RELATED APPLICATIONS

[0001] This application claims priority from U.S. Provisional Application Serial No. 62/065,602, filed on October 17, 2014, the entire disclosure of which is incorporated herein by this reference.

TECHNICAL FIELD

[0002] The presently-disclosed subject matter relates to genomic probes. In particular, the presently-disclosed subject matter relates to probes that comprise a Cas polypeptide complexed with a gRNA specific for a target nucleic acid sequences, including genomic DNA sequences.

INTRODUCTION

[0003] Probes for nucleic acid sequences are used for a variety of purposes. Such probes can be used to identify whether a specific sequence is found on a DNA or RNA sample and to identify the copy numbers of the specific sequence. The specific sequences may be sequences associated with the likelihood of developing certain diseases or conditions, sequences associated with the stage of certain diseases or conditions, sequences from infecting viruses, bacteria and other infection organisms, sequences that encode for certain genes, repetitive sequences, and the like. Such probes can be used to detect the relative location of multiple sequences, for instance, the genetic translocations that are frequently detected in various cancers. Probing the DNA of a cell can therefore provide valuable information that can be used for prognostic, diagnostic, medical, and species identification purposes.

[0004] The type II clustered regularly interspaced short palindromic repeats (CRISPR)- CRISPR-associated caspase 9 (Cas9) system derived from Streptococcus pyogenes has become a revolutionary tool for targeted genome editing, and its nuclease-deficient derivatives (dCas9) also are used for control of gene expression and visualization of genomic loci in live cells through fusion with a transcription-regulation domain or a fluorescent protein, respectively. Inherent multiplexing features offered by the CRISPR system hold great promise for applications in high-throughput assays. By programming the gRNA sequences, Cas9 protein can be directed to any target DNA sequence of interest. However, using genetically coded Cas9 protein and gRNA for imaging genomic DNA in live cell is still greatly limited because of the lack of efficient transduction of tens to hundreds of gRNAs in one cell, and because that assembly of Cas9 and gRNA in live cells are dependent on random collision, and because that one type of Cas protein can only be labeled with one color for imaging one group of target DNA sequence. Moreover, genetically coded expression of Cas 9 and gRNA requires delivery of genetic material to cultured live cells, which is not generally applicable to primary cells and tissues.

[0005] Fluorescent in situ hybridization (FISH) is currently used to identify specific DNA or RNA sequences in fixed cells and tissues. FISH typically uses a formamide chemistry and heat treatment for DNA denaturation. FISH includes steps for sample denaturation, hybridization, and post-hybridization washes, which require takes hours to days. (Lawrence JB, Villnave CA, Singer RH. Cell. 1988 Jan 15;52(1):51-61. PMID: 2830981 ; Lawrence JB, Singer RH. Nucleic Acids Res. 1985 Mar l l ; 13(5): 1777-99. PMID: 3889842; Cremer T. Landegent J. Brueckner A, Scholl HP, Schardin M, Hager HD, Devilee P. Pearson P. van der Ploeg M. (1986), "Detection of chromosome aberrations in the human interphase nucleus by visualization of specific target DNAs with radioactive and non-radioactive in situ

hybridization techniques: diagnosis of trisomy 18 with probe L .84," Hum. Genet 74:346- 352; Pinkel D, Straume T. Gray JW. (1986) "Cytogenetic analysis using quantitative, high- sensitivity, fluorescence hybridization," Proc Natl Acad Sci USA 83 :2934-2938).

[0006] Despite continuous improvements, DNA FISH requires harsh treatments such as heat and formamide to denature dsDNA to allow probe hybridization, thus running the risk of affecting the integrity of the biological structure and genome organization. In cells, genomic DNA is highly folded and organized in three dimensions. The spatial organization of chromatin in the nucleus and the relative positions of distinct chromatin regions are tightly associated with gene regulation in normal development and disease. While it can be beneficial to study interphase genomic organization with DNA that is in its native state, the study of organization of chromatin is not possible with FISH methods that denature the native chromosomes.

[0007] DNA FISH also is limited in detection resolution with BAC probes and by the high cost of oligo probes. Current FISH protocols require denaturation of samples and fluorescent labeling of all individual DNA probes, which adds to the complexity and cost of current FISH imaging methods. The lengthy procedure of DNA FISH also hinders its wide use in research and clinics.

[0008] Hence, there remains a need for compositions and methods for imaging nucleic acid sequences, including DNA, that do not require denaturation of a sample, including compositions and methods for imaging genomic DNA in its native state. There also remains a need for imaging probes and methods that can operate rapidly and do not require lengthy and harsh treatment of a sample.

SUMMARY

[0034] The presently-disclosed subject matter meets some or all of the above- identified needs, as will become evident to those of ordinary skill in the art after a study of information provided in this document.

[0035] This Summary describes several embodiments of the presently-disclosed subject matter, and in many cases lists variations and permutations of these embodiments. This Summary is merely exemplary of the numerous and varied embodiments. Mention of one or more representative features of a given embodiment is likewise exemplary. Such an embodiment can typically exist with or without the feature(s) mentioned; likewise, those features can be applied to other embodiments of the presently-disclosed subject matter, whether listed in this Summary or not. To avoid excessive repetition, this Summary does not list or suggest all possible combinations of such features.

[0036] Provided herein is a technology for the detection of nucleic acid sequences within undisturbed nuclei of fixed cells and tissues. The detection targets can be DNA, RNA, and other nucleic acid analogues or modified nucleic acid. In one exemplary embodiment, a protein from bacterial CRISPR (clustered regularly interspaced short palindromic repeats) system, is combined with an RNA sequence as probes to find the genes of interest in the intact genome. This approach preserves the spatial relationships of the genetic elements, which are important for understanding gene expression and detecting genetic translocations; moreover, the process is remarkably rapid (15 min), convenient, and can be used directly on tissues for diagnosis of disease.

[0037] The presently disclosed subject matter includes a probe. The probe includes a Cas (CRISPR associated caspase) polypeptide, or fragments and/or variants of a Cas polypeptide, a guide RNA (gRNA) specific for a predetermined nucleic acid sequence that is conjugated to the Cas polypeptide; and a label that is bound to the Cas polypeptide, the gRNA, or both.

[0038] In some embodiments, the Cas polypeptide is bound or fused to the label. The label in some instances can be fluorescent proteins, fluorescent labels, dyes, quantum dots, gold particles, radioactive labels, chemiluminescent enzymes, or enzymes that modify a substrate to make it visible by microscopy, or other analytes for microscopy or other detection methods.

[0039] The Cas polypeptide in some preferred embodiments includes a Cas9 polypeptide, or a fragment or variant of a Cas9 polypeptide. In some embodiments, the Cas9 polypeptide includes a nuclease-deficient dmCas9 polypeptide, fragment, and/or variant. When the Cas9 polypeptide is a dmCas9 polypeptide, in some embodiments, the dmCas9 polypeptide is encoded by a nucleotide sequence of SEQ ID NO: 1 or the dmCas9 polypeptide has a sequence of SEQ ID NO: 2. The Cas polypeptide in some embodiments include other CRISPR associated proteins in CRISPR I, II, II systems, as will be recognized by one of ordinary skill in the art.

[0040] In some instances, the probe includes no nuclease activity. In other instances, the probe can include little nuclease activity, diminished nuclease activity, or full, wild type nuclease activity.

[0041] In some embodiments, the polypeptide includes a nuclear localization signal (NLS). A NLS can assist the polypeptide in being incorporated by the nucleus of a cell. One example of a polypeptide that includes a NLS is encoded by a nucleotide sequence of SEQ ID NO: 3, or the polypeptide has a sequence of SEQ ID NO: 4.

[0042] In some embodiments, the gRNA is bound or fused to the label. The label in some instances can be fluorescent labels, dyes, quantum dots, gold particles, radioactive labels, RNA aptamers that can be directly or indirectly labeled, enzymes or other analytes for microscopy or other detection methods.

[0043] In some embodiments, the probe includes a gRNA that contains a constant backbone sequence and a variable sequence that is specific for a predetermined nucleic acid that is DNA or RNA. The gRNA typically comprises a target section, wherein the target section has full or partial complementarity to the predetermined nucleic acid sequence. In some embodiments, the target section of the gRNA is about 15 to about 25 nucleotides in length.

[0044] The backbone sequence of gRNA contains a hairpin structure for interacting with Cas protein. In some instances, the length and nucleic acid composition of the gRNA backbone can be modified to have longer or shorter, more dynamic or more stable hairpin structure. In other instances, gRNA can be modified for other specific properties.

[0045] In some instances, the gRNA can be substituted by two or more RNA molecules that can form interactions and remain functional in binding to Cas protein and hybridizing to a nuclei acid substrate.

[0046] In some embodiments, detection of target nucleic acid is from the labels on the Cas protein or gRNA. In some instances, a secondary reaction that relies on the binding or nuclease activity of Cas/gRNA complex on DNA can generate signal for detection.

[0047] Also disclosed herein are methods for imaging nucleic acids, including a first step of providing a sample that includes a nucleic acid; a second step of contacting the sample with a probe of any of the embodiments disclosed herein, and a subsequent step of detecting whether the probe binds the nucleic acid. The binding of the probe to the nucleic acid indicates the presence of a predetermined nucleic acid sequence in the nucleic acid sample.

[0048] In some instances, the sample is selected from chromosome spreads for genetic testing, cultures, prenatal materials, samples for in vitro fertilization, swabs, air filters, water cooling towers, food, drink, hair, stool, urine, saliva, blood, lymph, sputum, cervical smears, sperm, sections of tissues from biopsies, sections of tissues from autopsies, and combinations thereof. Any source of genetic material is contemplated for use in the presently disclosed subject matter. Human, animal, plant, bacteria, fungi and other microorganisms are some examples of sources of genetic material. The samples can be non-treated, or treated by non- crosslinking fixatives, such as methanol, ethanol, acetone, acetic acid or others, or crosslinking fixatives, such as formaldehyde, paraformaldehyde, formalin or others, or other chemicals.

[0049] In embodiments where the sample includes live cells, the contacting step can be performed by a method selected from bead loading, microinjection, nanoparticle or lipid mediated transduction, and combinations thereof.

[0050] The present methods can include contacting the sample with two or more probes each having different labels and each being selective for different predetermined nucleic acid sequences. These methods allow for detection of multiple nucleic acid sequences. [0051] The predetermined nucleic acid sequence can, in some embodiments, be associated with a disease or condition or a relatively increased likelihood of developing the disease or condition, and the methods disclosed herein can include diagnosing or prognosing a subject with the disease or condition if the predetermined nucleic acid sequence is detected in a nucleic acid sample from the subject.

[0052] Kits are also disclosed herein. Kits can include a probe including a Cas polypeptide, or fragments and/or variants thereof; a gRNA specific for a predetermined nucleic acid sequence that is capable of being conjugated to a the Cas polypeptide; and a label capable of being bound to the Cas polypeptide, or the gRNA, or both. In some embodiments, the label is bound to the Cas polypeptide. In some embodiments, the Cas9 polypeptide includes a dmCas9 polypeptide, or fragments and/or variants thereof. The kit can include two or more probes each having different labels and each being selective for different predetermined nucleic acid sequences. The gRNAs and probes can be adjusted according to the needs of the researcher, including, for example, the imaging desired, the predetermined nucleic acid sequences, as well as the type of samples on which the probes are to be used (e.g. tissue samples, fixed samples, unfixed samples).

BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 includes schematics of CASFISH against pericentromeres, telomeres, and centromeres and images of in vitro assembled dCas9/sgRNA fluorescently labels in genomic DNA in cells. (A) Schematic of the CASFISH strategy. (B, Upper) Relative positions of indicated DNA elements on a murine chromosome. (B, Lower) sgRNA sequences as indicated. sgMajSat: TTTCTTGCCATATTCCACGTCCTACAGTGG (SEQ ID NO: 5); sg Telomere: TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG (SEQ ID NO:6); sg MinSat: ACTCATCTAATATGTTCTACAGTGTGG (SEQ ID NO: 7). (C) CASFISH against pericentromeres in MEFs using the indicated fluorescent dCas9/sgMajSat probe assembled in vitro. dCas9 was labeled by JF646, and sgMajSat was labeled with DY547. Fluorescent images were taken with indicated filter settings and are pseudocolored for visualization purposes. (D, Left) CASFISH against telomeres in MEFs using the indicated fluorescent dCas9/sgTelomere complex. (D, Right) Histogram of the number of detected telomeres per cell; n = 134 cells. (E) CASFISH in MEF cells against minor satellite elements in centromeres. Maximum projection of z-stacks is shown. (Scale bars, 5 μΜ.)

[0054] Figure 2 includes images and schematics using dCas9 sgRNA complexes, including live-cell imaging (A) Live-cell imaging of pericentromeres in MEFs expressing dCas9-Halo and sgMajSat. (B) sgMajSat-2 sequence and CASFISH against sgMajSat-2 in MEFs. (C) Anti-ΗΡΙα immunofluorescence staining in pericentromeres costained with sgMajSat CASFISH. (D) CASFISH controls using the indicated reagents demonstrated that detection of pericentromeres requires the complex formed by dCas9 protein and the full- length sgRNA. Maximum projection of z-stacks is shown. (Scale bars, 5 μΜ.)

[0055] Figure 3 includes schematics and images of CASFISH using Cy5-labeled dCas9 protein. (A) DY547-labeled full-length sgMajSat detected pericentromeres. (B) The indicated truncated forms of unlabeled sgRNA or absence of sgRNA failed to detect the

pericentromeres. Maximum projection of z-stacks is shown. (Scale bars, 5 μΜ.)

[0056] Figure 4 includes images and data based on CASFISH in MBS binding sites of MEF cell lines (A) CASFISH against MS2-binding sites (MBS) in a U20S cell line that contains a repetitive MBS array. All examined cells were labeled as shown in the

representative views. Maximum projection of z-stacks is indicated by scale bars. (B) A representative cytogenetic analysis performed on G-banded metaphase of the MEF cell line used in this study. (C) Composite metaphase karyotypes of 10 MEF cells. The MEF cell line has a variable chromosome composition among cells with an average of 94.5.

[0057] Figure 5 includes schematics and assays of CASFISH as well as a histogram demonstrating stability of the tertiary complex formed by dCas9, sgRNA, and DNA: (A) EMSA assays of reactions using the indicated fluorescent or unlabeled reagents on 1% agarose gel. The gel was scanned with the two indicated filter settings, a green channel detecting JF549 and DY547 and a red channel detecting JF646 and Cy5. The color of the plus sign denotes that the indicated molecules were fluorescently labeled (green or red) or were unlabeled (black). +, 10 nM; ++, 40 nM; +++, 400 nM. Lanes 1-4 show migration of dCas9 protein alone (lanes 1 and 2), sgRNA alone (lane 3), or DNA substrate alone (lane 4) on the gel. The binary complex formed by dCas9 and sgRNA (lane 5) and the tertiary complex formed by dCas9, sgRNA, and DNA (lanes 6 and 8) migrated at distinct positions on the gel as indicated. dCas9 and DNA (lane 7) did not form a complex, because no new bands were detected on the gel. The addition of 10x unlabeled target DNA before complex formation (lane 10) resulted in about 10-fold less Cy5-DNA incorporated into the tertiary complex, as expected. (B, Left) The indicated fluorescent tertiary complex with Cy5-labeled sgMajSat target DNA was assembled in solution and incubated further at 37 °C for the indicated minutes with or without 3 Ox unlabeled target DNA as competitor. (B, Right) The Cy5 fluorescent intensity of the bands corresponding to the tertiary complex was plotted as a histogram. The stability of the complex is evident from the lack of competition. Error bars represent SD of three independent experiments.

[0058] Figure 6 includes Two-color CASFISH schematics, assays, histograms and imaging (A) Competition EMSA assessing the stability of the tertiary complex. (A, Left) The indicated fluorescent tertiary complex was assembled in solution and further incubated in 37 °C for 15 min with indicated fold-amounts of unlabeled sgMajSat target DNA as competitor. (A, Right) The fluorescent intensity of the bands of the tertiary complex plotted as a histogram. The stability of the complex is evident from the lack of competition. The control lane (ctrl) indicates the reaction product from a mixture of Cy5 DNA and 30-fold of unlabeled target DNA with dCas9/sgRNA binary complex. As expected, only a small fraction of Cy5-DNA was incorporated into the dCas9 tertiary complex. (B) Competition EMSAs assessing the stability of the binary complex. (B, Left) The indicated fluorescent binary complex was assembled at room temperature for 10 min and incubated further with the indicated fold-amounts of unlabeled sgMajSat at room temperature for 10 min. Unlabeled target DNA was added to the solution subsequently to form a tertiary complex followed by gel electrophoresis. (B, Right) The DY547 intensity of the bands of the tertiary complex plotted as a histogram. The stability of the binary complex of dCas9 and DY547-sgRNA is evident from the lack of competition. The control lane (ctrl) indicates the reaction product from the binary complex formed by a mixture of DY547-sgMajSat and 100-fold of unlabeled sgMajSat with dCas9 protein. As expected, only a small fraction of DY547-sgMajSat was incorporated into the dCas9 tertiary complex. (C) Schematic of two-color CASFISH methods. (D) Fluorescent imaging of sequential CASFISH against pericentromeres and telomeres in MEFs using the indicated JF549- or JF646-labeled dCas9 proteins and unlabeled sgRNAs. Results from sequential CASFISH are similar to those from one-step method.

Maximum projection of z-stacks is shown. (Scale bars, 5 μΜ.) Error bars represent the SD of three independent experiments.

[0059] Figure 7 is fluorescent imaging of pericentromeres and telomeres generated by one-step, two-color CASFISH using the indicated fluorescent dCas9 proteins and unlabeled sgRNAs. Maximum projection of z-stacks is shown. (Scale bars, 5 μΜ.).

[0060] Figure 8 includes CASFISH imaging of endogenous coding genes in human cells. (A) Fluorescent imaging of sequential CASFISH targeting two repetitive DNA sequences within intron 3 (sgMUC4-Il) or exon 2 (sgMUC4-E2) of the MUC4 gene. (B) Quantification of the number of MUC4 loci per cell and the total number of loci stained by sequential CASFISH against sgMUC4-Il (green) and sgMUC4-E2 (red) as in A. n = 80 cells. Loci labeled by both probes are colored yellow. (C) Fluorescent imaging of sequential CASFISH against the MUC4 and MUC1 genes. (D) Sequential CASFISH against repetitive intron 3 (sgMUC4-Il) and nonrepetitive intron 1 (sgMUC4-tiling) of the MUC4 gene. White arrowheads denote the labeled MUC4 genes. dCas9 was labeled by JF549 or JF646, as indicated. Maximum projection of z-stacks is shown. (Scale bars, 5 μΜ.)

[0061] Figure 9 includes investigations related to CASFISH sensitivity (A) Fluorescent imaging of a representative field of view of MUC4 CASFISH. All cells were labeled efficiently. Maximum projection of z-stacks is shown. (B) An example of MUC4 labeling in replicating cells. The fluorescent intensity of each spot was measured, and the background intensity was subtracted. Maximum projection of z-stacks is shown. (Scale bars, 5 μΜ.)

[0062] Figure 10 CASFISH imaging on a tissue section and a fast CASFISH protocol.

(A) CASFISH of mouse cryostat brain sections against major satellites and telomeres as indicated. (B, Left) Fifteen-minute and standard CASFISH of the MUC4 gene in HeLa cells. (B, Right) Intensity profiles across the labeled loci as indicated by the dotted lines on the left panel. dCas9 were labeled by JF646. Maximum projection of z-stacks is shown. (Scale bars, 5 μΜ.)

[0063] Figure 11 depicts CASFISH multicolor and multiplexing (A) The advantage of dCas9-Halo for multicolor and multiplexing CASFISH. dCas9-Halo can be labeled with various colored dyes and complexed with various sgRNA targeting different DNA sequences.

(B) Concept of the use of single-color or combinatory-color coding to image multiple targets with CASFISH. As shown, a combination of four different colors can detect 15 unique targets.

DESCRIPTION OF EXEMPLARY EMBODIMENTS

[0064] The details of one or more embodiments of the presently-disclosed subject matter are set forth in this document. Modifications to embodiments described in this document, and other embodiments, will be evident to those of ordinary skill in the art after a study of the information provided in this document. The information provided in this document, and particularly the specific details of the described exemplary embodiments, is provided primarily for clearness of understanding and no unnecessary limitations are to be understood therefrom. In case of conflict, the specification of this document, including definitions, will control.

[0065] The presently-disclosed subject matter includes probes, kits, and methods useful for detecting nucleic acid sequences. Embodiments of the presently-disclosed subject matter can operate with or without requiring denaturation and/or fixation of a sample, and in some embodiments the probes can detect genomic DNA sequences. In this regard, because some embodiments of the presently-disclosed probes do not require denaturation of a sample, imaging methods that utilize the present probes can exclude time-consuming and sample- destroying denaturation steps that are commonly associated with other known imaging techniques. This, in turn, can enhance the rapidity with which the present probes can image nucleic acid sequences, which can be particularly advantageous for processes that are time sensitive, such as certain diagnostic, treatment, or screening processes.

[0066] Provided herein is use of in vitro synthesized Cas protein and gRNA molecules followed by in vitro assembly as a programmable and sequence-dependent probe for visualizing genomic DNA in situ. The disclosed in vitro synthesis and in vitro assembly method allow efficient and effective assembly of Cas9 protein, containing any given modification for detection, with any given gRNA and with any given number of gRNAs. All assembled Cas/gRNA complex can be applied at once to its target DNA. Our and others' in vitro studies of the CRISPR system have indicated that Cas9/sgRNA had a strong and stable affinity for its target DNA. Also disclosed herein is a method for imaging multiple target DNA elements with multiple colors, by either applying multiple probes labeled with different colors at once to cells or applying mutiple rounds of probe reactions with washing steps in between. These methods allow for multicolored and expansive labeling of genomic sequences in cells and tissues.

[0067] Provided herein is use of a Cas/gRNA binary complex as a highly specific and efficient enzymatic probe for labeling nucleic acids, such as DNA, without global denaturation, which is generated by heat or chemical treatments in DNA FISH protocols. Also disclosed herein is a method of exploiting a CRISPR/Cas system for nucleic acid FISH studies, which allow for multicolored and expansive labeling of genomic sequences in cells and tissues.

[0068] The presently-disclosed subject matter includes a probe which comprises a Cas polypeptide, a gRNA that is complexed with the Cas polypeptide. The gRNA is specific for a target nucleic acid sequence of interest. The selected gRNA and Cas polypeptide of certain embodiments of the probes disclosed herein are assembled together before applied to a sample. In some instance, Cas polypeptide and gRNA can be applied simultaneously, or in subsequent order, to a sample. The probes also include one or more labels bound to the Cas polypeptide, the gRNA, or both. [0069] Embodiments of the probes disclosed herein can be assembled in vitro. Indeed, the complex probes disclosed herein have been found to be stable after assembly in vitro, allowing multiple probes for distinct target nucleic acid sequences to be applied

simultaneously to a sample without significant disassembly and/or reassembly of the complex(es) that would result in unintended combinations of labels and target sequences.

[0070] The terms "polypeptide", "protein", and "peptide", which are used

interchangeably herein, refer to a polymer of the protein amino acids, or amino acid analogs, regardless of its size or function. Although "protein" is often used in reference to relatively large polypeptides, and "peptide" is often used in reference to small polypeptides, usage of these terms in the art overlaps and varies. The term "polypeptide" as used herein refers to peptides, polypeptides, and proteins, unless otherwise noted. The terms "protein",

"polypeptide", and "peptide" are used interchangeably herein when referring to a gene product. Thus, exemplary polypeptides include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. Furthermore, the term "fusion polypeptide" is used herein to generally refer to a polypeptide formed from two or more distinct polypeptides.

