A GERMLINE COMPETENT CELL DERIVED FROM ADULT TISSUE

FIELD

THIS INVENTION relates to pluripotent mammalian cells and to methods of isolating, culturing and using same.

BACKGROUND

Pluripotent cells are cells that have the potential to differentiate into all cell types found in an adult organism, except for certain placental tissue and umbilicus. These cells naturally occur in the inner cell mass of an embryo and they differentiate to form three embryonic germ layers: ectoderm, endoderm and mesoderm. It is from these three germ layers that all adult tissues in a human are formed. There is considerable interest in using pluripotent cells in drug development and discovery, gene therapy and cell and tissue therapy. There has been clinical application of these cells in in vitro fertilisation and tissue and cellular regeneration and replacement therapies.

Pluripotent cells known to date may be classified into 3 groups. The first of these includes cells derived predominantly from embryonic tissue such as: (i) embryonic stem cells (ESCs), which are derived by long-term culture of cells from the inner cell mass of a blastocyst (Thomson et al. 1998 Science 282:1145-1147); and (ii) embryonic germ cells (EG cells), which are derived from migratory primordial germ cells found in the region of the hind gut in transit to the genitalgonadal ridge in E8.5 - E9.5 mouse foetuses (Shamblott et al. 1998 PNAS USA 10:13726-31). EG cells of a late embryo have many of the properties of ESCs. The primordial germ cells in an embryo develop into stem cells that in an adult generate the gametes. These cells are generally derived from embryos (created naturally or via cloning), fetal tissue or via the mixing of nucleus and cytoplasm of multiple species. Reprogramming of somatic cells to cells exhibiting pluripotent properties has been achieved by nuclear transplantation of a somatic nucleus into an enucleated egg. There are ethical issues that arise from the derivation of these cells. A second group includes those cells obtained by introducing defined transcription factors into somatic cells. Cells formed by expression of a combination of transcription factors (e.g SOX2, OCT-3/4, NANOG and KLF4) expressed from a retrovirus or other compounds are referred to as "induced pluripotent stem cells" or "iPS cells" (Takahashi & Yamanaka, 2006, Cell 126:663-676).

Until recently, adult stem cells have been thought not to be pluripotent although recent studies have cast some doubt on this thinking. In this context some adult stem cells are thought to represent a third class of pluripotent cells.

The in vivo developmental potency of a given cell may be determined by assessing for germline competency or, for teratoma formation in an immune deficient animal.

A "germline competent" cell is capable of giving rise to functional gametes. One form of assessing germline competence includes injecting a candidate cell into a blastocyst and determining whether Fl derived from an intercross involving a founder derived from the blastocyst contains the genetic complement of the candidate cell. Germline competency is a defining feature of all pluripotent cells.

The capacity to form a teratoma - a tumour containing tissue that is characteristic of endodermal, ectodermal and mesodermal lineages- is also understood to indicate that the candidate cell has pluripotency in vivo. All pluripotent cells known to date - ESCs, EG cells and iPS cells - have this defining property. It is generally understood that teratoma formation occurs as a consequence of a

"reprogramming" of the cell during culture to differentiate when placed in an environment in the absence of LIF. That is, the differentiation is a function of the cell itself, rather than stimuli from the tissue environment in which it is placed. As an example, inner cell mass cells generally do not form teratomas whereas ESCs do.

Teratoma formation is generally understood to be a significant limitation to the use of all pluripotent cells identified to date in clinical applications. More particularly, it is generally understood that there is a significant risk that pluripotent cells identified to date will cause teratomas or other forms of neoplasia or unregulated cell or tissue growth if used in clinical applications.

SUMMARY The present invention is broadly directed to a mammalian pluripotent stem cell that is obtainable from adult cells and/or tissues. A preferred advantage of the mammalian pluripotent stem cell is that it does not form teratomas. In one aspect, there is provided an isolated mammalian cell having the developmental potency of an embryonic stem cell (ESC), characterised in that the isolated mammalian cell does not form a teratoma when provided in an immune deficient animal. Suitably, the isolated mammalian cell is a germline competent, pluripotent stem cell.

The isolated mammalian cell may be further characterized by a presence, absence, relatively high or relatively low level of expression of one or more genes or proteins set forth in Tables 1-12. In particular embodiments, the invention provides:

(i) an isolated human cell designated Human XY pOS-17 deposited at the European Collection of Cell Cultures (ECACC) on December 16 2009 with accession number 09121602;

(ii) an isolated mouse cell designated B6 Rosa26-EGFP XY Pos deposited at the European Collection of Cell Cultures (ECACC) on

December 16 2009 with accession number 09121601; and/or

(i) an isolated rat cell designated SD Rat XY pOS deposited at the European Collection of Cell Cultures (ECACC) on December 16 2009 with accession number 09121603. In another aspect, the invention provides a method of producing a mammalian cell, said method including the step of culturing a one or more cells or tissues obtained from a mammal in a medium including one or more of FGF9, FGF2, SCF and LIF, to thereby produce the isolated mammalian cell.

In one particular embodiment, the method includes culturing neurospheres or a neurosphere-like cellular mass in a medium comprising one or more of FGF2, FGF9, SCF and/or leukaemia inhibitory factor (LIF).

In a particular embodiment of this aspect relating to human cells, the medium includes one or more of FGF2, FGF9, SCF, LIF, TGF-β2 and/or BMP-4.

In further embodiments, the method includes: (a) forming a neurosphere or a neurosphere-like cellular mass; and (b) isolating the mammalian cell from the neurosphere or neurosphere-like cellular mass, thereby providing the isolating mammalian cell. Preferably, the one or more cells or tissues, inclusive of the neurosphere or a neurosphere-like cellular mass, are obtainable from adult olfactory epithelium.

This aspect of the invention also provides an isolated mammalian cell obtainable by the method of this aspect. In yet another aspect, there is provided a method of producing a differentiated mammalian cell, said method including the step of culturing the isolated mammalian cell of any of the aforementioned aspects under conditions which facilitate the production of the differentiated cell.

This aspect of the invention also provides a differentiated cell obtainable by the method of this aspect.

In one particular embodiment of the aforementioned aspects, there is provided an isolated mammalian cell, or differentiated cell, transformed or transfected with an isolated nucleic acid.

Preferably, the isolated nucleic acid is, or is provided in, a genetic construct. In one particular embodiment, the isolated nucleic acid encodes a therapeutic agent.

In a further aspect there is provided a composition comprising an isolated mammalian cell according to the aforementioned aspects and/or a cell differentiated therefrom; and a suitable carrier, diluent or excipient. In another further aspect there is provided a method of treatment of a disease or condition in a mammal, said method including the step of administering an isolated mammalian cell according to the aforementioned aspects and/or a cell differentiated therefrom to said mammal to thereby treat said disease or condition.

