GENETICALLY MODIFIED NON-HUMAN ANIMALS AND PRODUCTS THEREOF

CROSS -REFERENCE

[0001] This application claims the benefit of U.S. Provisional Patent Application No.

62/462,195, filed February 22, 2017, and U.S. Provisional Patent Application No. 62/539,208, filed July 31, 2017, which applications are incorporated herein by reference in their entirety.

INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED AS A TEXT FILE

[0002] A Sequence Listing is provided herewith as a text file, "BERK-349PRV2_SEQ

LISTING_170726_ST25" created on July 26, 2017 and having a size of 675 KB. The contents of the text file are incorporated by reference herein in their entirety.

INTRODUCTION

[0003] Recent advancements in genome engineering for producing genetically modified

animals have many potential applications, for example, to model and study disease for research purposes and to improve production parameters of domestic animals. Foie gras is the fattened liver of a goose or duck and is considered a luxury food throughout the world. However, Foie gras is traditionally produced through the inhumane practice of force-feeding animals, a controversial practice that raises serious animal welfare concerns. The process of force -feeding is also extremely labor-intensive, greatly increasing the cost of production.

[0004] Objection to force -feeding has led over 15 nations and the state of California to ban the production of foie gras. In 1999, the Standing Committee of the European Convention for the protection of animals kept for farming purposes adopted a resolution entitled "Recommendation Concerning Muscovy Ducks (Cairina moschata) and Hybrids Of Muscovy And Domestic Ducks {Anas platyrhynchos)" , to encourage new scientific evidence on alternative methods of producing foie gras that are more humane.

[0005] There is a need for developing genetically modified birds, such as geese or ducks that will naturally develop a fatty liver during their natural lifespan with minimal or no need for force-feeding.

SUMMARY

[0006] The present disclosure provides systems and methods of making genetically modified birds that comprise a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage, wherein the disruption results in development of a fatty liver. The disclosure further provides methods for producing a food product, such as foie gras, using a subject genetically modified bird, as well as food products harvested from a subject genetically modified bird.

[0007] The present disclosure features a genetically modified bird, wherein the genetically modified bird is genetically modified to comprise a disruption in one or more target genes, wherein the one or more target genes is a: fatty acid metabolism pathway gene; gene that controls appetite; or gene that regulates fatty acid storage, wherein the disruption results in development of a fatty liver. In some cases, the genetically modified bird is a duck. In yet other instances, the genetically modified bird is a goose. In some embodiments, the genetically modified bird is a poultry animal. In some cases, the genetically modified bird is a chicken. In many instances, the genetically modified bird has a genetic modification that is present in multiple organs. In some cases, the genetically modified bird has a genetic modification that is liver specific. In such cases, the genetically modified bird can be genetically modified using CRISPR and Cre/loxP tissue-specific recombination techniques to generate liver-specific modifications. In many cases, the genetically modified bird is genetically modified to comprise a disruption in one or more target genes, wherein the one or more target genes comprises a nucleotide sequence having at least 80%, at least 90%, at least 95%, at least 98%, at lease 99%, or 100%, nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).

[0008] Aspects of the present disclosure further feature a method of making a genetically modified bird of the present disclosure. In some embodiments, the method generally involves: a) genetically modifying a bird stage X primordial germ cell, wherein genetic modification of bird stage X primordial germ cell comprise a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; b) delivering the genetically modified bird stage X primordial germ cell into a recipient embryo; and c) allowing the recipient embryo or artificial embryo to hatch as a chick. In some embodiments, the stage X primordial germ cell line of the method is delivered into the recipient embryo by injection. In other cases, the method generally involves: delivering a CRISPR/Cas plasmid construct to the bird stage X recipient embryo, wherein the CRISPR/Cas plasmid construct causes a disruption in one or more target genes of a recipient stage X embryo, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage. In such instances, the CRISPR/Cas plasmid construct delivered to the bird stage X recipient embryo genetically modifies primordial germ cells within the embryo. In some cases, the genetic modification of the method is achieved using a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas system. In yet other cases, the genetic modification of the method is achieved using a Transcription activator-like effector nucleases (TALENs) system. In yet other embodiments, the genetic modification of the method is achieved using a Zinc Finger Nucleases (ZFNs) system. In yet other cases, the method generally involves: a) genetically modifying an avian spermatozoa, wherein the genetic modification of the avian spermatozoa comprises a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; b) delivering the genetically modified bird spermatozoa to a hen; c) creating a artificial embryo; and d) allowing the artificial embryo to hatch as a chick. In some embodiments, the modified bird spermatozoa produced by the method is delivered into a hen by artificial insemination. In some embodiments, the genetic modification of the method is achieved using a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas system. In yet other embodiments, the genetic modification of the method is achieved using a TALEN system. In yet other embodiments, the genetic modification of the method is achieved using a ZFN system.

[0009] The present disclosure further features an isolated organ from a genetically modified bird of the present disclosure. In many cases, the isolated organ from the genetically modified bird is a liver. In some cases, the isolated organ from the genetically modified bird is a fatty liver. In some embodiments, the isolated organ from the genetically modified bird has greater than: 50 weight percent fat; 40 weight percent fat; or 30 weight percent fat. In some cases, a food product is produced from the isolated organ of the genetically modified bird. In some embodiments, the food product produced from the isolated organ of the genetically modified bird is foie gras.

[0010] The present disclosure further features a method of producing a food product. In some cases, the method generally involves harvesting a food product from an organ of a genetically modified bird of the present disclosure. In other cases, the method generally involves processing a food product harvested from the organ of the genetically modified bird. In some cases, the method generally involves harvesting an organ from the genetically modified bird; and processing the organ, to produce a food product.

[0011] The present disclosure further features a method for producing a fatty liver. In some

embodiments, the method generally involves: feeding a methionine and choline deficient (MCD) diet, a choline -deficient diet (CD), a high-fat containing diet (HFD), or a conjugated linoleic acid (CLA) containing diet to a genetically modified bird of the present disclosure during at least one of a plurality of growth periods; and harvesting the liver from the genetically modified bird. [0012] The present disclosure further features a method for producing foie gras. In some embodiments, the method generally involves: feeding a methionine and choline deficient (MCD) diet, a choline-deficient diet (CD), a high-fat containing diet (HFD), or a conjugated linoleic acid (CLA) containing diet to a genetically modified bird of the present disclosure during at least one of a plurality of growth periods; harvesting the liver from the genetically modified bird; and preparing foie gras from the harvested liver.

[0013] The present disclosure further features a system for generating a genetically modified bird. In some cases, the composition comprises: a) a first CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the first CRISPR/Cas guide RNA, wherein the first CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a first target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and b) a second CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the second CRISPR/Cas guide RNA, wherein the second CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a second target sequence in the target gene, wherein the second target sequence is 3' of the first target sequence. In some embodiments, the first target sequence and the second target sequence of the system are separated from each other by at least 25 base pairs. In other cases, the system comprises: a) CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the CRISPR/Cas guide RNA, wherein the CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and b) a donor template DNA, or a nucleic acid comprising a nucleotide sequence encoding the donor template DNA, where the donor template DNA replaces all or a portion of a target gene, resulting in a defect in the target gene. In other cases, the system comprises: a CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the CRISPR/Cas guide RNA, wherein the CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; where a class 2 CRISPR/Cas endonuclease introduces a double-stranded break in the target gene that, when repaired, results in a defect in the target gene. In some cases, the target gene of the system comprises a nucleotide sequence having least 80% nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), AP01A (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62). In some embodiments, the composition of the system further comprises a class 2 CRISPR/Cas endonuclease, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR/Cas endonuclease. In some cases, the class 2 CRISPR/Cas endonuclease of the system is a Cas9 protein. In yet other cases, the class 2 CRISPR/Cas endonuclease of the system is a Cpfl protein, a C2cl protein, a C2c3 protein, or a C2c2 protein. In some cases, the class 2 CRISPR /Cas endonuclease is a type V or type VI CRISPR/Cas endonuclease. In some cases, the first and second CRISPR/Cas guide RNAs of the system are Cas9 CRISPR/Cas guide RNAs. In some cases, the first and second CRISPR/Cas guide RNAs of the system are single molecule CRISPR/Cas guide RNAs. In yet other embodiments, the first and second CRISPR/Cas guide RNAs of the system are dual molecule CRISPR/Cas guide RNAs.

BRIEF DESCRIPTION OF THE DRAWINGS

[0014] FIG. 1 provides a nucleotide sequence of the MAT1A gene (SEQ ID NO: 51) in Anas

platyrhynchos.

[0015] FIG. 2 provides a nucleotide sequence of the ACOX1 gene (SEQ ID NO: 52) in Anas

platyrhynchos.

[0016] FIG. 3 provides a nucleotide sequence of the LEPR gene (SEQ ID NO: 53) in Anas

platyrhynchos.

[0017] FIG. 4 provides a nucleotide sequence of the LEP gene (SEQ ID NO: 54) in Anas

platyrhynchos.

[0018] FIG. 5 provides a nucleotide sequence of the SIRT7 gene (SEQ ID NO: 55) in Anas

platyrhynchos.

[0019] FIG. 6 provides a nucleotide sequence of the APOl A gene (SEQ ID NO: 56) in Anas

platyrhynchos.

[0020] FIG. 7 provides a nucleotide sequence of the SIRT1 gene (SEQ ID NO: 57) in Anas

platyrhynchos.

[0021] FIG. 8 provides a nucleotide sequence of the SIRT3 gene (SEQ ID NO: 58) in Anas

platyrhynchos.

[0022] FIG. 9 provides a nucleotide sequence of the SIRT4 gene (SEQ ID NO: 59) in Anas

platyrhynchos. [0023] FIG. 10 provides a nucleotide sequence of the SIRT5 gene (SEQ ID NO: 60) in Anas platyrhynchos.

[0024] FIG. 11 provides a nucleotide sequence of the SIRT6 gene (SEQ ID NO: 61) in Anas

platyrhynchos.

[0025] FIG. 12 provides a nucleotide sequence of the PTEN gene (SEQ ID NO: 62) in Anas

platyrhynchos.

[0026] FIG. 13 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the MAT1A gene (SEQ ID NO:63).

[0027] FIG. 14 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the ACOX1 gene (SEQ ID NO:64).

[0028] FIG. 15 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the LEPR gene (SEQ ID NO:65).

[0029] FIG. 16 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the SIRT7 gene (SEQ ID NO:66).

[0030] FIG. 17 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the LEP gene (SEQ ID NO:67).

[0031] FIG. 18 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the SIRT1 gene (SEQ ID NO:68).

[0032] FIG. 19 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the SIRT3 gene (SEQ ID NO:69).

[0033] FIG. 20 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the SIRT4 gene (SEQ ID NO:70).

[0034] FIG. 21 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the SIRT5 gene (SEQ ID NO:71).

[0035] FIG. 22 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the SIRT6 gene (SEQ ID NO:72).

[0036] FIG. 23 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the PTEN gene (SEQ ID NO:73).

[0037] FIG. 24 provides a guide nucleotide sequence of a CRISPR/Cas guide RNA for the APOIA gene (SEQ ID NO:74).

[0038] FIG. 25 illustrates a schematic of liver-specific knockout of target genes using CRISPR/Cas9 gene editing tool for delivery of LoxP sequences to flank target genes and create a genetically modified bird with floxed LoxP sites. The genetically modified bird is intercrossed with a transgenic bird expressing Albumin-Cre (Alb-Cre; Cre recombinase operably linked to an albumin promoter) in the liver to create a genetically modified bird lacking the target genes.

[0039] FIG. 26A provides a table (Table 2) showing nucleic acids comprising nucleotide sequences encoding CRISPR/Cas single guide RNAs #1-4 for each target gene MATIA (SEQ ID NOs: 87- 90), ACOXl (SEQ ID NOs: 91-94), SIRT7 (SEQ ID NOs: 95-98), LEPR(SEQ ID NOs: 99-102), and LEP (SEQ ID NOs: 103-106). FIG. 26B provides a table (Table 3) showing a guide nucleotide sequences of a CRISPR/Cas guide RNA for each of the MATIA (SEQ ID NOs: 107- 108, 63, 109), ACOXl (SEQ ID NOs: 110-113), SIRT7 (SEQ ID NOs: 114-116, 66), LEPR (SEQ ID NOs: 117-120), and LEP (SEQ ID NOs: 121-124) target genes.

[0040] FIG. 27 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as " edited", of the target gene MATIA for each of the CRISPR/Cas9 single guide RNAs 1-4.

[0041] FIG. 28 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as " edited", of the target gene ACOXl at exon 8 for each of the CRISPR/Cas9 single guide RNAs 1-2.

[0042] FIG. 29 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as " edited", of the target gene ACOXl at exon 9 for each of the CRISPR/Cas9 single guide RNAs 3-4.

[0043] FIG. 30 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as " edited", of the target gene SIRT7 for each of the CRISPR/Cas9 single guide RNAs 1-4.

[0044] FIG. 31 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as " edited", of the target gene LEPR for each of the CRISPR/Cas9 single guide RNAs 1-4.

[0045] FIG. 32 provides a plot showing t the percentage of INDELs (i.e. insertions or deletions),

denoted as " edited", of the target gene LEP for each of the CRISPR/Cas9 single guide RNAs

1-4.

[0046] FIG. 33A-33C provide Tables 4-6. FIG. 33A provides a table (Table 4) showing assembly oligonucleotide primer sequences containing T7 promoter, variable single guide RNA guide sequence, and the first 15 nt of the non-variable region of the sgRNA for each of the MATIA (SEQ ID NOs.125-128), ACOXl (SEQ ID NOs.129-132), LEPR (SEQ ID NOs.133-136), SIRT7 (SEQ ID NOs.137-140), and LEP (SEQ ID NOs.141-144) target genes. FIG. 33B provides a table (Table 5) showing genotyping forward and reverse primers of single guide RNAs 1-4 for each of the MATIA (Forward: SEQ ID NO: 145, Reverse: SEQ ID NO: 151), ACOXl (Forward: SEQ ID NOs: 146-147, Reverse: SEQ ID NO: 152-153), LEPR(Forward: SEQ ID NO: 148, Reverse: SEQ ID NO: 154), SIRT7(Forward: SEQ ID NO: 149, Reverse: SEQ ID NO: 155), and LEP (Forward: SEQ ID NO: 150, Reverse: SEQ ID NO: 156) target genes. FIG. 33C provides a table (Table 6) showing primers used for sgRNA template synthesis:

T7RevLong (SEQ ID NO: 157), T7FwdAmp (SEQ ID NO: 158), and T7RevAmp (SEQ ID NO: 159).

DEFINITIONS

[0047] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0048] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0049] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.

[0050] It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a genetically modified bird" includes a plurality of such genetically modified bird and reference to "the target gene" includes reference to one or more target genes and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation. [0051] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all sub-combinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.

[0052] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

[0053] The terms "polynucleotide" and "nucleic acid," used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxynucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA -RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The terms "polynucleotide" and "nucleic acid" should be understood to include single-stranded and double-stranded polynucleotides.

[0054] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and/or non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.

[0055] The term "naturally-occurring" as used herein as applied to a nucleic acid, a protein, a cell, or an organism, refers to a nucleic acid, protein, cell, or organism that is found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism that can be isolated from a source in nature and which has not been intentionally modified by a human in the laboratory is naturally occurring.

[0056] By "cleavage domain" or "active domain" or "nuclease domain" of a nuclease it is meant the polypeptide sequence or domain within the nuclease which possesses the catalytic activity for nucleic acid cleavage. A cleavage domain can be contained in a single polypeptide chain or cleavage activity can result from the association of two (or more) polypeptides. A single nuclease domain may consist of more than one isolated stretch of amino acids within a given polypeptide (e.g., RuvCI, RuvCII, and RuvCIII of a Cas9 protein can form a RuvC domain).

[0057] As used herein the term "isolated" is meant to describe a polynucleotide, a polypeptide, or a cell that is in an environment different from that in which the polynucleotide, the polypeptide, or the cell naturally occurs. An isolated genetically modified host cell may be present in a mixed population of genetically modified host cells.

[0058] "Heterologous," as used herein, means a nucleotide or polypeptide sequence that is not found in the native nucleic acid or protein, respectively (at least not at that particular position, e.g., see below). For example, in some cases, the heterologous nucleic acid (and/or the CRISPR/Cas target sequence) is heterologous to the genome because the sequence is present nowhere in the genome except for where the nucleic acid has integrated. In some cases the heterologous nucleic acid (and/or the CRISPR/Cas target sequence) is heterologous in the sense that it is found elsewhere in the genome, but is not normally present at the position the nucleic acid has (or will be) integrated.

[0059] As used herein, the term "exogenous nucleic acid" refers to a nucleic acid that is not normally or naturally found in and/or produced by a given organism or cell in nature. As used herein, the term "endogenous nucleic acid" refers to a nucleic acid that is normally found in and/or produced by a given bacterium, organism, or cell in nature. An "endogenous nucleic acid" is also referred to as a "native nucleic acid" or a nucleic acid that is "native" to a given organism or cell.

[0060] "Recombinant," as used herein, means that a particular nucleic acid (DNA or RNA) or protein is the product of various combinations of cloning, restriction, and/or ligation steps resulting in a construct having a sequence (e.g., structural, coding, or non-coding sequence) that is distinguishable from endogenous nucleic acids or proteins found in natural systems. DNA sequences can be assembled from cDNA fragments and short oligonucleotide linkers, or from a series of synthetic oligonucleotides, to provide a synthetic nucleic acid which is capable of being expressed from a recombinant transcriptional unit contained in a cell or in a cell-free

transcription and translation system. Such sequences can be provided in the form of an open reading frame uninterrupted by internal non-translated sequences, or introns, which are typically present in eukaryotic genes. Genomic DNA comprising the relevant sequences can also be used in the formation of a recombinant gene or transcriptional unit. Sequences of non-translated DNA may be present 5' or 3' from the open reading frame, where such sequences do not interfere with manipulation or expression of the coding regions, and may indeed act to modulate production of a desired product by various mechanisms (see "DNA regulatory sequences", below). [0061] Thus, e.g., the term "recombinant" polynucleotide or "recombinant" nucleic acid refers to one which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of sequence through human intervention. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques. Such is usually done to replace a codon with a redundant codon encoding the same or a conservative amino acid, while typically introducing or removing a sequence recognition site. In some cases, it is performed to join together nucleic acid segments of desired functions to generate a desired combination of functions. This artificial combination is often accomplished by either chemical synthesis means, or by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.

[0062] Similarly, the term "recombinant" polypeptide refers to a polypeptide which is not naturally occurring, e.g., is made by the artificial combination of two otherwise separated segments of amino sequence through human intervention. Thus, e.g., a polypeptide that comprises a heterologous amino acid sequence is recombinant.

[0063] By "construct" or "vector" is meant a recombinant nucleic acid, generally recombinant DNA, which has been generated for the purpose of the expression and/or propagation of a nucleotide sequence(s) of interest, or is to be used in the construction of other recombinant nucleotide sequences.

[0064] The terms "DNA regulatory sequences," "control elements," and "regulatory elements," used interchangeably herein, refer to transcriptional (e.g., transcription control elements) and translational control sequences, such as promoters, enhancers, polyadenylation signals, terminators, protein degradation signals, and the like, that provide for and/or regulate transcription of a non-coding sequence (e.g., DNA-targeting RNA) or a coding sequence (e.g., site -directed modifying polypeptide, or CasSVCsnl polypeptide) and/or regulate translation of an encoded polypeptide.

[0065] "Operably linked" refers to a juxtaposition wherein the components so described are in a

relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a nucleotide sequence (e.g., a protein coding sequence, e.g., a sequence encoding an mRNA; a non protein coding sequence, e.g., a sequence encoding a non-coding RNA (ncRNA) such as a Cas9 guide RNA, a targeter RNA, an activator RNA; and the like) if the promoter affects its transcription and/or expression. The relationship can also be referred to in the reverse and retain the same meaning. For example, a nucleotide sequence of interest can be said to be operably linked to a promoter. As used herein, the terms "heterologous promoter" and "heterologous control regions" refer to promoters and other control regions that are not normally associated with a particular nucleic acid in nature. For example, a "transcriptional control region heterologous to a coding region" is a transcriptional control region that is not normally associated with the coding region in nature.

[0066] A "host cell," as used herein, denotes an in vivo, ex vivo, or in vitro eukaryotic cell (e.g., an avian cell), a eukaryotic cell present in a multicellular organism, or a cell of a multicellular organism (e.g., a cell line) cultured as a unicellular entity, which eukaryotic cells can be, or have been, used as recipients for a nucleic acid (e.g., an expression vector that comprises a nucleotide sequence of interest), and include the progeny of the original cell which has been genetically modified by the nucleic acid. It is understood that the progeny of a single cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation. A "recombinant host cell" (also referred to as a "genetically modified host cell") is a host cell into which has been introduced a heterologous nucleic acid, e.g., an expression vector. For example, a eukaryotic host cell is a genetically modified eukaryotic host cell, by virtue of introduction into a suitable eukaryotic host cell of a heterologous nucleic acid, e.g., an exogenous nucleic acid that is foreign to the eukaryotic host cell, or a recombinant nucleic acid that is not normally found in the eukaryotic host cell.

