Field of the invention

The present invention relates to a new genetically attenuated, live organism against malaria. The present invention further relates to a pharmaceutical composition comprising such live attenuated organism. The present invention further relates to methods of treatment and/or prevention using such live attenuated organism.

Background of the invention

Malaria is a major health treat in mainly sub-Saharan Africa, claiming several million lives each year. Malaria is caused by hematoprotozoan parasites belonging to the Plasmodium genus, which use mosquitos as a vector in the reproduction cycle. Four species of Plasmodium are known to cause malaria in humans, P. falciparum (Pj), P. vivax, P. ovale and P. malariae, while other species such as P. knowlesi, P. yoelii and P. berghei (Pb) are known to cause disease in non human hosts.

P. falciparum causes the most lethal form of malaria, malaria tropica. Worldwide, 250 million people are at risk of being infected with the parasite on a daily basis, and especially children under five in sub-Sahara Africa contribute to a mortality figure of 800.000 yearly (3). Artemisinin-based combination therapies are first line drug treatments, however, resistance against these regimens has been developing in North- East Asia (4). The number of antimalarial drugs that are available is limited, and opportunities to treat patients suffering from multidrug resistant malaria are scarce. There is an urgent need for preventive measures to decrease malaria burden and morbidity. At this moment, no effective vaccine is available. The most promising vaccine candidate, the RTS,S subunit vaccine priming against recombinant circumsporozoite protein, is being tested in a third phase clinical trial. However, preliminary results indicate that protection does not exceed 35% of the volunteers (5). Whole parasite vaccination has been proposed as it induces a superior immune response to a broad spectrum of parasitic immunogens. Radiation Attenuated Sporozo ^' ites (RAS) have been considered as the gold standard, as these sporozoites do not complete liver stage development but do induce an efficient immune response resulting in sterile protection in human trials (6). From a product manufacturing perspective, GAPs have the clear advantage of representing a homogeneous parasite population with a defined genetic identity. The genetic attenuation is an irreversible, intrinsic characteristic of the parasite that does not require additional manufacturing steps like irradiation. Furthermore, in the manufacturing process of GAP-infected mosquitoes, operators are never exposed to Pf parasites that can cause disease.

The use of Chemically Attenuated Sporozo ^' ites (CAS) is another strategy of whole parasite presentation to the immune system (7). Efficacy of blood stage prevention in this case depends on variable factors such as host metabolism, and this strategy is therefore insufficiently safe for clinical use. Genetically attenuated Plasmodium parasites (GAP) can serve as a whole organism vaccine against malaria. Vaccination with live, attenuated parasites (i.e. sporozoites) is safe when parasite development is halted prior to the pathogenic post-hepatic blood stage. Genetic attenuation can be accomplished by deleting genes that encode proteins essential for development of the Plasmodium liver (hepatic) stage. In order to use genetically attenuated sporozoites as an immunogen two criteria must be met; attenuation needs to be complete, i.e. no blood stage development, and vaccination must induce protective immunity. Evidence has been presented that immunisation with parasites that arrest 'late' into liver- stage development induces stronger immune responses than parasites that arrest soon after hepatocyt invasion. However, until now no 'late liver-stage arresting' GAP have been identified in rodent and human parasites that have a complete attenuation phenotype (1, 2).

GAP vaccine candidates that have been described (11,13) include GAPs based on genes essential for i) the formation and maintenance of a parasitophorous vacuole (PV) (b9, p52, p36, uis3 and uis4; and ii) type II fatty acid synthesis (i.e. fabb/f, fabz, pdh ela; ), and iii) the regulation of gene expression in the liver stages (sapl/slarp). A critical safety requirement for GAPs in order to qualify as vaccine candidate is total absence of blood infections during immunization and therefore the complete abrogation of liver-stage development. Unfortunately many of the above mentioned target genes including p52, p36 and those involved in type II fatty acid synthesis show a leaky phenotype, resulting in blood stage infections after administration of high numbers of sporozoites. Incomplete liver stage arrest obviously disqualifies GAPs for further clinical development for safety reasons. Functional redundancy of related genes has been reported more often in Plasmodium, therefore the generation of GAPs from which multiple genes are removed from the genome each governing a critical yet independent cellular process is preferable. Genes encoding proteins with a role in late stage parasite liver development could be an attractive target, since induction of protection by late arresting GAPs may be superior to early arresting GAPs. Identification of genes critical and uniquely selective for liver stage development has become a major challenge for GAP vaccine development. Furthermore, single gene deletion GAPs will most likely not be adequate.

The inventors considered that a more thorough insight into essential processes of the parasite's biology would therefore be of invaluable importance. They had previously identified all ATP Binding Cassette (ABC) transport proteins of many Plasmodium species and localized three of its members on the P. falciparum plasma membrane (7). ABC transport proteins are evolutionary well conserved membrane transporters that translocate heterogeneous compounds at the expense of ATP and are able to maintain steep concentration gradients (8). A typical ABC transport protein consists of two transmembrane domains (TMD) in which six transmembrane helices are embedded jointly forming the transportation pore containing substrate binding sites, alternated with two cytosolic nucleotide binding domains (NBD) for ATP hydrolysis. ABC transport proteins can be encoded as full transporters, or as half transporters of which the TMD and NBD upon expression recombine on the membrane to form a fully functional transportation unit. The Multidrug Resistance-associated Proteins (MRP) form a subfamily of full transporters for which transported compounds include organic anions and glutathione-, glucuronate- or sulfate-conjugated xenobiotics (9). These transport proteins are mostly appreciated for their role in drug resistance through increased extrusion of compounds after appearance of mutations or expression upregulation. Also in P. falciparum, single nucleotide polymorphisms and copy number variation in mrpl have been associated to decreased drug sensitivity, most likely by extrusion of conjugated forms of antimalarial compounds (10-12). However, physiological roles that MRP transport proteins may play such as involvement in homeostasis, pH adaptation, autocrine pathways or decreasing intracellular concentrations of potentially harmful compounds, remain unknown. The inventors hypothesized that these functions could be of essential importance during different stages of the parasite life cycle. Accordingly, there is a large demand for a GAP vaccine candidate that is safe and arrests late during hepatic stage. However, such a GAP that develops until a late stage but does not induce blood stage parasitaemia has to date not been described (1). Description of the invention

Surprisingly, it has now been demonstrated that genetically attenuated Plasmodium organisms lacking mrp genes are completely arrested in liver stage development; these mutant parasites arrest late during liver stage development, during the process of parasite replication (schizogony), providing attractive GAPs for anti-malaria immunization strategies .

When investigating the physiological role of ATP Binding Cassette (ABC) transport proteins in Plasmodium during liver stage development, the inventors arrived at the finding that genes expressing C-type ABC transport proteins, i.e. the Multidrug Resistance-associated Proteins (MRP), were shown to be expressed in both blood and liver stages of Plasmodium. Generation of parasite mutants lacking expression of MRPl and / or MRP2 demonstrated normal development of the blood and mosquito stages. However, mutant parasites lacking both mrp genes were shown to be defective in liver stage development. MRP2 appeared mainly responsible for this effect, with an additive effect of MRPl . Both in the P. berghei rodent model of malaria and the human parasite P. falciparum the mutants lacking mrp genes were demonstrated to be completely arrested in liver stage development in vivo (mice) and in vitro (primary human hepatocytes), respectively. These mutant parasites demonstrated to arrest late during liver stage development, during the process of parasite replication (schizogony). In the rodent model the MRP deficient GAPs generated protective immune responses after immunization even with low doses of the attenuated sporozoites.

The inventors have targeted the mrp transporter genes in P. berghei and P. falciparum in blood stage parasites, which results in a Genetically Attenuated Parasite (GAP) that arrests during liver stage development. The deletion is stable and irreversible, as a double crossover knockout strategy was used. Furthermore, the inventors have removed selection marker sequences by FLPe mediated recombinase, assuring complete absence of heterologous DNA and leaving only a 34-bp scar at the targeted site (8). The background is homogenous and parasites are genetically stable. Gene deleted parasites arrest late during development, as schizogony and subsequent formation of merozoites is abolished. However, waning numbers of significantly size-reduced parasites can be detected until at least ten days of hepatic development in P. falciparum. The remaining parasites do create a functional parasitophorous vacuole and correspondingly express EXP1, whereas merozoite developmental characteristics such as MSP1 expression are abolished.

These characteristics are essential for a vaccine candidate. There is a high availability of the parasites, as they replicate normally during blood stage growth. Safety concerning non-reversion of the parasite to a wild type phenotype is guaranteed by the stable deletion of the genes, no drug-sensitivity altering heterologous sequences remain in the gene deleted parasites, combined with a stable genetic background. As the gene deleted parasites do not form merozoites, breakthrough to blood stage infection is not feasible. Furthermore, the developmental arrest is specifically pinpointed late during liver stage development. It has been demonstrated that a later arrest induces a superior immunoprotective response, either due to the broader repertoire of antigens that is presented or the increased time-window in which immunity can be obtained (9).

The GAP according to the present invention differs from the existing GAP candidates as the genes that are targeted lie in a different pathway and contain general transport functions. The existing GAP candidates arrest at an early stage after hepatocyte invasion, inducing immunity only against sporozoite and early hepatocytic stage antigens. In contrast, the deletion of the mrp gene family results in a complete but late developmental arrest, as schizogony is abolished and parasite maturation is thus absent. Accordingly, the attenuated parasites according to the present invention remain intrahepatically for a prolonged period, and present a larger repertoire of antigens to invoke a far more efficient immune response.

Accordingly, in a first aspect the present invention provides for a genetically attenuated, live organism of the Plasmodium genus. Such organism is herein referred to as an organism according to the invention. Preferably, in an organism according to the invention, the live attenuation is mediated by decreased expression of a gene encoding a protein necessary for continued in vivo survival, proliferation in the liver and/or infection of red blood cells of the host by the organism. More preferably, expression of a gene encoding a multidrug resistance-associate protein (MRP) is decreased. More preferably, a gene encoding a multidrug resistance-associate protein MDR is decreased. Even more preferably, the encoded MRP is MRP2 and/or MRPl, preferable MRP2 and MRPl .

