GENETIC VARIANTS IN THE INDOLEAMINE 2,3-DIOXYGENASE GENE

BACKGROUND

Degradation of the essential amino acid, tryptophan is now recognized to be important in the regulation of the immune system. Tryptophan is the least abundant essential amino acid in the circulation and its availability is important in several biological processes. In cancer, the regulation of immune tolerance by tryptophan degradation is now recognized as an important factor relating to tumor growth. A critical step in the development of cancer is the suppression of the host immunosurvellience around the tumor, and tryptophan metabolism by the enzyme, indoleamine 2,3-dioxygenase (IDO) is believed to play a role in such suppression.

Indoleamine 2,3-dioxygenase (IDO) is a rate-limiting enzyme in tryptophan metabolism that induces local immune tolerance by limiting tryptophan availability. IDO catabolizes tryptophan through the kynurenine pathway. Low tryptophan and high kynurenine concentrations have been reported to induce cell cycle arrest and/or apoptosis in effector T cells, and the resulting decrease in proliferation and activity of T-cells results in the localized suppression of T-cell responses and immune tolerance. IDO-mediated immune suppression appears to be important in tissues that are subjected to constant exposure to foreign antigens. This is supported by studies showing that tissues, such as the lungs, gut and endometrium, normally express IDO. In addition, blocking IDO activity in these tissues causes a loss of immune suppression, leading to inflammation and augmented local immunity. For example, pharmacological inhibition of IDO in mice that are pregnant with allogenic concepti causes a loss of the pregnancy. Results from preclinical models of organ transplant studies indicate that IDO also affects host tolerance to transplanted organs. This has been shown for liver, pancreatic islets, and lung transplants. In addition to its basal expression in selected tissues, IDO is also inducible. Direct induction of IDO, both in vivo and in vitro, has been demonstrated with interferons and with interleukins.

In rodent cancer models, IDO overexpression promotes cancer progression and IDO inhibition delays cancer development. The inhibition of IDO activity also improves chemotherapy responses in the MMTV-neu mammary tumors. In human cancer, IDO expression is associated with recurrence and sentinel lymph node

metastases. In preclinical studies, inhibiting IDO activity synergizes with other therapeutic drugs and can also affect tumor growth by itself.

In addition to the direct effects on tumors, elevated IDO activity can also affect circulating tryptophan and kynurenine concentrations. Interferon therapy suppresses circulating tryptophan concentrations in patients with hepatitis and cancer in some, but not all treated patients. This is presumed to be through variable induction of IDO activity. The systemic kynurenine/tryptophan ratio is increased during some normal pregnancies, which is likely related to placental IDO activity. Pregnancy and lactation associated suppression of circulating tryptophan levels also occur in some, but not all women.

This variability in systemic tryptophan concentrations may have important clinical implications. Since the reduction in circulating tryptophan levels can reduce serotonin levels in the central nervous system, depression is a common problem in people with suppressed tryptophan concentrations. Circulating serum tryptophan concentrations have been associated with depression in patients receiving interferon therapy. Postpartum depression has also been associated with increased kynurenine/tryptophan ratios.

Although the importance of IDO activity is clear in a number of clinical applications, there is substantial interindividual variability in IDO activity. The factors responsible for the variable IDO expression in tumors are poorly understood; however, it may be related to genomic alterations of the IDO gene. This interindividual variation in the IDO expression in patients, may affect therapeutic responses and susceptibility to drug side effects. Accordingly, there is a need to assess an individual's IDO expression, prior to administering a therapeutic regiment that impacts IDO expression, to optimize the therapy and to reduce potential adverse side effects. Furthermore, screening individuals for the presence of IDO gene variants can be used as a diagnostic indicator for susceptibility to various conditions or diseases, and allowing for monitoring and use of prophylactic procedures to avoid the development of the adverse condition or disease.

SUMMARY

Indoleamine 2, 3- dioxygenase (IDO) is a cytosolic enzyme that catalyses the oxidative metabolism of L- tryptophan to kynurenine. By regulating local concentrations of tryptophan and kynurenine, IDO regulates local function immune cells. IDO expression is highly inducible by cytokines in multiple cell types, including some cancer cell lines. Previous studies have shown that IDO is expressed in many types of human tumors. There is a large amount of interindividual variation in the IDO expression in cancer patients, which may affect therapeutic responses and susceptibility to drug side effects. Accordingly, to optimize a therapy directed at reducing IDO activity in a patient, and to reduce potential adverse side effects of such a therapy, there is a need to assess an individual's IDO expression, prior to administering a therapeutic regiment. Furthermore, screening individuals for the presence of IDO gene variants can be used as a diagnostic indicator for susceptibility to various conditions or diseases, including autoimmune disorders, cancer, organ transplant rejection and miscarriage, and allow for monitoring and use of prophylactic procedures to avoid the development of the adverse condition or disease.

The present disclosure is directed to compositions and methods for identifying individuals that carry a deficient indoleamine 2,3 -dioxygenase. Identification of such patients will help diagnose conditions related to low indoleamine 2,3 -dioxygenase activity, and will assist in proper selection, administration and effective management of therapeutic regiments, including cancer therapies.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 A-IE. Effects of IDO genetic variants on tryptophan metabolizing activity. Host cells were transfected with the empty pcDNA3 plasmid control (vector) or plasmids containing the wild-type (WT) or exon 1, or exon 3 variant cDNAs. Variant cDNAs were constructed by site directed mutagenesis. Media was collected 48 hrs after transfection of the host cells and tryptophan concentrations (Fig. IA for COS-7 host cells, Fig. 1C for HEK293 host cells) and kynurenine concentrations (Fig. IB for COS-7 host cells, Fig. ID for HEK293 host cells) were determined by HPLC. Values are the means and standard deviation of 3 experiments conducted on cells plated on 3 different days. Fig. IE presents data produced from measuring mRNA expression in the transfected HEK293 cells. The

- A - differences in the mRNA expression levels of the variant IDO mRNAs was not sufficient to account for the large decrease in IDO enzyme activities of the Arg77His and the 9 bp deletion.

Fig. 2 A and 2B represent a comparison of the variant regions of the nucleic acid and protein sequences of the IDO exon 3 and exon 7 variants. Fig. 2A shows a comparison between the wild type nucleic acid and encoded protein sequences of IDO exon 3 in comparison to the Arg77His variant. Fig. 2B shows a comparison between the wild type nucleic acid and encoded protein sequences of IDO exon 7 and the 9 base pair deletion variant. Fig. 3 A and 3B represent the enzymatic activity of the IDO variants when expressed using a rabbit reticulocyte transcription and translation expression system.

Fig. 4 represents the promoter of the human IDO gene including 1247 nucleotides upstream of the start codon for the protein (i.e. the last three nucleotides of the sequence).

Seven single nucleotide polymorphisms are identified by indicating the two alternative nucleotides at each of the respective positions, the first representing the wild type nucleotide and the second representing the nucleotide of the variant gene sequence.

DETAILED DESCRIPTION DEFINITIONS In describing and claiming the invention, the following terminology will be used in accordance with the definitions set forth below.

