Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
GENOTYPING OF HUMAN PAPILLOMA VIRUSES BY MULTIPLEX AMPLIFICATION AND SIZE DIFFERENTIATION
Document Type and Number:
WIPO Patent Application WO/2009/035177
Kind Code:
A1
Abstract:
The present invention relates to a method for identifying at least two types of human papilloma viruses (HPVs) by a multiplex amplification of a nucleic acid molecule of HPVs in a biological sample and a size differentiation of amplicons and a kit for conducting such method. The present genotyping method is carried out in accordance with relatively simple and convenient process such as multiplex amplification and analysis of amplicon sizes, enabling the high-throughput analysis of HPV detection and genotyping. Even though the present invention is carried out in a relatively simple fashion, the results for genotyping of HPVs are shown to be much more accurate and reproducible than any conventional methods.

Inventors:
CHUN, Jong Yoon (3 Olympic Seonsugijachon, Apartment 89, Bangi-dong, Songpa-gu, Seoul 138-050, 19-1301, KR)
Application Number:
KR2007/004452
Publication Date:
March 19, 2009
Filing Date:
September 14, 2007
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
SEEGENE, INC. (8 9F, Taewon Bldg.65-5, Bangyi-dong, Songpa-gu, Seoul 138-050, KR)
CHUN, Jong Yoon (3 Olympic Seonsugijachon, Apartment 89, Bangi-dong, Songpa-gu, Seoul 138-050, 19-1301, KR)
International Classes:
C12Q1/68; C12Q1/68
Attorney, Agent or Firm:
YANG, Boo-Hyun (4th Fl. Oksan Bldg, 1627-10Bongcheon-7-dong, Gwanak-gu, Seoul 151-818, KR)
Download PDF:
Claims:

What is claimed is:

1. A method for identifying at least two types of human papilloma viruses (HPVs) by a multiplex amplification of nucleic acid molecules of HPVs in a biological sample and a size differentiation of amplicons, which comprises the steps of: (a) obtaining a DNA molecule from the biological sample;

(b) amplifying the DNA molecule using at least two HPV type-specific primer pairs; wherein the HPV type-specific primer pairs generate amplicons with defined and different sizes from each other; and

(c) identifying the type of HPVs in the biological sample by analyzing the size of the amplified DNA molecule.

2. The method according to claim 1, wherein the human papilloma virus (HPV) belongs to types 6, 11, 16, 18, 31, 33, 35, 39, 42, 43, 44, 45, 51, 52, 56, 58, 59 or 68.

3. The method according to claim 1, wherein the nuclei acid molecule of human papilloma virus (HPV) in the biological sample is selected from the group consisting of GenBank Accession Nos. AF092932, L41216, M14119, K02718, AY262282, J04353, M12732, X74477, M74117, M62849, A28090, AJ620205, U31788, X74479, M62877, X74481, X74483, D90400, X77858, DQ080079 and NM_120599.

4. The method according to claim 1, wherein the step (b) is carried out using at least four HPV type-specific primer pairs for identifying at least four HPV types.

5. The method according to claim 4, wherein the step (b) is carried out using at least eight HPV type-specific primer pairs for identifying at least eight HPV types.

6. The method according to claim 5, wherein the step (b) is carried out using at least thirteen HPV type-specific primer pairs for identifying at least thirteen HPV types.

7. The method according to claim 6, wherein the step (b) is carried out using at least

eighteen HPV type-specific primer pairs for identifying at least eighteen HPV types comprising HPV types 6, 11, 16, 18, 31, 33, 35, 39, 42, 43, 44, 45, 51, 52, 56, 58, 59 and 68.

8. The method according to claim 1, wherein the HPV type-specific primer has a dual priming oligonucleotide structure represented by the following general formula I:

5'-X p -Y q -Z r -3' (I) wherein, X p represents a 5'-first priming portion having a hybridizing nucleotide sequence substantially complementary to a target sequence in the nucleic acid molecule of HPV, Y q represents a separation portion comprising at least three universal bases, Z 1 - represents a 3'-second priming portion having a hybridizing nucleotide sequence substantially complementary to a target sequence in the nucleic acid molecule of HPV, p, q and r represent the number of nucleotides, and X, Y, and Z are deoxyribonucleotides or ribonucleotides; the T m of the 5'-first priming portion is higher than that of the 3'-second priming portion and the separation portion has the lowest T m in the three portions; the separation portion separates the 5'-first priming portion from the 3'-second priming portion in terms of annealing events to the template DNA molecule, whereby the annealing specificity and priming of the oligonucleotide are determined dually by the 5'-first priming portion and the 3'-second priming portion such that the overall annealing specificity of the primer is enhanced.

9. The method according to claim 8, wherein the universal base is selected from the group consisting of deoxyinosine, inosine, 7-deaza-2'-deoxyinosine, 2-aza-2'- deoxyinosine, 2'-OMe inosine, 2'-F inosine, deoxy 3-nitropyrrole, 3-nitropyrrole, 2'-0Me 3-nitropyrrole, 2'-F 3-nitropyrrole, l-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole, deoxy 5-nitroindoIe, 5-nitroindole, 2'-0Me 5-nitroindole, 2'-F 5-nitroindole, deoxy 4- nitrobenzimidazole, 4-nitrobenzimidazole, deoxy 4-aminobenzimidazole, 4- aminobenzimidazole, deoxy nebularine, 2'-F nebularine, 2'-F 4-nitrobenzimidazole, PNA-5-introindole, PNA-nebularine, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3- nitropyrrole, morpholino-5-nitroindole, morpholino-nebularine, morpholino-inosine,

morpholino-4-nitrobenzimidazole, morpholino-3-nitropyrrole, phosphoramidate-5- nitroindole, phosphoramidate-nebularine, phosphoramidate-inosine, phosphoramidate- 4- nitrobenzimidazole, phosphoramidate-3-nitropyrrole, 2'-0-methoxyethyl inosine, 2 1 O- methoxyethyl nebularine, 2'-0-methoxyethyl 5-nitroindole, 2'-0-methoxyethyl 4-nitro- benzimidazole, 2'-0-methoxyethyl 3-nitropyrrole, and combinations thereof.

10. The method according to claim 9, wherein the universal base is deoxyinosine, 1- (2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole or 5-nitroindole.

11. The method according to claim 10, wherein the universal base is deoxyinosine.

12. The method according to claim 8, wherein the separation portion comprises contiguous nucleotides having universal bases.

13. The method according to claim 8, wherein the 5'-first priming portion is longer than the 3'-second priming portion.

14. The method according to claim 8, wherein the 5'-first priming portion is 15-40 nucleotides in length.

15. The method according to claim 8, wherein the 3'-second priming portion is 3-15 nucleotides in length.

16. The method according to claim 8, wherein the separation portion is 3-10 nucleotides in length.

17. The method according to claim 8, wherein the T m of the 5'-first priming portion ranges from 4O 0 C to 80 0 C.

18. The method according to claim 8, wherein the T m of the 3'-second priming

portion ranges from 10 0 C to 4O 0 C.

19. The method according to claim 8, wherein the T m of the separation portion ranges from 3°C to 15°C.

20. The method according to claim 8, wherein the HPV type-specific primer pair comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 and 2, 3 and 4, 5 and 6, 7 and 8, 9 and 10, 11 and 12, 13 and 14, 15 and 16, 17 and 18, 19 and 20, 21 and 22, 23 and 24, 25 and 26, 27 and 28, 29 and 30, 31 and 32, 33 and 34, and 35 and 36.

21. The method according to claim 1, wherein the step (b) is carried out using an additional internal control.

22. The method according to claim 1, the nuclei acid molecule of human papilloma virus (HPV) in the biological sample is present in at least 10 copies.

23. The method according to claim 1, wherein the step (c) is carried out by a genescan process.

24. The method according to claim 23, wherein the amplified product of step (b) is incubated with NaOH in step (c).

25. The method according to claim 24, wherein the amplified product of step (b) is incubated with NaOH and formamide at 90-98 0 C in step (c).

26. The method according to claim 1, wherein the method identifies simultaneously at least two types of human papilloma viruses (HPVs) in a single multiplex amplification reaction in step (b) and a single identifying process in step (c).