Preferably, in the embodiments of the present invention, an MRP is an MRP from Plasmodium falciparum. A more preferred MRP is MRPl or MRP2 from Plasmodium falciparum. A preferred MRPl is an MRP 1 encoded by a sequence that has at least 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity with SEQ ID NO: 18. Another preferred MRPl is an MRPl with an amino acid sequence that has at least 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity with SEQ ID NO: 17. A preferred MRP2 is an MRP2 encoded by a sequence that has at least 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity with SEQ ID NO: 20. Another preferred MRP2 is an MRP2 with an amino acid sequence that has at least 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity with SEQ ID NO: 19.

An organism with an additional gene deletion in an unrelated pathway such as membrane biogenesis could increase phenotype stability of the GAP in case complete schizont development and induction of blood stage parasitaemia cannot be prevented by mrp deletion alone; such organism is also within the scope of the present invention. Preferably, in an organism according to the invention, said decreased expression is mediated by complete or partial deletion of, or by a mutation of, the mrp2 and/or mrp 1 gene, resulting in a decreased quantity of the MRP2 and/or MRPl protein or resulting in production of non- functional MRP2 and/or MRPl protein. Alternatively to the previous embodiment, said decreased expression can be mediated by a decreased quantity of functional mrp2 and/or mrpl mRNA, preferably mediated by an antisense DNA or RNA construct. A preferred organism according to the invention is an organism that is selected from the group consisting of Plasmodium vivax, Plasmodium malariae, Plasmodium ovale, Plasmodium falciparum, Plasmodium knowlesi, Plasmodium yoelii or Plasmodium berghei. A preferred Plasmodium falciparum is selected form the group consisting of a 3D7 strain, a falciparum Vietnam-Fort (FVO) strain, a falciparum Uganda-Palo Alto (FUP) strain, a falciparum FCH/4 (Philippines) strain, a falciparum Santa Lucia (Salvador I) strain and a falciparum Malayan Camp (MC) strain.

In a second aspect, the present invention provides for a pharmaceutical composition comprising an organism according to the invention and a pharmaceutically acceptable carrier and/or an adjuvant. Such composition is herein referred to as a composition according to the invention or a vaccine composition according to the invention. Preferably, the organism in the second aspect of the invention is an organism as described in the first aspect of the present invention.

The organism and composition according to the invention can conveniently be used to elicit an immune response in a subject against a Plasmodium.

Accordingly, in a third aspect, the present invention provides for a method for eliciting an immune response in a subject, comprising introduction into said subject an effective amount of an organism or composition according to the present invention. Such method is herein referred to as a method according to the present invention.

The third aspect of the present invention also provides for the medical use and methods of treatment or prevention. Such medical use and methods of treatment are herein referred to as medical use and methods of treatment according to the present invention. Accordingly, there is provided the use of an organism or composition according to the present invention as a medicament in a subject, preferably for the treatment or prevention of a Plasmodium associated condition, preferably malaria.

Accordingly, there is also provided an organism or composition according to the present invention for use as a medicament, preferably for use in the treatment or prevention of a Plasmodium associated condition, preferably malaria.

Accordingly, there is also provided a method of treatment or prevention of a Plasmodium associated condition, preferably malaria, comprising administering to a subject an organism or composition according to the present invention. Preferably, the organism and pharmaceutical composition in the third aspect of the invention are the organism as described in the first aspect of the present invention and the composition as described in the second aspect of the invention. In a fourth aspect, there is provided a kit for immunization of a subject against a Plasmodium associated condition, preferably malaria, comprising an organism or composition according to the present invention, further comprising instructions for use. Preferably, the organism and pharmaceutical composition in the fourth aspect of the invention are the organism as described in the first aspect of the present invention and the composition as described in the second aspect of the invention.

Herein, an "attenuated organism" is an organism, preferably a plasmodium species which is impaired in infectivity or impaired in completing its lifecycle, such as showing reduced pathogenic post-hepatic blood stage infection, and complete attenuation of plasmodium is the absence of pathogenic post-hepatic blood stage infection or inability to detect so.

Herein, an "organism" is a unicellular or multicellular living system. An organism of the Plasmodium genus embodies all species in the genus of Plasmodium, which is part of the Plasmodiidae family, Haemosporida order, Aconoidasida class, Apicomplexa phylum, Alveolata superphylum and Chromalveolata kingdom.

Herein, an "immune response" can be a humoral immune response, a cellular immune response or both. The term 'eliciting an immune response' refers to the ability of a substance to cause a humoral and/or cellular response, whether alone or when linked to a carrier, in the presence or absence of an adjuvant. 'Neutralization' refers to an immune response that blocks the infectivity, either partially or fully, of an infectious agent.

A 'vaccine' is an immunogenic composition, such as an attenuated organism according to the present invention, capable of eliciting protection against malaria, whether partial or complete. A vaccine may also be useful for treatment of an infected individual, in which case it is called a therapeutic vaccine.

The term 'therapeutic' refers to a composition capable of treating malaria infection.

Herein, decreased expression of a gene is defined as that the protein levels of a protein encoded by the gene are less than 100% compared to a non-modified Plasmodium (wild-type) species at the same developmental stage, preferably said protein levels are between 0% and 50% of the wild-type, preferably less than 50%, 40%, 30%, 20% 10%, 5%, 2%, 1%, 0.5%, 0.2%, 0.1% or 0.05% of the wild-type Plasmodium at the same developmental stage; most preferably no encoded protein is detectable in the organism of the invention. Decreased expression of a gene in the present invention also comprises production of a protein by the subject gene which is truncated, mutated or otherwise different from the corresponding protein in wild-type Plasmodium; preferable such truncation, mutation or alteration results in a protein with decreased functionality or a mis-localized protein or another change in physiology resulting in different functioning of the protein when compared to the corresponding protein in the wild-type Plasmodium .

Decreased expression can be achieved by any method known to the person skilled in the art, including but not limited to deleting the gene encoding the subject protein (knock-out), deleting a part of the gene encoding said protein, mutating the gene encoding said protein, etc. It is also envisioned that in addition to decreased expression of the genes described herein that other genes are introduced that e.g. result in an increase of the immune response or encode an antigen not associated with Plasmodium thus resulting in cross- immunity against both a Plasmodium associated condition and to the condition associated with the antigen not associated with Plasmodium. Such other gene may be introduced anywhere, even at the site where one of the genes according to the invention is (partly) deleted. It is also envisioned that expression can be decreased by mutating or deleting introns, 5 ' or 3 'UTR regions or promoter regions of the gene encoding the protein, or by disrupting transcription factors involved in transcription of the mRNA of said protein. It is also envisioned that decreased expression can be achieved by down-regulating mRNA levels, preferably by expressing a DNA or RNA construct which is antisense to the mRNA or gene sequence of the disrupted protein.

Alternatively, or in combination with the methods previously herein to achieve decreased expression, a compound that binds to and/or inhibits an mrp gene or an MRP protein, preferably MRPl and/or MRP2, more preferably MRPl and MRP2, wherein binding and/or inhibition results in decreased function of the MRP. Such compound can conveniently be used by subjects living in or travelling to or through a malaria endemic region. In this case, the subjects are not treated with the live, attenuated Plasmodium, but the Plasmodium is attenuated in vivo in the subject by the compound. Use, medical use and methods of treatment and prevention of these compounds are comprised within the scope of the present invention.

Preferably, decreased expression of a gene is defined as a level of the encoded protein of 0% and 50% of the corresponding protein in the wild-type Plasmodium at the same developmental stage, more preferably less than 50%, 40%, 30%, 20% 10%, 5%, 2%, 1%), 0.5%), 0.2%), 0.1%) or 0.05%> of the corresponding protein in the wild-type Plasmodium at the same developmental stage; more preferably the protein level is less than 20%, 10%, 5%, 1%„ 0.5%, 0.1%, 0.05% or 0.001%; most preferably, the protein level cannot be detected and is considered 0.000%>.

Decreased expression can also be expressed in mR A levels of the encoded protein. Preferably, mRNA levels are 0% and 50% of the corresponding mRNA in the wild- type Plasmodium at the same developmental stage, preferably said mRNA levels are lower than 50%, 40%, 30%, 20% 10%, 5%, 2%, 1%, 0.5%, 0.2%, 0.1% 0.05%, 0.01% or 0.001% of the corresponding mRNA in the wild-type Plasmodium at the same developmental stage.

"Sequence identity" or "identity" in the context of amino acid- or nucleic acid-sequence is herein defined as a relationship between two or more amino acid (peptide, polypeptide, or protein) sequences or two or more nucleic acid (nucleotide, polynucleotide) sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleotide sequences, as the case may be, as determined by the match between strings of such sequences. Within the present invention, sequence identity with a particular sequence preferably means sequence identity over the entire length of said particular polypeptide or polynucleotide sequence. The sequence information as provided herein should not be so narrowly construed as to require inclusion of erroneously identified bases. The skilled person is capable of identifying such erroneously identified bases and knows how to correct for such errors.

"Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one peptide or polypeptide to the sequence of a second peptide or polypeptide. In a preferred embodiment, identity or similarity is calculated over the whole SEQ ID NO as identified herein. "Identity" and "similarity" can be readily calculated by known methods, including but not limited to those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988).

Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Preferred computer program methods to determine identity and similarity between two sequences include e.g. the GCG program package (Devereux, J., et al, Nucleic Acids Research 12 (1): 387 (1984)), BestFit, BLASTP, BLASTN, and FASTA (Altschul, S. F. et al, J. Mol. Biol. 215:403-410 (1990). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al, NCBI NLM NIH Bethesda, MD 20894; Altschul, S., et al, J. Mol. Biol. 215:403-410 (1990). The well-known Smith Waterman algorithm may also be used to determine identity.

Preferred parameters for polypeptide sequence comparison include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); Comparison matrix: BLOSSUM62 from Hentikoff and Hentikoff, Proc. Natl. Acad. Sci. USA. 89: 10915-10919 (1992); Gap Penalty: 12; and Gap Length Penalty: 4. A program useful with these parameters is publicly available as the "Ogap" program from Genetics Computer Group, located in Madison, WI. The aforementioned parameters are the default parameters for amino acid comparisons (along with no penalty for end gaps).