As used herein, the term "antibody" refers to a polypeptide or group of polypeptides which are comprised of at least one binding domain, where an antibody binding domain is formed from the folding of variable domains of an antibody molecule to form three-dimensional binding spaces with an internal surface shape and charge distribution complementary to the features of an antigenic determinant of an antigen, which allows an immunological reaction with the antigen. The term "antibody" absent further designation is intended to include monoclonal and polyclonal antibodies, recombinant proteins comprising the antibody binding domains, as wells as antibody fragments, including Fab, Fab', F(ab) ₂ , and F(ab') ₂ fragments.

The phrase "binds specifically" means high avidity and/or high affinity binding of a ligand or antibody to a specific polypeptide (e.g., a deficient indoleamine 2,3- dioxygenase). Antibody binding to its epitope on this specific polypeptide is preferably

stronger than binding of the same antibody to any other epitope, particularly those which may be present in molecules in association with, or in the same sample, as the specific polypeptide of interest (e.g., binds more strongly to the specified deficient indoleamine 2,3-dioxygenase than to wild type deficient indoleamine 2,3-dioxygenase). Antibodies which bind specifically to a polypeptide of interest may be capable of binding other polypeptides at a weak, yet detectable, level (e.g., 10% or less of the binding shown to the polypeptide of interest).

As used herein a "deficient indoleamine 2,3-dioxygenase" refers to an indoleamine 2,3-dioxygenase protein variant that has significantly reduced enzymatic activity relative to the wild type indoleamine 2,3-dioxygenase, when the proteins are expressed in a host cell. Comparison of the relative activities of wild type and variant IDO activity can be and based on the measurement of tryptophan and kynurenine concentrations using, for example the assay described in Example 1. More particularly, a deficient indoleamine 2,3-dioxygenase has less than 75% the activity of the wild type indoleamine 2,3-dioxygenase as determined using the assay of Example 1. In one embodiment the deficient indoleamine 2,3-dioxygenase has less than 50%, or even less than 30%, the activity of the wild type indoleamine 2,3-dioxygenase as determined using the assay of Example 1.

A deficient indoleamine 2,3-dioxygenase gene is a nucleic acid sequence variant of the wild type indoleamine 2,3-dioxygenase gene, wherein the deficient indoleamine 2,3-dioxygenase gene either fails to encode for a protein product, or encodes a deficient indoleamine 2,3-dioxygenase.

A "detectable marker" as used herein refers to any atom or molecule which can be used to provide a detectable (preferably quantifiable) "signal", and which can be attached to a nucleic acid or protein. Markers include, for example radioactive isotopes, antigenic determinants, chromophors, fluorophors, chemiluminescent molecules, colorimetry, gravimetry, electrochemically detectable molecules, molecules that provide for altered fluorescence-polarization or altered light-scattering, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like. As used herein, the term "conservative amino acid substitution" is defined herein as exchanges within one of the following five groups:

I. Small aliphatic, nonpolar or slightly polar residues: Ala, Ser, Thr, Pro, GIy;

II. Polar, negatively charged residues and their amides: Asp, Asn, GIu, GIn; III. Polar, positively charged residues:

His, Arg, Lys;

IV. Large, aliphatic, nonpolar residues:

Met Leu, He, VaI, Cys

V. Large, aromatic residues:

Phe, Tyr, Trp

EMBODIMENTS

An improved understanding of the factors that influence IDO activity has the potential to improve the treatment of immune tolerance-related disorders and prevent the side effects caused by therapy induced IDO activity. One factor that may contribute to the interindividual variability in IDO activity is genetic variability in the IDO gene. To identify such genetic variations the exons and the intron/exon borders of IDO genes of 96 samples from the Coriell DNA Repository were resequenced. Seventeen IDO variants were identified, and of these, three were nonsynonymous SNPs (Ala4Thr, Arg77His, Leul97Ile), three were intron/exon splice junction SNPs, and one was a 9 bp deletion in the coding region.

To determine the functional effects of the coding variations that were predicted to have functional consequences, the enzyme activity of three of the variant cDNAs, expressed in COS-7 and HEK293 cells, was investigated. The Arg77His and the 9 bp deletion resulted in nearly complete loss of enzyme activity. The allelic frequencies of these two functional variants were ~1% and were observed exclusively in the African American samples. Accordingly, this data established that there are naturally occurring polymorphisms in the human IDO gene that can cause reduced IDO enzyme activity. In accordance with one embodiment, a method is provided for screening for the presence of one or more such IDO variants in a patient to determine the patient's prognosis and/or assess treatment strategy and treatment dosages.

In accordance with one embodiment, provided herein are compositions and methods for identifying individuals that carry a deficient indoleamine 2,3-dioxygenase. Identification of such patients will help diagnose conditions related to low indoleamine 2,3-dioxygenase activity, and will assist in proper selection, administration and effective

management of therapeutic regiments, including cancer therapies. In one embodiment a method for screening patients for susceptibility to a condition or adverse reaction related to low indoleamine 2,3-dioxygenase activity is provided. The method comprises the step of identifying patients that carry a gene encoding for a deficient indoleamine 2,3- dioxygenase, or identifying patients that express a deficient indoleamine 2,3-dioxygenase.

In one embodiment, the method comprises the steps of obtaining a biological sample from a patient and screening the sample for the presence of deficient indoleamine 2,3-dioxygenases. The identification of deficient indoleamine 2,3-dioxygenases can be conducted by screening for the deficient indoleamine 2,3-dioxygenases themselves, or by screening for nucleic acids (e.g. gene sequences) that encode such a deficient indoleamine 2,3-dioxygenases, using standard analytical techniques known to those skilled in the art. In one embodiment the biological sample is screened to detect the Arg77His indoleamine 2,3-dioxygenase variant or the 9bp deletion in exon7 variant. In one embodiment nucleic acid sequences are recovered from an individual's biological sample and the nucleic sequences are screened for variant indoleamine 2,3-dioxygenase sequences using standard techniques (such as Northern and Southern blot analysis, sequencing, RFLP mapping and the like). Alternatively, polypeptide can be recovered from the patient's biological sample and screened for the presence of a deficient indoleamine 2,3-dioxygenase variant through the use of antibodies that specifically bind to the deficient indoleamine 2,3-dioxygenase or by direct peptide sequencing using mass spectroscopy or other known methods.

The biological sample can be a tissue sample, or in one embodiment a bodily fluid, including for example, blood, saliva or urine. In accordance with one embodiment, screening of patients to identify those that have deficient indoleamine 2,3-dioxygenase activity may help identify those individuals that will exhibit an adverse reaction to a cancer related therapy such as interferon treatments. Furthermore, identification of individuals that express deficient indoleamine 2,3-dioxygenase activity may indicate what types of side effects to expect during the development and use of therapeutic interventions that target IDO activity in humans.