27. A kit for identifying at least two types of human papilloma viruses (HPVs) by a multiplex amplification of a nucleic acid molecule of HPVs in a biological sample and a size differentiation of amplicons, which comprises at least two HPV type-specific primer pairs for identifying at least two types of human papilloma viruses (HPVs); wherein the HPV type-specific primer pairs generate amplicons with defined and different sizes from each other; wherein the HPV-type specific primer has the structure represented by the following general formula I:

5'-X p -Y q -Z r -3' (I) wherein, X p represents a 5'-first priming portion having a hybridizing nucleotide sequence substantially complementary to a target sequence in the nucleic acid molecule of HPV, Y q represents a separation portion comprising at least three universal bases, Z r represents a 3'-second priming portion having a hybridizing nucleotide sequence substantially complementary to a target sequence in the nucleic acid molecule of HPV, p, q and r represent the number of nucleotides, and X, Y, and Z are deoxyribonucleotides or ribonucleotides; the T m of the 5'-first priming portion is higher than that of the 3'-second priming portion and the separation portion has the lowest T m in the three portions; the separation portion separates the 5'-first priming portion from the 3'-second priming portion in terms of annealing events to the template DNA molecule, whereby the annealing specificity and priming of the oligonucleotide are determined dually by the 5'-first priming portion and the 3'-second priming portion such that the overall annealing specificity of the primer is enhanced.

28. The kit according to claim 27, wherein the universal base is selected from the group consisting of deoxyinosine, inosine, 7-deaza-2'-deoxyinosine, 2-aza-2'- deoxyinosine, 2'-OMe inosine, 2'-F inosine, deoxy 3-nitropyrrole, 3-nitropyrrole, 2'-OMe 3-nitropyrrole, 2'-F 3-nitropyrrole, l-(2'-deoxy-beta-D-ribofuranosyl)-3-nitropyrrole, deoxy 5-nitroindole, 5-nitroindole, 2'-OMe 5-nitroindole, 2'-F 5-nitroindole, deoxy 4- nitrobenzimidazole, 4-nitrobenzimidazole, deoxy 4-aminobenzimidazole, 4-

aminobenzimidazole, deoxy nebularine, 2'-F nebularine, 2'-F 4-nitrobenzimidazole, PNA-5-introindole, PNA-nebularine, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3- nitropyrrole, morpholino-5-nitroindole, morpholino-nebularine, morpholino-inosine, morpholino-4-nitrobenzimidazole, morpholino-3-nitropyrrole, phosphoramidate-5- nitroindole, phosphoramidate-nebularine, phosphoramidate-inosine, phosphoramidate- 4- nitrobenzimidazole, phosphoramidate-3-nitropyrrole, 2'-0-methoxyethyl inosine, 2 1 O- methoxyethyl nebularine, 2'-0-methoxyethyl 5-nitroindole, 2'-0-methoxyethyl 4-nitrobenzimidazole, 2'-0-methoxyethyl 3-nitropyrrole, and combinations thereof.

29. The kit according to claim 28, wherein the universal base is deoxyinosine, l-(2'- deoxy-beta-D-ribofuranosyl)-3-nitropyrrole or 5-nitroindole.

30. The kit according to claim 29, wherein the universal base is deoxyinosine.

31. The kit according to claim 27, wherein the separation portion comprises contiguous nucleotides having universal bases.

32. The kit according to claim 27, wherein the 5'-first priming portion is longer than the 3'-second priming portion.

33. The kit according to claim 27, wherein the 5'-first priming portion is 15-40 nucleotides in length.

34. The kit according to claim 27, wherein the 3'-second priming portion is 3-15 nucleotides in length.

35. The kit according to claim 27, wherein the separation portion is 3-10 nucleotides in length.

36. The kit according to claim 27, wherein the T m of the 5'-first priming portion

ranges from 40 0 C to 80 0 C.

37. The kit according to claim 27, wherein the T m of the 3'-second priming portion ranges from 10 0 C to 4O 0 C.

38. The kit according to claim 27, wherein the T m of the separation portion ranges from 3 0 C to 15°C.

39. The kit according to claim 27, wherein the human papilloma virus (HPV) belongs to types 6, 11, 16, 18, 31, 33, 35, 39, 42, 43, 44, 45, 51, 52, 56, 58, 59 or 68.

40. The kit according to claim 27, wherein the nuclei acid molecule of human papilloma virus (HPV) in the biological sample is selected from the group consisting of GenBank Accession Nos. AF092932, L41216, M14119, K02718, AY262282, J04353, M 12732, X74477, M74117, M62849, A28090, AJ620205, U31788, X74479, M62877, X74481, X74483, D90400, X77858, DQ080079 and NMJ.20599.

41. The kit according to claim 27, wherein the kit comprises at least four HPV type- specific primer pairs for identifying at least four HPV types.

42. The kit according to claim 41, wherein the kit comprise at least eight HPV type- specific primer pairs for identifying at least eight HPV types.

43. The kit according to claim 42, wherein the kit comprises at least thirteen HPV type-specific primer pairs for identifying at least thirteen HPV types.

44. The kit according to claim 43, wherein the kit comprises at least eighteen HPV type-specific primer pairs for identifying at least eighteen HPV types comprising HPV types 6, 11, 16, 18, 31, 33, 35, 39, 42, 43, 44, 45, 51, 52, 56, 58, 59 and 68.

45. The kit according to claim 27, wherein the HPV type-specific primer comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-36.

46. The kit according to claim 27, wherein the kit step further comprises primers for amplifying an additional internal control.

Description:

GENOTYPING OF HUMAN PAPILLOMA VIRUSES BY MULTIPLEX AMPLIFICATION AND SIZE DIFFERENTIATION

BACKGROUND OF THE INVENTION FIELD OF THE INVENTION

The present invention relates to a method for identifying at least two types of human papilloma viruses (HPVs) by a multiplex amplification of a nucleic acid molecule of HPVs in a biological sample and a size differentiation of amplicons and a kit for conducting such method.

DESCRIPTION OF THE RELATED ART

Human papillomavirus (HPV) has been known as the main cause of cervical cancer which kills over a quarter of a million women worldwide on an annual basis (1 / 2). There are over 50 viral types of HPV that infect the genital tract, however, only a small portion appears to cause most cervical neoplasias and cancers. On the basis of their association with cervical lesions, HPV can be divided into "high-risk (HR)" and "low-risk (LR)" groups. Of the 15 to 20 types associated with cervical cancer, a worldwide study determined that four types - 16, 18, 31, and 45 - accounted for 80 percent of cervical cancer (2). Virtually all genital warts are caused by low-risk types 6 and 11. Recently, quadrivalent (HPV types 6, 11, 16, and 18) and bivalent (HPV types 16 and 18) vaccines have been demonstrated to effectively prevent type-specific persistent infection and disease caused by HPVs (3,4).

The ability to determine the type-specific profile of HPV-positive women is essential in evaluating the efficacy of HPV vaccine implementation. Therefore, it is very important to know what type of HPV is infected in patients to prevent cancer development and transmission of the disease.

Traditionally, cervical cancer prevention programs have largely relied on cytological testing using the Papanicolaou (Pap) smear test. Pap smears require a sample of cells from the uterine cervix of each woman screened. Skilled technicians

then examine the specimen for cellular changes (dysplasia) known to precede the development of cervical cancer. Such screening methods can be expensive, prone to error, and logistically difficult to set up. The direct detection of HPV in cervical specimens therefore has been required for an alternative or complement to population-based cytological screening. To this end, several technologies have been developed for the molecular detection of HPV infection, the technologies can be broadly divided into those that are not amplified, such as southern blot and dot blot hybridization (5), in situ hybridization (6), and those that utilizes amplification.

Amplification techniques can be further divided into three separate categories: Firstly, target amplification, in which the assay amplifies the target nucleic acids {e.g. polymerase chain reaction; PCR); Secondly, signal amplification, in which the signal generated from each probe is increased by a compound-probe or branched-probe technology; and thirdly, probe amplification, in which the probe molecule itself is amplified {e.g. ligase chain reaction). Because of a time-consuming and labor-intensive process of non-amplification techniques, target and signal amplification techniques have been more often applied to the molecular detection of HPV than non-amplification techniques. In addition, recent developments in combining molecular probes with silicon-based chips ultimately introduced quick, relatively inexpensive diagnostics for HPV infection (7). While micro- array technology holds promise for the detection of a broad range of infectious diseases including HPV, this technology is also mainly based on probe-hybridization system; it seems hard to avoid the high false positive rate due to cross-reactivity between probes and various kinds of viral DNA or PCR amplicons used for hybridization. It has been pointed out that probe hybridization-based methods generate a number of false positives (8,9).