[0071] The terms "polypeptide fragment" or "fragment", when used in reference to a reference polypeptide, refers to a polypeptide in which amino acid residues are deleted as compared to the reference polypeptide itself, but where the remaining amino acid sequence is usually identical to the corresponding positions in the reference polypeptide. Such deletions can occur at the amino-terminus of the reference polypeptide, the carboxy-terminus of the reference polypeptide, at intermediate regions of the reference polypeptide, or a combination thereof. Additionally or alternatively, some embodiments include alternative combinatory deletions. A fragment can also be a "functional fragment," in which case the fragment retains some or all of the activity of the reference polypeptide as described herein. For example, a functional fragment of a particular Cas polypeptide variant retains some or all of the Cas-like activity. In some embodiments, the Cas polypeptide fragment and/or variant has up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or50 residues removed from its C-terminus and/or N-terminus, relative to wild type. In some embodiments, additional residues may be removed. In some embodiments, part or all residues of identified or unidentified domains of Cas9 protein, such as the N-terminal domain, FTNH nuclease domain, RuvC nuclease domain, and PAM binding domain, C-terminal domain, can be removed or substituted or inserted with other residues. In some embodiments, the Cas polypeptide fragment and/or variant further includes deletion of residues useful for nuclease activity, for instance, residues in the HNH and RuvC nuclease domains. In some

embodiments, the PAM binding domain can be modified to alter PAM motif that Cas9 can recognize.

[0072] The term "variant" refers to an amino acid sequence that is different from the reference polypeptide by one or more amino acids, e.g., one or more amino acid substitutions. In some instances, the variant includes amino acid insertions or provides tagging of the polypeptide that differentiates the variant from the reference polypeptide. These variants can modulate properties of the polypeptide, for example, by modulating its activity or stability. In some embodiments, for example, an insertion could include a nuclear localization signal (NLS), a small epitope tag including but not limited to Flag, HA, Myc, Biotin, and Histidine, and polypeptide including but not limited to Halo, SNAP, CLIP, GFP, YFP, RFP, mCherry, and HRP. In some embodiments, for example, an insertion could be at N-terminal, or C- terminal, or internal, or in combination.

[0073] Polypeptide mutants, including polypeptide variants and/or polypeptide fragments, can affect various activities of the polypeptide, including, but not limited to, the enzymatic activity, DNA recognition activity, nuclease activity, and/or the targeting activity of a polypeptide. Some embodiments utilize a probe that includes a Cas9 polypeptide to mediate a DNA-FISH process, and can be referred to as "CASFISH" herein.

[0074] Cas polypeptides will be known to those of ordinary skill in the art with examples including, but are not limited to, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, Cpfl, and orthologous polypeptide in various microorganism species, and fragments and/or variants thereof. Cas polypeptide has many orthologous genes in different species. For instance, Cas9 include but not limited to Streptococcus pyogenes Cas9 (spCas9), Streptococcus thermophilus Cas9 (StlCas9), Staphylococcus aureus Cas9 (SaCas9), and Neisseria meningitidis Cas9 (Nm Cas9). In specific embodiments of the presently-disclosed subject matter, the Cas polypeptide includes Streptococcus pyogenes Cas9 (spCas9), and variants and/or fragments thereof.

[0075] CRISPR/Cas systems will be known to those skilled in the art and can be used in the probes of the presently-disclosed subject matter, as will become apparent to those skilled in the art upon study of this document. For example, in some embodiments, Type I, Type II, and/or Type II systems could be adapted for use in the present invention. [0076] In some embodiments, the Cas polypeptide is a variant or fragment of a wild type Cas polypeptide. In some embodiments, the Cas polypeptide can be modified to further include an insertion capable of modulating the activity and/or stability of the polypeptide.

[0077] Another example of the mutant and/or variant polypeptide is a split version of a Cas polypeptide. For example, a. split-Cas polypeptide could include the nuclease lobe and a- helical lobe expressed as separate polypeptides. Another example of the mutant and/or variant polypeptide is a Cas polypeptide that could be engineered to recognize alternative PAM sequences, (reference: Engineered CRISPR-Cas9 nucleases with altered PAM specificities. Nature. 2015 Jul 23;523(7561):481 -5. doi: 10.1038/naturel 4592. Epub 2015 Jim 22.) In other embodiments, two or more Cas polypeptides or its variants can be used, for example, in fusion, to enhance targeting efficiency and/or specificity. In some instance, fusing Cas protein to split fluorescent protein could enhance the specificity since the split fluorescent protein becomes fluorescent only when two adjacent Cas/gR A simultaneously bind to DNA template. Binding of one Cas/gRNA with half of the fluorescent protein at off- target site would be dark and thus reduce noise. In some instance, an engineered Cas polypeptide and/or gRNA that could sense binding to DN A and trigger fluorescence or other activity, could enhance specificity. For instance, the sensor could be Forsier resonance energy- transfer (FRET) sensor.

[0078] In some embodiments, the Cas polypeptide provided has little to no nuclease activity, which could break a double stranded DNA sequence. In other embodiments, the protein can be a wild type protein with full activity. Embodiments where the polypeptide provided has little to no nuclease activity provide a probe that primarily functions as a probe for DN A sequences without cutting or altering the sequence of the DN being imaged.

Embodiments of polypeptides with little to no nuclease activity can include, for example, dmCas9, which is a Cas9 mutant polypeptide that has relatively little to no nuclease activity. For example, SEQ ΪΓ) NO: 1 provides the nucleic acid sequence of a Halo labeled (tagged) dmCas9 polypeptide. Likewise, SEQ ID NO: 2 provides the protein sequence of SEQ ID NO: 1.

[0079] In some embodiments the mutant polypeptide can exhibit modified targeting activity. For instance, in some embodiments the polypeptide is imparted with a nuclear localization signal (NLS) that can assist the polypeptide in being incorporated by the nucleus of a cell. As described herein, embodiments of polypeptides that include a NLS can be incorporated into the nucleus of cell, and in some instances can permit the detection of predetermined genomic DNA sequences in unfixed and/or native samples. For example, SEQ ID NO: 3 provides the nucleic acid sequence of an exemplary Cas9 polypeptide that is Halo tagged and includes the NLS. Likewise, SEQ ID NO: 4 provides the protein sequence of SEQ ID NO: 3.

[0080] Embodiments of the probes disclosed herein can also include tags, provided to confer various desired features to the probe, for example, facilitating preparation of the probe, detection of the probe, attachment of labels to the probe, and other desirable features that will be apparent to one of ordinary skill in the art upon study of this document.

[0081] In some embodiments, detection of the target nucleic acid is achieved by directly observing the labels on the probe, for example, because of the fluorescence of the probe. In other embodiments, the target nucleic acid is detected from secondary reactions that recognize the activity of the probe, including binding of the probes to the target and/or full or partial nuclease activity of the probe. For example, antibodies against the probe can permit detection. That is, secondary reactions can recognize the activity of the probe, permitting detection. Thus, in some embodiments, the label is not itself detectable until it undergoes one or more reactions following hybridization.

[0082] In this regard, a tag can be useful in subsequent secondary labeling. The probe need not be directly labeled, but could instead include a tag, such as a tag comprising an antibody target. Such tag could be used in subsequent secondary labeling, for example, making use of antibodies against the antibody target of the tag, and a secondary labeling reaction can recognize activity of the probe, e.g., probe binding to target and/or full or partial nuclease activity of the probe. As such, in some embodiments, the one or more labels of the probe can be a tag.

[0083] Exemplary tags can also include, but are not limited to, a polyhistidine tag, an aldehyde tag, and a HaloTag™ (Promega Corporation, Madison, WI, USA). Other tags SNAP, CLIP, and numerous fluorescent protein such as GFP, YFP, RFP, TagRFP, tandem tomato and mCherry, and enzyme HRP. Some of these proteins may be phooactivatable or photoswitchable.

[0084] In some embodiments, a tag is bound to the Cas polypeptide. In some

embodiments the Cas polypeptide is expressed as a fusion protein with the tag. For example, in some embodiments, the Cas polypeptide is expressed as a fusion protein with a HaloTag and/or a polyhistidine tag. In other embodiments, the Cas polypeptide is bound to a particular tag, such as a HaloTag, a polyhistidine tag, and/or an aldehyde tag.

[0085] Certain tags are useful for easily labeling the Cas polypeptide with one or more labels. In this regard, although embodiments of the presently-disclosed probes include label- conjugated sgRNA probes, they can be costly. However, making use of labeling the Cas polypeptide using a tag can be efficient and cost effective. The HaloTag is one example, which allow for the Cas polypeptide to be easily labelled with a variety of labels (e.g., fluorescent labels) allowing multiplexing with differently labelled probes. As will be recognized by the skilled artisan, there are various alternatives to the HaloTag, for example, SNAP or CLIP.

[0086] As noted herein, embodiments of the presently-disclosed probes cars include one or more labels bound to the Cas polypeptide, the gRNA, or both. The probe can be labeled by any means that permit detection of the probe within a sample. Thus, a label is any compound or element that permits detection of the probe within a sample, directly or indirectly, including by subsequent secondary labeling.

[0087] Examples of labels that can be used in the presently-disclosed probes include, but are not limited to fluorescent labels and fluorophores (e.g. cyanine dyes (Cy dyes), Alexas Fluor dye series, Quasar dyes), dyes, quantum dots, gold particles, radioactive labels, magnetic particles, enzymes, catalysts, spectrophotometric labels, and other analytes for microscopy or other detection methods, such as MRI, CAT or PET. Additional non-limiting examples include Alexa 488, DY547, Cy5, JF549, and JF646. It will be recognized that dyes that can be conjugated to a protein and a nucleic acid can be used in connection with the present invention.

[0088] In some embodiments wherein the polypeptide is labeled, the probe can exhibit increased sensitivity relative to other DNA probes. Without being bound by theory, the increased sensitivity is believed to be at least partially due to the fact that polypeptides can be capable of accepting a higher concentration of labels relative to other known probes that are comprised of nucleic acids.

[0089] In some embodiments, the Cas polypeptide is bound to the one or more labels. In some embodiments, the gRNA is bound to the one or more labels. In some embodiments, both the Cas polypeptide and the gRNA are bound to the one or more labels. In some embodiments, each of the multiple labels has a distinct emission color. As will be recognized by one of ordinary skill in the art upon study of this document, where there are multiple labels associated with a probe specific for a particular nucleic acid sequences, there is an ability to amplify the signal associate with detection of that target sequence. In this manner, detection of lower copy nucleic acid sequences can be facilitated. [0090] The presently-disclosed subject matter also beneficially allows for multicolor and/or multiplex probes, the understanding of examples of which can be facilitated with reference to FIG. 11 A and 1 IB.

[0091] In some embodiments, the probe can include a Cas polypeptide and multiple gRNAs specific for one or more additional target nucleic acid sequence, wherein each gRNA is complexed with the Cas polypeptide. In some embodiments, the probe can also include multiple labels are bound to the Cas polypeptide, the gRNA, or both. In some embodiments, multiple labels are bound to the Cas polypeptide. Such multiple labels can be bound to the Cas polypeptide, for example via a tag, such as a HaloTag. In some embodiments, each label has a distinct emission color. In some embodiments, the labels are selected from Alexa 488, DY547, Cy5, JF549, and JF646.