In another embodiment the identification of individuals expressing deficient indoleamine 2,3-dioxygenase activity may be diagnostic for individuals that are susceptible to autoimmune diseases and/or the inability to maintain a full term pregnancy. Screening for deficient indoleamine 2,3-dioxygenase activity may also identify patients that may be more susceptible to rejecting tissue and organ transplants as well as patients

who have an increased susceptibility to infection. As used herein a general reference to organ transplants is intended to encompass both solid organ transplants and the transplant of cell populations, such as stem cell transplants. Indoleamine 2,3-dioxygenase activity appears to be involved in the immune response to infections. Therefore, identifying patients with deficient indoleamine 2,3-dioxygenase activity could be beneficial with regards to patient care, including the prevention of infections as well as treating existing infections in such identified patients. The identification of patients with deficient indoleamine 2,3-dioxygenase activity could also allow for closer monitoring of their conditions or potentially allow for intervening therapies. In accordance with one embodiment a patient is screened to determine their level of indoleamine 2,3-dioxygenase activity in conjunction with the administration of a cancer therapy and/or determination of prognosis. More particularly, in one embodiment the cancer to be treated is breast cancer. An optimized immunohistochemical assay was developed and used to examine indoleamine 2,3-dioxygenase (IDO) expression in human breast cancer tumors. The results of these studies revealed that IDO is expressed in primary human breast tumors as well as in tumor cells in metastatic lymph nodes. This result confirms that IDO is expressed in human breast cancer, which was previously suggested based on data obtained from breast cancer cell lines. Furthermore, multiple cell types have been found by applicants to express IDO in the tumor tissue, including cancer cells, endothelial cells, immune cells and a fibroblast like cell of yet uncertain origin. In normal breast, IDO is expressed in the epithelial, endothelial and fibroblast-like cells. In cancer tissues, substantial variability was observed between individuals. In some tumors there was no apparent expression, whereas in others, there were high levels of expression. To further define IDO activity in breast cancer cells, an HPLC assay was established to determine the tryptophan and kynurenine concentrations in cell culture media and serum samples. Interferon induces the expression of IDO mRNA, and this expression is translated into functional IDO activity as evident by the metabolism of tryptophan to kynurenine. Of the cell lines tested, the SKBR-3 cell lines had the greatest capacity to metabolize the tryptophan. In 48 hrs, these cells metabolized all of the tryptophan in the media (-60 μM starting concentration) to nearly undetectable levels by HPLC. As a result, the kynurenine concentrations in the media increased to >15 μM. This illustrates that the IDO mRNA induced by interferon treatment in breast cancer cells

is translated into functional IDO activity. Furthermore, based on the in vitro data, there is sufficiently high IDO activity to deplete tryptophan to very low concentrations that would be expected to suppress T-cell activity. This induction was both time dependent and interferon dose dependent. Since there are no clinical drugs that are known to inhibit IDO activity, an in vitro

IDO enzyme assay was established using lysates from interferon treated SKBR-3 breast cancer cells to use as a screening tool to identify potential clinical therapeutic inhibitors. Using this assay, 3,3-diindolylmethane (DIM) was identified as a competitive inhibitor of IDO activity. DIM is the major absorbed form of indole-3-carbinol, a nutritional supplement that is used clinically in trials for the chemoprevention of breast cancer. The breast cancer prevention activity of these compounds has previously been assumed to be due to its ability to alter the metabolism of estradiol to less reactive metabolites via the cytochrome P450 enzymes. Accordingly, this IDO inhibitory activity may represent a novel mechanism of action of this chemoprevention therapy. As an initial pilot study in cancer patients, the circulating serum concentrations of tryptophan and kynurenine in cancer patients undergoing interferon and paclitaxel therapy was examined. Briefly, there were 17 patients with metastatic cancer of various types that underwent treatment with interferon alpha 2b and one of 3 doses of paclitaxel. Blood samples were taken prior to treatment and following 1, 2, 3 and 4 weeks of therapy. Serum concentrations of tryptophan and kynurenine were determined an HPLC assay described above. The concentrations of tryptophan ranged from near normal of 50-60 μM to as low as 10 μM, indicating a large variability, potentially resulting from variable expression of IDO in these patients. The pretreatment serum kynurenine concentrations were elevated compared to historical normal values, again with substantial variability. Interferon and paclitaxel treatment in most of these patients induced further suppression of tryptophan and elevation of kynurenine concentrations, indicating a clinical activation of IDO activity in these patients.

As disclosed herein two indoleamine 2,3-dioxygenase variants present in existing populations have substantially reduced enzymatic activity. The exon 3 variant (Arg77His) has -90% reduced activity compared to the wild-type plasmid. In addition, the three amino acid deletion variant (a 9 bp deletion in exon 7, see Fig. 2B) also has substantially reduced enzymatic activity. This data indicates that there are people in the general population that have one low functional allele, and maybe homozygous Arg77His

people that have no functional alleles. The phenotype of these individuals, if they exist, would provide valuable insight into the biology of IDO. For example, they may be particularly susceptible to autoimmune diseases and the inability to maintain a full term pregnancy. Furthermore, they may indicate what types of side effects to expect during the development and use of therapeutic interventions that target IDO activity in humans. It is also likely that they would not respond to IDO targeting therapies and may have altered reactions to immune therapies, such as interferons, that involve IDO in their mechanism of action.

The underlying functional genetic variation in the IDO gene will likely explain at least part of the interindividual variation in IDO activity among cancer patients. This would provide the foundation for developing strategies to alleviate adverse events caused by the altered tryptophan metabolism and improve the efficacy of cancer therapeutics. In accordance with one embodiment a deficient indoleamine 2,3-dioxygenase variant includes polypeptides having a non-conservative amino acid substitution relative to the wild type sequence of SEQ ID NO: 2 at position 4 or position 77, or deletion of four amino acids (ALLE) at position 199-202 of SEQ ID NO: 2. In one embodiment the deficient indoleamine 2,3-dioxygenase variant comprises a polypeptide having an amino acid substitution at position 77 selected from the group consisting of Ala, Ser, Thr, Pro, GIy, Asp, Asn, GIu, GIn, His, Arg, Lys. In one embodiment the amino acid substitution at position 77 is selected from the group consisting of Asp, GIu, GIn, His, Arg and Lys, and in a further embodiment the substituting amino acid is His, Arg or Lys.

In a further embodiment the indoleamine 2,3-dioxygenase variant comprises an amino acid sequence of K--H-L--P-D--L--I--E--S--G-Q--L--R-E--R--V--E--K--L--N- M~L-S~I~D~H-L-T-D-H-K~S-Q-H--L~A~R~L-V (SEQ ID NO: 4) or comprises the amino acid sequence of F-F- L-- V— S-L-- L-- V-- E-I- A— A— A— S— A— 1~ K-V-I-P-T-V-F-K-A-M-Q-M-Q-E-R-D-T-L-L-K-D-I-A-S (SEQ ID NO: 6). In one embodiment the deficient indoleamine 2,3-dioxygenase is identical to the wild type indoleamine 2,3-dioxygenase except for a single amino acid substitution (Arg77His). In another embodiment the deficient indoleamine 2,3-dioxygenase is identical to the wild type indoleamine 2,3-dioxygenase except for a three amino acid deletion in exon 7 (substituting Asp for the sequence Ala-Leu-Leu-Glu (SEQ ID NO: 15)). In one embodiment the indoleamine 2,3-dioxygenase variant comprises the amino acid sequence of SEQ ID NO: 17 or 19.

