A Genetically Encoded Sensor for PKC-gamma Activation and Signaling

CROSS-REFERENCE TO RELATED APPLICATIONS

[001] This application claims the benefit of U.S. Provisional Application No. 61/043,274, filed

April 8, 2008, which is herein incorporated by reference in its entirety.

STATEMENT OF GOVERNMENT SUPPORT

[002] This invention was made with government support under contract R21 NS448830 awarded by the National Institutes of Health. The government has certain rights in the invention.

FIELD OF INVENTION

[003] The present invention relates to the fields of genetics and molecular biology. In particular, the present invention provides genetically encoded fluorescent sensors for detecting conformational changes of proteins. A genetically encoded fluorescent sensor for detecting PKC-gamma activation is described.

BACKGROUND OF THE INVENTION

[004] The function of many cellular proteins is mediated by conformational changes in the protein's structure. For instance, conformational changes in ion channel proteins gate ion conductance through a cell's membrane. Similarly, an enzyme changes conformation upon binding a substrate, which positions the enzyme to catalyze a reaction. Thus, activity of a protein can be reflected in the protein's conformational state. Sensors that can detect a protein's conformational state would be useful for directly measuring that protein's activity level. [005] Several biosensors that utilize fusion proteins containing green fluorescent protein or a variant thereof have been developed to monitor interactions of proteins, trafficking of proteins, and subcellular localization of proteins within live cells. Most of these fluorescent fusion proteins employ the fluorescent protein (e.g. green fluorescent protein) at either the amino or carboxyl terminus of the fusion protein, which can interfere with the host protein's cellular function or native interactions with other proteins. Alternatively, the fluorescent protein may be inserted into the middle of the host protein. However, selection of a permissible site within the host protein that will not disrupt the protein's function is often difficult. Such problems are

exacerbated if the use of more than one fluorescent protein is desired, for example, for fluorescence resonance energy transfer (FRET) applications. Therefore, there is a need in the art for additional approaches for making fluorescent sensors that detect conformational changes in proteins without disrupting the host protein's function inside the cell.

SUMMARY OF THE INVENTION

[006] The present invention is based, in part, on the discovery that a FRET-based sensor, which detects functional conformational changes in a protein, can be produced by employing a synthetic transposon encoding a pair of fluorescent proteins separated by a short linker. Accordingly, the present invention provides a nucleic acid cassette for making a sensor that can be expressed from within a coding sequence of a target protein without disrupting the protein's cellular function. The inventors employed such a nucleic acid cassette to develop exemplary sensors for activation of protein kinase C-gamma (PKC -γ). Thus, the present invention also provides a sensor for monitoring activation of PKC -γ within live cells. [007] The present invention provides a nucleic acid cassette for making a sensor. In one embodiment, the cassette encodes a first fluorescent protein and a second fluorescent protein, wherein the first and second fluorescent proteins are separated by a linker region such that the first and second fluorescent proteins form functional fluorophores when said nucleic acid cassette is expressed from an internal location of an open reading frame of any protein that changes conformation in response to cellular signals. The first and second fluorescent proteins can be FRET donors and acceptors, respectively. In some embodiments, the FRET donors and acceptors are GFP variants, such as CFP and YFP. In certain embodiments, the nucleic acid cassette is a transposon.

[008] The present invention also includes a sensor for detecting activation of a protein. In one embodiment, the sensor is encoded by an open reading frame comprising a nucleic acid cassette of the invention, wherein the nucleic acid cassette is inserted into the middle of said open reading frame of the protein such that the resulting sensor is a functional protein. In another embodiment, the sensor comprises a fusion protein, wherein the fusion protein comprises a first amino acid sequence having the sequence of an amino terminal portion of the protein; a second amino acid sequence having the sequence of a FRET donor protein and a FRET acceptor protein separated by a linker region, wherein said second amino acid sequence is linked to the carboxyl terminal

end of the first amino acid sequence; and a third amino acid sequence having the sequence of a carboxyl terminal portion of the protein, wherein the third amino acid sequence is linked to the carboxyl terminal end of the second amino acid sequence and wherein the fusion protein is functional.

[009] In some embodiments, the sensor detects activation of a kinase, such as PKC-γ. In one embodiment, the nucleic acid cassette, which encodes the FRET donor and acceptor proteins separated by a linker region, is inserted into the CIb domain of PKC-γ. In another embodiment, the nucleic acid cassette is inserted into the C2 domain of PKC-γ. Activation of the PKC- γ kinase produces a change in the FRET signal measured from the sensor. [0010] The present invention also provides a method for detecting activation of a protein. In one embodiment, the method comprises preparing a fusion protein construct by inserting a nucleic acid cassette of the invention into a nucleic acid comprising an open reading frame encoding a protein such that the resulting fusion protein is functional; expressing the fusion protein construct in a cell; and measuring the FRET signal in a first condition and a second condition, wherein a change in FRET signal between the first and second condition indicates activation of the protein. In a preferred embodiment, the protein is PKC-γ kinase.