Preferred parameters for nucleic acid comparison include the following:

Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); Comparison matrix: matches=+10, mismatch=0; Gap Penalty: 50; Gap Length Penalty: 3. Available as the Gap program from Genetics Computer Group, located in Madison, Wis. Given above are the default parameters for nucleic acid comparisons.

Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called "conservative" amino acid substitutions, as will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide- containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulphur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine- valine, and asparagine-glutamine. Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. Preferably, the amino acid change is conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to ser; Arg to lys; Asn to gin or his; Asp to glu; Cys to ser or ala; Gin to asn; Glu to asp; Gly to pro; His to asn or gin; He to leu or val; Leu to ile or val; Lys to arg; gin or glu; Met to leu or ile; Phe to met, leu or tyr; Ser to thr; Thr to ser; Trp to tyr; Tyr to trp or phe; and, Val to ile or leu.

A polynucleotide is represented by a nucleotide sequence. A polypeptide is represented by an amino acid sequence. A nucleic acid construct is defined as a polynucleotide which is isolated from a naturally occurring gene or which has been modified to contain segments of polynucleotides which are combined or juxtaposed in a manner which would not otherwise exist in nature. Optionally, a polynucleotide present in a nucleic acid construct is operably linked to one or more control sequences, which direct the production or expression of said peptide or polypeptide in a cell or in a subject.

As used herein the term "heterologous sequence" or "heterologous nucleic acid" is one that is not naturally found operably linked as neighboring sequence of said first nucleotide sequence. As used herein, the term "heterologous" may mean "recombinant". "Recombinant" refers to a genetic entity distinct from that generally found in nature. As applied to a nucleotide sequence or nucleic acid molecule, this means that said nucleotide sequence or nucleic acid molecule is the product of various combinations of cloning, restriction and/or ligation steps, and other procedures that result in the production of a construct that is distinct from a sequence or molecule found in nature. "Operably linked" is defined herein as a configuration in which a control sequence is appropriately placed at a position relative to the nucleotide sequence coding for the polypeptide of the invention such that the control sequence directs the production/expression of the peptide or polypeptide of the invention in a cell and/or in a subject.

"Operably linked" may also be used for defining a configuration in which a sequence is appropriately placed at a position relative to another sequence coding for a functional domain such that a chimeric polypeptide is encoded in a cell and/or in a subject.

Expression will be understood to include any step involved in the production of the peptide or polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification and secretion.

As described herein, an attenuated organism and composition according to the present invention may be introduced into a subject by injection or other routes of administration, in one or more administration events at different time points, thereby eliciting an immune response protective against malaria infection. An attenuated organism and composition according to the present invention and formulations employing these may be admixed in various combinations and or admixed with known proteins, peptides, or adjuvants which are known or believed to facilitate an immunological response, thereby providing enhanced immunity. Such components according to the present invention may be administered separately, i.e., at different time points, which is known or believed to facilitate an immunological response, thereby providing protection against malarial infection. For example, an attenuated organism and composition according to the present invention can be combined with one or more antigens or toxoids, such as tetanus toxoid, diphtheria toxoid, cholera toxoid, ovalbumin (OVA), or keyhole limpet haemocyanin (KLH).

Pharmaceutically acceptable carriers which can be used in the methods and compounds according to present invention include, but are not limited to, an excipient, a stabilizer, a binder, a lubricant, a colorant, a disintegrant, a buffer, an isotonic agent, a preservative, an anesthetic, and the like which are commonly used in a medical field. Also, the dosage form, such as injectable preparations (solutions, suspensions, emulsions, solids to be dissolved when used, etc.), tablets, capsules, granules, powders, liquids, liposome inclusions, ointments, gels, external powders, sprays, inhalating powders, eye drops, eye ointments, suppositories, pessaries, and the like, can be used appropriately depending on the administration method and the components of the present invention can be accordingly formulated. Pharmaceutical formulations are generally known in the art and are described, for example, in Chapter 25.2 of Comprehensive Medicinal Chemistry, Volume 5, Editor Hansen et al, Pergamon Press 1990.

The present invention also provides compositions containing an attenuated organism and composition according to the present invention thereof and one or more suitable adjuvants commonly used in the field of immunology and medicine to enhance the immune response in a subject. Examples of such adjuvants include monophosphoryl lipid A (MPL), a detoxified derivative of the lipopolysaccharide (LPS) moiety of Salmonella Minnesota R595, which has retained immunostimulatory activities and has been shown to promote Thl responses when co-administered with antigens.

Herein the subject that would benefit from the administration of an attenuated organism and composition according to the present invention and a formulation described herein include any host that can benefit from protection against malarial infection. Preferably, the subject is a human. The subject may also be a domestic animal, including but not limited to, dog, cat, horse, bovine (meaning any sex or variety of cattle) or other such domestic animals. The subject may also be a non-human primate or an animal known to be or proposed to be an animal model of human malarial infection.

As used herein, "inhibit", "inhibiting" or "inhibition" includes any measurable or reproducible reduction in the infectivity of a malarial strain in the subject host. "Reduction in infectivity" means the ability of the subject to prevent or limit the spread of the malarial strain in red blood cells and tissues or organs exposed or infected by said malaria parasite. Furthermore, "amelioration", "protection", "prevention" and "treatment" mean any measurable or reproducible reduction, prevention, or removal of any of the symptoms associated with malarial infectivity, and particularly, the prevention, or amelioration of P. falciparum infection and resultant pathology itself. Plasmodium infection and resultant pathology itself are also referred to herein as a Plasmodium associated condition.

The dosages of the attenuated organism according to the invention preferably includes from about 10 to 1 ,000,000 malaria parasite cells, inclusive of all ranges and subranges there between. Such amount may be administered as a single dosage or may be administered according to a regimen, including subsequent booster doses, whereby it is effective; e.g., the compositions of the present invention can be administered one time or serially over the course of a period of days, weeks, months and or years. The compositions of the attenuated vaccines can be administered by any suitable administration method including, but not limited to, injections (subcutaneous, intramuscular, intracutaneous, intravenous, intraperitoneal), oral administration, intranasal administration, inhalation, or other methods of instillation known in the art. The term 'effective amount' for a therapeutic or prophylactic treatment refers to an amount of a malaria parasite of the present invention sufficient to induce an immunogenic response in the individual to which it is administered. Preferably, the effective amount is sufficient to effect prevention or to effect treatment, as defined above. Preferably, an effective amount of vaccine is directed to, or effective against, the blood-stage of malaria infection. The exact amount necessary will vary according to the application. For vaccine applications or for the generation of polyclonal antiserum/antibodies, for example, the effective amount may vary depending on the species, age, and general condition of the subject, the severity of the condition being treated, the particular polypeptide selected and its mode of administration, etc. It is also believed that effective amounts will be found within a relatively large, non-critical range. An appropriate effective amount can be readily determined using only routine experimentation. Preferred ranges of numbers of malarial parasites for prophylaxis of malaria disease are about 10 to 1,000,000; most preferably about 10,000 to 50,000 dose. Several doses of vaccine may be needed per individual in order to achieve a sufficient immune response and subsequent protection against malaria.

In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one". The word "about" or "approximately" when used in association with a numerical value (e.g. about 10) preferably means that the value may be the given value (of 10) more or less 0.1% of the value.

The sequence information as provided herein should not be so narrowly construed as to require inclusion of erroneously identified bases. The skilled person is capable of identifying such erroneously identified bases and knows how to correct for such errors. In case of sequence errors, the sequence of the MRP polypeptide obtainable by expression of the genes present in SEQ ID NO's 18 and 20 containing the nucleic acid sequence coding for the polypeptide should prevail.

All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.

Figure legends

Figure 1.

Stable deletion of Pf mrpl and mrp2

Stable deletion of the mrpl and mrp2 genes in P . falciparum was accomplished through double crossover recombination of target regions (TR) at the 5' and 3' sides of the gene of interest. Positive selection was enabled by the hdhfr selection cassette, followed by negative selection of single crossover events using the feu marker. Upon consecutive transfection with the FLPe encoding construct, selectable marker sequences between the FRT sites were excised, resulting in a gene deleted parasite with only a 34 base pair FRT site scar. Long range PCR was performed using primers PI and P2, spanning the 5' and 3' TR, amplifying the targeted domain of mixed blood stage parasites. A PCR product for wild type mrpl and mrp2 of 7937 and 8595 bp was obtained, whereas amplification of VfAmrpl-A and VfAmrp2-A genomic DNA resulted in product sizes of 2257 and 2380 bp. For the VfAmrpl/Amrp2 double knockout line, a PCR product of 5353 bp was obtained upon mrpl amplification, as the selectable marker at this site was not removed. Specific restriction with Seal and Xmnl for wild type mrpl and mrp2 PCR products, respectively, Aval restriction for both amplicons of the mrp gene deleted lines and Sacl restriction of the PCR product obtained after mrpl amplification in the FfAmrpl/Amrp2 line showed presence of the expected sequence. In order to ensure the absence of the targeted genes, an intergenic region of around 300 bp was amplified using primers PR3 and PR4. PCR product could be readily obtained from wild type genomic DNA. Also mrp2 product could be obtained from the ViAmrpl-A parasite line, and mrpl product was amplified from ViAmrp2-A genomic DNA. However, a PCR product of the mrpl intergenic region in ViAmrpl-A parasites and the mrpl intergenic region of ViAmrp2-A parasites could not be obtained. Furthermore, both regions could not be amplified by a PCR on ViAmrpl/Amrp2 genomic DNA.

Figure 2.

Pre-hepatocytic development of Vimrp deleted parasites

2A Blood stage multiplication was analyzed in candle jar cultures at 0, 3, 5, 6 and 7 days after inoculation with 0.1% infected red blood cells. Parasitaemia was determined in giemsa- stained thin smears, and no significant differences were observed in parasitaemia after 7 days of replication.

2B Gliding motility of NF54 wild type, ViAmrpl-A and ViAmrp2-A sporozoites was assayed on CSP-coated glass plates, on which the shed CSP was immune-localized and the characteristic trails could be detected.