In yet another further aspect there is provided an isolated mammalian cell according to the aforementioned aspects and/or a cell differentiated therefrom for use in treating a disease or condition mammal.

In a yet still further aspect there is provided a method of producing a non- human mammal, said method including the steps of:

(i) delivering one or more isolated mammalian cells of the aforementioned aspects to a blastocyst of a non-human mammal; and (ii) producing one or more progeny from said blastocyst. Suitably, the one or more progeny comprise one or more cells or tissues that have a genetic complement of the one or more isolated mammalian cells delivered at step (i).

Preferably, the method further includes the step of implanting or otherwise transferring the blastocyst produced at step (i) to a female non-human mammal.

In one embodiment, one or more isolated mammalian cells delivered at step (i) are genetically modified, wherein the progeny produced at step (ii) are genetically modified.

This aspect of the invention also includes a genetically-modified non-human mammal obtainable by the method of this aspect.

In a still yet another further aspect, the invention provides a method of identifying, designing, screening or otherwise producing a compound having a desired activity, said method including the step of: (i) contacting a candidate compound with an isolated mammalian cell of any of the aforementioned aspects, or a cell differentiated therefrom; or (ii) administering a candidate molecule to a non- human mammal produced according to the method of the aforementioned aspect, to thereby produce a compound having said activity.

Non-limiting examples of activities include cell growth and/or differentiation, anti-tumour activity, pro- or anti-apoptotic activity, neuropharmacological activity; regulation of metabolism; hormonal activity; gene regulatory activity; cell cycle regulation and immunoregulatory activity,

In particular embodiments of each of the aforementioned aspects, the mammal is a preferably human, rat or mouse.

Preferably, in aspects relating to non-human mammal, the non-human mammal is a rat or a mouse.

As used herein, except where the context requires otherwise, the term "comprise" and variations of the term, such as "comprising", "comprises" and "comprised", are not intended to exclude further additives, components, integers or steps.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1: Pluripotent adult stem cells were derived from adult olfactory mucosa. Cells from adult, Rosa-EGFP mouse olfactory mucosa were grown as neurospheres, dissociated and cultured for 48 hours as an adherent monolayer of expanded neurospheres in the presence of EGF and FGF2 for 2 days. The cells were then trypsinised and grown in POSE medium on mouse stromal feeder layers for 2 weeks (A) or 3 weeks (B) after which they were sorted on the basis of EGFP fluorescence, Y-axis, and forward scatter (X-axis (A, B). Prior to sorting, EGFP-negative cells were of similar undifferentiated phenotype (C). After sorting they were small and round (D). Scale bar = 100 μm. E: qPCR genotyping identified the EGFP amplicon in tail-tip DNA from 9 out of 13 live born offspring created from blastocyst injection of EGFP-dim cells (First experiment in G). Controls were DNA from non-transgenic mouse (WT negative control) and Rosa-EGFP mouse (EGFP-positive control). F: qPCR Control for FoxL2 amplicon from the same DNA samples. G: Summary Table of 67 separate blastocyst injections using EGFP-dim and EGFP-negative cells and different numbers of cells injected. Figure 2: EGFP was detected in many tissues in chimeric mice and throughout the tissues of progeny of germ-line chimeras. Immunochemistry detects EGFP in chimeric mouse generated from blastocyst injection of a single pOS cell (A-C). Small green dots are autofluorescence in blood cells which are also seen in controls (D-I). D-F: Negative control, adjacent section without primary antibody. G-I: Negative control, wild-type non-EGFP mouse with primary antibody. Images A-I are confocal, taken on the same settings, from similar regions of the embryo: A, D, G, head region showing brain (b); B, E, H, mid-region showing lung (Iu), skin (sk), dorsal root ganglia (drg); C, F, I, lower region showing liver (Ii), spinal cord (sc), stomach (st). All images show EGFP, autofluorescence, and DAPI-labelled nuclei. Bar (in I) = 200 μm. J-O: Fluorescence immunochemistry detects EGFP in transgenic offspring of chimeric founder (Pup 11 in Fig. IE, F) (J). Autofluorescence only is detected in Negative Controls: no primary antibody on adjacent section (L) and non EGFP mouse with primary antibody (N). K, M, O are the same sections as J, L, N, imaged for DAPI-labelled nuclei. Bars = lmm (J, K) and 2 mm (L-O). Figure 3: pOS cells express genes associated with pluripotency. A recent study identified 300 genes (the "PluriNet") associated with pluripotency in embryonic stem cells, induced pluripotent stem cells and embryonic carcinoma cells ¹⁵ . 273 probes on the mouse Illumina array map to 265 PluriNet members. A: Graph of expression of 166 PluriNet genes in different populations of olfactory cells: Reference (dissociated neurosphere cells prior to pOS cell culture and selection), Bright (EGFP-bright cells negatively selected from pOS cell cultures), Dim (EGFP-dim, pOS cells selected for initial blastocyst injections), Negative (EGFP-negative cells selected for blastocyst injections). Y-axis shows log normalised intensity for each gene: Grey shows genes not detected or reduced in Negative pOS cells. Lighter shading shows genes expressed in Negative pOS cells but neither reduced or enriched. Darker shading shows genes enriched in Negative pOS cells.

B: Relative expression in pOS cells of the chromatin modification subnetwork of PluriNet. Genes are shown that are significantly repressed or enriched in Negative pOS cells compared to Reference cells (p<0.01). Low or no expression of two of the key pluripotency genes Nanog and Oct4 are also associated with low levels of expression of protein-partners and adjacent network members. The chromatin targets Myc, Klf4/5, HDACl are induced in pOS cells, as are the cell cycle subnetworks associated with PluriNet. C: Immunofluorescence for key pluripotency proteins. Left column: antibodies against: Sox2 (top line), Oct4 (2 ^nd line), Nanog (3 ^rd line) and Klf4 (bottom line). Middle column: the same cells imaged for D APIDAP-label led nuclei. Right column: merged images of other columns. Sox2, Oct4, and Nanog mRNAs were below detection thresholds on the microarray but their proteins were detected in about 10% of cells.

Figure 4: Fl, F2 offspring of FO chimaeras.

Detection of pOS cell-derived EGFP expression in first and second generation offspring of chimaeric founder mice. On each slide the first column shows sections from the wild-type control reacted for anti-EGFP immunochemistry, the second column shows sections from the animals listed but without primary antibody, and the third column shows sections from the animals listed with primary antibody. Nuclei stained with DAPI. Endogenous EGFP expression visualised using a rabbit anti- EGFP primary antibody and an Alexa-488-conjugated goat anti-rabbit antibody. Each foetus is imaged using darkfield (DF), DAPI-labelled nuclei and EGFP filters, using an Olympus BX-51 fluorescent microscope and DP Manager software. Key to nomenclature: WT6 — Wild-type, non-transgenic control FoI 1, Fo2, FoIO, FoI 3 - Chimaeric founders 11, 10, 13 and 2, respectively. FoI 1/Fl 1 — 1st generation pup #1 bred from chimaeric founder #11.