[0011] The present invention also encompasses a method of making a sensor to detect an activation state of a protein (e.g. activated or inactivated). In one embodiment, the method comprises inserting a transposon randomly into a nucleic acid comprising an open reading frame encoding a protein, wherein the transposon encodes a FRET donor protein and a FRET acceptor protein separated by a linker region; expressing said nucleic acid containing one or more transposon insertions to produce one or more fusion proteins containing the FRET donor and acceptor proteins, wherein one or more fusion proteins are functional; exposing one or more fusion proteins to a modulator (e.g. activator or inhibitor) of the protein; measuring a change in FRET signal upon exposure to the modulator; and selecting one or more fusion proteins that exhibit a change in FRET signal, wherein the selected fusion proteins are sensors that detect the activation state of the protein. In some embodiments, the transposon is a Tn5 derivative. The transposon can contain a selectable marker gene, such as antibiotic resistance. In certain embodiments, the method is a method of making a sensor to detect activation of PKC-γ kinase. [0012] In another embodiment, the present invention provides a method of screening for modulators of a protein comprising expressing a sensor for the protein in a cell; exposing the cell

to one or more candidate compounds; measuring a change in FRET signal upon exposure to one or more candidate compounds; and selecting one or more compounds that produce a change in FRET signal, wherein the selected compounds are modulators of the protein. The method can be performed at a high-throughput level. Modulators can be activators or inhibitors of the protein. In certain embodiments, the protein is PKC-γ. In one embodiment, activators of PKC-γ are identified by the screening method.

BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1. A. Schematic showing the position of a FRET donor in relation to a FRET acceptor with one of the three linkers or hinges employed in the nucleic acid cassettes of the invention. B. Tn5 synthetic transposon encoding a FRET donor (eCFP) and a FRET acceptor (Venus) separated by a six amino acid linker. The transposon is flanked by mosaic ends (ME), which are recognized by the transposase.

[0014] Figure 2. A. Diagram depicting the thirty eight transposon insertions (open circles) in the different domains of the PKC-γ sequence. B. A subset of the resulting fusion proteins (filled circles) translocated to the cell membrane upon activation of PKC-γ. C. Ratio of emission at 465 nm to 535 nm (e.g. FRET signal) for three different PKC-γ fusion proteins produced by transposon insertions. Papilio 1 and 2 exhibit a change in emission ratio upon stimulation with a phorbol ester.

DETAILED DESCRIPTION

[0015] The present invention provides a novel nucleic acid cassette that can be inserted into a coding sequence of a protein of interest to create a fluorescent fusion protein which acts as a FRET-based sensor of protein activation. The nucleic acid cassette encodes two different fluorescent proteins separated by a short flexible linker sequence that enables the two fluorescent proteins to interact and transfer resonance energy to produce a fluorescent signal. In one embodiment, the nucleic acid cassette is inserted randomly into the coding sequence of the target protein by employing a transposon-based approach. Such an approach allows for the selection of an appropriate internal insertion site where changes in the protein's conformation will be reflected in a change in the FRET signal. Furthermore, this approach eliminates the difficulty and time-consuming effort required to select an insertion site based on structural information.

[0016] To illustrate the methods of the invention, the inventors used the novel nucleic acid cassette to construct a FRET-based sensor to detect activation of PKC-γ. PKC-γ is a calcium- phospholipid-dependent protein kinase that mediates a wide variety of intracellular signaling events. The gamma isoform is exclusively expressed in neurons and has been implicated in various neuronal processes, such as synaptic plasticity. Disruptions of PKC-γ function are thought to be involved in the development of neuropathic pain and neurodegenerative disorders, such as spinocerebellar ataxia- 14. The FRET-based sensors of the invention provide a direct method for measuring PKC-γ activation within living cells and can be adapted for high- throughput screening applications. Given the central role this enzyme plays in many signaling pathways, the sensors of the invention are particularly useful for measuring cell signaling in response to many different kinds of stimulation.