[0067] A polynucleotide or polypeptide has a certain percent "sequence identity" to another

polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same, and in the same relative position, when comparing the two sequences.

Sequence similarity can be determined in a number of different manners. To determine sequence identity, sequences can be aligned using the methods and computer programs, including BLAST, available over the World Wide Web at ncbi.nlm.nih.gov/BLAST. See, e.g., Altschul et al.

(1990), J. Mol. Biol. 215:403-10. Other techniques for alignment are described in Methods in Enzymology, vol. 266: Computer Methods for Macromolecular Sequence Analysis (1996), ed. Doolittle, Academic Press, Inc., a division of Harcourt Brace & Co., San Diego, California, USA. Of particular interest are alignment programs that permit gaps in the sequence. The Smith- Waterman is one type of algorithm that permits gaps in sequence alignments. See Meth. Mol. Biol. 70: 173-187 (1997). CLUSTAL, MUSCLE, and T-COFFEE are additional examples of alignment programs.

[0068] "Binding" as used herein (e.g. with reference to binding between an RNA and a protein, e.g., via an RNA -binding domain of a polypeptide) refers to a non-covalent interaction between macromolecules (e.g., between a protein and a nucleic acid). While in a state of non-covalent interaction, the macromolecules are said to be "associated" or "interacting" or "binding" (e.g., when a molecule X is said to interact with a molecule Y, it is meant the molecule X binds to molecule Y in a non-covalent manner). Not all components of a binding interaction need be sequence-specific, but some portions of a binding interaction may be sequence-specific. Binding interactions can generally be characterized by a dissociation constant (Kd), e.g., of less than 10 ⁶ M, less than 10 ⁷ M, less than 10 ^s M, less than 10 ⁹ M, less than 10 ¹⁰ M, less than 10 ¹¹ M, less than 10 ¹² M, less than 10 ¹³ M, less than 10 ¹⁴ M, or less than 10 ¹⁵ M. "Affinity" refers to the strength of binding, increased binding affinity being correlated with a lower Kd.

[0069] By "binding domain" it is meant a protein domain that is able to bind non-covalently to another molecule. A binding domain can bind to, for example, a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein) and/or a protein molecule (a protein- binding protein). In the case of a protein domain-binding protein, it can bind to itself (to form homodimers, homotrimers, etc.) and/or it can bind to one or more molecules of a different protein or proteins.

[0070] A "vector" or "expression vector" is a replicon, such as plasmid, phage, virus, or cosmid, to which another DNA segment, i.e. an "insert", may be attached so as to bring about the replication of the attached segment in a cell.

[0071] An "expression cassette" comprises a DNA coding sequence operably linked to a promoter.

"Operably linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a coding sequence (or the coding sequence can also be said to be operably linked to the promoter) if the promoter affects its transcription or expression.

[0072] The terms "recombinant expression vector," or "DNA construct" are used interchangeably herein to refer to a DNA molecule comprising a vector and one insert. Recombinant expression vectors are usually generated for the purpose of expressing and/or propagating the insert(s), or for the construction of other recombinant nucleotide sequences. The insert(s) may or may not be operably linked to a promoter sequence and may or may not be operably linked to DNA regulatory sequences.

[0073] A cell has been "genetically modified" or "transformed" or "transfected" by exogenous DNA, e.g. a recombinant expression vector, when such DNA has been introduced inside the cell. The presence of the exogenous DNA results in permanent or transient genetic change. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. In mammalian cells for example, the transforming DNA may be maintained on an episomal element such as a plasmid. With respect to eukaryotic cells, a stably transformed cell is one in which the transforming DNA has become integrated into a chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones that comprise a population of daughter cells containing the transforming DNA. A "clone" is a population of cells derived from a single cell or common ancestor by mitosis. A "cell line" is a clone of a primary cell that is capable of stable growth in vitro for many generations.

[0074] Suitable methods of genetic modification (also referred to as "transformation") include e.g., viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection,

electroporation, calcium phosphate precipitation, polyethyleneimine (PEI) -mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro injection, nanoparticle-mediated nucleic acid delivery (see, e.g., Panyam et al., Adv Drug Deliv Rev. 2012 Sep 13. pii: S0169- 409X(12)00283-9. doi: 10.1016/j.addr.2012.09.023 ), and the like. A suitable method of delivering a nucleic acid is via ribonucleoprotein (RNP) -mediated genetic modification.

[0075] The choice of method of genetic modification is generally dependent on the type of cell being transformed and the circumstances under which the transformation is taking place (e.g., in vitro, ex vivo, or in vivo). A general discussion of these methods can be found in Ausubel, et al., Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons, 1995.

[0076] By "cleavage" it is meant the breakage of the covalent backbone of a target nucleic acid

molecule (e.g., RNA, DNA). Cleavage can be initiated by a variety of methods including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded cleavage and double-stranded cleavage are possible, and double-stranded cleavage can occur as a result of two distinct single-stranded cleavage events. In some embodiments, a complex comprising a CRISPR/Cas protein (e.g., a Cas9 protein) and a corresponding guide RNA is used for targeted cleavage of a double stranded DNA (dsDNA), e.g., induction of a double-stranded DNA break (DSB).

[0077] "Nuclease" and "endonuclease" are used interchangeably herein to mean an enzyme which

possesses catalytic activity for nucleic acid cleavage (e.g., ribonuclease activity (ribonucleic acid cleavage), deoxyribonuclease activity (deoxyribonucleic acid cleavage), etc.). A "genome editing endonuclease" is an endonuclease that can be used for the editing of a cell's genome (e.g., by cleaving at a targeted location within the cell's genomic DNA). Examples of genome editing endonucleases include but are not limited to, CRISPR/Cas endonucleases (which can in some cases cleave both strands of a target double stranded DNA (dsDNA), and in some cases are nickases, which cleave only one strand of a target dsDNA). Examples of CRISPR/Cas endonucleases include class 2 CRISPR/Cas endonucleases such as: (a) type II CRISPR/Cas proteins, e.g., a Cas9 protein; (b) type V CRISPR/Cas proteins, e.g., a Cpfl polypeptide, a C2cl polypeptide, a C2c3 polypeptide, and the like; and (c) type VI CRISPR/Cas proteins, e.g., a C2c2 polypeptide.

[0078] By "cleavage domain" or "active domain" or "nuclease domain" of a nuclease it is meant the polypeptide sequence or domain within the nuclease which possesses the catalytic activity for nucleic acid cleavage. A cleavage domain can be contained in a single polypeptide chain or cleavage activity can result from the association of two (or more) polypeptides. A single nuclease domain may consist of more than one isolated stretch of amino acids within a given polypeptide.

[0079] A "host cell" or "target cell" as used herein, denotes an in vivo or in vitro avian cell that can be, or have been, used as recipients for a genome targeting composition (e.g., a system of the present disclosure), and include the progeny of the original cell (e.g., when the cell has been transformed by the nucleic acid, or when the cells genome has been modified by the genome targeting composition). It is understood that the progeny of a single cell may not necessarily be completely identical in morphology or in genomic or total DNA complement as the original parent, due to natural, accidental, or deliberate mutation. A "recombinant host cell" (also referred to as a "genetically modified host cell") is a host cell into which has been introduced an exogenous a nucleic acid, e.g., an exogenous expression vector. For example, an avian host cell can be a genetically modified avian host cell (e.g., an avian germ cell), by virtue of introduction into a suitable avian host cell of an exogenous nucleic acid.

[0080] The term "stem cell" is used herein to refer to a cell (e.g., an avid stem cell) that has the ability both to self-renew and to generate a differentiated cell type (see Morrison et al. (1997) Cell 88:287-298). Stem cells of interest include pluripotent stem cells (PSCs). The term "pluripotent stem cell" or "PSC" is used herein to mean a stem cell capable of producing all cell types of the organism. Therefore, a PSC can give rise to cells of all germ layers of the organism (e.g., the endoderm, mesoderm, and ectoderm of a vertebrate). Pluripotent cells are capable of forming teratomas and of contributing to ectoderm, mesoderm, or endoderm tissues in a living organism.

[0081] The term "avian" as used herein refers to any species, subspecies or race of organism of the taxonomic Class Aves, such as, but not limited to, such organisms as chicken, turkey, duck, goose, quail, pheasants, parrots, finches, hawks, crows and ratites including ostrich, emu and cassowary. The term includes the various known strains of Gallus gallus (chickens), for example, White Leghorn, Brown Leghorn, Barred-Rock, Sussex, New Hampshire, Rhode Island,

Australorp, Cornish, Minorca, Amrox, California Gray, Italian Partridge-colored, as well as strains of turkeys, pheasants, quails, duck, ostriches and other poultry commonly bred in commercial quantities. [0082] As used herein, a "genetically modified avian" or "transgenic avian" refers to any avian in which one or more of the cells of the avian contains heterologous nucleic acid introduced by way of human intervention.

DETAILED DESCRIPTION

[0083] The present disclosure provides systems and methods of making genetically modified birds that comprise a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage, wherein the disruption results in development of a fatty liver. The disclosure further provides methods for producing a food product, such as foie gras, using a subject genetically modified bird, as well as food products harvested from a subject genetically modified bird.

[0084] The present disclosure provides a system for generating a genetically modified bird, wherein the genetically modified bird is genetically modified to comprise a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, gene that controls appetite, or a gene that regulates fatty acid storage, wherein the disruption results in development of a fatty liver. Also provided in the present disclosure are methods of producing such genetically modified bird and methods of producing a food product from an isolated organ of the genetically modified bird.

GENETICALLY MODIFIED BIRD

[0085] The present disclosure provides a genetically modified bird. A genetically modified bird of the present disclosure is genetically modified to comprise a disruption in one or more target genes. Target genes include: a) a fatty acid metabolism pathway gene; b) a gene that controls appetite; and c) a gene that regulates fatty acid storage. Disruption of the one or more target genes results in development of a fatty liver. Disruption of the one or more target genes can result in more rapid weight gain than in a corresponding bird not comprising the genetic modification.

[0086] In some cases, the genetically modified bird is a duck. In some cases, the genetically modified bird is a goose. In some cases, the genetically modified bird is a chicken.

[0087] In some cases, the genetic modification is present in multiple organs. In some cases, the genetic modification is present only in the liver.

[0088] In some cases, a suitable target comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).

[0089] In some cases, the genetically modified bird is a duck. Since the major location of lipogenesis in birds is the liver, ducks are widely known to be used for unnatural production of fatty livers through force-feeding. In some cases, the duck is a Cairina mochata. In some cases, the duck is a mule duck. In some cases, the mule duck is a hybrid of a Muscovy drake and a female duck Anas platyrhnychos . In other cases, the genetically modified bird is a goose. In some embodiments, the goose is the grey Landaise goose Anser anser. In yet other cases, the genetically modified bird is a chicken.

[0090] In some cases, the genetic modification is present in multiple organs. In other cases, the genetic modification is target organ specific. In some cases, the genetic modification is liver specific.

[0091] In some cases, the genetic modification is achieved using gene editing tools well known to one of ordinary skill in the art. In some cases, the genetic modification is achieved using a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas system. The CRISPR/Cas system has been recognized and adapted to be utilized as a powerful, programmable gene editing tool within numerous organisms. Expression of a CRISPR/Cas nuclease, as well as a short stretch of RNA containing genomic targeting information (e.g., an approximately 20 bp sequence) and a structural component to associate with CRISPR/Cas nuclease itself, allow for the precise placement of a double-stranded or single-stranded break (DSB or SSB) at a desired location(s) within a genome of interest.

[0092] In other cases, the genetic modification is achieved using a TALEN system. TALENs are fusions of the Fokl restriction endonuclease cleavage domain with a DNA-binding transcription activator-like effector (TALE) repeat array. TALENs can be engineered to specifically bind and cleave a desired target DNA sequence, which is useful for the manipulation of nucleic acid molecules, genes, and genomes in vitro and in vivo. TALENs are thus useful in the generation of genetically engineered cells, tissues, and organisms. The use of TALENs for generation of genetically modified organisms is well known in the art, for example, in US Patent No.

9,359,599, which is hereby incorporated by reference in its entirety.

[0093] In some cases, the genetic modification is achieved using ZFNs. ZFNs are site-specific

endonucleases that allow for targeted manipulation of a single site within a genome, and have been used for genome engineering by stimulating either non-homologous end joining or homologous recombination. The use of ZFNs for generation of genetically modified organisms is well known in the art, for example, in US Patent No. 9,322,006, which is hereby incorporated by reference in its entirety. [0094] In some cases, the genetically modified bird is genetically modified to comprise a disruption in one or more target genes, wherein the one or more target genes comprises a nucleotide sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, nucleotide sequence identity to the nucleotide sequence of a gene selected from: Methionine

adenosyltransferaselA (MAT1A) (SEQ ID NO:51), Acyl-coenzyme A oxidase (ACOX1) (SEQ ID NO:52), Leptin receptor (LEPR) (SEQ ID NO:53), Leptin (LEP) (SEQ ID NO:54), Sirtuin7 (SIRT7) (SEQ ID NO:55), Apoliporotein A-I (APOIA) (SEQ ID NO:56), Sirtuinl (SIRTl) (SEQ ID NO:57), Sirtuin3 (SIRT3) (SEQ ID NO:58), Sirtuin4 (SIRT4) (SEQ ID NO:59), Sirtuin5 (SIRT5) (SEQ ID NO:60), Sirtuin6 (SIRT6) (SEQ ID NO:61), and Phosphatase and tensin homolog (PTEN) (SEQ ID NO:62).

[0095] In some cases, the genetically modified bird is genetically modified to comprise a

disruption of one or more target genes, wherein the one or more target genes comprise a nucleotide sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, nucleotide sequence identity to the nucleotide sequence of a gene selected from:

APOIA (SEQ ID NO:56), MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55). In such embodiments, the disruption causes a whole organism knockout of the one or more target genes.

[0096] In some cases, the genetically modified bird is genetically modified to comprise a

disruption of one or more target genes, wherein the one or more target genes comprise a nucleotide sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, nucleotide sequence identity to the nucleotide sequence of a gene selected from: SIRTl (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62). In such cases, the disruption causes a liver-specific knockout of the one or more target genes. In some cases, the genetically modified bird is genetically modified using Cre/loxP tissue-specific recombination and CRISPR techniques to generate liver-specific modifications.

[0097] In some cases, the genetically modified bird is genetically modified to comprise a disruption of one or more target genes, wherein the target genes cause a disruption in lipid metabolism. Target genes that cause a disruption in lipid metabolism are well known in the art, such target genes can include but are not limited to: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRTl (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62). [0098] In some cases, the genetically modified bird is genetically modified to comprise a disruption of one or more target genes, wherein the target genes cause a disruption in regulating appetite control. Target genes that cause a disruption in regulating appetite control are well known in the art, such target genes can include but are not limited to: LEPR (SEQ ID NO:53) and LEP (SEQ ID NO:54).

[0099] Disruption of the one or more target genes results in a genetically modified bird of the present disclosure provides for a genetically modified bird with a fatty liver. For example, in some cases, the liver of a genetically modified bird of the present disclosure can comprise at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 2-fold, at least 5-fold, at least 10-fold, at least 25 -fold, at least 50-fold, at least 100-fold, or more than 100-fold, higher fat content than the liver of a control bird not comprising the genetic modification(s) (target gene disruption).

[00100] As noted above, disruption of the one or more target genes can result in more rapid weight gain than in a corresponding bird not comprising the genetic modification (target gene disruption). Thus, for example, in some cases, disruption of the one or more target genes can result in a rate of weight increase that is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, or at least 50%, faster than the rate of weight increase by a control bird not comprising the genetic modification(s).

Generating a genetically modified bird

[00101] The present disclosure relates to a system and method for generating a genetically

modified bird. The method for generating a genetically modified bird comprises genetically modifying a bird stage X primordial germ cell, wherein genetic modification of bird stage X primordial germ cell comprise a disruption of one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; delivering the genetically modified bird stage X primordial germ cell into a recipient embryo, and allowing the recipient embryo to hatch as a chick. In some embodiments, the genetic modification is achieved using a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CAS system. In some cases, the genetic modification is achieved using TALENs. In some cases, the genetic modification is achieved using a ZFNs system. The present disclosure also includes a method for generating a genetically modified bird comprising: delivering a CRISPR/Cas plasmid construct to a recipient bird stage X embryo, wherein delivery of the CRISPR/Cas plasmid comprises a disruption of one or more target genes of a stage X primordial germ cell in the recipient stage X embryo, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and allowing the recipient embryo to hatch as a chick.

METHODS AND COMPOSITIONS

[00102] Aspects of the present disclosure relates to a system for generating a genetically

modified bird, the composition comprising: a) a first CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the first CRISPR/Cas guide RNA, wherein the first CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a first target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and b) a second CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the second CRISPR/Cas guide RNA, wherein the second CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a second target sequence in the target gene, wherein the second target sequence is 3' of the first target sequence. In some cases, the composition further comprises a class 2 CRISPR/Cas endonuclease, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR/Cas endonuclease.

[00103] In some cases, a CRISPR/Cas endonuclease and one or more CRISPR/Cas guide RNAs are placed in a CRISPR/Cas plasmid construct. In some cases, the plasmid will contain a first CRISPR/Cas guide RNA comprising a first guide sequence. In some cases, the plasmid will contain a second CRISPR/Cas guide RNA comprising a second guide sequence. In some cases, a cell is transfected with a CRISPR/Cas plasmid. In some cases, the guide sequence has 100% complementarity over 17 or more contiguous nucleotides with a target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage. In some cases, the plasmid will contain CRISPR/Cas guide RNAs comprising single molecule CRISPR/Cas guide RNAs. In some cases, the CRISPR/CAS endonuclease and one or more CRISPR/Cas guide RNAs will cause a frame shift mutation to disrupt the target sequence of the target gene. In some cases, the plasmid will contain CRISPR/Cas guide RNAs comprising dual molecule CRISPR/Cas guide RNAs. In some cases, the CRISPR/CAS endonuclease and one or more CRISPR/CAS guide RNAs will cause a deletion of the target sequence of the target gene. In some cases, the plasmid will contain a CRISPR/Cas endonuclease, one or more CRISPR/CAS guide RNAs, and a donor sequence, where the donor sequence will replace the disrupted target sequence of the target gene.

[00104] In some cases, the CRISPR/Cas endonuclease is a class 2 CRISPR/Cas endonuclease, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR/Cas

endonuclease. In some cases, the class 2 CRISPR/Cas endonuclease is a type V or type VI CRISPR/Cas endonuclease. In some cases, the class 2 CRISPR/Cas endonuclease is a Cpfl protein, a C2cl protein, a C2c3 protein, or a C2c2 protein. In some cases, the first and second CRISPR/Cas guide RNAs are Cas9 CRISPR/Cas guide RNAs. In some cases, the first and second CRISPR/Cas guide RNAs are single molecule CRISPR Cas guide RNAs. In some cases, the first and second CRISPR/Cas guide RNAs are dual molecule CRISPR/Cas guide RNAs.

[00105] One skilled in the art could identify any of a large number of guide RNAs that would be suitable in the disruption of one or more target genes in the present disclosure. Examples of suitable guide sequences of the CRISPR Cas guide RNAs that may be used in the present disclosure include, but are not limited to: caaugugucuaauugcaucu (SEQ ID NO:63), aauaccagcauuggcagucc (SEQ ID NO:64), gcagccacacugagcagcca (SEQ ID NO:65), augcucauaugggugagcgu (SEQ ID NO:66), cuccugcagcucuucccgcu (SEQ ID NO:67), agcgaugaagucauagccaa (SEQ ID NO:68), aagaagccacucacccugca (SEQ ID NO:69),

cuccucccaccagcccaaca (SEQ ID NO:70), aaagaagcagcagcuuugcu (SEQ ID NO:71),

uucucagaucuuugacccgc (SEQ ID NO:72), agaggcuugaaggaguguac (SEQ ID NO:73), ccaccaggucccugaggcgg (SEQ ID NO: 74), aggaaugguguugcucugug (SEQ ID NO: 107), gaucacaucucaugccauug (SEQ ID NO: 108), cgagaugcaauuagacacau (SEQ ID NO: 109), gucugauaauccaaaaucug (SEQ ID NO: 110), gcauacgcuguugccagaag (SEQ ID NO: 111), gacugccaaugcugguauug (SEQ ID NO: 112), cgaauggccuguggugggca (SEQ ID NO: 113), gcuucgaucccagacuaccg (SEQ ID NO: 114), gcaauguccaaaugccauug (SEQ ID NO: 115), auuuggacauugcugcagaa (SEQ ID NO: 116), gcaguuacacugagcagcca (SEQ ID NO: 117), gugugguugagucuugggga (SEQ ID NO: 118), ucaaccacacuuacgucaug (SEQ ID NO: 119), augggcuugacugacaucaa (SEQ ID NO: 120), aaaaacuacgggcggaugcg (SEQ ID NO: 121), auccccgagccgcgcgcuga (SEQ ID NO: 122), cauccccgagccgcgcgcug (SEQ ID NO: 123), and ugagccgaacccucagcgcg (SEQ ID NO: 124).