FoI 1/F12 - 1st generation pup #2 bred from chimaeric founder #11.

Fol l/F13 - lst generation pup #3 bred from chimaeric founder #11.

Fol l/F14 - lst generation pup #4 bred from chimaeric founder #11. Fol l/F16 - lst generation pup #6 bred from chimaeric founder #11.

F02/F11/F21 - 2nd generation pup #1 bred from 1st generation Tg mouse #1, descended from chimaeric founder 2.

F02/F11/F22 - 2nd generation pup #2 bred from 1st generation Tg mouse #1, descended from chimaeric founder 2. F02/F11/F23 - 2nd generation pup #3 bred from 1st generation Tg mouse #1, descended from chimaeric founder 2.

F02/F11/F24 - 2nd generation pup #4 bred from 1st generation Tg mouse #1, descended from chimaeric founder 2.

F02/F11/F25 - 2nd generation pup #5 bred from 1st generation Tg mouse #1, descended from chimaeric founder 2.

F02/F11/F26 - 2nd generation pup #6 bred from 1st generation Tg mouse #1, descended from chimaeric founder 2.

Fo 10/Fl 1 - 1st generation pup #1 bred from chimaeric founder #10.

Fo 10/Fl 3 - 1st generation pup #3 bred from chimaeric founder #10. Fo 13/Fl 1 - 1st generation pup #1 bred from chimaeric founder #13.

Fo 13/Fl 3 - 1st generation pup #3 bred from chimaeric founder #13.

Figure 5: EGFP immunochemistry in chimeric embryo SC14 after injection of a single pOS cell into a blastocyst. A, C, E, G: EGFP immunoreactivity in different tissues. B, D, F, H: Negative control - nearby sections without primary antibody showing autofluorescence, predominantly in blood cells. A, B: Sections through limb bud (Ib). C, D: Sections through head showing developing brain (b). E, F: Sections through liver (i) and lung (Iu). G, H: Sections through spinal cord (sc) and dorsal root ganglion (drg). All images are composites of two images at different excitation and emission wavelengths: green (for EGFP), and red (for autofluorescence). All images show autofluorescent blood cells. Photomicrographs were taken on a Zeiss

Axio Imager Zl epi-fluorescence microscope at the same exposures and assembled in Adobe photoshop and Adobe Illustrator without adjustment. Scale bar = 200 μm. Figure 6: qPCR for pluripotency gene expression in pOS cells. Positive controls (lighter shaded bars) indicate gene expression in primordial germ cells (PGCs) from El 1.5 embryos. Gene expression in pOS cells (darker shaded bars) and PGCs is expressed relative to the internal control, 18S ribosomal RNA sub-unit. Figure 7: A: Mouse pOS cells; B: human pOS cells; and C: rat pOS cells.

Figure 8: Injection of 1 pOS cell into one blastocyst is sufficient to generate male and female chimaeric founder (Fo) mice and Fl offspring. PCR detection of an EGFP amplicon was performed using DNA obtained from Fl progeny of an Fo2 female. Figure 9: Expression of OCT-3/4, SOX2, NANOG and NESTIN in murine ES cells and pOS cells. Representative flow cytometry analysis of cell number (count) vs fluorescence intensity. The unshaded histogram shows the binding profile of anti- Oct4, anti-Sox2 and anti-Nestin. The shaded histogram shows the binding of the isotype-matched control antibody. The % of positive cells and the normalized mean fluorescence intensity (nMFI= MFI _marker /MFIisotype) is shown for each marker.

Figure 10: Bar graph showing comparison of Sox2 and Oct4 expression by murine pOS cells, murine ES cells and murine embryonic fibroblast (MEF) cells.

DETAILED DESCRIPTION The inventors have produced an isolated mammalian cell obtainable or derivable from adult mammalian tissue. The isolated mammalian cell has germline competency, and therefore is by definition, a pluripotent stem cell. As exemplified herein the genetic complement of the isolated mammalian cell is inherited in Fl progeny formed from a founder mammal produced from a blastocyst into which the cell has been injected or otherwise delivered.

Further, as exemplified herein, the genetic complement of the cell can be identified in tissues derived from ectodermal, endodermal and mesodermal lineages of mammals produced from a blastocyst into which the cell is delivered.

Surprisingly, as exemplified herein the inventors have observed that the isolated mammalian cell is unable to form a teratoma when provided in an immune deficient animal. Further none of the founders, Fl or progeny derived therefrom to date have been found to have neoplastic or other uncontrolled cell or tissue growth. The finding suggests that the culture methodology and/or conditions that the inventors designed to produce the isolated mammalian cell of the invention are unlike those for derivation of ESCs and EG cells in that they do not appear to reprogram the cell of the invention for teratoma formation. It will be understood that having produced a isolated mammalian cell capable of self renewal, that cell can then be produced by a variety of processes including those described further herein.

For the purposes of this invention, by "isolated" is meant material (e.g. cells) that has been removed from its natural state or otherwise been subjected to human manipulation. Isolated material may be partly, substantially or essentially free from components that normally accompany it in its natural state, or may be manipulated so as to be in an artificial state together with components that normally accompany it in its natural state. The term "isolated" also includes "enriched" or "purified", which in the context of cells, means that the frequency or proportion of cells after enrichment or purification is greater than before enrichment or purification.

Thus in one aspect there is provided an isolated mammalian cell having the developmental potency of an embryonic stem cell (ESC), the cell being characterised in that the cell does not form a teratoma when provided in an immune deficient animal.

In certain embodiments, the isolated mammalian cell is of human, mouse or rat origin. An isolated mammalian cell having the developmental potency of an ESC is typically one that is capable of differentiating to form tissues derived from mesodermal, endodermal and ectodermal lineages. Typically the cell is also capable of self renewing proliferation.

An isolated mammalian cell having the developmental potency of an ESC is not a totipotent cell. An ESC does not form extra embryonic tissues. In contrast to a pluripotent cell, a "totipotent cell" is defined as a cell that may differentiate into an entire organism. A totipotent cell has the capability to develop into a complete embryo including extra-embryonic cell types. In this context, a "pluripotent cell" is generally understood as meaning a cell that may differentiate into all cell types that constitute an organism. A pluripotent cell cannot develop into any extra-embryonic cell types. Other cells that have the developmental potency of an ESC include embryonic germ cells (EG cells) and induced pluripotent stem cells (iPS cells). However, these cells form a teratoma when provided in an immune deficient animal. It will therefore be appreciated that in one embodiment, the invention provides a pluripotent stem cell, that does not form a teratoma when provided in an immune deficient animal. Suitably, the pluripotent stem cell is obtainable, derivable or otherwise produced from adult tissue.