Currently, commercially available major products to detect HPVs are Digene's hybrid capture 2 HPV test and Roche's Linear Array HPV genotyping test. Both of these methods are based on probe-hybridization method to detect and/or genotype HPVs. As mentioned above, the major defect of the probe hybridization-based methods is a high false positive rate.

Throughout this application, various patents and publications are referenced, and citations are provided in parentheses. The disclosure of these patents and publications in their entities are hereby incorporated by references into this application in order to more fully describe this invention and the state of the art to which this invention pertains.

SUMMARY OF THE INVENTION

The present inventors have made intensive researches to develop a novel approach for genotyping HPVs in more convenient and accurate manner. As a result, we have discovered that the genotyping of HPVs could be successfully performed according to multiplex amplifications using at least two primer pairs and a size differentiation of amplicons without false results.

Accordingly, it is an object of this invention to provide a method for identifying at least two types of human papilloma viruses (HPVs) by a multiplex amplification of a nucleic acid molecule of HPVs in a biological sample and a size differentiation of amplicons.

It is another object of this invention to provide a kit for identifying at least two types of human papilloma viruses (HPVs) by a multiplex amplification of a nucleic acid molecule of HPVs in a biological sample and a size differentiation of amplicons.

Other objects and advantages of the present invention will become apparent from the detailed description to follow taken in conjugation with the appended claims and drawings.

BRIEF DESCRIPTION OF THE DRAWINGS

Figs. Ia-Ie represents electropherograms of GeneScan analysis results showing 19-plex HPV PCR amplification products for 18 different HPV types run under denaturing conditions. The 19-plex HPV PCR was performed in the presence of each

18 individual HPV cloned plasmids. IC indicates internal control {Arabidopsis thaliana CESA3 gene). Y-axis, rfu (relative fluorescence unit); X-axis, length of DNA fragments, bp (base pair).

Fig. If shows an electropherogram of GeneScan analysis results for combined 19 single PCR reactants.

Figs. 2a and 2b represent analytic sensitivity of the HPV 19-plex PCR system for detecting 18 different HPV genotypes on dilution series (10-fold serial dilution of 10 4 copies down to 10 copies) of HPV-31 and HPV-42 control plasmids.

Figs. 3a-3d represent representative electropherograms from the HPV 19-plex PCR on 15 positive clinical samples. 30 clinical samples were evaluated using the HPV 19-plex PCR system for identifying the genotype of HPV.

DETAILED DESCRIPTION OF THIS INVETNION

In one aspect of this invention, there is provided a method for identifying at least two types of human papilloma viruses (HPVs) by a multiplex amplification of a nucleic acid molecule of HPVs in a biological sample and a size differentiation of amplicons, which comprises the steps of:

(a) obtaining a DNA molecule from the biological sample;

(b) amplifying the DNA molecule using at least two HPV type-specific primer pairs; wherein the HPV type-specific primer pairs generate amplicons with defined and different sizes from each other; and

(c) identifying the type of HPVs in the biological sample by analyzing the size of the amplified DNA molecule.

The present inventors have made intensive researches to develop a novel approach for genotyping HPVs in more convenient and accurate manner. As a result, we have discovered that the genotyping of HPVs could be successfully performed according to multiplex amplifications using at least two primer pairs and a size differentiation of amplicons without false results. According to the present invention, the determination of genotypes of HPVs is easily made based on sizes of finally

amplified products (amplicons).

According to categories mentioned earlier, our system belongs to "target amplification" method. However, unlike other conventional PCR-based method generating a great deal of non-specific amplification of non-target DNAs, the present method exhibits dramatically enhanced specificity and reproducibility. The present HPV detection/genotyping method is designed to amplify only specific targets and more importantly, can be automated in detection using a suitable analysis tool {e.g., GeneScan size analysis). Therefore, the present invention is appropriate for the high throughput analysis of HPV detection and genotyping. The present method is directed to genotyping of HPVs by a multiplex amplification and a size differentiation of amplicons. To our best knowledge, the present method is the first accomplishment to genotype HPVs based on multiplex amplification and amplicon size differentiation, preferably using a genescan process.

The term "amplicon" as used herein refers to the product of a gene amplification reaction wherein primers are employed in the presence of a template and one or more nucleotides and a template-dependent polymerizing agent to yield a nucleic acid. An amplicon product of a primer extension reaction is typically double- stranded.

The term used herein "size differentiation of amplicons" is intended to mean the difference in sizes of finally amplified products by the HPV type-specific primers designed to produce defined and different amplicon sizes. The size differentiation of amplicons permits to easily identify the type of HPVs, preferably, by automated size analysis tools.

The present invention will be described hereunder with referring to each step:

In the first step of this invention, DNA molecules are obtained from biological samples.

The biological samples include, but not limited to, biological fluids {e.g., blood, serum, plasma and urine) and cervix scrapings (tissue and cell samples).

The preparation of DNA molecules from biological samples may be carried out by conventional techniques including, but not limited to, extraction with a phenol/chloroform mixture and precipitation, and isolation using spin columns (Peter B. Kaufman, et al., Handbook of Molecular and Cellular Methods in Biology and Medicine, CRC Press, Inc (1995) and Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)). For example, the preparation of DNA molecules from biological samples may be conducted in three sequential steps: (i) cells (or viruses) are lysed to release their content which includes protein, lipids, RNA and DNA by use of a detergent-containing lysis solution {e.g., containing sodium dodecyl sulfate or N-Lauroyl sarcosine) or a chaotropic-containing lysis solution; (ii) ribonucleases (RNases) are optionally added to remove RNA; and (iii) non-DNA contaminants such as protein are removed to yield pure DNA by organic solvents or column chromatography.

The isolated DNA molecules are then amplified using at least two HPV type- specific primer pairs in which the HPV type-specific primer pairs generate amplicons with defined and different sizes from each other.

According to a preferred embodiment, the HPV type-specific primer has a dual priming oligonucleotide (DPO) structure represented by the following general formula I: 5'-X p -Y q -Z r -3' (I) wherein, X p represents a 5'-first priming portion having a hybridizing nucleotide sequence substantially complementary to a target sequence in the nucleic acid molecule of HPV, Y q represents a separation portion comprising at least three universal bases, Z 1 - represents a 3'-second priming portion having a hybridizing nucleotide sequence substantially complementary to a target sequence in the nucleic acid molecule of HPV, p, q and r represent the number of nucleotides, and X, Y, and Z are deoxyribonucleotides or ribonucleotides; the T m of the 5'-first priming portion is higher than that of the 3'-second priming portion and the separation portion has the lowest T m in the three portions; the separation portion separates the S'-first priming portion from the 3'-second priming portion in terms of annealing events to the template DNA

molecule, whereby the annealing specificity and priming of the oligonucleotide are determined dually by the 5'-fϊrst priming portion and the 3'-second priming portion such that the overall annealing specificity of the primer is enhanced.

The HPV type-specific primers have a unique structure or formula called as a dual specificity oligonucleotide structure. This dual specificity oligonucleotide (DSO) structure was first proposed by the present inventor (see WO 2006/095981) and then its nomenclature was changed to a dual priming oligonucleotide (DPO) structure.

The DPO embodies a novel concept in which its hybridization or annealing is dually determined by the 5'-high T m specif icity portion (or the 5'-first priming portion) and the 3'-low T m specificity portion (or the 3'-second priming portion) separated by the separation portion, exhibiting dramatically enhanced specificity (see WO 2006/095981). As such, the DPO has eventually two primer segments with distinct annealing properties: the 5'-first priming portion that initiates stable priming, and the 3'-second priming portion that determines target-specific extension. The separation portion comprising at least three universal bases delineates the boundary between the 5'-first priming portion and the 3'-second priming portion, resulting in separation of the 5'-first priming portion from the 3'-second priming portion in view of annealing events. Such separation permits the annealing specificity and priming of the primers to be determined dually by the 5'-first priming portion and the 3'-second priming portion, finally dramatically increasing the overall annealing specificity of the HPV type-specific primers.