2C A cell traversal assay was performed as an alternative measure for parasite motility and invasion. HC04 cells were exposed to sporozoites for three hours, after which rhodamine-labeled dextran positive traversed cells were counted by FACS. The percentage of traversed cells was significantly increased after exposure to ViAmrpl-A and ViAmrpl/Amrp2 sporozoites; the mean percentage of NF54 wild type traversed HC04 cells was 14,6% (95% CI 13,4-15,8), whereas mean traversal of ViAmrpl-A sporozoites reached 26,7% (95% CI 19,6-33,7) of the HC04 cells and ViAmrpl/Amrp2 sporozoites traversed 22,7% (95% CI 18,8-26,6). Traversal of FfAmrp2-A sporozoites was comparable with wild type, with a mean of 17,9% (95% CI 10,8-25,0) dextran positive cells.

Figure 3.

Hepatocytic development of Pfmrp deleted parasites

3A Development of parasites upon sporozoite infection of fresh primary human hepatocytes was monitored for seven days. HSP70 was immuno-fluorescently labeled, and nuclear staining using DAPI was performed. Representative images for the different developmental stages were selected, in which can be perceived that ViAmrp2 and ViAmrpl/Amrp2 parasites do not develop in size and schizogony past a day 3 WT phenotype during 7 days of intra-hepatocytic culture.

3B-E Parasite numbers per well were counted, in order to survey survival of day 2 intrahepatical parasites. NF54 wild type parasite counts are reduced to 37,2% (95% CI 25,5-48,9) on day 6, which is comparable to FfAmrpl-A parasites, in which counts are reduced to 37,1% (95% CI 24,6-49,6). However, upon infection with FfAmrp2-A and FfAmrpl/Amrp2 sporozoites, parasite numbers are reduced to 4,89% (95% CI 1,78- 8,00) and 0,79% (95% CI -0.07-1.65) of day 2 parasite counts, respectively.

Figure 4.

Antigenic expression in Vtmrp deleted parasites

Expression and localization of (A) CSP (B) EXPl and (C) MSP1 was evaluated in the ViAmrpl-A and ViAmrp2-A gene deleted lines using immuno-cytochemistry, with HSP70 staining as cytosolic marker and DAPI for nuclear identification. CSP was detected in all lines during early time-points of liver development, exemplifying day 3. EXPl, which localizes to the parasitophorous vacuole, could also be detected in both gene deleted lines. An expression pattern comparable to NF54 wild type parasites could be observed; a circumferential structure around the parasitic cytosol throughout liver stage development. Here, day 6 parasites are displayed. MSP1 localizes to the plasma membrane of the parasite, and in NF54 wild type parasites as well as ViAmrpl-A liver stage forms, inter-nuclear staining could be detected in late stage liver parasites, here day 6 of development is exemplified. However, in ViAmrp2-A parasites MSP1 was not expressed.

Figure 5.

Localization of PfMRPl and PfMRP2 in hepatic stage parasites

MRPl and MRP2 were immuno-localized in NF54 wild type parasites. Co-localization with MSP1 could be observed for both proteins, which suggests localization at the plasma membranes of the parasite. However, as localization for MRP2 was also observed more peripheral, additional counterstaining with EXPl was performed. Partial overlap could be observed, however, EXPl localizes to the outermost boundaries of the parasite. Figure 6.

Protection after a T ^> bAmrp2 challenge

Intravenous immunization with 400, 800 or 1200 T ^> bAmrp2 parasites lead to sterile protection upon a WT challenge with 10.000 parasites, with one exception of a mouse in the 800 parasites immunization group. Some luciferase expression in the anatomical liver area could be detected primarily in the low-dose immunization group, however, none of these mice became blood stage positive. The only mouse that was not protected showed high luciferase expression, comparable to the group of mice that received a control (PBS) immunization.

The present invention is further described by the following examples which should not be construed as limiting the scope of the invention.

Unless stated otherwise, the practice of the invention will employ standard

conventional methods of molecular biology, virology, microbiology or biochemistry. Such techniques are described in Sambrook et al. (1989) Molecular Cloning, A

Laboratory Manual (2 ^nd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press; in Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY; in Volumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA; and in Volumes I and II of Brown (1998) Molecular Biology LabFax, Second Edition, Academic Press (UK); Oligonucleotide Synthesis (N. Gait editor); Nucleic Acid Hybridization (Hames and Higgins, eds.).

Examples

Example 1

Production of a live, attenuated vaccine providing long-lasting protection against infection by wild-type Plasmodium. ABSTRACT

ATP Binding Cassette (ABC) transport proteins are evolutionary well conserved membrane bound proteins that export a wide variety of compounds at the expense of ATP. They are best known for their contribution to drug resistance acquisition, but also have important physiological functions in homeostasis, membrane potential, pH adaptation, autocrine pathways or decreasing intracellular concentrations of potentially harmful compounds. These functions remain unknown in Plasmodium species, the causative parasite for malaria. In this study, we have targeted the ABC genes of the Multidrug Resistance-associated Proteins (MRP) subfamily, mrpl and mrp2, both single as well as combinatorial in P. falciparum and the mrpl orthologue in P. berghei for stable deletion by double crossover recombination. We have evaluated the phenotype of these gene deleted parasites during different stages of the parasite life cycle. Upon infection in freshly isolated primary human hepatocytes, the VfAmrp2 line shows waning parasite numbers combined with a vital retardation in expansion and maturation. An additional deletion of Vfmrpl results in further reduction in size and parasite count after seven days of intrahepatical development. Analogous results were observed in P. berghei for the development of Amrp parasites in liver cell cultures. Transmission to blood stage could not be detected in C57BL/6 mice upon intravenous injection with 300.000 VbAmrp parasites, indicating full attenuation of the mrp gene deleted parasites at liver stage. As liver stage parasites are capable of inducing an effective immune response in whole parasite immunization strategies, we explored the possibilities of employing the mrp gene deletion mutant in P. berghei for these means. Intravenous vaccination was performed with low dose gene deleted parasites in BALB/c mice. A challenge with 10.000 wildtype parasites after three weeks did not result in blood stage parasitaemia. In conclusion, MRP2 mediated export is essential for parasite development during liver stage, and sterile protection can be obtained through whole parasite immunization with mrp deleted lines INTRODUCTION

The Plasmodium falciparum (Pf) parasite causes the most lethal form of malaria, malaria tropica. This infectious disease is one of the greatest health threats globally, with a large impact on mortality and morbidity in malaria-endemic regions, and an large effect on the economical development in third world countries (1, 2). In recent years, the renewed initiatives to limit the effects of malaria has resulted in reduced numbers of cases, and eradication possibilities are back on the agenda. This incipient recovery is, however, threatened by increasing parasite resistance against first-line drug treatments consisting of artemisinin-based combination therapies (3, 4). As the availability of effective antimalarial drugs is limited, so are the opportunities to treat patients suffering from multidrug resistant malaria (5). Preventive measures are therefore essential to meet the goal of malaria eradication, however, despite of many efforts, no effective vaccine is available yet. The most promising vaccine candidate, the RTS,S subunit vaccine priming against a recombinant circumsporozoite protein, is being tested in a third phase clinical trial. Preliminary results indicate that protection does not exceed 35% of the volunteers (6).

A more thorough insight into essential processes of the parasite's biology is therefore of invaluable importance. We have previously identified all ATP Binding Cassette (ABC) transport proteins in many Plasmodium species and localized three of its members on the P. falciparum plasma membrane (7). ABC transport proteins are evolutionary well conserved membrane transporters that translocate heterogeneous compounds at the expense of ATP and are able to maintain steep concentration gradients (8). A typical ABC transport protein consists of two transmembrane domains (TMD) in which six transmembrane helices are embedded jointly forming the transportation pore containing substrate binding sites, alternated with two cytosolic nucleotide binding domains (NBD) for ATP hydrolysis. ABC transport proteins can be encoded as full transporters, or as half transporters of which the TMD and NBD upon expression recombine on the membrane to form a fully functional transportation unit. The Multidrug Resistance-associated Proteins (MRP) form a subfamily of full transporters for which transported compounds include organic anions and glutathione-, glucuronate- or sulfate-conjugated xenobiotics (9). These transport proteins are mostly appreciated for their role in drug resistance through increased extrusion of compounds after appearance of mutations or expression upregulation. Also in P. falciparum, single nucleotide polymorphisms and copy number variation in mrpl have been associated to decreased drug sensitivity, most likely by extrusion of conjugated forms of antimalarial compounds (10-12). However, physiological roles that MRP transport proteins may play such as involvement in homeostasis, pH adaptation, autocrine pathways or decreasing intracellular concentrations of potentially harmful compounds, remain unknown. These functions could be of essential importance during different stages of the parasite life cycle. In this study, we have stably deleted both mrp genes in P. falciparum blood stage parasites through double crossover recombination, and evaluated their phenotype during the different parasite life cycle stages. The most remarkable effect was found during liver stage, as infection of primary human hepatocytes with T ^> fAmrp2 and T ^> fAmrpl/Amrp2 resulted in severely underdeveloped parasitic forms combined with crashing parasite numbers. Subsequently, we deleted the orthologue mrp gene in P. berghei (Pb), the rodent model organism, to assess the absoluteness of the attenuation in liver stage parasites and to evaluate the opportunities for immunization. Breakthrough to blood stage of the gene deleted parasite line was not observed after injection of 300.000 sporozoites, and a single immunization with 400, 800 and 1200 gene deleted parasites resulted in sterile protection against a wild type challenge after three weeks. The mrp2 deleted parasite lines might therefore be an interesting candidate for whole parasite vaccination strategies. MATERIALS AND METHODS

Generation and genotyping of mrp deleted parasites

For the P. falciparum knockout generation, NF54 wild type parasites were cultured using a semi-automated culture system, described previously (55) and based on the Trager- Jensen culture method (13). In short, human serum supplemented RPMI medium was changed twice daily and 0.5% heamatocrite shaken cultures were maintained at parasitaemias below 20%.