A teratoma is generally understood as meaning a malignant tumour that contains tissues derived from all three embryonic layers (mesoderm, endoderm and ectoderm) including bone, muscle, cartilage, nerve, tooth buds and various glands.

Prior to the invention, teratoma formation in an immune deficient, or immune compromised animal such as a SCID mouse had been regarded as a defining characteristic of pluripotency. Assays for teratoma formation generally involve the injection of candidate pluripotent cells into such an animal and examination of the animal after a period in which a teratoma or related tumour would be expected to have formed without any other cell growth stimuli. The isolated mammalian cell according to the invention is characterised in that it does not form a teratoma under these assay conditions.

In certain embodiments the isolated mammalian cell retains an undifferentiated phenotype when provided in an immune deficient animal. For example, the cell may not differentiate in the immune deficient animal. In these embodiments, after injection into an immune deficient animal the cell may retain capacity for self renewal. For example, the isolated mammalian cell may retain the developmental potency of an ES, EG or iPS cell. In another embodiment, the cell may retain the phenotype of a multipotent stem cell.

A "multipotent cell" is generally understood as meaning a cell that can develop into several cell types. A multipotent cell does not have the capability to develop into a complete embryo nor does it have the capacity to develop into all cell types that constitute an organism.

In other embodiments the cell may differentiate in the immune deficient animal to form tissue and cellular elements of the tissue in which it is placed. In other embodiments the cell may migrate to another site in the immune deficient animal or undergo cell death.

It will also be appreciated from the foregoing that the inventors have produced a germline competent cell. A germline competent cell is a cell that when injected into a blastocyst can give rise to germ cells. These germ cells can then give rise to progeny.

It will therefore be appreciated that in one embodiment, the invention provides a germline competent cell, that does not form a teratoma when provided in an immune deficient animal. Suitably, the germline competent cell is obtainable, derivable or otherwise produced from adult tissue.

The isolated mammalian cell hereinbefore described is obtainable, derivable or otherwise produced from adult cells or tissues. Non-limiting examples include bone marrow, central nervous system tissue, neural tissue, skin, gut, pancreas, muscle, brain, heart, adipose, olfactory mucosa or other mucosa or epithelia. Typically the tissue is olfactory mucosa.

It will also be appreciated that isolated mammalian cells of the invention may be characterized by levels of gene expression. Levels of gene expression may be relative levels of gene expression compared to a Reference cell, or may be detected as the presence or absence of expression of a particular gene. Typically, although not exclusively, this may be through detection and/or measurement of RNA expression. This may be by transcriptome analysis or by mRNA expression profile analysis, for example. Suitable techniques for analysis of gene expression are provided in the Examples herein, inclusive of microarray analysis, RT-PCR, northern blotting and other techniques known in the art. The inventors have determined the protein-coding transcriptome of the isolated mammalian cell of the invention. The inventors have compared the transcriptome with PluriNet genes - a regulatory network of genes that is shared by pluripotent ES cells, embryonal carcinomas and iPS cells - to identify genes in the isolated mammalian cell of the invention that are also expressed in these pluripotent cells. Surprisingly the inventors have found that certain genes that have been observed as being associated with pluripotency in these pluripotent cells are not actively transcribed in the isolated mammalian cells of the invention. These are Sox 2, Oct3/4, all of which appear to have little or no transcription, and Nanog which appears to have very little transcription.

While not wishing to be bound by hypothesis, the inventors recognise that the unique differences in mRNA expression profile of the isolated mammalian cell of the invention as compared with known pluripotent cells may mean that the isolated mammalian cell of the invention is incapable of forming teratoma because it does not have expression of certain genes that are observed in known pluripotent cells. By extension it is recognised that the invention identifies the genes that are transcribed in known pluripotent cells but not in the isolated mammalian cell of the invention as being tumourigenic genes that are not necessary for germline competency.

In one embodiment, the isolated mammalian cell according to the invention does not contain, or contains relatively low amounts of Sox 2 or Oct3/4 mRNA.

Typically the isolated mammalian cell does not contain, or contains relatively low amounts of one or more of SET, ZFP42, HMGBl or ARID38 mRNA. Typically the isolated mammalian cell does not contain, or contains relatively low amounts of one or more of the mRNAs shown in Table 3 herein.

Typically the cell does not contain, or contains relatively low amounts of DNMT3b, HDAC2 and Nanog mRNA.

In embodiments where the isolated mammalian cell, or a population of said cells, does not contain, or contains relatively low amounts of one or more mRNAs, it will be understood that the isolated mammalian cell does not contain a detectable level of the mRNA, or contains an amount that is significantly lower than in a

Reference cell or cell population. Accordingly, the isolated mammalian cell or population of said cells preferably contains a relative amount or abundance of said mRNA that is less than 50%, less than 40%, less than 30%, less than 20%, less than

15%, less than 10%, less than 5%, less than 2% or less than 1% of that of a

Reference cell or cell population.

A preferred Reference cell is a neurosphere-derived cell.

A preferred method of mRNA quantification is quantitative PCR. In another embodiment, the isolated mammalian cell may contain SPl and/or

ANP32A mRNA.

Typically the isolated mammalian cell may contain one or more mRNAs shown in Table 2 herein. Typically the cell may contain one or more of Myc, HMGAl, SMARCADl, SMARCCl, PTMA, MCM6, PCNA, HDACl, KLF5, KLF4, BTBD14B, HoxA5, FoxAl, Meisl and/or ENl mRNA. These mRNAs are enriched in the isolated mammalian cell of the invention as compared with Reference cells (described further herein) from which they are derived. Although not wishing to be bound by theory, it is possible that culture conditions exemplified herein effectively direct the emergence and/or phenotype of the isolated mammalian cell of the invention.

In one embodiment, the isolated mammalian cell may express one or more genes at a level at least 2-fold, at least 3-fold, at least 5-fold, at least 10-fold or at least 20-fold greater than that of a Reference cell or cell population.

For example, the cell may contain one or more mRNAs shown in Table 1 herein, wherein the Reference cell is, or derived from, expanded neurospheres.

In other particular embodiments, the isolated mammalian cell has a profile of mRNA expression substantially as shown in Table 4 or Table 5 herein. In yet another particular embodiment, an isolated human cell of the invention is characterized by a presence, absence, relatively high or relatively low level of expression of one or more genes (e.g mRNAs) set forth in any one of Tables 9-12. As will described in more detail in the Examples and is evident from Tables 9-12, microarray analysis of genes expressed in human cells of the invention has revealed that certain genes are expressed at higher or lower levels human cells compared to neurosphere-derived cells from which the cells were cultured. It is also evident that exposure to growth factors such as FGF-2, FGF9, leukaemia inhibitory factor (LIF), SCF, BMP-4 and/or TGFβ2 modulates gene expression in human cells.

It will also be appreciated that isolated mammalian cells of the invention may be characterized by protein expression.