[0017] In one embodiment, the present invention provides a nucleic acid cassette for making a sensor, wherein the nucleic acid cassette encodes a first fluorescent protein and a second fluorescent protein, wherein the first and second fluorescent proteins are separated by a linker region such that the first and second fluorescent proteins form functional fluorophores when said nucleic acid cassette is expressed from an internal location of an open reading frame of a protein. Preferably, the protein changes conformation in response to cellular signals. As used herein, a "sensor" refers to a composition that produces a detectable signal that reflects a change in conformation of a protein of interest. In some embodiments, the change in conformation can indicate an activation of the protein of interest. In other embodiments, the change in conformation can indicate a deactivation or inhibition of the protein of interest. [0018] The nucleic acid cassette can be expressed from an internal location of an open reading frame of a protein of interest. As used herein, an "internal location" refers to any location within the open reading frame of a protein of interest, at a distance of one or more amino acids from either end of the translated protein. For instance, the nucleic acid cassette can be expressed at an internal location that is at least about 5, at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 75, at least about 100, at least about 150, at least about 250, or at least about 500 amino acids or more from either the amino or carboxyl terminus of the translated protein. Thus, in some embodiments, expression of an open reading frame in which the nucleic acid cassette has been inserted in an internal location results in a fusion protein

where the first and second fluorescent proteins encoded by the nucleic acid cassette are flanked by amino acids of the protein of interest.

[0019] In some embodiments, the first fluorescent protein and the second fluorescent are capable of producing a fluorescence resonance energy transfer (FRET) signal. FRET is a distance- dependent excited state interaction in which emission of one fluorophore is coupled to the excitation of another. It occurs primarily because the acceptor dipole interacts or resonates with the donor dipole. A FRET signal can be detected by measuring an emission of the acceptor fluorophore after excitation at the donor fluorophore's wavelength. This wavelength normally would not produce an emission from the acceptor fluorophore, but will produce an emission if an energy transfer occurs between the excited donor fluorophore and the acceptor fluorophore. This energy transfer can also be detected by measuring a decrease of donor emission at its emission wavelength in the presence of an acceptor because the acceptor has a quenching effect on the donor. Energy transfer will take place between the donor and acceptor fiuorophores if the two fluorophores are in close proximity (e.g. within an average of 50-60 Angstroms). [0020] In one embodiment, the first fluorescent protein is a FRET donor and the second fluorescent protein is a FRET acceptor. Several pairs of FRET donors and FRET acceptors are known in the art and suitable for use in the invention. For instance, in certain embodiments, the FRET donor and FRET acceptor are green fluorescent proteins (GFP) or variants thereof. Variants or modified forms of green fluorescent protein include blue fluorescent protein (BFP), enhanced green fluorescent protein (EGFP), cyan fluorescent protein (CFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), YFP-Venus, dsRed, Citrine, mRFPl, mCherry, mOrange, mθrange2, mApple, Azurite, mStrawberry, mBlueberry2, TagBFP, TagCFP, TagGFP2, Tag YFP, TagRFP, mKate, mKate2, Keima, Kusabira, Umikinoko-Green, Kikume Green, Azami-Green, pmKOl, Midoriishi-Cyan, mono KO, pVision-GFP, mKOK, and mUKG. As used herein, the term "variant" is intended to refer to polypeptides with at least about 30%, at least about 40%, at least about 50%, at least about 75% identity, at least about 85%, at least about 90%, at least about 95% or greater identity to native fluorescent molecules. Many such variants are known in the art, or can be readily prepared by random or directed mutagenesis of native fluorescent molecules (see, for example, Fradkov et ciL, FEBS Lett. 479:127-130 (2000), U.S. Patent No. 5,625,048). In one embodiment, the FRET donor is a GFP variant and the FRET acceptor is a different GFP variant. Exemplary FRET donor/acceptor fluorescent proteins

include CFP/YFP, CFP/citrine, GFP/mRFPl, BFP/GFP, BFP/YFP, mUKG/mKOK, EGFP/mKOK, and GFP/mCherry. In a preferred embodiment, the FRET donor is CFP and the FRET acceptor is YFP. In another preferred embodiment, the FRET donor is CFP and the FRET acceptor is citrine. Conceivably, any FRET donor/FRET acceptor pair can be used in the nucleic acid cassette and the methods of the invention as long as the FRET pair can be encoded by a nucleic acid.

[0021] In some embodiments, the FRET donor and FRET acceptor interact to produce a FRET signal. For instance, excitation at the FRET donor's wavelength produces a signal at the FRET acceptor's emission wavelength. In other embodiments, the FRET donor and FRET acceptor interact to quench or suppress a signal. For instance, the FRET acceptor may absorb the energy transferred from the FRET donor, but not produce an independent signal. That is, the FRET acceptor quenches the signal from the FRET donor. In such embodiments, a signal from the FRET donor would appear when the FRET donor and FRET acceptor were no longer in close proximity such that energy transfer would not occur (i.e. during a conformational change of the fusion protein).

[0022] In another embodiment, the first and second fluorescent proteins can be separated by a linker region. Preferably the linker region is of sufficient length to allow the first and second fluorescent proteins to form functional fluorophores. A "functional fluorophore" means that the fluorescent protein is able to fold into its native conformation and produce a fluorescent signal upon excitation at a particular wavelength. The linker region can be at least about one, at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about fifteen, at least about twenty up to about fifty amino acids or more. The linker region can be encoded by a nucleic acid that contains a restriction site or a nucleic acid that contains a lox p site or variant thereof that is recognized by site-specific recombinases, such as Cre recombinase or FLP recombinase. Exemplary linker nucleic acid sequences include the sequences GGTACCGGTAATGGTGGTGGTAAT (SEQ ID NO: 3); GGAGGTGGAGGTACCACA (SEQ ID NO: 4); and GGTACCACA (SEQ ID NO: 5).