[00106] In some cases, the genetically modified bird is genetically modified to comprise a

disruption of one or more target genes, wherein the one or more target genes comprise a nucleotide sequence having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100%, nucleotide sequence identity to the nucleotide sequence of a gene selected from: SIRTl (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62). In some cases, the disruption causes a liver-specific knockout of the one or more target genes. In such cases, the disruption of liver- specific knockout of the one or more target genes comprises deletion of the one or more target genes using a Cre/loxP tissue-specific recombination system. The Cre/loxP system is based on promoter-mediated expression of the bacteriophage PI Cre recombinase (or a modified version of the PI Cre recombinase) to delete regions of target genes flanked by loxP sites. For example, the recognition sequence for a Cre recombinase is loxP, which is a 34 base pair sequence comprised of two 13 base pair inverted repeats and an 8 bp core sequence, serves as the recombinase binding sites. See e.g. Sauer, B., Current Opinion in Biotechnology 5:521-527 (1994). Specifically, the loxP-Cre system utilizes the expression of the PI phage Cre

recombinase to catalyze the excision of DNA located between flanking lox sites. By using gene - targeting techniques to produce binary transgene animals with modified endogenous genes that can be acted on by Cre or Flp recombinases expressed under the control of tissue-specific promoters, site-specific recombination may be employed to inactivate endogenous genes in a spatially or time controlled manner. See, e.g., U.S. Pat. Nos. 6,080,576, 5,434,066, and

4,959,317; and Joyner, A. L., et al. Laboratory Protocols for Conditional Gene Targeting, Oxford University Press, New York (1997). The cre-lox system, an approach based on the ability of transgenic mice, carrying the bacteriophage Cre gene, to promote recombination between, for example, 34 by repeats termed loxP sites, allows ablation of a given gene in a tissue specific and a developmentally regulated manner (Orban et al. (1992) PNAS 89:6861- 6865). The Cre-lox system has been successfully applied for tissue-specific transgene expression (Orban et al. Proc Natl Acad Sci U S A. 1992 Aug l;89(15):6861-5.), for site specific gene targeting and for exchange of gene sequence by the "knock-in" method (Aguzzi et al. Glia 1995 Nov,15(3):348- 64). The use of the Cre/LoxP system for generation of genetically modified organisms is well known in the art, for example, in US Patent Application No. US20160143256, which is hereby incorporated by reference in its entirety.

[00107] In some cases, the genetically modified bird is genetically modified through flanking the target gene with two loxP sites. In some cases, two loxP sequences are inserted at specific sites on either side of one or more target genes using the CRISPR/Cas gene editing tool. In some cases, the genetically modified bird comprising two loxP sites one either side of the target gene is intercrossed with a transgenic bird comprising a gene encoding a Cre recombinase driven by a liver-specific promoter/enhancer. In such cases, the offspring of the genetically modified bird and the transgenic bird comprise a disruption of liver-specific knockout of the one or more target genes. In some cases, the liver-specific knockout of the one or more target genes of the offspring comprises a deletion of the one or more target genes. In some cases, the Cre partial cleavage of the two loxP sites will result in the liver-specific knockout of the target genes.

[00108] Liver-specific promoters are known in the art, and any suitable liver-specific promoter can be used to drive expression of a Cre recombinase. Non-limiting examples of suitable liver- specific promoters include, e.g., an alpha- 1 antitrypsin promoter, a transthyretin promoter, an albumin promoter, a thyroxine-binding globulin promoter, a phosphoenol pyruvate carboxykinase promoter, an apolipoprotein H promoter, a lecithin cholesterol acetyl transferase promoter, and the like.

[00109] Examples of suitable sequence-specific, e.g. genome editing, endonucleases include, but are not limited to, ZFNs, meganucleases, TALEN fusion proteins, Cre/LoxP recombinase, and CRISPR/Cas endonucleases (e.g. class 2 CRISPR/Cas endonucleases such as a type II, type V, or type VI CRISPR/Cas endonucleases). In some cases, a sequence-specific genome editing endonuclease includes a ZFN or a TALEN. In some cases, one or more TALEN protein(s) that bind to a target site in one or more target genes is introduced into a cell such that the TALEN proteins(s) is expressed and the one or more target genes are cleaved. In some cases, said gene cleavage results in functional disruption and/or deletion of the targeted gene. In some cases, the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage. In some cases, cleavage of the targeted DNA is followed by non-homologous end joining (NHEJ) where small insertions or deletions (indels) are inserted at the site of cleavage, where the indels cause functional disruption through introduction of non-specific mutations at the cleavage location. See, e.g., U.S. Patent No. 9,512,444. In some cases, one or more ZFNs is introduced into a cell, where the one or more ZFNs comprise a DNA -binding domain and a DNA -cleaving domain. In some cases, the DNA-cleaving domain is a nuclease domain of Fokl. In some cases, one or more ZFNs that bind to a target site in one or more target genes is introduced into a cell such that the ZFN protein(s) is expressed and the one or more target genes are cleaved. In some cases, the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage. In some cases, the one or more ZFNs make a double stranded break in the target site in the one or more target genes. In some cases, cleavage of the targeted DNA is followed by NHEJ where small insertions or deletions (indels) are inserted at the site of cleavage, where the indels cause functional disruption through introduction of non-specific mutations at the cleavage location.

Delivery of genetic modification compositions

Direct Injection Technique

[00110] The present disclosure further provides a method of making a genetically modified bird of the present disclosure, the method comprising: a) genetically modifying a bird stage X primordial germ cell, wherein genetic modification of bird stage X primordial germ cell comprises a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; b) delivering the genetically modified bird stage X primordial germ cell to into a recipient embryo; and c) allowing the recipient embryo or artificial embryo to hatch as a chick. In some cases, the genetically modified stage X primordial germ cell line is delivered into the recipient embryo by injection. In some cases, the genetically modified stage X primordial germ cell line injected into the recipient embryo at the time of primordial germ cell migration at approximately Stages 12-17. In some cases, the genetically modified stage X primordial germ cell line is injected into the recipient embryo at Stages 13-14.

[00111] In some cases, the genetic modification comprises delivering a CRISPR/Cas plasmid construct into a stage X recipient embryo at the time of primordial germ cell migration. In some cases, the primordial germ cell migration occurs at approximately Stages 12-17. In some cases, the genetically modified Stage X recipient embryo is injected into the recipient embryo at Stages 12-17. In some cases, the genetically modified Stage X recipient embryo is injected into the recipient embryo at Stages 13-14.

[00112] Methods of generating genetically modified chickens have been described, for example, in Tyack et al., Transgenic Res. 2013 June 17; 22: 1257-1264; and Doran et al., Transgenic Res. 2013 June; 25(3):307-19, and in US Patent No. 7,375,258, US Patent No. 7,323,619, US Patent No. 7,312,374, US Patent No. 7,375,258, US Patent No. 7,507,873, US Patent No. 7,550,650, 8,507,749, and US Patent No. 9,510,571, which are hereby incorporated by reference in their entirety.

[00113] In order to make genetically modified birds, bird stage X primordial germ cells are

genetically modified to include a disruption in one or more fatty acid metabolism pathway genes, in one or more appetite control genes, or in one or more genes that regulate fatty acid storage,. In some cases, the genetic modification comprises transfection of primordial stage X bird cells with the CRISPR/Cas plasmid construct. In some cases, the genetic modification of primordial stage X bird cells with the CRISPR/Cas plasmid construct includes a transfection reagent. One skilled in the art could identify commonly available transfection reagents suitable for transfection in the present application. An example of a suitable transfection reagent includes, but is not limited to: Lipofectamine 2000CD (Thermo Fisher).

[00114] The genetically modified bird stage X primordial germ cells, or the CRISPR/Cas

plasmid construct itself, are in some cases delivered to a laid egg. In some cases, genetically modified bird stage X primordial germ cells or the CRISPR/Cas plasmid construct are delivered into early stage X bird recipient embryos. In one embodiment, freshly laid eggs are obtained and placed in a temperature controlled, humidified incubator. In some cases, the embryonic blastodisc in the egg is gradually rotated to lie on top of the yolk. This may be accomplished by any method known in the art, such as by gently rocking the egg regularly, in some cases every 15 minutes. The genetically modified bird stage X primordial cells, or the CRISPR/Cas plasmid construct, may be delivered by any method known in the art for delivering compositions to the inside of an egg (See, e.g. Doran et al., Transgenic Res. 2013 June; 25(3):307-19). In a preferred embodiment, the CRISPR/Cas plasmid construct is injected into the circulatory system of the early stage X bird recipient embryos. In a preferred embodiment, the genetically modified bird stage X primordial germ cells or the CRISPR/Cas plasmid construct are injected into a blood vessel of a bird embryo. In one embodiment a window is opened in the shell, the genetically modified bird stage X primordial germ cells are injected through the window and the shell window is closed. In some cases, the eggs are incubated until hatching. In some cases, the eggs are incubated at a temperature sufficient for the embryo to develop into a chick. In some cases, the eggs will hatch after approximately 20 days, depending upon the particular avian species from which they are obtained. In some cases, hatched chicks are raised to sexual maturity and mated. The genetically modified offspring of the founder animals may be identified by any method known in the art, such as Southern blot, PCR and expression analysis.

[00115] In one embodiment, the genetically modified bird stages X primordial germ cells, or

CRISPR/Cas plasmid construct, are injected into the embryo in the eggshell in which the embryo is developed. While the germ cells that are genetically modified in the bird may be embryonic germ cells, in some cases the cells are primordial germ cells.

[00116] In some cases, the genetically modified bird is a chicken. Methods of generating

genetically modified chickens have also been described, for example, in US Patent Application No. 14394712, which is hereby incorporated by reference in its entirety. The germline in chickens is initiated as cells from the epiblast of a Stage X embryo ingress into the nascent hypoblast. As the hypoblast progresses anteriorly, the pre-primordial germ cells are swept forward into the germinal crescent where they can be identified as large glycogen laden cells. The earliest identification of cells in the germline by these morphological criteria is

approximately 8 hours after the beginning of incubation (Stage 4 using an established staging system). The primordial germ cells reside in the germinal crescent from Stage 4 until they migrate through the vasculature during Stage 12-17. At this time, the primordial germ cells are a small population of about 200 cells. From the vasculature, the primordial germ cells migrate into the genital ridge and are incorporated into the ovary or testes as the gonad differentiates.

[00117] Germline chimeric chickens have been generated previously by transplantation of donor primordial germ cells and gonadal germ cells from various developmental stages (blastoderm to day 20 embryo) into recipient embryos. Methods of obtaining transgenic chickens from long- term cultures of avian primordial germ cells have also been described, for example, in US Patent Application 20060206952. When combined with a host avian embryo by known procedures, those modified primordial germ cells are transmitted through the germline to yield genetically modified offspring. [00118] In some cases, the method of the present disclosure involves direct injection of genetically modified primordial stage X bird cells into a bird embryo to make a genetically modified bird. Thus, the methods of the disclosure may be used to inject genetically modified bird germ cells including primordial germ cells and embryonic germ cells.

Sperm modification Technique

[00119] In some cases, the method of making the genetically modified bird comprises:

genetically modifying an avian spermatozoa, wherein the genetic modification of the avian spermatozoa comprises a) a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; b) delivering the genetically modified bird spermatozoa to a hen; c) creating a artificial embryo; and d) allowing the artificial embryo to hatch as a chick. In some cases, the one or more target genes comprises a nucleotide sequence having least 80% or at least 90% nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).

[00120] In some cases, genetically modified birds are created using sperm transfection assisted gene editing (STAGE). Examples of using STAGE as a delivery mechanism for gene editing constructs is known in the art, for example, in Cooper et al., 2016 (Cooper A. et al., 2016, "Generation of gene edited birds in one generation using sperm transfection assisted gene editing (STAGE)", Transgenic Research (2016), pp. 1-17).

[00121] In some cases, the genetic modification of avian spermatozoa comprises transfection of avian spermatozoa with the CRISPR/Cas plasmid construct. In some cases, the CRISPR/Cas plasmid construct is transfected into the sperm cytosol of the spermatozoa. In some cases, the genetic modification of avian spermatozoa comprises transfection of avian spermatozoa with the CRISPR/Cas plasmid construct and a transfection reagent. One skilled in the art could identify commonly available transfection reagents suitable for transfection in the present application. An example of a suitable transfection reagent includes, but is not limited to: Lipofectamine 2000CD (Thermo Fisher).In some embodiments, the genetically modified avian spermatozoa will be placed into female recipient birds using a syringe. In some cases, the genetically modified avian spermatozoa will be delivered into the cloaca of the female bird recipient. In some embodiments, insemination is performed at 3-7 day intervals. Following insemination, an artificial embryo is created. It is known to one of ordinary skill in the art that genome activation and active transcription in a chick embryo occurs after the embryo has reached stage X and contained more than 20,000 cells. In many cases, the artificial embryo contains the CRISPR/Cas endonuclease and one or more CRISPR/Cas guide RNAs for disruption of target genes after the embryo has reached stage X. The embryo containing the CRISPR/Cas endonuclease and one or more CRISPR/Cas guide RNAs will target fatty acid metabolism genes, genes that regulate appetite, or genes that regulate fatty acid storage. The embryo from the recipient bird is collected and stored at a desired temperature and desired time until the artificial embryo is hatched, thereby producing a chick. In some cases, the genetically modified bird is produced after 1 generation. In other cases, the genetically modified bird is produced after 2 generations.

Genetic modification using CRISPR/Cas

[00122] In some cases, the genetically modified birds of the disclosure are genetically modified with a composition comprising a) a first CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the first CRISPR/Cas guide RNA, wherein the first CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a first target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and b) a second CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the second CRISPR/Cas guide RNA, wherein the second CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a second target sequence in the target gene, wherein the second target sequence is 3' of the first target sequence.

[00123] In some embodiments, the first target sequence and the second target sequence are

separated from each other by at least 25 base pairs. In some embodiments, the target gene comprises a nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62) In some embodiments, the composition further comprises a class 2 CRISPR/Cas endonuclease, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR/Cas endonuclease. In some embodiments, the class 2 CRISPR/Cas endonuclease is a Cas9 protein. In other embodiments, the class 2 CRISPR /Cas endonuclease is a type V or type VI CRISPR/Cas endonuclease. In some embodiments, the class 2 CRISPR/Cas endonuclease is a Cpf 1 protein, a C2cl protein, a C2c3 protein, or a C2c2 protein.

[00124] In other cases, the system comprises: a) CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the CRISPR/Cas guide RNA, wherein the

CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and b) a donor template DNA, or a nucleic acid comprising a nucleotide sequence encoding the donor template DNA, where the donor template DNA replaces all or a portion of a target gene, resulting in a defect in the target gene. In other cases, the system comprises: a CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the CRISPR/Cas guide RNA, wherein the CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; where a class 2 CRISPR/Cas endonuclease introduces a double-stranded break in the target gene that, when repaired, results in a defect in the target gene.

] In some cases, the first and second CRISPR/Cas guide RNAs are Cas9 CRISPR/Cas guide RNAs. In yet other embodiments, the first and second CRISPR/Cas guide RNAs are single molecule CRISPR/Cas guide RNAs. In some embodiments, the first and second CRISPR/Cas guide RNAs are dual molecule CRISPR/Cas guide RNAs. Suitable guide sequences of first and second CRISPR/Cas guide RNAs (e.g., a Cas9 guide RNA) are well known in the art. Examples of suitable guide sequences of first and second CRISPR/Cas (e.g. a Cas9 guide RNA) guide RNAs that may be used in the present disclosure include, but are not limited to:

caaugugucuaauugcaucu (SEQ ID NO:63), aauaccagcauuggcagucc (SEQ ID NO:64), gcagccacacugagcagcca (SEQ ID NO:65), augcucauaugggugagcgu (SEQ ID NO:66), cuccugcagcucuucccgcu (SEQ ID NO:67), agcgaugaagucauagccaa (SEQ ID NO:68), aagaagccacucacccugca (SEQ ID NO:69), cuccucccaccagcccaaca (SEQ ID NO:70),

aaagaagcagcagcuuugcu (SEQ ID NO:71), uucucagaucuuugacccgc (SEQ ID NO:72), agaggcuugaaggaguguac (SEQ ID NO:73), ccaccaggucccugaggcgg (SEQ ID NO: 74), aggaaugguguugcucugug (SEQ ID NO: 107), gaucacaucucaugccauug (SEQ ID NO: 108), cgagaugcaauuagacacau (SEQ ID NO: 109), gucugauaauccaaaaucug (SEQ ID NO: 110), gcauacgcuguugccagaag (SEQ ID NO: 111), gacugccaaugcugguauug (SEQ ID NO: 112), cgaauggccuguggugggca (SEQ ID NO: 113), gcuucgaucccagacuaccg (SEQ ID NO: 114), gcaauguccaaaugccauug (SEQ ID NO: 115), auuuggacauugcugcagaa (SEQ ID NO: 116), gcaguuacacugagcagcca (SEQ ID NO: 117), gugugguugagucuugggga (SEQ ID NO: 118), ucaaccacacuuacgucaug (SEQ ID NO: 119), augggcuugacugacaucaa (SEQ ID NO: 120), aaaaacuacgggcggaugcg (SEQ ID NO: 121), auccccgagccgcgcgcuga (SEQ ID NO: 122), cauccccgagccgcgcgcug (SEQ ID NO: 123), and ugagccgaacccucagcgcg (SEQ ID NO: 124). [00126] Examples of suitable nucleotide sequences encoding CRISPR/Cas (e.g. a first Cas9 guide RNA and/or a second Cas9 guide RNA) single guide RNAs that may be used in the present disclosure include, but are not limited to: aataccagcattggcagtcc (SEQ ID NO:76), gcagccacactgagcagcca (SEQ ID NO:77), ctcctgcagctcttcccgct (SEQ ID NO:79),

agcgatgaagtcatagccaa (SEQ ID NO:80), aagaagccactcaccctgca (SEQ ID NO:81),

ctcctcccaccagcccaaca (SEQ ID NO:82), aaagaagcagcagctttgct (SEQ ID NO:83),

ttctcagatctttgacccgc (SEQ ID NO:84), agaggcttgaaggagtgtac (SEQ ID NO:85),

ccaccaggtccctgaggcgg (SEQ ID NO: 86), aggaatggtgttgctctgtg (SEQ ID NO: 87),

gatcacatctcatgccattg (SEQ ID NO:88), caatgtgtctaattgcatct (SEQ ID NO:89),

cgagatgcaattagacacat (SEQ ID NO:90), gtctgataatccaaaatctg (SEQ ID NO:91),

gcatacgctgttgccagaag (SEQ ID NO:92), gactgccaatgctggtattg (SEQ ID NO:93),

cgaatggcctgtggtgggca (SEQ ID NO:94), gcttcgatcccagactaccg (SEQ ID NO:95),

gcaatgtccaaatgccattg (SEQ ID NO:96), atttggacattgctgcagaa (SEQ ID NO:97),

atgctcatatgggtgagcgt (SEQ ID NO:98), gcagttacactgagcagcca (SEQ ID NO:99),

gtgtggttgagtcttgggga (SEQ ID NO: 100), tcaaccacacttacgtcatg (SEQ ID NO: 101),

atgggcttgactgacatcaa (SEQ ID NO: 102), aaaaactacgggcggatgcg (SEQ ID NO: 103),

atccccgagccgcgcgctga (SEQ ID NO: 104), catccccgagccgcgcgctg (SEQ ID NO: 105), tgagccgaaccctcagcgcg (SEQ ID NO: 106).

[00127] In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MATIA comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence aggaatggtgttgctctgtg (SEQ ID NO: 87). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MATIA comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gatcacatctcatgccattg (SEQ ID NO:88). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MATIA comprises at least 90% sequence identity to the nucleotide sequence caatgtgtctaattgcatct (SEQ ID NO:89). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MATIA comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence cgagatgcaattagacacat (SEQ ID NO:90).

[00128] In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence aataccagcattggcagtcc (SEQ ID NO:76). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gtctgataatccaaaatctg (SEQ ID NO:91). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcatacgctgttgccagaag (SEQ ID NO:92). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gactgccaatgctggtattg (SEQ ID NO:93). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence cgaatggcctgtggtgggca (SEQ ID NO:94).

[00129] In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcttcgatcccagactaccg (SEQ ID NO:95). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90% sequence identity to the nucleotide sequence gcaatgtccaaatgccattg (SEQ ID NO:96). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atttggacattgctgcagaa (SEQ ID NO:97). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atgctcatatgggtgagcgt (SEQ ID NO:98).

[00130] In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcagccacactgagcagcca (SEQ ID NO:77). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcagttacactgagcagcca (SEQ ID NO:99). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gtgtggttgagtcttgggga (SEQ ID NO: 100). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence tcaaccacacttacgtcatg (SEQ ID NO: 101). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atgggcttgactgacatcaa (SEQ ID NO: 102). [00131] In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence ctcctgcagctcttcccgct (SEQ ID NO:79). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence aaaaactacgggcggatgcg (SEQ ID NO: 103). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atccccgagccgcgcgctga (SEQ ID NO: 104). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence catccccgagccgcgcgctg (SEQ ID NO: 105). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence

tgagccgaaccctcagcgcg (SEQ ID NO: 106).