Protein expression can be determined using the techniques in the Examples herein and other standard protein chemistry and serology techniques such as western blotting, 2D gel electrophoresis (e.g. SDS-PAGE and isoelectric focussing), mass spectrometry, immunohistochemistry and immunofluorescence (e.g by flow cytometric analysis).

In one embodiment, the isolated mammalian cell expresses one or more of the proteins set forth in Table 6, or preferably the proteins expressed by at least 20% of isolated mammalian cells listed in Table 7 and/or wherein mean fluorescence is greater than 5000 units. Referring to Table 6, particular examples of proteins expressed by said isolated mammalian cell, wherein mean fluorescence is greater than 18000 units include: CD13; CD16/32; CD23; CD34; CD28; CD38; CD40; CD45; CD61; CD69; CD95; CDl 17; CD122; CD124; CD201 and/or CD309. In another embodiment, the isolated mammalian cell expresses one or more of OCT-3/4, SOX2 , NANOG, KLF4, MVH, KIT and NESTIN. Typically, OCT- 3/4 and SOX2 proteins appear to be less abundant than in a Reference cell such as an ES cell.

The isolated mammalian cell of the invention may include a label for detection of the cell. GFP is one example. The label may be passed on to subsequent generations so as to monitor the development and cellular fate of the progeny.

Typically the isolated mammalian cell of the invention has a diameter of about 6 to 12 micron, preferably 8 to 10 micron and defines a spherical shape in suspension culture. The diameter of the cell can be determined by microscopy or other standard methods in the art. The adherent mammalian cell defines an elongated shape, with a morphology that resembles a fibrocyte or mesenchymal cell, with variable dimensions.

An isolated mammalian cell according to the invention may be provided, produced, cultured or obtained by any of a number of processes. Advantageously, these processes do not require the use of embryonic tissues, nor do they require genetic manipulation or modification of cells or tissues.

In one embodiment, an isolated mammalian cell according to the invention is provided by culturing the one or more cells or tissues in conditions for promoting cell proliferation and self renewal. These conditions prevent the cell from differentiating. In another embodiment, the isolated mammalian cell is provided by a process including culturing one or more cells or tissues in a medium containing factors for inducing plasticity and/or inhibiting differentiation and/or for inducing proliferation.

Generally the sample is a sample of adult tissue, examples including bone marrow, central nervous system tissue, neural tissue, skin, gut, pancreas, muscle, brain, heart, adipose, olfactory mucosa or other mucosa or epithelia.

Preferably, the tissue is olfactory mucosa. Particularly preferred examples of olfactory mucosa and methods for isolation are discussed in the Examples below. Isolated mammalian cells may be cultured "directly" from primary olfactory mucosa or from neurospheres or a neurosphere-like cellular mass which is derived from primary olfactory mucosa.

In certain embodiments, the isolated mammalian cell is provided by a process including culturing neurospheres or a neurosphere-like cellular mass in a medium containing factors for inducing plasticity and/or inhibiting differentiation and/or for inducing proliferation, thereby providing the isolated mammalian cell.

A "neurosphere" is generally known in the art as a heterogenous mixture of sometimes free floating cells generated by neural stem cells in vitro. Neurospheres are understood to form because daughter neural stem cells remain attached to their mothers through many rounds of cell division. They may also form by aggregation in which some aggregates are clonal whereas others are not.

A "neurosphere -like cellular mass" is generally understood as meaning a cellular mass that has the physical characteristics of a neurosphere. However the mass is generally not just derived from a neural stem cell. A neurosphere is a heterogenous mass that contains multipotent cells (typically less than 0.5 - 1 % of total cells) plus proliferating progenation and precursom, plus differentiating progeny

(neurons and glia). Prior to the invention a neurosphere-like cellular mass was understood to be multipotent normally giving rise to neurons or glia, and not to contain pluripotent cells.

In one embodiment the neurosphere or neurosphere-like cellular mass is formed by the process discussed in Murrell et al. 2005 Dev. Dynamics 233: 496.

In another embodiment, the cell is provided by a process including:

(a) forming a neurosphere or neurosphere-like cellular mass from a sample of tissue; and

(b) obtaining the cell from the neurosphere or neurosphere-like cellular mass, thereby providing the cell.

Examples of a medium containing factors for inducing plasticity and/or inhibiting differentiation and/or for inducing proliferation are described further herein. Typically the factors that are used in the cell culture are FGF2, FGF9, leukaemia inhibitory factor (LIF) and SCF or homologues thereof that retain the functional activity of these molecules. In one embodiment SCF is provided in a form wherein it is attached to, or otherwise expressed by, a feeder layer of cells. In certain embodiments, the cell obtained from the neurosphere or neurosphere-like cellular mass or tissue sample is cultured on a feeder layer and exposed to a gelatin coated surface. Examples of these culture conditions are described further herein. Preferably, the cell is provided by a process including the following steps:

(a) forming a neurosphere or neurosphere-like mass from a sample of tissue;

(b) dissociating cells that form part of the neurosphere or neurosphere-like mass;

(c) culturing the dissociated cells on a feeder layer in a culture medium comprising one or more of the group selected from FGF2, LIF, FGF9 and/or SCF or homologues thereof; and

(d) harvesting cultured cells produced at step (c). Preferably, the culture medium is POSE medium.

Preferably, the cells are cultured in step (c) for greater than 7 days. More preferably, the cells are cultured for greater than 16 days.

In specific embodiments relating to isolated human cells of the invention, the medium may further comprise one or more of TGFβ2 or BMP4.

In one particular embodiment relating to isolated human cells of the invention, the medium comprises FGF2, LIF, FGF9, SCF, TGFβ2 and BMP4. As shown in Table 8, various combinations of some or all of FGF2, LIF, FGF9, SCF, TGFβ2 and BMP4 may be used. It is also noted that feeder cells expressing SCF (column I in Table 8) may support cell culture in the absence of any of the other factors.

In some embodiments, the RNA and/or expressed protein is analysed for expression of genes that are required for pluripotency of cells. The resulting gene expression profile can be compared to the PluriNet database to determine the genes expressed in common with those in the PluriNet database. The analysis provides information in regard to the pluripotentiality of the cells by providing information in relation to the ability of cells to form teratomas and to undergo differentiation in culture along specific differentiation pathways.

It will also be appreciated that isolated mammalian cells of the invention may be propagated and differentiated into one or more cells or tissues of interest. Differentiation may be facilitated by culture of isolated mammalian cells of the invention in suitable growth and/or differentiation factors, as are well known in the art. Non-limiting examples of such growth and/or differentiation factors include NGF, colony stimulating factors, EGF, FGF, VEGF, HGF, IGFs and the like.