[0092] In some embodiments, there are a series of probes, each probe comprising a gRNA complexed with a Cas polypeptide, wherein each gRNA is specific for a distinct target nucleic acid sequence, and each probe includes a label having a distinct emission color. In some embodiment, the labels are bound to the Cas polypeptides, the gRNAs, or both. In some embodiments, the labels are bound to each of the Cas polypeptides. Such labels can be bound to the Cas polypeptides, for example via a tag, such as a HaloTag. In some embodiments, each label has a distinct emission color. In some embodiments, the labels are selected from Alexa 488, DY547, Cy5, JF549, and JF646. With reference to Fig. 1 IB, by way of providing one limiting example, having a panel of labels with four distinct emission colors can allow for detection of 15 unique targets.

[0093] As noted here, the presently-disclosed probes further include a gRNA specific for a target nucleic acid sequence, which gRNA is complexed with the Cas polypeptide. In some embodiments of the present probes can include molar ratios of Cas polypeptide to gRNA at a molar ratio of 1 : 1 to 1 :4. A large range of molar ratio can be used to enhance Cas/gRNA complex formation and optimize imaging results. When Cas polypeptide is labeled, equal or more gRNA, at 1 : 1, 1 :2, 1 :3, ... 1 :20 or even more is reacted together to enhance complex formation. When gRNA is labeled, equal or more Cas polypeptide is used. When both are labeled, use 1 : 1 ratio. Variation in ratios may still give good results once followed by extensive wash steps.

[0094] The term "gRNA" is used herein to refer to an RNA sequence selected to specifically target a particular nucleic acid sequence of interest (a "target nucleic acid sequence" or a "predetermined nucleic acid sequence"). Complexing between a Cas polypeptide and a gRN can include the binding of the gRNA and polypeptide by covalent bonding, hydrogen bonding, and/or other non-eovalent bonding, and is well-understood in the field of CRISR/Cas systems. Exemplary gRNAs can therefore comprise a section that is targeted for a particular nucleic acid sequence of interest and section that is for binding to the Cas polypeptide, and these sections may or may not be mutually exclusive from one another. Moreover, additional sections may optionally be included in the gRNA.

[0095] In some embodiments the present probes include a polypeptide that is conjugated to guide RNA (gRNA), wherein the gRNA is targeted to a predetermined nucleic acid sequence. In some embodiments, the gRNA has a target section. In some embodiments, the gRNA targets and hybridizes with the target nucleic acid sequence. The gRNA can comprise a single RNA molecule in some instances, and in other embodiments the gRNA can be assembled from two or more RNA molecules. The two or more RNA molecules individually may or may not be able to conjugate with the polypeptide, and may or may not target the predetermined nucleic acid sequences. However, upon assembly, the gRNA will perform to target a predetermined nucleic acid sequence.

[0096] The gRNA molecules utilized in embodiments of the present probes can vary in sequence length. The portion of the gRNA that has complementarity to a target nucleic acid sequence, the target section, can also vary in length, and can be selected so that the gRNA targets the target nucleic acid sequences (or "particular nucleic acid sequences of interest" or "predetermined nucleic acid sequences") of different lengths. In some embodiments the portion of the gRNA targeted to a predetermined nucleic acid sequence, the predetermined nucleic acid sequence, or the entire gRNA sequence is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30 ,31 ,32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more nucleic acids in length. In some preferred embodiments, the target section of the gRNA is about 15-25 nucleic acids in length. In some embodiments, the gRNA has a section binding to the polypeptide but not the target nucleic acid. In some embodiments, this section is about 80 to about 100 nucleic acids in length, more preferably about 90 nucleic acids in length.

[0097] Methods and tools for designing gRNAs are known to those of ordinary skill in the art. For example, there are multiple publicly-available tools that can be accessed at the following sites: crispr.mit.edu/; https://chopchop.rc.fas.harvard.edu/; www.e-crisp.org/; crispr. cos. un i-heidelberg. de/ [0098] The terms "target," "targeting," and the like refer to the characteristic of a compound being selectively drawn to and/or selectively bound a target compound. For instance, gRNA that targets a predetermined DNA sequence is drawn to and/or selectively binds the predetermined DNA sequence. In some embodiments a gRNA molecule is said to target a predetermined DNA sequence when the gRNA is hybridizable with the

predetermined DNA sequence, wherein the term "hybridize" refers to the binding (e.g., non- covalent binding) of one nucleic acid sequence to another nucleic acid sequence in a sequence specific manner. Hybridizable sequences can therefore be referred to as

"complementary" sequences herein.

[0099] In some instances 100% complementarity of the target section of a nucleic acid (e.g., gRNA) to its target nucleic acid (e.g., DNA) is not required for hybridization. In some instances, a nucleotide can hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure). The target section of a nucleotide can comprise at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% sequence

complementarity to a hybridizable target sequence.

[00100] "Complementarity" refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non- traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). "Perfectly complementary" means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. "Substantially complementary" as used herein refers to a degree of complementarity that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%. 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.

[00101] As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part 1, Second Chapter "Overview of principles of hybridization and the strategy of nucleic acid probe assay", Elsevier, N.Y.

[00102] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson Crick base pairing, Hoogstein binding, or in any other sequence specific manner. The complex may comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination of these. A hybridization reaction may constitute a step in a more extensive process, such as the initiation of PCR, or the cleavage of a polynucleotide by an enzyme. A sequence capable of hybridizing with a given sequence is referred to as the "complement" of the given sequence.

[00103] The terms "nucleotide," "polynucleotide," "nucleic acid," and "nucleic acid sequence" are also used herein to refer to deoxyribonucleotides or ribonucleotides and polymers thereof in either single or double stranded form. Unless specifically limited, the terms encompass nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified versions thereof (e.g., degenerate codon substitutions) and complementary sequences and as well as the sequence explicitly indicated. Thus, the term nucleotide and the like is inclusive of the gRNAs that are described herein.

[00104] The terms "predetermined nucleic acid sequence," "target nucleic acid sequence," and "particular nucleic acid sequence of interest" refer to a nucleic acid sequence of a nucleic acid molecule that is known and was chosen before synthesis of the gRNA in accordance with the invention disclosed herein. Accordingly, in its broadest sense the expression "target nucleic acid sequence" indicates merely that target nucleic acid sequence has a particular known sequence.

[00105] The target nucleic acid sequence can be selected from a DNA sequence, an RNA sequence, or a sequence of another nucleic acid analogue such as but not limited to peptide nucleic acid (PNA), Morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). In some embodiments, the target nucleic acid sequence is a nucleic acid molecule in which one or more nucleotides have been modified such as but not limited to methylation, and hydroxymethylation. As noted herein, the target nucleic acid sequence can be in native DNA that has not been denatured, and the target nucleic acid sequence can be within chromosomal DNA that has not been denatured.

[00106] The target nucleic acid sequence can be contained in any sample containing genetic material. In this regard, the probes, kits, and methods disclosed herein are useful for detecting and imaging target nucleic acid sequence(s) in a sample(s) containing genetic material.

[00107] The sample types are not particularly limited so long as the samples comprise genetic material. In some embodiments, the cell is a human cell. In some embodiments, the sample comprises a virus, bacteria or fungus. In some embodiments, the sample is a cell. The cell can be a live cell or a fixed cell. The cell can be a plant cell or an animal cell. In some embodiments the sample includes an entire native chromosome and/or a portion of a native chromosome. In some embodiments, the cell can be a human cell.

[00108] Thus, in some embodiments the samples include cells obtained from a subject. Exemplary samples from a subject may include chromosome spreads for genetic testing, cultures, prenatal materials, samples for in vitro fertilization, swabs, air filters, water cooling towers, food, drink, hair, stool, urine, saliva, blood, lymph, sputum, cervical smears, sperm, sections of tissues from biopsies, sections of tissues from autopsies, and the like. Samples can include fixed tissue samples by various fixation methods known in the art. Examples of chemical fixation include formaldehyde, paraformaldehyde, formamide, glutaraldehyde, Tween-20 and HC1, acetic acid and methanol, and other aldehydes and alcohols.

[00109] The presently-disclosed subject matter further includes kits, which include probes or components of probes as disclosed herein. Exemplary kits can include a Cas polypeptide, a gRNA specific for a target nucleic acid sequence for complexing with the Cas polypeptide, and a label capable of being bound to the Cas polypeptide, the gRNA, or both. In some embodiments the kits are provided with a label is already bound to the Cas polypeptide. Subsequently, prior to performing an imaging procedure, one may mix the components of the kits to obtain a probe or collection of probes. The ability to store the probes as kits that include separate components permits one to synthesize the polypeptide separately from the gRNA. Maintaining the components separate from one another can also increase the shelf life of certain embodied probes relative to probes that stored in a state wherein the polypeptide and gRNA are already assembled or relative other known probes.

[00110] Additionally, the present probes and kits permit for a wide variety of customization and configuration of the probes. For instance, because each probe is not individually labeled, but instead the polypeptides can all be labeled in advance, different probes can be synthesized by conjugating the labeled polypeptides to different gRNA. Thus, a set of labeled polypeptides can be adapted for use as probes for a variety of different predetermined sequences with relative ease by altering the gRNA that is conjugated to the polypeptides. This can present significant cost savings over other known probes that are preassembled and are each individually labeled for specific DNA sequences.

[00111] In some embodiments, the kit further includes a tag, as described herein. In some embodiments of the kit, the label is a tag for use in subsequent secondary labeling. In some embodiments, the tag comprises an antibody target and the kit further includes an antibody against the antibody target.

[00112] In some embodiments, the kit also includes reagents for preparing a sample containing the target nucleic acid sequence. For example, the kit can include reagents for fixing the sample, as described herein, or by any method known in the art.

[00113] The presently-disclosed subject matter further relates to methods for imaging nucleic acids using the presently-disclosed probes. As noted herein, such methods allow for detection and/or visualization of the target nucleic acid sequence and/or a sample containing the target nucleic acid sequence without denaturing the nucleic acid, e.g., without denaturing double-stranded, chromosomal DNA), which can be detrimental to morphology of cells, nuclei, and chromosomes. In this regard, the method can allow for subnuclear localization of sequences in a cell, and for visualizing thee three-dimensional organization of chromosomes in nuclei.

[00114] In some embodiments the methods comprise contacting a sample that includes nucleic acid with a probe, and then detecting whether the probe has bound the target nucleic acid sequence. The presence of probe bound to a nucleic acid molecule indicates that the nucleic acid molecule comprises the target nucleic acid sequence to which the probe is targeted. Methods disclosed herein can also involve imaging the sample to determine the location and/or the relative copy number of the target nucleic acid sequence.

[00115] The contacting step can also be performed by any known means that bring the probes into direct contact with the sample. In some embodiment, such as embodiments for imaging live cells, the present probes can be contacted to the live cells by delivering the probes using methods such as bead loading, microinjection, nanoparticle or lipid mediated transduction, and the like. Thus, live cell imaging can be performed by delivering probes on or into cells that are in a sample of interest. [0009] Any of the embodiments of the probes as described herein can be used in accordance with the methods of the presently disclosed subject matter, with benefits of the particular selection of the probe(s) being apparent to one of ordinary skill in the art upon study of this document and in view of the desired determination, sample, and target nucleic acid sequence. In some embodiments, the probe includes a Cas polypeptide and multiple gRNAs, each specific for one or more additional target nucleic acid sequence, wherein each gRNA is complexed with the Cas polypeptide; and the method involves detecting whether the probe binds each of the target nucleic acid sequences, wherein binding of the probe to the nucleic acids indicates the presence of the target nucleic acid sequences in the sample. In some embodiments, there is a series of probes, each probe comprising a gRNA complexed with a Cas polypeptide, each gRNA being specific for a distinct target nucleic acid sequence, and each probe including a label having a distinct emission color; and the method involves simultaneously detecting whether the probes bind each of the multiple target nucleic acid sequences. As desired, the method can include imaging the sample to determine the location and/or relative copy number of each of the multiple target nucleic acid sequences.

