evertf me trlal Fora def4m6n'F MUSNNF MI' FII MVSudden OegtJOeftnNe Nordl MI IF&W mi"-Faial a NaaW NJ wktlmolas FnrstuU'W'WOSCOPS TABLE 14, page 1 of 7 Place6o PatfeMs StatUstically Signitfcant Assoeivftans Between SNP Genotypes and Two CVD Case Definitlon Fatal MI I Sudden Dealh 1 fveraU'Ghi- Control _ mro _ n 2 Ra All I 0 ZR_re Nlele vs 0 S niecance P Pli. 2 ABCA1 hCV2741083 CARE CaseICorrtrol F MU5DlNF MI All Passi6le WM 7. 81 0. 0201 11. 09 0. 0258 1131918 12. 8°/a 171243 70°/1113 7. 7°) 0. 54 0 07 to 4. 27 0. 4 0. 26 to 0. 81 P<=p D5. ABCA1 hCV27410H8 W CeSBfControl F MUSD/NF MI Alf Passtble WAA i. 58 0. 0229 52. 38 0 0148 1A316a4 23. 7° 801t95 9u. 8°lu Tll5 48. 7° ! 0 2. 87 1. 05 m 8. A4 144 100 to 2 08 P<=0. 05 A ABCA7 hCV2T41083 W CaseiControl F MUSDMF MI Cieaner WM 6. 4 0. 0408 11. D4 0. G2fi1 1A3Jb31 26. 996 801113 34. 7° a 71t5 48. 710 2. 49 U 8710 7. 10 1. 48 9 Ot to 2. 12 P<=0. U5 ABO hCV2581Q7TA CARE CaseICnMrol F MIISD (NF MI. Cleaner WM 6. 55 0. 0382 9. 54 0. 049 881438 79. 7 49f262 18 496 ? J97 5. 49'0 0. 19 0. 04 to 0. 81 0 81 0 53 to 12a P<=p a5 ABO hCV25B10818 CARE CaselCard F MUSDINF MI AlI Passlble WM B21 0. 0448 8. 97 O. oa1 BBI875 tZ. 7°/o 431431 10. 0° 2159 3. 496 0. 23 no5to o. e7 a 7b o. SD to t_t1 P=o 05 AHO hCV25810818 CARE CasefComrol F M11SD1NF MI Claaner WM 7 34 0. 0255 10. 24 O. A3T1 B8f430 20 a°k 431280 185°/2t39 5. 1% D. 17 0 04 W O. T4 0 S1 0. 53 to 1. 24 P<=0. 05 'A80 hCV878478T CARE Case/Controt FMUS1NFMI Clsaner WM 1 7. 81 0. 0327 9. 84 0. 0414 BB1431 18. 8% 31ZB8 iB. 996 23 (5. 3°) 0. 1 (0, 04to0. 80 0, 8 (052to122 P=005 I ADAMT51 hCV828700 CARE CaselConhol F MIISDJNF MI Geanet WM 8 A1 0 0405 11. 88 0. 0183 871434 15 496 511258 19. 896 12142 28 89'0 2. 90 1. 08 W 4. 87 1. 44 0 8510 2. 17 P<=0. 05 ADAMT51 hCV5297t0 CARE P (oS eCtIVe FMUSU/NFM1 CI28IIBf WM 59B D. 0488 5. 85 0. 0538 8T/438 15. 3% 5 ? 1285 t8. 8% 1 ? ! d2 28696 2. 22 1. 06tD4. d8'1. 37 08110204 P « 05 AOAMTS1 hCV529710 GARE CaselContcol F MIiSOfNF Mt AlI Pcsslhle W M 6. 95 0. 031 12. 81 000117 671898 8 8% 521410 12. J96 12187 17 9% 2 08 1. 04 to 4. 17 1 61 1. 02 to 2. 24 P=O AS A13C ; Al 7 APOB hCV3218558 CARE CaseIControl F MIISDMF M Cleaner WM 815 0 0482 B. 5B 0 0488 911455 20 0°h 351248'14. 2°r6 5130 (8. 7% 0. 78 0. 28 to 2. 09 0. 5 (0 37 to 0 89 P<=0 05 ABI 2M 1431531 (2B. 60l173134. 7%) 7115 (46. 7%) 2AS (D 87 ASAH7 hCV2442143 CARE CaseIControl FMI/SDINFMI AIIPOSSiGIe WM 798 D. 01H5 1192 DOt& 43l31A 13. T% 671577 11. 696 211278 75°/045 028to0. 80 084 0. 58to128 PC=0. 05 7 A7F6 hCVZ5831888 CARE Pros ive F MI/SDMF MI Cleaner WM 7. 08 0. 0291 8. 58 0 0376 113I60B 19_eh 11f115 B. B 1l2 50. 0° 4. 38 0. 17 to 110. 18 0. 48 0. 23 to 0 65 P-0. 05 ATFB hCV25631ABA CARE CaselConirol FMIISINFMI Cleaner WM 7. 71 0. 0212 tO. 59 0. 0315 t131998 189°h 111113 9. 7 112 55095 7. 21 0. 4dtoit9. 14 047 0, 24toA. A) P<=0. 05 BAfAP3 hCV251I334 CARE Pros ective F MilSDlI MI All Possible WM 8, 74 0. 0126 7. 03 0. 0298 981A58 10. 396 291223 13. 0 317 42. 9 8. 57 1. 28 to 3. 18 1. 31 0. 83 to 2 01 P=0. 05 BAIAP3 hCU2503034 CARE Pros ve F MUSDINF MI Geanet WM 10. 18 0 0062 8. 48 0. 01d4 9BI80A 16, 1°6, 2AI123 23. 6% 3/5 60 0°/a 7 82 1. 28 W fi8. 85 1. 67 A 8B to 2 55 P<=0 05 BAIAP3 hCV2563034 CARE CaselCoMro1 F MIfSDIPfF Ml Af1 Possible WM 789 O. OS83 0. 09 0. U399 991938 tU. 59'o 91221 13, 1% 3 !77 42. 9Yo 8. 53 1 41 to 30. t8 1. 22 0 77 to l. B) P=0. 85 BAIAP3 hCV2503034 CARE CaselControl F MI1SOINF MI Cleaner WM 833 0. 0184 11. 74 0. 0184 8BI641 18. 3 2A1122 23. 8Y 3I5 80. 096 7. 03 1. 13 to 43 88 1. 55 0 85 to 2 52 P<=0 a5 BAT2 hGV7514722 CARE Pms tvo F MIISDINF MI Ail Posslble WM 1 734 0. 0409 8 3 0. 0428 81iH38 9. 7% 4 f318 i4. 796 3197 8. 1°/0 0. 82 O. ZO to 2. 36 81 1. 09 to 2 38 P<=0 U5 43fla 3AT2 hCV751477 2 Case/Control F MIISDINF MI All Posslble WM 6. 34 0. 042 9 87 O. D88 87/62ri 9. 896 471812 15. 196 9f3B B. 3'Ya 0 81 0 2d to 2 73 1 83 f, 0 to2 22 P<=0 05 dAT2 hCV7514722 CARE CaselConhol F MIlSOINF Ml Cleaner WM, 7, 11 Q, 0298 8, 59 0. 0479 811525 15. 4% 47h92 24 59S 3J18 16. 7° 0. 82 0. 28 to 3. 83 7. 75 1. 15 ta 2 88 P=0 05 3DKR82 hCV25833900 CARE Pres actlva F MIISDINF MI NI Possible WM 8, 04 0. 0487 S. A3 0. 0515 581809 9. 796 fi5f481 3. 596 71105 8. 8% O. BB 0. 28 to 1. 44 1. 46 1. OO to 212 P « 0 OS 3DKR82 CV25A33fi00 CARE Pros ecHvs F MUSDINF MI Geaner WM 8. 29 0. OA3 8. 27 0 04488 1388 i5. 3° 85t2B9 2l. TYa 7158 1t. 8% A. 75 U. 3D to 1 82 1. 54 5. 04 to 2 29 P « 0 A5 '25 r : ASP1 CVM2764a5 CARE Pros sctlve F MI/SDINF MI AlI Passi6le WM 12. 28 O. OOD5 11. 88 O. UOB5811981 9 5 4D1228 17 5° ! a O00 0. 0% 2. 03 1, 35 to 3. 03 P<=O OD5 : HSP1 hCV182T8495 CARE PtCS ve FMI/SlNFMI Cleanr WM 10. 7 0, 0011 10. 43 O. OD12 911591 549'a 40H49 2889 Ol0 0096 2. 02 1. 31to307 Pc=0005 CASP7 hCV16276485 CARE CaselCcntroi F MIISDINF MI Ali Possibia WM 9. 14 0, 0025. 894 0. 0028 911945 9. &9 40f223 t79°l U (U 0 096 1. AD 1z5 to 280 P<=0, 005 CASPt hCVtfi276485 CI4RE CeseICoMroI FMtISINFMI Cleaner WM 8. 34 O, OU39 8. 16 0. 0043 91f585 15. 8 4M147 27296 O ! 0 0. 096 1. 82 1. 23io3. 01 P=O. oo5 : CKBR tCV9604851 CARE Pras ecGve FMt/SDINFMI Al PossiWe WM 13. 75 0. 0D1 10. 68 0. D048 12111058 11496 7l130 5. 4° 918 f 9. 0°I 7. 74 142to4224 0. 44 0. 1Bto0. 8U P=005 CKBR hCV8A4851 CARE Pros Ive F MUSDINF Ml Cleaner WM l2. Bi A, 0018 8. 81 0. 0135 7211868 18 2%) 7174 8 6Y 3I4 75 0°. b 8. A8 1, 71 to 274. 34 0 4 (0. 19 to 2 27) P<=D 05 CKBR hCV98U485i CARE CaselCnnVat F MIISDINF Ml AlI Possible WM 11. 84 O, OU21 14, 34 0. 0483 12111038 11. 796 7N28 5. 5, 3/8 SD. U°/ 8 32 122 to 3270 0. 41 019 to 0 91 P<=0. 05 CCKBR hCV980A851 CARE CaseJCordrol F MIISDINF MI Cieanef WM 9. 26 O. OQ98 i1. 17 0. 0248 121I65T 18. 4 7l14 9 596 314 5 096 10. 11 1. 03 to B8 5B 0. 48 0 21 to 1. 09 P<=0. 05 CL22 hCV3288420 CARE Pros ve FMIlSDlNFMI NIPvsslble WM 1127 0. 0038 6. 95 0. 032 12111079 11. 2% l112 7. 1% 2I8 (8. 7%) 5. 83 1. 511034197 081(027to121 Pt 0. 05 "CL22 hCV92B8420 CARE CeSeIGOntral F MIlSDtNF MI All Pnsslble WM 12. 98 O. OGiS 11. 27 O. D23B 121HD59 11. 45 S1110 7. 3°k 13 88. 7e, 9. 59 f. 72to 222. 63 0. 62 0. 29 fu 132 Pc=D. 05 7CRL2 hCV25837308 CARE ProspeeHve F MI/SD/NF MI All Posslhle WM 12 07 0. 0024 10. 08 0. 0065 1U 9029 1 2°b, 21l150 14. D 5113 38 5Yo 5 50 1. 84 to 18. 79 1. R8 0 85 to 2. 93 P<=0 005 : CRL2 hCV258373a8 CARE Pros ective F MUSD/NF MI Cleaner WM 8. 98 0 0112 T. 88 O. D214 1053637 18. 5 21188 21. 8. 10 S0 0 5. 0J 1. 89 to 18. 61 1 42 0 82 to 2 37 P=0. 