[00132] A target gene can have at least 80%, at least 90%, at least 95%, at least 98%, at least

99%, or 100%, nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).

Cells

[00133] A CRISPR/Cas protein (also referred to herein as a CRISPR/Cas endonuclease) interacts with (binds to) a corresponding guide RNA to form a ribonucleoprotein (RNP) complex (referred to herein as a CRISPR/Cas complex) that is targeted to a particular site (a target sequence) in a target genome via base pairing between the guide RNA and a target sequence within the target genome. A guide RNA includes (i) a nucleotide sequence (a guide sequence) that is complementary to a sequence (the target site) of a target DNA and (ii) a protein-binding region that includes a double stranded RNA (dsRNA) duplex and bind to a corresponding CRISPR/Cas protein. The guide RNA can be readily modified in order to target any desired sequence within a target genome (by modifying the guide sequence). A wild type CRISPR/Cas protein (e.g., a Cas9 protein) normally has nuclease activity that cleaves a target nucleic acid (e.g., a double stranded DNA (dsDNA)) at a target site defined by the region of complementarity between the guide sequence of the guide RNA and the target nucleic acid. The term

"CRISPR/Cas protein," as used herein, includes wild type CRISPR/Cas proteins, and also variant CRISPR/Cas proteins, e.g., CRISPR/Cas proteins with one or more mutations in a catalytic domain rendering the protein a nickase.

[00134] To generate a genetically modified bird of the present disclosure, a heterologous nucleic acid is integrated into the genome of a cell (e.g., any prokaryotic or eukaryotic cell). A heterologous nucleic acid can be any desired length. In some cases, the heterologous nucleic acid has a length in a range of from 17 to 40 nucleotides (nt) (e.g., 17 to 30, 17 to 25, 17 to 22, 17 to 20, 18 to 40, 18 to 30, 18 to 25, 18 to 22, 18 to 20, 19 to 40, 19 to 30, 19 to 25, 19 to 22, 19 to 20, 20 to 40, 20 to 35, 20 to 30, or 20 to 25 nt). In some cases, the heterologous nucleic acid is 17 to 25 nucleotides in length. In some cases, the heterologous nucleic acid is 17 nt in length. In some cases, the heterologous nucleic acid is 18 nt in length. In some cases, the heterologous nucleic acid is 19 nt in length. In some cases, the heterologous nucleic acid is 20 nt in length. In some cases, the heterologous nucleic acid is 18 nt in length. In some cases, the heterologous nucleic acid is 23 nt in length. As noted above, the term "heterologous" is a relative term. In some cases, the heterologous nucleic acid is heterologous to the genome because the sequence is present nowhere in the genome except for where the nucleic acid has integrated. In some cases, the heterologous nucleic acid is heterologous in the sense that it is found elsewhere in the genome, but is not normally present at the position the nucleic acid has integrated (i.e., it is heterologous to the position at which it is integrated)(i.e., the sequence is not present at that position in the genome in the parent cell that was used to produce the genetically modified cell.

[00135] Many methods for integrated foreign nucleic acids into the genomes of various cell types will be known to one of ordinary skill in the art and any convenient method can be used (e.g., a CRISPR/Cas system can be used to generate the genetically modified cells and organisms described herein). A nucleic acid that is integrated into the genome at one or more positions includes a CRISPR/Cas target sequence. In some cases, two or more nucleic acids (having the same CRISPR/Cas target sequence) (3 or more, 4 or more, 5 or more, 6 or more, etc.) are integrated into two or more different positions within the same locus (e.g., flanking a nucleotide sequence encoding a protein and/or an RNA, or a transcription control element). In some cases, two or more (3 or more, 4 or more, 5 or more, 6 or more, etc.) nucleic acids (having the same CRISPR/Cas target sequence) are integrated into two or more different loci (e.g., into nucleotide sequences that encode two different proteins). In some cases, at least two of the two or more positions are within 1 kilobase (1 kb) of one another.

[00136] The term "locus" as used herein refers to a position (which position can be particular base pair location, or can be a range of from one base pair to another) within a genome of interest. For example, a locus can be a particular base pair position (as an illustrative example - base pair 10,324 of human chromosome 14 would be a particular base pair position). As another example, a locus can be a range of base pair positions, e.g., the position in the genome that codes a particular protein or RNA that is transcribed (as an illustrative example, the Wnt3A locus is a protein-coding locus that is transcribed and encodes the Wnt3A protein). As used herein, the term protein-coding locus or RNA -coding locus generally includes the transcriptional control sequences that influence transcription of the locus. Thus, for example, the term "protein-coding locus" not only refers to the nucleotide sequences that have an open reading frame (ORF) and directly encode the protein, but also the promoter, the 5' UTR, the 3' UTR, etc. Thus, when a heterologous nucleic acid is integrated into a protein-coding locus, it will be understood that the purpose is to integrate a CRISPR/Cas target sequence for later recognition by a CRISPR/Cas complex, and that editing a promoter of a protein-coding sequence can in some cases accomplish the same goal as editing the protein-coding sequence itself (e.g., when the goal is to cleave at the CRISPR/Cas target sequence in order to reduce expression of the protein encoding by the locus).

[00137] A target DNA (e.g., genomic DNA) that can be recognized and cleaved by a CRISP/Cas protein (e.g., Cas9) is a DNA polynucleotide that comprises a "target site" or "target sequence." The terms "CRISPR/Cas target site" or "CRISPR/Cas target sequence" are used interchangeably herein to refer to a nucleic acid sequence present in a target DNA (e.g., genomic DNA of a cell) to which a CRISPR/Cas guide RNA can bind, allowing cleave of the target DNA by the CRISPR/Cas endonuclease. The strand of the target DNA that is complementary to and hybridizes with the CRISPR/Cas guide RNA is referred to as the "complementary strand" or the "target strand' and the strand of the target DNA that is complementary to the "complementary strand" (and is therefore not complementary to the guide RNA) is referred to as the "non- complementary strand" or "non-target strand." When the genome editing endonuclease is a CRISPR/Cas endonuclease, the target sequence is the sequence to which the guide sequence of a subject CRISPR/Cas guide RNA (e.g., a Cas9 guide RNA) will hybridize. For example, the target site (or target sequence) 5'-GAGCAUAUC-3' within a target nucleic acid is targeted by (or is bound by, or hybridizes with, or is complementary to) the sequence 5'-GAUAUGCUC-3'. Suitable hybridization conditions include physiological conditions normally present in a cell.

[00138] A target sequence can be any desired length and in some cases can depend upon the type of CRISPR/Cas guide RNA and CRISPR/Cas protein that will be used to target the target sequence. In some cases, the CRISPR/Cas target sequence has a length in a range of from 17 to 40 nucleotides (nt) (e.g., 17 to 30, 17 to 25, 17 to 22, 17 to 20, 18 to 40, 18 to 30, 18 to 25, 18 to 22, 18 to 20, 19 to 40, 19 to 30, 19 to 25, 19 to 22, 19 to 20, 20 to 40, 20 to 35, 20 to 30, or 20 to 25 nt). In some cases, the CRISPR/Cas target sequence is 17 to 25 nucleotides in length. In some cases, the CRISPR/Cas target sequence is 17 nt in length. In some cases, the CRISPR/Cas target sequence is 18 nt in length. In some cases, the CRISPR/Cas target sequence is 19 nt in length. In some cases, the CRISPR/Cas target sequence is 20 nt in length.

[00139] A feature that renders the target sequence functional (such that it can be recognized and cleaved by a CRISPR/Cas complex) is that it is adjacent to a protospacer adjacent motif (PAM), also referred to as a "PAM sequence." Once a nucleic acid is integrated into the genome (when generating a subject genetically modified cell / organism), the CRISPR/Cas target sequence is adjacent to a PAM. The PAM can be present at that position in the genome prior to the integration (e.g., the nucleic acid can be integrated such that the CRISPR/Cas target sequence is inserted next to the PAM that was already present in the genome. In some cases, the PAM is not present at the desired position in the genome, and the PAM is instead present on the nucleic acid to be integrated. Such a heterologous nucleic acid would therefore include the CRISPR/Cas target sequence adjacent to a PAM sequence, and both the CRISPR/Cas target sequence and the PAM would be integrated into the genome.

"Protospacer adjacent motif (PAM)

[00140] As noted above, a wild type CRISPR/Cas protein (e.g., Cas9 protein) normally has

nuclease activity that cleaves a target nucleic acid (e.g., a double stranded DNA (dsDNA)) at a target site defined by the region of complementarity between the guide sequence of the guide RNA and the target nucleic acid. In some cases, site-specific targeting to the target nucleic acid occurs at locations determined by both (i) base-pairing complementarity between the guide nucleic acid and the target nucleic acid; and (ii) a short motif referred to as the "protospacer adjacent motif (PAM) in the target nucleic acid. For example, when a Cas9 protein binds to (in some cases cleaves) a dsDNA target nucleic acid, the PAM sequence that is recognized (bound) by the Cas9 polypeptide is present on the non-complementary strand (the strand that does not hybridize with the targeting segment of the guide nucleic acid) of the target DNA. In some cases, a PAM sequence has a length in a range of from 1 nt to 15 nt (e.g., 1 nt to 14 nt, 1 nt to 13 nt, 1 nt to 12 nt, 1 nt to 11 nt, 1 nt to 10 nt, 1 nt to 9 nt, 1 nt to 9 nt, 1 nt to 8 nt, 1 nt to 7 nt, 1 nt to 6 nt, 1 nt to 5 nt, 1 nt to 4 nt, 1 nt to 3 nt, 2 nt to 15 nt, 2 nt to 14 nt, 2 nt to 13 nt, 2 nt to 12 nt, 2 nt to 11 nt, 2 nt to 10 nt, 2 nt to 9 nt, 2 nt to 8 nt, 2 nt to 7 nt, 2 nt to 6 nt, 2 nt to 5 nt, 2 nt to 4 nt, 2 nt to 3 nt, 2 nt, or 3 nt).

[00141] CRISRPR/Cas (e.g., Cas9) proteins from different species can have different PAM

sequence requirements. For example, in some embodiments (e.g., when the Cas9 protein is derived from S. pyogenes or a closely related Cas9 is used; see for example, Chylinski et al., RNA Biol. 2013 May;10(5):726-37; and Jinek et al., Science. 2012 Aug 17;337(6096):816-21 ; both of which are hereby incorporated by reference in their entirety), the PAM sequence is NRG because the S. pyogenes Cas9 PAM (PAM sequence) is NAG or NGG (or NRG where "R" is A or G). For example, a Cas9 PAM sequence for 5. pyogenes Cas9 is: NGG, NAG, AGG, CGG, GGG, TGG, AAG, CAG, GAG, and TAG.

[00142] As would be known by one of ordinary skill in the art, the PAM sequence can be

different depending on the species from which the Cas9 nuclease is derived. In some cases, the PAM sequence is on the 5' end of the target sequence. In some cases, the PAM sequence is on the 3' end of the target sequence. In some embodiments (e.g., when a Cas9 protein is derived from the Cas9 protein of Neisseria meningitidis or a closely related Cas9 is used), the PAM sequence (e.g., of a target nucleic acid) can be 5 ' -NNNNGANN-3 ' , 5 ' -NNNNGTTN-3 ' , 5'- NNNNGNNT-3' , 5 ' -NNNNGTNN-3 ' , 5 ' -NNNNGNTN-3 ' , or 5 ' -NNNNGATT-3 ' , where N is any nucleotide. In some embodiments (e.g., when a Cas9 protein is derived from Streptococcus thermophilus #1 or a closely related Cas9 is used), the PAM sequence (e.g., of a target nucleic acid) can be 5'-NNAGAA-3', 5'-NNAGGA-3', 5'-NNGGAA-3', 5'-NNANAA-3', or 5'- NNGGGA-3' where N is any nucleotide. In some embodiments (e.g., when a Cas9 protein is derived from Treponema denticola (TD) or a closely related Cas9 is used), the PAM sequence (e.g., of a target nucleic acid) can be 5'-NAAAAN-3', 5'-NAAAAC-3', 5'-NAAANC-3', 5'-NANAAC-3', or 5'-NNAAAC-3' , where N is any nucleotide. As would be known by one of ordinary skill in the art, additional PAM sequences for other Cas9 polypeptides can readily be determined using bioinformatic analysis (e.g., analysis of genomic sequencing data). See Esvelt et al., Nat Methods. 2013 Nov;10(l l): 1116-21, for additional information.

CRISPR/Cas endonucleases

[00143] Examples of suitable RNA-guided endonucleases include, but are not limited to,

CRISPR/Cas endonucleases (e.g., class 2 CRISPR/Cas endonucleases such as a type II, type V, or type VI CRISPR/Cas endonucleases). In some cases, a suitable RNA-guided endonuclease is a class 2 CRISPR/Cas endonuclease. In some cases, a suitable RNA-guided endonuclease is a class 2 type II CRISPR/Cas endonuclease (e.g., a Cas9 protein). In some cases, a suitable RNA- guided endonuclease is a class 2 type V CRISPR/Cas endonuclease (e.g., a Cpfl protein, a C2cl protein, or a C2c3 protein). In some cases, a suitable RNA-guided endonuclease is a class 2 type VI CRISPR/Cas endonuclease (e.g., a C2c2 protein).

[00144] In some cases, an RNA-guided endonuclease is a fusion protein that is fused to a

heterologous polypeptide (also referred to as a "fusion partner"). In some cases, an RNA-guided endonuclease is fused to an amino acid sequence (a fusion partner) that provides for subcellular localization, i.e., the fusion partner is a subcellular localization sequence (e.g., one or more nuclear localization signals (NLSs) for targeting to the nucleus, two or more NLSs, three or more NLSs, etc.). In some embodiments, an RNA-guided endonuclease is fused to an amino acid sequence (a fusion partner) that provides a tag (i.e., the fusion partner is a detectable label) for ease of tracking and/or purification (e.g., a fluorescent protein, e.g., green fluorescent protein (GFP), YFP, RFP, CFP, mCherry, tdTomato, and the like; a histidine tag, e.g., a 6XHis tag; a hemagglutinin (HA) tag; a FLAG tag; a Myc tag; and the like). In some cases, the fusion partner can provide for increased or decreased stability (i.e., the fusion partner can be a stability control peptide, e.g., a degron, which in some cases is controllable (e.g., a temperature sensitive or drug controllable degron sequence).

[00145] In some cases, an RNA-guided endonuclease is conjugated (e.g., fused) to a polypeptide permeant domain to promote uptake by the cell (i.e., the fusion partner promotes uptake by a cell). A number of permeant domains are known in the art and may be used, including peptides, peptidomimetics, and non-peptide carriers. (See, for example, Futaki et al. (2003) Curr Protein Pept Sci. 2003 Apr; 4(2): 87-9 and 446; and Wender et al. (2000) Proc. Natl. Acad. Sci. U.S.A 2000 Nov. 21 ; 97(24): 13003-8; published U.S. Patent applications 20030220334; 20030083256; 20030032593; and 20030022831, herein specifically incorporated by reference for the teachings of translocation peptides and peptoids). The nona-arginine (R9) sequence is one of the more efficient PTDs that have been characterized (Wender et al. 2000; Uemura et al. 2002). The site at which the fusion is made may be selected in order to optimize the biological activity, secretion or binding characteristics of the polypeptide. The optimal site can be determined by routine experimentation.

[00146] In some cases, a genome editing nuclease includes a "Protein Transduction Domain" or

PTD (also known as a CPP - cell penetrating peptide), which refers to a polypeptide, polynucleotide, carbohydrate, or organic or inorganic compound that facilitates traversing a lipid bilayer, micelle, cell membrane, organelle membrane, or vesicle membrane. A PTD attached to another molecule, which can range from a small polar molecule to a large macromolecule and/or a nanoparticle, facilitates the molecule traversing a membrane, for example going from extracellular space to intracellular space, or cytosol to within an organelle. In some

embodiments, a PTD is covalently linked to the amino terminus a polypeptide (e.g., a genome editing nuclease, e.g., a Cas9 protein). In some embodiments, a PTD is covalently linked to the carboxyl terminus of a polypeptide (e.g., an RNA-guided endonuclease, e.g., a Cas9 protein). In some cases, the PTD is inserted internally in the RNA-guided endonuclease (e.g., Cas9 protein) (i.e., is not at the N- or C-terminus of the genome editing nuclease). In some cases, an RNA- guided endonuclease (e.g., a Cas9 protein) includes (is conjugated to, is fused to) one or more PTDs (e.g., two or more, three or more, four or more PTDs). In some cases a PTD includes a nuclear localization signal (NLS) (e.g., in some cases 2 or more, 3 or more, 4 or more, or 5 or more NLSs). [00147] In some cases, an RNA-guided endonuclease (e.g., a Cas9 protein) includes one or more

NLSs (e.g., 2 or more, 3 or more, 4 or more, or 5 or more NLSs). In some embodiments, a PTD is covalently linked to a nucleic acid (e.g., a CRISPR/Cas guide RNA, a polynucleotide encoding a CRISPR/Cas guide RNA, a polynucleotide encoding a class 2 CRISPR/Cas endonuclease such as a Cas9 protein or a type V or type VI CRISPR/Cas protein, etc.). Examples of PTDs include but are not limited to a polyarginine sequence comprising a number of arginines sufficient to direct entry into a cell (e.g., 3, 4, 5, 6, 7, 8, 9, 10, or 10-50 arginines); a VP22 domain (Zender et al. (2002) Cancer Gene Ther. 9(6):489-96); a Drosophila Antennapedia protein transduction domain (Noguchi et al. (2003) Diabetes 52(7): 1732-1737); a truncated human calcitonin peptide (Trehin et al. (2004) Pharm. Research 21 : 1248-1256); polylysine (Wender et al. (2000) Proc. Natl. Acad. Sci. USA 97: 13003-13008). In some embodiments, the PTD is an activatable CPP (ACPP) (Aguilera et al. (2009) Integr Biol (Camb) June; 1(5-6): 371-381). ACPPs comprise a polycationic CPP (e.g., Arg9 or "R9") connected via a cleavable linker to a matching polyanion (e.g., Glu9 or "E9"), which reduces the net charge to nearly zero and thereby inhibits adhesion and uptake into cells. Upon cleavage of the linker, the polyanion is released, locally unmasking the polyarginine and its inherent adhesiveness, thus "activating" the ACPP to traverse the membrane.

[00148] An RNA-guided endonuclease (e.g., a Cas9 protein) can have multiple (1 or more, 2 or more, 3 or more, etc.) fusion partners in any combination of the above. As an illustrative example, an RNA-guided endonuclease (e.g., a Cas9 protein) can have a fusion partner that provides for tagging (e.g., GFP), and can also have a subcellular localization sequence (e.g., one or more NLSs). In some cases, such a fusion protein might also have a tag for ease of tracking and/or purification (e.g., a histidine tag, e.g., a 6XHis tag; a hemagglutinin (HA) tag; a FLAG tag; a Myc tag; and the like). As another illustrative example, an RNA-guided endonuclease (e.g., a Cas9 protein) can have one or more NLSs (e.g., two or more, three or more, four or more, five or more, 1, 2, 3, 4, or 5 NLSs). In some cases a fusion partner (or multiple fusion partners, e.g., 1, 2, 3, 4, or 5 NLSs) (e.g., an NLS, a tag, a fusion partner providing an activity, etc.) is located at or near the C-terminus of the RNA-guided endonuclease (e.g., Cas9 protein). In some cases a fusion partner (or multiple fusion partners, e.g., 1, 2, 3, 4, or 5 NLSs) (e.g., an NLS, a tag, a fusion partner providing an activity, etc.) is located at the N-terminus of the RNA-guided endonuclease (e.g., Cas9 protein). In some cases the genome editing nuclease (e.g., Cas9 protein) has a fusion partner (or multiple fusion partners, e.g., 1, 2, 3, 4, or 5 NLSs)(e.g., an NLS, a tag, a fusion partner providing an activity, etc.) at both the N-terminus and C-terminus. Class 2 CRISPR/Cas endonucleases

[00149] RNA-mediated adaptive immune systems in bacteria and archaea rely on Clustered

Regularly Interspaced Short Palindromic Repeat (CRISPR) genomic loci and CRISPR- associated (Cas) proteins that function together to provide protection from invading viruses and plasmids. In some embodiments, an RNA-guided endonuclease nuclease of a system of the present disclosure is a class 2 CRISPR/Cas endonuclease. Thus in some cases, a system of the present disclosure includes a class 2 CRISPR/Cas endonuclease (or a nucleic encoding the endonuclease). In class 2 CRISPR systems, the functions of the effector complex (e.g., the cleavage of target DNA) are carried out by a single endonuclease (e.g., see Zetsche et al., Cell. 2015 Oct 22;163(3):759-71 ; Makarova et al., Nat Rev Microbiol. 2015 Nov;13(l l):722-36; and Shmakov et al., Mol Cell. 2015 Nov 5;60(3):385-97). As such, the term "class 2 CRISPR/Cas protein" is used herein to encompass the endonuclease (the target nucleic acid cleaving protein) from class 2 CRISPR systems. Thus, the term "class 2 CRISPR/Cas endonuclease" as used herein encompasses type II CRISPR/Cas proteins (e.g., Cas9), type V CRISPR/Cas proteins (e.g., Cpfl, C2cl, C2C3), and type VI CRISPR/Cas proteins (e.g., C2c2). To date, class 2 CRISPR/Cas proteins encompass type II, type V, and type VI CRISPR/Cas proteins, but the term is also meant to encompass any class 2 CRISPR/Cas protein suitable for binding to a corresponding guide RNA and forming an RNP complex.