Gene targeting constructs for double crossover recombination assuring stable deletion were cloned for both Pfinrpl (PF3D7 0112200) and Pfmrp2 (PF3D7 1229100). 5' and 3' homologous recombination targeting regions were amplified (LA Taq, TAKARA) using primers SR001, SR002, SR003 and SR004 for mrpl and SR005, SR006, SR007 and SR008 for mrp2 (Table 1). After TOPO TA subcloning (Invitrogen), these regions were cloned into the previously described PHHT-FRT-FCU construct for positive/ negative selection to achieve double crossover integration, containing FRT sites enabling FLPe mediated recombination for selective marker elimination, using BssHII/BsiWi and Xmal/Nhel restriction enzymes for the 5' and 3' targeting regions, respectively (14).

Wild type parasites were transfected with the gene targeting construct using a BTX electroporation system, as described previously (15). Gene deleted mutants were selected by cycling drug pressure of WR99210 for positive selection and FCU for negative selection (16). Two mutant lines were created for each of the targeted genes from independent transfections, the Amrpl-A and the Amrpl- , as well as the Amrp2- A and the Amrp2-B gene deletion lines. For both the Amrpl-A and Amrp2-A parasites, the remaining selection marker was deleted through transfection with the pMV-FLPe plasmids and selection using blasticidin (17). A consecutive gene deletion was made in the Amrp2-A knockout line, targeting mrpl, thus creating a double knockout parasite. Both members of the MRP family are absent in parasites of the Amrpl/ Amrp2 line. Clonal lines for the Amrpl, Amrp2 and Amrpl VAmrp2 parasites were produced through limiting dilution in a 96-well plate format (18). Genotype analysis of the mutant lines was performed using a long range PCR spanning from the 5' to the 3' homologous regions (Expand Long Range dNTPack, Roche) using primers SR009 and SROIO for mrpl and SR013 and SR014 for mrp2 combined with an internal gene specific PCR using primers SROl l and SR012 for mrpl and SR015 and SR016 for mrp2 (Taq polymerase, Invitrogen) (Table 2).

Mrp (PBANKA_144380) was deleted in Pb using the high efficiency transfection previously described (19). In short, a double cross-over strategy was applied using target sequences that were amplified from P. berghei ANKA (cll5cyl) genomic DNA using primers as depicted in Table 1. These products were cloned into the pLOOOl plasmid (MR4; Malaria Research and Reference Reagent Resource Center), flanking the pyrimethamine resistant Toxoplasma gondii (Tg) dihydrofolate reductase- thymidylate synthase (dhfr/ts) as selectable marker under the control of P. berghei dhfr/ts promoter. Gene-deletion constructs were linearized using the appropriate enzymes (Table 1) and transfection and selection of transformed parasites with pyrimethamine was performed. Clonal lines of the gene-deletion mutants were generated through limiting dilution of the parasites in mice. The genotype was verified using 5' and 3' spanning PCR primers and Southern analysis of pulsed- field gel electrophoresis separated chromosomes that were hybridized with probes specific for the selectable marker (FIGE). To analyze gene expression, northern blots were performed in which RNA from blood stage parasites was analyzed. Radio labeled 5' homologous recombination regions were used as probes in order to evaluate untranslated transcript size. Table 1 Targeting constructs and primers

Gene deletion constructs Basic construct

Prime Sequences Restriction Descriptio SEQ r si tes n ID NO

MRP1 PFC-MRP1 PHHT-FRT-FCU

SR001 GGGGCGCGCGAATCAAAAGGAGGTTCTT BsHII 5'- mrpl 1

C targeting

region F

SR002 GGGCGTACGTTCATGTAATACGCATACC BsiWi 5'- mrpl 2 targeting region R

SR003 GGGCCCGGGCTTACACACACCCATGCAT Xmal 3'- mrpl 3

AC targeting

region F

SR004 GGGGCTAGCGTAACTATTTCTGACCAAT Nhel 3'- mrpl 4

TC targeting

region R

MRP2 PFC-MRP2 PHHT-FRT-FCU

SR005 GGGGCGCGCCTTCTTACATTTGTTTATC BsHII 5'- mrp2 5

G targeting

region F

SR006 GGGCGTACGCGAAATTGTAAACGCTTCT BsiWi 5'- mrp2 6

CCG targeting

region R

SR007 GGGCCCGGGCCGAATTAGCTAACTTGC Xmal 3'- mrp2 7 targeting region F

SR008 GGGGCTAGCGGTTCATGCAAATGTTTAT Nhel 3'- mrp2 8 GC targeting

region R

Phenotypical analysis of Pf gene deleted parasites

P. falciparum blood stage replication was evaluated 0, 3, 5, 6 and 7 days after subculturing at 0,1% parasitaemia in a 0,25% haematocrite culture with daily change of medium. Read-outs were performed through giemsa-stained thin blood smear countings or pLDH based enzymatic activity assays (REF). Mature stageV gametocytes were produced in crashing cultures as described previously, and after 14 days they were counted using a Burker-Turk cell counter and microscopically analyzed on morphology after giemsa staining (20). Male exflaggelation capacity was evaluated after stimulation with fetal calf serum at pH 8.0. Standard membrane feeding assays of Anopheles stephensi mosquitoes were performed and oocyst development was monitored at day 7 after which selection of sporozoites from mosquito salivary glands was performed. Sporozoite gliding motility was evaluated by visualizing gliding trails using anti-CSP (PF3D7 0304600; 3SP) antibody and hepatocyte traversal capability was analyzed through FACS sorting of rhodamine-labelled dextran positive cells, as previously described (21, 22). The infection and development monitoring of P. falciparumparasites during maximal ten days was performed in primary human hepatocytes that were freshly isolated from human remnant material after tumor removal surgery, as described previously and according to French and Dutch ethical legislation (23, 24). Immuno localization was performed using anti-HSP70 (PF3D7 0930300) at 20 μg/mL; anti-CSP at 17 μg/mL; anti-EXPl (PF3D7 1121600) at 800 μΒ/mL, anti-MSPl (PF3D7 0930300) at 1 :2000, anti-MRPl at 25 μg/mL and anti-MRP2 at 25 μg/mL (7, 25-28). Phenotypical analysis of P. berghei gene deleted parasites

During the cloning procedure of the mrp deleted parasites, multiplication rates of asexual blood stages in mice were determined as described previously (29). Parasitaemias in percentages in Swiss OF1 mice injected with a single parasite are determined at day 8 to 11 on Giemsa stained blood films. Per mouse, an estimated number of 1.2 x 10 ¹⁰ erythrocytes was used to calculate the multiplication rate per 24 hours. The percentage of infected erythrocytes in mice infected with reference lines of the P. berghei ANKA strain consistently ranges between 0.5-2% at day 8 after infection, resulting in a mean multiplication rate of 10 per 24h (30). The gametocyte conversion was obtained by pretreating mice with phenyhydrazine-HCl, and calculating the percentage of ring forms that developed into mature gametocytes in synchronized infections (31). Ookinete production was analysed by standard in vitro fertilization and ookinete maturation assays (32). Mosquito feeding and oocyst formation was evaluated as previously described (33). Sporozoites were dissected from mosquito salivary glands and intrahepatical development was analyzed through infection of Huh7 cells as described (34). Primary antibodies were used against PbEXPl (PBANKA 092670), HSP70 (PBANKA 081890) and MSPl (PBANKA 083100) MRA-78, obtained through MR4, (available through the internet at MR4.org) (35, 36).

Safety and protection of a mrp gene deleted parasite vaccination strategy

The absoluteness of the hepatic arrest was evaluated in a breakthrough experiment, in which 300.000 sporozoites were intravenously injected into 5 C57BL/6 mice. Tail smears were made three times a week and checked on presence of parasites. Mice were sacrificed upon parasite detection or at 21 days post infection. A protection experiment was performed in BALB/c mice, where 5 mice of each group were vaccinated with a saline solution, 400, 800 or 1200 mutant parasites. After 21 days, a challenge experiment was performed with 10.000 parasites of the 676ml ell (i¾GFP-LUC _con mutant RMgm-29; available through the internet at pberghei.eu) luciferase reporter line, in which the luciferase gene is integrated at the pb230p locus and constitutively expressed under control of the eefla promotor. Parasites can thus be tracked through luciferase expression, and liver load can be specifically analyzed in vivo in a Lumina (Caliper Life Sciences, USA) (37).

RESULTS

Deletion of mrpl and mrpl from the P. falciparum genome

Regions at the 5' and 3' side of both mrpl and mrp2 were designed as target sites for homologous recombination. Integration of the knockout construct stably removed the gene of interest (GOI) and replaced it with the positive selection marker (PSM) after crossover at both sides of the gene had been completed through positive and negative selection (Figure 1). Subsequent deletion of the resistance marker was achieved by FLPe mediated excision of the sequence originating from the construct, between the FRT sites. As only a 34-base pair scar was present at the former mrp site, mrpl could be additionally deleted in the Amrp2-A parasite line, creating the PfAmrpl/Amrp2 mutant. Clonal lines were produced for al mutants to ensure a homologous genetic background. Diagnostic PCRs were performed to demonstrate deletion of the targeted genes. A long range PCR spanning the 5' and 3' target regions resulted in amplification of the entire gene locus. Specific restriction for wild type PCR products was performed using Seal and Xmnl after mrpl and mrp2 amplification, respectively, whereas the knockout line PCR products were both restricted with Aval. Restriction of ViAmrpl/Amrp2 genomic DNA-based PCR product of mrpl was performed with Sad, as the selection cassette was not removed at this location, and the amplified product represented an alternative sequence (Figure 1). Furthermore, an intragenic site was amplified in both wild type and gene deleted mutants to exclude exosomal or non- autonomal presence (Figure 1).

Phenotypical analysis in blood and mosquito stages

Blood stage replication analyzed in candle jar cultures at 0, 3, 5, 6 and 7 days after inoculation with 0.1% parasitaemia. Parasitaemia was analyzed in giemsa- stained thin smears and using pLDH activity assays. Blood stage multiplication of all mutant parasite lines, Amrpl-A, Amrp2-A and Amrpl/Amrp2 was similar to NF54 wildtype (Figure 2A). Gametocytogenesis was analyzed in crashing cultures, and after 14 days gametocyte production was comparable in the knockout parasites and the NF54 line, with a mean of 1.94 (range 1.15-2.80) xlO ⁶ gametocytes per mL for the NF54 parent line, 2.16 (range 0.84-3.16), 1.63 (range 0.59-2.76) and 0.88 (range 0.28-1.56) xlO ⁶ gametocytes per mL for the mrpl-A, mrp2-A and mrpl/Amrp2 deleted lines, respectively (Table 3). No alterations in gametocyte morphology could be detected microscopically after giemsa staining for the gene deletion mutants. Male gametocyte functionality was analyzed and active exflaggelation was observed in all lines.