05 : CRL2 hCV25B3T39B CARE CaseIContrW F MIISDINFMI WIPosslWa WM 13b2 OOa12 15. 11 U. UQ45 1a5I1U11 t0, 4° 21H4 14_496 5113 38. 5% 86D 207to21. 1 1. 28(0. 78to21B P<=00o5 : CRL2 hCV2583T308 CARE CaselContrai F MIISDJNF MI Geaner WM 7. 02 0. 0289 9. 24 0. 0555 105/62B 18. T° 21195 22. 1% 5110 50 Oo 4. 81 1. 34 to 17 28 1. 15 0 86 to 2. OD P=0 OS : CRt2 hCV2583730A CARE Pros ective F MilSDINF MI Cleaner WM 6. 17 0 0458 5 95 O. p50B 5DI26B 78 49 87/348 19. 296 14H38 i0. 3% 04B 0 25 W 0, 88 0 8 (0 89 to 149 P=0 05 TABLE 14, page 2 of 7 Placebo Patients Stallstlcally Signiffcaat Assoclatlons Setween SNP Genotypes and Two CVD Case Definitions : Fatal MI f Sudden Death I Overall Chi- Deffnite Nonfalal MI and Falal l Nontatal MI S uare e t SNP Eftect Ntatal Odds Ratio 95 CI Control Grouo AI e1 s vs 1 Rare Allele vs o Si nilieance Puhlic Marke Stud Stud aesiCase Definllio Daflnihon"'Stratum Stahstc vatue Sta ti val 0 Rare Alleles 1 Rare Altele 2 Ra Allel Rare Alleles Rare Allelea Level COL2A9 hCV25608528 CAAE Case/Control F MIISDINF MI All Possible WM 6. ! 0. 0474 7. 59 0. 1078 11311042 (10. 8%) 161128 1277l 215 40 096 8 28 1. 11 to 81. 51 1. 18 0. 67 io 2. 09) P=O. Ob CPT1A hCV15851335 CARE Pras ective FMI/SDINFMI AIIPossIWe WM A. 05 0. 010A 7. 1 0. 0288 116l1018 (1. 4%) 12/169 (7.°l0 214 50. 09f, 778 093toB5. 35) 0. 5 (031to18 Pc=005 CR1 hCV25598588 CARE CaseICoMroI F MUSD1TJF MI All PossiMa WM 525 0. 022 5. 01 0. 0253 119H1105 (10. 8%) 11/62 1T. 7%) 0I0 (00%) 2 25 1. 11 to 4 57 P=0 05 CR1 hCV25598589 CARE Case/Control F MUSDlNF MI Geaner WM 6. 01 0. 0142 5. 06 0. 0175 119l893 17. 2°Io 11138 28. 9% 0I0 0. 0% 2 56 (1. 18 to 5 57) P=0. 05 CX3CR7 hCV7900503 CARE Pros ectlve F MUSDINF MI AII Passlble WM 769 0. 0193 7. 75 0. 0208 787587 13. 3%) 41/507 B. 1%) 12/92 (3 0% 0. 9 (0. 49 to 1. 82 0. 57 (0. 38 to 0. 85 P<=0. 05 CXCX3CR1 hCV79Ua503 CARE ProspeMve F MUSDINF Mi CAeaner WM 8. 19 0. 0167 8. 04 0. 018'78138 (20. 6%) 41/311 (13. 2%) 12/48 (25. D% 1. 28 0. 62 to 253 0. 5 (0. 39 to 0. 88) Pe=C 05 C7C3CR1 hCV790O503 CARE Case/CoMtol F MUSD1NF MI AlI Pas5161e WM 7. 39 00249 9. 58 0. 0484 781577 13. 5%) 411497 8. 2%) 12/90 (13. 3% 1. 11 0. 57 to Z. 76 0. 58 0. 39 to D 89 P=0. 05 CX3CR1 hCV7900503 CARE Case/Cont ol F MIISDINFM1 Cleaner WM 6. 9 0. 0317 9. 06 0. 0587 7S ; 376fZ07%) 41/306 (13. 4%) 1ZH6 (25. 0% j 1. 6 (0. 75 to 3. 13 0. 05 (0. 42100. 90) PenG 05 DBH hCV12020339 CARE CasalCantmol F MUSDINF MI Cleaner WM 9. 48 0. 0087 11. 92 0. 018 1181834 18. 6%) 101A3 90_88%) 3/6 (50. 0%) 6. 23 (l. 19to 3 65) 0. 53 (0. 2B to 109 P<=0_05 F7 hCV763184 W Case/Contfol F MUSD1NF MI All PoSSible WM 641 0. 0406 9. 66 0. 0466 176/95 (27. 0%) 281148 (19. 29a HI14 42. 9%) 1. B (0. 87 to 6. 8S A 62 (0. 40 to 0 87 P<=0 05 hCV783184 W CaselCantml F MUSDINF MI Cleaceer WM 8. 88 U. 0364 8. 86 0. 0428 lT8I67A (30. 7°I 281132 (21. 2°l Bit3 48. 2'. t. B4 0 80 to 6 Bt 0 5A 0 37 to 0. 94 P--0. 05 GBA hCV2278802 CARE Prospe F MIISDINF MI Cleaner WM 7_05 0. 0079 6. 95 0 0084 4511A9 23 8 855555 153°k Ol0 0. 09'0 0. 58 0 3B to 0. 87) Pc=p 05 iHLA-A hCV11888818 CARE Pros ive F MUSDINF MI All Passible WM go9 0. 098 8. 98 00412 331404 8. 2%) 421381 (11. 0%) 49/35 (14. 0% 1. 82 1. 1 to2 3) 1. 39 0, 88 to 2. 28 P<=0 05 IiLA-A hCV11889A18 CARE Case/Conrol FMIlSDfNFMI AiIPassiGe WM A. 08 00478 94d 0_05f1 331398 8_396 421371 11. 3° 491345 14. 2°/ L78 1. 10to2. B2 1. 20 0. 73to197 P<0. 05 HLA-DP81 hCV11916884 CARE Pros va F MII5INF MI NI PossIWe WM 6. 68 0 354 6. 56 0. 0377 921832 9. 8% 381245 15. 5%) 1118 8, 3Yu 0. B1 0 03 to 3. 06 1. 68 1 10 to 2 50 Pa=0 OS HLA-DPBi hCV11916894 CARE PmspFFMIfSDINFMI deaner WM 10. 56 zoos1 10. 28 00059 821581 (15. 6%) 38H41 27. 096 1/10 1010° !) 0O BD(0. 03 to 828 2. 00 1. 2A to 3 07 P<=0 05 HLA-DPBi hCV11916894 CARE Case/COrnroi F MUSD1NF MI Geaner WM 8. 93 0. 0115 11. 82 a. 018T 821584 15. 896 381138 27. 3°/ lll0 10. 050 0. 74 (0. 09to62) 1. 97 1. 25to3. 10 P=0 05 HLA-DPB1 hCV25851174 CARE Prospectlve F MIfSDINF MI Geanar WM 7. 46 0. 024 6. 51 0. 0388 711370 i9. 296 581300 18. 7Y5 4189 5. 8°h 0. 28 0. 08 fo O. fi5 0. 97 (0. 65 to 1. 42 P= 05 HLA43PB1 hCV2601174 CARE Case/Contmi F MIISDINF MI Cieaner WM 7. 05 0. 0295 8. 92 0. 0631 711368 I9. 996 561295 (19. 0° 4i8 (6. 0%) 0. 26 0. 09 to 0. 76) 0 8 (0 65 to 1. 45) Pc=0. 05 HL"PDI hCV86510GS CARE Prospecflve IF MUSDINF Mi CJeaner WM 716 0. 0276 6. 07 0 04A 721391 (8. 4%) 581284 (8. 0%) 9/60 (5. 0% 0 23 0. 06 to D. BS 1. 04 ( 71 b 1. 53 P=0 OS HSPG2 hCV1B0a8SS W CaseICantrol F MdSDlNFMI NI Pass161e WM 84 OS0B 7. 98 0. 0924 174/665(262%) 31/133 (23. 3 51771, 4°/ 6. 06 1 18 ta 31. 62 0 88 058 to 1. 37 P=0 05 HSPG2 hCV180365a W Case/Cotml FMUSDINFMI Geanec WM 7. 43 0. 0243 7. 85 0. 0974 174158A 29. 5°/ 31fti7 2fi. 5°) 5 5 ( 3 3%) 10. 41 121toB9_85 089(058t0138 Pe-p05 IL1A hGV8548471 W Gase/Control F Mi/SDINF Ml Ali Passl6le WM 7. sa 0. 0226 13. 48 00092 t211400 3o3%) T81351 Z2. 2% a 1111i 18. 0% 0. 52 0. 26 to t. 4 u. 8 (0. 48 to 0 83 P=0 05 'IL1A hCV854B471 W CaselConml F MUSDMF MI Geaner WM 7. 67 0. 0195 14. 02 0 0072 121/354 34. 2%) 78/307 25. 445 11156 19. 896 0. 49 0. 24l0 0 A8 0. 67 (0. 47 to 0. 94) P=0 05 ILiB hCV9548517 CAfiE Case/Control F MIISD1NF MI Cieaner WM 6. 1 0. 0474 11. 13 00252 &51427 (15. 2%) 81257 21. 8°k tU150 (20. 0%) 1. B4 0. 76 to 3 53 1 H4 1. 08 to 2 47 Pc=0. 05 IL7RL7 hCV25607108 CARE Prospective F MtISDINF MI All Possibie WM 845 0. 0089 9. 2 0. 0101 4B151 (10 9) 501556 9 0%) 32/187 (17. 1% 1. 69 1. 04to 2. 73 0. 8 (0. 53 to 1. 23) P<=0. 05 ILiRL1 ttCV25607108 CARE Case/Control F MI/SDINF MI AlI Passible WM 10. 51 0. 0052 10 0. 0404 4A1443 11. 1% 501545 (9. 2%) 2ft84 1T 4°4% 1 6 (1. 13 to 3. 08 0 4 0 55 to 129 Ps=0 05 1L1RL1 x hCV258071U8 CARE Case/CaMrd FMIlSDINFMI Cieaner WM 7. 32 0. 0257 7. 99 0. 0919 4912B1 (7. 4'a 501326 (5. 3°h 32/127 252% 1. 85 1. 09to 3. 14) 0. 94 (08 to1. 46) P=O. 05 IL4R hCV27B9554 CARE Pms ectlve F MI/SDINF MI All Possible WM 62 00165 769"0. 0194 421371 113c 73584 129° t81257 A 2%) 0. 52 D 28 to a 93 1 1 (0'7A to t 78 P=0 05 IL4R hCV2769554 CARE Pros tve FMMUSDINFMI Cleaner WM 704 00296 682 003 4 ? J233 18 0° ! 0 73i358 20 4°k 16Jt5 70. 69a 0 54 0 28l0 0 98 1 18 0 77 to 1. 7A P<=0. 05 IL4R hGV2788554 CARE Case/Contro). FMHSDfNFM) AOPosstNe WM 10. 46 0. 0053 1A, 12 0. 0384 42I3B1 1t 116%) 733557 13. 1°/) 16l252 ( 3Yo 0. 46 (0. 25to O. B4 1 14 U 75 to . 73 Ps. 05 L4R hCV2769SS4 CARE Case/Cadrol F MIISD1NF MI Cleaner WM 8. 54 0014 8. 58 00732 421230 (8. 3%) 731354 (20. 6%) 161149 10 7% 0. 