The present disclosure also encompasses nucleic acids encoding for the deficient indoleamine 2,3-dioxygenase variants disclosed herein, including for example, nucleic acid sequence comprising SEQ ID NO: 16 or 18. In addition to nucleic acid variants that encode deficient IDO polypeptides having amino acid substitutions, deletions and insertions relative to the sequence of SEQ ID NO: 2, the present invention also encompasses gene sequence variants that are modified in non-coding regions of the gene sequence that impact the activity of the expressed indoleamine 2,3-dioxygenase. Such nucleic acid sequence variations may impact the transcription, translation or stability of the IDO mRNA resulting in deficient indoleamine 2,3-dioxygenase activity. For example the mutation may occur in a splice junction and thus impact the processing of the DNA transcript, or alternatively the sequence variation may occur in the transcription or translation regulatory sequences and thus directly impact the transcription or translation of the gene. In one embodiment the variation is in the promoter of the gene, and more particularly, a variation in the sequence at one or more of the transcription factor binding sites of the gene. For example, applicants have discovered two specific single nucleotide polymorphisms in the human indoleamine 2,3-dioxygenase within the FOXCl (tattac*[A > G]ttattag; SEQ ID NO: 28) and GATA3 (tatgct*[A > G]tcattgg; SEQ ID NO: 29) transcription factor binding sites. Therefore it is anticipated that these two sequences can also serve as markers for deficient indoleamine 2,3-dioxygenase genes. Additional single nucleotide polymophisms that exist in the IDO promoter (Fig. 5) are also anticipated as serving as markers for deficient IDO genes, and those sequence are provided in Table 1.

Table 1

*SEQ ID NOs: 28 and 29 represent potential the transcription factor binding sites FOXCl and GATA3, respectively

In accordance with one embodiment, nucleic acid probes are provided that specifically binds to a deficient IDO gene but not the wild type IDO gene. More

particularly, in one embodiment the nucleic acid probe specifically binds to the Arg77His variant nucleic acid sequence (i.e. SEQ ID NO: 3) or the 9bp deletion IDO variant nucleic acid sequence (i.e. SEQ ID NO: 5), or their complements. In another embodiment the nucleic acid probe specifically binds to the nucleic acid sequence tattacgttattag (SEQ ID NO: 28) or tatgctgtcattgg (SEQ ID NO: 29).

In one embodiment a nucleic acid probe (as well as binding conditions including hybridization and wash conditions) are used such that the nucleic acid probe specifically binds to the nucleic acid sequence of SEQ ID NO: 16 or 18, or its complement. In one embodiment the nucleic acid probe comprises the nucleic acid sequence AGCACCT (SEQ ID NO: 20) or AGGCAATA (SEQ ID NO: 21) or their respective complements. In a further embodiment a nucleic acid probe is provided that specifically binds to the sequence of SEQ ID NO: 16 or SEQ ID NO: 18. These probes can be used to screen DNA and/or RNA samples isolated from a subject to detect the presence of the nucleic acid sequences encoding for the Arg77His or 9 bp deletion IDO variants. The nucleic acid sample isolated from the subject may represent genomic DNA or isolated mRNA. In one embodiment a nucleic acid sample is isolated from an individual, and the nucleic acid sequences are amplified. More particularly, primers are selected to amplify the nucleic acid sequences encoding for IDO, using standard PCR techniques, for example. The amplified nucleic acid sequences can then be analyzed for the detection of IDO gene variants that produce deficient IDO. The analysis may include, for example, restriction length polymorphism analysis, sequence analysis, gel shift electrophoresis analysis or Southern or Northern blot analysis using wild type and variant specific nucleic acid probes as well as any other techniques that can be used to detect deficient IDO nucleic acid sequences in a patient. In accordance with one embodiment, an antibody is provided that specifically binds to a deficient indoleamine 2,3-dioxygenase. More particularly, in one embodiment, the deficient indoleamine 2,3-dioxygenase is an Arg77His variant, or a protein encoded by a gene having the 9 bp deletion in exon 7. In one embodiment an antibody is provided that specifically binds to the IDO variant protein of SEQ ID NO: 17 or 19. In one embodiment, the antibody is a monoclonal antibody. The antibody can be provided as one component of a kit for identifying patients having a deficient indoleamine 2,3- dioxygenase protein. Alternatively, the kit may be provided with a nucleic acid probe for detecting a deficient indoleamine 2,3-dioxygenase gene in the patient. The nucleic acid

probes or antibodies can be directly or indirectly labeled using standard techniques known to those skilled in the art.

In accordance with one embodiment a kit for identifying patients having reduced indoleamine 2,3-dioxygenase activity in their cells is provided. In one embodiment the kit comprises a ligand that specifically binds to a deficient indoleamine 2,3-dioxygenase gene sequence or protein, and reagents for detecting the binding of the ligand to said a deficient indoleamine 2,3-dioxygenase. In one embodiment, the ligand is an antibody and the deficient indoleamine 2,3-dioxygenase is an Arg77His variant, or a protein encoded by a gene having the 9 bp deletion in exon 7. In one embodiment a composition is provided comprising a nucleic acid probe, wherein the probe comprises the nucleic acid sequence AGCACCT (SEQ ID NO: 20) or AGGCAATA (SEQ ID NO: 21) or its complement, wherein the nucleic acid sequence is labeled with a detectable marker. This composition can be combined with other reagents in the form of a kit.

EXAMPLE 1

Evidence is rapidly accumulating that inherited germline genetic variants in many, if not all, human genes contribute to the interindividual variability in expression and activity. To identify sequence variability of the IDO genes, all 10 exons and flanking intron/exon boarders of the IDO gene were resequenced in 48 African Americans and 48 Caucasians using the diversity panel of DNA samples from the Coriell Institute.

17 polymorphisms were identified in these samples. The positions and frequencies are described in Table 2. Of particular interest, there were two nonsynonomous SNPs, a 9 bp deletion in the coding region, and 2 SNPs in intron/exon splice junctions. Several of the low frequency alleles appeared in only one ethnic group, indicating the possibility of ethnic specific variants that may cause ethnic specific differences in IDO activity.

To test the functional significance of the three nonsynonomous SNPs, the wild- type IDO cDNA was inserted into the pCMV-SPORT vector (Invitrogen, Inc), and cDNA's containing the exon 1 and exon 3 variants were created by site-directed mutagenesis using the Quick-change Site Directed Mutagenesis kit (Stratagene, Inc). The exon 1 and exon 3 variants encode for the amino acids changes Ala4Thr and Arg77His, respectively. The sequences of the mutated plasmids were confirmed by DNA

resequencing the entire cDNA. The wild-type and mutated cDNAs were also subcloned into the pcDNA3 expression vector. These plasmids were transiently transfected into the COS-7 cells and the quantity of tryptophan and kynurenine were measured in the media 48 hrs after transfection. The results from these studies are presented in Fig 1.

Materials and Methods

Resequencing of IDO exon and flanking intron regions

DNA samples from 48 African- Americans and 48 Caucasians subjects were obtained from the Coriell DNA Repository (Camden, NJ, USA) (Sample Sets HDlOOCAU and HDlOOAA). These samples had been collected and anonymized by the National Institute of General Medical Sciences. The resequencing of all exons and exon- intron boundaries in the INDO gene and SNP identification was done by Polymorphic DNA, Inc. DNA was sequenced in both the forward and reverse directions. Each polymorphic site was verified by examining the chromatograms using the Vector NTI Advance software.