Type II CRISPR/Cas endonucleases (e.g., Cas 9)

[00150] In natural Type II CRISPR/Cas systems, Cas9 functions as an RNA-guided

endonuclease that uses a dual-guide RNA having a crRNA and iraws-activating crRNA

(tracrRNA) for target recognition and cleavage by a mechanism involving two nuclease active sites in Cas9 that together generate double-stranded DNA breaks (DSBs), or can individually generate single-stranded DNA breaks (SSBs). The Type II CRISPR endonuclease Cas9 and engineered dual-guide RNA (dgRNA) or singleguide RNA (sgRNA) form a ribonucleoprotein (RNP) complex that can be targeted to a desired DNA sequence. Guided by a dual-RNA complex or a single-guide RNA (sgRNA), Cas9 generates site-specific DSBs or SSBs (for example, when one of the catalytic domains harbors an inactivating mutation) within double- stranded DNA (dsDNA) target nucleic acids, which are repaired either by non-homologous end joining (NHEJ) or homology-directed recombination (HDR).

[00151] As noted above, in some cases, a system of the present disclosure includes a type II

CRISPR/Cas endonuclease. A type II CRISPR/Cas endonuclease is a type of class 2

CRISPR/Cas endonuclease. In some cases, the type II CRISPR/Cas endonuclease is a Cas9 protein. A Cas9 protein forms a complex with a Cas9 guide RNA. The guide RNA provides target specificity to a Cas9-guide RNA complex by having a nucleotide sequence (a guide sequence) that is complementary to a sequence (the target site) of a target nucleic acid (as described elsewhere herein). The Cas9 protein of the complex provides the site-specific activity. In other words, the Cas9 protein is guided to a target site (e.g., stabilized at a target site) within a target nucleic acid sequence (e.g. a chromosomal sequence or an extrachromosomal sequence, e.g., an episomal sequence, a minicircle sequence, a mitochondrial sequence, a chloroplast sequence, etc.) by virtue of its association with the protein-binding segment of the Cas9 guide RNA.

[00152] A Cas9 protein can bind and/or modify (e.g., cleave, nick, methylate, demethylate, etc.) a target nucleic acid and/or a polypeptide associated with target nucleic acid (e.g., methylation or acetylation of a histone tail)(e.g., when the Cas9 protein includes a fusion partner with an activity). In some cases, the Cas9 protein is a naturally-occurring protein (e.g., naturally occurs in bacterial and/or archaeal cells). In other cases, the Cas9 protein is not a naturally-occurring polypeptide (e.g., the Cas9 protein is a variant Cas9 protein, a chimeric protein, and the like).

[00153] Examples of suitable Cas9 proteins include, but are not limited to, those set forth in SEQ

ID NOs: 5-21. Naturally occurring Cas9 proteins bind a Cas9 guide RNA, are thereby directed to a specific sequence within a target nucleic acid (a target site), and cleave the target nucleic acid (e.g., cleave dsDNA to generate a double strand break, cleave ssDNA, cleave ssRNA, etc.). A chimeric Cas9 protein is a fusion protein comprising a Cas9 polypeptide that is fused to a heterologous protein (referred to as a fusion partner), where the heterologous protein provides an activity (e.g., one that is not provided by the Cas9 protein). The fusion partner can provide an activity, e.g., enzymatic activity (e.g., nuclease activity, activity for DNA and/or RNA methylation, activity for DNA and/or RNA cleavage, activity for histone acetylation, activity for histone methylation, activity for RNA modification, activity for RNA-binding, activity for RNA splicing etc.). In some cases a portion of the Cas9 protein (e.g., the RuvC domain and/or the HNH domain) exhibits reduced nuclease activity relative to the corresponding portion of a wild type Cas9 protein (e.g., in some cases the Cas9 protein is a nickase). In some cases, the Cas9 protein is enzymatically inactive, or has reduced enzymatic activity relative to a wild-type Cas9 protein (e.g., relative to Streptococcus pyogenes Cas9).

[00154] Many Cas9 orthologs from a wide variety of species have been identified and in some cases the proteins share only a few identical amino acids. Identified Cas9 orthologs have similar domain architecture with a central HNH endonuclease domain and a split RuvC/RNaseH domain (e.g., RuvCI, RuvCII, and RuvCIII) (e.g., see Table 1). For example, a Cas9 protein can have 3 different regions (sometimes referred to as RuvC-I, RuvC-II, and RucC-III), that are not contiguous with respect to the primary amino acid sequence of the Cas9 protein, but fold together to form a RuvC domain once the protein is produced and folds. Thus, Cas9 proteins can be said to share at least 4 key motifs with a conserved architecture. Motifs 1, 2, and 4 are RuvC like motifs while motif 3 is an HNH-motif. The motifs set forth in Table 1 may not represent the entire RuvC -like and/or HNH domains as accepted in the art, but Table 1 does present motifs that can be used to help determine whether a given protein is a Cas9 protein.

[00155] Table 1. Table 1 lists 4 motifs that are present in Cas9 sequences from various species.

The amino acids listed in Table 1 are from the Cas9 from 5. pyogenes (SEQ ID NO: 5).

[00156] In some cases, a suitable Cas9 protein comprises an amino acid sequence having 4

motifs, each of motifs 1-4 having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to motifs 1-4 as set forth in SEQ ID NOs: 1-4, respectively (e.g., see Table 1).

[00157] In other words, in some cases, a suitable Cas9 polypeptide comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5 (e.g., the sequences set forth in SEQ ID NOs: 1-4, e.g., see Table 1), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-21.

[00158] In some cases, a suitable Cas9 protein comprises an amino acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21.

[00159] In some cases, a suitable Cas9 protein comprises an amino acid sequence having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21.

[00160] In some cases, a suitable Cas9 polypeptide is a high fidelity (HF) Cas9 polypeptide (e.g., see Kleinstiver et al. (2016) Nature 529:490). [00161] In some cases, a suitable Cas9 polypeptide exhibits altered PAM specificity. See, e.g.,

Kleinstiver et al. (2015) Nature 523:481.

[00162] As used herein, the term "Cas9 protein" encompasses a "chimeric Cas9 protein." As used herein, the term "Cas9 protein" encompasses a variant Cas9 that is a nickase.

Variant Cas9 proteins - nickases

[00163] In some cases, a Cas9 protein is a variant Cas9 protein. A variant Cas9 protein has an amino acid sequence that is different by at least one amino acid (e.g., has a deletion, insertion, substitution, fusion) when compared to the amino acid sequence of a corresponding wild type Cas9 protein. A protein (e.g., a class 2 CRISPR/Cas protein, e.g., a Cas9 protein) that cleaves one strand but not the other of a double stranded target nucleic acid is referred to herein as a "nickase" (e.g., a "nickase Cas9").

[00164] In some cases, a variant Cas9 protein can cleave the complementary strand (sometimes referred to in the art as the target strand) of a target nucleic acid but has reduced ability to cleave the non-complementary strand (sometimes referred to in the art as the non-target strand) of a target nucleic acid. For example, the variant Cas9 protein can have a mutation (amino acid substitution) that reduces the function of the RuvC domain. Thus, the Cas9 protein can be a nickase that cleaves the complementary strand, but does not cleave the non-complementary strand. As a non-limiting example, in some embodiments, a variant Cas9 protein has a mutation at an amino acid position corresponding to residue D10 (e.g., DIOA, aspartate to alanine) of SEQ ID NO: 5 (or the corresponding position of any of the proteins set forth in SEQ ID NOs: 6-21 and can therefore cleave the complementary strand of a double stranded target nucleic acid but has reduced ability to cleave the non-complementary strand of a double stranded target nucleic acid (thus resulting in a single strand break (SSB) instead of a double strand break (DSB) when the variant Cas9 protein cleaves a double stranded target nucleic acid) (see, for example, Jinek et al., Science. 2012 Aug 17;337(6096):816-21).

[00165] In some cases, a variant Cas9 protein can cleave the non-complementary strand of a target nucleic acid but has reduced ability to cleave the complementary strand of the target nucleic acid. For example, the variant Cas9 protein can have a mutation (amino acid substitution) that reduces the function of the HNH domain. Thus, the Cas9 protein can be a nickase that cleaves the non-complementary strand, but does not cleave the complementary strand. As a non- limiting example, in some embodiments, the variant Cas9 protein has a mutation at an amino acid position corresponding to residue H840 (e.g., an H840A mutation, histidine to alanine) of SEQ ID NO: 5 (or the corresponding position of any of the proteins set forth as SEQ ID NOs: 6- 21) and can therefore cleave the non-complementary strand of the target nucleic acid but has reduced ability to cleave (e.g., does not cleave) the complementary strand of the target nucleic acid. Such a Cas9 protein has a reduced ability to cleave a target nucleic acid (e.g., a single stranded target nucleic acid) but retains the ability to bind a target nucleic acid (e.g., a single stranded target nucleic acid).

[00166] In addition to the above, a variant Cas9 protein can have the same parameters for

sequence identity as described above for Cas9 proteins. Thus, in some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 4 motifs, each of motifs 1-4 having 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more or 100% amino acid sequence identity to motifs 1-4 of the Cas9 amino acid sequence set forth as SEQ ID NO: 5 (the motifs are in Table 1, above, and are set forth as SEQ ID NOs: 1-4, respectively), or to the corresponding portions in any of the amino acid sequences set forth in SEQ ID NOs: 6-21.

[00167] In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having

60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more, or 100% amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21.

[00168] In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having

60% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 70% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 75% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 80% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 85% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 90% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 95% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 99% or more amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 100% amino acid sequence identity to amino acids 7-166 or 731-1003 of the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to the corresponding portions in any of the amino acid sequences set forth as SEQ ID NOs: 6-21.

In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having

60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 99% or more, or 100% amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 60% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 70% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 75% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 80% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 85% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 90% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 95% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 99% or more amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21. In some cases, a suitable variant Cas9 protein comprises an amino acid sequence having 100% amino acid sequence identity to the Cas9 amino acid sequence set forth in SEQ ID NO: 5, or to any of the amino acid sequences set forth as SEQ ID NOs: 6-21.

Type V and Type VI CRISPR/Cas Endonucleases

[00170] In some cases, a system of the present disclosure includes a type V or type VI

CRISPR/Cas endonuclease (i.e., the genome editing endonuclease is a type V or type VI CRISPR/Cas endonuclease) (e.g., Cpfl, C2cl, C2c2, C2c3). Type V and type VI CRISPR/Cas endonucleases are a type of class 2 CRISPR/Cas endonuclease. Examples of type V

CRISPR/Cas endonucleases include but are not limited to: Cpfl, C2cl, and C2c3. An example of a type VI CRISPR/Cas endonuclease is C2c2. In some cases, a system of the present disclosure includes a type V CRISPR/Cas endonuclease (e.g., Cpfl, C2cl, C2c3). In some cases, a Type V CRISPR/Cas endonuclease is a Cpfl protein. In some cases a type V CRISPR/Cas endonuclease is a C2cl protein. In some cases, a system of the present disclosure includes a type VI CRISPR/Cas endonuclease (e.g., C2c2). In some cases a type V CRISPR/Cas endonuclease is a C2c2 protein. In some cases, a system of the present disclosure includes t type VI CRISPR/Cas endonuclease (e.g., C2c3). In some cases a type V CRISPR/Cas endonuclease is a C2c3 protein.

[00171] Like type II CRISPR/Cas endonucleases, type V and VI CRISPR/Cas endonucleases form a complex with a corresponding guide RNA. The guide RNA provides target specificity to an endonuclease-guide RNA RNP complex by having a nucleotide sequence (a guide sequence) that is complementary to a sequence (the target site) of a target nucleic acid (as described elsewhere herein). The endonuclease of the complex provides the site-specific activity. In other words, the endonuclease is guided to a target site (e.g., stabilized at a target site) within a target nucleic acid sequence (e.g. a chromosomal sequence or an extrachromosomal sequence, e.g., an episomal sequence, a minicircle sequence, a mitochondrial sequence, a chloroplast sequence, etc.) by virtue of its association with the protein-binding segment of the guide RNA.

[00172] Examples and guidance related to type V and type VI CRISPR/Cas proteins (e.g., cpfl,

C2cl, C2c2, and C2c3 guide RNAs) can be found in the art, for example, see Zetsche et al., Cell. 2015 Oct 22;163(3):759-71 ; Makarova et al., Nat Rev Microbiol. 2015 Nov;13(l l):722-36; and Shmakov et al., Mol Cell. 2015 Nov 5;60(3):385-97; and U.S. patents and patent applications: 8,906,616; 8,895,308; 8,889,418; 8,889,356; 8,871,445; 8,865,406; 8,795,965; 8,771,945; 8,697,359; 20140068797; 20140170753; 20140179006; 20140179770; 20140186843;

20140186919; 20140186958; 20140189896; 20140227787; 20140234972; 20140242664;

20140242699; 20140242700; 20140242702; 20140248702; 20140256046; 20140273037;

20140273226; 20140273230; 20140273231 ; 20140273232; 20140273233; 20140273234;

20140273235; 20140287938; 20140295556; 20140295557; 20140298547; 20140304853;

20140309487; 20140310828; 20140310830; 20140315985; 20140335063; 20140335620;

20140342456; 20140342457; 20140342458; 20140349400; 20140349405; 20140356867;

20140356956; 20140356958; 20140356959; 20140357523; 20140357530; 20140364333; and 20140377868; all of which are hereby incorporated by reference in their entirety.

Additional resources

[00173] More information (including examples) related to various Cas9 guide RNAs, Cas9 proteins, and Cas9 PAMs can be found in the art, for example, see Jinek et al., Science. 2012 Aug 17;337(6096):816-21 ; Chylinski et al., RNA Biol. 2013 May;10(5):726-37; Ma et al., Biomed Res Int. 2013;2013:270805; Hou et al., Proc Natl Acad Sci U S A. 2013 Sep

24;110(39): 15644-9; Jinek et al., Elife. 2013;2:e00471; Pattanayak et al., Nat Biotechnol. 2013 Sep;31(9):839-43; Qi et al., Cell. 2013 Feb 28;152(5): 1173-83; Wang et al., Cell. 2013 May 9;153(4):910-8; Auer et al., Genome Res. 2013 Oct 31; Chen et al., Nucleic Acids Res. 2013 Nov l ;41(20):el9; Cheng et al, Cell Res. 2013 Oct;23(10): 1163-71 ; Cho et al., Genetics. 2013 Nov;195(3): 1177-80; DiCarlo et al., Nucleic Acids Res. 2013 Apr;41(7):4336-43; Dickinson et al., Nat Methods. 2013 Oct;10(10): 1028-34; Ebina et al, Sci Rep. 2013;3:2510; Fujii et al, Nucleic Acids Res. 2013 Nov l ;41(20):el87; Hu et al., Cell Res. 2013 Nov;23(l l): 1322-5; Jiang et al., Nucleic Acids Res. 2013 Nov l ;41(20):el88; Larson et al., Nat Protoc. 2013

Nov;8(l l):2180-96; Mali et al, Nat Methods. 2013 Oct;10(10):957-63; Nakayama et al., Genesis. 2013 Dec;51(12):835-43; Ran et al., Nat Protoc. 2013 Nov;8(l l):2281-308; Ran et al., Cell. 2013 Sep 12;154(6): 1380-9; Upadhyay et al., G3 (Bethesda). 2013 Dec 9;3(12):2233-8; Walsh et al., Proc Natl Acad Sci U S A. 2013 Sep 24;110(39): 15514-5; Xie et al., Mol Plant. 2013 Oct 9; and Yang et al., Cell. 2013 Sep 12;154(6):1370-9; Briner et al., Mol Cell. 2014 Oct 23;56(2):333-9.

[00174] In some cases, the Type V or type VI CRISPR/Cas endonuclease (e.g., Cpfl, C2cl,

C2c2, C2c3) is enzymatically active, e.g., the Type V or type VI CRISPR/Cas polypeptide, when bound to a guide RNA, cleaves a target nucleic acid. In some cases, the Type V or type VI CRISPR/Cas endonuclease (e.g., Cpfl, C2cl, C2c2, C2c3) exhibits reduced enzymatic activity relative to a corresponding wild-type a Type V or type VI CRISPR/Cas endonuclease (e.g., Cpfl, C2cl, C2c2, C2c3), and retains DNA binding activity. [00175] In some cases a type V CRISPR/Cas endonuclease is a Cpfl protein. In some cases, a

Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the Cpfl amino acid sequence set forth in any of SEQ ID NOs: 22-26. In some cases, a Cpfl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the Cpfl amino acid sequence set forth in any of SEQ ID NOs: 22-26.

[00176] In some cases a type V CRISPR/Cas endonuclease is a C2cl protein (examples include those set forth as SEQ ID NOs: 27-34). In some cases, a C2cl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2cl amino acid sequence set forth in any of SEQ ID NOs: 27-34. In some cases, a C2cl protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the C2cl amino acid sequence set forth in any of SEQ ID NOs: 27-34.

[00177] In some cases a type V CRISPR/Cas endonuclease is a C2c3 protein (examples include those set forth as SEQ ID NOs: 35-38). In some cases, a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 35-38. In some cases, a C2c3 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the C2c3 amino acid sequence set forth in any of SEQ ID NOs: 35-38.

[00178] In some cases a type VI CRISPR/Cas endonuclease is a C2c2 protein (examples include those set forth as SEQ ID NOs: 39-50). In some cases, a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 39-50. In some cases, a C2c2 protein comprises an amino acid sequence having at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 90%, or 100%, amino acid sequence identity to a contiguous stretch of from 100 amino acids to 200 amino acids (aa), from 200 aa to 400 aa, from 400 aa to 600 aa, from 600 aa to 800 aa, from 800 aa to 1000 aa, from 1000 aa to 1100 aa, from 1100 aa to 1200 aa, or from 1200 aa to 1300 aa, of the C2c2 amino acid sequence set forth in any of SEQ ID NOs: 39-50.

Guide RNA (for CRISPR/Cas endonucleases)

[00179] A nucleic acid that binds to a class 2 CRISPR/Cas endonuclease (e.g., a Cas9 protein; a type V or type VI CRISPR/Cas protein; a Cpfl protein; etc.) and targets the complex to a specific location within a target nucleic acid is referred to herein as a "guide RNA" or

"CRISPR/Cas guide nucleic acid" or "CRISPR/Cas guide RNA."

[00180] A guide RNA provides target specificity to the complex (the RNP complex) by

including a targeting segment, which includes a guide sequence (also referred to herein as a targeting sequence), which is a nucleotide sequence that is complementary to a sequence of a target nucleic acid.

[00181] A guide RNA can be referred to by the protein to which it corresponds. For example, when the class 2 CRISPR/Cas endonuclease is a Cas9 protein, the corresponding guide RNA can be referred to as a "Cas9 guide RNA." Likewise, as another example, when the class 2

CRISPR/Cas endonuclease is a Cpfl protein, the corresponding guide RNA can be referred to as a "Cpfl guide RNA."

[00182] In some embodiments, a guide RNA includes two separate nucleic acid molecules: an

"activator" and a "targeter" and is referred to herein as a "dual guide RNA", a "double-molecule guide RNA", a "two-molecule guide RNA", or a "dgRNA." In some embodiments, the guide RNA is one molecule (e.g., for some class 2 CRISPR/Cas proteins, the corresponding guide RNA is a single molecule; and in some cases, an activator and targeter are covalently linked to one another, e.g., via intervening nucleotides), and the guide RNA is referred to as a "single guide RNA", a "single-molecule guide RNA," a "one -molecule guide RNA", or simply "sgRNA."

[00183] For example, in some cases, the first and second CRISPR/Cas guide RNA comprise guide sequences that hybridize to a target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage. Thus, a guide sequence of a first and second CRISPR/Cas guide RNA (e.g. a Cas9 guide RNA) is targeted to a target sequence of a target gene. In some cases, the guide sequence of the first CRISPR/Cas guide RNA (e.g. a Cas9 guide RNA) has 100% complementarity over 20 contiguous nucleotides with the target sequence of the target gene selected from SEQ ID NOs.: 51-62, and the guide sequence of the second CRISPR/Cas guide RNA (e.g., a Cas9 guide RNA) has 100% complementary over 20 contiguous nucleotides with a target sequence of the target gene selected from SEQ ID NOs.: 51-62. In some cases, a first CRISPR/Cas guide RNA (e.g., a Cas9 guide RNA) includes a guide sequence that includes a sequence selected from SEQ ID NOs.: 63-74, 107-124 (which sequences hybridize to a target sequence of a target gene that is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage). In some cases, a second CRISPR/Cas guide RNA (e.g., a Cas9 guide RNA) includes a guide sequence that includes a sequence selected from SEQ ID NOs.: 63-74, 107-124 (which sequences hybridize to a target sequence of a target gene that is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage).