Formation of oocysts was analyzed after 7 days in the standard membrane feeding assay. Significantly reduced numbers of oocysts in the mosquito midgut were detected for the Amrpl/Amrp2 gene deleted line. The mean number of oocysts formed in the NF54 wildtype line was 21.4 (95% CI 13.0-29.8) oocysts per midgut, whereas for the Amrpl/Amrp2 parasites a mean number of 3.66 (95%> CI 0.75-6.57) oocysts per midgut were detected. The production of oocysts and sporozoites during the development of the Amrpl-A and Amrp2-A parasites in the mosquito was within the NF54 wild type range, with 13.2 (95% CI -7.94-34.3) and 35.0 (95% CI 23.3-46.7) oocysts per mosquito midgut, respectively. Sporozoite production per oocyst, however, was not significantly different in the gene deleted lines.2,849 sporozoites per oocyst could be detected in the NF54 wild type parasites, 4,360 in the Amrpl line, 3,152 in the Amrp2-A line, and 3,517 sporozoites per oocyst were retrieved in the Amrpl /Amrp2 parasites.

Table 3

Parasi te Gametocytogen Exflaggelat Oocyst Infected Sporozoi te line esis *10 ^Λ 6 ion producti mosquito production per mL on (95% es (%) per

(range) CI) mosquito

NF54 1, 94 + 21,5 93, 9 67184

(1, 15-2, 80) (13, 1-29,

9)

Amrpl-A 2, 16 + 3,40 90 12208

(0, 84-3, 16) (-4, 22-11

, 0)

Amrp2-A 1, 63 + 35, 0 90 134259

(0, 59-2, 76) (23, 3-46, 7)

Amrpl /Δπι 0, 88 + 3, 67 46, 9 20931 rp2 (0, 28-1, 56) (0,75-6, 5

7)

Pre-hepatocytic development of Vimrp deleted parasites

Extensive pre-hepatocytic phenotyping was performed for the gene deleted parasite lines. Mature stageV gametocytogenesis was evaluated after 14 days gametocyte culture, and no significant differences in morphology or quantity could be detected for the knockout parasites compared to the NF54 wild type line. Male exflaggelation was observed in all parasite lines upon induction with FCS at pH 8.0. Whereas oocyst formation in the mosquito midgut was comparable to WT for the ViAmrpl-A and T ^> fAmrp2-A lines, it was significantly inhibited in ViAmrpl/Amrp2 parasites. Consequently, also the number of sporozoites that could be extracted from the mosquito salivary glands of the FfAmrpl/Amrp2 parasite line was decreased, however, the number of sporozoites formed per oocyst did not differ between the gene deleted lines. The percentage of infected mosquitoes was again significantly lower in the double knockout line.

Phenotypical analysis of pre-erythrocytic stages

Motility of the sporozoites, which is essential for invasion and thus establishing hepatocyte infection, was assessed by analysis of gliding on glass plates. All parasite lines showed effective gliding motility, as shed CSP could be visualized and consisted of the characteristic circle-shaped trails (Figure 2B). No significant differences could be detected in gliding motility between the Amrpl-A and Amrp2-A gene deleted lines and wild type parasites.

Prior to invasion and development into a hepatocyte by establishing a parasitophorous vacuole, sporozoites traverse through a number of cells (38). Traversal capacity was evaluated in HC04 cells using rhodamine labeled dextran, which diffuses into the traversed and thus wounded cells, thereby fluorescently labeling them (Figure 2C). The percentage of traversed cells as determined by FACS analysis was significantly increased for the Amrpl-A and Amrpl/Amrp2 gene deleted lines compared to wild type parasites. 14.6% (95% CI 13.4-15.8) of the HC04 cells were traversed by NF54 sporozoites, whereas 26.7% (95% CI 19.6-33.7) and 22.7% (95% CI 18.8-26.6) was traversed by the Amrpl-A and Amrpl/Amrp2 sporozoites. Traversal of Amrp2-A parasites was comparable to NF54 wild type, as 17.9% (95% CI 10.8-25.0) of the exposed HC04 cells was rhodamine positive.

P. falciparum Amrp2 and Amrpl/Amrp2 are significantly reduced in size and parasite count during hepatic development

The intra-hepatic development of mrp deleted parasite lines was evaluated in freshly isolated primary human liver cell cultures during maximally ten days. Sporozoites were isolated from salivary glands of infected mosquitoes and 32.500 per well were added in a 96-wells plate format. Samples were fixed at 2-10 day time points and immunocytochemically stained to identify and characterize hepatic stage parasites. For NF54 and Amrpl-A parasites, functional intra-hepatic development could be readily observed. For NF54, a mean of 162 (95%> CI 125 - 199) parasites could be detected per well at day 2, however, infection with the Amrpl-A parasite line lead to a significantly increased infectivity of 424 (95% CI 375 - 521) parasites per well. Parasite count per well steadily decreased to 37.2% (95% CI 25.5-48.9) and 37.1% (95% CI 24.6-49.6) of these original quantities until day 6 in NF54 and Amrpl-A parasite lines, respectively (Figure 3B-C). This decrease in liver stage parasites in in vitro cultures has been described previously (39). Increase in parasite size measured after immuno fluorescent labeling of HSP70 and the quantity of DAPI stained nuclei could be observed for both parasite lines during the seven day follow-up period (Figure 3A). A mean diameter of 2.01 (95%o CI 1.61 - 2.41) μΜ was measured for NF54 parasites on day 2, which increased to 10.6 (95%> CI 5.29 - 16.0) μΜ on day 7, comparable to the size-increase of the Amrpl-A parasites, where a mean diameter of 1.82 (95% CI 1.51 - 2.13) μΜ was measured on day 2 which increased to 9.23 (95%> CI 5.96 - 12.5) μΜ on day 7. In all parasites observed schizogony increased equally to size. Already on day 2, parasites were multi-nucleated, and the number of nuclei increased exponentially up and until day 7 of parasite development (Figure 3A).

Very different results were obtained for the Amrp2-A and Amrpl/Amrp2 gene deleted parasite lines during intra-hepatic development. Parasite sizes on day 2 of intra-hepatic development already were significantly decreased compared to the NF54 wildtype, with diameters of 1.13 (95% CI 0.93 - 1.33) μΜ and 2.41 (95% CI 2.00 - 2.82) μΜ for the Amrp2-A and Amrpl/Amrp2 gene deleted lines, respectively. On day 7, diameters did not exceed 2.12 (95% CI 1.02 - 3.21) and 2.36 (95% CI 1.92 - 2.81) μΜ (Figure 3 A). Furthermore, schizogony was drastically inhibited for both lines, as on day 2 only one DAPI positive nucleus could be detected for these parasites, and a maximum number of 6 nuclei was found on day 7 of intra-hepatic development. Besides a crippled phenotype, parasite numbers were severely reduced shortly after day 2 of hepatocyte infection of the Amrp2-A and Amrpl/Amrp2 gene deleted lines (Figure 3 A). On day 2, a mean of 347.7 (95% CI 248.6-416.7) and 343.7 (95% CI 195.3-492.0) parasites could be detected per well, of which only 4.89% (95% CI 1.78-8.00) and 0.79%) (95%) CI -0.07-1.65) were still present at day 6 of intra-hepatic parasite development for the respective parasite lines (Figure 3 D-E). Maximal development of the Amrp2-A and Amrpl/Amrp2 parasite during liver stage resembles a day 3 NF54 wild type schizont. These gene deleted parasites are significantly reduced in size and schizogony, and numbers of viable parasites are marginalized during maturation.

P. falciparum Amrp2 and Amrpl/Amrp2 maturation is lethally reduced during liver stage development

More specific phenotyping and determination of the degree of development of the gene deleted parasites was performed by immunofluorescent staining of liver-stage specific antigens. Circumsporozoite Surface Protein (CSP) is an antigenic membrane epitope involved in sporozoite function and hepatocyte invasion, which is expressed on sporozoites and early hepatic stages (40). CSP expression was demonstrated on day 3 of intra-hepatic development of NF54 wildtype and all mrp deleted parasite lines (Figure 4A). Furthermore, expression of Exported Protein 1 (EXP1) was demonstrated for NF54 as well as the Amrpl-A, Amrp2-A and Amrpl/Amrp2 mutant lines on day 3 - 7 of intra-hepatic development (Figure 4B). As EXP1 is expressed at the parasitophorous vacuole membrane, it can be concluded that the mrp deleted mutants effectively form a parasitophorous vacuole in which hepatic development is supported. However, the expression of Merozoite Surface Protein 1 (MSP1) could not be detected in any of the Amrp2-A and Amrpl/Amrp2 gene deleted parasites (Figure 4C). This indicates that merozoite formation is absent, due to the strongly reduced schizogony that was detected in the Amrp2-A and Amrpl/Amrp2 gene deleted parasite lines. The crippled phenotype combined with the waning parasite numbers and absence of MSP1 expression in the Amrp2-A and Amrpl/Amrp2 gene deleted parasites suggest that merozoite formation and subsequent blood stage infection cannot be completed by these mutant lines, and deletion of mrp2 either in combination with mrpl leads to a liver-arrested parasite. MRP hepatic stage localization

Being membrane-bound proteins, MRP functionality is tightly associated with its localization as substrates are translocated from one parasitic compartment to another. Previously, MRPl and MRP2 were shown to localize at the plasma membrane of erythrocytic stages of P. falciparum (7). As MSP1 also locates to this membrane in liver stage schizonts, we have immune-localized both MRPl and MRP2 in combination with MSP1 (Figure 5). For all three proteins, expression at the membranes separating individual day 6 merozoites could be detected, indicating these proteins are indeed present at the plasma membrane, and co- localization of MRPl and MRP2 with MSP1 was evident. However, MRP2 expression appeared somewhat more external compared to MRPl localization. Immune-localization of MRP2 combined with EXP1, which is expressed at the parasitophorous vacuole membrane, shows EXP1 expression is outermost which renders localization of the MRP2 predominantly to the plasma membrane. At this position, MRP2 is evidently exporting essential compounds out of the parasite, as deletion of the encoding gene essentially inhibits schizogony and maturation of the parasite during liver stage development.