IDO comparative genomic analysis

The wild type human indoleamine 2,3 dioxygenase amino acid sequence was aligned with those of IDO in other species to identify residues that were identical in other known vertebrate orthologs. When an amino acid was different in any species, the residue was classified as evolutionarily "unconserved". Each human IDO variant amino acid was also assigned a position-specific independent count (PSIC) using PolyPhen. A count of <0.5 predicts that the amino acid change is benign. SIFT (Porting Intolerant From Tolerant) values were determined to help predict whether each specific amino acid substitution might influence function.

Site-directed mutagenesis of the IDO expression vector

The full length IDO cDNA (NM 002164.2) in a pCMV-Sport 6 vector (clone ID 5208340) was purchased from (Invitrogen, San Diego, CA) and was subcloned into the pcDNA3 mammalian expression vector. Expression constructs for the IDO variants were created by site-directed mutagenesis. Site-directed mutagenesis of IDO-pCMV-Sport 6 vector was undertaken using QuickChange® II Site-Directed Mutagenesis kit

(Stratagene®) as per the manufacturer's instructions. All primers were synthesized by

(Integrated DNA Technologies, INC, Coralville, IA). Primers used for site-directed mutagenesis were as follows:

Forward: Ala4 to Thr4, GCAGACTACAAGAATGGCACACACTATGGAAAACTCCTGG (SEQ ID NO: 7);

Reverse: Ala4 to Thr4, CCAGGAGTTTTCCATAGTGTGTGCCATTCTTGTAGTCTGC (SEQ ID NO: 8);

Forward: Arg77 to His77,

CTCACAGACCACAAGTCACAGCACCTTGCACGTCTAGTTCTG (SEQ ID NO: 9);

Reverse: Arg77 to His77,

CAGAACTAGACGTGCAAGGTGCTGTGACTTGTGGTCTGTGAG (SEQ ID NO: 10); Forward: Arg77 to Lys77,

CTCACAGACCACAAGTCACAGAAGCCTTGCACGTCTAGTTCTG (SEQ ID NO:

H);

Reverse: Argil to Lys77,

CAGAACTAGACGTGCAAGGTGCTGTGACTTGTGGTCTGTGAG (SEQ ID NO: 12);

Forward: Ala Leu Leu GIu to Asp, GGACACTTTGCTAAAGGCAATAGCTTCTTG (SEQ ID NO: 13);

Reverse: Ala Leu Leu GIu to Asp, CCAAGCAAGAAGCTATTGCCTTTAGCAAAGT (SEQ ID NO: 14);

Indoleamine 2,3-dioxygenase expression in COS-7 and HEK293 cells

COS-7 cells were purchased from American Type Culture Collection (ATCC, Rockville, MD). The cells were cultured at 37°C in 5 % CO ₂ atmosphere, in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, as recommended by ATCC. Cells were plated in 6-well plates at 7.5 xlO ⁵ cells/well in 3 ml of media and cultured for 24 hours before transfection. Cells were transfected with the ID0-pcDNA3- expression constructs (500 ng DNA) using COSFectin (BioRad). Lipofectamine Plus

reagent was used for the transfection of HEK293 cells as recommended by the manufacturer Invitrogen (Carlsbad, CA). An 'empty' pcDNA3 vector, (i.e. one that did not contain a cDNA), was used as a control to correct for possible endogenous IDO enzyme activity in the transfected cells. Endogenous activity was found to be negligible; it averaged less than 1% of the activity present after transfection with the wild type construct. All transfections were performed in triplicate within each experiment and replicated on multiple days. The culture media were collected 48 hours after transfection and frozen at -20 until analysis.

Measurement of tryptophan and kynurenine concentrations

We used an HPLC assay to determine the tryptophan and kynurenine concentrations. Following chromatographic separation, tryptophan was detected by fluorescence and kynurenine was detected by UV. Fifty μl of 3-nitro-tyrosine (3-NT) was added to a new microcentrifuge tube as the internal standard. The samples were thawed on ice; vortexed and 200 μl of the culture medium were transferred to the tube containing the 50-μl 3NT. Fifty μl of 30% trichloroacetic acid (TCA) was then added to each tube to precipitate out the proteins and the tubes were vortexed immediately. The samples were spun at 14,00Og for 5 min and 200 μl of supernatant was transferred to 8 x 40 mm glass tubes for HPLC analysis. All samples were run in duplicate. An HPLC with UV and fluorescence detectors connected in tandem was set up for the quantification of tryptophan and kynurenine. The HPLC system consisted of a Waters (Milford, MA) model 515 pump, model 717 auto sampler, model 490 programmable absorbance UV detector and Hewlett Packard 1046A programmable fluorescence detector. The separation system consisted of a Zorbax SB-Ci ₈ column (150 x 4.6 mm, 3.5-μm particle size; Phenomenex, Torrance, CA), a Luna Ci ₈ Guard column (30 x 4.6 mm, 5 μm; Phenomenex), with a mobile phase composed of 97.3%, 15 mM KH ₂ PO ₄ (pH=5.5) and 2.7% acetonitrile (flow rate, 0.8 ml/min). The column eluant was monitored by fluorescence detection using excitation and emission wavelengths of 285 nm and 365 nm, respectively, for tryptophan and by UV detection at 360 nm for kynurenine. Chromatograms looked similar for analyses from cultured media as well as from serum. The limits of quantification for tryptophan and kynurenine are approximately 1.6 μM and 0.16 /xM, respectively. Decreasing the mobile phase pH from

6.5, which was used in the published HPLC assay (Bernhard Widner ERW, Harald Schennach , Helmut Wachter and Dietmar Fuchs Clinical Chemistry., . Simultaneous Measurement of Serum Tryptophan and Kynurenine by HPLC,. 1997:2424-2426), to 5.5 accelerated the elution and sharpness of the tryptophan and kynurenine peaks. The retention times of tryptophan and kynurenine were stable over the course of time on a single run. Standard curves were included in each run. They were pure L-tryptophan (100, 50, 25, 12.5, 6.25, 3.12, 1.56 μM) and kynurenine (10, 5, 2.5, 1.25, 0.625, 0.312 and 0.156 μM) diluted in Bovine Serum Albumin (BSA) concentration. Standards were prepared using the same TCA precipitation as for the unknown samples. RNA analysis

Initially, endpoint RT-PCR analysis was performed to determine if the wild type and the variant cDNAs were expressed. In later experiments, the assay was converted to a real-time quantification PCR assay as described below. Cells were harvested after 48 hr and total RNA was extracted using RNeasy kit (Qiagen, Inc., Santa Clarita, CA) following the manufacturer's protocol. Following the extraction of total RNA, the samples were treated with DNase I (DNA-free™; Ambion, Austin, TX). Total RNA concentrations were measured using an Agilent Bioanalyzer lab-on-a-chip (Agilent Technologies, Palo Alto, CA). The RNA quality was checked based on the ratio of 28S/18S ribosomal RNA. Reverse transcription (RT) was performed on 1 μg of RNA using Promega Reverse Transcription kit (Madison, WI). All primers were purchased from Integrated DNA Technologies, Inc. (Coralville, IA). The specific sequences of primers were designed using Primer 3 (http://frodo.wi.mit.edu/cgi- bin/primer3/primer3_www.cgi) using the sequence from NCBI (Xl 7668). GAPDH was used as a control. Quantitative real time RT-PCR analysis using SYBR Green was performed to assess the mRNA level in transiently transfected HEK293 cells with the wild type and variant IDO constructs. Briefly, the reaction volume was set at 25 μl with the following composition. Both primers were diluted to 20 μM and used 0.25 μl each (to a final concentration 200 nM). SYBR green was used to quantify the PCR products and fluorescein was included for the iCycler well-factor correction. The samples were amplified using the Platinum Supermix UDG (2X) (Invitrogen, Carlsbad, CA). Two μl of cDNA were used in the reaction. The rest of the volume was made up by water to a final

volume of 25 μ\. Samples were amplified using the conditions. Samples were incubated at 50 ⁰ C for 2 minutes followed by 30 cycles of amplification using the following program: denaturation at 95 ⁰ C for 30 sec, annealing at 54°C for 1 minute and extension of PCR product at 72°C for 1 minute and final extension at 72°C for 10 minutes. The 2 ^{" δδ l} method was used to calculate relative changes in gene expression determined from real-time quantitative PCR experiments (Kreuzer KA et al., Cancer Res. (1999)13:3171- 3174.