[00184] A target gene can have at least 80%, at least 90%, at least 95%, at least 98%, at least

99%, or 100%, nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62). In some cases, a non-complementary strand of the target sequence that is targeted by a first CRISPR/Cas guide RNA (e.g. a Cas9 guide RNA) includes a sequence selected from SEQ ID NOs: 76-77, 79-106. In some cases, a first CRISPR/Cas guide RNA (e.g. a Cas9 guide RNA) includes a guide sequence that includes a sequence selected from SEQ ID NOs: 63-74, 107-124. In some cases, a non-complementary strand of the target sequence that is targeted by a second CRISPR/Cas guide RNA (e.g. a Cas9 guide RNA) includes a sequence selected from SEQ ID NOs: 76-77, 79-106). In some cases, a second CRISPR/Cas guide RNA (e.g. a Cas9 guide RNA) includes a guide sequence that includes a sequence selected from SEQ ID NOs: 63-74, 107-124.

Cas9 Guide RNA

[00185] A nucleic acid molecule that binds to a Cas9 protein and targets the complex to a

specific location within a target nucleic acid is referred to herein as a "Cas9 guide RNA."

[00186] A Cas9 guide RNA (can be said to include two segments, a first segment (referred to herein as a "targeting segment"); and a second segment (referred to herein as a "protein-binding segment"). By "segment" it is meant a segment/section/region of a molecule, e.g., a contiguous stretch of nucleotides in a nucleic acid molecule. A segment can also mean a region/section of a complex such that a segment may comprise regions of more than one molecule.

[00187] The first segment (targeting segment) of a Cas9 guide RNA includes a nucleotide

sequence (a guide sequence) that is complementary to (and therefore hybridizes with) a specific sequence (a target site) within a target nucleic acid (e.g., a target ssRNA, a target ssDNA, the complementary strand of a double stranded target DNA, etc.). The protein-binding segment (or "protein-binding sequence") interacts with (binds to) a Cas9 polypeptide. The protein-binding segment of a subject Cas9 guide RNA includes two complementary stretches of nucleotides that hybridize to one another to form a double stranded RNA duplex (dsRNA duplex). Site-specific binding and/or cleavage of a target nucleic acid (e.g., genomic DNA) can occur at locations (e.g., target sequence of a target locus) determined by base-pairing complementarity between the Cas9 guide RNA (the guide sequence of the Cas9 guide RNA) and the target nucleic acid.

[00188] A Cas9 guide RNA and a Cas9 protein form a complex (e.g., bind via non-covalent interactions). The Cas9 guide RNA provides target specificity to the complex by including a targeting segment, which includes a guide sequence (a nucleotide sequence that is

complementary to a sequence of a target nucleic acid). The Cas9 protein of the complex provides the site-specific activity (e.g., cleavage activity or an activity provided by the Cas9 protein when the Cas9 protein is a Cas9 fusion polypeptide, i.e., has a fusion partner). In other words, the Cas9 protein is guided to a target nucleic acid sequence (e.g. a target sequence in a chromosomal nucleic acid, e.g., a chromosome; a target sequence in an extra chromosomal nucleic acid, e.g. an episomal nucleic acid, a minicircle, an ssRNA, an ssDNA, etc.; a target sequence in a mitochondrial nucleic acid; a target sequence in a chloroplast nucleic acid; a target sequence in a plasmid; a target sequence in a viral nucleic acid; etc.) by virtue of its association with the Cas9 guide RNA.

[00189] The "guide sequence" also referred to as the "targeting sequence" of a Cas9 guide RNA can be modified so that the Cas9 guide RNA can target a Cas9 protein to any desired sequence of any desired target nucleic acid, with the exception that the protospacer adjacent motif (PAM) sequence can be taken into account. Thus, for example, a Cas9 guide RNA can have a targeting segment with a sequence (a guide sequence) that has complementarity with (e.g., can hybridize to) a sequence in a nucleic acid in a eukaryotic cell, e.g., a viral nucleic acid, a eukaryotic nucleic acid (e.g., a eukaryotic chromosome, chromosomal sequence, a eukaryotic RNA, etc.), and the like. In some embodiments, the guide sequence of a CRISPR/Cas9 guide RNA will have a nucleotide sequence having at least 80% or at least 90% nucleotide sequence identify to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62). Examples of suitable single guide RNAs that may be used in the present disclosure include, but are not limited to: caaugugucuaauugcaucu (SEQ ID NO:63), aauaccagcauuggcagucc (SEQ ID NO:64), gcagccacacugagcagcca (SEQ ID NO:65), augcucauaugggugagcgu (SEQ ID NO:66), cuccugcagcucuucccgcu (SEQ ID NO:67), agcgaugaagucauagccaa (SEQ ID NO:68), aagaagccacucacccugca (SEQ ID NO:69), cuccucccaccagcccaaca (SEQ ID NO:70),

aaagaagcagcagcuuugcu (SEQ ID NO:71), uucucagaucuuugacccgc (SEQ ID NO:72), agaggcuugaaggaguguac (SEQ ID NO:73), ccaccaggucccugaggcgg (SEQ ID NO: 74), aggaaugguguugcucugug (SEQ ID NO: 107), gaucacaucucaugccauug (SEQ ID NO: 108), cgagaugcaauuagacacau (SEQ ID NO: 109), gucugauaauccaaaaucug (SEQ ID NO: 110), gcauacgcuguugccagaag (SEQ ID NO: 111), gacugccaaugcugguauug (SEQ ID NO: 112), cgaauggccuguggugggca (SEQ ID NO: 113), gcuucgaucccagacuaccg (SEQ ID NO: 114), gcaauguccaaaugccauug (SEQ ID NO: 115), auuuggacauugcugcagaa (SEQ ID NO: 116), gcaguuacacugagcagcca (SEQ ID NO: 117), gugugguugagucuugggga (SEQ ID NO: 118), ucaaccacacuuacgucaug (SEQ ID NO: 119), augggcuugacugacaucaa (SEQ ID NO: 120), aaaaacuacgggcggaugcg (SEQ ID NO: 121), auccccgagccgcgcgcuga (SEQ ID NO: 122), cauccccgagccgcgcgcug (SEQ ID NO: 123), and ugagccgaacccucagcgcg (SEQ ID NO: 124). Examples of suitable nucleotide sequences encoding CRISPR/Cas (e.g. a first Cas9 guide RNA and/or a second Cas9 guide RNA) single guide RNAs that may be used in the present disclosure include, but are not limited to: aataccagcattggcagtcc (SEQ ID NO:76), gcagccacactgagcagcca (SEQ ID NO:77), ctcctgcagctcttcccgct (SEQ ID NO:79), agcgatgaagtcatagccaa( SEQ ID NO:80), aagaagccactcaccctgca (SEQ ID NO:81), ctcctcccaccagcccaaca (SEQ ID NO:82), aaagaagcagcagctttgct (SEQ ID NO:83), ttctcagatctttgacccgc (SEQ ID NO:84),

agaggcttgaaggagtgtac (SEQ ID NO:85), ccaccaggtccctgaggcgg (SEQ ID NO:86),

aggaatggtgttgctctgtg (SEQ ID NO:87), gatcacatctcatgccattg (SEQ ID NO:88), caatgtgtctaattgcatct (SEQ ID NO:89), cgagatgcaattagacacat (SEQ ID NO:90), gtctgataatccaaaatctg (SEQ ID N0:91), gcatacgctgttgccagaag (SEQ ID NO:92),

gactgccaatgctggtattg (SEQ ID NO:93), cgaatggcctgtggtgggca (SEQ ID NO:94),

gcttcgatcccagactaccg (SEQ ID NO:95), gcaatgtccaaatgccattg (SEQ ID NO:96),

atttggacattgctgcagaa (SEQ ID NO:97), atgctcatatgggtgagcgt (SEQ ID NO:98),

gcagttacactgagcagcca (SEQ ID NO:99), gtgtggttgagtcttgggga (SEQ ID NO: 100),

tcaaccacacttacgtcatg (SEQ ID NO: 101), atgggcttgactgacatcaa (SEQ ID NO: 102),

aaaaactacgggcggatgcg (SEQ ID NO: 103), atccccgagccgcgcgctga (SEQ ID NO: 104), catccccgagccgcgcgctg (SEQ ID NO: 105), and tgagccgaaccctcagcgcg (SEQ ID NO: 106).

[00190] In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MAT1A comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence aggaatggtgttgctctgtg (SEQ ID NO: 87). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MAT1A comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gatcacatctcatgccattg (SEQ ID NO:88). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MAT1A comprises at least 90% sequence identity to the nucleotide sequence caatgtgtctaattgcatct (SEQ ID NO:89). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene MAT1A comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence cgagatgcaattagacacat (SEQ ID NO:90).

[00191] In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence aataccagcattggcagtcc(SEQ ID NO:76). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gtctgataatccaaaatctg (SEQ ID NO:91). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX 1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcatacgctgttgccagaag (SEQ ID NO:92). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gactgccaatgctggtattg (SEQ ID NO:93). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene ACOX1 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence cgaatggcctgtggtgggca (SEQ ID NO:94). [00192] In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcttcgatcccagactaccg (SEQ ID NO:95). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90% sequence identity to the nucleotide sequence gcaatgtccaaatgccattg (SEQ ID NO:96). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atttggacattgctgcagaa (SEQ ID NO:97). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene SIRT7 comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atgctcatatgggtgagcgt (SEQ ID NO:98).

[00193] In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcagccacactgagcagcca(SEQ ID NO:77). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gcagttacactgagcagcca (SEQ ID NO:99). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence gtgtggttgagtcttgggga (SEQ ID NO: 100). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence tcaaccacacttacgtcatg (SEQ ID NO: 101). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEPR comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence

atgggcttgactgacatcaa (SEQ ID NO: 102).

[00194] In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence ctcctgcagctcttcccgct (SEQ ID NO:79). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence aaaaactacgggcggatgcg (SEQ ID NO: 103). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence atccccgagccgcgcgctga (SEQ ID NO: 104). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence catccccgagccgcgcgctg (SEQ ID NO: 105). In some cases, a nucleotide sequence encoding a CRISPR/Cas single guide RNA for the target gene LEP comprises at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence

tgagccgaaccctcagcgcg (SEQ ID NO: 106).

[00195] In some embodiments, a Cas9 guide RNA includes two separate nucleic acid molecules: an "activator" and a "targeter" and is referred to herein as a "dual Cas9 guide RNA", a "double- molecule Cas9 guide RNA", or a "two-molecule Cas9 guide RNA" a "dual guide RNA", or a "dgRNA." In some embodiments, the activator and targeter are covalently linked to one another (e.g., via intervening nucleotides) and the guide RNA is referred to as a "single guide RNA", a "Cas9 single guide RNA", a "single-molecule Cas9 guide RNA," or a "one-molecule Cas9 guide RNA", or simply "sgRNA."

[00196] A Cas9 guide RNA can also be said to include 3 parts: (i) a targeting sequence (a

nucleotide sequence that hybridizes with a sequence of the target nucleic acid); (ii) an activator sequence (as described above)(in some cases, referred to as a tracr sequence); and (iii) a sequence that hybridizes to at least a portion of the activator sequence to form a double stranded duplex. A targeter has (i) and (iii); while an activator has (ii).

[00197] A Cas9 guide RNA (e.g. a dual guide RNA or a single guide RNA) can be comprised of any corresponding activator and targeter pair. In some cases, the duplex forming segments can be swapped between the activator and the targeter. In other words, in some cases, the targeter includes a sequence of nucleotides from a duplex forming segment of a tracrRNA (which sequence would normally be part of an activator) while the activator includes a sequence of nucleotides from a duplex forming segment of a crRNA (which sequence would normally be part of a targeter).

[00198] As noted above, a targeter comprises both the targeting segment (single stranded) of the

Cas9 guide RNA and a stretch ("duplex-forming segment") of nucleotides that forms one half of the dsRNA duplex of the protein-binding segment of the Cas9 guide RNA. A corresponding tracrRNA-like molecule (activator) comprises a stretch of nucleotides (a duplex-forming segment) that forms the other half of the dsRNA duplex of the protein-binding segment of the Cas9 guide RNA. In other words, a stretch of nucleotides of the targeter is complementary to and hybridizes with a stretch of nucleotides of the activator to form the dsRNA duplex of the protein- binding segment of a Cas9 guide RNA. As such, each targeter can be said to have a

corresponding activator (which has a region that hybridizes with the targeter). The targeter molecule additionally provides the targeting segment. Thus, a targeter and an activator (as a corresponding pair) hybridize to form a Cas9 guide RNA. The particular sequence of a given naturally existing crRNA or tracrRNA molecule is characteristic of the species in which the RNA molecules are found. Examples of suitable activator and targeter are well known in the art. Targeting segment of a Cas9 guide RNA

[00199] The first segment of a subject guide nucleic acid includes a guide sequence (i.e., a

targeting sequence) (a nucleotide sequence that is complementary to a sequence (a target site) in a target nucleic acid). In other words, the targeting segment of a subject guide nucleic acid can interact with a target nucleic acid (e.g., double stranded DNA (dsDNA)) in a sequence-specific manner via hybridization (i.e., base pairing). As such, the nucleotide sequence of the targeting segment may vary (depending on the target) and can determine the location within the target nucleic acid that the Cas9 guide RNA and the target nucleic acid will interact. The targeting segment of a Cas9 guide RNA can be modified (e.g., by genetic engineering)/designed to hybridize to any desired sequence (target site) within a target nucleic acid (e.g., a eukaryotic target nucleic acid such as genomic DNA).

[00200] The targeting segment can have a length of 7 or more nucleotides (nt) (e.g., 8 or more, 9 or more, 10 or more, 12 or more, 15 or more, 20 or more, 25 or more, 30 or more, or 40 or more nucleotides). In some cases, the targeting segment can have a length of from 7 to 100 nucleotides (nt) (e.g., from 7 to 80 nt, from 7 to 60 nt, from 7 to 40 nt, from 7 to 30 nt, from 7 to 25 nt, from

7 to 22 nt, from 7 to 20 nt, from 7 to 18 nt, from 8 to 80 nt, from 8 to 60 nt, from 8 to 40 nt, from

8 to 30 nt, from 8 to 25 nt, from 8 to 22 nt, from 8 to 20 nt, from 8 to 18 nt, from 10 to 100 nt, from 10 to 80 nt, from 10 to 60 nt, from 10 to 40 nt, from 10 to 30 nt, from 10 to 25 nt, from 10 to 22 nt, from 10 to 20 nt, from 10 to 18 nt, from 12 to 100 nt, from 12 to 80 nt, from 12 to 60 nt, from 12 to 40 nt, from 12 to 30 nt, from 12 to 25 nt, from 12 to 22 nt, from 12 to 20 nt, from 12 to 18 nt, from 14 to 100 nt, from 14 to 80 nt, from 14 to 60 nt, from 14 to 40 nt, from 14 to 30 nt, from 14 to 25 nt, from 14 to 22 nt, from 14 to 20 nt, from 14 to 18 nt, from 16 to 100 nt, from 16 to 80 nt, from 16 to 60 nt, from 16 to 40 nt, from 16 to 30 nt, from 16 to 25 nt, from 16 to 22 nt, from 16 to 20 nt, from 16 to 18 nt, from 18 to 100 nt, from 18 to 80 nt, from 18 to 60 nt, from 18 to 40 nt, from 18 to 30 nt, from 18 to 25 nt, from 18 to 22 nt, or from 18 to 20 nt).

[00201] The nucleotide sequence (the targeting sequence) of the targeting segment that is

complementary to a nucleotide sequence (target site) of the target nucleic acid can have a length of 10 nt or more. For example, the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid can have a length of 12 nt or more, 15 nt or more, 18 nt or more, 19 nt or more, or 20 nt or more. In some cases, the nucleotide sequence (the targeting sequence) of the targeting segment that is complementary to a nucleotide sequence (target site) of the target nucleic acid has a length of 12 nt or more. In some cases, the nucleotide sequence (the targeting sequence) of the targeting segment that is complementary to a nucleotide sequence (target site) of the target nucleic acid has a length of 18 nt or more.

[00202] For example, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid can have a length of from 10 to 100 nucleotides (nt) (e.g., from 10 to 90 nt, from 10 to 75 nt, from 10 to 60 nt, from 10 to 50 nt, from 10 to 35 nt, from 10 to 30 nt, from 10 to 25 nt, from 10 to 22 nt, from 10 to 20 nt, from 12 to 100 nt, from 12 to 90 nt, from 12 to 75 nt, from 12 to 60 nt, from 12 to 50 nt, from 12 to 35 nt, from 12 to 30 nt, from 12 to 25 nt, from 12 to 22 nt, from 12 to 20 nt, from 15 to 100 nt, from 15 to 90 nt, from 15 to 75 nt, from 15 to 60 nt, from 15 to 50 nt, from 15 to 35 nt, from 15 to 30 nt, from 15 to 25 nt, from 15 to 22 nt, from 15 to 20 nt, from 17 to 100 nt, from 17 to 90 nt, from 17 to 75 nt, from 17 to 60 nt, from 17 to 50 nt, from 17 to 35 nt, from 17 to 30 nt, from 17 to 25 nt, from 17 to 22 nt, from 17 to 20 nt, from 18 to 100 nt, from 18 to 90 nt, from 18 to 75 nt, from 18 to 60 nt, from 18 to 50 nt, from 18 to 35 nt, from 18 to 30 nt, from 18 to 25 nt, from 18 to 22 nt, or from 18 to 20 nt). In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 15 nt to 30 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 15 nt to 25 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 18 nt to 30 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 18 nt to 25 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target sequence of the target nucleic acid has a length of from 18 nt to 22 nt. In some cases, the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid is 20 nucleotides in length. In some cases, the targeting sequence of the targeting segment that is complementary to a target site of the target nucleic acid is 19 nucleotides in length.

[00203] The percent complementarity between the targeting sequence (guide sequence) of the targeting segment and the target site of the target nucleic acid can be 60% or more (e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the seven contiguous 5 '-most nucleotides of the target site of the target nucleic acid. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 60% or more over about 20 contiguous nucleotides. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the fourteen contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 14 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the seven contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 20 nucleotides in length.

In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 7 contiguous 5'- most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3'-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 8 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 9 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 10 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 17 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3'- most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 18 contiguous 5 '-most nucleotides of the target site of the target nucleic acid (which can be complementary to the 3 '-most nucleotides of the targeting sequence of the Cas9 guide RNA). In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 60% or more (e.g., e.g., 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 100%) over about 20 contiguous nucleotides. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 7 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 7 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 8 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 8 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 9 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 9 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 10 contiguous 5 '-most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 10 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 11 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 11 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 12 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 12 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 13 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 13 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 14 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 14 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 17 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 17 nucleotides in length. In some cases, the percent complementarity between the targeting sequence of the targeting segment and the target site of the target nucleic acid is 100% over the 18 contiguous 5'- most nucleotides of the target site of the target nucleic acid and as low as 0% or more over the remainder. In such a case, the targeting sequence can be considered to be 18 nucleotides in length.

Protein-binding segment of a Cas9 guide RNA

[00206] The protein-binding segment of a subject Cas9 guide RNA interacts with a Cas9 protein.

The Cas9 guide RNA guides the bound Cas9 protein to a specific nucleotide sequence within target nucleic acid via the above mentioned targeting segment. The protein-binding segment of a Cas9 guide RNA comprises two stretches of nucleotides that are complementary to one another and hybridize to form a double stranded RNA duplex (dsRNA duplex). Thus, the protein-binding segment includes a dsRNA duplex. In some cases, the protein-binding segment also includes stem loop 1 (the "nexus") of a Cas9 guide RNA. For example, in some cases, the activator of a Cas9 guide RNA (dgRNA or sgRNA) includes (i) a duplex forming segment that contributes to the dsRNA duplex of the protein-binding segment; and (ii) nucleotides 3' of the duplex forming segment, e.g., that form stem loop 1 (the "nexus"). For example, in some cases, the protein- binding segment includes stem loop 1 (the ' 'nexus") of a Cas9 guide RNA. In some cases, the protein-binding segment includes 5 or more nucleotides (nt) (e.g., 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 15 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 70 or more, 75 or more, or 80 or more nt) 3' of the dsRNA duplex (where 3' is relative to the duplex-forming segment of the activator sequence).