According to a preferred embodiment, the universal base in the separation portion is selected from the group consisting of deoxyinosine, inosine, 7-deaza-2'- deoxyinosine, 2-aza-2'-deoxyinosine, 2'-OMe inosine, 2'-F inosine, deoxy 3- nitropyrrole, 3-nitropyrrole, 2'-OMe 3-nitropyrrole, 2'-F 3-nitropyrrole, l-(2'-deoxy- beta-D-ribofuranosyl)-3-nitropyrrole, deoxy 5-nitroindole, 5-nitroindole, 2'-0Me 5- nitroindole, 2'-F 5-nitroindole, deoxy 4-nitrobenzimidazole, 4-nitrobenzimidazole, deoxy 4-aminobenzimidazole, 4-aminobenzimidazole, deoxy nebularine, 2'-F nebularine, 2'-F 4-nitrobenzimidazole, PNA-5-introindole, PNA-nebularine, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrole, morpholino-5-nitroindole, morpholino-

nebularine, morpholino-inosine, morpholino-4-nitrobenzimidazole, morpholino-3- nitropyrrole, phosphoramidate-5-nitroindole, phosphoramidate-nebularine, phosphoramidate-inosine, phosphoramidate-4- nitrobenzimidazole, phosphoramidate- 3-nitropyrrole, 2'-0-methoxyethyl inosine, 2'0-methoxyethyl nebularine, 2'-O- methoxyethyl 5-nitroindole, 2'-0-methoxyethyl 4-nitro-benzimidazole, 2'-O- methoxyethyl 3-nitropyrrole, and combinations thereof. More preferably, the universal base or non-discriminatory base analog is deoxyinosine, l-(2'-deoxy-beta-D- ribofuranosyl)-3-nitropyrrole or 5-nitroindole, most preferably, deoxyinosine.

Preferably, the separation portion comprises contiguous nucleotides having at least three, more preferably at least four, most preferably at least five universal bases, preferably, deoxyinosine.

Preferably, the 5'-first priming portion is longer than the 3'-second priming portion. The 5'-first priming portion is preferably 15-40 nucleotides, more preferably 15-25 nucleotides in length. It is preferable that the 3'-second priming portion is 3-15 nucleotides, more preferably 6-13 nucleotides in length.

The separation portion is preferably 3-10 nucleotides, more preferably 4-8 nucleotides, most preferably 5-7 nucleotides in length.

According to a preferred embodiment, the T m of the 5'-first priming portion ranges from 40 0 C to 80 0 C, more preferably 45°C to 65 0 C. The T m of the 3'-second priming portion ranges preferably from 10 0 C to 40 0 C. It is preferable that the T m of the separation portion ranges from 3°C to 15°C.

Preferably, the HPV-specific primers used in this invention have a sequence specific to a type of HPVs and have the structure of the dual priming oligonucleotide (DPO). According to a preferred embodiment, the specific nucleotide sequence to a type of HPVs is located in the 5'-first priming portion and/or the 3'-second priming portion. The separation portion may accommodate common sequences found in various types of HPVs.

According to a preferred embodiment, the HPV type-specific primers are designed to amplify nucleotide sequences of human papilloma virus (HPV) types 6, 11,

16, 18, 31, 33, 35, 39, 42, 43, 44, 45, 51, 52, 56, 58, 59 or 68.

The main reference sequences for preparing HPV type-specific primers are unique sequences selected by aligning publicly-known nucleotide sequences of various types of HPVs, Among the selected sequences, a sequence suitable to design primers or probes having the DPO structure is then determined.

According to a preferred embodiment, the target nucleotide sequence annealed with the HPV type-specific primers includes a nucleotide sequence of a gene or a sequence in a HPV genomic DNA.

According to a preferred embodiment, the target nucleotide sequence may be selected on the basis of publicly-known nucleotide sequences. For example, the target nucleotide sequence may be selected with referring to sequences described in the following data bases: for HPV types 6, 11, 16, 18, 31, 33, 35, 39, 42, 43, 44, 45, 51,

52, 56, 58, 59 and 68, GenBank Accession Nos. AF092932, L41216, M14119, K02718,

AY262282, J04353, M12732, X74477, M74117, M62849, A28090, AJ620205, U31788, X74479, M62877, X74481, X74483, D90400, X77858, DQ080079 and NM_120599, respectively.

More preferably, the HPV type-specific primers used in this invention are designed to hybridize with or amplify the E5 gene for HPV type 6, the L2 gene for HPV type 11, the E2 gene for HPV type 16, the E4-E5 gene for HPV type 18, the E2 gene for HPV type 31, the E4 gene for HPV type 33, the E2-E4 gene for HPV type 39, the L2 gene for HPV type 43, the E2 gene for HPV type 44, the E4-E5 gene for HPV type 45, the E2 gene for HPV type 52, the E2-E5 gene for HPV type 58, the E2-E4 gene for HPV type 59 or the L2 gene for HPV type 68.

Most preferably, the HPV type-specific primer pair comprises the nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 and 2, 3 and 4, 5 and

6, 7 and 8, 9 and 10, 11 and 12, 13 and 14, 15 and 16, 17 and 18, 19 and 20, 21 and

22, 23 and 24, 25 and 26, 27 and 28, 29 and 30, 31 and 32, 33 and 34, and 35 and

36, which are specifically annealed to the target sequence of HPVs described above.

The HPV type-specific primers comprises not only the nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-36 but also a complementary sequence to

and a substantially identical nucleotide sequence to that. The term used herein "substantially identical nucleotide sequence" refers to a nucleotide sequence having some deletions, additions and/or substitutions in the nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-36. Such nucleotide changes are permissible, so long as the HPV type-specific primers can be specifically hybridized with a target sequence. It will be appreciated under the doctrine of equivalency that these substantially identical nucleotide sequences fall within the scope of claims.

The HPV type-specific primers adopting the DPO structure completely eliminate false-positive results and backgrounds associated with conventional technologies using probes or primers for detecting HPVs.

According to a preferred embodiment, the HPV type-specific primer is labeled with fluorescent molecules such as fluorescein, tetramethyl rhodamine (TAMRA), 5'- or β'-carboxyfluorescein (FAM), 6'- or S'-carboxy-^'^^'^'^'-hexachlorofluorescein (HEX), 5'-tetrachloro-fluorescein (TET), 6'-carboxy-4',5'-dichloro-2',7'- dimethoxyfluorescein (JOE), Lucifer Yellow, B-phycoerythrin, 9-acridineisothiocyanate, Lucifer Yellow VS, 4-acetamido-4'-isothio-cyanatostilbene-2,2'-disulfonic acid, 7- diethylamino-3-(4'-isothiocyanatophenyl)-4-methylcoumarin, succinimdyl 1- pyrenebutyrate, 4-acetamido-4'-isothiocyanatostilbene-2,2'-disulfonic acid derivatives, LC™-Red 640, LC™-Red 705, Cy5, Cy5.5, Lissamine rhodamine B sulfonyl chloride, tetramethyl rhodamine isothiocyanate, rhodamine x isothiocyanate, erythrosine isothiocyanate, diethylenetriamine pentaacetate or other chelates of Lanthanide ions (e.g., Europium, or Terbium), l-dimethylaminonaphthyl-5-sulfonate, l-anilino-8- naphthalene sulfonate, 2-p-touidinyl-6-naphthalene sulfonate, 3-phenyl-7- isocyanatocoumarin, 9-isothiocyanatoacridine, acridine orange, N-(p-(2- benzoxazolyl)phenyl)maleimide, benzoxadiazoles, stilbenes and pyrenes.