Western blot analysis

The indoleamine 2,3 dioxygenase protein levels in the transfected HEK293 cells were determined by western blot. The total protein concentrations were determined using the BCA method (Pierce, Rockford, IL). Briefly, 100 μg of total protein from each samples were loaded and separated on a 4-20 % SDS-polyacrylamide gel (Invitrogen, Carlsbad, CA). Electrophoresis was performed for 1 hr and 30 min at 125 V, and proteins were transferred to Polyvinylidene fluoride (PVDF) membranes overnight at 4 ⁰ C at 35 V. The membranes were then blocked overnight with 5 % milk powder in TBST (Tris-HCl (25 mM; pH 7.5), KCl (3 niM), NaCl (140 mM) Tween-20 (0.05%)). The following day, the membrane was incubated with an anti-IDO primary antibody diluted 1 :500 with 5% milk powder in TBST. We used a mouse anti-human monoclonal antibody directed against hIDO amino acids 78-184 (USBiological, Swampscott, MA). Following the primary incubation, the membranes were washed three times. The secondary antibody was a goat anti-mouse horseradish peroxidase (Pierce, Rockford, IL) diluted 1 : 10,000 in 5 % milk powder in TBST. The secondary antibody was incubated for 2 hr and then washed three times in TBST. The bound antibody was detected by enhanced chemiluminescence performed with the ECL™ Western Blotting Analysis Kit (Pierce, Rockford, IL).

Statistical analysis

Data are expressed as mean ± SD, and statistical analyses were performed with the SPSS statistical program. One way analysis of variance with the Dunett Mest was used to evaluate the difference between wild type and variants. A p-value less than 0.05 was considered significant.

RESULTS Identification of INDO genetic variants

To identify genetic variants of indoleamine 2,3 dioxygenase, we resequenced the exons and intron-exon borders of the INDO gene. We used 48 African American (AA) and 48 Caucasian (CA) DNA samples from the Coriell DNA repository. These DNA samples are from unrelated individuals without known hereditary diseases.

In these samples, 17 INDO genetic variants were identified . The detailed information on these variants is provided in Table 2. Eight of the variants were observed exclusively in the African American samples, 4 exclusively in the Caucasians samples and 5 in both populations. Allelic frequencies of 4 of the 9 newly identified intronic

SNPs were greater than 15%; three of those were in putative intron/exon splice junctions, which may alter the INDO mRNA processing. We also identified four variants that change the predicted IDO amino acid sequence; three are nonsynonymous SNPs and one is a 9 bp deletion. The first nonsynonymous SNP (Ala4Thr) changes the predicted amino acid at position 4 from an Ala to a Thr. The minor allele (Thr) was observed in 2 of the 48 African American samples (96 alleles), with an allelic frequency of 2%. Both samples were heterozygous at this site.

The second nonsynonymous SNP (Arg77His) was in exon 3 and changes the predicted amino acid at position 77 from an Arg to a His. One minor allele (His) was observed in the 48 African American samples (96 alleles), with an allelic frequency of 1%. A summary chart listing the genetic polymorphisms identified in the INDO gene based on the analysis of Coriell DNA samples from 48 African Americans and 48 Caucasians is provided in Table 2.

The nucleotide positions referred to are relative to the translation start site. The first nucleotide of the translation initiation codon are assigned the number (+1). The numbering is based on accession # X17668. Allelic frequencies are the number of variant alleles out of the 96 alleles (48 subjects) in each group. African American (AA) and Caucasian (CA). * Genetic variants not in public databases.

The third nonsynonymous SNP changes the predicted amino acid at position 197 from Leu to He on exon 7. This SNP was observed in one African American sample, with an allelic frequency of 1%.

The deletion of a 9 bp fragment in exon 7 replaces four predicted amino acids at position 199-202 (Ala-Leu-Leu-Glu) with an Asp. One minor allele (Asp) was observed in the 48 African American samples (96 alleles), an allelic frequency of 1%. In total, 5 of the 48 samples (-10%) of the African American samples contained nonsynonymous variant alleles (Table 2).

Bioinformatic analysis of the INDO genetic variants.

In order to help predict the functional significance of the amino acid variations, we performed a comparative genomic analysis of INDO gene. Evolutionary theory purports that amino acid variations occurring at conserved residues are more likely to have functional consequences. Using the FASTA algorithm to compare the human INDO gene with four other non-human species, we were able to identify evolutionarily conserved residues (Table 3). Sequence alignment was calculated using a Blosum50 amino acid substitution matrix using an affme gap penalty of d= a + k.β where a= -10 and β = -2. 32.

We defined Evolutionarily Conserved (EC) residues as those that were identical in all 5 vertebrate IDO orthologs used in this analysis (Table 4). The Arg77His and the two other amino acids (Ala-Leu) affected by the 9 base pair deletion were conserved among all 4 species. The third scoring method tested was SIFT, an algorithm that assigns scores to changes in amino acids on the basis of both residues involved and by aligning orthologs for the protein of interest (i.e. it uses both evolutionary and physical/chemical data). In general, SIFT values of <0.1 are predicted to affect protein function and assigned as Intolerant, but if this value is >0.1 it will be assigned as Tolerant. Using this method, the Ala4Thr and the Arg77His were predicted to be intolerant. The 9 base pair deletion was predicted to possibly intolerant.