PbAmrp parasites liver stage arrest

The most applicable model to assess parasite liver development and subsequent breakthrough to blood stage infection is the P. berghei rodent model. In the genome of P. berghei, only one MRP, the orthologue of the Ffmrp2 gene, is encoded. The Fbmrp gene was deleted using a high efficiency transfection method generating two independent transfectant lines, PbAmrp-A and PbAmrp- . Blood stage replication was similar to wildtype parasites.

Liver stage development was analyzed in parasites cultured in Huh7 cells during two days, which represents a complete liver stage in P. berghei (Figure 6). Immuno fluorescent staining after 52 hours revealed a similar phenotype detected in P. falciparum. Parasites were significantly smaller compared to wildtype, and schizogony was appreciably inhibited. Furthermore, EXP1 expression could be detected at the site of the parasitophorous vacuole membrane, however, MSP1 expression was completely abolished.

In order to evaluate the extent of liver stage arrest and detect possible breakthrough parasites, 5 C57BL/6 mice were intravenously injected with 300.000 mrp deleted parasites. These mice were followed up for 21 days post injection, and all remained negative for blood stage infection after routinely monitoring of tail smears. These data indicate that indeed mrp deleted parasites arrest at liver stage and do not support merozoite formation and blood stage infection.

P. bergheiAmrp mediated protection

The mrp deleted parasites in both P. falciparum and P. berghei arrest at a late stage during liver development, resulting presence of parasitic material even after 7 days in falciparum, and 52 hours in berghei. As parasites do not form merzoites and do not break through to blood stage infection, these mutant lines may form ideal candidates for whole parasite vaccination strategy applying Genetically Attenuated Parasites (GAP). Especially as late liver stage arrest is hypothesized to induce superior protection (41). We assessed protection upon intravenous immunization with 400, 800 or 1200 PbAmrp parasites in 5 BALB/c mice per group. Immunized mice were challenged after 21 days with 10.000 luciferase positive sporozoites. In vivo intra-hepatical development of these parasites was monitored using a Lumina luminescence detector after 24, 48 and 52 hours. All control mice that had been immunized with PBS emitted high luciferase signal in the hepatic area as early as the 24 hour timepoint. Except for 1 mouse, these signals were not detected in any of the immunized mice, regardless of the immunization dose. After 48 hours, low luciferase positivity was detected in the liver of the mice that had been immunized with the lowest parasite dose, 400 parasites per mouse. However, during the follow-up periode of 21 days, none of these mice, or of the mice in the other immunization dose groups, became blood stage positive. An exception was detected in the 800 sporozoite immunization dose group, as one mouse expressed parasite-related luciferase signal at the location of the liver already after 24 hours. The load that could be detected was equally high as for the non-immunized mice. Furthermore, this mouse also developed blood stage parasiteamia, at a time point and rate comparable to non-immunized mice. As non of the mice in the lower dose group showed equal results and there was no decreased signal expression compared to wild type, we consider this mouse to be inefficiently immunized due to practical handling errors. Except for this atypical finding, a single immunization with low dose mrp deleted parasites is very effective in inducing an immunogenic response, resulting in sterile protection against a high-dose wild type challenge in BALB/c mice.

DISCUSSION

The MRP transport proteins are members of the ABC family, which are known to actively translocate organic anions or conjugated compounds in many organisms. We have stably deleted all MRP family members in both P. falciparum and P. berghei in order to evaluate the physiological effect of mrp absence. Gene deleted parasites were analyzed in all parasitic life cycle stages; erythrocytic, asexual, mosquito and pre- erythrocytic. The most remarkable effect was found during liver stage for the mrp2 deleted parasites in P. falciparum as well as in the P. berghei orthologue mutant lines. Sporozoite motility and invasion was unimpaired, whereas intrahepatical parasite numbers were significantly decreased combined with a vital inhibition of cytosolic as well as nuclear replication of the parasite during liver stage development. V&lmrp2 and VfAmrpl/Amrp2 parasites that could still be detected at day 6 of parasite development in freshly isolated primary human hepatocytes could be phenotyped as comparable to maximally day 3 NF54 wild type parasites according to size and schigozony. For the mrp deleted P. berghei parasites, analogous conclusions could be drawn. Hepatocyte invasion was not inhibited in any of the gene deleted parasite lines, and indeed CSP expression, which is essential for invasion, could be detected in all early hepatocytic parasite stages. The parasitophorous vacuole is readily constructed in the gene deleted parasites, as EXP1 expression could be readily detected in mrp mutant parasite lines. However, in mrp2 deleted parasite lines, merozoite formation is abolished. This is reflected in the absence of MSP 1 expression on the plasma membrane in these lines, which is also the case for the VbAmrp parasites. The VfAmrp2 arrest at a very late time point during liver stage, as after seven days they are still present. For VfAmrpl/Amrp2 parasites we could even detect parasites after ten days of primary liver cell culture. Also for P. berghei, hepatic forms were still present after complete liver development. The additional deletion of the mrpl gene in the ViAmrp2 parasite line showed a further decrease in parasite numbers, implicating a possible additional effect. However, absence of MRP1 alone did not affect liver stage development significantly. We did observe decreased mosquito infectivity in the ViAmrpl/Amrp2 and the VbAmrp parasite lines, which was expressed in decreased oocyst numbers per mosquito. Gametocyte production and exflaggelation were similar to wild type, indicating that it is specifically the mosquito stage development that is inhibited by the combined absence of MRP 1 and MRP2 in P. falciparum and the MRP in P. berghei. Increased hepatocyte traversal capacity that was detected for the ViAmrpl-A and ViAmrpl/Amrp2 is possibly due to the deletion of Vimrpl which evidently increases sporozoite motility and/or infectivity. This is also reflected in the higher hepatocyte invasion numbers at day 2 for the ViAmrpl-A and ViAmrp I VAmrp2 gene deleted lines compared to NF54 wild type parasites. PfMRPl and PfMRP2 are localized on the plasma membrane of hepatic plasmodium stages, as MSP1 expression showed a similar expression and is a known plasma membrane-associated protein (56). Furthermore, the MRP proteins were identified at the plasma membrane in erythrocytic stages and gametocytes previously (7). This localization indicates the involvement of MRPs in export of most likely metabolites during the hepatic stage.

The mrp gene that is encoded in Pb has been classified as a Vimrp2 orthologue based on phylogenetic analysis of the NBD (7). Functional analysis of substrates cannot be performed, however, in many organisms MRP transport proteins share specific substrates and can therefore be redundant. As we see an additional reducing effect on parasite number and size in the P. falciparum parasite line in which both mrpl and mrp2 are deleted compared to mrp2 deletion alone, one could argue that the substrate(s) causing the attenuating effect may also be transported by PfMRPl, however, with much lower affinity. The expression of a broad range of antigens including parasitophorous vacuole-related proteins in combination with a long duration of possible antigen presentation are interesting properties of a potential whole parasite vaccine candidate. Subunit vaccination strategies against mostly veterinary parasites are often not providing sterile protection (43). Therefore, a strategy in which an attenuated whole parasite is applied could induce a superior immune response as in contrary to subunit vaccines, a broad spectrum of parasitic immunogens is displayed. Radiation Attenuated Sporozo ^' ites (RAS) have been considered the gold standard, as these sporozoites do not complete liver stage development but do induce an efficient immune response resulting in sterile protection in human trials (27). However, the heterologous background of DNA damage and dependence on radiation dose renders this technique unsuitable for clinical applications. The use of Chemically Attenuated Sporozo ^' ites (CAS) is another strategy of whole parasite presentation to the immune system (44). Efficacy of blood stage prevention in this case depends on variable factors such as host metabolism, and this strategy is therefore insufficiently safe for clinical use. Genetically Attenuated Sporozoites (GAS) vaccination is considered to be a superior strategy, as sporozoites have a homologous genetic background, attenuation can be pinpointed and is not dependent on external factors. Of the genes that have been reported to attenuate parasite development many do so at an early liver stage, as they are involved in the process of parasitophorous vacuole remodelling to enable merozoite formation or in fatty acid biosynthesis required for membrane biogenesis required for the extraordinarily high rate of parasite multiplication (36, 45-51 , 57). The prolonged availability and higher diversity of antigen presentation in late liver stage arresting parasites to which the ViAmrp2-A and T>fAmrpl/ mrp2 classify is thought to be responsible for the increased immunity that is obtained (41).

Breakthrough of supposedly liver stage attenuated parasites to blood stage infection has proved to be a great hurdle in the development of a safe GAP vaccine candidate (52). Parasites incapable of forming a functional PV could still complete liver stage development when located in the nuclear compartment of liver cells. Detection of the low percentage of parasites evading attenuation in this manner requires a very sensitive measure, for which the primary human hepatocyte culture is unqualified as infection rates vary and detection limits are high. A single merozoite can induce blood stage infection and thus malaria, thus a qualitatively absolute attenuation is required. Detection of breakthrough to blood infection of the genetically attenuated parasite lines was done in the rodent P. berghei model, where the injection of 20-100 asexual stage parasites is sufficient to establish blood stage infection in C57BL/6 mice (53). The absence of a blood stage infection in mice that were intravenously injected with 300.000 mrp deleted sporozoites and followed up for 21 days is therefore the maximal safety assessment that could be performed. A model in which Plasmodium falciparum liver to blood stage transmission can be evaluated is unfortunately currently not available.