[00207] The dsRNA duplex of the guide RNA (sgRNA or dgRNA) that forms between the

activator and targeter is sometimes referred to herein as the "stem loop". In addition, the activator (activator RNA, tracrRNA) of many naturally existing Cas9 guide RNAs (e.g., 5. pyogenes guide RNAs) has 3 stem loops (3 hairpins) that are 3' of the duplex-forming segment of the activator. The closest stem loop to the duplex-forming segment of the activator (3' of the duplex forming segment) is called "stem loop 1" (and is also referred to herein as the "nexus"); the next stem loop is called "stem loop 2" (and is also referred to herein as the "hairpin 1"); and the next stem loop is called "stem loop 3" (and is also referred to herein as the "hairpin 2").

[00208] In some cases, a Cas9 guide RNA (sgRNA or dgRNA) (e.g., a full length Cas9 guide

RNA) has stem loops 1, 2, and 3. In some cases, an activator (of a Cas9 guide RNA) has stem loop 1, but does not have stem loop 2 and does not have stem loop 3. In some cases, an activator (of a Cas9 guide RNA) has stem loop 1 and stem loop 2, but does not have stem loop 3. In some cases, an activator (of a Cas9 guide RNA) has stem loops 1, 2, and 3. [00209] In some cases, the activator (e.g., tracr sequence) of a Cas9 guide RNA (dgRNA or sgRNA) includes (i) a duplex forming segment that contributes to the dsRNA duplex of the protein-binding segment; and (ii) a stretch of nucleotides (e.g., referred to herein as a 3' tail) 3' of the duplex forming segment. In some cases, the additional nucleotides 3' of the duplex forming segment form stem loop 1. In some cases, the activator (e.g., tracr sequence) of a Cas9 guide RNA (dgRNA or sgRNA) includes (i) a duplex forming segment that contributes to the dsRNA duplex of the protein-binding segment; and (ii) 5 or more nucleotides (e.g., 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, 50 or more, 60 or more, 70 or more, or 75 or more nucleotides) 3' of the duplex forming segment. In some cases, the activator (activator RNA) of a Cas9 guide RNA (dgRNA or sgRNA) includes (i) a duplex forming segment that contributes to the dsRNA duplex of the protein-binding segment; and (ii) 5 or more nucleotides (e.g., 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 20 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, 50 or more, 60 or more, 70 or more, or 75 or more nucleotides) 3' of the duplex forming segment.

[00210] In some cases, the activator (e.g., tracr sequence) of a Cas9 guide RNA (dgRNA or sgRNA) includes (i) a duplex forming segment that contributes to the dsRNA duplex of the protein-binding segment; and (ii) a stretch of nucleotides (e.g., referred to herein as a 3' tail) 3' of the duplex forming segment. In some cases, the stretch of nucleotides 3' of the duplex forming segment has a length in a range of from 5 to 200 nucleotides (nt) (e.g., from 5 to 150 nt, from 5 to 130 nt, from 5 to 120 nt, from 5 to 100 nt, from 5 to 80 nt, from 10 to 200 nt, from 10 to 150 nt, from 10 to 130 nt, from 10 to 120 nt, from 10 to 100 nt, from 10 to 80 nt, from 12 to 200 nt, from 12 to 150 nt, from 12 to 130 nt, from 12 to 120 nt, from 12 to 100 nt, from 12 to 80 nt, from 15 to 200 nt, from 15 to 150 nt, from 15 to 130 nt, from 15 to 120 nt, from 15 to 100 nt, from 15 to 80 nt, from 20 to 200 nt, from 20 to 150 nt, from 20 to 130 nt, from 20 to 120 nt, from 20 to 100 nt, from 20 to 80 nt, from 30 to 200 nt, from 30 to 150 nt, from 30 to 130 nt, from 30 to 120 nt, from 30 to 100 nt, or from 30 to 80 nt). In some cases, the nucleotides of the 3' tail of an activator RNA are wild type sequences. Examples of various Cas9 proteins and Cas9 guide RNAs (as well as information regarding requirements related to protospacer adjacent motif (PAM) sequences present in targeted nucleic acids) can be found in the art, for example, see Jinek et al., Science. 2012 Aug 17;337(6096):816-21 ; Chylinski et al., RNA Biol. 2013

May;10(5):726-37; Ma et al., Biomed Res Int. 2013;2013:270805; Hou et al., Proc Natl Acad Sci U S A. 2013 Sep 24;110(39): 15644-9; Jinek et al., Elife. 2013;2:e00471 ; Pattanayak et al., Nat Biotechnol. 2013 Sep;31(9):839-43; Qi et al, Cell. 2013 Feb 28;152(5): 1173-83; Wang et al., Cell. 2013 May 9;153(4):910-8; Auer et al., Genome Res. 2013 Oct 31 ; Chen et al., Nucleic Acids Res. 2013 Nov l ;41(20):el9; Cheng et al., Cell Res. 2013 Oct;23(10): 1163-71 ; Cho et al., Genetics. 2013 Nov;195(3): 1177-80; DiCarlo et al., Nucleic Acids Res. 2013 Apr;41(7):4336- 43; Dickinson et al., Nat Methods. 2013 Oct;10(10): 1028-34; Ebina et al., Sci Rep. 2013;3:2510; Fujii et al, Nucleic Acids Res. 2013 Nov l ;41(20):el87; Hu et al., Cell Res. 2013

Nov;23(l l): 1322-5; Jiang et al, Nucleic Acids Res. 2013 Nov l ;41(20):el88; Larson et al, Nat Protoc. 2013 Nov;8(l l):2180-96; Mali et at., Nat Methods. 2013 Oct;10(10):957-63; Nakayama et al., Genesis. 2013 Dec;51(12):835-43; Ran et al., Nat Protoc. 2013 Nov;8(l l):2281-308; Ran et al., Cell. 2013 Sep 12;154(6): 1380-9; Upadhyay et al., G3 (Bethesda). 2013 Dec

9;3(12):2233-8; Walsh et al., Proc Natl Acad Sci U S A. 2013 Sep 24;110(39): 15514-5; Xie et al., Mol Plant. 2013 Oct 9; Yang et al., Cell. 2013 Sep 12;154(6): 1370-9; Briner et al., Mol Cell. 2014 Oct 23;56(2):333-9; and U.S. patents and patent applications: 8,906,616; 8,895,308;

8,889,418; 8,889,356; 8,871,445; 8,865,406; 8,795,965; 8,771,945; 8,697,359; 20140068797; 20140170753; 20140179006; 20140179770; 20140186843; 20140186919; 20140186958;

20140189896; 20140227787; 20140234972; 20140242664; 20140242699; 20140242700;

20140242702; 20140248702; 20140256046; 20140273037; 20140273226; 20140273230;

20140273231 ; 20140273232; 20140273233; 20140273234; 20140273235; 20140287938;

20140295556; 20140295557; 20140298547; 20140304853; 20140309487; 20140310828;

20140310830; 20140315985; 20140335063; 20140335620; 20140342456; 20140342457;

20140342458; 20140349400; 20140349405; 20140356867; 20140356956; 20140356958;

20140356959; 20140357523; 20140357530; 20140364333; and 20140377868; all of which are hereby incorporated by reference in their entirety.

Guide RNAs corresponding to type V and type VI CRISPR/Cas endonucleases (e.g., Cpfl Guide RNA)

[00211] A guide RNA that binds to a type V or type VI CRISPR/Cas protein (e.g., Cpfl, C2cl,

C2c2, C2c3), and targets the complex to a specific location within a target nucleic acid is referred to herein generally as a "type V or type VI CRISPR/Cas guide RNA" . An example of a more specific term is a "Cpfl guide RNA."

[00212] A type V or type VI CRISPR/Cas guide RNA (e.g., cpfl guide RNA) can have a total length of from 30 nucleotides (nt) to 200 nt, e.g., from 30 nt to 180 nt, from 30 nt to 160 nt, from 30 nt to 150 nt, from 30 nt to 125 nt, from 30 nt to 100 nt, from 30 nt to 90 nt, from 30 nt to 80 nt, from 30 nt to 70 nt, from 30 nt to 60 nt, from 30 nt to 50 nt, from 50 nt to 200 nt, from 50 nt to 180 nt, from 50 nt to 160 nt, from 50 nt to 150 nt, from 50 nt to 125 nt, from 50 nt to 100 nt, from 50 nt to 90 nt, from 50 nt to 80 nt, from 50 nt to 70 nt, from 50 nt to 60 nt, from 70 nt to 200 nt, from 70 nt to 180 nt, from 70 nt to 160 nt, from 70 nt to 150 nt, from 70 nt to 125 nt, from 70 nt to 100 nt, from 70 nt to 90 nt, or from 70 nt to 80 nt). In some cases, a type V or type VI CRISPR/Cas guide RNA (e.g., cpfl guide RNA) has a total length of at least 30 nt (e.g., at least 40 nt, at least 50 nt, at least 60 nt, at least 70 nt, at least 80 nt, at least 90 nt, at least 100 nt, or at least 120 nt,).

[00213] The guide sequence of a type V or type VI CRISPR/Cas guide RNA (e.g., cpfl guide

RNA) can have 100% complementarity with a corresponding length of target nucleic acid sequence. The guide sequence can have less than 100% complementarity with a corresponding length of target nucleic acid sequence. For example, the guide sequence of a type V or type VI CRISPR/Cas guide RNA (e.g., cpfl guide RNA) can have 1, 2, 3, 4, or 5 nucleotides that are not complementary to the target nucleic acid sequence. For example, in some cases, where a guide sequence has a length of 25 nucleotides, and the target nucleic acid sequence has a length of 25 nucleotides, in some cases, the target nucleic acid-binding segment has 100% complementarity to the target nucleic acid sequence. As another example, in some cases, where a guide sequence has a length of 25 nucleotides, and the target nucleic acid sequence has a length of 25 nucleotides, in some cases, the target nucleic acid-binding segment has 1 non-complementary nucleotide and 24 complementary nucleotides with the target nucleic acid sequence. As another example, in some cases, where a guide sequence has a length of 25 nucleotides, and the target nucleic acid sequence has a length of 25 nucleotides, in some cases, the target nucleic acid- binding segment has 2 non-complementary nucleotides and 23 complementary nucleotides with the target nucleic acid sequence.

[00214] Examples and guidance related to type V or type VI CRISPR/Cas endonucleases and guide RNAs (as well as information regarding requirements related to protospacer adjacent motif (PAM) sequences present in targeted nucleic acids) can be found in the art, for example, see Zetsche et al, Cell. 2015 Oct 22;163(3):759-71 ; Makarova et al, Nat Rev Microbiol. 2015 Nov;13(l l):722-36; and Shmakov et al., Mol Cell. 2015 Nov 5;60(3):385-97.

[00215] In some cases, the genetically modified organism will include a nucleic acid encoding a

CRISPR/Cas endonuclease (e.g., a Cas9 protein). In such cases, the nucleotide sequence encoding the CRISPR/Cas endonuclease and/or a transcription control element that is operably linked to the nucleotide sequence will include a CRISPR/Cas target sequence (e.g., via a subject heterologous integrated nucleic acid). In some cases that CRISPR/Cas target sequence will be the same as the CRISPR/Cas target sequence integrated elsewhere in the genome. In some cases that CRISPR/Cas target sequence will be different than the target sequence integrated elsewhere (e.g., will be a second CRISPR/Cas target sequence), and a second guide RNA (a second species of guide RNA, having a guide sequence that hybridizes with the second target sequence) would be needed to target the second target sequence. In some cases, the nucleic acid encoding the CRISPR/Cas endonuclease (e.g., a Cas9 protein) will be integrated into the genome of the genomically modified cell/organism and in some cases, the nucleic acid will not be integrated (e.g., will be episomally or transiently maintained).

[00216] Provided are methods of editing the genome or modulating transcription of a subject genetically modified cell (or non-human organism; e.g., bird). The components of a CRISPR/Cas system can be delivered (introduced into a cell) as DNA, RNA, or protein. For example, when the composition includes a class 2 CRISPR/Cas endonuclease (e.g., Cas9, Cpfl, etc.) and a corresponding guide RNA (e.g., a Cas9 guide RNA, a Cpfl guide RNA, etc.), the endonuclease and guide RNA can be delivered (introduced into the cell) as an RNP complex (i.e., a pre- assembled complex of the CRISPR/Cas endonuclease and the corresponding CRISPR/Cas guide RNA). Thus, a class 2 CRISPR/Cas endonuclease can be introduced into a cell as a protein. In some cases, a class 2 CRISPR/Cas endonuclease can be introduced into a cell as a nucleic acid (DNA and/or RNA) encoding the endonuclease. A CRISPR/Cas guide RNA can be introduced into a cell as RNA, or as DNA encoding the guide RNA. In cases where the genetically modified cell includes a nucleic acid encoding the CRISPR/Cas endonuclease, e.g., under the control of an inducible promoter, the method may include inducing expression of the CRISPR/Cas endonuclease.

[00217] In applications in which it is desirable to insert a polynucleotide sequence into the

genome where a target sequence is cleaved, a donor polynucleotide (a nucleic acid comprising a donor sequence) can also be provided to the cell. By a "donor sequence" or "donor

polynucleotide" it is meant a nucleic acid sequence to be inserted at the site cleaved by the CRISPR/Cas protein. The donor polynucleotide can contain sufficient homology to a genomic sequence at the target site, e.g. 70%, 80%, 85%, 90%, 95%, or 100% homology with the nucleotide sequences flanking the target site, e.g. within about 50 bases or less of the target site, e.g. within about 30 bases, within about 15 bases, within about 10 bases, within about 5 bases, or immediately flanking the target site, to support homology-directed repair between it and the genomic sequence to which it bears homology. Approximately 25, 50, 100, or 200 nucleotides, or more than 200 nucleotides, of sequence homology between a donor and a genomic sequence (or any integral value between 10 and 200 nucleotides, or more) can support homology-directed repair. Donor polynucleotides can be of any length, e.g. 10 nucleotides or more, 50 nucleotides or more, 100 nucleotides or more, 250 nucleotides or more, 500 nucleotides or more, 1000 nucleotides or more, 5000 nucleotides or more, etc.

ISOLATED ORGAN OR FOOD PRODUCT FROM GENETICALLY MODIFIED BIRD

[00218] The present disclosure relates to a genetically modified bird, wherein the genetically modified bird is genetically modified to comprise a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; wherein the disruption results in a fatty liver. The present disclosure also provides an organ (e.g., an isolated organ) obtained from a genetically modified bird of the present disclosure. In some cases, the isolated organ from the genetically modified bird is a liver. In some cases, the isolated organ from the genetically modified bird is a fatty liver. In some cases, the organ isolated from a genetically modified bird of the present disclosure is not an embryo. The present disclosure also provides a food product (e.g., an unprocessed food product; where examples of such unprocessed food products are meat and eggs) obtained from a genetically modified bird of the present disclosure.

[00219] The major location of lipogenesis in birds is the liver (Leveille et al., (1975) Lipid

biosynthesis in the chick. A consideration of site of synthesis, influence of diet and possible regulatory mechanism. Poultry Science 54: 1075-1093). In some cases, an organ of the present disclosure has greater than 30 weight percent fat. In some cases, the organ has greater than 40 weight percent fat. In some cases, the organ has greater than 50 weight percent fat. In some cases, the organ is 5 to 7 times the size of an organ from a naturally produced bird (i.e., a bird that is not genetically modified).

[00220] The present disclosure provides a method of producing a food product, the method

comprising a) harvesting an organ from a genetically modified bird of the present disclosure; and processing the organ, to produce a food product. In some cases, the food product is foie gras. A method of harvesting and processing the organ of a bird is well known to those skilled in the art, for example, in Brun et al., ((2015) BMC Genet , 16: 145).

[00221] Foie gras is a food product made of the liver of a duck or goose that has been fattened by force feeding. See, e.g., Skippon et al, (2013) Can Vet J. ; 54(4):403-404.

[00222] The present disclosure provides a method of producing a fatty liver in a genetically

modified bird of the present disclosure. In some cases, the genetically modified bird is not force fed in order to produce foie gras. In some cases, the genetically modified bird is fed a special diet that, along with the genetic modification, gives rise to a fatty liver.

[00223] In some cases, the genetically modified bird is force-fed in order to produce foie gras. In some cases, the genetically modified bird is force-fed for a shorter period of time than generally required to produce foie gras. (Skippon et al., (2013) Can Vet J. ; 54(4):403-404; Guemene et al., (2004) World's Poultry Science Journal.; 60:211-222) In some cases, the genetically modified bird is force -fed less than 2-3 times a day. In some cases, the genetically modified bird is force- fed for less than 2-4 weeks. In some cases, the genetically modified bird is force -fed less than 2- 3 times a day for less than 2-4 weeks. [00224] In certain embodiments of the present disclosure relating to a method of producing a fatty liver, the genetically modified bird is fed a methionine and choline deficient diet (MCD), a choline deficient diet (CD), a high-fat containing diet (HFD), or a conjugated linoleic acid containing (CLA) diet during at least one of a plurality of growth periods. In some cases, the liver of the genetically modified bird that is fed a MCD, CD, a HFD, or a CLA containing diet is harvested. In such cases, the genetically modified bird is force -fed a MCD, CD, HFD, or a CLA diet less than 2-3 times a day for less than 2-4 weeks. (American Veterinary Medical Association (2014) Foie Gras Production: 1-4)

Conjugated linoleic acid (CLA) diet

[00225] In some cases, a method for producing a fatty liver comprises feeding a CLA containing diet to a genetically modified bird of the present disclosure during at least one of a plurality of growth periods; and harvesting the liver from the genetically modified bird.

[00226] In some embodiments, a genetically modified bird of the present disclosure produces a fatty liver by feeding a CLA containing diet to the genetically modified bird. Examples of the CLA containing diet can be found in US Patent Application No. 20060182785, which is hereby incorporated by reference in its entirety.

[00227] One embodiment provides a method for producing a fatty liver includes producing

poultry with CLA enhanced nutritional properties including preparing a CLA containing diet, selecting a poultry species, feeding the CLA containing diet to the genetically modified bird and harvesting at least one of a plurality of CLA enhanced poultry products.

[00228] Feeding the CLA containing diet to a genetically modified bird of the present disclosure can include feeding the CLA containing diet to the selected poultry species during one or more periods within the life of that animal. The life periods can include a starter period, a grower period, a breeding period and a mature period. The CLA containing diet can include a CLA isomer mixture. The CLA containing diet can include a CLA isomer mixture in addition to a typical diet The CLA containing diet can include a CLA isomer mixture that replaces at least a portion of a typical diet The specific isomer content of the CLA isomer mixture can include about 25% to about 50% cis-9, trans-11 CLA and about 25% to about 100% trans-10, cis-12 CLA. The CLA containing diet can include between about 45 and about 65% carbohydrate, between about 10 and about 25% protein and between about 3 and about 10% fat, wherein the fat includes about 25% to about 100% of the CLA isomer mixture.

[00229] The CLA enhanced poultry products can include a fatty liver, a CLA enhanced meat product, and a CLA enhanced egg. Foie gras can be produced using the fatty liver. [00230] In some cases, a genetically modified bird of the present disclosure is selected and the

CLA containing diet is fed to the genetically modified bird during at least one period in the life of the animal. One or more CLA enhanced poultry products can be harvested.

Methionine and choline deficient (MCD) diet

[00231] A diet deficient in both methionine and choline is widely used to induce fatty liver in rodents and typically contains about 20% fat by energy (Fatty_Liver_Disease_2012, Ricci et al., 2012). Examples of methionine and choline deficient diets tested in animals to induce and study non-alcoholic fatty liver disease can be found in US Patent Nos 9061009, 7883904, 8003620, which are all hereby incorporated by reference in their entirety.

[00232] In some cases, a genetically modified bird of the present disclosure produces a fatty liver by feeding a MCD diet to the genetically modified bird. In some cases, a method for producing a fatty liver comprises feeding a MCD diet to the genetically modified bird during at least one of a plurality of growth periods; and harvesting the liver from the genetically modified bird.

Choline deficient (CD) diet

[00233] A choline defieicnet (CD) diet is commonly used to induce fatty livers in rodents.

Choline is required for the metabolism of fat, and therefore, choline deficient diets are used to develop fatty livers. Examples of CD diet tested in animals to induce and study non-alcoholic fatty liver disease or steatosis can be found in US Patent No. 7,314,720, which is hereby incorporated by reference in its entirety.

[00234] In some cases, a genetically modified bird of the present disclosure produces a fatty liver by feeding a CD diet to the genetically modified bird. In some cases, a method for producing a fatty liver comprises feeding a CD diet to the genetically modified bird during at least one of a plurality of growth periods; and harvesting the liver from the genetically modified bird.

High-fat containing diet (HFD)

[00235] A high-fat containing diet (HFD) is commonly used to induce fatty liver in rodents. A high -fat diet has been shown to increase liver fat within days (Ricci et al., 2012, Fatty Liver Disease 2012) Examples of high-fat containing diet tested in animals to induce and study nonalcoholic fatty liver disease or steatosis can be found in US Patent Nos. 9061009, which is hereby incorporated by reference in its entirety.