Table 3. Indoleamine 2,3 dioxygenase comparative genomics: amino acid conservation for human EDO polymorphic residues

Variant alleles Exon 1 Exon 3 Exon 7 Exon 7 (9base pair deletion)

199-200-201-202 Amino acid AIa ⁴ ThT Arg ⁷⁷ His LeU ¹⁷⁹ IIe Ala-Leu-Leu-Glu >Asp (SEQ ID NO 15)

Conservation EU EC EU C E

Human A R L ALLE (SEQ ID NO 15)

Mouse P R E ALHD (SEQ ID NO 47)

Rat P R E ALCS (SEQ ID NO 48) Dog L R K ALHY (SEQ ID NO 49)

Cow P R Q ALLE (SEQ ID NO 15)

Amino acid locations of variant residues in human indoleamine 2,3 dioxygenase are shown. Data for four non-human species are listed Those ammo acids which are conserved among species are highlighted

Table 4. Human indoleamine 2,3 dioxygenase (EDO) variant amino acid 'scoring'

Scoring system for variant residues hIDO Amino acid *Activity relative Immunoreactive protein C/U PolyPhen SIFT changes to wild-type (% )

Wild-type 100 Yes - - -

Exon 1 Ala4Thr 100 Yes U NP IT

Exon 3 Arg77His 10 No C POS IT

Exon 3 Arg77Lys# 20 No C POS IT

Exon 7 Leul79Ile ND ND U BN T

Exon 7 Ala-Leu-Leu-Glu 1 No c/u ^@ ND IT/T

> ASD (SEO ID No- 15)

The table lists levels of activity and immunoreactive protein for variant IDO compared to wild- type, as well as PolyPhen (Polymorphism Phenotyping) SIFT (Sorting Intolerant From Tolerant) values and whether that position was evolutionary conserved (C) or unconserved (U) among the species listed in table 3 (ND) Not determined. *Activity measured as the formation of kynurenme (from Fig. 3A); # this variant does not occur naturally; @ partially conserved (Ala- Leu) conserved, but not (Leu-Glu); (NP) not predicted, (POS) possibly damaging; (BN) benign; (IT) intolerant; (T) tolerant.

Laboratory analysis of INDO variants

Using in vitro expression of the IDO cDNA's, we tested the functional effects of the genetic variants on the IDO enzyme activity. We focused our studies on the nonsynonymous SNPs Ala4Thr and Arg77His and the 9 bp deletion. Based on the bioinformatic analyses above, these appeared to be the most likely to have functional effects on the IDO enzyme activity. The wild-type and variant cDNAs were expressed in the COS-7 cells using the pcDNA3 vector. COS-7 cells were used because they have very low endogenous IDO activity and the transfected wild-type IDO is highly active in this cell line. Since they are a mammalian cell line, they also contain the post- translational modification machinery and protein degradation systems that may affect the activity of the variant IDO enzymes. To determine the IDO enzyme activity, we analyzed the tryptophan and kynurenine concentrations of the cultured media harvested 48 hrs after transfection. The results are shown in (Fig IA and IB).

As expected, the transfection of the wild-type cDNA was highly active. The cultured media contained reduced tryptophan and elevated kynurenine concentrations. The expression of the Ala4Thr resulted in similar tryptophan metabolism. In contrast, the Arg77His transfected cells had very little metabolic activity. Relative to the wild-type cDNA, the Arg77His kynurenine production was reduced by >90%. When the Arg at position 77 was replaced by a Lys, another basic and hydrophilic amino acid, the activity was also reduced.

To assure that the differences in the enzyme activity in the variant IDO constructs were not due to artifacts in the plasmid production replicated these studies in several ways. First, we expressed the cDNAs in another cell line, the human embryonic kidney cells (HEK293), using the pcDNA3 IDO plasmids. The enzyme activity of the expressed enzymes was similar to that observed in the COS-7 cells (see Figs. 1C and ID). In the HEK293 cells, we also expressed the 9 bp deletion in exon 7. This cDNA showed no detectable activity (Figs. 1C and ID). Second, cDNA's were also expressed in the COS-7 cells from a second plasmid (pCMV-SPORT). A similar reduction in activity was observed. Third, to verify that the variant IDO mRNAs were being expressed from the plasmids, we also quantified the IDO mRNA expression in the transfected HEK293 cells (Fig IE). The differences in the mRNA expression levels of the variant IDO mRNAs was

not sufficient to account for the large decrease in IDO enzyme activities of the Arg77His and the 9 bp deletion. Similar mRNA expression was seen from the transfected COS-7 cells. Fourth, to be certain that the concentrations of wild-type and variant plasmids used for the transfections were similar, we quantified the working dilutions of the plasmids using DNA 7500 chip in the Agilent Bioanalyzer 2100. Fifth, we also used multiple preparations of the plasmids in the replicates to assure that the reduced activity was not due to an artifact in one of the preparations.

To assess the effects of the genetic variants on the expression of the IDO protein, we harvested the transfected cells and analyzed them by western blot. We detected immunoreactive IDO protein in the cells transfected with the wild-type and the Ala4Thr plasmids, but not the Arg77His, the Arg77Lys, the 9 bp deletion, or the empty pcDNA3 vector. These results were similar to the enzyme activity results, which indicate that the reduced enzyme activity of the variant proteins may be due to altered stability of the variant proteins. Location of the variant positions in the 3D structure of the IDO protein.

Since the Arg77His and the 9 bp deletion appeared to affect the metabolic activity when their respective cDNA's were transfected into cells, we mapped these variant sites on the IDO crystal structure to determine their position relative to the substrate and heme binding site. The X-ray crystal structure of human indoleamine 2,3-dioxygenase has been solved by Sugimoto et al 2006. Because the crystal structure of the first 11 amino acids of IDO was not determined, the Ala4Thr could not be mapped. Neither the Arg77His nor the 9 bp deletion appeared to be part of the substrate recognition or heme binding site. However, it is possible that the changes indirectly alter those binding sites through changes in the protein folding or structure.

Discussion

We have identified naturally occurring genetic variants in the indoleamine 2,3- dioxygenase (INDO) gene that cause impaired functional activity. The existence of these alleles in the Coriell diversity panel subjects indicate that the variants occur in the general population. Although we observed genetic variants in both Caucasian and African American samples, the impaired function alleles were detected exclusively in the African American subjects. Since our sample size was relatively small, it remains possible that

these variants also exist in Caucasian populations and in other ethnic groups. Within the African American samples, -4% of the subjects carried a nonfunctional INDO allele. The reduced function alleles included the Arg77His in exon 3 and the 9 bp deletion in exon 7. Some of the other genetic variants are also in important functional sites, such as those in the exon-intron splice junctions, may also have important functional effects.

We have yet to identify any subjects that have two nonfunctional alleles. This may be a result of the low frequency of these genetic variants; however, it is also possible that having two nonfunctional alleles may cause sufficiently impaired immune function to result in a high susceptibility to a variety of immunity related diseases. If this is the case, it is unlikely that those people would have been included in the Coriell DNA samples, since these are people who do not have any known diseases at the time of the sampling. Since IDO activity appears to be involved in the maintenance of pregnancy, it is also possible that homozygosity for the reduced activity alleles is embryonic lethal. Although the INDO knockout is not lethal in transgenic mice, the effect may differ in humans, since there is much greater genetic diversity between parents compared to inbred mice.

The variants may affect the enzyme activity by affecting protein stability. The altered folding of variant proteins, and consequently, recognition by the proteosomal degradation pathway, has been shown to cause reduced protein levels. This is often the result of rapid variant allozyme degradation through a proteasome-mediated process. Studies on other genes indicate that this is a common mechanism of reduced enzyme activity caused by genetic variants. Our results showing that immunoreactive IDO protein is reduced in cells transfected with variant cDNAs are consistent with this mechanism.