It is preferable that the fluorescent dye is attached to the 5'-end of the HPV type-specific primers. Either forward or reverse primer of the HPV type-specific primer pair may be labeled with fluorescent dyes. Alternatively, all primers of the HPV type- specific primer pair may be labeled with fluorescent dyes. The term "primer" as used herein refers to an oligonucleotide, which is capable

of acting as a point of initiation of synthesis when placed under conditions in which synthesis of primer extension product which is complementary to a nucleic acid strand (template) is induced, i.e., in the presence of nucleotides and an agent for polymerization, such as DNA polymerase, and at a suitable temperature and pH. The primer is preferably single stranded for maximum efficiency in amplification. Preferably, the primer is an oligodeoxyribonucleotide. The primer of this invention can be comprised of naturally occurring dNMP {i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotide, or non-natural nucleotide. The primer can also include ribonucleotides. For example, the primer used in this invention may include nucleotides with backbone modifications such as peptide nucleic acid (PNA) (M. Egholm et al., Nature, 365:566-568(1993)), phosphorothioate DNA, phosphorodithioate DNA, phosphoramidate DNA, amide-linked DNA, MMI-linked DNA, 2'-O-methyl RNA, alpha-DNA and methylphosphonate DNA, nucleotides with sugar modifications such as 2'-O-methyl RNA, 2'-fluoro RNA, 2'-amino RNA, 2'-0-alkyl DNA, 2'-O-allyl DNA, 2'-O-alkynyl DNA, hexose DNA, pyranosyl RNA, and anhydrohexitol DNA, and nucleotides having base modifications such as C-5 substituted pyrimidines (substituents including fluoro-, bromo-, chloro-, iodo-, methyl-, ethyl-, vinyl-, formyl-, ethynyl-, propynyl-, alkynyl-, thiazolyl-, imidazolyl-, pyridyl-), 7-deazapurines with C-7 substituents (substituents including fluoro-, bromo-, chloro-, iodo-, methyl-, ethyl-, vinyl-, formyl-, alkynyl-, alkenyl-, thiazolyl-, imidazolyl-, pyridyl-), inosine, and diaminopurine. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the agent for polymerization. The exact length of the primers will depend on many factors, including temperature, application, and source of primer. The term "annealing" or "priming" as used herein refers to the apposition of an oligodeoxynucleotide or nucleic acid to a template nucleic acid, whereby the apposition enables the polymerase to polymerize nucleotides into a nucleic acid molecule which is complementary to the template nucleic acid or a portion thereof. The term used "hybridizing" used herein refers to the formation of a double- stranded nucleic acid from complementary single stranded nucleic acids. There is no intended distinction between the terms "annealing" and "hybridizing", and these terms

will be used interchangeably.

The sequences of the HPV type-specific primers may comprise some mismatches, so long as they can be hybridized with templates and serve as primers. The 5'-first priming portion and the 3'-second priming portion are designed to have a nucleotide sequence substantially complementary to the template DNA molecule. The term "substantially complementary" is used herein to mean that the primer is sufficiently complementary to hybridize selectively to a template nucleic acid sequence under the designated annealing conditions or stringent conditions, such that the annealed primer can be extended by a polymerase to form a complementary copy of the template. Most preferably, the 5'-first priming portion and the 3'-second priming portion have a nucleotide sequence perfectly complementary to template DNA molecules, i.e., no mismatches.

The process for amplifying the DNA molecule by primer annealing, primer extending and denaturing is well known to those of skill in the art. Suitable annealing or hybridization conditions may be routinely determined by optimization procedures. Conditions such as temperature, concentration of components, hybridization and washing times, buffer components, and their pH and ionic strength may be varied depending on various factors, including the length and GC content of primer and target nucleotide sequence. The detailed conditions for hybridization can be found in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001); and M. LM. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y.(1999).

According to a preferred embodiment, the annealing is performed at temperature of 45-72°C, more preferably, 50-70 0 C, most preferably 58-65 0 C.

Where the DNA molecule as templates is typically double-stranded, it is preferred to render the two strands into a single-stranded or partially single-stranded form. Methods known to separate strands includes, but not limited to, heating, alkali, formamide, urea and glycoxal treatment, enzymatic methods {e.g., helicase action), and binding proteins. For instance, strand separation can be achieved by heating at

temperature ranging from 8O 0 C to 105 0 C. General methods for accomplishing this treatment are provided by Joseph Sambrook, et al v Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001).

The present methods do not require that the template nucleic acid molecules have any particular sequence or length. The HPV type-specific primers used for the present invention are annealed to a site on the template such that double-stranded structure is formed. Conditions of nucleic acid annealing suitable for forming such double stranded structures are described by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001) and Haymes, B. D., et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985).

A variety of DNA polymerases can be used in the extension step of the present methods, which includes "Klenow" fragment of E. coli DNA polymerase I, a thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase which may be obtained from a variety of bacterial species, including Thermus aquaticus (Taq), Thermus thermophilus (Tth), Therm us filiformis, Thermis flavus, Thermococcus literalis, and Pyrococcus furiosus (Pfu). When a polymerization reaction is being conducted, it is preferable to provide the components required for such reaction in excess in the reaction vessel. Excess in reference to components of the extension reaction refers to an amount of each component such that the ability to achieve the desired extension is not substantially limited by the concentration of that component. It is desirable to provide to the reaction mixture an amount of required cofactors such as Mg 2+ , dATP, dCTP, dGTP, and dTTP in sufficient quantity to support the degree of the extension desired. Annealing or hybridization in the present method is performed under stringent conditions that allow for specific binding between the primer and the template nucleic acid. Such stringent conditions for annealing will be sequence-dependent and varied depending on environmental parameters. In the present method, the annealing step is generally performed under high stringent conditions. In the most preferable embodiment, the amplification is performed in

accordance with PCR (polymerase chain reaction) which is disclosed in U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159.

Fundamentally, the present method follows multiplexing amplifications using at least two HPV type-specific primer pairs annealed to several target sequences. Preferably, the amplification is performed in accordance with multiplex PCR.

According to a conventional multiplex PCR, the results obtained with multiplex PCR are frequently complicated by the artifacts of the amplification procedure. These include "false-negative" results due to reaction failure and "false-positive" results such as the amplification of spurious products, which may be caused by annealing of the primers to sequences which are related to but distinct from the true recognition sequences. Therefore, elaborate optimization steps of multiplex PCR have to be conducted to reduce such false results; however, the optimization of the reaction conditions for multiplex PCR may become labor-intensive and time-consuming and unsuccessful. The present method amplifies simultaneously a variety of target sequence for HPV genotyping with no false results in a single multiplex PCR reaction to completely overcome shortcomings associated with conventional multiplex PCR.

According to a preferred embodiment, the step (b) for multiplex amplification reactions is carried out using at least four HPV type-specific primer pairs for identifying at least four HPV types (preferably, HPV types 16, 18, 31 and 45 accounted for 80% of cervical cancer). More preferably, the step (b) is carried out using at least eight HPV type-specific primer pairs for identifying at least eight HPV types. Still more preferably, the step (b) is carried out using at least thirteen HPV type-specific primer pairs for identifying at least thirteen HPV types (preferably, HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59 and 68, a high-risk group). Most preferably, the step (b) is carried out using at least eighteen HPV type- specific primer pairs for identifying at least eighteen HPV types comprising HPV types 6, 11, 16, 18, 31, 33, 35, 39, 42, 43, 44, 45, 51, 52, 56, 58, 59 and 68.

Surprisingly, the present method generates amplicons specific for the types of HPV even when eighteen HPV type-specific primer pairs are used, as demonstrated in Examples.

According to a preferred embodiment, the step (b) for multiplex amplification is carried out using an additional internal control for evaluating the quality of the multiplex amplification. The internal control sequence should show no homology with HPV genomic DNA. Preferably, the internal control sequence is the Arabidopsis thaliana CESA3 gene. Primers for amplifying the internal control sequence comprises preferably the nucleotide sequence of SEQ ID NOs:37 and 38.

The present method for genotyping HPVs exhibits dramatic accuracy and reproducibility. In addition, the present method shows much higher sensitivity for genotyping HPVs in biological samples. The present inventors appreciate that the instant method could detect and identify HPVs present even in 10 copy number- According to a preferred embodiment, the nucleic acid molecule of human papilloma virus (HPV) in the biological sample is present in at least 10 copies.

The amplified DNA molecules in step (b) are then analyzed based on their sizes, allowing to identify the type of HPVs in the biological sample. The analysis of amplified products may be conducted by various methods or protocols. For example, the amplified products can be analyzed by electrophoresis on a suitable gel {e.g., agarose gel). The amplified products could be also detected on a denaturing polyacrylamide gel by autoradiography or non-radioactive detection methods, such as silver staining (Gottschlich et al., (1997) Res. Commun. MoI. Path. Pharm. 97, 237-240; Kociok, N., et al. (1998) MoI. BiotechnoL 9, 25-33), or by using fluoresenscent-labelled oligonucleotides (Bauer D., et al., (1993) Nucleic Adds Res. 21, 4272-4280; Ito, T. et al., (1994) FEBS Lett. 351, 231-236. Luehrsen, K.R. et al., (1997) BioTechniques 22, 168-174; Smith, N.R. et al., (1997) BioTechniques 23, 274-279), and the use of biotinylated primers (Korn, B. et al., (1992) Hum. MoI. Genet 1, 235- 242; Tagle, D.A. et al., (1993) Nature 361. 751-753; Rosok, O. et al., (1996) BioTechniques 21, 114-121).

The HPV type-specific primers used in the present invention are designed to produce amplicons with defined and different sizes for identifying HPV types; therefore the simple analysis or observation of size difference of amplified products enables to genotype HPVs in more convenient manner.

According to a preferred embodiment, the analysis of the amplified DNA molecules in step (b) is conducted by a genescan process. Where the analysis is performed by the genescan process, at least one primer of the HPV type-specific primer pair has to be labeled with fluorescent dyes in step (b). The term used herein "genescan process" is intended to mean a process involving (i) denaturation of the amplified DNA molecules, (ii) fluorescent capillary electrophoresis (preferably, automated fluorescent capillary electrophoresis) by sequencers (preferably, automated sequencers) and (iii) software analysis to analyze and show DNA fragments with different sizes in different peaks. The denaturation of the amplified DNA molecules may be carried out by conventional techniques. According to a preferred embodiment, the denaturation is carried out by incubating the amplified product of step (b) with NaOH. Preferably, the concentration of NaOH ranges from 0.1 N to 0.001 N, more preferably 0.1-0.005 N, still more preferably 0.05-0.008 N, most preferably 0.02-0.009 N. Preferably, the amplified product of step (b) is incubated with NaOH and formamide at 90-98 0 C in step (c).

For resolution of amplified DNA molecules, a fluorescent capillary electrophoresis is then performed using sequencers {e.g., ABI PRIM™ family such as 310, 377, 3100 and 3700 automated DNA sequencers available from Applied Biosystems, USA), which are described in Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001). According to a preferred embodiment, a small portion of the amplified and denatured DNA molecules is combined with a dye-labeled size standard and electrophoresed on an automated sequencer, where the fluorescent product is sized and quantified. The software analysis is to analyze DNA fragment resolution data from fluorescent capillary electrophoresis and display DNA fragments with different sizes in different peaks. This analysis may be performed using commercially available software such as GeneScan™ software purchasable from Applied Biosystems, USA.

Since the HPV type-specific primers are prepared to produce amplicons with defined and different sizes, the peaks generated by the software represent each type

of HPVs.

According to a preferred embodiment, the present method identifies simultaneously at least two types of human papilloma viruses (HPVs) in a single multiplex amplification reaction in step (b) and a single detection process in step (c).

In another aspect of this invention, there is provided a method for identifying at least eighteen types of human papilloma viruses (HPVs) by an 18-plex amplification of a nucleic acid molecule of HPVs in a biological sample and a size differentiation of amplicons, which comprises the steps of: (a) obtaining a DNA molecule from the biological sample;

(b) 18-plex amplifying the DNA molecule using at least eighteen HPV type- specific primer pairs; wherein the HPV type-specific primer pairs generate amplicons with defined and different sizes from each other; and

(c) identifying the type of HPVs in the biological sample by analyzing the size of the amplified DNA molecule.

In still another aspect of this invention, there is provided a kit for identifying at least two types of human papilloma viruses (HPVs) by a multiplex amplification of a nucleic acid molecule of HPVs in a biological sample, which comprises at least two HPV type-specific primer pairs for identifying at least two types of human papilloma viruses (HPVs); wherein the HPV type-specific primer pairs generate amplicons with defined and different sizes from each other; wherein the HPV-type specific primer has the structure represented by the following general formula I:

5'-X p -Y q -Z r -3' (I) wherein, X p represents a 5'-first priming portion having a hybridizing nucleotide sequence substantially complementary to a target sequence to hybridize therewith, Y q represents a separation portion comprising at least three universal bases, Z 1 - represents a 3'-second priming portion having a hybridizing nucleotide sequence substantially complementary to a target sequence to hybridize therewith, p, q and r represent the number of nucleotides, and X, Y, and Z are deoxyribonucleotides or ribonucleotides;

the T m of the 5'-first priming portion is higher than that of the 3'-second priming portion and the separation portion has the lowest T m in the three portions; the separation portion separates the 5'-first priming portion from the 3'-second priming portion in terms of annealing events to the template DNA molecule, whereby the annealing specificity and priming of the oligonucleotide are determined dually by the 5'-first priming portion and the 3'-second priming portion such that the overall annealing specificity of the primer is enhanced.

Since, the HPV type-specific primers contained in the present kit are identical to those used in the present genotyping method, the common descriptions between them are omitted in order to avoid undue redundancy leading to the complexity of this specification.

The present kit may optionally include the reagents required for performing PCR reactions such as buffers, thermostable DNA polymerase, DNA polymerase cofactors, and deoxyribonucleotide-5-triphosphates. Optionally, the kit may also include various polynucleotide molecules, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. The kits may also include reagents necessary for performing positive and negative control reactions. Optimal amounts of reagents to be used in a given reaction can be readily determined by the skilled artisan having the benefit of the current disclosure. The kits, typically, are adapted to contain in separate packaging or compartments the constituents afore-described.

The features and advantages of this invention are will be summarized as follows:

(a) the present invention identify various types of HPVs in accordance with multiplex amplification using a multitude of HPV type-specific primer pairs and a size differentiation of amplicons;

(b) according to the present invention, the HPV type-specific primer pairs used are not limited in their number and generate distinct amplicons to permit the genotyping of HPVs by a single multiplex amplification and a single identifying

process;

(c) the present genotyping method is carried out in accordance with relatively simple and convenient process such as multiplex amplification and analysis of amplicon sizes, enabling the high-throughput analysis of HPV detection and genotyping;

(d) according to the present invention, the determination of genotypes of HPVs is readily made by a simple analysis of sizes of amplification products;

(e) interestingly, it is possible to simultaneously identify genotypes of HPVs in a single multiplex amplification by the present invention; and (f) even though the present invention is carried out in a relatively simple fashion, the results for genotyping of HPVs are shown to be much more accurate and reproducible than any conventional methods.

The present invention will now be described in further detail by examples. It would be obvious to those skilled in the art that these examples are intended to be more concretely illustrative and the scope of the present invention as set forth in the appended claims is not limited to or by the examples.

EXAMPLES Materials and Methods

DPO primer design

We designed DPO primers specific for 18 different types of HPV (types 6, 11, 16, 18, 31, 33, 35, 39, 42, 43, 44, 45, 51, 52, 56, 58, 59 and 68) and internal control. An artificially created plasmid DNA was used as an internal control (IC) in every PCR reaction. This IC was used to monitor any possible inhibition in the PCR reaction due to the presence of inhibitory substances in the clinical specimens. Primers for IC were designed from the Arabidopsis thaliana CESA3 gene which shows no homology with human or viral genomic DNA. Consequent PCR amplicon (558 bp) was subsequently

cloned into pUC19 plasmid vector. This recombinant plasmid (CESA3 in pUC19) and its specific primer set, IC/Df_FAM and IC/Dr (Table 1) were added to multiplex primer mix so as to serve as an internal control all through multiplex PCR. The total 38 primers were designed to produce 19 PCR amplicons with different sizes, which permit to discriminate each of 18 different HPV genotypes and internal control based on PCR product sizes. For GeneScan analysis, the forward primer of each primer set was 5'- end labeled with the fluorescent dye 6-carboxyfluorescein (6-FAM). All primers were synthesized by Bioneer (Korea), Table 1

Tm Amplicon Accession Target

Name 3 Direction Sequence (5'→3') ("C) Size (bp) number 13 Region

TGTGTAAATATATGGTATTGG

P6/Df_FAM Forward 63.4 TGTIIIIIAACTGTACATG AF092932

425 E5

TGTACAGCTCTATAGTGCATII L41216

P6/Dr Reverse 64.5 IIIATAACCCCAAC

CAAACGCMCAATAATGGTGI

Pll/DLFAM Forward 75.7 IIIIAACCTGTCAC

293 M14119 L2

GGTTTCATTATATATAACTAAC

Pll/Dr Reverse 68.2 IIIIICCACACACTG

CCTCTCCTGAAATTATTAGGC

P16/Df_FAM Forward 72.5 AIIIIITGGCCAACCAC

186 K02718 E2

AGGATTGGAGCACTGTCCAC

P16/Dr Reverse 71.6 TIIIIITCTGTGCA

GGACCTGTCAACCCACTTCT

P18/Df_FAM Forward 75.6 CIIIIIAGCTACAC

463 AY262282 E4-E5

CCACAATATACACAAATACCII

P18/Dr Reverse 72.0 IIICCATGCATAC

ATGTATAGATGGCCAATGTAII

P31/Df_FAM Forward 68.3 IIIGTGGAAGGGC

244 J04353 E2

TGGTGTTGTTGGCTGTTGGTI

P31/Dr Reverse 71.5 IIIITGTAACAATCC

CATACAGACAGACAACGATAA

P33/Df_FAM Forward 75.7 CIIIIIACCACAAGCAG

150 M 12732 E4

CAGTTAGTTGCAGTACGTGC

P33/Dr Reverse 76.9 TGIIIIITTGTCCAAGG

GGTACCGAGCTCCCCTACIIII

P35/Df_FAM Forward 80.1 X74477 ICACCAAGCGAG 404 * M74117

P35/Dr Reverse AGCACAGCAACACAGTACTG 74.2

GIIIIIGTAAGGTCγA

TTCATTGGGTTACATGACATT

P39/Df_FAM Forward 70.9 GIIIIITATACTATGG

324 M62849 E2-E4

GTAGTTATGCACAATGCACAT

P39/Dr Reverse 70.0 ACIIIIICAGTACTATATC

CAGTTATAGGACTTCAATACT

P42/Df_FAM Forward 73.6 GIIIIICCACAACGTG

310 A28090

ACACACACCTAAACTAATATG

P42/Dr Reverse 67.6 IIIIITTGTATTGC

AGGCTATGTCCCTCTAACAAC

P43/Df_FAM Forward 75.9 AGIIIIIACGGGTATTG

388 AJ620205 L2

GTTCAGCACTATCAGCAGTAA

P43/Dr Reverse 71.2 CIIIIIAGTGAGAT

TGGACATGTTCAGATACATCC

P44/Df_FAM Forward 76.4 IIIIITGCACTGG

481 U31788 E2

CGTACATGTTAGCATTGTAAT

P44/Dr Reverse 64.0 AIIIinCTTGTTGTG

AGCACCACGGACGTGTCAAC

P45/Df_FAM Forward 83.5 IIIIICGTGCACAAC

370 X74479 E4-E5

GCATAGTAATGTTACATACTII

P45/Dr Reverse 56.6 IIICAATATACAG

CACAACAGTGGGAGGTCTIII

P51/Df_FAM Forward 65.7 IITATGGTACTG

167 M62877 *

GTCTGGGCTTCTTTGGCGCII

P51/Dr Reverse 80.9 IIICAGGTGGTAAG

ACCGAAACCTCCAAGACCTCI

P52/Df_FAM Forward 79.8 IIIITGTCCGTGG

205 X74481 E2

G I GCAACCCG I CC 1 1 1 G 1 1 1 G

P52/Dr Reverse 80.0 IIIIITCAGTTGCAG

TAGATACAGATTTAGATGGAT

P56/Df_FAM Forward 62.9 IIIIIGACGATTCATA

354 X74483 *

CTATTGTTACTATAGGTACTG

P56/Dr Reverse 62.8 TπIIIGAGCCTCCA

CCACATGGCATTGGACCAGTI

P58/Df_FAM Forward 73.6 IIIICAMGGTGAC

225 D90400 E2-E5

ATAGGTAATATCATTGTATATA

P58/Dr Reverse 60.3 IIIIIAGCAGCACAT

ACCGTCAGACGAAGACTGGII

P59/Df_FAM Forward 77.5 IIIGACCAAGAC

443 X77858 E2-E4

TACAATATAGCAGCAGTATTG

P59/Dr Reverse 72.0 GCIIIIITTACATTTGC

AGCAGGCGGACCCγATGGIII

P68/Df_FAM Forward 73.5 IπTATATGAT

270 DQ080079 L2

ATCAATTGGAGTAGAGGGTGI

P68/Dr Reverse 76.9 IIIIGGCAACTGTG

ATGGAATCCGAAGGAGAAAC

IC/DLFAM Forward 78.3 IIIIIGAAAGCCGAT

558 NM_120599 CESA3

TCCAACAGGATCCACAATCCI

IC/Dr Reverse 78.4 IIIITTTGGTGATTG

3 Df and Dr represent DPO forward primer and DPO reverse primer, respectively. bAccesion numbers are available from the GenBank. The symbol "I" denotes deoxyinosine. IC indicates internal control (Arabidopsis thaliana CESA3 gene). *not identified region.

19-plexPCR

To assess the identified genotypes of the 18 different HPV types using 19-plex HPV PCR, specific primers were utilized (Table 1). The total 20 μl PCR reaction contained 5-10 ng viral DNA or 10 to 10000 copies of cloned plasmids, 4 μl of 5 X primer mixture (final concentration of 3 pmole per each primer and 10 5 copies of internal control plasmid in a single reaction), 10 μl of 2X Master Mix (Seegene, Korea) containing 5% DMSO. The cycling conditions were as follows: denaturation for 15 min at 94 °C; amplification for 40 cycles, with denaturation for 30 sec at 94 0 C, annealing for 1.5 min at 60 0 C and extension for 1.5 min at 72 °C; and a final extension step of 72 ° C for 10 min. The sizes of each PCR amplicon are listed in Table 1.

The positive control plasmids which were used for 19-plex HPV PCR templates were generated from clinical samples of HPV-infected patients by mono-PCR with specific primer pair for 18 individual HPV types (6, 11, 16, 18, 31, 33, 35, 39, 42, 43, 44, 45, 51, 52, 56, 58, 59 or 68; indicated in Table 1). Each of 18 PCR amplicons was eluted using spin columns (PCR DNA Purification Kit, GeneAII Biotechnology, Korea) and ligated into TOPO ® vector (Invitrogen) respectively. The resulting ligates were used for eventual transformation into chemically competent cells {e.g. DH5α) and subsequent clones were confirmed by complete sequencing of PCR-generated fragments.

GeneScan analysis

Following PCR, 1 μl of the amplification products was transferred to MicroAmp™

96-well reaction plates (Applied Biosystems) containing 11.2 μl of Hi-Di™ formamide (Applied Biosystems), 0.5 μl of the internal size standard, and 0.5 μl of 0.3 N NaOH.

The samples were prepared as summarized below (Table 2) and placed in a heat block or thermal cycler for 5 min at 95 0 C and immediately cooled on ice for a few minutes.

Amplicon analysis was then performed on an four-capillary ABI PRISM™ 3100-Avant

Genetic Analyzer (Applied Biosystems) with GeneScan software (version 2.0), using a 36-cm capillary with POP-4 polymer according to User's Manual for the general procedure.

Table 2

Components Volume

PCR product i μl

GeneScan Internal Lane Size Standard* 0.3 μl

0.3 N NaOH 0.5 μl

Deionized formamide 11.2 μl

Final volume 13 μi φ GeneScan-500 (Applied Biosystems) recommended

Sensitivity studies

The sensitivities of the GeneScan PCR assays were assessed by testing 10-fold serial dilutions of the quantified, cloned PCR amplification products of each HPV type prepared with the TOPO TA cloning kit (Invitrogen).

DNA isolation

Viral genomic DNA was isolated from 200 μl aliquots of human cervical swab samples using spin columns (Viral Gene-spin™ Viral DNA/RNA extraction kit, iNtRON Biotechnology, Inc., Korea) according to the manufacturer's recommendations.

Clinical Application

Viral genomic DNA samples were obtained from 30 patients of whom results were proven to be identical by two different commercially available HPV detection and/or genotyping methods {i.e. Digene's hybrid capture 2 HPV test and Roche's Linear Array HPV genotyping test), and then 19-plex PCR amplifications were conducted using 5-10 ng of viral genomic DNA samples as described above.

Results

Primers/template concentrations and thermocyding conditions were optimized for each assay, and a single standard set of conditions was chosen to accommodate all assays. To check the specificity of each primer pair, 18 rounds of 19-plex PCR were performed using 10 3 copies of each 18 individual cloned plasmids as PCR templates in the presence of 10 5 copies of internal control plasmid. An electropherogram of each of 18 different HPV genotypes is shown in Figs. Ia-Ie. As shown in Figs. Ia-Ie, each primer pair generated a PCR amplicon specific for its corresponding HPV genotypes.

In order to see if each PCR amplicon peak is properly separated from each other for an easy read-out resolution, 18 rounds of type-specific single PCR were performed in the absence of internal control and a separate PCR only for internal control itself was also performed. The resultant PCR reactants were pooled together and were subjected to GeneScan analysis (Fig. If). As represented in Fig. If, the 19 different PCR products were detected at suitably separated peaks by GeneScan.

To determine the detection limit of 19-plex PCR, GeneScan analysis of dilution series of cloned PCR products was performed. The detection limits for each of 18 different HPV types were 10 to 100 copies (Table 3), indicating the HPV 19-plex PCR system is much more sensitive than conventional gel electrophoresis and ethidium bromide staining. Table 3

As representative results, electropherograms for HPV-31 and HPV-42 were shown in Figs. 2a and 2b.

We evaluated the workability of the present invention on 30 cervical swab samples previously tested by Digene's hybrid capture 2 HPV test and Roche's Linear Array HPV genotyping test. Results of 30 clinical specimens were proven to be identical by these currently available two assays. The results of 15 positive clinical samples are summarized in Table 4. Table 4

The genotyping results by 19-plex PCR according to this invention were almost completely consistent with those by the other two assays, and 19-plex PCR successfully detected and genotyped HPV in 16 positive clinical samples (Figs 3a-3d). For samples 6 and 7, HPV-53 and HPV-66 were not detected when they were further tested by the type-specific single PCR, suggesting that they were false positives generated by Roche's Linear Array HPV genotyping test. The remaining 15 out of 30 clinical samples were identified as negative just like the other two assays have identified (data not shown). A common peak of 558 bp size as the internal control appeared in all the cases tested. Taken together, the results of the HPV 19-plex PCR according to this invention were significantly consistent with or more accurate than those by other major HPV detection/genotyping methods such as Digene's hybrid capture 2 HPV test and Roche's Linear Array HPV genotyping test.

Discussion

The aim of this invention is to develop a multiplex PCR system on automated fluorescent capillary electrophoresis and GeneScan software analysis for simultaneous detection of 18 different HPV genotypes; 13 high-risk types (16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68) and 5 low-risk types (6, 11, 42, 43, 44). Our results suggest that the HPV 19-plex PCR system will achieve this goal and improve the ability of laboratories to detect HPV genotypes in a highly specific manner.

Using cloned HPV plasmid standards as control, the HPV 19-plex PCR system shows excellent type specificity. The analytical sensitivity was between 10 and 100 copies HPV per reaction mixture for each of the 18 individual HPV types (Table 3). As demonstrated by the perfect concordance with Digene's hybrid capture 2 HPV test and Roche's Linear Array HPV genotyping test, the HPV 19-plex PCR system can be used on clinical material.

The present invention overcomes the most difficult problems with conventional multiplex PCR; incompatible primer sets and high background amplification/detection. While a conventional multiplex PCR is difficult to optimize because each amplification target has relatively narrow range for "optimal" conditions, such as annealing temperature and salt concentration, the HPV 19-plex PCR system is easy to optimize since it is based on DPO system which has much wider "optimal" range of annealing temperature and salt concentration. Furthermore, the HPV 19-plex PCR system does not require any post-PCR step such as probe hybridization step and are read directly on genetic analyzer. These features result in an assay that requires only about 3.5 hours of hands-on time. The entire procedure is amenable to automation because only reagent addition is required. The 19-plex PCR system is an open platform that could theoretically be integrated with other high-throughput platforms for amplicon detection and identification. However, quality control for multiple sets of DPO primers, especially those with FAM label should be addressed to a satisfactory level of compliance by the laboratories prior to routine settings for the high throughput analysis.

Since the clinical importance of infection with multiple types of HPV is increasingly recognized (11) and the efficacy of HPV vaccine implementation should be evaluated by accurate genotyping of HPVs, it becomes more critical to know the exact genotype of HPVs. To this end, the present HPV 19-plex PCR system has been developed and offers a highly specific method for genotyping 18 different HPVs in cervical swab specimens.

Having described a preferred embodiment of the present invention, it is to be understood that variants and modifications thereof falling within the spirit of the invention may become apparent to those skilled in this art, and the scope of this invention is to be determined by appended claims and their equivalents.

References

1. Pollack, A.E., Balkin, M.S. and Denny, L (2006) Cervical cancer: a call for political will. Int J Gynaecol Obstet, 94, 333-342.

2. Bosch, F.X., Manos, M. M., Munoz, N., Sherman, M., Jansen, A.M., Peto, 1, Schiffman, M. H., Moreno, V., Kurman, R. and Shah, K.V. (1995) Prevalence of human papillomavirus in cervical cancer: a worldwide perspective.

International biological study on cervical cancer (IBSCC) Study Group. J Natl Cancer Inst, 87, 796-802.

3. Villa, L.L., Costa, R.L., Petta, C.A., Andrade, R.P., AuIt, K.A., Giuliano, A.R., Wheeler, CM., Koutsky, LA., Malm, C, Lehtinen, M. et al. (2005) Prophylactic quadrivalent human papillomavirus (types 6, 11, 16, and 18) Ll virus-like particle vaccine in young women: a randomised double-blind placebo- controlled multicentre phase II efficacy trial. Lancet Oncol, 6, 271-278.

4. Harper, D.M., Franco, E.L., Wheeler, C, Ferris, D.G., Jenkins, D., Schuind, A., Zahaf, T., Innis, B., Naud, P., De Carvalho, N.S. et al. (2004) Efficacy of a bivalent Ll virus-like particle vaccine in prevention of infection with human papillomavirus types 16 and 18 in young women: a randomised controlled trial. Lancet, 364, 1757-1765.

5. Lorincz, AT. (1996) Molecular methods for the detection of human papillomavirus infection. Obstet Gynecol Clin North Am, 23, 707-730. 6. Huang, CC, Qiu, J.T., Kashima, M. L, Kurman, RJ. and Wu, T.C (1998) Generation of type-specific probes for the detection of single-copy human papillomavirus by a novel in situ hybridization method. Mod Pathol, 11, 971- 977.

7. Oh, Y., Bae, S.M., Kim, Y.W., Choi, H.S., Nam, G.H., Han, SJ., Park, CH., Cho, Y., Han, B.D. and Ahn, W.S. (2007) Polymerase chain reaction-based fluorescent

Luminex assay to detect the presence of human papillomavirus types. Cancer Sc/, 98, 549-554.

8. Kosel, S., Burggraf, S., Mommsen, I, Engelhardt, W. and Olgemoller, B. (2003) Type-specific detection of human papillomaviruses in a routine laboratory setting—improved sensitivity and specificity of PCR and sequence analysis

compared to direct hybridisation. Clin Chem Lab Med, 41, 787-791. 9. Vernon, S.D., Unger, E.R. and Williams, D. (2000) Comparison of human papillomavirus detection and typing by cycle sequencing, line blotting, and hybrid capture. J Clin Microbiol, 38, 651-655. 10. Chun, J.Y., Kim, KJ., Hwang, I.T., Kim, YJ., Lee, D.H., Lee, LK. and Kim, J. K. (2007) Dual priming oligonucleotide system for the multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene. Nucleic Acids Res, 35, e40.

11. Trottier, H., Mahmud, S., Costa, M.C., Sobrinho, J. P., Duarte-Franco, E., Rohan, T.E., Ferenczy, A., Villa, LL. and Franco, E.L. (2006) Human papillomavirus infections with multiple types and risk of cervical neoplasia. Cancer Epidemiol Biomarkers Prev, 15, 1274-1280.