4b (0. 28 to 0 A2) 1! B(0 75 to 1 80 Pe-p 05 , ITGAB nGV25944801 CARE FMI/312INFMI CAeaner WM 11. 24 0 0008 1D 710a. 0Dt 1 1971865 1B11) 24M76 331BW 010 0 6 2. 49 1 40 ta 4 03 P « 005 KIAA0329 hCV25751017 CARE F MIISDINF Mi All Possible WM 6. 88 00002 662 0. 0101 11311102 (10. 3%) 133l82 21. 0°la O0 (0. 0%) 2. 32 1. 18 to 4 28 P<=0 05 KtAAO32A hCV25751017 CARE Pros ve FMIISDlNFMtull Geaner WM 8. 8 0. 0099 6. 42 00113 113/687 16. 4%) 13/40 32 5%) 010 (0. 0%) 2445 1 19 to 4 80 P<=0 05 KLK14 hCV16044337 ARE Pf0s ECtIVe F MUSDINF MI AII POSsI61e WM 12. 02 0. 0025 11. 5 0003Z 50/B60 (BS%) 57/S11f11. 2%) 23M15f200% 2. 55 (1. 46 t0 . 34 1. 28 0. 88101. 92) <cp 005 KLK14 hCV18044337 CARE Pros ectfve F MI/SDMF MI Cleaner WM 10. 52 0. 0052 10. 11 0. 0064 SU1342 (14. 6%) 57323 (17. 6°/a 23f16 30. 3%) 2. 53 (1. 41 to 4. 47) 125 (0 63 to 1. 90) P<=0. 05 KLK14 hCV1B04433> CP, RE CaselCoMroi F MI1SDINF MI AlI Pass161a WM 13 O. OD15 18. 35 O. C011 SO/Sde 9. 1%) 57/502 11. 496 23H113 (20. 4° 2 79 (1. 67 to 4 94) 1. 2A (0. 85 to 198 P<=0 005 KLK14 hCV160440337 CARE CaselCortlroi F MI/SDMF MI Cleaner VYM 1207 0. 0024 17. 46 0. 0016 501339 14. 7° ! e ST1318 17. 9% 23fT5 30. 7% 2. 88 l. 5Bto 5. 26 1. 3A D 85 to 2. 01 P<=D. D05 KLKBI tkCV22272267 CARE Pmspecdvo F MI/SDINF Mi All Possible WM I EL55 0. 0379- 6. 44 0. 0398 27t311 8. 7%) 611592 (10. 3%) 43J288 44, 8 1, 86 1, 11 to 8. 11 1. 21 D, 76 to 1. 97 pus-9 05 1 1 hCV22272287 CARE Case/CardFd F MIISD/NF Mi All Possible WM 7. 61 00223 10. 02 0. 04 271308 8. 895 811678 tO. B% 431283 15. 2° 1. A4 1. 15 to 3 28) l. ig. 73toid'3 ! 05 nKSi hCV22272287 CARE Case/Contid F MIISDINF Mi Cleaner wm 8. 3 0. 0426 1073 0. 0288 27H197 3. 7° ! a 8i134A 17, 596 43l18 22. 99'0 1. 97 (1. 13 to3. 40) i. o'c°a. 7 in3. 2 : : =' i<=00. 5 LAPTM5 hCV25632652 CARE Pros us F MIISD1NF MI M Posslble WM 7. 22 0. 0271 7. 11 0. 0288 8 ? J894 8. 996 581418 14. 196 7184 10. 8% 1. 25 (0. 50 to 2. 6A 1. 6B 1. 15IG2. 4511 . C=0. 05 LAPTMS hCV2$032652 CARE CosWConW F MI/SDINF Mi All Possible WM T. 4 00247 11. 11 0. 0254 621681 (9. 1%) 59409 (14. 49' 7764 (10. 9% 1. 28 0 55 to 3 01) 1. 71 (1. 18 to 2. 53) P<=0. 05 LRP2 hCV181B59BB CARE ProspacHve F MI/SDIIFMI Geaner WM 837 0. 0414 52 0. 0743 921431 (A. 0%) 471285 17. 795 ? JA7 4 396 0. 19 (0. 03to063) 0. 92 (0. 61to1M) P<=005 LRP2 hCV16185998 W CaselContml FMU5D1NFM1 All Poasi6le WM 7_7 0. 0213 9. 65 0. 0468 1211469 25. 8° 841283 22. B 25/63 (3_796 195 1_12tu8. 3) 0. 8 (0. 61 to 1-24) P<=005 LRP2 hCV18185998 CARE Case/Coniml F MUSDI (M CGeaner WM 8. 12 0 047 7. 77 0. 1003 821427 (8 2%) 471260 18. 1) 2/47 4. 3%) 0. 19 0 04 to 0. 81) 0 8 (0. 83 to 1444 P=D 05 LRP2 hCV161659AS W CaseICordrol F MI/SDINF M Cleaner WM a. S2 O. OOB6 11. 4 0. 0224 121/428 28. 4% 641241 (26 6 25l64 (46396 2 35 13D to 4. 22) 0. 95 (0. 66 to 136) P<=0 S LTA hCV7514870 CARE Pros ective F AdiISDNF MI All Possible WM 8. 37 0. 0415 627 0. 0434 451532 8. 5% 68f53B 12. 9 % 1TH 24 13. 1° 1. 72 (093 to 3 07) 1. 60 (1. 08 to 2 3 LTA hCV7514B70 CARE Prospeclve F MII5DNF MI Gleaner WM . 34 0. 0255 7 24 0. 028B 45Yi34 13. 5%) 68f330 209% 17178 21. 8% 1. 7A 0 9A to 3. 2A 1. 70 (1. 13 to 2 57) Pc=O 05 TABLE 14, page 3 of 7 Plabo Patia StaUsticalfy Stgnlficant AssocIaUons Betwean SNP Genotypes awed Two CVD Case UetInIllons : Fatat M ! f Sudden Death i Overatl'Chi- Detinite Non-fatal MI and Fatal f Nonfatal MI Square Test SNP Effect nllotal ° Odds Ratt 95% CI control Gros 2 re Alleles vs. 0 1 Rare AIlela vs 0 S (mficance 6liC Matker Stud Stud esl n Case Daftnltion DefinHion"'Stratum Statistic-vafue Statis8c-vafue 0 Rare Allelss 1 Rars Altsla 2 Rars AIIeSes Rare Alieles Rere Alleles Levet LTA hCV75148T0 CARE CaselComrol F MuSDINF MI All Possibie WM 711 0. 028B 1418 00068 d51521 8 6%) 691527 1311%)177122 13 99% 1 87 102 to 3 45 1. 82 1. 08 to24242 P<=0 05 LTA hCV1514870 CARE CaselContml F MlISD/NF MI Cieaner WM 6. 17 00458 12T 0 0129 45/329 19 7%) 69328(21. %%) 176 224% 1 10 0 88 to 3 fi4 1 58 104 to 2 42 P<=0 05 MARK3 hCV25926771 CARE Prospective F MUS/NF MI All Possible WM 3. 98 00411 393 0 0473 381453 8 6%) 8 ?713 12 3%) 010 (00%) 149 (1. 01 to 2 24) P<=0 OS MARK3r hCV25928T7t CARE Pmspective FMUS (NFMI Ceaner WM 393 a. 0474 389 0. 0485 39i279 140u BB14b8 59. T%) 010 00°/a 161 1. O11o2. 30 P<np05 MC1 R hCV11851085 CARE Prospective F MUSDINF MI Cleaner WM 6. 79 0. 0092 8 29 0. 0121 124/855 18 9%) 7/80 (7. 8%) 0J (0. 0%) 0 30 (0. 15 to 0. 75) P<=0 OS MMP7 hCV3210838 CARE Pros ve F MIISOfNF MI All Possi6le WM 8. 2 O. O1HB 66 0. 0358 93l739 92. 8% 371398 A. 3°/a 1158 1. 7% 012 0. 01 to 0. 58 0 T1 0. 47 to 1 O6 P=0 05 MMP7 hCV3210838 CARE FMUSDINFMI CAeat) er WM 701 0. 0301 5. 53 0. 0599 93/472 (8. 7%) 37/239 (5. 5% if33 3. 096 013 O. D1to080 015 049to1. 12 P<=005 MMP7 tZV3210838 CARE CaselContml F MIISlNF MI AlI Possible WM 74 0. 0248 1052 00325 931729 12. 9% 1--T7/389. 81. 1 P<- (l 06 MMP7 hCV3210838 CARE Case/Control F MUSD/NF MI Geaner WM T. 86 0. 021T 10 48 0 0328 931467 18. 8%) 37/238 (157% 1133 3. A % 0. 12 0. 02 to e8 0. 72 0 47 to 1 it P<< 05 MMPB hCV114B4594 CARE Pros ective F MIISD/NF MI Cleaner WM 6. 33 0. 0422 6. 2 0. 045 251206 12. ! % 7 ? J35 (20 436 341178 18. 096 1. 70 0 9T to 3 00 1. 86 1. 15 to 9 08 P<=D. 05 MTR ACV16172188 CARE Pmspectlve FMUSDIP1FMI AIIPossible WM 4_82 00282 4. 83 0. 0314 118H131 10. 4°/ 12lB2 19. 496 Ol0 0. 096 208 102to386 P0. 06 MTR hCV18172188 CARE ProspecUve FMIISDINFMI Cleaner WM 417 0. 0413 4. 01 0. 04I1 111702 168Y%) 12 41 (28. 3) 0/0 D. 0%) 2 05 (088to 4 04) P005 NDUFS2 hCV25853285 CARE Pros ve F MIISINF MI All PossIble WM 4. 66 0. 0311 9 68 O. D48T 121188 10. 8%) 3f9 (33. 3%) 0l0 (0050 4. 13 (088 fi 15 8B P0. 05 NDUFS2 hCV25B53285 CARE CaseIControl F MIISDINF MI Afl Possi6le WM 6. 66 0. 0099 538 0. 0204 128H184 11. 0%) 3fA 333. 3%) b 01a(0. 0%) 5 40 1 30 to 22 49 P=0OS MDUFS2 hCV2Se53285 CARE CaseIControl F MIlSDlNF MI Cleaner WM 5 OB 0 024 411 U. 0426 128/T2B tT 8' f8 50. 0lo OI0 D. 0°k 5 41 (108 ta 27. 88 P0 05 MOS2A hCV1 te89267RE Pros ve F MIISDINF MI All Possi6le WM 8 53 0 0393 629 0043 771785 9. 896 511964 14. 0°/ ? l45 4. 4% 0. 43 (0. 07 to 1. 43) 1. 50 (1. 02 to 218 P<0 05 NOS2A hCV518B9257 CARE Pros va F MIf5INF MI Cleaner WM 693 0. 0313 6. 64 0. 0361 77l488 15. 8yo 51t228 (22 A96 ?2J29 B. 9% 0 3B U. OB to 1. 35 1. 53 1. 03 to 2. 27) P-0 0S NOS2A hCV11889257 CARE Case/Conrd F MIISDINF MIANI Possible WM 7. 19 00274 10. 14 O. Q381 77 ? 74 9. 8% 511355 14. 496 2143 4 7% 0. 41 (0. to to 1. 