Reference list

1. WHO. World Malaria Report 2012. (2012).

2. Sachs, J. & Malaney, P. The economic and social burden of malaria. Nature 415, 680-5 (2002).

3. Dondorp, A.M. et al. Artemisinin resistance in Plasmodium falciparum malaria. N Engl J Med 361, 455-67 (2009).

4. Ariey, F. et al. A molecular marker of artemisinin-resistant Plasmodium falciparum malaria. Nature 505, 50-5 (2014).

5. WHO. Guidelines for the treatment of malaria. (2010).

6. Agnandji, S.T. et al. First results of phase 3 trial of RTS,S/AS01 malaria vaccine in

African children. N Engl J Med 365, 1863-75 (2011).

7. Kavishe, R.A. et al. Localization of the ATP -binding cassette (ABC) transport proteins PfMRPl, PfMRP2, and PfMDR5 at the Plasmodium falciparum plasma membrane. Malar J 8, 205 (2009).

8. Koenderink, J.B., Kavishe, R.A., Rijpma, S.R. & Russel, F.G. The ABCs of multidrug resistance in malaria. Trends Parasitol 26, 440-6.

9. Borst, P., Evers, R., Kool, M. & Wijnholds, J. A family of drug transporters: the multidrug resistance-associated proteins. J Natl Cancer Inst 92, 1295-302 (2000).

10. Mu, J. et al. Multiple transporters associated with malaria parasite responses to chloroquine and quinine. Mol Microbiol 49, 977-89 (2003).

11. Dahlstrom, S., Veiga, M.I., Martensson, A., Bjorkman, A. & Gil, J. P. Polymorphism in PfMRPl (Plasmodium falciparum multidrug resistance protein 1) amino acid 1466 associated with resistance to sulfadoxine-pyrimethamine treatment. Antimicrob Agents Chemother 53, 2553-6 (2009).

12. Dahlstrom, S. et al. Plasmodium falciparum multidrug resistance protein 1 and artemisinin-based combination therapy in Africa. J Infect Dis 200, 1456-64 (2009).

13. Trager, W. & Jensen, J.B. Cultivation of erythrocytic stages. Bull World Health Organ 55, 363-5 (1977).

14. van Schaijk, B.C., Vos, M.W., Janse, C.J., Sauerwein, R.W. & Khan, S.M. Removal of heterologous sequences from Plasmodium falciparum mutants using

FLPe-recombinase. PLoS One 5, el 5121. 15. Wu, Y., Kirkman, L.A. & Wellems, T.E. Transformation of Plasmodium falciparum malaria parasites by homologous integration of plasmids that confer resistance to pyrimethamine. Proc Natl Acad Sci U S A 93, 1130-4 (1996).

16. Duraisingh, M.T., Triglia, T. & Cowman, A.F. Negative selection of Plasmodium falciparum reveals targeted gene deletion by double crossover recombination. Int J

Parasitol 32, 81-9 (2002).

17. Mamoun, C.B., Gluzman, I.Y., Goyard, S., Beverley, S.M. & Goldberg, D.E. A set of independent selectable markers for transfection of the human malaria parasite Plasmodium falciparum. Proc Natl Acad Sci U S A 96, 8716-20 (1999).

18. Rosario, V. Cloning of naturally occurring mixed infections of malaria parasites. Science 212, 1037-8 (1981).

19. Janse, C.J. et al. High efficiency transfection of Plasmodium berghei facilitates novel selection procedures. Mol Biochem Parasitol 145, 60-70 (2006).

0. Ponnudurai, T., Lensen, A.H., Meis, J.F. & Meuwissen, J.H. Synchronization of Plasmodium falciparum gametocytes using an automated suspension culture system.

Parasitology 93 ( Pt 2), 263-74 (1986).

1. Stewart, M.J. & Vanderberg, J.P. Malaria sporozoites leave behind trails of circumsporozoite protein during gliding motility. J Protozool 35, 389-93 (1988). 2. Prudencio, M., Rodrigues, CD., Ataide, R. & Mota, M.M. Dissecting in vitro host cell infection by Plasmodium sporozoites using flow cytometry. Cell Microbiol

10, 218-24 (2008).

3. Guguen-Guillouzo, C. et al. High yield preparation of isolated human adult hepatocytes by enzymatic perfusion of the liver. Cell Biol Int Rep 6, 625-8 (1982). 4. Mazier, D. et al. Complete development of hepatic stages of Plasmodium falciparum in vitro. Science 227, 440-2 (1985).

5. Renia, L. et al. A malaria heat-shock- like determinant expressed on the infected hepatocyte surface is the target of antibody-dependent cell-mediated cytotoxic mechanisms by nonparenchymal liver cells. Eur J Immunol 20, 1445-9 (1990).

6. Verhave, J.P., Leeuwenberg, A.D., Ponnudurai, T., Meuwissen, J.H. & van Druten, J.A. The biotin-streptavidin system in a two-site ELISA for the detection of plasmodial sporozoite antigen in mosquitoes. Parasite Immunol 10, 17-31 (1988). 7. Epstein, J.E. et al. Live attenuated malaria vaccine designed to protect through hepatic CD8(+) T cell immunity. Science 334, 475-80 (2011). Bonnet, S. et al. Soluble and glyco-lipid modified baculo virus Plasmodium falciparum C-terminal merozoite surface protein 1, two forms of a leading malaria vaccine candidate. Vaccine 24, 5997-6008 (2006).

Spaccapelo, R. et al. Plasmepsin 4-deficient Plasmodium berghei are virulence attenuated and induce protective immunity against experimental malaria. Am J

Pathol 176, 205-17 (2010).

Janse, C.J. et al. Malaria parasites lacking eefla have a normal S/M phase yet grow more slowly due to a longer Gl phase. Mol Microbiol 50, 1539-51 (2003). Janse, C.J. & Waters, A.P. Plasmodium berghei: the application of cultivation and purification techniques to molecular studies of malaria parasites. Parasitol

Today 11, 138-43 (1995).

van Dijk, M.R. et al. A central role for P48/45 in malaria parasite male gamete fertility. Cell 104, 153-64 (2001).

Annoura, T. et al. Assessing the adequacy of attenuation of genetically modified malaria parasite vaccine candidates. Vaccine 30, 2662-70 (2012).

Annoura, T., Chevalley, S., Janse, C.J., Franke-Fayard, B. & Khan, S.M. Quantitative analysis of Plasmodium berghei liver stages by bio luminescence imaging. Methods Mol Biol 923, 429-43 (2013).

Sturm, A. et al. Manipulation of host hepatocytes by the malaria parasite for delivery into liver sinusoids. Science 313, 1287-90 (2006).

Mueller, A.K. et al. Plasmodium liver stage developmental arrest by depletion of a protein at the parasite-host interface. Proc Natl Acad Sci U S A 102, 3022-7 (2005).

Ploemen, I. et al. Evaluation of immunity against malaria using luciferase- expressing Plasmodium berghei parasites. Malar J 10, 350 (2011).

Mota, M.M. et al. Migration of Plasmodium sporozoites through cells before infection. Science 291, 141-4 (2001).

Silvie, O. et al. Effects of irradiation on Plasmodium falciparum sporozoite hepatic development: implications for the design of pre-erythrocytic malaria vaccines. Parasite Immunol 24, 221-3 (2002).

Epstein, J.E., Giersing, B., Mullen, G., Moorthy, V. & Richie, T.L. Malaria vaccines: are we getting closer? Curr Opin Mol Ther 9, 12-24 (2007). 41. Nganou-Makamdop, K. & Sauerwein, R.W. Liver or blood-stage arrest during malaria sporozoite immunization: the later the better? Trends Parasitol 29, 304-10 (2013).

42. Sanchez, CP., Rotmann, A., Stein, W.D. & Lanzer, M. Polymorphisms within PfMDRl alter the substrate specificity for antimalarial drugs in Plasmodium falciparum. Mol Microbiol (2008).

43. Vercruysse, J., Knox, D.P., Schetters, T.P. & Willadsen, P. Veterinary parasitic vaccines: pitfalls and future directions. Trends Parasitol 20, 488-92 (2004).

44. Purcell, L.A., Yanow, S.K., Lee, M., Spithill, T.W. & Rodriguez, A. Chemical attenuation of Plasmodium berghei sporozoites induces sterile immunity in mice.

Infect Immun 76, 1193-9 (2008).

45. van Dijk, M.R. et al. Genetically attenuated, P36p-deficient malarial sporozoites induce protective immunity and apoptosis of infected liver cells. Proc Natl Acad Sci U S A 102, 12194-9 (2005).

46. Silvie, O., Goetz, K. & Matuschewski, K. A sporozoite asparagine-rich protein controls initiation of Plasmodium liver stage development. PLoS Pathog 4, el000086 (2008).

47. Aly, A.S. et al. Targeted deletion of SAPl abolishes the expression of infectivity factors necessary for successful malaria parasite liver infection. Mol Microbiol 69, 152-63 (2008).

48. Yu, M. et al. The fatty acid biosynthesis enzyme Fabl plays a key role in the development of liver-stage malarial parasites. Cell Host Microbe 4, 567-78 (2008).

49. Vaughan, A.M. et al. Type II fatty acid synthesis is essential only for malaria parasite late liver stage development. Cell Microbiol 11, 506-20 (2009).

50. Falae, A. et al. Role of Plasmodium berghei cGMP-dependent protein kinase in late liver stage development. J Biol Chem 285, 3282-8 (2010).

51. Pei, Y. et al. Plasmodium pyruvate dehydrogenase activity is only essential for the parasite's progression from liver infection to blood infection. Mol Microbiol 75, 957-71 (2010).

52. Khan, S.M., Janse, C.J., Kappe, S.H. & Mikolajczak, S.A. Genetic engineering of attenuated malaria parasites for vaccination. Curr Opin Biotechnol 23, 908-16 (2012). Scheller, L.F., Wirtz, R.A. & Azad, A.F. Susceptibility of different strains of mice to hepatic infection with Plasmodium berghei. Infect Immun 62, 4844-7 (1994).

Foquet, L. et al. Molecular detection and quantification of Plasmodium falciparum-infected human hepatocytes in chimeric immune-deficient mice. Malar J

12, 430 (2013).

Ponnudurai et al, Parasitology, 1986.

Gerald et al, Mol Biochem Parasitol, 1996.

van Schaijk et al, FASEB J, 2014