[00116] The detecting and/or imaging step can be performed by any known means, including any known means currently used for fluorescent in situ hybridization imaging. In some embodiments the detecting step is performed with a process that includes magnetic resonance imaging (MRI), x-ray computed tomography (CAT), positron emission tomography (PET), or combinations thereof.

[00117] Embodiments of the present probes have the superior and unexpected capability of detecting genomic or native nucleic acids. Known probes are commonly composed of nucleic acid sequences and require fixation and denaturization of DNA in order to detect certain sequences on the DNA. However, embodiments of the present probes are comprised of a polypeptide conjugated with gRNA, and, notwithstanding their relatively large size, are capable of penetrating native DNA to probe for specific predetermined genomic DNA sequences. Embodiments of the present probes can penetrate the nucleus and/or native DNA. In this respect, the polypeptides that comprise certain embodiments of present probes can be mutated to provide enhanced penetration and binding of native DNA sequences.

[00118] Embodiments of the present probes can also expedite the entire imaging process because they include the novel characteristic of not requiring fixation and/or denaturization of a sample. For instance, some implementations of the present imaging methods can be performed in about 0.1 hours, 0.5 hours, 1.0 hours, 1.5 hours, 2.0 hours, 2.5 hours, or 3.0 hours. Of course, there may be difficult samples that are performed in longer time frames; however, one advantage of the presently disclosed subject matter is the relatively expeditious process.

[00119] Additionally, in some instances a method for imaging is provided that includes providing two or more probes, wherein each probe is targeted to a different predetermined DNA sequence. The probes can be targeted to different nucleic acid sequences by forming the probes with different gRNA. Additionally, each probe that is targeted to a predetermined nucleic acid sequence can be labeled differently, either by using different types of labels on each type of probe or by using labels that emit different fluorescence on each type of probe. After contacting the sample with the two or more probes, one can identify whether any, some, or all of the different types of probes are bound to a nucleic acid sequence. By applying and imaging the different probes together, a "spectral barcode" that includes the point sources of signals from each of the respective types of probes can be created. This permits the visualization and characterization of two or more different predetermined DNA sequences within a sample. This method is referred to herein as two-color CASFISH or multicolor CASFISH.

[00120] As described herein, embodiments of the present imaging methods can be provided for the purpose of studying and characterizing translocations within a genetic sample. Some embodiments that do not require fixation and/or denaturization of a nucleic acid sample advantageously can image native chromosomes, thereby permitting relatively easy identification of potential translocations within the sample.

[00121] In other embodiments, the present imaging methods can be provided for the purpose of diagnosing or prognosing certain diseases and conditions. Notably, because certain methods can be performed without fixation and hybridization protocols, some embodiments offer a relatively rapid assay for diagnosing or prognosing a subject. This rapidity can be particularly beneficial in time sensitive situations, such diagnostic methods that are performed during surgery to determine the diagnosis and immediate treatment required.

[00122] In some embodiments, the target nucleic acid sequence is associated with a disease or condition. In this regard, the sample is obtained from a subject, and the method further involves identifying an increased likelihood of the subject having or developing the disease or condition if the target nucleic acid sequence is detected in the sample and/or the imaging of the sample in indicative of an increased likelihood of the subject having or developing the disease or condition. Although not necessary, in some embodiments, the method can include fixing the sample and/or obtaining a sample that is fixed, as is often common clinical practice.

[00123] The terms "diagnosing" and "diagnosis" as used herein refer to methods by which the skilled artisan can estimate and even determine whether or not a subject is suffering from a given disease or condition. Along with diagnosis, making a "prognosis" or "prognosticating" can refer to predicting a clinical outcome (with or without medical treatment), selecting an appropriate treatment (or whether treatment would be effective), or monitoring a current treatment and potentially changing the treatment, based on the presence of a predetermined DNA sequence and/or particular gene in a sample associated with a subject.

[00124] "Prognosticating" as used herein refers to methods by which the skilled artisan can predict the course or outcome of a condition in a subject. The term "prognosis" can refer to the ability to predict the course or outcome of a condition with up to 100% accuracy, or predict that a given course or outcome is more or less likely to occur. The term "prognosis" can also refer to an increased probability that a certain course or outcome will occur; that is, that a course or outcome is more likely to occur in a subject exhibiting a mutation, inversion, addition, and/or deletion in the gene, when compared to those individuals not exhibiting the mutation in the gene. In certain embodiments, a prognosis is about a 5% chance of a given expected outcome, about a 7% chance, about a 10% chance, about a 12% chance, about a 15% chance, about a 20% chance, about a 25% chance, about a 30% chance, about a 40% chance, about a 50% chance, about a 60% chance, about a 75% chance, about a 90% chance, or about a 95% chance. If an accurate prognosis can be made, appropriate therapy, and in some instances less severe therapy or more effective therapy, for the patient can be chosen.

[00125] Furthermore, the term "subject" is inclusive of human, plant, animal, bacteria, virus other microorganisms, and any subj ect containing genetic material. Thus, veterinary uses are provided in accordance with the presently disclosed subject matter and the presently- disclosed subject matter provides methods for preventing oxidative damage in mammals such as humans, as well as those mammals of importance due to being endangered; of economic importance, such as animals raised on farms for consumption by humans; and/or animals of social importance to humans, such as animals kept as pets or in zoos. Examples of such animals include but are not limited to: carnivores such as cats and dogs; swine, including pigs, hogs, and wild boars; ruminants and/or ungulates such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels; and horses. Thus, also provided is the treatment of livestock, including, but not limited to, domesticated swine, ruminants, ungulates, horses, poultry, and the like.

[00126] In this regard, diagnosis or prognosis can be accomplished by providing probes having gRNAs that are selective for nucleic acid sequences, including DNA sequences and/or genes, that are known to cause and/or are associated with a particular disease or condition, and/or are associated with an increased risk or likelihood of developing a particular disease or condition. The diseases and conditions that can be diagnosed or prognosed by the present methods are not particularly limited, and those of ordinary skill will recognize a multitude of known genes that can be probed to diagnose or prognose for a particular disease or condition. Such diseases and conditions can include, but are not limited to, various types of genetic abnormalities, cancer, and other diseases and conditions. Specific diseases and conditions that may be diagnosed or prognosed including, but not limited to, acute and chronic leukemia including chronic myelogenous leukemia and acute

promyelocytic leukemia, lymphoma; multiple myeloma, breast cancer, lung cancer, colon cancer, prostate cancer, sarcomas and tumors of mesenchymal origin, brain tumors including oligodendroglioma, Alzheimer's disease, Parkinson's disease, epilepsy, amyotrophic lateral sclerosis, multiple sclerosis, stroke, autism, Cri du chat, lp36 deletion syndrome, Angelman syndrome, Prader-Willi syndrome, Velocardiofacial syndrome, Turner syndrome, Klinefelter syndrome, Edwards syndrome, Down syndrome, Patau syndrome, and trisomies 8, 9 and 16, and the like. Additional uses can be for detection of viral infection and integration and parasitic microorgansims (e.g. malaria causing Plasmodium ). Use of the presently disclosed methods may also be used in genetic tests in agriculture, botanical studies, and breeding.

[00127] Those of ordinary skill will recognize that the presently-disclosed imaging methods, which may be inclusive of methods for diagnosis or prognosis, can be further optimized and modified. In some instances the present probes and methods may be modified to be compatible with a broader range of sample types and application purposes. With respect to methods that include a fixation step, such optimizations can include, but are not limited to, varying the ratio of acetic acid and methanol, treatment time, permeablizing formide, and paraformaldehyde for fixing samples.

[00128] The presently-disclosed subject matter also includes methods of assembling a probe, as described herein, including methods of assembling a probe in vitro. In some embodiments, the method of assembling a probe in vitro involves selecting a gRNA capable of targeting a nucleic acid sequence of interests, which is optionally labeled the gRNA; providing a Cas polypeptide, which is optionally labeled, wherein at least one of the gRNA and the Cas polypeptide is labeled; mixing and incubating the gRNA and the Cas polypeptide.

[00129] The presently-disclosed subject matter further includes a probe, as disclosed herein, which is bound to or in complex with the target nucleic acid sequence(s) and/or wherein the probe is bound to the target nucleic acid sequence of each gRNA. The presently- disclosed subject matter further includes a series of probes, each bound to or in complex with the target nucleic acid sequence(s) and/or wherein each probe of the series is bound to the target nucleic acid sequence of each gRNA. As such, a sample including probe-bound nucleic acid sequences is inclusive of the presently-disclosed subject matter.

[00130] The presently-disclosed subject matter is further illustrated by the following specific but non-limiting examples. The following examples may include compilations of data that are representative of data gathered at various times during the course of

development and experimentation related to the present invention.

EXAMPLES

[00131] The following examples use fluorescently labeled nuclease-deficient Cas9 (dCas9) protein assembled with various single-guide RNA (sgRNA), to demonstrate rapid and robust labeling of repetitive DNA elements in pericentromere, centromere, G-rich telomere, and coding gene loci. Assembling dCas9 with an array of sgRNAs tiling arbitrary target loci, enable the visualization of nonrepetitive genomic sequences. As provided in the following examples, the dCas9/sgRNA binary complex is stable and binds its target DNA with high affinity, allowing sequential or simultaneous probing of multiple targets. The examples provided herein also demonstrate CASFISH assays using differently colored dCas9/sgRNA complexes that allow multicolor labeling of target loci in cells.

[00132] Materials and Methods

[00133] Sd dCas9 Constructs and Purification.

[00134] The S. pyogenes Cas9 gene containing the double nuclease mutation (D10A and H840A; dCas9) was cloned into PET302/N (Invitrogen) with an N-terminal hexahistidine affinity tag and a C-terminal Halo tag. A construct with an additional N-terminal aldehyde tag was generated for aldehyde-specific Cy5 labeling (13). All dCas9 fusion proteins were expressed and purified through a three-step FPLC purification protocol as described herein.

[00135] dCas9 FPLC.

[00136] All dCas9 fusion proteins were expressed and purified through a three-step FPLC purification protocol, as described (20), with the following modifications. Briefly, the protein was expressed in E. coli BL21 (DE3) (Agilent Technologies) and was grown in LB medium at 16 °C overnight following induction with 1 mM isopropyl β-d-l- thiogalactopyranoside (IPTG). Cells were lysed in 50 mM sodium phosphate (pH 7.0) and 300 mM NaCl. Clarified lysate was applied to a 1-mL HisTALON (Clontech) affinity column. The bound protein was eluted in 50 mM sodium phosphate (pH 7.0) and 300 mM NaCl by increasing the imidazole concentration to 150 mM and was exchanged into buffer [50 mM Hepes (pH 7.5), 100 mM KC1, 1 mM TCEP] by a 50,000-MWCO centrifugal filter (Millipore Amicon). The protein was purified further with cation ion exchange

chromatography (HiTrap SP HP; GE Healthcare) and was eluted with a linear gradient of buffers containing 0.1-1.0 M KC1. The eluted protein was purified further by gel filtration chromatography on a Superdex 200 16/60 column (GE Healthcare) in buffer containing 50 mM Hepes (pH 7.5), 150 mM KC1, and 1 mM TCEP. Protein was stored at -80 °C with additional 20% glycerol.

[00137] Live-Cell Imaging of Pericentromeres.

[00138] MEFs were transfected with mammalian expression plasmids containing dCas9-Halo and sgMajSat. At 48 h posttransfection, cells were incubated with 300 nM of JF549-Halo ligands for 15 min at 37 °C in a cell incubator. Cells subsequently were washed twice with warm PBS, incubated with fresh and warm medium for another 30 min, washed twice with warm PBS, and changed to fresh medium before imaging.

[00139] Immunofluorescence Staining.

[00140] The cells were blocked in 1% BSA/10% normal goat serum/0.3 M glycine in 0.1% PBS-Tween 20 for 1 h and then were incubated with Alexa 488-conjugated anti-HPla antibody (abl 85018; Abeam) at a working dilution of 1 :50 overnight at 4 °C. The cells were washed with PBS and stained with DAPI before imaging. Alexa 488 labeling was imaged using a white light excitation system (SOLA light engine; Lumencor) in conjunction with the proper filter cube sets (CFP-A-Basic-NTE; Semrock).

[00141] dCas9 Fluorescent Labeling.

[00142] For Halo domain labeling, fluorescent Halo ligands (JF549 and JF646) were mixed in protein samples at ratio of 8: 1 and reacted at room temperature for 30 min followed by incubation at 4 °C overnight. The dCas9-Halo with an aldehyde tag was fluorescently labeled with Cy5 hydrazide (GE Healthcare) as described (13). The excessive unreacted fluorescent Halo ligand or Cy5 hydrazide was removed using 40-K molecular weight cut off (MWCO) Zeba spin desalting columns (Thermo Scientific). Protein was eluted in storage buffer containing 50 mM Hepes (pH 7.5), 150 mM KC1, 1 mM Tris(2- carboxyethyl)phosphine (TCEP), and 10% (vol/vol) glycerol, snap frozen in liquid nitrogen, and stored at -80 °C. Protein concentration and labeling efficiency were calculated from absorption spectrum and extinction coefficients according to Beer's laws.

[00143] sgRNA Synthesis.

[00144] The DY547-labeled sgMajSat was generated by splint ligation of two fragments: 36 synthetic nucleotides 5' of sgMajSat with DY547 (GE Dharmacon), and 77 nucleotides 3' of sgMajSat transcribed and purified with T7. The unlabeled sgRNAs were synthesized in vitro by T7 RNA polymerase (MEGAshortscript T7 Kit; Life Technologies) using DNA templates with the following sequence, 5 '-TAATACGACTCACTATAGG 17- 28GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGT TATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3' (SEQ ID NO: 8). The template contains a T7 promoter-binding sequence (underlined), the sgRNA target (GG 17-28) (bold), and the sgRNA backbone as reported (6). The T7 template DNA was synthesized by either gBlock (Integrated DNA Technologies) or PCR reactions. Produced sgRNAs were purified by MEGAclear Transcription Clean-Up Kit (Life Technologies), and the quality was verified by 10% denaturing PAGE. Related sequences are listed in Tables 1-3.

Table 1: Synthesis of DY547-labeled sgMajSat by splint ligation

5 '-sgMajSat DY547-CCAUAUUCCACGUCCUACAGGUUUAAGAGCUAUGCU (SEQ ID NO: 9)

3 '-sgMaj Sat GGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUC-

AACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (SEQ ID

NO: 10)

sgMajSat-bridge AAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAACCTGT (SEQ ID NO: 11)

Table 2: Synthesis of DNA template for T7 transcription of sgRNA: T7 transcription template sequences synthesized by gBlock

gBlock_sgMajSat GGTGACACTATAGAACTCGAGCAGCTGGATCCTAATACGACTCACTATAGGCCATAT

TCCACGTACAGGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCT

(SEQ ID NO: 12) AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC

gBlock_sgTelomere GGTGACACTATAGAACTCGAGCAGCTGGATCCTAATACGACTCACTATAGGGTTAGG

GTTAGGGTTAGGGTTAGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATA

(SEQ ID NO: 13) AGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC

gBlock_sgMinSat GGTGACACTATAGAACTCGAGCAGCTGGATCCTAATACGACTCACTATAggATCTAT

TATGTTCTACAGTGGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAG

(SEQ ID NO: 14) GCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC

gBlock_sgMBS GGTGACACTATAGAACTCGAGCAGCTGGATCCTAATACGACTCACTATAGGTCGACT (SEQ ID NO: 15) CTAGAAAACATGGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGC

TAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC

Design of the T7 transcription template (TAATACGACTCACTATAGGN ₁₇ _

₂₈ GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTT ATCAACTTGAAAAAGTGGC

ACCGAGTCGGTGC) (SEQ ID NO: 8). Lowercase "g" denotes additional guanines that are not complementary to sgRNA targets

Table 3: T7 transcription template synthesized by PCR

Table 3

Sequence name Sequence

sgMUC4_14 TAATACGACTCACTATAgGCTTTTAAACCCGAGCTCAGGTTTAAGAGCTATGCTGG

(SEQ ID NO: 34)

sgMUC4_15 TAATACGACTCACTATAgGTAGCCCCGGCATTGGCCTTGTTTAAGAGCTATGCTGG

(SEQ ID NO: 35)

sgMUC4_16 TAATACGACTCACTATAgGCCTGTGGGAGATGTTCCCTCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 36)

sgMUC4_17 TAATACGACTCACTATAgGTCCTGAAGCCAGAGGGACAGCCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 37)

sgMUC4_18 TAATACGACTCACTATAgGAGTCTTTGGGGGAGAGTCTGTTTAAGAGCTATGCTGG

(SEQ ID NO: 38)

sgMUC4_19 TAATACGACTCACTATAgGCTCCTGCCCTGCCTCTCAGCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 39)

sgMUC4_20 TAATACGACTCACTATAgGCATATTTGAGGAGCTTCCTGTTTAAGAGCTATGCTGG

(SEQ ID NO: 40)

sgMUC4_21 TAATACGACTCACTATAGGCTGCAAGAGAAGCCATGCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 41)

sgMUC4_22 TAATACGACTCACTATAgGATGTTTCAGGACTAGGCTGAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 42)

sgMUC4_23 TAATACGACTCACTATAgGCTGGAGGGTGGGGAGGTGTAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 43)

sgMUC4_24 TAATACGACTCACTATAGGTGGGATGAGCACTGGAGCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 44)

sgMUC4_25 TAATACGACTCACTATAgGCCCTGCAGATGTGGTTGAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 45)

sgMUC4_26 TAATACGACTCACTATAgGAGGCTGGGGCTTGGGGCGCCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 46)

sgMUC4_27 TAATACGACTCACTATAgGTCTTTGCCGTGAACTGTTCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 47)

sgMUC4_28 TAATACGACTCACTATAgGACCGGGGCCCTGGGGAGACACGTTTAAGAGCTATGCTGG

(SEQ ID NO: 48)

sgMUC4_29 TAATACGACTCACTATAgGCTGGACACTCAGCTCCATGGTTTAAGAGCTATGCTGG

(SEQ ID NO: 49)

sgMUC4_30 TAATACGACTCACTATAgGAGCGCAGAGGGGCAAGACCTGTTTAAGAGCTATGCTGG

(SEQ ID NO: 50)

sgMUC4_31 TAATACGACTCACTATAgGAGAAGGAGTGAAGGACTGTGTTTAAGAGCTATGCTGG

(SEQ ID NO: 51)

sgMUC4_32 TAATACGACTCACTATAgGCTCCACGACATGCCTAGCTTCTTCGTTTAAGAGCTATGCTG G

(SEQ ID NO: 52)

sgMUC4_33 TAATACGACTCACTATAgGAGCTGGGCCAGGAGAGGAGAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 53)

sgMUC4_34 TAATACGACTCACTATAgGACCGGGCATGACCAGGGCCTGTTTAAGAGCTATGCTGG

(SEQ ID NO: 54)

sgMUC4_35 TAATACGACTCACTATAGGGCAGCCCCCACCCCCACAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 55)

sgMUC4_36 TAATACGACTCACTATAgGTTCCTTTTGGCTCCCTGAAGGTTTAAGAGCTATGCTGG Table 3

Sequence name Sequence

(SEQ ID NO: 56)

sgMUC4_37 TAATACGACTCACTATAGGGTCTGTTTGCACACTTGCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 57)

sgMUC4_38 TAATACGACTCACTATAgGCCCAGGCCAGAGGAAAAACACAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 58)

sgMUC4_39 TAATACGACTCACTATAgGTTTCCTTAAGGAACAGCCCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 59)

sgMUC4_40 TAATACGACTCACTATAgGCAGACAGAGGTGGGCTAGACAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 60)

sgMUC4_41 TAATACGACTCACTATAgGCCCCAGGCAGGAATGACTCAGAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 61)

sgMUC4_42 TAATACGACTCACTATAgGACCCAGTTGCCTTTCCCTGGTTTAAGAGCTATGCTGG

(SEQ ID NO: 62)

sgMUC4_43 TAATACGACTCACTATAgGACCCCAGGGAGGTGACAGGCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 63)

sgMUC4_44 TAATACGACTCACTATAgGCCACAGCGCACTCCACGGGGAAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 64)

sgMUC4_45 TAATACGACTCACTATAgGTCCCAGACTGACAGATAGACCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 65)

sgMUC4_46 TAATACGACTCACTATAgGAGGGGTCTGTGGAGAGTTTGTTTAAGAGCTATGCTGG

(SEQ ID NO: 66)

sgMUC4_47 TAATACGACTCACTATAgGTCCAGCATCAGCGACGCCCTGTTTAAGAGCTATGCTGG

(SEQ ID NO: 67)

sgMUC4_48 TAATACGACTCACTATAgGCCTAAGACTCCAGAGCCAAAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 68)

sgMUC4_49 TAATACGACTCACTATAgGCTACTACGTAGGGTTGTCATGGTTTAAGAGCTATGCTGG

(SEQ ID NO: 69)

sgMUC4_50 TAATACGACTCACTATAgGTAAAGTAGAAAAGGCATAAAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 70)

sgMUC4_51 TAATACGACTCACTATAgGCACTTTTGGAGGCCCAGGCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 71)

sgMUC4_52 TAATACGACTCACTATAgGTGGAGACAGGGTTGGCCAAGCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 72)

sgMUC4_53 TAATACGACTCACTATAgGCTCCCTGCAACCTCTGCCTCCCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 73)

sgMUC4_54 TAATACGACTCACTATAgGCCTCTTTCTCAAACACGTCTTTAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 74)

sgMUC4_55 TAATACGACTCACTATAgGAACCCGGAATGGCACTTGTGTGTTTAAGAGCTATGCTGG

(SEQ ID NO: 75)

sgMUC4_56 TAATACGACTCACTATAGGTGGCTTTTTAGAGGCACGGTTTAAGAGCTATGCTGG

(SEQ ID NO: 76)

sgMUC4_57 TAATACGACTCACTATAGGCTTGGTGTATTCAGAATGGTTTAAGAGCTATGCTGG

(SEQ ID NO: 77)

sgMUC4_58 TAATACGACTCACTATAgGCACTGCCAGGCCAGCCTCTGCCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 78) Table 3

Sequence name Sequence

sgMUC4_59 TAATACGACTCACTATAgGCTAAGGACAAGAGGCAATGAGGTTTAAGAGCTATGCTGG

(SEQ ID NO: 79)

sgMUC4_60 TAATACGACTCACTATAgGACTCAATTTCTCAGAACATGCTGGTTTAAGAGCTATGCTGG

(SEQ ID NO: 80)

sgMUC4_61 TAATACGACTCACTATAgGACAGAGTTTCTCTCTGTCCCCCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 81)

sgMUC4_62 TAATACGACTCACTATAGGGGTTTCACCATGTTGGCCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 82)

sgMUC4_63 TAATACGACTCACTATAgGCTCGCCTCGGCTCCCAAAGTGCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 83)

sgMUC4_64 TAATACGACTCACTATAGGGCATTTGTGTTGCACGTGGTTTAAGAGCTATGCTGG

(SEQ ID NO: 84)

sgMUC4_65 TAATACGACTCACTATAgGAGTGGAGCTGCGGGCAACCCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 85)

sgMUC4_66 TAATACGACTCACTATAgGTAGAGATGCCGCCCCGCCCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 86)

sgMUC4_67 TAATACGACTCACTATAgGTCCAGTGGCCAGTGGATTTTGGTTTAAGAGCTATGCTGG

(SEQ ID NO: 87)

sgMUC4_68 TAATACGACTCACTATAgGAGGCAGCTGGGACTAGAACCCGTTTAAGAGCTATGCTGG

(SEQ ID NO: 88)

sgMUC4_69 TAATACGACTCACTATAgGTCGGTGGGCTGGGCTGGTTGTTTAAGAGCTATGCTGG

(SEQ ID NO: 89)

sgMUC4_70 TAATACGACTCACTATAgGAATGAATGGCTGTCTCAGCAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 90)

sgMUC4_71 TAATACGACTCACTATAgGAAACAGACGTGGCCCAGTCTCTGTTTAAGAGCTATGCTGG

(SEQ ID NO: 91)

sgMUC4_72 TAATACGACTCACTATAgGCTGAGAGCTGCATTTCGAAGTTTAAGAGCTATGCTGG

(SEQ ID NO: 92)

sgMUC4_73 TAATACGACTCACTATAgGACAAGTCAGGAAGGGCCCTGTGGTTTAAGAGCTATGCTGG

(SEQ ID NO: 93)

PCR template:

GCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACT TGCTATGCTGTTTCCAGCATAGCTCTTAAAC (SEQ ID NO: 94); reverse primer:

GCACCGACTCGGTGCCACTT (SEQ ID NO: 95). Lowercase "g" denotes additional guanines that are not complementary to sgRNA targets.