By way of example only, isolated mammalian cells of the invention may be differentiated into particular cell or tissue types such as neural cells, glia, epithelial cells such as skin and corneal cells, bone marrow cells or more differentiated cell types of the lymphoid or myeloid lineages, hepatic cells, pancreatic islet cells, cardiomyocytes and other muscle cell types and endothelial cells such as vascular endothelium, although without limitation thereto. In particular, isolated mammalian cells of the invention may be differentiated into cells or tissues known to be affected in a disease or disorder. Examples of such diseases are schizophrenia, Parkinson's disease, motor neurone disease, hereditary spastic paraplegia, MELAS mitochondrial mutational disorder and Alzheimer's disease.

In certain embodiments, differentiated cells and tissues may be useful for autologous or non-autologous cell or tissue transplantation for the treatment of a disease or condition responsive to such treatment.

In certain other embodiments, these differentiated cells may be useful for identifying or screening compounds for a desired activity, such as by drug screening and identification, toxicology, pharmacological testing and the like. Accordingly the desired activity may biological, pharmacological or any other desired activity. By way of example only, desired activities may include cell growth and/or differentiation activity, anti-tumour activity, pro- or anti-apoptotic activity, neuropharmacological activity; activity in regulation of metabolism; hormonal activity; gene regulatory activity; cell cycle regulation and immunoregulatory activity.

For example candidate drug {i.e. any suitable compound) could be screened using these differentiated cells to test their toxicological or teratogenic effect. For example if a drug is being developed for treating cancer, isolated mammalian cells of the invention cells may be differentiated into corresponding normal cells. A candidate drug or other compound may then be applied to the differentiated cells (i.e normal or non-cancerous) cells to determine which drugs or compounds that act on the cancer cell line, but not on normal cells. In this manner, the drug or other compound may be added to the cancer cell line and the differentiated cells to select a drug or compound and/or dose suitable for killing the cancer cell line, but not the normal cells. In another example, isolated mammalian cells of the invention may be propagated and differentiated into a specific type of neuron (with a specific neurotransmitter profile) or glia and then drug effects and gene expression assessed. Differentiated cells may then be screened using nucleic acid expression profiling or protein expression profiling to identify nucleic acids or proteins that may be used to investigate a cause of the disorder or could be used for clinical diagnosis.

Nucleic acid and protein profiling is known in the art and may include methods such as an array, microarray and protein binding assays (e.g. ELISA and Western blot). The arrays may be nucleic acid arrays or protein arrays. A reference expression profile may be determined by profiling expression of a number of selected nucleic acids or proteins from one or more representative normal or diseased individuals (i.e. individuals having a disorder). A particular reference expression profile may be correlated with normal or diseased condition. In one embodiment, isolated mammalian cells of the invention may be propagated from a patient presenting with a particular disease, such as those mentioned above, and a nucleic acid or protein expression profile determined. This patient expression profile may be compared with a reference expression profile of an unaffected control. Such a comparison may determine a nucleic acid or protein profile correlated with a particular disease. A reference expression profile of a diseased condition may be determined once an expression profile is known that correlates with a diseased condition.

In embodiments where isolated mammalian cells of a patient are differentiated into cells of interest that are associated with a particular disease (e.g. neurons, glia), nucleic acid or protein expression of these differentiated cells may then be compared with a reference expression profile, e.g. a control or known profile correlated with a diseased condition.

Comparing an expression profile of a diseased condition with a normal control may reveal a biochemical pathway associated with the diseased condition. Such a finding may lead to a diagnostic test for that disease and may aid in defining a cause of the disease.

The reference nucleic acid or protein expression profile may comprise a variety of cell types or tissue types. The reference profiles may be purchased commercially. In general, a reference profile may comprise a "control sample" from normal tissues of developmental stages of interest, such as those available commercially or the control sample may originate from cells of a particular disorder. For example, in schizophrenia a change in gene expression is observed in post- mortem brain. A similar change in gene expression may be assessed in cells available from a skin biopsy. A comparison may be made between fibroblast cell from skin, olfactory tissue biopsies and isolated and propagated olfactory stem cells. All these samples may be compared with commercially available reference profile (s) or a unique reference profile may be discovered which may be compared with future samples for research or diagnostic purposes.

When assessing genetic fingerprints of disease it may not be necessary to differentiate the isolated mammalian cells of the invention uniformly into a specific cell type and a heterogeneous population of neurons and glia that are reproducibly presented in control and disease cultures may be sufficient to compare gene expression. Alternatively, if a particular neuron type is suspected to be affected in a disease the isolated mammalian cells may be differentiated into a single cell type.

The method described above does not require assaying for a previously known nucleic acid or protein. As will be appreciated by a person skilled in the art, a comparison between expressed nucleic acids or proteins of a test cell and a known normal and/or diseased cell may provide information in relation to the test cell being normal or diseased (i. e. associated with a disorder).

It will be appreciated that toxicity or teratogenicity of a drug or other compound may be assessed as described above. Toxicity or teratogenicity of a compound may be determined by abnormal or a change in behavior of the isolated mammalian cell and/or differentiated cell therefrom. For example, abnormal or changed behaviour may include a change when compared with control non-disease cultures or control non-compound exposed cultures. Such changes include: cell death rate, cell division rate, proliferation rate, differentiation fate or abnormal differentiation, a change in morphology (perhaps due to cytoskeletal deficits), a changes in nuclear repair mechanisms such as in response to ionising radiation or a change in gene expression or protein expression. A person skilled in the art would be able to consider other changes in cell behaviour. In one embodiment, there is provided an isolated mammalian cell of the invention, or a cell differentiated therefrom as hereinbefore described, transformed or transfected with an isolated nucleic acid, referred to herein as a "genetically- modified cell of the invention". In one preferred embodiment, the isolated nucleic acid encodes a therapeutic agent, such as a therapeutic protein or therapeutic nucleic acid. Examples of therapeutic nucleic acids include RNA molecules, as wil be described in more detail hereinafter.

In one particular embodiment, the isolated nucleic acid is, or is provided in, a genetic construct, such as an expression vector or construct.

Suitably, the genetic construct comprises said isolated nucleic acid operably linked or connected to one or more additional nucleotide sequences. In certain embodiments additional nucleotide sequences may be regulatory sequences that facilitate and/or control expression of said nucleic acid. Non-limiting examples include promoters, enhancers, repressors, polyadenylation sequences, introns and/or splice donor/acceptor sequences, although without limitation thereto.

Promoters operable in mammalian cells are well known the art. The promoter may be constitutive, regulatable (Le inducible or repressible), tissue specific or subject to other desired functional constraints or influences on promoter activity. By way of example only, the promoter may be any promoter useful for mammalian expression, including but not limited to a CMV promoter, an SV40 promoter, an elongation factor α promoter (e.g. pEF-BOS), a crystallin promoter (e.g. αA crystallin, β2 crystallin) or a hybrid promoter (e.g. SRa), for example.