[00236] In some cases, a genetically modified bird produces of the present disclosure a fatty liver by feeding a HFD to the genetically modified bird. In some cases, a method for producing a fatty liver comprises feeding a HFD to the genetically modified bird during at least one of a plurality of growth periods; and harvesting the liver from the genetically modified bird. UTILITY

[00237] The present disclosure provides a genetically modified bird that has been modified to include a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage, wherein the disruption results in a fatty liver. The bird comprising genetically modified germ cells or genetically modified spermatozoa of the disclosure, and the genetically modified bird according to the present disclosure, may be used in the production of food. Thus, the methods of the present disclosure can be applicable to the production of poultry products for human and animal consumption. Methods of the disclosure are also applicable to the production of luxury food products such as foie gras. Methods of producing food from poultry are well known in the art and may comprise the harvesting of meat and/or eggs from poultry such as, but not limited to, duck or geese. See, e.g., US Patent Application No. 14394712.

[00238] The genetically modified birds find use in a variety of applications, including, but not limited to, food production, research, and the like. For example, the genetically modified birds find use in producing food products that are high in fatty acid than those produced naturally. The genetically modified birds find use in research, the study the effects of non-alcoholic fatty liver disease.

Food applications

[00239] The present disclosure provides methods for producing food products from a genetically modified bird of the present disclosure, and food products harvested from a genetically modified bird. The methods generally involve harvesting a food product from a subject genetically modified bird. Where the food product requires further processing, the methods involve harvesting a food product from a genetically modified bird, and processing the food product. Thus, the disclosure provides a method of producing a processed food product, involving processing a food product harvested from a genetically modified bird. The disclosure further provides a processed food product obtained by processing a food product harvested from a genetically modified bird.

[00240] Methods of harvesting food products from a subject genetically modified bird are well known to those in the agricultural and food production industries. Where a subject genetically modified bird produces a fatty liver, the liver is harvested by standard abattoir methods. Where the subject transgenic animal is a transgenic poultry, and the food product is an egg, the eggs are harvested in the usual manner. Methods of processing a food product harvested from a subject genetically modified bird are standard in the food processing art and are well known to those in the field. Where the subject transgenic animal is a transgenic poultry, and the food product is meat, the meat is harvested in the usual manner. [00241] The present disclosure further provides food products produced by a subject genetically modified bird, and processed food products made with such food products. A subject food product includes a food product that contains a meat, egg, or other product of a subject genetically modified bird. A subject food product includes an organ, or a processed product of an organ, of a subject genetically modified bird. Food products include any preparation for human consumption including for enteral or parenteral consumption, which when taken into the body (a) serve to nourish or build up tissues or supply energy and/or (b) maintain, restore or support adequate nutritional status or metabolic function.

[00242] Food products produced from an organ obtained from a subject genetically modified bird can include foie gras. The present disclosure provides production of foie gras by isolating and processing the fatty liver of the genetically modified bird with minimal or no need for force- feeding.

Research applications

[00243] The present disclosure further provides a method for making a genetically modified bird, where the genetically modified bird can be used as models for studying non-alcoholic fatty liver disease or hepatic steatosis. The subject genetically modified birds find use in research, to study fatty acid synthesis and regulation, fatty acid storage, and appetite control. Thus, the disclosure provides a method to study such conditions associated with non-alcoholic fatty liver disease and hepatic steatosis such as: obesity, insulin resistance, and type 2 diabetes. The method for making a genetically modified bird can also be used to generate a wide range of genetically modified birds, including models for studying avian influenza.

[00244] The present disclose further provides use of a genetically modified bird of the present disclosure for research applications. For example, the present disclosure provides a method of determining the effect of a test agent on one or more of: i) fatty acid synthesis; ii) fatty acid regulation; iii) fatty acid storage; and iv) appetite control, the method comprising: a)

administering to a genetically modified bird of the present disclosure a test agent; and b) determining the effect of the test agent on one or more of i) fatty acid synthesis; ii) fatty acid regulation; iii) fatty acid storage; and iv) appetite control.

Examples of Non-Limiting Aspects of the Disclosure

[00245] Aspects, including embodiments, of the present subject matter described above may be beneficial alone or in combination, with one or more other aspects or embodiments. Without limiting the foregoing description, certain non-limiting aspects of the disclosure numbered 1-35 are provided below. As will be apparent to those of skill in the art upon reading this disclosure, each of the individually numbered aspects may be used or combined with any of the preceding or following individually numbered aspects. This is intended to provide support for all such combinations of aspects and is not limited to combinations of aspects explicitly provided below:

[00246] Aspect 1. A genetically modified bird, wherein the genetically modified bird is

genetically modified to comprise a disruption in one or more target genes, wherein the one or more target genes is a: a) fatty acid metabolism pathway gene; b) gene that controls appetite; or c) gene that regulates fatty acid storage, wherein the disruption results in development of a fatty liver.

[00247] Aspect 2. The genetically modified bird of aspect 1 , wherein the bird is a duck.

[00248] Aspect 3. The genetically modified bird of aspect 1, wherein the bird is a goose.

[00249] Aspect 4. The genetically modified bird of aspect 1 , wherein the bird is a chicken.

[00250] Aspect 5. The genetically modified bird of any one of aspects 1-4, wherein the genetic modification is present in multiple organs.

[00251] Aspect 6. The genetically modified bird of any one of aspects 1-4, wherein the genetic modification is liver specific.

[00252] Aspect 7. The genetically modified bird of any one of aspects 1-6, wherein the one or more target genes comprises a nucleotide sequence having least 80% nucleotide sequence identity to the nucleotide sequence of a gene selected from: MATIA (SEQ ID NO:51), ACOXl (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).

[00253] Aspect 8. The genetically modified bird of any one of aspects 1-6, wherein the one or more target genes comprises a nucleotide sequence having least 90% nucleotide sequence identity to the nucleotide sequence of a gene selected from: MATIA (SEQ ID NO:51), ACOXl (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), APOIA (SEQ ID NO:56), SIRT1 (SEQ ID NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6 (SEQ ID NO:61), and PTEN (SEQ ID NO:62).

[00254] Aspect 9. An organ or food product isolated from the genetically modified bird of any one of aspects 1-8.

[00255] Aspect 10. The organ or food product of aspect 9, wherein the organ is a liver; or

wherein the food product is meat or an egg.

[00256] Aspect 11. The organ or food product of aspect 10, wherein the organ has greater than

50% weight percent fat, greater than 40% weight percent fat, or greater than 30% weight percent fat. [00257] Aspect 12. A food product (e.g., a processed food product) produced from the isolated organ or food product of any one of aspects 9-11.

[00258] Aspect 13. The processed food product of aspect 12, wherein the product is foie gras.

[00259] Aspect 14. A method of producing a food product (e.g., a processed food product), the method comprising: a) harvesting an organ or food product from the genetically modified bird of any one of aspects 1-8; and b) processing the organ or food product, to produce a processed food product.

[00260] Aspect 15. The method of aspect 14, wherein the processed food product is foie gras.

[00261] Aspect 16. A method for producing a fatty liver, the method comprising: a) feeding a methionine and choline deficient (MCD) diet, a choline -deficient diet (CD), a high-fat containing diet (HFD), or a conjugated linoleic acid (CLA) containing diet to the genetically modified bird of any one of aspects 1-8 during at least one of a plurality of growth periods; and b) harvesting the liver from the genetically modified bird.

[00262] Aspect 17. A method for producing foie gras, the method comprising: a) feeding a

methionine and choline deficient (MCD) diet, a choline -deficient diet (CD), a high-fat containing diet (HFD), or a conjugated linoleic acid (CLA) containing diet to the genetically modified bird of any one of aspects 1-8 during at least one of a plurality of growth periods; b) harvesting the liver from the genetically modified bird; and c) preparing foie gras from the harvested liver.

[00263] Aspect 18. A system for generating a genetically modified bird, the composition

comprising: a) a first CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the first CRISPR/Cas guide RNA, wherein the first CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a first target sequence present in a target gene, wherein the target gene is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and b) a second CRISPR/Cas guide RNA, or a nucleic acid comprising a nucleotide sequence encoding the second CRISPR/Cas guide RNA, wherein the second CRISPR/Cas guide RNA comprises a guide sequence having 100% complementarity over 17 or more contiguous nucleotides with a second target sequence in the target gene, wherein the second target sequence is 3' of the first target sequence.

[00264] Aspect 19. The system of aspect 18, wherein the first target sequence and the second target sequence are separated from each other by at least 25 base pairs.

[00265] Aspect 20. The system of aspect 18, wherein the target gene comprises a nucleotide sequence having least 80% nucleotide sequence identity to the nucleotide sequence of a gene selected from: MAT1A (SEQ ID NO:51), ACOX1 (SEQ ID NO:52), LEPR (SEQ ID NO:53), LEP (SEQ ID NO:54), SIRT7 (SEQ ID NO:55), AP01A (SEQ ID NO:56), SIRT1 (SEQ ID

NO:57), SIRT3 (SEQ ID NO:58), SIRT4 (SEQ ID NO:59), SIRT5 (SEQ ID NO:60), SIRT6

(SEQ ID NO:61), and PTEN (SEQ ID NO:62).

[00266] Aspect 21. The system of aspect 18, wherein the composition further comprises a class 2

CRISPR/Cas endonuclease, or a nucleic acid comprising a nucleotide sequence encoding the class 2 CRISPR/Cas endonuclease.

[00267] Aspect 22. The system of aspect 21, wherein the class 2 CRISPR/Cas endonuclease is a

Cas9 protein.

[00268] Aspect 23. The system of aspect 22, wherein the class 2 CRISPR /Cas endonuclease is a type V or type VI CRISPR/Cas endonuclease.

[00269] Aspect 24. The system of aspect 22, wherein the class 2 CRISPR/Cas endonuclease is a

Cpfl protein, a C2cl protein, a C2c3 protein, or a C2c2 protein.

[00270] Aspect 25. The system of aspect 18, wherein the first and second CRISPR/Cas guide

RNAs are Cas9 CRISPR/Cas guide RNAs.

[00271] Aspect 26. The system of aspect 18, wherein the first and second CRISPR/Cas guide

RNAs are single molecule CRISPR/Cas guide RNAs.

[00272] Aspect 27. The system of aspect 18, wherein the first and second CRISPR/Cas guide

RNAs are dual molecule CRISPR/Cas guide RNAs.

[00273] Aspect 28. A method of making the genetically modified bird of any one of aspects 1-8, the method comprising: a) genetically modifying: i. a bird stage X primordial germ cell; wherein genetic modification of bird stage X primordial germ cell comprise a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; b) delivering the genetically modified bird stage X primordial germ cell into a recipient embryo; and c) allowing the recipient embryo to hatch as a chick.

[00274] Aspect 29. A method of making the genetically modified bird of any one of aspects 1-8, the method comprising: a) delivering a CRISPR/Cas plasmid construct into a recipient stage X embryo, wherein delivery of the CRISPR/Cas plasmid construct causes a disruption in one or more target genes of a stage X primordial germ cell in the stage X embryo, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; and b) allowing the recipient embryo to hatch as a chick.

[00275] Aspect 30. A method of making the genetically modified bird of any one of aspects 1-8, the method comprising: a) genetically modifying an avian spermatozoa, wherein the genetic modification of the avian spermatozoa comprises a disruption in one or more target genes, wherein the one or more target genes is a fatty acid metabolism pathway gene, a gene that controls appetite, or a gene that regulates fatty acid storage; b) delivering the genetically modified bird spermatozoa to a hen; c) creating a artificial embryo; and d) allowing the artificial embryo to hatch as a chick.

[00276] Aspect 31. The method of any one of aspects 28-30, wherein said genetic modification is achieved using a Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CAS system.

[00277] Aspect 32. The method of any one of aspects 28-30, wherein said genetic modification is achieved using a Transcription activator-like effector nucleases (TALENs).

[00278] Aspect 33. The method of any one of aspects 28-30, wherein said genetic modification is achieved using a Zinc Finger Nucleases (ZFNs) system.

[00279] Aspect 34. The method of aspect 28, wherein the stage X primordial germ cell line is delivered into the recipient embryo by injection.

[00280] Aspect 35. The method of aspect 30, wherein the avian spermatozoa is delivered into a hen by artificial insemination.

EXAMPLES

[00281] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric. Standard abbreviations may be used, e.g., bp, base pair(s); kb, kilobase(s); pi, picoliter(s); s or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino acid(s); kb, kilobase(s); bp, base pair(s); nt, nucleotide(s); i.m., intramuscular(ly); i.p., intraperitoneal(ly); s.c, subcutaneous(ly); and the like.

Example 1 : Delivery of CRISPR/Cas9 guide RNA complexes to chicken cell lines

[00282] Synthesis of Cas9 RNPs. Cas9 ribonucleoprotein (RNP) component synthesis and

assembly was carried out based on published work (Lin et al. (2014) Elife 3, e04766; Dewitt et al. (2016) Science Translational Medicine 12, 360RA134). Cas9 was prepared by the UC Berkeley Macro Lab using a published protocol (Lin et al. (2014) supra). Cas9 was stored and diluted in sterile-filtered Cas9 Buffer (20 mM HEPES pH 7.5, 150 mM KC1, 1 mM MgCl ₂ , 10% glycerol, 1 mM TCEP). sgRNA was synthesized by assembly polymerase chain reaction (PCR) and in vitro transcription. A T7 RNA polymerase substrate template was assembled by PCR from a variable 58 nt primer, or a 59 nt primer with an additional guanine at the 5' end, containing T7 promoter, variable sgRNA guide sequence, and the first 15 nt of the non-variable region of the sgRNA (T7FwdVar primers, 10 nM) (Table 4, presented in FIG. 33A), and an 82 nt primer containing the reverse complement of the invariant region of the sgRNA (T7RevLong, 10 nM), along with amplification primers (T7FwdAmp, T7RevAmp, 200 nM each) (Table 6, presented in FIG. 33C). These primers anneal in the first cycle of PCR and are amplified in subsequent cycles. Phusion high-fidelity DNA polymerase was used for assembly (New England Biolabs, Inc.). The thermocycling protocol was: 95 °C, 30 seconds (30"); 35 cycles of 95 °C, 10", 57 °C, 10", 72 °C, 10"; with a final extension time of 2 minutes (2'). Assembled template was used without purification as a substrate for in vitro transcription by T7 RNA polymerase using the HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, Inc.). Resulting transcriptions reactions were treated with DNAse I (New England Biolabs, Inc.), and RNA was purified by treatment with a 5X volume of homemade solid phase reversible immobilization (SPRI) beads (comparable to Beckman-Coulter AMPure beads) and elution in DEPC -treated water. sgRNA concentrations were determined by fluorescence using the Qubit RNA BR assay kit (Life Technologies, Inc). Cas9 RNP was assembled immediately before electroporation of target cells as follows: 120 pmol of sgRNA was diluted to a final volume of 7.5 μΕ in Cas9 Buffer. 2.5 μΕ of a 40 uM stock of Cas9-NLS was slowly added to the sgRNA while gently mixing. The mixture was incubated at room temperature for 10-20 minutes to allow for RNP assembly.

[00283] Culture of the LMH chicken hepatocellular carcinoma cell line. LMH cells were

obtained from ATCC. LMH cells were grown on gelatin-coated tissue culture plates in

Waymouth's Medium (Thermo Fisher Scientific) supplemented with 10% fetal calf serum, penicillin, and streptomycin.

[00284] Electroporation of LMH cells with Cas9 RNP. LMH cells were lifted from tissue culture plates with trypsin, followed by centrifugation at 100 xg for 10 minutes. For each

electroporation, 200,000 cells were resuspende of Nucleofection buffer SF (Lonza). 10 μΕ of assembled Cas9 RNP was mixed with 20 s in solution and transferred to an electroporation cuvette. Cells were electroporated with a Lonza 4D nucleofection device using program code CA-199 or CB-150. Control cells were electroporated under the same conditions with Cas9 without sgRNA. Following electroporation, the cells were incubated at room temperature for 10 minutes. Electroporated cells were then transferred to the wells of a gelatin- coated 24-well tissue culture plate containing 1 mL of fresh medium. [00285] Analysis of gene editing efficiency. 3-4 days post-electroporation, genomic DNA was harvested with QuickExtract DNA Extraction Solution (Epicenter, Inc.) according to the manufacturer' s protocol. The edited loci were amplified by PCR using primers listed in Tables 4-6, presented in FIG. 33A-33C, respectively. The PCR primers contain 5' "stubs" to allow for subsequent amplification for sequencing library preparation (see below). PCR product sizes were verified by agarose gel electrophoresis, and PCR products were purified by treatment with a 5X volume of homemade solid phase reversible immobilization (SPRI) beads (comparable to Beckman-Coulter AMPure beads) and elution in DEPC-treated water. PCR product

concentrations were determined by fluorescence using the Qubit dsDNA HS assay kit (Life Technologies, Inc). A second round of PCR amplification was performed to amplify on Illumina sequencing adapters and indexes. PCR product sizes were verified by agarose gel

electrophoresis, and PCR products were purified by treatment with a 0.8X volume of Beckman- Coulter AMPure beads and elution in DEPC-treated water. PCR product concentrations were determined by fluorescence using the Qubit dsDNA HS assay kit (Life Technologies, Inc). Samples were pooled and sequenced on the Illumina MiSeq with 2x250 paired-end reads.

[00286] Sequencing reads were de -multiplexed. The sequence reads for each sample were

aligned against the genomic reference sequence of the edited loci to identify insertions and deletions (in-dels) at the Cas9 cut site. The fraction of edited alleles for each sample was calculated as (# of indel reads)/(# of indel reads + # of unedited reads).

RESULTS

[00287] To test the ability to edit target genes in birds, CRISPR/Cas9 single guide RNA

complexes were delivered to chicken liver cells. Genomic DNA from the chicken liver cells was harvested 3-4 days following delivery of CRISPR/Cas9 single guide RNAs. Frequency of insertion and deletions (INDELs) were measured using Illumina sequencing.

[00288] FIGs. 27-32 provide the percentage of indels for target genes MAT1A, ACOX1, SIRT7,

LEPR, and LEP following delivery of different single guide RNAs per target gene (FIG. 26).

[00289] The CRISPR/Cas9 single guide RNA complexes were delivered using electroporation protocols (as described above) for each of the 4 single guide RNA complexes. The

electroporation protocol was used for delivery of CRISPR/Cas9 single guide RNAs 1-4 for each target gene corresponding to SEQ ID NOs 87-90, 91-94, 95-98, 99-102, and 103-106. Gene editing rates (% INDELs) for the electroporation protocol using program code CA-199 or CB- 150, which varied in time and voltage of electroporation, worked similarly, thus, editing results of the different electroporation protocols for each CRISPR/Cas9 single guide RNA complex were averaged (n=2), as shown in FIGs. 27-32. [00290] Results show that delivery of CRISPR/Cas9 guide RNAs in chicken cell lines can be expressed and localized to the nucleus of chicken cells to edit the target genes MATIA, ACOXl, SIRT7, LEPR, and LEP.

[00291] FIG. 27 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as "% edited", of the target gene MATIA for each of the CRISPR/Cas9 single guide RNAs 1-4. The CRISPR/Cas9 single guide RNA #2 showed the greatest percentage of INDELs (13.06%), followed by single guide RNA #1 (10.17%), single guide RNA #3 (7.54%), and single guide RNA 4 (3.23%).

[00292] FIG. 28 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as "% edited", of the target gene ACOXl at exon 8 for each of the CRISPR/Cas9 single guide RNAs 1-2. The CRISPR/Cas9 single guide RNA #2 showed the greatest percentage of INDELs (11.28%), followed by single guide RNA #1 (9.18%).

[00293] FIG. 29 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as "% edited", of the target gene ACOXl at exon 9 for each of the CRISPR/Cas9 single guide RNAs 3-4. The CRISPR/Cas9 single guide RNA #3 showed the greatest percentage of INDELs (5.08%), followed by single guide RNA #4 (0.20%).

[00294] FIG. 30 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as "% edited", of the target gene SIRT7 for each of the CRISPR/Cas9 single guide RNAs 1-4. The CRISPR/Cas9 single guide RNA #1 showed the greatest percentage of INDELs (18.63%), followed by single guide RNA #2 (11.87%), and single guide RNA #3 (0.01%).

Single guide RNA #4 did not result in any indels in the SIRT7 gene.

[00295] FIG. 31 provides a plot showing the percentage of INDELs (i.e. insertions or deletions), denoted as "% edited", of the target gene LEPR for each of the CRISPR/Cas9 single guide RNAs 1-4. The CRISPR/Cas9 single guide RNA #1 showed the greatest percentage of INDELs (43.61%), followed by single guide RNA #2 (41.70%), single guide RNA #4 (16.61%), and single guide RNA #3 (4.99%).

[00296] FIG. 32 provides a plot showing t the percentage of INDELs (i.e. insertions or

deletions), denoted as "% edited", of the target gene LEP for each of the CRISPR/Cas9 single guide RNAs 1-4. The CRISPR/Cas9 single guide RNA #4 showed the greatest percentage of INDELs (9.97%), followed by single guide RNA #2 (5.95%), single guide RNA #1 (2.54%), and single guide RNA #3 (1.10%).

[00297] While the present invention has been described with reference to the specific

embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto.