CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to US Application 61/298,451, filed January 26, 2010, which is incorporated by reference in its entirety.

TECHNICAL FIELD

[0002] The invention provides compositions and methods useful for

pharmacogenetics and molecular detection.

BACKGROUND

[0003] Pharmacogenetics is the study of clinical testing of genetic variations that give rise to differing response to drugs, and is increasingly important in the practice of medicine.

[0004] CYP2D6 is a member of the cytochrome P450 super family and highly involved in drug metabolism. It catalyses the breakdown of about 25% of all commonly prescribed drugs. More than 100 medically important substrates of CYP2D6 are known. The following tables show a selection of the most important substrates.

Selection of β-blockers metabolized b CYP2D6

Anti s chotic dru s metabolized b CYP2D6

Antiarr thmatic a ents metabolized b CYP2D6 Flecainid CYP2D6 Propafenon CYP2D6

N-Propylajmalin CYP2D6 Spartein CYP2D6

Further substrates metabolized b CYP2D6

[0005] The CYP2D6 gene expresses four different phenotypes, which are highly correlated to adverse drug reactions (ADRs) and ineffective drug therapies. These phenotypes are the Poor Metabolizer (PM), the Intermediate Metabolizer (IM), the Extensive Metabolizer (EM) and the Ultra Rapid Metabolizer (UM).

Frequencies of different CYP2D6 henot es in Caucasians

[0006] The therapeutic window is only reached with a standard dose in case of EMs. At that same standard dose, IMs will see variance from the expected blood levels. No effect of the drug dose will be observed if the patient has an UM phenotype, as blood levels will be far below those expected. Furthermore, PMs will have a blood plasma level where the concentration of the administered drug has toxic side-effects. In these patients, a substantial change of the drug dosing regime is critical.

Ineffective Tamoxifen Therapies

[0007] Tamoxifen represents a "prodrug", because it is first activated by CYP2D6 to the metabolic active agent endoxifen. Tamoxifen is used as aftercare in the case of estrogen-receptor-positive breast cancer. However, current studies show that patients expressing a PM phenotype have a three times higher risk for breast cancer recurrence. They might benefit from determination the CYP2D6 genotype prior to tamoxifen therapy and a change of their medication to an alternative agent such as aromatase inhibitors (Goetz et al., 2007).

[0008] Currently, several technologies are available for the genotyping of the human CYP2D6 gene. Most important in this context is sequencing and real-time PCR.

Sequencing is mainly done according to Sanger's method, by applying fluorescence labeled ddNTPs, which incorporate into the DNA during amplification and thereby stop this reaction. After separation, each different nucleotide can be detected by a special reader using four different fluorophores. Real-time PCR is another method which can be used to detect mutations by means of melting curve analysis. The melting curve is related to fluorescence labeled, sequence specific probes, which melt differently depending on whether the target is a wildtype or a mutated DNA. The change of fluorescence signal can be detected by the real-time measuring instrument. Several protocols have been developed to detect different CYP2D6 genotypes by these two methods.

[0009] Additionally, a special microarray chip for the detection of several CYP2D6 alleles has been developed by Roche based on the Affymetrix platform, called

AmpliChip. In this case, a high number of different probes are targeted to the different numbers of CYP2D6 mutations, and detection also is done with different fluorophores.

[0010] Genotyping the CYP gene in an easy, fast and cost-effective manner remains a challenge, however. Only a small number of mutations can be detected quickly and cost-effectively by sequencing and real-time PCR. This small number of detectable alleles is not enough to accurately guide drug treatment decisions for patients. While Roche's AmpliChip can detect all relevant mutations in the CYP2D6 gene in one run, the procedure takes much longer and costs much more as compared to the methods set forth in the present invention. The AmpliChip technology is based on the use of fluorescence, so the most important drawback is the high-priced equipment. The required AmpliChip reader has a 20 times higher price than the reader used in this invention, and the lab personnel has to be specifically trained to perform the AmpliChip gene test. The utilization of fluorescence requires reagents that are very high priced compared to the colorimetric reagents used in the various embodiments of the invention disclosed herein.

SUMMARY OF INVENTION

[0011] The invention provides kits, compositions (such as macroarray chips) and methods for determining alleles of the CYP2D6 gene in a target. One advantage provided by various embodiments of the invention described herein is the fast, easy and cost-effective determination of the presence of the most relevant poor metabolizer alleles of the CYP2D6 gene to obtain an exact and credible assessment of a patient's CYP2D6 related metabolism. The speed of the method is more than two fold better than competitive methods. Simple, compact, reasonably priced equipment can be used, facilitating the availability of testing in a larger number of laboratories. Since the macroarray chip can be integrated into a common 1.5 mL lab tube in some

embodiments, no specialized equipment has to be purchased from the laboratory and lab personnel require no special training. [0012] Furthermore, due to the utilization of a precipitation reaction for detection instead of fluorescence as done by the competitive technologies described above, reagents cost less. Moreover, the result of the genotyping can be read out by a cost- effective reader or a microscope, since due to the precipitation, the detection is principally based on colorimetry and no expensive fluorescence based detection system has to be used.

BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figs. 1-4 show various probes that may be used in the invention.

DESCRIPTION OF EMBODIMENTS

OVERVIEW

[0014] The present invention provides kits, compositions and methods for detecting the presence or absence of various alleles of various genes in a target nucleic acid. The alleles are characterized by single nucleotide polymorphisms (SNPs), insertions, deletions or any combination thereof, all relative to a parent (e.g., wildtype, major allele or other allele) sequence. The investigated variations are connected to varying levels of CYP2D6 enzyme activity, which in turn lead to an increased risk for severe side effects and toxicities due to drug therapies in the case of poor metabolizers or a risk that a drug will be metabolized before having its intended effect in the case of ultra-rapid metabolizers.

[0015] Analysis of the CYP2D6 gene can help to reduce the risk of drug toxicity or ineffectiveness by anticipating the catalytic function of the CYP2D6 enzyme for each individual patient. With the assays disclosed herein, patients bearing variants leading to a decreased or increased enzyme activity can be identified prior to therapy initiation and can be treated accordingly with lower or higher doses or alternative medications if applicable. Genotyping of CYP2D6 variants can help to optimize and individualize drug therapies to prevent undesired effects and lower the costs that emerge from prolonged hospitalization and the treatment of adverse reactions. Gene variants that are useful in these regards include those associated with the following CYP2D6 allele panels: *3, *4, *5, *6, *7, *8, * 11, * 12, * 19, *40 and any combination thereof.

[0016] Accordingly, the invention provides kits, compositions and methods for detecting the presence or absence of a target nucleic acid sequence, particularly those comprising a CYP2D6 sequence or a variant thereof, in a sample. The term "sample" used herein refers to a specimen or culture and includes liquids, gases and solids, including for example tissue. In exemplary embodiments, a sample is obtained from a subject, for example, a mammal, preferably a human. A sample could be a fluid obtained from a subject including, for example, whole blood or a blood derivative (e.g. serum, plasma, or blood cells), ovarian cyst fluid, ascites, lymphatic, cerebrospinal or interstitial fluid, saliva, mucous, sputum, sweat, urine, or any other secretion, excretion, or other bodily fluids. As will be appreciated by those in the art, virtually any experimental manipulation or sample preparation steps may have been done on the sample. For example, wash steps may be applied to a sample. In an exemplary embodiment, the sample comprises blood, such as whole blood. In various

embodiments, the sample comprises extracted nucleic acid. For example, the sample may be a buffer containing extracted nucleic acid. In various embodiments, a target sequence is measured directly in a subject without the need to obtain a separate sample from the patient.

[0017] If required, the target sequence is prepared using known techniques. For example, the sample may be treated to lyse the cells, using known lysis buffers, electroporation, etc., with purification and/or amplification as needed, as will be appreciated by those in the art. Suitable amplification techniques can be done, with PCR finding particular use in the invention as described herein.

KITS

[0018] Provided herein are kits useful for detecting the presence or absence of a nucleic acid (or nucleic acid sequence) in a sample. The term "nucleic acid",

"oligonucleotide" or "polynucleotide" herein means at least two nucleotides covalently linked together. A nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases (for example to stabilize the capture probes) the nucleic acids may have alternate backbones as known in the art.

[0019] Nucleic acids detected using the kits described herein may be referred to interchangeably as "target", "target species", "target nucleic acid" or "target sequence." A target sequence may be a portion or the entire length of a gene, a regulatory sequence, genomic DNA, cDNA, RNA including mRNA and rRNA, the complements of any of these and others. In exemplary embodiments, a target sequence is a portion of genomic DNA, especially a portion containing a sequence of an allele of a gene disclosed herein. In exemplary embodiments, a target sequence is an allele of the CYP2D6 gene or a fragment thereof.

[0020] The target sequence may in some embodiments be a secondary target such as a product of an amplification reaction, such as PCR, (e.g. an "amplicon") etc., as applied to, for example, a portion or the entire length of a gene, a regulatory sequence, genomic DNA, cDNA, RNA including mRNA and rRNA, the complements of any of these and the like. In some embodiments, the complement of a target sequence may be usefully detected and can provide the same information as detecting the target sequence. In some cases it is possible to detect an allele in a sense (i.e. plus) strand, antisense (i.e. minus) strand, or both, depending on the assay.

[0021] Target sequences may be of any length, with the understanding that longer sequences are more specific. As is outlined more fully below, capture probes are made to hybridize to target sequences to determine the presence or absence of the target sequence in a sample.

[0022] The target sequence may also be comprised of different target domains; for example, a first target domain of the sample target sequence may hybridize to a capture probe (which is optionally immobilized on a solid support) and a second target domain may hybridize to a label probe (e.g. a "sandwich assay" format). The target domains may be adjacent or separated as indicated. Unless specified, the terms "first" and "second" are not meant to confer an orientation of the sequences with respect to the 5'- 3' orientation of the target sequence. For example, assuming a 5 '-3' orientation of the target sequence, the first target domain may be located either 5 ' to the second domain, or 3 ' to the second domain.

[0023] As is more fully outlined below, the target sequence comprises a position for which sequence information is desired, generally referred to herein as the "detection position." In some embodiments, the detection position comprises a single nucleotide, In some embodiments, a detection position comprises a plurality of nucleotides, either contiguous with each other or separated by one or more nucleotides. In exemplary embodiments, the detection position in a target sequence corresponds to a potential SNP in a CYP gene that results in expression of a variant CYP protein with a varied capacity to metabolize a substrate, for example, tamoxifen. As used herein, the base of a capture probe that basepairs with the detection position base in a hybrid is termed the

"interrogation position." In other words, for example, if a target sequence is an allele characterized by "A" or "G" at a polymorphic position, then the corresponding interrogation position in two capture probes could comprise "T" or "C" respectively, and vice versa, with other combinations possible.

[0024] Of particular use in the present invention are macroarray or biochip assays. By "macroarray", "biochip" or "chip" herein is meant a composition generally comprising a solid support or substrate to which a capture probe is attached. Thus, in exemplary embodiments, a kit comprises a solid support. The term "solid support" or "substrate" refers to any material that can be modified to contain discrete individual sites appropriate for the attachment or association of a capture probe, described below. Suitable substrates include metal surfaces such as gold, electrodes, glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polycarbonate, polyurethanes, Teflon, derivatives thereof, etc.), polysaccharides, nylon or

nitrocellulose, resins, mica, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, fiberglass, ceramics, GETEK (a blend of polypropylene oxide and fiberglass) and a variety of other polymers.

[0025] A number of different biochip array platforms as known in the art may be used. For example, the compositions and methods of the present invention can be implemented with array platforms such as GeneChip (Affymetrix), CodeLink Bioarray (Amersham), Expression Array System (Applied Biosystems), SurePrint microarrays (Agilent), Sentrix LD BeadChip or Sentrix Array Matrix (Illumina) and Verigene (Nanosphere).

[0026] Of particular use in the kits, compositions and methods disclosed herein are solid supports provided in a ClonDiag™ platform. The ClonDiag™ platform may refer to Array Tube or ArrayStrip, as provided by Alere Technologies GmbH (Germany), and can also include readers or other analytical devices such as ArrayMate and ATR03 by the same company. In various embodiments, a solid support is a component of

Array Tube (AT). One unique feature of the Array Tube is the combination of a micro probe array (the biochip) and micro reaction vial. Accordingly, in some embodiments, a combination of a micro probe array (the biochip or solid support) and micro reaction vial is used in place of an array or solid support alone. In addition to Array Tube, the ClonDiag ArrayStrip (AS) can be used. The ArrayStrip provides a 96-well format for high volume testing. Each ArrayStrip consists of a standard 8-well strip with a microarray integrated into the bottom of each well. Up to 12 ArrayStrips can be inserted into one microplate frame enabling the parallel multiparameter testing of up to 96 samples. Thus, in some embodiments, the solid support is a component of a ClonDiag platform, optionally wherein the ClonDiag platform is selected from Array Tube and ArrayStrip. That is, a sample can be contacted with the micro probe array of such a combination for detection of various analytes present in the sample. In exemplary embodiments, a ClonDiag™ platform is used for the colorimetric detection of target sequences. In some embodiments, a solid support comprises a ClonDiag™ chip or ClonDiag™ solid support.

[0027] In various embodiments, where a target sequence is a nucleic acid, detection of the target sequence is done by amplifying and biotinylating the target sequence amplification products contained in a sample and optionally digesting the amplification products. The amplification product (amplicon) is then allowed to hybridize with capture probes contained in the ClonDiag (or other) platform and described below. A solution of a streptavidin-enzyme conjugate, such as Poly horseradish peroxidase (HRP) conjugate solution, is contacted with the platform. After washing, a dye solution such as o-dianisidine substrate solution is contacted with the chip. Oxidation of the dye results in precipitation that can be detected colorimetrically. Further description of the

ClonDiag™ platform is found in Monecke S, Slickers P, Hotzel H et al., Clin Microbiol Infect, 2006, 12: 718-728; Monecke S, Berger-Bachi B, Coombs C et al, Clin

Microbiol Infect, 2007, 13: 236-249; Monecke S, Leube I and Ehricht R, Genome Lett, 2003, 2: 106-118; DE Patent 10201463; US Publication US/2005/0064469 and

ClonDiag, ArrayTube (AT) Experiment Guideline for DNA-Based Applications, version 1.2, 2007, all incorporated by reference in their entirety. Examples of using the

ClonDiag™ platform for genotyping is described in Sachse K et al., BMC

Microbiology, 2008, 8: 63; Monecke S and Ehricht R, Clin Microbiol Infect, 2005, 11 : 825-833; and Monecke S et al, Clin Microbiol Infect, 2008, 14(6): 534-545. One of skill in the art will appreciate that numerous other dyes that react with a peroxidase can be utilized to produce a colorimetric change, such as 3,3',5,5'-tetramethylbenzidine (TMB). Such dyes may be referred to as a "precipitating agent" herein. If solid supports other than that of the ClonDiag™ platform are used, attachment and immobilization of the capture probes are done according to methods known in the art.

[0028] In various exemplary embodiments, detection and measurement of target species utilizes colorimetric methods and systems in order to provide an indication of binding of a target species. In colorimetric methods, the presence of a bound target species will result in a change in the absorbance or transmission of light by a sample at one or more wavelengths. Detection of the absorbance or transmission of light at such wavelengths thus provides an indication of the presence of the target species.

[0029] In some embodiments, a detection system for colorimetric methods includes any device that can be used to measure colorimetric properties as discussed above. Generally, the device is a spectrophotometer, a colorimeter or any device that measures absorbance or transmission of light at one or more wavelengths. In various

embodiments, the detection system comprises a light source; a wavelength filter or monochromator; a sample container such as a cuvette or a reaction vial; a detector, such as a photoresistor, that registers transmitted light; and a display or imaging element. In some embodiments, a colorimetric change is detected by inspection by the naked eye.

[0030] Transmission detection and analysis may be performed with a ClonDiag AT reader instrument. Suitable reader instruments and detection devices include the ArrayTube Workstation ATS, ArrayMate and the ATR 03. The ArrayStrip can be processed using the ArrayStrip Processor ASP, which performs all liquid handling, incubation, and detection steps required in array based analysis. [0031] The invention provides numerous kits for genotyping the CYP2D6 gene. Kits can be used for performing any of the methods disclosed herein for a number of medical (including diagnostic and therapeutic), industrial, forensic and research applications. Kits may comprise a portable carrier, such as a box, carton, tube or the like, having in close confinement therein one or more containers, such as vials, tubes, ampoules, bottles, pouches, envelopes and the like. In various embodiments, a kit comprises one or more components selected from one or more media or media ingredients and reagents for the measurement of the various target species disclosed herein. For example, kits of the invention may also comprise, in the same or different containers, in any

combination, one or more DNA polymerases, one or more primers, one or more probes, one or more binding ligands, one or more suitable buffers, one or more nucleotides (such as deoxynucleoside triphosphates (dNTPs) and preferably labeled dNTPs, such as biotin labeled dNTPs), one or more detectable labels and markers and one or more solid supports, any of which is described herein. The components may be contained within the same container, or may be in separate containers to be admixed prior to use. The kits of the present invention may also comprise one or more instructions or protocols for carrying out the methods of the present invention. The kits may comprise a detector for detecting a signal generated through use of the components of the invention in conjunction with a sample. The kits may also comprise a computer or a component of a computer, such as a computer-readable storage medium or device. Examples of storage media include, without limitation, optical disks such as CD, DVD and Blu-ray Discs (BD); magneto-optical disks; magnetic media such as magnetic tape and internal hard disks and removable disks; semi-conductor memory devices such as EPROM,

EEPROM and flash memory; and RAM. The computer-readable storage medium may comprise software for data analysis or for encoding references to the various therapies, treatment regimens, risk classifications and instructions. The software may be interpreted by a computer to provide the practitioner with such information. Generally, any of the methods disclosed herein can comprise using any of the kits (comprising primers, probes, enzymes, labels, ligands, solid supports and other components, in any combination) disclosed herein.

Probes

[0032] In exemplary embodiments, a kit described herein comprises a solid support comprising a capture probe set. Capture probes sets comprise a plurality of "capture probes," which are compounds used to detect the presence or absence of, or to quantify, relatively or absolutely, a target species or target sequence. Generally, a capture probe allows the attachment of a target sequence to a solid support for the purposes of detection as further described herein. Attachment of the target species to the capture binding ligand can be direct or indirect and can be covalent or noncovalent. Capture probes that bind directly to a target species may be said to be "selective" for,

"specifically bind" or "selectively bind" their target. It should be noted that capture probes are designed to be perfectly or substantially complementary to either of the strands (e.g. either the sense or the antisense strand) of a double stranded

polynucleotide, such as a gene. Thus, in some cases, a capture probe described herein is perfectly or substantially complementary to the sense strand; that is, assuming the sense strand is referred to as "Watson", the capture probe would be "Crick". In some cases, a capture probe described herein is perfectly or substantially complementary to the antisense strand. For detecting a SNP, a capture probe selective for an allele of a gene typically spans the one or more nucleic acids that differs from corresponding nucleic acids in a different allele of a gene. For detecting an insertion, a capture probe selective for an allele of a gene typically spans one or more nucleic acids that are present compared to the corresponding site in a different allele of a gene in which the nucleic acids are absent. For detecting a deletion, a capture probe selective for an allele of a gene typically spans a site where one or more nucleic acids are absent compared to the corresponding site in a different allele of a gene in which the nucleic acids are present.

[0033] Capture probes that "selectively bind" to or are "selective" for (i.e., are "complementary" or "substantially complementary" to) a target nucleic acid find use in the present invention. "Complementary" or "substantially complementary" refers to the hybridization or base pairing or the formation of a duplex between nucleotides or nucleic acids, such as, for instance, between the two strands of a double stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single stranded nucleic acid. Complementary nucleotides are, generally, A and T (or A and U), or C and G. Two single stranded RNA or DNA molecules may be said to be

substantially complementary when the nucleotides of one strand, optimally aligned and compared and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the nucleotides of the other strand, usually at least about 90%> to 95%, and more preferably from about 98% to 100%, and in some embodiments, at least a percentage selected from 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99%. Where one single stranded RNA or DNA molecule is shorter than another, the two single stranded RNA or DNA molecules may be said to be substantially complementary when the nucleotides of the longer strand, optimally aligned and compared and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the nucleotides of the shorter strand, usually at least about 90%> to 95%, and more preferably from about 98% to 100%, and in some embodiments, at least a percentage selected from 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99%.

Alternatively, substantial complementarity exists (i.e., one sequence is selective for another) when an RNA or DNA strand will hybridize under selective hybridization conditions (for example, stringent conditions or high stringency conditions as known in the art) to its complement. Typically, selective hybridization will occur when there is at least about 65% complementarity over a stretch of at least 14 to 25 nucleotides, preferably at least about 75%, more preferably at least about 90% (or 91 >, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%) complementarity. See, M. Kanehisa, Nucleic Acids Res., 2004, 12: 203. In some embodiments, the term "bind" refers to binding under high stringency conditions. In some embodiments, a capture probe that selectively binds to or is selective for a target is perfectly complementary to the target. In some embodiments, a capture probe that selectively binds to or is selective for a target is substantially complementary to the target.

[0034] "Duplex" means at least two oligonucleotides and/or polynucleotides that are fully or partially complementary undergo Watson-Crick type base pairing among all or most of their nucleotides so that a stable complex is formed. The terms "annealing" and "hybridization" are used interchangeably to mean the formation of a stable duplex. In one embodiment, stable duplex means that a duplex structure is not destroyed by a stringent wash, e.g. conditions including temperature of about 5°C less than the T _m of a strand of the duplex and low monovalent salt concentration, e.g. less than 0.2 M, or less than 0.1 M. "Perfectly matched" in reference to a duplex means that the poly- or oligonucleotide strands making up the duplex form a double stranded structure with one another such that every nucleotide in each strand undergoes Watson-Crick basepairing with a nucleotide in the other strand. The term "duplex" includes the pairing of nucleoside analogs, such as deoxyinosine, nucleosides with 2-aminopurine bases, PNAs, and the like, that may be employed. A "mismatch" in a duplex between two oligonucleotides or polynucleotides means that a pair of nucleotides in the duplex fails to undergo Watson-Crick bonding.

[0035] In exemplary embodiments, each of the probes of a capture probe set is suitable for distinguishing at least two different alleles of a given gene (e.g., CYP2D6). The probes or capture probe sets described herein can be used to determine a polymorphism at a gene locus. As understood in the art, an "allele" refers to a particular alternative form of a gene. For convenience, the term "allele" as used herein can also refer to a combination of alleles at multiple loci that are transmitted together on the same chromosome. That is, an allele can refer to a haplotype. An allele can be characterized, for example, by substitution, insertion or deletion of one or more bases relative to a different allele. A capture probe could thus, in various examples, span a polymorphic site of the gene, span one or more insertions or span nucleic acids flanking a deletion.

[0036] An allele may be referred to in various ways. For example, an allele may be referred to by a substitution of a nucleotide for another in a parent polynucleotide strand (e.g., genomic DNA, mRNA, fragments thereof, amplification products thereof and other polynucleotides disclosed herein) or by the substitution of an amino acid for another in a parent polypeptide strand (e.g., a polypeptide resulting from translation of a polynucleotide). In some instances, a reference to an amino acid substitution

corresponds to a nucleotide variation in the gene that causes that amino acid substitution in the polypeptide resulting from expression of the gene as understood in the art. Where reference is made to a substitution, both a parent molecule (e.g. gene) and a molecule containing the substitution relative to the parent are contemplated and either or both alleles may be probed. Where reference is made to an insertion, both a parent molecule (e.g. gene) and a molecule containing the insertion relative to the parent is contemplated and either or both alleles may be probed. Where reference is made to a deletion, both a parent molecule (e.g. gene) and a molecule containing the deletion relative to the parent is contemplated and either or both alleles may be probed.

[0037] In one embodiment, a capture probe set comprises a probe that is selective for an allele of a gene, e.g., CYP2D6. In one embodiment, a capture probe set comprises a pair of probes, one of which is selective for a first allele of a gene and one of which is selective for a second allele of the gene. In some embodiments, a capture probe set comprises a pair of probes, one of which is selective for a wildtype allele of the gene and one of which is selective for a mutant (or "variant") allele of the gene. The term "wildtype" can in some embodiments refer to a major allele or an allele that is the most frequently occurring allele. The term "variant" can in some embodiments refer to a minor allele or an allele that is not the most frequently occurring allele. In exemplary embodiments, a capture probe set comprises a pair of probes, one of which is selective for a major allele of the gene and one of which is selective for a minor allele of the gene. In some embodiments, a capture probe set comprises more than two probes, each of which is selective for a different allele of the gene. In exemplary embodiments, a capture probe set comprises one or more probes selective for one or more alleles of one or more genes.

[0038] In various embodiments, one, two, three, four, five or six or more probes are used to probe a chosen gene or allele. In various embodiments, the number of probes used to probe a first allele is different from the number of probes used to probe a second allele. In various embodiments, each of the chosen alleles is probed by the same number of probes. Furthermore, additional alleles as known in the art may probed in any combination with any combination of the alleles disclosed herein, using any

combination of primers and probes. In various embodiments, either the forward or reverse sequence of an allele may be probed, i.e., a given sequence corresponding to an allele or its complement may be probed. [0039] The invention provides numerous capture probe sets that can be attached to a solid support. A capture probe set can comprise or consist of any combination of nucleic acids disclosed herein (e.g., in the figures, tables and elsewhere) that are useful for detecting an allele in a gene, e.g. CYP2D6. Thus, each of the probes of the capture probe set should be complementary to at least a portion of a gene. In one embodiment, a capture probe set comprises or consists of a plurality of probes selected from (a) a probe selective for the CYP2D6*3 allele and/or a probe selective for the corresponding wildtype allele, (b) a probe selective for the CYP2D6*4 allele and/or a probe selective for the corresponding wildtype allele, (c) a probe selective for the CYP2D6*5 allele and/or a probe selective for the corresponding wildtype allele, (d) a probe selective for the CYP2D6*6 allele and/or a probe selective for the corresponding wildtype allele, (e) a probe selective for the CYP2D6*7 allele and/or a probe selective for the

corresponding wildtype allele, (f) a probe selective for the CYP2D6*8 allele and/or a probe selective for the corresponding wildtype allele, (g) a probe selective for the CYP2D6* 11 allele and/or a probe selective for the corresponding wildtype allele, (h) a probe selective for the CYP2D6* 12 allele and/or a probe selective for the corresponding wildtype allele, (i) a probe selective for the CYP2D6* 19 allele and/or a probe selective for the corresponding wildtype allele and (j) a probe selective for the CYP2D6*40 allele and/or a probe selective for the corresponding wildtype allele, and in exemplary embodiments, a capture probe set consists of each of these probes.

[0040] In some embodiments, a first capture probe has a low binding affinity for a second allele or a lower binding affinity relative to a second capture probe for the second allele; similarly, the second capture probe has a low binding affinity for the first allele or a lower binding affinity relative to the first capture probe for the first allele. In some embodiments, the first capture probe is perfectly complementary to the first allele and is not perfectly complementary to the second allele, and the second capture probe is perfectly to the second allele and is not perfectly complementary to the first allele.

[0041] In some embodiments, one or more capture probes are used to identify the base at a detection position. In these embodiments, each different probe comprises a different base at an "interrogation position," which will differentially hybridize to a base at the detection position of the target sequence. By using different probes, each with a different base at the interrogation position, the identification of the base at the detection position is elucidated. In some embodiments, a capture probe does not comprise an interrogation position. Such embodiments might be useful for detecting deletion or insertion variants. For example, in some embodiments, a capture probe for a wildtype allele comprises an interrogation position, and a capture probe for a deletion mutant of the allele does not comprise the interrogation position. In some embodiments, an interrogation position in a capture probe for detecting a deletion variant corresponds to a nucleic acid deleted from a parent (e.g. wildtype) polynucleotide. In some

embodiments, a capture probe for a wildtype allele does not comprise an interrogation position, and a capture probe for an insertion mutant of the allele comprises an interrogation position. In some embodiments, an interrogation position in a capture probe for detecting an insertion variant corresponds to a nucleic acid inserted into a parent (e.g. wildtype) polynucleotide.

[0042] In one embodiment, all nucleotides outside of the interrogation position in two or more probes are the same as compared between the probes; that is, in some embodiments it is preferable to use probes that have equal all components other than the interrogation position (e.g. both the length of the probes as well as the non-interrogation bases) to allow good discrimination. In some embodiments, it may be desirable to alter other components, in order to maximize discrimination at the detection position. For example, all nucleotides outside of the interrogation position in two probes may be the same except for one or two nucleic acids added to the end of only one probe.

[0043] As a preliminary matter, the strand that gives the most favorable difference for T _m differences is preferably chosen: G/T is chosen over C/A and G/A over C/T mismatches, for example. In some embodiments, probes are used that have the interrogation base in the middle region of the probe, rather than towards one of the ends. However, as outlined herein, the shifting of the interrogation position within the probe can be used to maximize discrimination in some embodiments.

[0044] For example, in an exemplary embodiment, the perfect match/mismatch discrimination of the probes may be enhanced by changing the binding affinities of bases at and near the mismatch position. For example, sequences that have G-C pairs adjacent to the detection position (or within 3 bases) can hinder good discrimination of match/mismatch. By choosing substitutions in these areas, better discrimination is achieved. For example, this may be done to either destabilize the base pairing in the detection position, or preferably to stabilize the base pairing in the detection position while destabilizing the base pairs in the positions adjacent to the detection position. Base substitutions reduce the number of hydrogen bonds to only two or less hydrogen bonds per base pair without disturbing the stacking structure of the double strand in the area. The amount of destabilization will depend on the chemical nature of the substitution, the number of substitutions and the position of the substitutions relative to the detection position. The local strand destabilization has to be balanced against the loss of specificity of the probe. These substitutions can be either naturally occurring or synthetic base analogs as known in the art.

[0045] In an exemplary embodiment, the discrimination of the capture probes can be altered by altering the length of the probes. For example, as noted above, certain mismatches, such as G/A differences, can be difficult due to the stability of G:T mispairings. By decreasing the standard probe length from 15-25 basepairs to 10-15 basepairs, increased discrimination may be done.

[0046] In addition, matching the T _m s of the different capture probes with their complements allows for good multiplexing; that is, the panel of different alleles to be evaluated need to tested under one set of conditions, and thus the capture probes are designed accordingly.

[0047] Thus, the invention provides capture probes comprising an interrogation position, and in some cases not comprising an interrogation position, that can be used to identify the nucleotide at a number of detection positions within the CYP gene or fragments thereof. In exemplary embodiments, the nucleotide at a detection position corresponds to a SNP of a CYP allele. A capture probe comprising an interrogation position can be used to detect an insertion, deletion or substitution of a nucleotide relative to a parent (e.g., wildtype or variant) nucleic acid.

[0048] In one embodiment, a capture probe comprising an interrogation position is perfectly complementary outside of the interrogation position to a CYP fragment. A capture probe can thus be constructed by identifying an interrogation position and extending a number of nucleotides in the 5 ' direction and a number of nucleotides in the 3' direction. In some embodiments, the extension in either or both directions will be perfectly complementary to a portion of a target sequence. For example, in relation to a reference sequence, for example, a sequence indicated in a dbSNP rs record, the portion of a target sequence can be the nucleotides outside of the polymorphic position

("allelepos") indicated in the sequence. In this way, it could be said that the capture probe spans the polymorphic position. The capture probe can be of any length that permits differential hybridization compared to a second capture probe having the same length but a different nucleotide at the interrogation position. In some embodiments, a capture probe is perfectly complementary to a sequence indicated in a dbSNP rs record. In some embodiments, a capture probe is substantially complementary to a sequence indicated in a dbSNP rs record. In some embodiments, a capture probe is perfectly complementary to a sequence indicated in a dbSNP rs record outside of a polymorphic position. In some embodiments, a capture probe is substantially complementary to a sequence indicated in a dbSNP rs record outside of a polymorphic position.

[0049] Also provided herein are probes that are extended or shortened versions of a probe disclosed herein. For example, a probe disclosed herein can be shortened by 1, 2, 3, 4, 5, or 6 nucleotides, on either or both ends. A probe disclosed herein can be extended by 1, 2, 3, 4, 5, 6 or more nucleotides on either or both ends. The extension can perfectly or substantially complementary to a region of a nucleic acid to which the probe binds before extension. Also provided herein are probes that are of the same length or substantially same length as other probes disclosed herein and that differ therefrom by 1, 2, 3, 4, 5 or 6 nucleotides.

[0050] In some embodiments, the length of a capture probe can be selected from about 10 to about 60 nucleic acids, about 10 to about 50 nucleic acids, about 10 to about 40 nucleic acids and about 10 to about 30 nucleic acids. In some embodiments, the length of a capture probe can be selected from about 15 to about 60 nucleic acids, about 15 to about 55 nucleic acids, about 15 to about 50 nucleic acids, about 15 to about 45 nucleic acids, about 15 to about 40 nucleic acids, about 15 to about 35 nucleic acids, and about 15 to about 30 nucleic acids. In an exemplary embodiment, the length of a capture probe is about 18 to about 33 nucleic acids. What is important is that the set of probes works well together in a multiplex assay as described herein.

[0051] Accordingly, the invention provides a capture probe set (e.g. used in an array comprising the capture probe set, each at a different location) that is used to determine whether a nucleic acid is characterized by any combination of the following CYP2D6 alleles: *3, *4, *5, *6, *7, *8, * 11, * 12, * 19 and *40. In some embodiments, only *3, *4, *5, *6, *7, *8, * 11, * 12, * 19 and *40 alleles are probed.

[0052] As will be appreciated by those in the art, additional capture probes can be included, including negative and positive control sequences. The invention also provides a capture probe set that is used to determine whether a nucleic acid is characterized by CYP2D6 alleles *3, *4, *5, *6, *7, *8, * 11, * 12, * 19, *40 and one more alleles shown in Figures 1-4. In one embodiment, a capture probe set is capable of determining whether a nucleic acid is characterized by CYP2D6 alleles *3, *4, *5, *6, *7, *8, * 11, * 12, * 19 and *40. In some embodiments, a capture probe set is capable of determining whether a nucleic acid is characterized only by CYP2D6 alleles *3, *4, *5, *6, *7, *8, * 11, * 12, * 19 and *40. The invention also provides a capture probe set that is used to determine whether a nucleic acid is characterized by a combination of the CYP2D6 alleles disclosed herein. Any combination of the alleles disclosed herein can be probed.

[0053] Thus, in some embodiments, a capture probe set comprises or consists of a plurality of capture probes useful for detecting the following mutations in the CYP2D6 gene, such as those in Table 1 or Table 2: Table 1

Table 2

[0054] Probes that can be used for detecting any particular allele— for example, a probe set comprising or consisting of a plurality of probes each selective for an allele selected from *3, *4, *5, *6, *7, *8, * 11, * 12, * 19 and *40— are disclosed throughout the present application, particularly in the drawings. In the probe sets, with respect to each particular allele, a probe selective for a wildtype sequence; a probe selective for a mutant sequence; or both a probe selective for a wildtype sequence and a probe selective for a mutant sequence are part of the probe set.

[0055] In Table 1 , the underlined nucleotide represents one or more interrogation positions as discussed herein. The concentration probe indicates if the concentration is in the appropriate range to be valid. In any embodiment, a capture probe set includes or excludes a concentration probe, such as according to SEQ ID NO: 20. Interrogation positions can be readily determined by one of skill in the art through comparison of a mutant probe with a wildtype sequence to determine the difference in one or more bases.

[0056] In some embodiments, a capture probe set includes or excludes a capture probe for detecting the *3 mutation. In some embodiments, a capture probe set includes or excludes a capture probe for detecting the *4 mutation. In some embodiments, a capture probe set includes or excludes a capture probe for detecting the *5 mutation. In some embodiments, a capture probe set includes or excludes a capture probe for detecting the *6 mutation. In some embodiments, a capture probe set includes or excludes a capture probe for detecting the *7 mutation. In some embodiments, a capture probe set includes or excludes a capture probe for detecting the *8 mutation. In some embodiments, a capture probe set includes or excludes a capture probe for detecting the * 11 mutation. In some embodiments, a capture probe set includes or excludes a capture probe for detecting the * 12 mutation. In some embodiments, a capture probe set includes or excludes a capture probe for detecting the * 19 mutation. In some embodiments, a capture probe set includes or excludes a capture probe for detecting the *40 mutation. Any mutation may be conveniently referred to by the change caused in the expressed protein. Also, in some embodiments, a capture probe set includes or excludes a capture probe for detecting the wild-type form of any of these alleles.

[0057] In some embodiments, a capture probe set comprises or consists of: (a) an isolated nucleic acid comprising SEQ ID NO: 1 or its complement, (b) an isolated nucleic acid comprising SEQ ID NO: 2 or its complement, (c) an isolated nucleic acid comprising SEQ ID NO: 3 or its complement, (d) an isolated nucleic acid comprising SEQ ID NO: 4 or its complement, (e) an isolated nucleic acid comprising SEQ ID NO: 5 or its complement, (f) an isolated nucleic acid comprising SEQ ID NO: 6 or its complement, (g) an isolated nucleic acid comprising SEQ ID NO: 7 or its complement, (h) an isolated nucleic acid comprising SEQ ID NO: 8 or its complement, (i) an isolated nucleic acid comprising SEQ ID NO: 9 or its complement, j) an isolated nucleic acid comprising SEQ ID NO: 10 or its complement, (k) an isolated nucleic acid comprising SEQ ID NO: 11 or its complement, (1) an isolated nucleic acid comprising SEQ ID NO: 12 or its complement, (m) an isolated nucleic acid comprising SEQ ID NO: 13 or its complement, (n) an isolated nucleic acid comprising SEQ ID NO: 14 or its complement, (o) an isolated nucleic acid comprising SEQ ID NO: 15 or its complement, (p) an isolated nucleic acid comprising SEQ ID NO: 16 or its complement, (q) an isolated nucleic acid comprising SEQ ID NO: 17 or its complement, (r) an isolated nucleic acid comprising SEQ ID NO: 18 or its complement and (s) an isolated nucleic acid comprising SEQ ID NO: 19 or its complement. In some embodiments, a capture probe set comprises or consists of: (a) an isolated nucleic acid comprising SEQ ID NO: 29 or its complement, (b) an isolated nucleic acid comprising SEQ ID NO: 30 or its complement, (c) an isolated nucleic acid comprising SEQ ID NO: 31 or its complement, (d) an isolated nucleic acid comprising SEQ ID NO: 32 or its complement, (e) an isolated nucleic acid comprising SEQ ID NO: 33 or its complement, (f) an isolated nucleic acid comprising SEQ ID NO: 34 or its complement, (g) an isolated nucleic acid comprising SEQ ID NO: 35 or its complement, (h) an isolated nucleic acid comprising SEQ ID NO: 36 or its complement, (i) an isolated nucleic acid comprising SEQ ID NO: 37 or its complement, (j) an isolated nucleic acid comprising SEQ ID NO: 38 or its complement, (k) an isolated nucleic acid comprising SEQ ID NO: 39 or its complement, (1) an isolated nucleic acid comprising SEQ ID NO: 40 or its complement, (m) an isolated nucleic acid comprising SEQ ID NO: 41 or its complement, (n) an isolated nucleic acid comprising SEQ ID NO: 42 or its complement, (o) an isolated nucleic acid comprising SEQ ID NO: 43 or its complement, (p) an isolated nucleic acid comprising SEQ ID NO: 44 or its complement, (q) an isolated nucleic acid comprising SEQ ID NO: 45 or its complement, (r) an isolated nucleic acid comprising SEQ ID NO: 46 or its complement and (s) an isolated nucleic acid comprising SEQ ID NO: 47 or its complement. In some embodiments, each of the isolated nucleic acids has a length of about 20 to about 50 nucleic acids (or other length described herein). In exemplary embodiments, a capture probe set consists of the isolated nucleic acids in this paragraph. The invention also provides a solid support comprising a capture probe set described in this paragraph. The invention also provides a kit comprising a solid support described in this paragraph. In some embodiments, the solid support is a component of a ClonDiag platform, optionally wherein the ClonDiag platform is selected from Array Tube and Array Strip.

[0058] In some embodiments, a capture probe set comprises or consists of: (a) an isolated nucleic acid consisting of SEQ ID NO: 1 or its complement, (b) an isolated nucleic acid consisting of SEQ ID NO: 2 or its complement, (c) an isolated nucleic acid consisting of SEQ ID NO: 3 or its complement, (d) an isolated nucleic acid consisting of SEQ ID NO: 4 or its complement, (e) an isolated nucleic acid consisting of SEQ ID NO: 5 or its complement, (f) an isolated nucleic acid consisting of SEQ ID NO: 6 or its complement, (g) an isolated nucleic acid consisting of SEQ ID NO: 7 or its

complement, (h) an isolated nucleic acid consisting of SEQ ID NO: 8 or its

complement, (i) an isolated nucleic acid consisting of SEQ ID NO: 9 or its complement, (j) an isolated nucleic acid consisting of SEQ ID NO: 10 or its complement, (k) an isolated nucleic acid consisting of SEQ ID NO: 11 or its complement, (1) an isolated nucleic acid consisting of SEQ ID NO: 12 or its complement, (m) an isolated nucleic acid consisting of SEQ ID NO: 13 or its complement, (n) an isolated nucleic acid consisting of SEQ ID NO: 14 or its complement, (o) an isolated nucleic acid consisting of SEQ ID NO: 15 or its complement, (p) an isolated nucleic acid consisting of SEQ ID NO: 16 or its complement, (q) an isolated nucleic acid consisting of SEQ ID NO: 17 or its complement, (r) an isolated nucleic acid consisting of SEQ ID NO: 18 or its complement and (s) an isolated nucleic acid consisting of SEQ ID NO: 19 or its complement. In some embodiments, a capture probe set comprises or consists of: (a) an isolated nucleic acid consisting of SEQ ID NO: 29 or its complement, (b) an isolated nucleic acid consisting of SEQ ID NO: 30 or its complement, (c) an isolated nucleic acid consisting of SEQ ID NO: 31 or its complement, (d) an isolated nucleic acid consisting of SEQ ID NO: 32 or its complement, (e) an isolated nucleic acid consisting of SEQ ID NO: 33 or its complement, (f) an isolated nucleic acid consisting of SEQ ID NO: 34 or its complement, (g) an isolated nucleic acid consisting of SEQ ID NO: 35 or its complement, (h) an isolated nucleic acid consisting of SEQ ID NO: 36 or its complement, (i) an isolated nucleic acid consisting of SEQ ID NO: 37 or its

complement, j) an isolated nucleic acid consisting of SEQ ID NO: 38 or its

complement, (k) an isolated nucleic acid consisting of SEQ ID NO: 39 or its

complement, (1) an isolated nucleic acid consisting of SEQ ID NO: 40 or its

complement, (m) an isolated nucleic acid consisting of SEQ ID NO: 41 or its complement, (n) an isolated nucleic acid consisting of SEQ ID NO: 42 or its

complement, (o) an isolated nucleic acid consisting of SEQ ID NO: 43 or its

complement, (p) an isolated nucleic acid consisting of SEQ ID NO: 44 or its

complement, (q) an isolated nucleic acid consisting of SEQ ID NO: 45 or its

complement, (r) an isolated nucleic acid consisting of SEQ ID NO: 46 or its

complement and (s) an isolated nucleic acid consisting of SEQ ID NO: 47 or its complement. In exemplary embodiments, a capture probe set consists of the isolated nucleic acids in this paragraph. The invention also provides a solid support comprising a capture probe set described in this paragraph. The invention also provides a kit comprising a solid support described in this paragraph. In some embodiments, the solid support is a component of a ClonDiag platform, optionally wherein the ClonDiag platform is selected from Array Tube and Array Strip.

[0059] In some embodiments, a capture probe set comprises or consists of: (a) an isolated nucleic acid consisting of SEQ ID NO: 1, (b) an isolated nucleic acid consisting of SEQ ID NO: 2, (c) an isolated nucleic acid consisting of SEQ ID NO: 3, (d) an isolated nucleic acid consisting of SEQ ID NO: 4, (e) an isolated nucleic acid consisting of SEQ ID NO: 5, (f) an isolated nucleic acid consisting of SEQ ID NO: 6, (g) an isolated nucleic acid consisting of SEQ ID NO: 7, (h) an isolated nucleic acid consisting of SEQ ID NO: 8, (i) an isolated nucleic acid consisting of SEQ ID NO: 9, 0 ^' ) an isolated nucleic acid consisting of SEQ ID NO: 10, (k) an isolated nucleic acid consisting of SEQ ID NO: 11, (1) an isolated nucleic acid consisting of SEQ ID NO: 12, (m) an isolated nucleic acid consisting of SEQ ID NO: 13, (n) an isolated nucleic acid consisting of SEQ ID NO: 14, (o) an isolated nucleic acid consisting of SEQ ID NO: 15, (p) an isolated nucleic acid consisting of SEQ ID NO: 16, (q) an isolated nucleic acid consisting of SEQ ID NO: 17, (r) an isolated nucleic acid consisting of SEQ ID NO: 18 and (s) an isolated nucleic acid consisting of SEQ ID NO: 19. In some embodiments, a capture probe set comprises or consists of: (a) an isolated nucleic acid consisting of SEQ ID NO: 29, (b) an isolated nucleic acid consisting of SEQ ID NO: 30, (c) an isolated nucleic acid consisting of SEQ ID NO: 31 , (d) an isolated nucleic acid consisting of SEQ ID NO: 32, (e) an isolated nucleic acid consisting of SEQ ID NO: 33, (f) an isolated nucleic acid consisting of SEQ ID NO: 34, (g) an isolated nucleic acid consisting of SEQ ID NO: 35, (h) an isolated nucleic acid consisting of SEQ ID NO: 36, (i) an isolated nucleic acid consisting of SEQ ID NO: 37, (j) an isolated nucleic acid consisting of SEQ ID NO: 38, (k) an isolated nucleic acid consisting of SEQ ID NO: 39, (1) an isolated nucleic acid consisting of SEQ ID NO: 40, (m) an isolated nucleic acid consisting of SEQ ID NO: 41, (n) an isolated nucleic acid consisting of SEQ ID NO: 42, (o) an isolated nucleic acid consisting of SEQ ID NO: 43, (p) an isolated nucleic acid consisting of SEQ ID NO: 44, (q) an isolated nucleic acid consisting of SEQ ID NO: 45, (r) an isolated nucleic acid consisting of SEQ ID NO: 46 and (s) an isolated nucleic acid consisting of SEQ ID NO: 47. In exemplary embodiments, a capture probe set consists of the isolated nucleic acids in this paragraph. The invention also provides a solid support comprising a capture probe set described in this paragraph. The invention also provides a kit comprising a solid support described in this paragraph. In some embodiments, the solid support is a component of a ClonDiag platform, optionally wherein the ClonDiag platform is selected from Array Tube and Array Strip.

[0060] In some embodiments, a capture probe set comprises or consists of a) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 1 and contains T at a position corresponding to position 8 of SEQ ID NO: 1; b) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 2; c) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 3 and contains G at a position

corresponding to position 9 of SEQ ID NO: 3; d) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 4 and contains A at a position corresponding to position 11 of SEQ ID NO: 4; e) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 5; f) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 6 and contains T at a position corresponding to position 10 of SEQ ID NO: 6; g) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 7; h) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 8 and contains T at a position corresponding to position 9 of SEQ ID NO: 8; i) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 9 and contains C at a position corresponding to position 12 of SEQ ID NO: 9; j) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 10 and contains C at a position corresponding to position 12 of SEQ ID NO: 10; k) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 11 and contains T at a position corresponding to position 13 of SEQ ID NO: 11; 1) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 12 and contains C at a position corresponding to position 10 of SEQ ID NO: 12; m) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 13 and contains G at a position corresponding to position 6 of SEQ ID NO: 13; n) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 14 and contains C at a position corresponding to position 12 of SEQ ID NO: 14; o) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 15 and contains A at a position corresponding to position 13 of SEQ ID NO: 15; p) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 16 and contains AACT at positions corresponding to position 11-14 of SEQ ID NO: 15; q) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 17; r) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 18; and s) a capture probe that will hybridize under high stringency conditions to the complement of SEQ ID NO: 19 and contains TTTCGCCCCTTTCGCCCC at positions corresponding to positions 3-20 of SEQ ID NO: 19. In some embodiments, each of the capture probes has a length of about 20 to about 50 nucleic acids. In some embodiments, each of the capture probes has a length of about 20 to about 40 nucleic acids. In some embodiments, each of the capture probes has a length of about 20 to about 30 nucleic acids.

[0061] Additional probes for detecting SNPs of these and other alleles are found in Figures 1-4.

[0062] Any capture probe or capture probe set disclosed herein can be attached to a solid support for the purposes of the invention.

[0063] The invention provides capture probes that can be used to detect one or more variations (e.g., substitutions, insertions or deletions) in a CYP2D6 gene, such as provided in RefSeq Accession Record NG 008376.1 hereby incorporated by reference in its entirety.

[0064] In one embodiment, a capture probe is designed to determine a CYP2D6*3 allele, for example at position 7640 of the CYP2D6 gene according to RefSeq

Accession Record NG 008376.1. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 1, in which T at position 8 (the interrogation position) binds to A in a complementary wild type sequence. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 2, which binds to a complementary deletion variant sequence. Capture probes are designed that target this area, and can be about 10 to about 40 bases long or any other appropriate length described herein in general. In some embodiments, the interrogation position is positioned roughly in the middle of the capture probe. [0065] In some embodiments, SEQ ID NO: 1 and/or SEQ ID NO: 2 are used to probe the *3 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 1 and/or SEQ ID NO: 2. In some embodiments, SEQ ID NO: 29 and/or SEQ ID NO: 30 are used to probe the *3 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 29 and/or SEQ ID NO: 30.

[0066] In one embodiment, a capture probe is designed to determine a CYP2D6*4 allele, for example at position 6937 of the CYP2D6 gene according to RefSeq

Accession Record NG 008376.1. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 3, in which G at position 9 (the interrogation position) binds to C in a complementary wild type sequence. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 4, in which A at position 11 (the interrogation position) binds to G at the detection position in a complementary variant sequence. Capture probes are designed that target this area, and can be about 10 to about 40 bases long or any other appropriate length described herein in general. In some embodiments, the interrogation position is positioned roughly in the middle of the capture probe.

[0067] In some embodiments, SEQ ID NO: 3 and/or SEQ ID NO: 4 are used to probe the *4 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 3 and/or SEQ ID NO: 4. In some embodiments, SEQ ID NO: 31 and/or SEQ ID NO: 32 are used to probe the *4 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 31 and/or SEQ ID NO: 32.

[0068] In one embodiment, a capture probe is designed to determine a CYP2D6*5 allele. The *5 allele represents a whole gene deletion.

[0069] In some embodiments, SEQ ID NO: 5 is used to probe the *5 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 5. In some embodiments, SEQ ID NO: 33 is used to probe the *5 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 33.

[0070] In one embodiment, a capture probe is designed to determine a CYP2D6*6 allele, for example at position 6798 of the CYP2D6 gene according to RefSeq

Accession Record NG 008376.1. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 6, in which T at position 10 (the interrogation position) binds to A in a complementary wild type sequence. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 7, binds to a complementary deletion variant sequence. Capture probes are designed that target this area, and can be about 10 to about 40 bases long or any other appropriate length described herein in general. In some embodiments, the interrogation position is positioned roughly in the middle of the capture probe. [0071] In some embodiments, SEQ ID NO: 6 and/or SEQ ID NO: 7 are used to probe the *6 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 6 and/or SEQ ID NO: 7. In some embodiments, SEQ ID NO: 34 and/or SEQ ID NO: 35 are used to probe the *6 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 34 and/or SEQ ID NO: 35.

[0072] In one embodiment, a capture probe is designed to determine a CYP2D6*7 allele, for example at position 8026 of the CYP2D6 gene according to RefSeq

Accession Record NG 008376.1. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 8, in which T at position 9 (the interrogation position) binds to A in a complementary wild type sequence. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 9, in which C at position 12 (the interrogation position) binds to G at the detection position in a complementary variant sequence. Capture probes are designed that target this area, and can be about 10 to about 40 bases long or any other appropriate length described herein in general. In some embodiments, the interrogation position is positioned roughly in the middle of the capture probe.

[0073] In some embodiments, SEQ ID NO: 8 and/or SEQ ID NO: 9 are used to probe the *7 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 8 and/or SEQ ID NO: 9. In some embodiments, SEQ ID NO: 36 and/or SEQ ID NO: 37 are used to probe the *7 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 36 and/or SEQ ID NO: 37.

[0074] In one embodiment, a capture probe is designed to determine a CYP2D6*8 allele, for example at position 6849 of the CYP2D6 gene according to RefSeq

Accession Record NG 008376.1. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 10, in which C at position 12 (the interrogation position) binds to G in a complementary wild type sequence. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 11, in which T at position 13 (the

interrogation position) binds to A at the detection position in a complementary variant sequence. Capture probes are designed that target this area, and can be about 10 to about 40 bases long or any other appropriate length described herein in general. In some embodiments, the interrogation position is positioned roughly in the middle of the capture probe.

[0075] In some embodiments, SEQ ID NO: 10 and/or SEQ ID NO: 11 are used to probe the *8 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 10 and/or SEQ ID NO: 11. In some embodiments, SEQ ID NO: 38 and/or SEQ ID NO: 39 are used to probe the *8 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 38 and/or SEQ ID NO: 39. [0076] In one embodiment, a capture probe is designed to determine a CYP2D6* 11 allele, for example at position 5972 of the CYP2D6 gene according to RefSeq

Accession Record NG 008376.1. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 12, in which C at position 10 (the interrogation position) binds to G in a complementary wild type sequence. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 13, in which G at position 6 (the interrogation position) binds to C at the detection position in a complementary variant sequence. Capture probes are designed that target this area, and can be about 10 to about 40 bases long or any other appropriate length described herein in general. In some embodiments, the interrogation position is positioned roughly in the middle of the capture probe.

[0077] In some embodiments, SEQ ID NO: 12 and/or SEQ ID NO: 13 are used to probe the * 11 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 12 and/or SEQ ID NO: 13. In some embodiments, SEQ ID NO: 40 and/or SEQ ID NO: 41 are used to probe the * 11 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 40 and/or SEQ ID NO: 41.

[0078] In one embodiment, a capture probe is designed to determine a CYP2D6* 12 allele, for example at position 5214 of the CYP2D6 gene according to RefSeq

Accession Record NG 008376.1. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 14, in which C at position 12 (the interrogation position) binds to G in a complementary wild type sequence. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 15, in which A at position 13 (the

interrogation position) binds to T at the detection position in a complementary variant sequence. Capture probes are designed that target this area, and can be about 10 to about 40 bases long or any other appropriate length described herein in general. In some embodiments, the interrogation position is positioned roughly in the middle of the capture probe.

[0079] In some embodiments, SEQ ID NO: 14 and/or SEQ ID NO: 15 are used to probe the * 12 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 14 and/or SEQ ID NO: 15. In some embodiments, SEQ ID NO: 42 and/or SEQ ID NO: 43 are used to probe the * 12 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 42 and/or SEQ ID NO: 43.

[0080] In one embodiment, a capture probe is designed to determine a CYP2D6* 19 allele, for example having a deletion at positions 7630-7633 of the CYP2D6 gene according to RefSeq Accession Record NG 008376.1. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 16, in which a sequence AACT at positions 11-14 (the interrogation position) binds to TTGA in a complementary wild type sequence. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 17, which binds to a complementary deletion variant sequence. Capture probes are designed that target this area, and can be about 10 to about 40 bases long or any other appropriate length described herein in general. In some embodiments, the interrogation position is positioned roughly in the middle of the capture probe.

[0081] In some embodiments, SEQ ID NO: 16 and/or SEQ ID NO: 17 are used to probe the * 19 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 16 and/or SEQ ID NO: 17. In some embodiments, SEQ ID NO: 44 and/or SEQ ID NO: 45 are used to probe the * 19 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 44 and/or SEQ ID NO: 45.

[0082] In one embodiment, a capture probe is designed to determine a CYP2D6*40 allele, which represents, for example, a TTTCGCCCCTTTCGCCCC insertion after position 6954 of the CYP2D6 gene according to RefSeq Accession Record

NG 008376.1. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 18, which binds to a complementary wild type sequence. In one embodiment, a capture probe has a sequence according to SEQ ID NO: 19, in which the sequence TTTCGCCCCTTTCGCCCC at positions 3-20 (the interrogation positions) binds to AAAGCGGGGAAAGCGGGG at the detection positions in a complementary variant sequence. Capture probes are designed that target this area, and can be about 10 to about 40 bases long or any other appropriate length described herein in general. In some embodiments, the interrogation position is positioned roughly in the middle of the capture probe.

[0083] In some embodiments, SEQ ID NO: 18 and/or SEQ ID NO: 19 are used to probe the *40 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 18 and/or SEQ ID NO: 19. In some embodiments, SEQ ID NO: 46 and/or SEQ ID NO: 47 are used to probe the *40 status of a patient. In some embodiments, a solid support comprises SEQ ID NO: 46 and/or SEQ ID NO: 47.

[0084] In some embodiments, the invention provides a capture probe comprising an isolated nucleic acid comprising any one of SEQ ID NOS: 1-19, wherein the isolated nucleic acid has about a length of about 10 to about 50 nucleic acids. In some embodiments, the invention provides a capture probe comprising an isolated nucleic acid comprising any one of SEQ ID NOS: 29-47, wherein the isolated nucleic acid has about a length of about 10 to about 50 nucleic acids. Other possible lengths are disclosed herein.

[0085] In some embodiments, a solid support of the invention comprises the capture probe set of SEQ ID NOS: 1-19. In some embodiments, a solid support of the invention consists of the capture probe set of SEQ ID NOS: 1-19. In some embodiments, a solid support comprises a plurality of capture probes selected from the combination of SEQ ID NOS: 1-19 and the sequences of FIGS. 1-4. In some embodiments, a solid support comprises a probe set wherein each of the probes is an isolated nucleic acid comprising or consisting of a sequence selected from SEQ ID NOS: 1-19 and the sequences disclosed in Figs. 1-4, optionally wherein each of the isolated nucleic acids has a length of about 20 to about 50 nucleic acids (or any other length or length range herein).

[0086] In some embodiments, a solid support of the invention comprises the capture probe set of SEQ ID NOS: 29-47. In some embodiments, a solid support of the invention consists of the capture probe set of SEQ ID NOS: 29-47. In some

embodiments, a solid support comprises a plurality of capture probes selected from the combination of SEQ ID NOS: 29-47 and the sequences of FIGS. 1-4. In some embodiments, a solid support comprises a probe set wherein each of the probes is an isolated nucleic acid comprising or consisting of a sequence selected from SEQ ID NOS: 29-47 and the sequences disclosed in Figs. 1-4, optionally wherein each of the isolated nucleic acids has a length of about 20 to about 50 nucleic acids (or any other length or length range herein).

[0087] In one embodiment, a capture probe comprising an interrogation position is perfectly complementary outside of the interrogation position to a CYP2D6 fragment except for a number of mismatches. In exemplary embodiments, the number of mismatches is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 mismatches.

[0088] Accordingly, the invention provides a capture probe comprising or consisting of an isolated nucleic acid comprising a variant of a sequence selected from SEQ ID NOS: 1-19 (and optionally the sequences of FIGS. 1-4), wherein the isolated nucleic acid is varied at 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 positions outside of the interrogation position compared to the selected sequence. The invention also provides a capture probe comprising or consisting of an isolated nucleic acid consisting of a variant of a sequence selected from SEQ ID NOS: 1-19 (and optionally the sequences of FIGS. 1-4), wherein the isolated nucleic acid is varied at 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 positions outside of the interrogation position compared to the selected sequence. As will be understood in the art, in one embodiment, a capture probe for detecting a deletion mutant does not comprise an interrogation position, and in that embodiment, the capture probe comprises an isolated nucleic acid consisting of a variant of the sequence wherein the isolated nucleic acid is varied at 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 positions compared to the selected sequence.

[0089] the invention provides a capture probe comprising or consisting of an isolated nucleic acid comprising a variant of a sequence selected from SEQ ID NOS: 29-47 (and optionally the sequences of FIGS. 1-4), wherein the isolated nucleic acid is varied at 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 positions outside of the interrogation position compared to the selected sequence. The invention also provides a capture probe comprising or consisting of an isolated nucleic acid consisting of a variant of a sequence selected from SEQ ID NOS: 29-47 (and optionally the sequences of FIGS. 1-4), wherein the isolated nucleic acid is varied at 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 positions outside of the interrogation position compared to the selected sequence. As will be understood in the art, in one embodiment, a capture probe for detecting a deletion mutant does not comprise an interrogation position, and in that embodiment, the capture probe comprises an isolated nucleic acid consisting of a variant of the sequence wherein the isolated nucleic acid is varied at 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 positions compared to the selected sequence.

[0090] In one embodiment, a length and/or a base variation, as discussed above, may be applied to any of SEQ ID NO: 1-19 and the sequences of FIGS. 1-4 to generate an additional probe that will target the corresponding CYP2D6 allele. In one embodiment, a length and/or a base variation, as discussed above, may be applied to any of SEQ ID NO: 29-47 and the sequences of FIGS. 1-4 to generate an additional probe that will target the corresponding CYP2D6 allele.

[0091] Further probes that may be of use in the invention for determining CYP2D6 alleles are described in Figures 1-4.

[0092] In one embodiment, a solid support comprises one or more probes for positive control primers. Examples of such probes include:

GCACCCCCTGGATCCAGGTAAGGC (SEQ ID NO: 21)

AAGCACCCCCTGAATCCAGGTAAGGC (SEQ ID NO: 22)

[0093] In some embodiments, at least one probe needs a signal higher than 0.1 to show that the experiment is valid. Any of these probes may be included or excluded from a probe set or a kit of the invention.

[0094] The probes can be specifically designed to detect the relevant mutations, as compared with other techniques, e.g. the AmpliChip, which use much larger sets. The AmpliChip carries a set of probes just varying in the position to the mutation, with one set for the wild type and one set for the mutated allele. For genotyping, the mean value of all probes is calculated. This approach leads to increased production cost, since a high number of probes have to be used to detect each mutation.

[0095] In order to identify the optimal probe for each mutation, a complex experimental evaluation was performed. Thus, fewer probes have to be spotted on the macroarray chip itself and production costs decrease enormously. Primers

[0096] The invention also provides primers that are useful for genotyping the

CYP2D6 gene to determine the SNP status of a patient using the capture probe set(s) outlined herein. Additionally, primer sets are provided that include any combination of the primers disclosed herein. The kits described herein can comprise a primer set comprising or consisting of any combination of primers disclosed herein. Any primer can also be modified to hybridize to the CYP2D6 gene (e.g., any allele thereof) under stringent conditions, high stringency conditions or other appropriate conditions as known in the art.

[0097] In general, current SNP detection methods utilize a first amplification step such as PCR to amplify sections of a CYP2D6 gene. As will be appreciated by those in the art, the size of the CYP2D6 gene is large, and thus small fragments can be amplified to allow more efficient and less expensive processing. In addition, a label or a detectable label is preferably added during the amplification step. The primers disclosed herein can be allowed to bind to a target sequence (e.g., a nucleic acid comprising or consisting of an allele of CYP2D6, or a fragment thereof) and can be extended using polymerases known in the art.

[0098] Thus, in one embodiment, a target sequence comprises a detectable label, as described herein. A "label", "detectable label" or "detectable marker" used

interchangeably herein is an atom (such as an isotope) or molecule attached to a compound to enable the detection of the compound. In general, labels fall into four classes: a) isotopic labels, which may be radioactive or heavy isotopes; b) magnetic, electrical, thermal; c) colored or luminescent dyes; and d) enzymes, although labels include particles such as magnetic particles as well. The dyes may be chromophores or phosphors but in some exemplary embodiments are fluorescent dyes, which because of their strong signals provide a good signal-to-noise ratio for decoding. Suitable dyes for use in the invention include, but are not limited to, fluorescent lanthanide complexes, including those of europium and terbium, fluorescein, rhodamine,

tetramethylrhodamine, eosin, erythrosin, coumarin, methyl-coumarins, pyrene, Malacite green, stilbene, Lucifer Yellow, Cascade Blue, Texas Red, Alexa dyes and others described in Molecular Probes Handbook (6th ed.) by Richard P. Haugland. Additional labels include nanocrystals or Q-dots as described in US Patent 6,544,732.

[0099] A detectable label can be incorporated in a variety of ways for detection of a target sequence. In various embodiments, the target sequence is labeled; binding of the target sequence thus provides the label at the surface of the solid support. In various embodiments, a sandwich format is utilized, in which a target sequence is unlabeled. In these embodiments, a capture probe is attached to a detection surface as described herein, and a soluble binding ligand (also referred to as a "signaling probe," "label probe" or "soluble capture ligand") binds independently to the target sequence and either directly or indirectly comprises at least one label or detectable marker. A detectable label may refer to one or more components of a set of binding partners forming a binding complex. Thus, in various embodiments, a detectable label comprises (a) biotin, (b) biotin bound to streptavidin or (c) biotin bound to a streptavidin conjugate. In various embodiments, the detectable label comprises an enzyme (for example, horseradish peroxidase (HRP)). In various embodiments, the enzyme is a conjugated enzyme (for example, HRP-streptavidin). In various embodiments, the system relies on detecting the precipitation of a reaction product or on a change in, for example, electronic properties for detection. In various embodiments, none of the compounds comprises a label.

[00100] In exemplary embodiments, a detectable label is added to the target sequence during amplification of the target through the use of either labeled primers or labeled dNTPs, both of which are well known in the art. Labeled dNTPs could thus be incorporated during amplification. In some embodiments, each of the primers comprises a detectable label.

[00101] A detectable label can either be a primary or secondary label. A primary label produces a detectable signal that can be directly detected. For example, the label on a primer or a dNTP is a primary label such as a fluorophore. Alternatively, a label may be a secondary label, such as biotin or an enzyme. A secondary label requires additional reagents that lead to the production of a detectable signal. A secondary label is one that is indirectly detected; for example, a secondary label can bind or react with a primary label for detection, can act on an additional product to generate a primary label, or may allow the separation of the compound comprising the secondary label from unlabeled materials, etc. Secondary labels include, but are not limited to, one of a binding partner pair, such as biotin; chemically modifiable moieties; nuclease inhibitors; enzymes such as horseradish peroxidase; alkaline phosphatases; lucifierases, etc. Secondary labels can also include additional labels.

[00102] In some embodiments, the primers or dNTPs are labeled with biotin, which can then be contacted with a streptavidin/label complex. In some embodiments, the streptavidin/label complex comprises a fluorophore. In exemplary embodiments, the streptavidin/label complex comprises an enzymatic label. For example, the enzymatic label can be horseradish peroxidase, and upon contact with a precipitating agent, such as 3,3',5,5'-tetramethylbenzidine (TMB) or o-dianisidine (3,3'-dimethoxybenzidine (dihydrochloride), Fast Blue B), an optically detectable precipitation reaction occurs. This has a particular benefit in that the optics for detection do not require the use of a fluorimeter or other detector, which can add to the expense of carrying out the methods.

[00103] In various embodiments, the secondary label is a binding partner pair. For example, the label may be a hapten or antigen, which will bind its binding partner. Suitable binding partner pairs include, but are not limited to: antigens (such as a polypeptide) and antibodies (including fragments thereof (FAbs, etc.)); other polypeptides and small molecules, including biotin/streptavidin; enzymes and substrates or inhibitors; other protein-protein interacting pairs; receptor-ligands; and carbohydrates and their binding partners. Nucleic acid-nucleic acid binding proteins pairs are also useful. In general, the smaller of the pair is attached to the NTP for incorporation into the primer. Preferred binding partner pairs include, but are not limited to, biotin (or imino-biotin) and streptavidin, digeoxinin and Abs, and Prolinx™ reagents.

[00104] Primer pairs can be used to amplify the entire CYP2D6 gene or shorter fragments of the CYP2D6 gene, any of which are then used as the target sequences. Thus, a primer pair suitable for amplifying a gene is also suitable for amplifying a fragment of the gene. In some cases, a single amplicon may contain two or more SNP positions; alternatively, separate amplicons are generated for each SNP location. In some embodiments, a primer pair is used to amplify an entire gene or fragment of the gene, either of which contains a substitution, insertion or deletion relative to another gene or gene fragment. For example, the amplified product could be used to determine the presence or absence of any of the variations shown in Table 1, Table 2, or described elsewhere herein.

[00105] In some embodiments, one or more control primers are used. In various embodiments, any combination of the primers disclosed herein may be used.

[00106] As will be appreciated by those in the art, the length of a primer can vary. In some embodiments, the length of a primer is selected from about 10 to about 60 nucleic acids, about 10 to about 50 nucleic acids, about 10 to about 40 nucleic acids and about 10 to about 30 nucleic acids. In some embodiments, the length of a primer is selected from about 15 to about 60 nucleic acids, about 15 to about 55 nucleic acids, about 15 to about 50 nucleic acids, about 15 to about 45 nucleic acids, about 15 to about 40 nucleic acids, about 15 to about 35 nucleic acids, and about 15 to about 30 nucleic acids. In some embodiments, the length of a primer is about 18 to about 22 nucleic acids. In some embodiments, the length of a primer is about 17 to about 28 nucleic acids. In exemplary embodiments, a primer has a length of about 17 to about 25 nucleic acids. Any set of primers disclosed herein may also be used. Methods

[00107] The invention provides methods for determining a plurality of CYP2D6 alleles characterizing a nucleic acid. Any method of the invention may be carried out using the various probes, primers, solid supports and kits described herein.

[00108] In one aspect, the invention provides a method of detecting one or more polymorphisms (or alleles) in a nucleic acid, the method comprising: (a) generating a plurality of amplicons in a sample comprising the nucleic acid, wherein each of the plurality of amplicons comprises a detectable label; (b) contacting the plurality of amplicons with a solid support of the invention; and (c) detecting the presence or absence of the detectable label, thereby detecting one or more polymorphisms (or alleles) in the nucleic acid. In one embodiment, the generating step comprises contacting the sample with a primer set of the invention or with a primer set of a kit of the invention. The solid support can also be a solid support of a kit of the invention. In exemplary embodiments, the plurality of alleles is any combination of the alleles disclosed herein (e.g. a panel of CYP2D6 alleles, such as CYP2D6*3, CYP2D6*4, CYP2D6*5, CYP2D6*6, CYP2D6*7, CYP2D6*8, CYP2D6* 11, CYP2D6* 12, CYP2D6* 19 and CYP2D6*40). In these and other methods, the nucleic acid is typically one suspected of comprising one or more of the alleles being detected, for example, a target sequence derived from genomic DNA, mRNA, amplification products derived therefrom or any target sequence described herein. In some embodiments, the solid support is a component of a ClonDiag platform, optionally wherein the ClonDiag platform is selected from Array Tube and ArrayStrip. Thus, the invention provides for a method of using a ClonDiag platform for determining whether a nucleic acid is characterized by one or more CYP2D6 alleles.

[00109] In exemplary embodiments, the determining step comprises generating a plurality of amplicons in a sample comprising the nucleic acid, wherein the generating step comprises contacting the sample with a primer set comprising a plurality of primers suitable for amplifying the plurality of alleles and wherein each of the plurality of amplicons comprises a detectable label; contacting the plurality of amplicons with a solid support comprising a plurality of capture probes selective for the plurality of alleles; and detecting the presence or absence of the detectable label.

[00110] In some embodiments, the generating step comprises using a DNA polymerase known in the art (e.g. Taq polymerase). In exemplary embodiments, the detecting step comprises causing precipitation of a precipitating agent. In exemplary embodiments, the detecting step comprises contacting the sample with a conjugated enzyme. Particularly useful conjugated enzymes include those can oxidize or reduce a precipitation agent. Examples include a horseradish peroxidase conjugate, for example, HRP-streptavidin or other conjugate disclosed herein or known in the art. In exemplary embodiments, the detecting step comprises contacting the sample with a precipitating agent, for example, o-dianisidine. In exemplary embodiments, the sample is derived from a subject to determine the subject's ability to metabolize a drug.

[00111] In one aspect, the invention provides a method of determining a CYP2D6 genotype in a subject, the method comprising determining whether a nucleic acid in a sample from the subject is characterized by a plurality of CYP2D6 alleles. In one embodiment, the plurality of CYP2D6 alleles comprises *3, *4, *5, *6, *7, *8, * 11, * 12, * 19 and *40. In one embodiment, the plurality of CYP2D6 alleles consists of *3, *4, *5, *6, *7, *8, * 11, * 12, * 19 and *40. In some embodiments, it is implied that a nucleic acid is tested for the presence of all of these alleles or a subset of these alleles. In some embodiments, a nucleic acid that is being tested does not need to be finally determined to be characterized by all or any of these alleles. In one embodiment, the method comprises contacting a sample from the subject with a solid support of a kit of the invention. Any of the methods disclosed herein can be performed using the various kits, compositions, primer sets or probe sets disclosed herein.

[00112] In one aspect, the invention provides a method of determining a CYP2D6 genotype of a subject. In one embodiment, the method comprises performing a method of the invention on a sample from the subject. In some embodiments, the method further comprises administering to the subject a drug that is metabolized by CYP2D6. In some embodiments, the dosage of the drug is adjusted according to the CYP2D6 SNPs or alleles that are detected.

General Procedure

[00113] The first step of the genotyping process includes the amplification of a subject's DNA. This is done by means of the Polymerase Chain Reaction (PCR). Since two pseudogenes of the CYP2D6 gene are present, the whole gene has to be amplified before genotyping. Therefore, primers PI 00 and P200 from Sachse et al. (1997) are used. For detection of the *5 allele, which represents the whole gene deletion, a 3,5 kb fragment can be amplified with CYP13 and CYP24 primers from Steen et al. (1995). The primers used carry a 5 ' biotin molecule for detection on the macroarray .

GGCCTACCCTGGGTAAGGGCCTGGAGCAGGA (P100) (SEQ ID NO: 23) CTCAGCCTCAACGTACCCCTGTCTCAAATGCG (P200) (SEQ ID NO: 24) ACCGGGCACCTGTACTCCTCA (CYP13) (SEQ ID NO: 25)

GCATGAGCTAAGGCACCCAGAC (CYP24) (SEQ ID NO: 26)

[00114] The amplification of the whole gene and the deletion specific fragment is accomplished in two separate tubes. In tube 1, the whole gene is amplified with 5' labelled biotin primers. In the second tube, the deletion specific fragment is amplified together with positive control primers. Both primer pairs are also 5' biotin labelled.

Positive control primers:

Forward: CTCCCTGCAATGTGATCTGCTCC (SEQ ID NO: 27)

Reverse: ACTTTGCCATCTTTTCCAGATATTCACCC (SEQ ID NO: 28)

Tube 1 set up:

[00115] To accomplish this, Taq DNA polymerase from Fermentas (Fermentas International Inc., Canada) is combined with a special buffer from a different product, namely the 1 Ox long PCR Puffer from the Long Template Enzyme Mix (Fermentas) as described in the table below.

[00116] The mixture can be set up as a master mix. 12 μΐ freshly extracted DNA is mixed with 13 μΐ of the master mix.

[00117] Cycling conditions (using the MJ Research PTC-200 Peltier Thermal Cycler, Biozym Diagnostik GmbH, Oldendorf) are selected as follows:

Tube 2 set up:

[00118] To accomplish this, Taq DNA polymerase from Fermentas (Fermentas International Inc., Canada) is combined with a special buffer from a different product, namely the 1 Ox long PCR Puffer from the Long Template Enzyme Mix (Fermentas) as described in the table below.

[00119] The mixture can be set up as an master mix. 4 μΐ freshly extracted DNA is mixed with 13 μΐ of the master mix.

[00120] Cycling conditions (using the MJ Research PTC-200 Peltier Thermal Cycler, Biozym Diagnostik GmbH, Oldendorf) are selected as follows:

[00121] After the amplification in the two tubes, tube 1 is 1 :25 diluted and then 12 μΐ is mixed with 10 μΐ out of tube 2. Afterwards the sample is denatured for 2 min at 95 °C.

[00122] This mix is then mixed with 100 μΐ hybridisation buffer as listed below. The spotting concentration is 15 μΜ with 160 μιη spot distance to each other. Chip Processing

[00123] The microarray chip is initially conditioned with 500 distilled water at 550 rpm (Eppendorf thermomixer compact) and room temperature (RT) for 5 min. In the second step, the chip is conditioned with hybridization buffer at the same conditions. Then the mix of hybridisation buffer together with amplificate and strand blockers are incubated on the chip for lh, at 550 rpm and 55 °C. After hybridization, the chip is washed three times with the washing buffers I, II and III, respectively, with 500 μΐ and 5 min each spun at 550 rpm and 50 °C. Upon washing, blocking solution is freshly prepared and 100 μΐ is incubated on the chip for 15 min. at 550 rpm and RT. The next step comprises the addition of 100 μΐ freshly prepared Streptavidin Poly HRP 80 solution and incubation for 15 min at 550 rpm and RT. Following this, the unbound conjugate is washed away by adding washing buffers I, II and III in sequence as described above but at RT. The precipitation reaction is introduced by adding 100 μΐ of precipitating agent. After 5 min, the results can be read out.

Buffers and solutions

Hybridization buffer

3DNA buffer from Clondiag (Germany)

Wash buffer I

2X SSC: mix lOmL 20x SSC with 90 mL distilled water

Mix lOOmL 2x SSC with 10 \iL Triton XI 00

Wash buffer II

Mix lOmL 20X SSC with 90 mL distilled water

Wash buffer III

Mix 1 mL 20x SSC with 99 mL distilled water

AT blocking solution

6X SSPE: Mix 30 mL 20x SSPE mit 70 mL distilled water

100 mL 6x SSPE + 5 μΐ, Triton X100 and 0.02g blocking reagent (Roche)

Streptavidin Poly HRP 80

Mix 1.5 mL 20X SSPE with 3.5 mL distilled water

Add 1 μί Streptavidin Poly HRP 80 (SDT GmbH, Germany)

Precipitating agent:

ep(HS)TMB-mA (SDT GmbH, Germany) [00124] Chip evaluation: Concentration probe must no be less than 0,1 and higher than 0,5 precipitation intensity according to the IconoSoftware (Clondiag). Concerning the probes targeting the different variants, values higher than 0,1 are expected to be positive. Thus, genotyping can be performed by the combined evaluation of the wild type and mutated probe (homozygous wild type, homozygous mutated, heterozygous).

[00125] Probes targeting different mutations in the CYP2D6 gene were designed by calculation their specific melting temperatures by means of the algorithm according to SantaLucia (1998) and were experimentally adjusted.

[00126] Generally, any method of DNA amplification as known in the art may be used. In various embodiments, DNA target species are amplified directly from whole blood. In various embodiments, the method of DNA amplification comprises isothermal amplification as known in the art.

[00127] The articles "a," "an" and "the" as used herein do not exclude a plural number of the referent, unless context clearly dictates otherwise. The conjunction "or" is not mutually exclusive, unless context clearly dictates otherwise. The term "include" is used to refer to non-exhaustive examples.

[00128] All references, publications, patent applications, issued patents, accession records and databases cited herein, including in any appendices, are incorporated by reference in their entirety for all purposes.

CITATIONS

Goetz et al., 2007, The impact of cytochrome P450 2D6 metabolism in women receiving adjuvant tamoxifen, Breast Cancer Res Treat. 2007 Jan; 101(1): 113; 21. Epub 2006 Nov 18.

Sachse, C, J. Brockmoller, et al., 1997, "Cytochrome P450 2D6 variants in a Caucasian population: allele frequencies and phenotypic consequences." Am J Hum Genet 60(2): 284-95.

Lundqvist E., Johansson I., Ingelman-Sundberg, M., 1999, Genetic mechanisms for duplication and multiduplication of the human CYP2D6 gene and methods for detection of duplicated CYP2D6 gene. Gene 226:327-338.

SantaLucia J., 1998, A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics, Proc. Natl. Acad. Sci. USA Vol. 95, pp. 1460-1465.

Steen et al., 1995, Detection of the poor metabolizer-associated CYP2D6(D) gene deletion allele by long-PCR technology. Pharmacogenetics, 1995 Aug, 5(4): 215-23.