[00145] Cell Culture and Brain Section Preparation.

[00146] MEFs and HeLa cells were cultured in DMEM without Phenol-red (Gibco) supplemented with 10% FBS and 1% penicillin/streptomycin. Cytogenetic analysis of MEF cells was performed by Cell Line Genetics. Cryostat sections were prepared from freshly frozen adult mouse brain with a slice thickness of ~20 μΜ.

[00147] CASFISH Protocol

[00148] Unless indicated, the standard CASFISH protocol is as follows: Cells cultured on 35-mm MatTek dishes or tissue sections were fixed at -20 °C for 20 min in a prechilled solution of methanol and acetic acid at a 1 : 1 ratio. Samples were washed three times (5 min each washing) with PBS with gentle shaking, followed by incubation for 15 min at 37 °C in blocking/reaction buffer [20 mM Hepes (pH 7.5), 100 mM KCl, 5 mM MgC12, freshly added 1 mM DTT, 5% (vol/vol) glycerol, 1% BSA, and 0.1% TWEEN-20]. To assemble CASFISH probes, fluorescently labeled dCas9 protein (5-25 nM) was mixed with labeled or unlabeled sgRNA at molar ratio of 1 : 1 or 1 :4, respectively, in blocking/reaction buffer and was incubated at room temperature for 10 min and stored on ice before the next step. Five nM of fluorescent dCas9 protein was used for CASFISH against MUC4 repetitive DNA elements. For all other CASFISH experiments, 25 nM dCas9 protein was used. The assembled dCas9/sgRNA was applied on preblocked cells and incubated for 5-30 min at 37 °C. The reaction was terminated by the removal of the dCas9/sgRNA solution and washing three times with blocking/reaction buffer. CASFISH samples of sgMUC4-tiling were washed further in buffer containing 20 mM Hepes (pH 7.5), 300 mM NaCl, 3 M urea, and 1.1% (vol/vol) Nonidet P-40. The short CASFISH protocol was modified to the following procedures: Cells were fixed for 5 min at -20 °C, rinsed three times with PBS, subjected to the preincubated (5 min) dCas9 and sgRNA mixture for 5 min at 37 °C, and again rinsed three times with PBS. All samples were stained with 0.5 μg/mL DAPI for 5 min before imaging.

[00149] EMSA Assay.

[00150] dCas9 protein and sgRNA were incubated together at room temperature for 10 min to examine the binary complex and subsequently were incubated with target DNA at 37 °C for 15 min to examine the tertiary complex. For the competition assay, an additional binary or tertiary complex reaction was performed after the addition of the competitor molecules. Resulting reaction mixtures were subjected to electrophoresis of 1% agarose gel in 1 x Tris/borate/EDTA buffer containing 5 mM MgC12 and were imaged with GE Typhoon Trio+ Imagers.

[00151] Microscopy and Image Analysis.

[00152] All CASFISH samples were imaged on an inverted microscope (Nikon Eclipse Ti) equipped with a 100x oil-immersion objective (Nikon CFI Plan Apo VC 100x Oil, NA 1.4) and an EM CCD (Andor iXon Ultra 897). DAPI, JF549, or JF646 labeling was imaged using a white light excitation system (SOLA light engine; Lumencor) in conjunction with the proper filter cubes sets (DAPI-1160B-NTE-Zero, LF561/LP-A-NTE, or Cy5-3040C-NTE- Zero, respectively; Semrock). JF549 or JF646 labeling also was imaged using laser excitation [561 nm (Cobolt Jive) or 637 nm (Vortran Stradus), respectively] in conjunction with a multiband dichroic (Di01-R405/488/561/635; Semrock). Proper emission filters for JF549 or JF6464 ( FFO 1-593/40 or FFO 1-676/37; Semrock) were placed in front of the camera. Z- stacks were collected at step size of 0.2 μιη for 30^10 slices to image the entire nucleus. Images were processed using ImageJ (21).

[00153] Example 1; Fluorescently Labeled dCas9 protein

[00154] To produce fluorescently labeled dCas9 protein, we constructed a dCas9 fusion protein that contains a hexahistidine affinity tag at the N terminus and a Halo tag at the C terminus. The Halo tag can be labeled efficiently and covalently by Halo ligands conjugated to a variety of organic fluorescent dyes for different imaging purposes (10). We purified recombinant dCas9 fusion protein expressed in Escherichia coli and labeled the protein with Halo ligands conjugated with Janelia Fluor 646 (JF646) (11). (All fluorochromes are listed in Table 1.)

Table 1: Spectral properties of fluorochromes

[00155] The presently dislcosed strategy was tested on the highly repetitive major satellite (MajSat) sequences at murine pericentromeric regions and thus generated a 5'- DY547 (Cy3 alternative)-labeled sgRNA (sgMajSat) (Fig. IB). Equal molar amounts of purified JF646-dCas9 and DY547-sgMajSat were incubated together to form the

dCas9/sgMajSat complex and then were applied to mouse embryonic fibroblasts (MEFs) that were fixed with methanol/acetic acid solution. Within 30 min of incubation, dCas9/sgMajSat probes effectively hybridized to the target satellite DNA in pericentromeres (Fig. 1C).

Images from the DY547 channel that detects sgMajSat, the JF646 channel that detects dCas9 protein, and the DAPI channel generated a colocalized pattern of the pericentromeres in nuclei. Pericentromeres were of various sizes and numbers, as observed in live MEF cells coexpressing dCas9-halo and sgMajSat (Fig. 2A). Staining of pericentromeres by the fluorescent dCas9/sgMajSat complex was verified further by dCas9 staining with an independent sgRNA (sgMajSat-2) targeting the other strand of the major satellite sequence (Fig. 2B) and by its colocalization with heterochromatin protein 1 alpha (HP la)

immunofluorescence staining (Fig. 2C). In contrast, JF646-dCas9 alone or incubated with the backbone hairpin portion of sgMajSat lacking a target complementary sequence failed to generate any specific staining (Fig. 2D) indicating that dCas9/sgMajSat-mediated staining of pericentromeres was sequence-specific. DY547-sgMajSat alone did not hybridize with the target major satellite DNA, suggesting that the target DNA was not denatured during the Cas9-mediated FISH (CASFISH) procedure and that the observed signal was not caused simply by RNA-DNA hybridization independent of dCas9 (Fig. 2D). To demonstrate dCas9- mediated fluorescent staining with an independent labeling method, we engineered a genetically encoded aldehyde tag to the N terminus of dCas9 protein and labeled the aldehyde-tagged dCas9 with Cy5 hydrazide (Cy5nz) (13). The Cy 5 -labeled dCas9 protein assembled with DY547-sgMajSat generated the same specific staining of pericentromeres as JF646-labeled dCas9 protein (Fig. 3). In summary, these results demonstrated that in vitro assembled fluorescent dCas9/sgRNA complex could label its genomic DNA target sequences in cells effectively and specifically. We therefore named the method "CRISPR/Cas9- mediated FISH," CASFISH.

[00156] Example 2; Halo Tag Labeling

[00157] The synthesis of fluorochrome-conjugated sgRNA probes (— 110 nt) is costly, whereas labeling of the Halo tag is efficient and cost-effective; thus this example describes the strategy of assembling fluorescent dCas9-Halo and unlabeled sgRNA for CASFISH. Specifically, we labeled dCas9-Halo protein through Halo ligands providing flexibility in the choice of fluorochromes and used T7 polymerase to synthesize sgRNA in vitro, a solution combining low cost and scalability for multiplexing. dCas9-Halo proteins labeled with both tested fluorochromes [JF549 and JF646 (11)] retained their activity, as demonstrated by successful CASFISH imaging and specific binding to target DNA in vitro (see below).

Assembling labeled dCas9-Halo with T7-synthesized sgRNA, we successfully stained various DNA targets including telomeres, minor satellites, and a gene array containing repeated MS2-binding sequences (Fig. ID and Fig. IE and Fig. 4A). The number of detected telomeres was in agreement with the number of chromosomes in MEF cells by cytogenetic analysis (Fig. ID and Fig. 4B and Fig. 4C). Telomere sequences are G-rich and have a higher melting temperature than regular genomic DNA. Although conventional DNA FISH of telomeres requires peptide nucleic acid probes for hybridization, the CASFISH probe detected telomeres effectively with unmodified sgRNA, indicating CASFISH' s superiority to DNA FISH in detecting G-rich sequences. Thus, we established a cost-effective and convenient pipeline for synthesizing fluorescent CASFISH probes for customized sequences.

[00158] Example 3 CASFISH for multiple DNA Targets

[00159] Simultaneous imaging of multiple chromatin domains or genes is critical for studying chromatin interactions. To explore the possibility of using CASFISH to detect multiple DNA targets simultaneously, we first investigated the binding of CASFISH probes to target DNA by electrophoretic mobility shift assays (EMSA). Using fluorescently labeled dCas9 protein, sgMajSat, and its target DNA, we found that dCas9 protein formed a binary complex with sgMajSat and a tertiary complex upon the addition of target DNA. These two complexes migrated on the gel as distinct bands away from free dCas9, free sgMajSat, or free target DNA (Fig. 5A) As expected, dCas9 showed no detectable interaction with target DNA in the absence of sgMajSat. To examine the stability of dCas9/sgMajSat binding to its target DNA, we carried out competition assays by adding excessive amounts of unlabeled target DNA to a preformed tertiary complex of JF549-dCas9/sgMajSat/Cy5-DNA. We found that incubation with increasing amounts of competitor DNA did not displace the Cy5-DNA from the preformed tertiary complex, as indicated by unchanged Cy5 fluorescence intensity of the tertiary complex even in the presence of a 100-fold excess of competitor DNA (Fig. 6A). Incubating preassembled tertiary complex with 30-fold of unlabeled competitor DNA for up to 1.5 h did not dissociate preformed tertiary complex either (Fig. 5A). These results demonstrated that, once bound to its DNA substrate, the Cas9/sgRNA/DNA complex is exceptionally stable. This prominent feature would allow a strategy of sequential CASFISH by subjecting cells to multiple rounds of CASFISH assays using probes labeled with different fluorochromes and targeting different DNA sequences.

[00160] Example 5; One Step MultiColor Imaging

[00161] To explore the possibility of applying multiple dCas9/sgRNA species in one step for multicolor imaging, we assessed the stability of the binary complex by sgRNA competition assay. We found that increasing amounts of competitor unlabeled sgRNA up to 100-fold did not displace the DY547-sgRNA from preassembled fluorescent dCas9/sgRNA, as indicated by the unchanged DY547 fluorescence intensity of the dCas9 complex (Fig. 6B). In contrast, adding unlabeled sgRNA competitor before the formation of the binary complex substantially reduced the incorporation of DY547-sgRNA to the dCas9 complex. These results demonstrated the high stability of the binary complex and the feasibility of one-step multicolor CASFISH. Therefore, we tested two methods for multicolor CASFISH: sequential rounds of CASFISH or a one-step application of multiple probes (Fig. 6C). Using JF549- dCas9/sgMajSat and JF646-dCas9/sgTelomere probes, we produced two-color imaging of pericentromeres and telomeres in cells with either the sequential CASFISH method (Fig. 6D) or the one-step method in which the two color probes are applied to the cell simultaneously (Fig. 7). There was no detectable cross-reactivity between the two imaging channels in either case. Probes with switched fluorescent labels gave the same results. As expected, CASFISH using two different sgRNAs targeting sgMajSat and sgMajSat-2 showed identical patterns (Fig. 6D). Thus we demonstrated that CASFISH could be used for imaging multiple sequence-specific genomic regions with multiple colors.

[00162] Example 6; CASFISH Sensitivity

[00163] The major satellite and telomere sequences contain hundreds to thousands of repeats for sgRNA targeting. To assess the sensitivity of CASFISH, we tested sgRNAs against DNA substrates with lower copy numbers at the level of tens to hundreds. The human mucin 4 (MUC4) and mucin 1 (MUC1) genes contain repetitive sequences that have been imaged successfully in live cells with dCas9-EGFP (6). CASFISH using sgRNA against the ~400 copies of the target in exon 2 of the MUC4 gene (sgMUC4-E2) and ~45 copies of the target in intron 3 (sgMUC4-Il) detected prominent fluorescent puncta in all examined HeLa cell nuclei using either JF549- or JF646-labeled dCas9 protein (Fig. 8A and Fig. 9A). There are three fluorescent puncta in the majority of cells, as expected for the three copies oiMUC4 loci in interphase HeLa cells (Fig. 8B). We also observed that labeling appeared weaker in sister chromatids (Fig. 9B, puncta 1 and 2) than in replicating sites in the same cells (Fig. 9B, puncta 3 and 4). Two-color sequential CASFISH using these two sgRNA produced puncta in close proximity, verifying that the signal was specific to MUC4 genes. Based on the fraction of loci labeled in both colors, we estimate the detection efficiency to be >94%. As a control, sequential CASFISH of the MUC4 and MUC1 genes (sgMUC4-Il and sgMUCl-El) showed distinct locations of these two genes in the nuclei (Fig. 8C), revealing no detectable cross- reactivity between sequential rounds of CASFISH probing. In summary, these results demonstrated that CASFISH is robust and efficient for the simultaneous and multiplexing labeling of multiple given genomic DNA sequences.

[00164] Example 7; CASFISH in Tissue [00165] This example shows how a diagnostic procedure would be facilitated by a rapid and robust assay for genomic sequences present in tissue. To test whether CASFISH can be applied to tissue sections, we prepared cryostat sections of adult mouse brain and proceeded with CASFISH assays against pericentromeres and telomeres. The dCas9/sgRNA probes penetrated to 15 μιη of the brain sections and efficiently labeled their targets in all examined cells (Fig. 10A). We envision that rapid detection of genomic elements by

CASFISH could be advantageous in various scenarios, such as a rapid genetic diagnosis and detection of infectious agents. To derive an even more rapid CASFISH protocol, we reduced the reaction time of each step and achieved a 15-min protocol (5-min fixation and concurrent 5-min binary complex assembly, 5-min DNA binding, and 5-min washing between steps) using sgMUC-E2 as an example. The rapid protocol achieved robust labeling for the MUC4 gene, with most cells having three labeled puncta, as expected (Fig. 10A). The fluorescent intensity of the labeled locus was similar to that obtained by the standard protocol. These results suggested that CASFISH can be a rapid and robust method for visualizing specific genomic elements in cells and primary tissue. Detection of RNA can be developed utilizing a similar procedure.

[00166] Summary

[00167] The CASFISH assay is rapid, cost-effective, and convenient (Table 4).

Table 4. Comparison of CASFISH with DNA FISH and live Cas9 imaging

DNA FISH Live Cas9 imaging CASFISH

Probe Nucleic acid probe Genetically coded dCas9/sgRNA In vitro assembled dCas9/sgRNA

Difficulty of probe generation Reliable synthesis Variable and time-consuming Reliable synthesis Experiment duration Hours to days Immediately Minutes to 1 h Color Multicolor One color per CRISPR system Multicolor per CRISPR system

High-throughput multiplexing Yes Challenging Yes

Global DNA denaturation Yes No No

Fixed cell imaging Yes No Yes

Live cell imaging No Yes Possible

Tissue imaging Yes Possible Yes

[00168] First, CASFISH takes advantage of the CRISPR-based mechanism for rapid DNA hybridization. This enzymatic probe is more efficient than the nuclei-acid-only probe of DNA FISH that requires heat and formamide treatment to denature dsDNA. Thus, while DNA FISH takes hours or longer, CASFISH can be as fast as 15 min under optimized conditions. Second, the mild conditions of CASFISH (room temperature and 37 °C) can better preserve cell morphology and DNA structure, and thus CASFISH can be a useful tool for studying genome organization combined with single-molecule superresolution imaging. Third, the two-component nature of CASFISH probes provides great potential for multiplexing and room for further engineering (Fig. 11). Halo tagging of dCas9, as demonstrated in this study, allows the ease and flexibility of fluorescent labeling for various imaging purposes. A single reagent of labeled dCas9 protein can be assembled with a number of customized unlabeled sgR As at minimal cost. CASFISH therefore can be used to interrogate multiple targets with multiple single colors or with combinatory color codes, facilitating studies of spatial relationships of multiple distinct genomic loci. The fast-binding kinetics of CASFISH probes to targets and the mild reaction conditions would allow highly multiplexed DNA profiling in single cells. In addition, the protein moiety of CASFISH probes provides room for exploring other labeling methods and incorporating multiple fluorochromes per molecule to achieve higher sensitivity and specificity. Fourth, CASFISH holds great potential for applications. CASFISH can be advantageous in detecting "difficult" DNA FISH sequences as exemplified by G-rich telomeres. CASFISH can be potentially advantageous in detecting subtle DNA variations such as SNPs because the sgRNA sequence composition near the protospacer adjacent motif (P AM) is sensitive to permutation. The CASFISH strategy allows delivery of fluorescent dCas9 protein coupled with unlimited numbers of sgRNA, thereby allowing the labeling of gene loci and chromatin domain of any given size. In principle, customized CASFISH probes can be delivered to live cells via direct microinjection or protein delivery methods to allow studies of native chromatin organization. CASFISH is rapid and applicable to primary tissue, thus offering advantages for rapid genetic diagnosis such as the detection of DNA translocations. The CASFISH assay can also be expanded to orthogonal CRISPR systems, allowing a wide range of reagent development and providing an opportunity for developing combinatorial, multiplexed, multicolor imaging systems.

[00169] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the presently-disclosed subject matter belongs. Although any methods, devices, and materials similar or equivalent to those described herein can be used in the practice or testing of the presently-disclosed subject matter, representative methods, devices, and materials are now described.

[00170] Following long-standing patent law convention, the terms "a", "an", and "the" refer to "one or more" when used in this application, including the claims. Thus, for example, reference to "a cell" includes a plurality of such cells, and so forth. [00171] Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and claims are approximations that can vary depending upon the desired properties sought to be obtained by the presently-disclosed subject matter.

[00172] As used herein, the term "about," when referring to a value or to an amount of mass, weight, time, volume, concentration or percentage is meant to encompass variations of in some embodiments ±20%, in some embodiments ±10%, in some embodiments ±5%, in some embodiments ±1%, in some embodiments ±0.5%, and in some embodiments ±0.1% from the specified amount, as such variations are appropriate to perform the disclosed method.

[00173] As used herein, ranges can be expressed as from "about" one particular value, and/or to "about" another particular value. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[00174] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference, including the references set forth in the following list:

REFERENCES

1. Hubner MR, Eckersley-Maslin MA, Spector DL (2013) Chromatin organization and transcriptional regulation. Curr Opin Genet Dev 23(2):89-95.

2. Levsky JM, Singer RH (2003) Fluorescence in situ hybridization: Past, present and

future. J Cell Sci 1 16(Pt 14):2833-2838.

3. Beliveau BJ, et al. (2012) Versatile design and synthesis platform for visualizing genomes with Oligopaint FISH probes. Proc Natl Acad Sci USA 109(52):21301-21306.

Abstract/FREE Full Text

4. Sternberg SH, Doudna JA (2015) Expanding the Biologist's Toolkit with CRISPR-Cas9.

Mol Cell 58(4):568-574.

5. Mali P, Esvelt KM, Church GM (2013) Cas9 as a versatile tool for engineering biology.

Nat Methods 10(10): 957-963. hen B, et al. (2013) Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155(7): 1479-1491.

anenbaum ME, Gilbert LA, Qi LS, Weissman JS, Vale RD (2014) A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell 159(3):635-646.

a H, et al. (2015) Multicolor CRISPR labeling of chromosomal loci in human cells. Proc Natl Acad Sci USA 112(10):3002-3007.

ternberg SH, Redding S, Jinek M, Greene EC, Doudna JA (2014) DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature.

Encell LP, et al. (2012) Development of a dehalogenase-based protein fusion tag capable of rapid, selective and covalent attachment to customizable ligands. Curr Chem Genomics 6:55-71.

Grimm JB, et al. (2015) A general method to improve fluorophores for live-cell and single-molecule microscopy. Nat Methods 12(3):244-250, 3, 250.

Ziegler-Birling CEL, Miyanari Y, Torres-Padilla M-E (2013) Live visualization of chromatin dynamics with fluorescent TALEs. Nat Struct Mol Biol 20: 1321-1324.

Shi X, et al. (2012) Quantitative fluorescence labeling of aldehyde -tagged proteins for single-molecule imaging. Nat Methods 9(5):499-503.

Zijlmans JM, et al. (1997) Telomeres in the mouse have large inter-chromosomal variations in the number of T2AG3 repeats. Proc Natl Acad Sci USA 94(14):7423-7428. O'Connell MR, et al. (2014) Programmable RNA recognition and cleavage by

CRISPR/Cas9. Nature.

Beliveau BJ, et al. (2015) Single-molecule super-resolution imaging of chromosomes and in situ haplotype visualization using Oligopaint FISH probes. Nat Commun 6:7147. Chen KH, Boettiger AN, Moffitt JR, Wang S, Zhuang X (2015) RNA imaging. Spatially resolved, highly multiplexed RNA profiling in single cells. Science 348(6233):aaa6090. Hsu PD, et al. (2013) DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 31(9):827-832.

Esvelt KM, et al. (2013) Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods 10(11): 1 116-1 121.

Jinek M, et al. (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337(6096): 816—821.

Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9(7):671-675.

Janicki SM, et al. (2004) From silencing to gene expression: Real-time analysis in single cells. Cell 1 16(5):683-698. 23. Gilbert et al., CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes, Cell, 2013 vol. 154(2) pp. 442-51.

24. Anton, et al, (2014) "Visualization of specific DNA sequences in living mouse

embryonic stem cells with a programmable fluorescent CRISPR/Cas system," Nucleus 5(2): 163-72.

25. Van der Oost, et al, (2014) "Unravelling the structural and mechanistic basis of CRISPR- Cas systems," Nat Rev Microbiol, 12(7): 479-92.

26. Wright, et al, (2015) "Rational design of a split-Cas9 enzyme complex," Proc Natl Acad Sci USA, 1 12(10): 2984-89.

27. U.S. Patent No. 8,697,359 to Zhang for "CRISPR-Cas systems and methods for altering expression of gene products."

[00175] It will be understood that various details of the presently disclosed subject matter can be changed without departing from the scope of the subject matter disclosed herein. Furthermore, the foregoing description is for the purpose of illustration only, and not for the purpose of limitation.