75 1. 55 1. 05 to 2 28 P<=0 05 NOS ? A hCV118SB257 CARE CaseJControl F MIISDINF MI Geaner WM 6. 82 0. 0331 9. 62 D. 0474 771482 1B 0%' 511223 (22. 696 212 (6. 890 0 3 (0. 08 to 1. 53 1. 51 (1. 00 to 2. 29) c=0. 05 NPCi hCV25472873 CARE Pros eclive F MIISDMF MI AI ! Possi6le WM 7. 63 0. 022 7. 4T D. a23A 37I436 8 6%) 51576 1. 8% 28H773 8 2% 2. 08 1. 22 io 3 52 t. 37 0 90 to 2. i2 P<=0. 05 NPGI hCVFfi472fi73 CARE Pt05 CIiVe F MUSdiNF MI C1eanet WM 13. in 0. 0014 12. 68 O. D018 371282 (13. 1°/a 85138D 78. 1% 289S (29. 5°) 2. 77 1. 57 tu 4. 84 t. 46 0. 95 to 2. 28 P<=0. 005 NPC1 hCV25472673 CARE CaselContml F MIISDINF MI All PossiWe WM 0. 45 0. 0397 11. 66'0. 02 37142$ 8. 8% B515BT 11. 5% 281167 16. 8% 2. 02 (1. 17 to 3. 48 1. 29 0 B4 t01. 98 P<=0. 05 NPC1 hCV25472873 CARE CasdCoNrol F MUSD1NF MI Cleaner WM t0. 6B 0. 004B 16. 12 0 0029 371278 15. 9% 651958 18. 3% 28193 9D. 1%) 2 8D (145 l0 4. 89)1 32 (0. 84 to 2. 0511 P<=0. 005 PDGFRA hCV22271841 CARE Pmspecdve F MUSNNF MI All PossIBle WM 15. 64 0. 0004 11. 07 0. 004 100/944 1D. 8°/ 261231 11. 3% 5110 50. 0°Jo 8 44 2. 31 to 30. 83 1. 07 0 87 o 1 67 P<-0. 005 POGFRA hCV22271841 CARE Pospeclve F MIISDINF Mt Geaner WM 1396 0. 000 9. 72 0. 0128 100I580 17 2%) 26H152 17. 195 5l7 71. 4°, 61. 9 (2. 55 to 84. 5B 0. A9 0. 61 to 1. 57 P<=0 m5 PD6FRA hCV22271841 CARE CaselControl F MIISDINF Ml PJI Possible WM 13. 1) 0. 0014 13. 83 0. 0075 100/925 (10. 6%) 26I22B 1Y1455 5110 50. 0% 7. 87 2, 13tA 27. 62)t. iT 0. 73to 8 8B P<c0005 PDGFRA hCV22271849 CARE Case/Contmi F MIISDINF MI Cleaner WM 11. 59 0. 003 11. 42 0. 0222 1001573 (17. 6%) SR 171. 4-1. 1 11. OB(2 05 to 59. 73 1. 13 (0 i9 to 1. 84) P<=0 05 PEMT hCV7443082 W Case/Conttol F MUSINF MI All Possible WM 6. 76 0034 1218 0 016 74f235 31. 5°Je 84138 (21. 8%) 441174 (25. 3°k 0. 76 (0. 49 to 1. 19 A B7 0. 42 to 0. 89 Pt=0 05 PLAB hCV7494810 CARE CaseIControl F MIISDMF MI Cleaner WM 7. 12 0. 0284 8. 73 0. 0452 67T1111 16. 3° ! 60t278 (21. A°I 4I46 (87%6 048 0. 17 to 1. 42 1. 51 t. 02 tp 2. 25 Pc=0 05 PNN hCV2082598 CARE Pros ive F MIISDINF MI All Possfble WM 6. 41 0. 0405 5. 35 0. 0691 11DI1043 (10. 5%) 8t111 i2. 8%) 3/1 (37. 5% 5_09 (1. 03 ta 27. 02)1. 24 0. 71 to 2 07 P=0 05 PNN hCV20925B8 CARE Pros Ive F MI/SDINF Ml Cleaner WM 10. 31 00068 648 00302 110/665 (16. 8%) 18183 (217%) 314 (76. 0% 0 4. 84 t. 881a 30188 1 37 0 7B to 2 38 P=0 05 PNN hCV20825H8 CPRE Case/Control FMIISDfNF MI Ali P0. 5sible WM 628 0. 0433 CM 0. 058A 11011023 10 8 18113A 129°. 6 9/8 37. 545 616 1 17 to 22 B6 1. 30 0. 75 to 2. 24 P « OS hCV15954277 CARE ProspacHve MIJSDINF Mi I AJI Possible WM 6. 97 0 03DO 0. 29 0043 a3t657 12 0%) PRKC hCV15954277 CARE Pros've F MIISDlNF MI All Passible WM 6. 97 00308 6. 29 00043 89f65T 12 &Yo A51445 1Qi 6 9/85 S 59b 0 25 (06 toO. TO 0. 7 0. 53 to 1 14 P=0 05 PRKC hGV15B54277 CHRE C85E/GOFItf0l F MIISINF MI All PossiWe WM fi. 96 O 030H 10. 69 0 0302 831845 129%) 45143 (10 935 9183 3. 896 0 2 (0 07 to 0 80 0 79 Q 53 to 1. 17 P<=0 05 PUR CL hCV15954277 W Case/CoMrol F MIISDfNF MI All Passi6la WM 6 73 0 0345 10 87 0. 027 13 ? J442 2. %) 66135 (20. 8% 12153 22 6% 0 74 0 37 to 1. 4B 6B (0 45 to 0 90 P<c0 05 , PRKC hCV1585427T W CaseJCoMroI F MIISDINF MI Cleaner WM 687 00323 1103 00259 132/391 (33. 8%) 66/280 (236%) 12M7 {2S. S%) 074 (037 tot 49) 0. 63 (044 to 069) P<) 05 SERPINA10 hCV1280411 CARE Cabe/CotrtrW F MUSDINFMI Cleaner WM 797 00185 1107 00258 89f536 16 896 411178 23 095 1121 4. 8°/0 0 28(0 04 to 218 189 1. 10 to 2 BO P=0. 05 'SERPINA10 hCV7586187 CARE Prospective FMUSDINFMMI GBaner WM 744 00242 68 0. 0335 881587 18 0%) 411179 (22 9% ll24 (4. 2°J) 0 23 D0Ot t01 tA 158 102 t0 2 35 P<o0. a5 SERPINAID hCV7588197 CARE CaseIControl FMUSOINF MI Cleaner WM 9. 39 0. 0092 12. 51 0 0138 881532 (16. 2% i1178(23. 3%) 1/23 (4. 3%) 029 (004to 220) 80 1. 18 to 2. 78) <ep, 05 SERPINBB hCV3023238 W CaselConrol F MUSDINF MI AII Paesible WM 7. 05 0. 0294 1394 0. 0075 59/277 (20. 2%) 118/405 (29. 1% 33/131 (27. 5% ; 1. 50 0. 92to 2. 43 1. 63 (1. 13 to 2 38 P=0. 05 SERPIN86 hCV3023238 W CaselCoMro ! FId115DINFM1 deaner WM 7. 62 0. 0221 1535 0. 004 Sf246 22. 895 1181380 32. 896 3B1118 319°h 162 0. 98toU 1. 66 (1. 14102. 42 P<=005 hCV370782 CARE Pfospectlve F MUSDlNF MI Cleaner WM 7. 6 0. 0223 7. 4 0024 451293 75. 4% 73333 (21. 7%h 131112 111. 6°rb 0 72 0 36 to 1. 36) 1. 52 (1. 02) o2. 31) P<=005 TAP1 hCV549026 CARE Proseecove F MUSDINF Mi All Possible WM 8. 24 00183 777 0. 0206 81/629 (9. 8%) 42f329 12. 8°/ 8133 24 2°/) 2 98 1. 21 to 8. 50) 1. 35 0 9 ta 2 D P<=0. 05 TAP1 hCV549928 CARE CasefCantrol F MUSDJNF MI AlI Possl6ls WM 7. 02 00209 1177 0. 0101 811817. 0% 2t3 (24 2ola) 2. 73 (i. 17toO. 39). 30 (O. Sl to 2. 05) 1 PC--O 05 TAP2 hCVt6171128 CARE Prospecitva F MUSDINF MI AH Possl6ls WM 8 82 00121 7. 02 0 0288 1061i001 10. 6 2111B3 tt. 5°k 4) 10 40 0°/ 8 (1. d2 to 20. 02 1. A8 0 861 1. 77 Pe=005 TAP2 hCV16171128 CARE Pros ective F MIISOINF MI Cleaner WM 8. 24 0, 0441 5 22 0. 0735 108f82T 1B. H% 2i11D8 9. 4%) 4lB 50. 0%) 4 92 1. 15 to 21. ) 1. 1 (0 B9lo 1 88 Pce405 TAP2 hCV1B171128 CAI CaseIConUOI FMIISDINFMI AIIPossible WM 10. 07 0. 0085 12. 8 A. OtBB 1081988 10. 7° !21 21N18 f1. 9la-04! 8 4440 7. 80 I. BOto34. 62 125(0. 75to2. 08 P<=00. 5 TAP2 hCV1617112aEARE CasB/Cantm) Mt/SD/NFM) aeaner WM 7. 13 00282 9. 82 D. 035 1081822 17 0% 211105 20. D96 418 50. 090 8 41 1 3210 31 22 1. 29 (076to221) P<=0. 05 THBD hCV2531431 MRE Pmspectiva Mt/SDMFM) MPosstbte WM 7. 8 0. 0202 7. 47 0 0239 79l818 9. 8% 4 ? J325 12. 9% 8141 22 0% 2. 83 i. i5 te 5 51 1 SB 0 93 to 2 P< : o, 05 TABLE 14, page 4 of 7 Placebo Patients itatlsticalty SignIfleant Associations Between SNP Genotypes md Two OVO Case DeOnittons ; Fatal MI I Sudden Oeath I Overalh Chl- ) eflntte Non-fatal Mi and Fatal I Non-fatal MI Sauara Test SNP Effect nttotal Odds Ratio 855% Cl) Cons Grou 2 Rare Alleles vs 0 1 Rare Allele vs 0 SIonHca u611c Mark r S ud St aesl Case Definlllon e8nltion''Strafum Statistfc lue Statt tie valua D Rare Alleles 1 Rare Alle a leles R re Rllele afe Alleles ev HOD hCV2531431 CARE CaselCor4 F MUSDMF MI All Possibla WM 7. 13 0 U283 11. A4 D Ote5 T91809 9. 8 47J314 13. 4% 8l40 22. 5% 2. 77 (1. 21 tD 8 3B 1. 34 0 89 to 2 02 P<=0 05 me) hCV25B15380 CARE Pros ve F MIISOINF MI AII Possible WM 5. 91 O. C169 4. 74 0. 0284 12811187 10 8% 318 87. 5o OIO 0. 0°Ja 4 97 1. 01 to 20. 47) P<=0. 05 1R3 hCV25615SBO CARE Prospective F MVSDINF Mi Cleaner WM 6. 24 0. 0125 4. 6 0. 032 12t73D (17. 3 3 ! 5 60. 0°/ OJO 0. 0% 718 1. 18 to 54. 77 PD 05 'LRB hCV25015380 CARE Case/Control F MIISDINF MI WI Posslble WM-4. 88 0. 0272 4. 1 0049 129/116Sf110%) 3/8 (37. 5%) 0<0 (00%) 4. 51 (105 to 19 36 P<=005 TN V2536595 CARE Prospectlve F MUSDINF MI AlI Possible WM aas 0. 0121 8. 57 0. 013B 26/361 (6. û%) 741557 (131%) 32J268 (11. 9% 1. 82 (1. 06 to 3. 181 2 02 (1. 27 to 3 30) P<=D 06 rfN hCV2538595 CARE Pros ectlve F MIISMF MI Cleaner WM 7. 52 0. 0233 7. 35 0. 0254 251213 11. 7% 74l357 20 7% 37J175'18. 3% 1. 88 O. A8lo 2 1. 9T 1 22 to 326 P0 05 TN hCV253B595 CARE Case/Contml F MI/SDMF MI AlI Possible WM 9. 52 0 0088 18. 58 0. 001 251352 _i° ! o TM559 13 2° 32/283 12 2°h 1. 83 1. D3 to 3 25 2 iB 1. 51 to 3. 54 P0 D5 TN hCV2533565 CARE CaselContral F MI/SD/NF Ml Cleaner WM 7 01 0. 0301 13. 75 0 0081 251210 119% T41352 21. 0% 321i14 18. 4°. 6 . 61 U 89 to 2. 81 1 8B 1. 19 to 3 33 Pa0 D5 vBCA1 hCV2741083 CARE Pros ective F&NF MI All Possibte WM 9. t4 0. 0081 9. 26 0 Oo97 137t827 14 8 18t253 7. Sh 1H4. 96 0. 44 0 02 to 226 0. 47 (0. 23 to 0. 75) Pe=D. os INCA1 hCV2741083 CARE Pros ectlva FBNF MI Cleaner WM 10. 64 0. 0049 10. 18 0. 0062 137/599 (22 9%) 19t167 (114%'tß (200%) 0 84 (0. 04 to573) 0. 43 (O 25 to 0. 71) P<=ü 005 BCA1 hCV2741083 CARECase/Contro) F&MFM)'"AfiPossiNe. WM 100)'BToBT'136S O-OOM 137f91S (iaO%) 16/242 (7. 9%) IM3f7. 7%) 043 (O. OSto33S) 0. 4S (0. 2B (o0. 7E) P<==ODS v8CA1 hC1/2T4193 CARE CaselCOrttrol F&NFMI Cleanar _ _ O _ O 1 t5 5 (23 « 60 (ttD% t5 (20jOW 9. 10t 3 043 (0. 24toO7) pZ 005 IOAMt2 hCV25928818 CARE Proe ve FBNF MI AII Possibie WM 6. 32 00424 6. 21 0. 0449 681482 (14. 1%) 201102 (19. 6% 196 (1. 10 tA 3 36 1. 32 0 82 ta 1. 8D P=o OS TRAM12 hCV25926933 CARE Pros ive F&NFMI AIIPossible WM 653 003B3 641 0. 0405 6M578 11. 1°k 701487 74. 4°/a 201102 196°/a 1. 98 t. t0to33B 135 094ta194 P<=OD5 d) AM12 hCV25926933 CARE Cass/Control F&NF MI Ali PossnAel WM 612 0. 0460 1223 0. 0167"EQ3 (114%) 70T481 (14 6%) 201100 (20. 0%). 194 109to3461 1138 (0. 95 to 199) P<=0. 05 SOB hCV3216558 CARE Prospactive F&NF MI All Posstble WM 6. 09 0 0477 5 98 0 0504 111JT32 15 296 4314D2 10196 4153 7 5% 0 48 0. 14 l01 15 0 87 0 46 to 0 87 P<=D. OS POB) hCV3216558 CARE SasB/Contm)'&NFMt MPosstNt WM 723 OOzea 1204 00171 11V721 (1S. 4%) 43/389 (111%) 4/53 (75%) 043 ; 015to1ZZ) 064 (044 (0094) P<=00a kpob hCV3216558 CARE Case/Contnl F&NF MI Geanar W M T 05 0. o2B5 11 71 0. 0198 111f475 23 4% 431252 17. 196 4129 13 8% 0. 48 01B to 144 O. 6U 0 40 to 0 91 P0 05 kpob hCV7615376 CARE Pros ective F&NF MI All Possible WM 6. 04 0. 0439 593 00515 111/732 (15 2%) 43/403 (10. 7%) 4152 (7. 7%) 0 47 (0. 14 to 1. 17 10 67 (D 46 to 0. 97) P-0. 05 kpob hCV7616376 CARE Case/Control FBNF MI All Possible WM 721 0. 0272 11. 69 0. 0174 111/721 (15. 4Y1 43350 11. 0°/ 4/52 7. 7° A 43 0. 15 to 1 23 O. B4 0 43 to 0 94 P0 05 kpob hCV7815376 CARE Case/Control FBNF MI Geaner WM 7. 02 0 02A9 11. 63 0 0203 1111475 23 4°k 4I253 17. 0% 4128 14. 396 0, 49 (0. 16to1. 49))). 60 (0. 40to0. a0) P<=009 iSAHt hCV2442143 CARE Pros ctive FBNF MI All Possible WM 8. 6B 0 0138 8 37 0 0152 541320 16. 95'0 791588 19 436 25128d B 8°/a 0 48 0 28 to 0 78 0. 78 0. 53 tn 1 12 P<=0 OS 1SHAH1 hCV2442143 CARE Prospive F&NFMI Cleaner WM 9. 54 0. a085 A. 31 0. 0096 SM207 28. 1°l0 791378 2l. Oa 251185 13. 5% 044 0. 28to074 0. 75 0. lto1. 12 P<=005 iSAH1 hCV2442143 CARE CaseIControt F&NF MI All Possible WM iD. 55 0. 005t 15. 78 0_0093 541314 17. 29t, 79/5T8 13. 7°6 261278 8. 'Yo 0. 43 0 25 to0. 72 0 80 0 55 to 1. 17 P==0. 05 SAH1 hCV2442143 CARE CaselCOntro1 F&NF MI Cieanar WM 11. 9 O Q028 15. i3 0 0044 541208 2B 2k 781988 21. 596 25H83 13 7 0 40 0. 25 Io 0. 0. 87 0. 58 to i. 3f P=a U05 tTF6) hCV25831988 CARE Pros ctlva F&NF MI All PossiWe WM 1D. 47 C M53 902 OOH 137/952 (14. 0%) 1376 (7. 4%) 2/4 (500%) 6. 17<0. 74to51. 73) 0. 49 (0. 26to0. 86) P<=O 05 iTFfi hCV25631989 CARE Prospfve F&NF MI Cleaner WM 10. 92 0. 0043 8. 45 A. 0089 1371630 21. 796 131117 11. 196 ? l3 88. 7'Yo T. 20 0 88 to 155 43 0. 45 0 23 to 0. 80 P<=p 05 tTF6 hCU25881989 CARE CaseICortlrd FBNF MI All Possl6le WM 9. 23 0. 0099 12. 16 0. 0162 l3Ti 14. 295 19f177 T. 8°Ia 214 50. 0% 5. 84 (0. 8Ho42. 04i 051 (028to093) P<=005 IFS hCV25631989 CARE Case/Conbnl F&NFMI aeaner WM 1 10. 79 0. 0045 13. 53 0. 0089 13TIB22 22. 0% 191114 11. 4 2I3 66. 7 % 8. 24 0. 72 to 94. 43 0. 45 (0. 24 to 0. 94 PG0. 05 IAW3 _ hCV2503034 CARE ProspecUva F&NFMI All Possible WM 6. 1 0 0473 5. 1 0 0782 1211856 12. 796 331223 14 8 9II 42, 90 5. 18 101 to 23. 74 1. 20 0. 78 to 1. 80 P0. 05 MAP3 hCV 2503034 CARE Pros ve F&NF MI Geaner WM 7. 83 0. 02 6. 74 0. 0344 1211632 (16. 1%) 331127 (260%) 315 60 0% 8333 104 to 48. 48 1 48(0. 94 to 2 29) pco 05 lCL2A1 hCV25992796 CARE ProspIve F&NF MI Ali Posslbie WM 8. 14 Q0485 6. 03 0, 0482 102/665 (15. 3%) 47/458 (10. 2%) S/67 (134%) 0. 66 (039) 0170) 063 (0. 43to0. e0) P<=005 3CL2A1 hGV760885A CARE Pms ive F&NF MI Ali Possihle WM 7. 14 0. 0281 7. 04 00296 102/M2 (1S. 4%) 4M93 (9. 8%) S/6B « 3. 6%) 0. 87 (0. 39 to 1. 72) 0. 61 (0. 42 to 0 87) PftD. DS I 3CL2A1 hCV7508350 CARE Pros iva F&NF MI Geanar WM 6. 17 0. 045B 6. 1 0. 47fi 10 ? J434 28. 5°/0 481289 15. 9°Jo g148 19. 8% 0. 79 (0. 35to1. 63' 0. 62 (0. 42 to 0 90 PU D5 3CL2At hCV7509654 CARE Prospedhe F&NF Mi Ail Possible WM 687 COS22 879 00338 lOi/645 15. 7%) 4B/465 (10. 3P/ol 9f7i (12. 7110) 0. 76 (0. 3510155) 0 62 (0 42 to 0. 08) P-0 03 IHMT tvCV1184880t) CARE Case/Control F&NFMI Cleaner WM 6. 43 0. 0402 8. 37 00789 77l390 18. 596 141284 25. 296 12 ? S 16. 096 A. 88 0. 44to1. 71 158 I. OBto228 PDDS Aspi hCV16276495 CARE PmBi3edya-F&NFMI All PaGslble WM 11. 61 00007 11. 32 0. 0008 1121981 (117%) 46=8 (20 2%) 010 (00%) 1'a 2. 71) pe=o 005 : ASP1 hCV18278485 CARE Pros ectlve FBNF MI Cleaner WM 9. 79 0. 0018 9. 59 0. 002 112/812 (8. 3%) 461155 (2B 7%) 010 (0. 096 t. e (1. 25 to 2 80} pe=O 005 : ASP1 hCV18278495 CARE CaselCOmrol F&NF MI All Possible WM 8. 04 0. 0048 7 81 O. OD48 1121045 11. 9'Y 481221 20 896 Of0 0 0°. 6 1. 76 (1. 19 to 2 61) Pe-C 005 ASP1 hCV1627B495 CARE CaselConlml F&NFMI Cleaner WM 7. 41 00085 729 0. Host 112/BOB 185% 48H51 30596 0I0 00 1. T8 l. lTto2. 72 P<=O. DS : CKBR hCV8604851 CARE PmspIve F&NF Mi All PossiWe WM 8 95 0. 0114 7. 15 0 028 143i1A58 15. 5% 12f190 9. 2% 9l8 50 090 8. 40 (1. 17 to 34 D6} 0 65 (033 to t. 16) P<4 ûS CKBR hCV9604851 CARE Pros ive FSNF MI Cleaner WM 8. 69 0. 0129 5. 9 00523 143/6M (2a. B%) 12/79 (152%) 3/4 (75. 0%) 1. 43 (1. 45to 23199 0. 