Other embodiments of additional nucleotide sequences may be selection marker sequences to facilitate selection of stable transformants/transfectants (e.g by providing resistance to neomycin, geneticin etc., or susceptibility to gangcyclovir, for example). Yet further additional nucleotide sequences may include sequences that facilitate homologous recombination, inclusive of gene "knock out" or "knock in" sequences such as Cre, loxP and/or FLP recombinase sequences. Isolated mammalian cells of the invention, or differentiated cells, may be transfected or transformed with a genetic construct, such as an expression vector or construct comprising a nucleic acid of interest. It will be appreciated that any suitable means for delivering a nucleic acid into a cell may be used, for example transfection or transformation such as by electroporation, calcium phosphate precipitation, cationic lipid delivery, DEAE dextran or other methods known in the art.

The construct or vector may be integrated into the genome of the isolated mammalian cell, or alternatively may be maintained extra-chromosomally. The nucleic acid may encode a protein or another molecule such as an RNA molecule, such as a therapeutic protein or RNA (e.g. an interfering RNA, microRNA, snoRNA, piRNA, ncRNA or a ribozyme). These RNA molecules may have a role in cellular activities including tumour suppression, regulation of transcription and/or of translation and/or regulation of the cell cycle, or of regulation of apoptosis. Proteins encoded by the nucleic acid may be hormones, cytokines, growth factors, neurotransmitters, enzymes, antibodies, immunogenic and/or antigenic proteins, although without limitation thereto. The protein may be a gene regulatory protein such as a transcription factor, repressor or other DNA-binding protein, or a protein that induces epigenetic changes in chromatin structure. Examples include but are not restricted to: histone modifiers (acetylases, deacetylases, DNA methyltransferases).

In some embodiments, the nucleic acid may correspond to an "endogenous nucleic acid" normally expressed by the cell, or a fragment thereof, or may be homologous to an endogenous nucleic acid. By way of example only, the construct or vector may comprise an endogenous nucleic acid that corresponds to a defective or mutated nucleic acid of a recipient. Accordingly, expression of the nucleic acid and/or encoded protein may treat a disease present in the recipient caused by the mutated or otherwise defective endogenous nucleic acid of the recipient. Genetically modified cells of the invention may be suitable for delivering therapeutic agents to a mammal to thereby treat a disease or condition.

In one particular example, the nucleic acid may enable said genetically modified cell of the invention to express a secreted protein such as a hormone, growth factor or cytokine, or biologically active fragment thereof. Expression of these proteins may have therapeutic benefit. By way of example only, these include: insulin for treating diabetes; thyroxine for treating hypothyroidism; and/or treatment of the nervous system such as by expressing dopamine or GDNF for Parkinson's Disease or acetylcholine to treat Alzheimer disease. In brain and spinal cord regeneration other growth factors might be useful such as BDNF, NGF, NT3.

Accordingly, in other aspects the invention provides compositions, methods and/or uses of one or more isolated mammalian cell according to the invention, and/or one or more cells differentiated therefrom, for treating a disease or condition in a mammal. Such treatments may be prophylactic or therapeutic, as required.

In one particular embodiment there is provided a composition, methods and/or uses of an isolated mammalian cell according to the invention, and/or one or more cells differentiated therefrom, for autologous or non-autologous cell transplantation for the treatment of a disease or condition.

Compositions of the invention may comprise one or more of said cells together with a carrier, diluent, excipient or preservative.

Preferably, the composition is a pharmaceutical composition. The pharmaceutical composition suitably comprises a pharmaceutically-acceptable carrier, diluent or excipient. By "pharmaceutically-acceptable carrier, diluent or excipient" is meant a solid or liquid filler, medium, diluent or encapsulating substance that may be safely administered to a mammal, such as a human- Depending upon the particular route of administration, a variety of carriers, well known in the art may be used. These carriers may be selected from a group including sugars, starches, phosphate buffered solutions, emulsifiers and isotonic saline.

Any suitable route of administration may be employed for providing a patient with the pharmaceutical composition of the invention. For example, intravenous, intra-articular, intra-muscular, intra-dermal, subcutaneous, intraperitoneal, surgically implanted and the like may be employed. In a preferred form, the pharmaceutical composition is administrable to a specific site by surgical implantation. Non-limiting examples include compositions administrable at a site of a spinal injury, as bone marrow for reconstitution in immune compromised patients, as heart muscle for regeneration in cardiac patients, as pancreatic β cells for diabetics, or as neural tissue for treating brain injury or degeneration. For example, cells may be administered into either the caudate nucleus or the substantia nigra for dopamine neuron replacement in treating Parkinson's disease patients. A predetermined dosage form includes dispersions, suspensions, injections, solutions and the like. Dosage forms may also include implants, matrices, microcapsules, prostheses, gels, controlled-delivery devices, osmotic pumps and the like. Pharmaceutical compositions of the present invention suitable for administration may be presented as discrete units such as vials containing a predetermined amount of one or more cells of the invention, as a solution or a suspension in an aqueous liquid or a non-aqueous liquid. Such compositions may be prepared by any of the methods of pharmacy, but all methods include the step of bringing into association one or more cells as described above with the carrier which constitutes one or more necessary ingredients.

It may be possible to treat several diseases using cells of the present invention. For example, stem cells obtained from a biopsy of human donor having the CCR5 allele may confer resistance to HIV infection (Samson et al., 1996, Nature 382 722, incorporated herein by reference). Cells may be transplanted into a patient infected with HIV to prevent or reduce progression of AIDS. Alternatively, cells may be transplanted into a non-infected patient to confer immunity or resistance to HIV infection. Similar methods may be used to genetically modify a cell propagated in accordance with the methods of the invention such that the propagated cells express any nucleic acid of interest. Using the cells of the invention, several diseases may potentially be treated, for example, nerve injury, spinal injury, schizophrenia, Parkinson's disease, Alzheimer's disease, bipolar disorder, mitochondrial disorders, epilepsy, diabetes, kidney failure, neuro-degenerative diseases, plastic anemia, immune-deficiency diseases, autoimmune diseases, cancers including lymphomas and leukemias, sickle cell anemia and osteoporosis deficiency in expression of a protein.

The cells of the invention may be useful for treating genetic defects. For example, U. S. Pat. No. 5,760, 012 (incorporated herein by reference), describes methods to genetically modify hematopoietic stem cells in patients afflicted with hemoglobinopathies such as sickle cell anemia, beta-thalassemia, or Gaucher's Disease. Methods of treating sickle cell anemia are disclosed by Cole-Strauss, A., et al., 1996, Science, 273 1386, incorporated herein by reference. In particular embodiments, genetically modified cells of the invention may express an antibody or an antigen. For example, the genetically modified cell of the invention may be differentiated into a "dendritic cell" (DC) for use in dendritic cell therapy. DCs are antigen presenting cells capable of initiating an antigen-specific T- cell response in an animal. DCs may be isolated from various locations of an animal's body, including peripheral blood, however, it may be difficult and laborious to isolate and propagate DCs from blood. Alternatively, DC precursors may be propagated. For example, a DC precursor may be propagated and expanded in accordance with the methods of the present invention so that a suitable number of cells may be cultured for use in dendritic cell therapy. A isolated mammalian cell may be differentiated into a predetermined stage of development suitable for dendritic cell therapy.