[0023] In some embodiments, the nucleic acid cassette further comprises a selectable marker. A selectable marker can be used, for instance, to detect in-frame insertions of the nucleic acid cassette within the open reading frame of the protein of interest. Selectable marker genes can

vary depending on the host cell to be used. For instance, suitable selectable marker genes include, but are not limited to, antibiotic resistance genes, such as kanamycin, ampicilin, tetracycline, gentamycin, phleomycin, erythromycin, clindamycin, neomycin, chloramphenicol, and zeocin resistance, as well as any genetic elements that can be used for selection (e.g. supF or URA3). The selectable marker can be flanked by restriction sites for later removal. [0024] The present invention also includes methods of making a nucleic acid cassette encoding a first fluorescent protein and a second fluorescent protein separated by a linker region and inserting the cassette into an open reading frame of a protein. For instance, the skilled artisan can design and chemically synthesize adapter nucleic acids for facilitating insertion of the nucleic acid cassette into the open reading frame of a gene or cDNA encoding a protein of interest by incubating the nucleic acid cassette, suitable adapter, and cleaved DNA encoding the protein of interest with a ligase enzyme using methodology known in the art. The nucleic acid cassette can be inserted at any known restriction site with the knowledge of the gene sequence of the protein of interest in hand. Adapters can be designed to facilitate insertion of the nucleic acid cassettes into any restriction site, with the length and codon content of the adaptor being designed to maintain the open reading frame, structure and/or function of the resulting fusion protein. Alternatively, the DNA encoding the protein of interest can be physically sheared, for instance, using hydrodynamic forces, sonication, shaking or vortexing, and the nucleic acid cassette inserted into the sheared DNA using blunt-end ligation and/or gap-fill reactions. [0025] In some embodiments, the nucleic acid cassette is a transposon. By using a transposon encoding a first fluorescent protein and a second fluorescent protein separated by a linker region, the fluorescent protein pair can be introduced at random locations within the gene or cDNA for the protein of interest. Such an approach is particularly useful where one does not know which location in the coding region of interest will produce a change in the fluorescent signal in response to a conformational shift in the protein's structure. A selectable marker can be used to select for nucleic acids receiving a transposon insertion, and the selectable marker can be subsequently removed following transposition to recreate the fused reading frame using restriction digestion or site-specific recombination, for instance, using a recombinase (e.g. Cre or FLP recombinase).

[0026] The particular type of transposon employed can vary, and may be selected and modified depending on the characteristics of the insertions that are desired. Transposition reactions can be

performed in vitro with an isolated nucleic acid target or library of target nucleic acids, by exposing the target nucleic acid(s) to the transposon and isolated transposase enzyme. Nucleic acids receiving transposon insertions can then be selected by transforming the nucleic acids from the reaction into a suitable host cell and selecting cells expressing the selectable marker on the transposon. Any type of transposon can be used as the nucleic acid cassette of the invention including, but not limited to, bacterial transposons and eukaryotic transposons {e.g. insect, animal, and plant-derived transposons). Suitable insect or animal-derived transposons include Mariner-type transposons, Sleeping Beauty transposons, piggyBac transposons, Tigger transposons, pogo transposons and AIu elements, among others. Plant-derived transposons include, but are not limited to, activator transposons (Ac), mutator transposons (Mu), mutator- like elements (Mules), Suppressor mutator (Spm) transposons, Enhancer/Suppressor (En/Spm) transposons, Taml, Tam2, and Tam3 transposons, to name a few. Bacterial transposons useful as nucleic acid cassettes of the invention include any known bacterial transposon, such as TnIO (Huisman et al. (1987) Genetics, Vol. 116: 191-9), mTn (Ross-Macdonald et al. (1997) Proc. Natl. Acad. Sci. U S A, Vol. 94:190-5), as well as Tn3 (Hoekstra et al. (1991) Proc. Natl. Acad. Sci. U S A, Vol. 88:5457-61), Tn5 and Tn4430 (reviewed in: Manoil and Traxler (2000) Methods, Vol. 20:55-61). A suitable transposon can also be chosen from any of the publicly available databases. For instance, ACLAME (A CLAssification of genetic Mobile Elements) is a database dedicated to the collection and classification of mobile genetic elements (MGEs) from various sources, including all known phage genomes, plasmids and transposons. In a preferred embodiment, the transposon suitable for use as a nucleic acid cassette of the invention is a Tn5 derivative. Tn5 derivatives are particularly useful for in vitro transposition reactions as Tn5 transposase is commercially available in isolated form (EZ-Tn5™, Epicentre Biotechnologies; see, e.g., US patents 5,925,545; 5,948,622; 5,965,443; 6,437,109; 6,159,736; and 6,294,385, which are each herein incorporated by reference in their entireties). The most useful transposons will show little preference for insertion site, in order to maximize the efficiency of the screen for appropriate insertion sites; show a high frequency of insertion into other sequences of DNA; and contain at least one reading frame across the DNA sequences that flank the transposon sequence and which are incorporated in the DNA that is ultimately inserted into the target. This latter characteristic is particularly important for producing a fusion protein in which the sequence

encoding the target protein, and the one encoding the fluorescent protein pair, are joined to produce one continuous reading frame that encodes a single fusion protein. [0027] The nucleic acid cassette encoding a first fluorescent protein and a second fluorescent protein separated by a linker region as described herein can be inserted into virtually any open reading frame of a target protein of interest to produce a sensor to detect the activation state of the target protein (e.g. activated or inactivated). For instance, target proteins can include, but are not limited to, enzymes (e.g. kinases, phosphatases, proteases), ion channels, receptors, and transcription factors. Thus, the present invention includes a method of making a sensor to detect activation of a protein.

[0028] In one embodiment, the method comprises inserting a transposon randomly into a nucleic acid comprising an open reading frame encoding a protein, wherein the transposon encodes a FRET donor protein and a FRET acceptor protein separated by a linker region; expressing said nucleic acid containing one or more transposon insertions to produce one or more fusion proteins containing the FRET donor and acceptor proteins, wherein one or more fusion proteins are functional, exposing one or more fusion proteins to a modulator of the protein; measuring a change in FRET signal upon exposure to the modulator; and selecting one or more fusion proteins that exhibit a change in FRET signal, wherein the selected fusion proteins are sensors that detect the activation state of the protein. The change in FRET signal can be a decrease in the signal or an increase in the signal. The transposon can be any of the transposons described herein. In a preferred embodiment, the transposon is a Tn5 derivative. In some embodiments, the transposon can encode a selectable marker gene, such as an antibiotic resistance gene as described above. The selectable marker gene can, in some embodiments, be subsequently removed by restriction digestion or site-specific recombination.

[0029] In some embodiments, the transposon is randomly inserted into a nucleic acid by employing an in vitro transposition reaction. Such reactions are well known in the art and entail combining the transposon with a nucleic acid encoding a protein of interest (e.g. plasmid, cDNA) in a reaction tube with a purified transposase, such as the commercially available EZ:TN5™. The resulting solution from the transposition reaction is typically used to transform bacteria or other host cells to isolate and select for transposon insertions. Selectable markers encoded on the transposon can be used in the selection process. The selected plasmids or nucleic acids encoding the fusion proteins resulting from transposon insertion can be screened for function by

transfection into host cells. In some embodiments, mammalian host cells, such as HEK cells, are preferred.

[0030] As used herein, a "modulator" is a compound that activates or inhibits the native biological function of a target protein. A modulator can be an activator or inhibitor of target protein function. An "activator" refers to a compound that produces a conformational change in the target protein and/or induces the native biological function of the protein. For instance, an activator of an ion channel would increase conductance and ion flux across a membrane. An activator of an enzyme would induce the formation of product from the reaction catalyzed by the enzyme. By way of example, an activator of a kinase would increase the transfer of phosphate to a natural or synthetic substrate of the kinase. In one embodiment of the invention, the protein is a kinase. In another embodiment, the kinase is PKC -γ. Activators of PKC -γ include, but are not limited to, phorbol esters and ligands of G-protein coupled receptors, such as the Ml muscarinic receptor. An "inhibitor" refers to a compound that produces a conformational change in a protein that reflects an inactivated or deactivated state of a target protein. "Activation state" means a conformational configuration that is associated with either an activated, functional form of the target protein or a deactivated, inhibited form of the protein.

[0031] Any of the FRET donor and acceptor proteins described herein can be encoded on the transposon for use in the methods of making a sensor to detect protein activation. In one embodiment, the FRET donor protein is a GFP variant and the FRET acceptor protein is a different GFP variant. In another embodiment, the FRET donor protein is CFP and the FRET acceptor is YFP. In some embodiments, the linker region separating the FRET donor and the FRET acceptor proteins is three or more amino acids, six or more amino acids, or eight or more amino acids. The linker region can comprises nucleic acids that constitute a lox p site or variant thereof, which is recognized by Cre recombinase, for removal or exchange of selectable markers. [0032] Methods of measuring FRET signals are well known to those skilled in the art and include measuring fluorescence at particular emission wavelengths following excitation at other wavelengths using fluorimeters, fluorescent microscopes or fluorescent microplate readers. For instance, a FRET signal can be measured by detecting an increase in fluorescence at the emission wavelength of the acceptor fluorophore or by detecting a decrease in fluorescence at the emission wavelength of the donor fluorophore. The particular excitation and emission wavelengths employed will depend on the specific FRET donor and acceptor proteins encoded by the

transposon. Excitation and emission wavelengths for common FRET donor/acceptor pairs are known in the art and can be readily ascertained by the skilled artisan.

[0033] The present invention also encompasses sensors for detecting activation of a protein. In one embodiment, the sensor is encoded by an open reading frame comprising a nucleic acid cassette as described herein, wherein the nucleic acid cassette is inserted into the middle of said open reading frame of the protein such that the resulting sensor is a functional protein. The nucleic acid cassette encodes a first fluorescent protein and a second fluorescent protein, wherein the first and second fluorescent proteins are separated by a linker region such that the first and second fluorescent proteins form functional fluorophores. The protein can be any protein that changes conformation upon stimulation (e.g. binding another protein, phosphorylation, dephosphorylation). In some embodiments, the protein is an enzyme. In one embodiment, the protein is a kinase.

[0034] In a preferred embodiment of the invention, the protein is PKC -γ. Thus, the present invention provides a sensor for detecting activation of PKC-γ. The PKC -γ sensors of the invention allow for direct measurement of PKC-γ activation, which is a considerable improvement over previously developed assays for measuring PKC-γ activation. For instance, many prior art assays involve the detection of a change in fluorescence of a PKC substrate when the substrate becomes phosphorylated or dephosphorylated (see, e.g. U.S. Patent Nos. 7,125,682 and 6,203,994). Such measurements are indirect and require the use of other reagents to perform the measurement. Other PKC assays involve the detection of translocation of the activated, fluorescently-labeled PKC enzyme to the membrane (see, e.g., U.S. Patent No. 6,518,021). The readout of such assays is problematic due to the requirement to spatially resolve the fluorescent signal. Furthermore, these translocation-based assays are not readily adapted to high throughput screening methods. The PKC-γ sensors described herein provide several advantages over previous methods for detecting activation of this kinase, including rapid, direct measurements and amenability to use in high throughput methods. In addition, the PKC-γ sensors of the invention can be used to create cell lines and transgenic animals, which would enable the detection of PKC-γ activation in response to physiologically relevant stimuli. [0035] In one embodiment, the sensor is encoded by an open reading frame comprising a nucleic acid cassette, said nucleic acid cassette encoding a first fluorescent protein and a second fluorescent protein, wherein the first and second fluorescent proteins are separated by a linker

region, and wherein the nucleic acid cassette is inserted in the CIb domain of PKC -γ. In another embodiment, the nucleic acid cassette is inserted between amino acids 234 and 235 of the PKC- γ primary sequence. In another embodiment, the sensor is encoded by an open reading frame comprising a nucleic acid cassette, said nucleic acid cassette encoding a first fluorescent protein and a second fluorescent protein, wherein the first and second fluorescent proteins are separated by a linker region, and wherein the nucleic acid cassette is inserted in the C2 domain of PKC-γ. In still another embodiment, the nucleic acid cassette is inserted between amino acids 268 and 269 of the PKC-γ primary sequence.

[0036] In certain embodiments, the first fluorescent protein and the second fluorescent protein are a FRET donor and FRET acceptor, respectively. Preferably, the PKC-γ sensor produces a change in the FRET signal upon activation of the PKC-γ kinase. In one embodiment, the change is a decrease in FRET signal. For instance, such a decrease in FRET signal would be observed where a conformational change in PKC-γ upon activation caused the first fluorescent protein and the second fluorescent protein to become further separated spatially such that an energy transfer between the two fluorophores is reduced or eliminated. In another embodiment, the change is an increase in FRET signal. Such an increase can be observed where an activation-induced conformational change in PKC-γ increases the proximity of the first and second fluorescent proteins and thus enhances the energy transfer between the fluorophores.

[0037] In another embodiment, the sensor for detecting activation of a protein comprises a fusion protein, wherein the fusion protein comprises a first amino acid sequence having the sequence of an amino terminal portion of the protein; a second amino acid sequence having the sequence of a FRET donor protein and a FRET acceptor protein separated by a linker region, wherein said second amino acid sequence is linked to the carboxyl terminal end of the first amino acid sequence, and a third amino acid sequence having the sequence of a carboxyl terminal portion of the protein, wherein the third amino acid sequence is linked to the carboxyl terminal end of the second amino acid sequence and wherein the fusion protein is functional. As used herein, "functional" means that the fusion protein is capable of the same activity and interaction as the native protein. By way of example, a functional fusion protein containing an enzyme as one of the fusion partners would retain the same catalytic activity as the native (e.g. unfused) enzyme. In certain embodiments, the protein is a kinase. In other embodiments, the kinase is PKC-γ. "Amino terminal portion" refers to a portion of the protein that contains at least one, at least five,

at least ten, at least fifteen, at least twenty, at least thirty, at least forty, at least fifty, at least seventy-five, at least 100, or at least 200 amino acids from the amino terminus of the protein. "Carboxyl terminal portion" refers to a portion of the protein that contains at least one, at least five, at least ten, at least fifteen, at least twenty, at least thirty, at least forty, at least fifty, at least seventy-five, at least 100, or at least 200 amino acids from the carboxyl terminus of the protein. [0038] The present invention also provides a method of detecting activation of a protein. In one embodiment, the method comprises preparing a fusion protein construct by inserting a nucleic acid cassette as described herein into a nucleic acid comprising an open reading frame encoding a protein such that the resulting fusion protein is functional; expressing the fusion protein construct in a cell; and measuring the FRET signal in a first condition and a second condition, wherein a change in FRET signal between the first and second condition indicates activation of the protein. The nucleic acid cassette preferably encodes a FRET donor protein and a FRET acceptor protein that interact to produce a FRET signal. Any of the FRET donor/acceptor pairs described herein or otherwise known to those skilled in the art can be used in the method. In one embodiment, the FRET donor is CFP and the FRET acceptor is YFP.

[0039] A first condition can be a control condition, for instance, the absence of an activator or stimulator of the protein. A first condition can also be a particular developmental state, disease- free state, or other physiological "normal" condition. A second condition can be a condition in which an activator or stimulator of the protein is present or a condition of interest, such as a disease state or developmental state. Generally, the first and second conditions can be any conditions where it is of interest to examine the activation state of the protein. A change in the FRET signal between the first and second conditions preferably indicates activation of the protein. The change in signal could be a decrease or an increase depending on the location of the FRET donor and acceptor proteins within the protein's coding sequence. In one embodiment, the method detects activation of a kinase. In another embodiment, the kinase is PKC-γ. [0040] In another embodiment, the present invention provides a method for screening modulators of a target protein using the sensors of the invention. In one embodiment, the method comprises expressing a protein sensor as described herein in a cell; exposing the cell to one or more candidate compounds, measuring a change in FRET signal upon exposure to one or more candidate compounds, and selecting one or more candidate compounds that produce a change in FRET signal, wherein the selected compounds are modulators of the protein. In some

embodiments, the protein is PKC -γ. In one particular embodiment, the method comprises expressing a PKC-γ sensor as described herein in a cell; exposing the cell to one or more candidate compounds, measuring a change in FRET signal upon exposure to one or more candidate compounds, and selecting one or more candidate compounds that produce a change in FRET signal, wherein the selected compounds are activators of PKC-γ. As used herein the term "candidate compound" refers to any molecule that may potentially modulate the catalytic activity of a target protein, such as PKC-γ. Non-limiting examples of candidate compounds that can be screened according to the methods of the present invention are proteins, peptides, polypeptides, including antibodies and fragments thereof, polynucleotides, oligonucleotides or small molecules. In some embodiments, the change in FRET signal that is measured is a decrease in FRET signal. In other embodiments, the change in FRET signal that is measured is an increase in FRET signal.

[0041] The screening method can be performed at a high-throughput level. Performance of the method at a high throughput level can entail testing two or more compounds for activation of a target protein simultaneously. One possible high throughput approach would be to grow cells transfected with the protein sensor (e.g. PKC-γ sensor) described above in a multiwell plate (e.g. 24, 48, 96, 384, 1536-wells). Cells in each well can be exposed to a different candidate compound allowing for the testing of multiple compounds at the same time. The number of compounds that could be tested at one time would only be limited by the number of wells in the plate. Conceivably, any host cell can be used in the screening method as long as the host cell is capable of synthesizing the genetically-encoded sensor. Suitable host cells include, but are not limited to, human embryonic kidney (HEK) cells, baby hamster kidney (BHK) cells, human epithelial HeLa cells, Chinese hamster ovary (CHO) cells, COS cells, mouse L cells, LNCaP cells, CVl cells, MDCK cells, Vero cells, and Hep-2 cells.

[0042] This invention is further illustrated by the following additional examples that should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application, as well as the Figures, are incorporated herein by reference in their entirety.

EXAMPLES

Example 1. Construction of a synthetic transposon encoding fluorescent protein pairs

[0043] A novel transposon was created that encoded two fluorescent proteins separated by a short hinge. To create the transposon, the mosaic ends from a hyperactive Tn5 transposon were used on either end of a nucleic acid sequence encoding a eCFP coding sequence and the coding sequence of the Venus variant of YFP (Nagai et al. (2002) Nat. BiotechnoL, Vol. 20: 87-90) separated by a hinge or linker region. The mosaic ends are 19 base pair inverted repeats that can be placed on either side of any stretch of DNA to create a Tn5 transposon. The sequences of the mosaic ends are given below:

CTGTCTCTTATACACATCT (SEQ ID NO: 1) AGATGTGTATAAGAGACAG (SEQ ID NO: 2)

[0044] Three different linker regions of varying length (e.g. 8, 6, and 3 amino acids) were used to separate the coding sequences of eCFP (FRET donor) and Venus YFP (FRET acceptor). All three linkers (See Figure IA) allowed for both fluorescent proteins to fold and function correctly when the transposon was inserted into the coding sequence of another protein. The synthetic Tn5 transposon was created using PCR and standard subcloning techniques to insert the mosaic ends on either end of the nucleic acid cassette encoding the two fluorescent proteins and the linker. The nucleic acid cassette encoded in a 5' to 3' direction the Venus YFP variant, one of the three linker nucleic acids (GGTACCGGTAATGGTGGTGGTAAT (SEQ ID NO: 3); GGAGGTGGAGGTACCACA (SEQ ID NO: 4); GGTACCACA (SEQ ID NO: 5)), and the coding sequence for eCFP. The kanamycin resistance gene (Kan ^R ) flanked by Srfl restriction sites was incorporated into the transposon to select for transposon insertions. Immediately before the Kan ^R there is a stop codon; therefore, each clone containing an in-frame insertion should encode a truncated protein with eCFP at the carboxyl terminus. A schematic of the synthetic Tn5 transposon using the 6 amino acid linker is shown in Figure IB. The resulting synthetic transposons, in combination with recombinant Tn5 transposase, can be inserted into a target plasmid in an in vitro reaction in which the transposase recognizes the mosaic ends of the transposon and inserts the transposon in a reasonably random fashion into any other DNA present in the reaction. Thus, one can obtain several different fusions of a target protein and the linked fluorescent proteins. The linkers employed enable the two fluorescent proteins to be in

close proximity to one another to produce a FRET signal when the fusion protein is produced in a cell.

Example 2. A sensor for PKC -γ activation

[0045] Using the synthetic transposon described in Example 1 , a sensor was created for detecting activation of PKC-γ. The transposon encoding Venus YFP and eCFP separated by the six amino acid linker or hinge (Figure IB) was randomly inserted into the primary structure of PKC-γ in an in vitro transposition reaction. The reaction produced insertions in 38 separate locations along the primary sequence of PKC-gamma (open circles in Figure 2A). Spectral analysis showed that all of the insertions produced a fluorescent fusion protein with both CFP (FRET donor) and YFP (FRET acceptor) fluorescence (data not shown).

[0046] The fluorescent PKC-γ fusion proteins were activated by addition of phorbol 12,13- dibutyrate (PDBU) to HEK cells expressing the fusion proteins. PDBU activates PKC-γ directly, by binding the Cl domain of the protein. Only a subset of the fluorescent proteins {e.g. 14 out of 38) translocated to the cell membrane in response to PDBU activation (see filled circles in Figure 2B). When expressed and imaged in HEK 293 cells, most of these PKC-γ fusion proteins did not exhibit a change in FRET upon stimulation with PDBU. The FRET signal {e.g. 465/535 emission ratio) of Papilio 3 as shown in Figure 2C is representative of an insertion that did not produce a change in FRET signal upon activation of the fusion protein. However, two insertions produced fusion proteins, Papilio 1 and Papilio 2, that translocated to the membrane and produced a change in FRET signal upon stimulation with PDBU (Figure 2C). Papilio 1 contains a transposon insertion between amino acids 234 and 235 in the CIb domain of PKC-γ, while Papilio 2 contains a transposon insertion between amino acids 268 and 269 in the C2 domain of PKC-γ (Figure 2B). In response to activation of the PKC-γ, the Papilio 1 fusion protein produced a loss in FRET signal that exceeded 50% (Figure 2C). Papilio 2 produced approximately a 30% loss in FRET signal in response to PKC-γ activation (Figure 2C). Similar results were obtained when citrine was used as the FRET acceptor in place of Venus YFP. [0047] These results demonstrate that the random labeling approach achieved with the transposon-based construction of fluorescent fusion proteins can be successfully used to obtain appropriate insertion points to create fluorescent sensors that signal changes in the conformation of a target protein. The two PKC-γ sensors described in this example can be used in a number of

applications including high throughput screens for novel compounds that activate or inhibit this protein kinase.

[0048] It is understood that the disclosed invention is not limited to the particular methodology, protocols and materials described as these can vary. It is also understood that the terminology used herein is for the purposes of describing particular embodiments only and is not intended to limit the scope of the present invention which will be limited only by the appended claims. [0049] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.