68 (O 34 to 125) pe=O 05 CKBR hCV9B04851 CARE CaselControl F&NF MI AU Possible WM 177 0 028 10. 81 0. 0314 143l1037 15. 89'a 171127 9496 SIB 50 0% 5 25 103 to ZB 81 0 BO 0 32 to 1 12 P<=0 O5 hCV3268420 IBFSNFMI Al Po3alble WM 864 00188 5. 58 O. A8lb 145HD78 13. 4° 11H12 9896 ? J3 887% 288 1. 23to27804 070 035to128 P=005 : CL22 hCU3268420 CARE CasalControl F&NFMI All Paesible WM 8. 57 0. 013B 8 B O. a882 tA5/i057 13. 796 11H 10 10. 096 2l3 BB. 7° S 5B 9 21 ta 15236 a. 74 . 38 to 1. 42 P<e0 05 : CRL2 hGV25B37308 CARE Pro9 BCtIYe FBNF MI CIC2nEr W M 6 63 0. 038 6 46 0. 0396 55'1263 (20. 5%} ase367 (23 2% 181140 12 8% 0. 58 0 31 Io U, 9B 1. 14 0. 78 to 1. 88 P<=0. 05 : D2''hCU2820518 CARE Pros edlrre FBNF MI All Possl6le WM 6. 04 00467 592 0. 0546 14410t8 (14. 1%) 13/172 (7. 6%) t/4 25. 096 2 02 0. 10 to 15 A2 0. 50 0-28 W 0 87 P<0 05 : D6 hCV255303p W CaselCordrol FBNF MI AII Possible WM 7. 21 0. 0272 5 82 0. 0435 148Ib79 30. 996 B71288 23. 3°/0 17143 39. 5° 1. 43 (0. 74 to 2. 75 0 68 O. AB to 0 95 Pc=0. 05 : DB hCV2553030 W Csse/Conlro F&NF Ml Clean3r WM 7. 94 0. 0189 105T 0. 0318 148/433 342% 87l283 25. 5°/0 17/41 41, 5°/a 1. 35 O. TOlo262 0. 85 0. 48to0. B1 P<=005 : DBB hCV22271672 CARE Case/Control F&NF MI All Posside WM 6. 69 0. 0353 5. 04 0 0601 t44/996 (14. 5%) 11M51 (7. 3%) 1/8 (12 5% j O BO {O 11 lo7. 421 0 42 (O 22to 0 B3) pe=O 06 TABLE 14, page 5 of 7 Placebo Patients Statlstically SlgnilicantAssoeIatfons Between SNP Genotypes and Two CVD Case Deflnitions : Fatal Mt I Sudden Death f Ovarall Ch- Odds Ratio 95°/CI Conte) GAP Gyro' CD66 hCV22271672 CARE Casa/CatttM SNFM) Oeaner WM 967 OC358 927 OOM6 14</M6 (2M%) 11/95 (6 </Bn6. 7%) 075 (009 to 6 62) 04KO. Z1taO. B2) P<=005 86 hCV222T1672 CARE CaseICantrvl F&NFMl Cleaner W M 8 670013258 9 27 fl U54B i41848 22%) 62 11195 118° 118 18, 7°/a 0 75 0 08 to 6 62 0 41 0. 21 to 0. 32 P<=0 D5 L hCV2603B81 CARE Pros va F&NF MI Cleaner WM 884 0. 0132 8. A7 0. 0149 9403 2 (24. 7%) J305 (179°. 6 7180 11. 7%) 042 (017 to . 8 O. B4 0 44 to . 83 P<=D OS COLOA2 MV2811372 I m 759 0-02251 7. 44 0. 0242 471278 (16. 9%) 841822 (13. 5%) 27J295 (L2 A 0 50 (0. 30 to 0 81) 0 77 (0. 52 to 1. 14) P<=0. 05 COLSA2 hCV28S1872 CAA£ Ftos edtve FSNF M ! AIl Passlha WM T 59 0_0225 7. 44 0. 0242 47l278 18. 8°/a 841822 13. 50 271295 A. 2°/ O 50 0. 30 to 0 81 0 77 O. b2 to 1. 14 P<=0. 05 C : OL8A2 hCV2811372 CARE POS eCliv6 8NFM1 Cleaner WM T. Q1 0. 0301 H. 89 O. OS19 47I18A 25. 596 8414D1 20. % 27H8B 4. 59) 0. 49 02910Q83 0, 77 051t01. 17 P<=DOS Cl2811372 CARE PtOSpBptiva =SNFM) Oeaner WM T. Dl j 20. 4 _L_ CRt hCV25598594 CARE Pros ecliYe F&NF M1 Cieaner WM 6. 7T 0. 0348 4. 25 0. 0392 147IT40 (9. 8%) 11131 35. 5% A O 0. 0% 222 1. 01 4. 85 P « 05 CTSB hCV8339781 CARE Pros 0dive FBNF MI AII Possi6le WM 8. 14 0. 0485 5. 81 O. U604 11317HH 72. 7Yo 381281 l3. Slo 7123 30. 4% 8. 00 1. 13 to 7. 20 1. T Q. 72 tu 158 P « 0S C1'5B hCV83397At CARE CaSeICO h l F&NFMI AfIPOSSIG1A WM 7. 14 0. 0282 1008 0. 0382 1131870 18. 096 38f275 13. 8° ! 0 7123 30. 4% 3 35 1. 31 t08. 58 1. 19 075101 fi9 P « 05 "13 a"5'0'6" CX3CR1 hCV79UD50S CARE Case/Control NFM)"'AifPossma WM 10. 67 0 U48 1. 42 0. 055 811393 23. 2% 501920 15. 695 17i53 32. 15L 1. 67 0 82 to 2. 88 0. 61 ( 42 to 0. 80 P « 05 0"0'4"0 0"'6 ELN hCV125383D CARE Pros ectlve F&NF MI All PossiWe WM 7. 22 0 D271 7 03 0. 0298 84/d08 15. 8°Jo 551579 13. 09'0 16l2A1 S Yc 0 4 0 2510 0 80 0 8D 0. 65 lo d.114 P « O6 -61 4) 42 1. 0 on ELN hCVi253630 CARE C85elControl F&NF MI Aii Po5aier WM B 48 0 0088 15. 4 O. ODS9 641993 i6 2%) 751571 13. 1°k 161107 8. 1% 0 41 d 23 to U 18 D 77 0 53 to i. t P=« a5 ELN hCV5253B30 GARE Case/CoMsot FSNF M ! Cleacer WM T 07 0 0281 12 37 0. 0148984/283 24 3% 7 l389 2D. 396 1 BJi 21 1 S 2% 0 44 0. 24 to 0 82 0 78 0 53 to 1 18 P<=0 O5 5 tu 1-14 0, 3, O. S. GAP hCV8921288 CARE PraspectNe F&NF MI. Cleaner WM 5. 62 00176 5. S9 001M 5)/19S (262%) 105/579 (183% O/OtOPTt.) 063 (043to063) P<=O. OS '10 1_18 (). ao or HLA-17PB1 hCV1191889d CARE Pros e tive F&NF MI Afl Possihie WM 8. 22 D. 0164 8. 7 0 0171 1101932 11. 8 461245 18 8° 2 18 12. 596 1 07 017 to 3 89 1. 73 1 18 to 2 51 P<=0. 05 Tu 1. 12 Pp 77 HLADPB1 hCV25851i74 CARE CaselContrW F&NF MI Cleaner WM 8. 54 O Q378 8 38 O 7B7 89107 21. 9°/ 891308 22 4% 8168 8. 8 0. 9 014 t (o. 83 t. D3 0. 71 to t. 5o P<=o 05 No MOX 1CV15S69716 MRE ='rospect) ve'&NFM) COanBr WM 464 00312 4. 47 0. 0346 149/666 (216%) 10/66 (116%) 0/0 (0. 0%) 049 (023 to i. 70 P<=005 iMOX1 hCV15889T 8 CARE Pros ecdve F&NFMI Cleaner WM 484 00 12 4. 4 0. 0346 1. 1886 2189 1Dl8 41896 0/0 . A96 AAB 029to0. 81 P<=005 i5PG2 hCV1603658 W C858/COnkol F&NF MI All PoSSfWe WM 10 28 O. A058 9. 7 0. 0458 181l885 21. 7%) 3N33 24. B / 8l7 85. 7% 3. 24 1. 58 (0. 1. 11 85 D 55 tU 181 P<=0. 05 iSPG2 hGV16036 6 W CaselCorthnl F&NFMI Cleaner WM 902 0. 011 8. 98 0. 0813 f911e (i6 37. 5°/233111 27. 7°k 8I7 85. 7%) 11. 85 1. 4 to 8. 39 086 055ta1 3 P<=005 GSA hV""'CARF-Proseective F&NF III Cleaner wm 15. 82-"0 0179-YS6--UO183 511195126 2-/.) 1051576 (18 W. ;, OID 10 O'bi--0 63 43 to 0 03) P<=0. 05 CAM1 hCV8728331 CPRE Pro5 ectfve FBNF MI A ! 1 Possible WM 7. 01 0. 0978 t8 0 0458 1971941 92. 496 341238 1 (4°/, Siid 35. 7Ya 3. 91 1. 19 to 71. 53 1. 18 0 T8 to 1. 77 P<=0 OS L1A hGV8546471 W CaselControl F&NF MI NI Possibla WM 9. 27 0. 0A7 15. 82 0. 0033 134J4 ( 3359b 861351 24, 59n 11161 18 %) 0. 4 (0 23 tu 0. 82 0. 78 0. 48 to D 8) P<=0 05 m 2JI 1 18. 2% L18 hCV8548617 W CasdControl F&NF MI Cleaner WM 8. 85 0. 0328 12. 03 0 172 119l158 34. 9% 841241 2639"a B144 20 5% 0. 49 0. 23to 1 05 0. 88 0, 49 So 0 98 P<=0 05 L4R hCV2769554 CARE Pro 1V9 F&NF MI All POSSIbIA WM 1, 2 O. Q273 6 9B 0 03DS 5 137 314. 36 831584 1 , 7°/a 211257 8 2% 0. 53 0 3f t0 0 90 104 0. 72 l0 1. 5) P<=0. 05 M L4R hCV258H554 CARE CaselCaMrd F6NF MI Cleaner WM 6. 48 00325 7. 08 0. 1318 531240 22, tYo 83f383 22. 896 2t1154 186 . 68 0. 3210 0 8B 1 11 014 to 1 88 P<=005 Wu WM 6168 8. 8% TPR3 hCV1928859 CARE Pros ve F&NF ? N Cleaner WM 1. 18 0. 0278 T. 04 0 0285 I274 19. 29b 83137 (2209'o A8H89 2 , 3% 1. A4 1. 17 to 3. 28 1. 50) P<=O 05 1PR3 hCV1B23359 CARE CaselContmt F&NF MI All Passibie WM 8. 8 O. a114 18. 8A 0. 0008 28/327 8. 9°/0 831568014. 7% 4BI271 16 B% 211 1. 27 t0 . 49 1. 71 1. 09 to 2. 8) P<=0 05 < ! AA [) 3S9 t) CV2S7S1Q17 CARE roepeetiva =&MFM MtPas't ! h) 6 WM 7. 15 00075 6. 92 0. 009 197/1102 (12. 4%) 15/62 (24. 2%) 0/0 (00%) 9SS (1. 1Bb404) P<=005 CU440328 hCV25751017 CAR6 Pros ve F&NFMI AIIPassl6le WM 7. 5 0OD75. 82 0. 009 1'7f1102 t2. 4% 15182 ? A. 2°l OJD U046 225 l, lAto404 Ps05 fIAA0328 hCV15757017 CARE Pros cGve FBNF MI Cleanar WM 8 68 0 0089 B 3 0 011A l37FI11 19. 896 1 142 7^k 10 0. ° 12 3 t, SB to 4. 44 P<=0 0S CLK14 hCV1644937 CARE Pros ctlva F&NFMI AIIPosslble WM 13. 25 0. 0013 127 O. D017 61If580 10. 996 68f571 133% 27/115 23. 5% 251 150to4. t3 128 0, 871n1. 82 P<«, O05 CLK14 hCV16044337 CARE Pro9 ectlve FBNF MI Cteaner WM 70. 82 0 0043 10 52 0. 0052 611353 1T. 896 68/934 20. 43 2718A 33 B°, 6 2. 4d 1. 41 to 491) 1. 30 (0. 89 to 1. 8) P<=0. 005 fLKl4 hCV16044337 CAftE CasefControt FBNF Mi AfI PosstWe WM i5. 27 00005 21 26 0 00a3 6t1548 tt i 881501 13 896 271113 23 99'0 2. 82 1. 85 to 4 81 1. 30 o. a9 ta t 91 P<=O OOD5 TABLE 14, page 6 of 7 Placebo Patients StatIsOcally Signl (IcantAssociations Between SNP Genotypes and Two CVD Case Deftnfttons : Fatal MI I Sudden Death I Overail'Chi- Centra ! _ _ _ __ CoMro Control EM-UL 2 Rare Allolas v4 ; 0 1 Rare Allele vs. 0 S ; Pnificance KLKt4 hCV1H044397 CARE CaselCantrd FBNF MI Cleaner WM 13. 84 O. OD1 19. 8 OOOB 611348 17. 596 681328 20 796 27i79 34. 2 2. 90 1 83 to 5. 14 1 31 0 BB to 1 BB P<=0. 005 ', LPA hCV11225884 CARE Pros'e F&NF MI CteanMr WM 9. 11 0. 0471 9. 69 0. 05 12B1575 22. 3% 251179 14. U96 3H19 7. 3%) 1. 31 U 28 to 4 fi0 0. 57 0 35 tn 0. 8) P<=0 05 LPA hCV11225994 Ci4RE CaselCaMiol F&NF MI Alleassi6le WM 7. 18 0. 0279 8. 8 0 0478 1281867 14 7 k 251278 B. t°la S 19 t5 B9 1. 01 0. 28 to 3. 82 0. 54 0. 34 to 0 85 P0 05 LPA hCVif225994 CARE Case/Control F&NFMI Cleaner WM 7. 62 0. 02A1 9. 7 O.0D45 1281565 22. 7°%) 2511T8 14. 0° 3N1 27. 3°. b 091 0. 23to3. 63 0. 52 O. S2to085) 0. 05 LRP2 hCVt8165988 W CaseIContro ! F&NF MI All Possf6fer WM 7. 62 0. 02911 9. 74 0. 0234 124148 (28. 4 801258 28, 396 27183 42. Bo 2. 12 1. 23 to S 85 t. 12 0 801o t 57 P<=D 05 LRP2 hCV18185998 W CaselCaol F&NF MI Cleane WM 9. 98 0. 0081 f3. 54 0. 008A 1241428 28. 996 801257 91. 1°. 6 27158 48. 2°/ 2. 4 1. 3510 4 24 1. 15 0 B2 to 1. B2 P=0 05 LRP2 hCV2586831B CARE Pros acfive FBNF MI All Possible WM 7. 52 0. 02331 11. 3 0. 0234 1241469 (26. 4%) BOMS (28,) 127/83 142. 9%) 2. 12 (0 80 to 157) P<--D 05 LRP2 hCV25648318 CARE CaseICamroi F&NF Mt AlI Possihle WM 13, 74 0. 001 15. 94 0. 0037 12BN015 12 8% a 281145 ZO, a°Ia S ! 2 SO. Oo 8 28 D 89 to 338 83 1. 90 1. 19 to 3 01 fxro 05 , LRPZ hCV25B483iB CARE CaseICantroi FBNFMI Cleaner WM 7. 78 0. 0207 10. 88 0. 03D4 1281649 19. 796 29l105 27. 836 il2 50. 0°/ 1. 23 064to19802 163 1. 00to2. B5 P<=0OS LRP2 hCV16165995 Cleanner wm 9. 39 O. OD91 13. 64 0. 0089 1241420 (28. 9%) 8Ot257 (31. 1% 1 27156 B. (1.. 5. 4 1. 15 82tol. 62) FC=D 05 : MARK3 hC 25A2B771 CAf Pms ve FBNF MI AII PassiWe WM 4. 41 0. 0358 4. 37 0. a3fi7 481459 10, 6la 108f113 14. 8% OlU . U% 1. 47 103 to 2. 13 Pt=0 aS MARK3 hCV25928771 CARE Pras ve F&NFMI Geaner WM 4. t7 0. 0113 4. 13 0. 0421 481288 18_2°k 1A8/484 228°, 6 0I0 00°b 1. A8 f. 0 to217 P<=005 MC1R hCV11851085 CARE Pros active F&NF MI Gleaner WM 8. 02 0. 141 5. T3 O. OtBT 147I67S 27. 795 1UJ93 70. 89n Of 0. 0 0. 44 0. 21 to 0 82 Pt=0 05 MMPS hCV11482579 CRRE CaseJCoMroI F&NF MI Cleaner WM &47 0. 09A4 8. 87 0. 1543 190/82S 2D 9°/a 2BH34 18. 4% ? J3 80. 75'0 1. BB 1. 05 l0134. 77 0 93 0. 58 to 50 P=0 05 NOS2A hCV11889F57 CARE Pf eCtHe F&NF MI A11 Po551618 WM 8.7 0. 0308 8. 92 0. A331 93l185 11. 8% 81t384 75. 89 3145 8. 7% 0 53 013 to 1 50 1. 50 1. 05 to 2. 12 P<=0 05 13. 74 NOS7l1 hCV1188825T CARE CeeAlCOIdroI FBNF MI NI Possanlr WM 7. OB o 0294 10. 08 0. 0999 93f778 12 0% 611354 17296 3/43 7 0°k 0. 51 0. 15 to 1. 71 1 51 1 O6 t0 2 t8 Ps=0 OS NOS2A hCVt1889257 CARE CaselCOnlrnl F&NFMI Cfeanar WM 6. 11 40399 9. 65 0. 048B 83J497 187°/0 811232 28395 313D 10. 0% 0. 46 0. 13to1. 52 15A i02to220 P « OS LTA hCV7S1487O CARE Prospective F&NF MI Clearier WM 6. 1 O. U474 6604 t) 04aa 1918023. 8%) l. 5B (D86to2-Bi) i. 57 (108 to 2 30 1 Pc=13 05 6 NPR1 hCV25472879 CARE CaselCantrve F&NF MI Ciaener WM 9, 6T D 0084 1612 0 9029 45l287 1. 7Yc 1) 37 (11. 9°/a 31t86 32. % . 5 (1. 36to 411 1. 98 O 80 to 2 05 P<=005 PGFRA hCV22271841 CARE Pras ive F&NF MI All Possible WM 11 A1 D 028 9 02 D 011 1211844 121896 32J2 1 13. 9°10 51i0 5D. A°/ 8 80 1. 87 ta 24, 78 1. D9 0 71 to 1 64 P « 005 PGFRA hCV22271841 CARE Pros va F&NFMI Claanar WM 11. 0 00038 7. 42 U. 0244 12118D1 20. 1°/ 371158 Z0396 5I7 T1. 4°, 992 211ta) B. 80 10. 0. to1. 54 Psc005 POGFRA ifCV22271841 CARE CaselContlroi F&NF MI All Possible WM f 0 59 0 ODS 12 U8 0 168 1211924 1%. 1% a 321227 14.)1Yo 5 (10 . DYo 6. 37 t. 79 to 2270 . 14 0. T4 ta11 T4 P<=Q 05 PGFRA hCV222i1241 CARE CaspCOnhoi F&NF MI ClPoner WM 9. 62 0. 008 9 92 0. 0419 121I B3 20 4°/a 321155 20 69f, SI 71. 4° 9. 10 1 72 to 48, 10 1. Q8 0 69 to 1. 69 P=0 OS PLA2G4C hCV25472887 CARE Pos ectlva FBNFMI AiIeassible WM 7, 04 OU2BB 0. 34 0042 12D1986 124% 34f213 18. 5°/ 91t1 36. 496 4. 03 1. 04t0135d 134 0. 87t0200 P=005 PLA2G4C hCV25472687 CARE Pros edfe F&NF MI Geaner WM 7. 72 0. D211 8 57 0. 0375 1201824 19 2°/341139 24. 5% 4 ! 7 (T. 196 5. 60 1. 22SO 73 138 . 81 to 2 08 PC=O U5 PLA2G4G hCV25472687 CARE Case/Control F&NF Mf-Alleaner WM 7. 7 D. D212 11. 85 0 Q201 t201947 12. 7°/ 341208 18. 3°/ 411 (3B. 4%) 4. 0 (i. id to t4. 17 1. 44 0. 94 to 2. 21 P=0 05 PLA2G4C hCV25472877 CARE CaseICantrot FBNF MI Gleaner WM 9. 5A O. 083 12. 84 0. 0121 1201A15 19 5% 34H87 241 8 4fl 51. 1°. 6 6 83 1. 42 to 3280)1. 4 (0'93 to 2 32 P=0. 05 PLAB hCV7494217 CARE CoselCantrol FSNF MI CI Possinlr WM 6. 68 0 0354 9. 11 0. 0523 1041712 14 696 411397 10. 3 Y 1 18U 20. 0° 1. 35 0 8d to 2. 87 0 B4 0 43 to 0 95 P=0 O5 P 4 PNN hCV20B250B CARE CaselContml FSNF MI Gleaner WM 4. 35 0. 0399 4. 0S 0004147/1138 (12. 9%) 7) 26 (28. 9%) Omm. 0%) 2. 49 (0. 96) 05. 77) P<=005 E SELL hCV2B1725Tt CARE Pms tve FRNF MI : 411 Possible WM 7. 88 D. a18 7 68 0. 0215 105f88S 11. 9°h 521289 17. 99'0 1H8 5. 3%) 0. 41 0. 02 to 2. 09 1 61 t 12 to 2 81 P< O5 R _are Car 5ERPINA10 hCV7586197 CARE CeselCOrdrol F&NF MI Cleaner WM B. 4B 0. 008T 1256 0. 0138 1061652 19. 2° ! a 4BI181 28. 596 1123 4 3% 0. 2 (0 03 to 1. 78) 69 . 12 to 1. fi4 P OS SERPINBB hCV9023238 CARE CsseIControl F&NF MI AlI Posstble WM 8. 02 D. 0484 12 24 0. 768 651597 18. 49 101550 12 . 6 2 ? 122 10 0% U 54 , 32 tv d 79 1. 73 0 50 to 1. 08 P<«. 05 SERPINBB hCV9023296 W CaseICantsal FBNFMt NIPossv6fe WM 8. 74 O. Ot2B 1T. T3 O. a014 801277 21. 79'0 1281405 31. 6° 43tt31 32. 8 1. 71 t. u7fo2. 73 9. 66 l. i6fo2. 38 p<=UO5 SERPINBB hCV3023286 W CaselCorol FBNF MI Cleanar WM 8. 2 0 098 18. 52 0. 01 6 J250 24 0° ! a 1281370 34. 6% a 43112 (95. 9%) 1. 75 t. OB ta 2. 82 1. 89 1. 18 to 2. 44 Pe-p. 05 Rif RPINI2 hCV370782 CARE Pms ve FBNF Mf Gaana WM 8 85 Q. D072 9. 71 0. 00T8 5112A8 17. 1° 90135 25. 496 171116 14_7°, 0 8 0. 45 to 1. 49 1. 86 1. 13 ta 2. 05 P<=0 OS 3ERPlNI2 hCV370782 CARE CaseICOrol F&NFMI AIIPoasIWr WM 7. 87 0. 0211 8. 89 D. 0124 51I48D tt. 1% BOf531 18. 99' 1T1175 8. 7%a O. B (0. 6 to1. B1 i. B (1. 1 to 2 0 P<=DUS E iPARCLi hCV8827241 CARE Pros ecllve F&NF MI Cleaner WM 7. 8T 0. 0188 7. 77 0. 0208 551308 17. 9% 721384 19 9l0 2B183 31. 2% 2. 08 1. 22 to 3. 52 1. 53 0. 77 to 1. 88 P<r-D a5 iPARCLt hCV8B27241 CARE Case/Cordrol F&NFMI AIIPossaner WM 9. 39 0. 0008 10. 38 0. 0346 551472 11. 7h 72l540 13. 39 29J152 191 1 1 1. 15to3. 18 1. 17 OHOtot. 77 Ps.-ro05 ; PARCLi hCV8827241 CARE CaselControl FBNF MI Cle ner WM 6. BB 00354 9. 11 0. 0583 Mf7l2 (14 5% 41/397 (10. 3%) 12f6D (20. 0%) 1. 0 64 (p 43 to 0. 96) Pe=O 05 3PON2 hCV22275550 CARE Pros ecllva FNFMI AiiPassIWe WM 8. 24 O. U4A2 8. 15 0. 0482 5111920 52_5 451251 17. 8°l 2J22 9i'/a 0. 73 (012M2541 1. 5A (t. Q81n231a PQ5 1 TABLE 14, page 7 of 7 Placebo Patients StatlsticallyStgntncantAssociations Between SNP Genotypes and Two Case Definitlans : Fatal MI f Sudden Death I oaerali'Cht- Deftnlte Non-fatal MI and Fatal ! Nondatal MI S e Tast SNP Effed Niota ! ° Odds Ratio B5 CI Corttral _ _. _ rou v 1 Rara, ljele vs o P 6llc Marker tu Shd Dsst Cese 0 niUa Deflmtion't tum Statistic value Stahstie v lue 0 Rar Alleles Rare Allele Alleles Rare Alleles R e Allefes Level SPONZhCV22Z7S5SaC/\RE Case/CnntfO) F&NFM ! AttPoss) i)) a WM 76S 0. 0266 M''0f) 4ge <1Mai (1M%) 45Q<St183'<,) 2/23 (91%) t. OOjaB3to446t') aBn<4toZ46t PCOS F&NF (11 T/tM Vt6) 7U2SCARE PmspaOa FSNFM) AtfPossiMe WM B. 3 0043 527 0. 0T1T 13DltA01 (3. 0%) 24H83 13. 1% M10 4D, 0°fo 4-07 1. 13to 584 1 1 0. 82to1. 69 P<=005 TAP2 hGVt61T1 t28 CARE CaselCOMroI FBNF MI All Possfble WM B. 16 0. 0103 10. 44 0, 0338 130JH87 19. 2% 2M978 73. 896 4I8 5A. 096 T. 07 t 6B to 30. 1A) 112 0. 8A to 1 80 P<=0 OS TNF hCV1514B78 G4RE Pros va FBNFMI CI9a t WM 8. 72 0. a347 5. 86 a, 057 1fl3154i lB. tY% 5Qf220 22. 1% 5J50 5D. 0° ! a 4. 25 i. 18to15. 55 1. 25 085to182 Pc=005 P... 11 a Mi TRPC6 tCVNB7BO CARE pr0. s ve F$NF MI All PossIWe WM 7, 88 O. D186 7. 68 0, 0215 1041888 (1. T%) 0/281 17. 8% 1118 5. 8°Io 044 (O. Q2to 2 t8 1. 83 1. 12 ta 2 35 Pc=0 05 TRPCe hCV288190 CARE Pros ecHve F8NF 5lI Cleaner WM B. 1S 0. 0465 8. 08 O, A482 1041571 18. 296 50i189 28. 5% 1f ! 14. 3° ! 0 0. 75 0, 04 to 4 45 1. 82 1. 09 to 2 37 P<=p a9 TRPCB hCV2887s0 CARE C9selCorArol F&NF MI All Pos9IGIB WM 8. 04 0. 018 11. 02 0. 0263 1041888 l2. 0°/a 5D1278 18 0% llt7 5. 9°/ 0, 83 0 OB to 4. 88 1. 70 1, 18 to 2 48 Pe=0. 5 F& FMI 717 F&NF MI OL VTN hCV25S65B5 CAFtE Case/Control F$NFMI AIIPaSSIbIB WM 10. 83 0. U042 15. 82 O. OD313 951 9. 1°l B3l559 188°/331282 12. 8% 1A0 082l02. 38 203 i, 31to8t8 P «, Up5 0. 'For the CARE praspecHve stvdy dasfgrc results oEttte OvaraH Scare Test (chl,-squara test) for the logistlc regreasion model Inwhlch tha phenotype (case deBNtton) s a huncUan of SNP genotype based on acebo Ilertts oN. Forthe casekontrol studydasigu ; resutts otthe Overall Scare Test (ch1-squera test) fnr fha condlttonat logisdc cegrass (on mcdel Inwhlchthe phenetype (case deAnltion) (s a codon ofSNP genatype (based an pfacelo patients only) and cases and controls wers matched on ante and current amok status, "Results of the eht-square teat of the SNP efact baned on the logistic regresston modet In valch the phenotype (case degnftlon) Is a fundlon of SNP genotype (based on placebo Ilenis onl. Results ofthe chl-oquare test of the SNP effect based on the condltbnal log1stlc ragresslon nadel In whtch the phenotype (case dsflnftfon) Is a emotion of SUP genotype (based on )lacebo patients only) and cases and controls were matched on age and current smoking status " AI Possible Controls fnc (ude all conmls with genotype data. Cleane contbnls include rontmts with ena data but wlth no other CVD-retated events durnrt Nst tdal. S en Death>nllll Islon-U = vrcase daflnton'F MIISDMF MI"= Fatal MUSuUden OeathIOefiNta Nonfatal Mt orcase daftniHon'FBNF MI' Fatal S otfatal MI 'orstratum.'WM"= WM 'or Stud'W"a W TABLE 15, page 1 of 1 ForlhrCAREpspXeg llheS » S : >T st (enboquwolall _., _. _. _ _-l rob MMtioe Khmft FONtCMf'CM-ftmctim OftcrtAttftt tftftAM* : RtftMMt* CMEt SftOne bsxn nnl p. ~ 4-FMr,-/conlnll ul ; $ rzulborlhomllSeantT « frbl wntntlrYUs _ _ _ _ _ _ R lknotawllFS*l dw » rh « sKb nAbpa Hklic Marlwr S. &IUC Ue n CmeDolfnaion eMAnon'^ gWUm leusln alup gatln due PatmNe pecebnPWeHa Pe0enl FlseeMPala Pelomds Palnmlf ReAlidea Ra9AlINS RamAlleiu SIMlnlfe mlw ? NI ht. Y254B992 CANE ! ppf m TOIICHOEveNe Pmamk WhIVMd 21A2 OU005 1701 A90S0 tB3813 2BBlG 223l927 3569G 1511'opq yppY, 143fd5E 312%m18nW 1881L 17f100-020% 077 OAlloOAB 0A9 O681e15A 02B 0131a080 NA PONP hCV/2Fd6BA2 CARE rvn FddNaniaInlA4 C7ar er Whl, Mb f30U 00234 3A0 075E7 91/42J 5B% 7dlJGE 1E 6pp 7q'/4 9C/Jpy p » y, grop l3% fAl84 7l11i 061 fiA1a 18 0A3 03110136 032 0111o0A5 NA PON1 ACV26i6Bp2 C9ii CndConlrcl Fvtd oNa7MI dem WW M l3iA 00170 515 OOTA3 07/41C 191% B9 1907L 6633611 % d12A1 21A% o'iD 114% 1NM 267X OEA O6E1o722 0& 04Sto0 020 012IO071 w , *'*'11------------------------------------------------------ --------- 1 Fx Ilu CARE poipim, nnly rrwJb af uw MraU 9canTnri (UWqWn IM) torn. or. w... mnmoadmwhcnnwprwwyqeweW mbnJimNrdbn ro d nsxPpm, utyp. pmt. u » Mtrxwn dMVm 9NP Grdyp tmrrtart. 5 : 'Riftt&M'tM. nMerOMfmSNftTtttfcM-tquMttOftftM Onst@bansl Iroolmnnl nmun (huS enlh lxalenrobn modds hxnalan olCw SHP pndyp, rWmK pmnp, ma uuladlon SNP pnro ytYPeand trnmMnl cup and aosara eomd hm bW malclrC on p. a mokt sluua "FaRr CHRE pmnpeUM ntudY twth af UrcAt-uan Iwl uf ihs fnct6n oNWeaf SNP eM Inilmenl Wsed af Ih 1 tslK modd "FRUfetulmllWntudiu nwlbdtlhcGn. puohalc (IMnMrnCGOnbMtsn 5 p lmd Woup (baud an"coWnionW idgwoo"qmn ,, Nd, g,, &mlyps '"An Pouble Cmlidi VidWo Wi nld. lh a-lyp. dl Cl.--W. iris tLMm<. rtmtmm-tqMt<. dbM-m.. Mtb. ftfft ; u bOdlYlly'eRrbrd F, vxrerrs nassoScOr'SP eemlYne3 1 nnpa'WSallygnfknt P-vsluwfarCAfEUMWOSCOPSwsnmrna nfinplhomattn9atFWnr (78517 RndISMrC9REaNWOSCPShars t ?) lhcX&nforaYommaYit nd1zZlludFspe hepvFoetprUmdSI M<)) onofMtOMttan) MtMtf) « 010 CdHt) cttM [Mn<d) ob*cancanfMU Wracmnaunda6n) rW oIo-010 AddnllorW lAnrlloMmNw fmIhdIMOS% eonlitNncmm6 (fabolAaJW utlroa) rrrtrnIyWCwtOa I n I. NdAndruble