The variants we have identified may have phenotypic effects in the human population. Since many preclinical studies indicate that IDO frequently induces immune tolerance, people with genetically reduced IDO activity may be at an elevated risk for inflammatory and autoimmune type diseases. As described above, maternal tolerance of paternal antigens may also be affected. In contrast to the potential effects on tolerance, other preclinical studies indicate that NK cell activity is partially dependent on IDO activity. Consequently, people with reduced IDO activity may have impaired immune function and have an increased susceptibility to infectious diseases. Since there does not appear to be redundancy of tryptophan metabolizing enzymes that are induced in peripheral tissues by inflammation, it is likely that people with no functional INDO

alleles would have phenotypic consequences. These phenotypes would likely be revealed to a greater extent in human populations that are exposed to many pathogenic antigens than in INDO knockout mice that are housed in relatively clean environments. These genetic variants may also contribute to inter-individual variability in IDO expression/activity in important clinical settings, such as cancer and during the therapeutic induction of IDO activity by interferons.

EXAMPLE 2 Stability of IDO variant proteins

To investigate whether the stability of the IDO polypeptides may be impacted by the proteasome-mediated process, the variants were first expressed in vitro using a rabbit reticulocyte transcription and translation expression system and the resulting proteins were recovered and purified by HPLC. As shown in Fig. 4A and 4B, the ArgWHis variation does not affect the IDO enzyme activity when expressed using a rabbit reticulocyte transcription and translation expression system. Furthermore, use of a proteosomal inhibitor (Hemin) increases exon 3 variant (both ArgWHis and Arg77Lys) activity in a dose dependent manner in HEK293 cells transfected with genes encoding the variant IDO enzyme. Additional experiments wherein host cells are transfected with either the variant gene alone or with both the wild type gene and the variant gene demonstrate that the Arg77His (exon 3) and Exon 7 (9 bp del) variants are not dominant negative.

EXAMPLE 3 Identification of Additional Deficient IDO variants cDNAs encoding additional IDO genetic variants using site-directed mutagenesis of the wild-type cDNA in the pcDNA plasmid, as described for the exon 3 variant above will be constructed, and these genetic variants will be transfected into COS-7 cells (as describe in Example 1) and enzyme kinetics will be determined. Kinetic constants (Km and Vmax) will be estimated by nonlinear regression analysis using WinNonlin Software Version 3.1 (Pharsight, Mountain View, CA). Formation rates (V) of metabolites versus substrate concentrations (S) will be fit to a simple Michaelis - Menten Equation (V = Vmax X S/ (Km + S)). COS-7 cells will be used for these studies because they have undetectable endogenous IDO activity and the transfected IDO activity is active in these

cells (see Fig. 1). IDO activity will be monitored using the IDO enzyme assay on cell lysates and by measuring the tryptophan and kynurenine concentrations in the media.

The effect of the genetic variants on the steady state mRNA expression levels will be determined by transfecting the wild-type and variant cDNA in COS-7 cells and measuring the IDO mRNA levels by quantitative RT-PCR (qRT-PCR). Endogenous IDO mRNA expression is undetectable with 30 cycles of PCR in the COS-7 cells. Cells will be transfected with the variant cDNAs using the IDO/pcDNA3 expression vector and IDO mRNA levels will be determined by qRT-PCR. A real-time qRT-PCR has been established using SYBR green with allele specific primers. This assay amplifies a single sized PCR product and detects the transfected IDO mRNA in < 20 cycles but has no detectable amplification in the control tranfectants at 30 cycles. A standard curve will be created using a cloned PCR product and using a GAPDH as a normalizing control.

If there are significant effects of the genetic variants on mRNA concentrations, additional experiments will be conducted to determine the variant have a reduced mRNA half-life. To do this, the cDNAs will be transfected into the COS-7 cells for 24 hr and then transcription will be stopped by adding actinomycin D to the cultures. RNA will be isolated at 0, 0.5, 1 , 2, 4, 6 12 and 24 hrs after the addition of actinomycin D. IDO mRNA concentrations will be determined by qRT-PCR at these time points and the IDO mRNA half-life calculated by the decay of the mRNA transcripts. Nonsynonomous genetic variants are frequently associated with reduced protein expression. Therefore, the effect of the genetic variants on protein expression will be determined by western blot. Western blot analyses are currently conducted using the mouse anti-human IDO monoclonal antibody MAB5412 (Chemicon, Temecula, CA). This antibody works well for both Western blots and immunohistochemistry. Western blots are detected using the ECL detection kit (Pierce).

The reduction in protein expression caused by genetic variants is frequently the result of increased rates of protein degradation. This is usually due to alterations in protein folding and consequently altered interactions with heat shock proteins and accelerated targeting to the proteosomes and/or aggresomes. For IDO genetic variants that have altered protein expression levels, the protein degradation rates will be investigated using methods previously described by Dr. Richard M. Weinshilboum. Briefly, [ ³⁵ S] methionine- labeled wild-type and variant IDO isoforms will be generated using the TNT in vitro transcription and translation system (Promega). The labeled wild-

type and variant proteins will then be incubated with the rabbit reticulocyte lysates (RRL) and an ATP generating system for 0, 0.5, 2, and 4 hrs. The remaining protein will be analyzed by SDS-polyacrylamide gel electrophoresis and visualized by autoradiography. X-Ray films will be quantified using the Kodak EDAS 290 Gel Documentation System in the PFs laboratory. If the mechanism appears to be a result of accelerated degradation, additional experiments will be conduct to determine the pathway of degradation by pretreating the RRLs with proteosome inhibitors (MG132 (160 μM), lactacystin (500 μM) or hemin (100 μM)) or the lysosome inhibitor chloroquine (200 μM). The accelerated degradation may also be mediated through the heat shock protein 90 (hsp90) so the effect of the hsp90 inhibitor, geldanamycin will also be tested.

EXAMPLE 4

Screening of genetic variants associated with the sarcoidosis samples

Sarcoidosis is an immune system disorder characterized by non-necrotising granulomas (small inflammatory nodules). The granulomas can grow and clump together, making many large and small groups of lumps. If many granulomas form in an organ, they can affect how the organ works. Sequencing the IDO gene from 23 individual sarcoidosis samples revealed the sequence variants disclosed in Table 5. Details of the polymorphisms listed in Table 5 are presented in Table 6. In particular, it is noted that subject 143 has the lowest kynurenine/typtophan (Kyn/Trp) ratio, and this sample is the only one with a mutation in the 5' UTR at position -89. Accordingly, it is anticipated that this polymorphism, gataaa[C > TJtgtggt (SEQ ID NO: 30), may serve as a valuable marker for screening patients for the presence of deficient IDO.

Two SNPS (SEQ ID NOs: 50 and 51) in the sarcoid samples were not observed in the Coriell samples (see Tables 1 and 2). In the sarcoid samples, 12 of the 23 samples had one of these two SNPS. This is a very high frequency, considering that they were not observed in the 96 Coriell samples. Thus, these two polymorphisms may be a genetic risk factor for sarcoidosis.

Table 5

N)

Table 6

EXAMPLE 5

Screening of genetic variants associated with 11 cancer patients.

IDO genes from 11 cancer patients were sequences to identify further IDO polymorphisms. The allelic frequencies as indicated in Table 7 represent the number of variant alleles out of the 22 alleles (11 cancer patients) screened. The two SNPs listed in Table 7 were not identified in the Coriell samples (healthy subjects). One of these (SEQ ID NO: 51) was observed in all three angiosarcoma samples and one of two sarcoma samples. Thus, it may be a genetic risk factor for sarcomas and used to screen for cancer.

Table 7