"Dendritic cell therapy" refers to therapeutic cancer vaccines or cellular vaccines used for tumour immunotherapy as a method for treating cancer. Dendritic cell therapy typically involves isolating DC from a patient (or isolating propagating the DC precursor), culturing the isolated DC in the presence of a tumour-associated antigen or transfecting the isolated DC with a nucleic acid encoding a tumour- associated antigen ("antigen loading or pulsing"), and administering the antigen loaded or transfected DCs to the patient. Methods for loading or pulsing dendritic cells with an antigen are described in (Meidenbauer et al, 2001, Biol Chem 4 507; Rains, et al, 2001, Hepatogastroenterology 38 347; Nestle, 2000, Oncogene 56 6673; Gilboa & Lyerly, 1998, Cancer Immunotherapy 46 82).

By way of example, US Patent 5,788, 963, describes methods and compositions for use of human dendritic cells to activate T-cells for immunotherapeutic responses against primary and metastatic prostate cancer. In one embodiment isolated DC are exposed in vitro to a prostate cancer antigen before administration to a patient.

Isolated mammalian cells may be used with a patient undergoing high dose chemotherapy and/or radiation therapy. Prior to chemotherapy, a neural tissue biopsy may be performed on a patient and the stem cells expanded in vitro in accordance with the invention and stored. The stem cells may be genetically modified or not after biopsy. The cells may later be infused into the patient after the chemotherapy treatment. Isolated mammalian cells of the invention may undergo spontaneous or induced immortalisation in vitro. The resulting immortalised, clonal or non-clonal cells may be useful as a cell line that may be genetically manipulated or not. The cell line may be placed in conditions that induce or do not induce, lineage commitment in vitro or in vivo and/or undergo cell differentiation or not, in vitro or in vivo.

Isolated mammalian cells of the invention can be used for basic research to understand the fundamental biology of development, including genes, growth factors and nutrients, which direct cellular and tissue formation. Examples of typical methods that may be used with cells prepared in accordance with the present invention are well known in the art.

Accordingly, one particular aspect of the invention provides a method of producing a non-human mammal, said method including the steps of:

(a) delivering one or more isolated mammalian cells of the invention to a blastocyst of a non-human mammal; and (b) producing one or more progeny from said blastocyst.

Suitably, the one or more progeny comprise one or more cells or tissues that have a genetic complement of the one or more isolated mammalian cells delivered at step (i).

Preferably, the method further includes the step of implanting or otherwise transferring the blastocyst produced at step (i) to a female non-human mammal.

Suitably, the one or more progeny comprise one or more cells or tissues that have a genetic complement of the one or more isolated mammalian cells delivered at step (i).

It will be appreciated that "progeny" include and encompass immediate offspring and the progeny of subsequent generations.

One particular embodiment includes producing a genetically-modified non- human mammal. For example, one or more genetically-modified mammalian cells, as hereinbefore described, may be delivered to the blastocyst of the non-human mammal at step (i). Subsequent "transgenic" progeny may be bred which include the genetic modification of the cell delivered at step (i).

A non-human mammal (e.g. a mouse or rat) produced according to the invention, inclusive of genetically-modified non-human mammals, may be useful for drug screening, analysis of developmental gene expression and identification of candidate molecules having a desired biological activity, such as by high-throughput screening, although without limitation thereto. The desired biological activity may include cell growth and/or differentiation, anti-tumour activity, pro- or anti-apoptotic activity, cell cycle regulation and immunoregulatory activity, although without limitation thereto.

Isolated mammalian cells of the invention may be used with a known animal model of disease to assess cell replacement therapy.

These animal models include: (A) neurobiology and disorders thereof, in all of its manifestations, including: Alzheimer's disease, Amyotrophic lateral sclerosis, Huntington's disease research tools for neurobiology, spinal cord injury, spinal cord disease, multiple sclerosis, cerebral palsy, muscular atrophy, (B) cardiovascular biology and disorders thereof, in all of its manifestations including myocardial infarction, stroke, ischemia, (C) epilepsy in all of its manifestations, (D) reproduction and disorders thereof, in all of its manifestations, (E) endocrinology and disorders thereof, in all of its manifestations, including Diabetes Mellitus Type I and Type II, (F) sensorineural development and function and disorders thereof, in all of its manifestations, (G) immune deficiency in all of its manifestations, (L) inflammation in all of its manifestations, (H) vital organ development and function and disorders thereof, in all of its manifestations, (I) dermatology and disorders thereof in all of its manifestations, (J) lung and respiratory tract development and function and disorders thereof, in all of its manifestations, (K) apoptosis and disorders thereof, in all of its manifestations, (L) cancer in all of its manifestations, (M) cell biology and disorders thereof, in all of its manifestations, (N) developmental biology and disorders thereof, in all of its manifestations, (O) haematology and disorders thereof, in all of its manifestations, (P) rodent/human gene homologs / orthologs, and mutants thereof, in all of their manifestations, (Q) metabolism and disorders thereof, in all of its manifestations.

The following non-limiting examples illustrate the isolated mammalian cells, compositions and methods of the invention. These examples should not be construed as limiting: the examples are included for the purposes of illustration only. The pluripotent olfactory stem "pOS" cell discussed in the Examples will be understood to represent an exemplification of the isolated mammalian cell of the invention.

EXAMPLES Production and characterization of a murine pluripotent olfactory stem "pOS" cell

Generation of murine pOS cells

Olfactory mucosa was dissected from adult, transgenic Rosa-EGFP mice (Quah et al., 2008, Proceedings of the National Academy of Sciences of the United States of America 105, 4259) and the cells grown in serum-free medium with EGF and FGF2 to form neurospheres in order to select for a cell population that includes a multipotent, neural stem cell (Murrell et al, 2005, Dev Dyn 233, 496; Murrell et al, 2008, Stem cells (Dayton, Ohio) 26, 2183)

Neurosphere-derived cells were dissociated and grown on a feeder layer of mouse stromal cells expressing a membrane-associated form of mouse Stem Cell Factor (SCF; Matsui et al., 1992, Cell 70 841) in a medium containing FGF2, SCF, FGF9, and Leukemia Inhibitory Factor (LIF). After 2 weeks, fluorescence-activated cell sorting (FACS) of these cultures revealed three populations of cells based on their EGFP expression: bright, dim and negative (Fig. IA). After a further week, EGFP expression was lost completely (Fig. IB). Prior to FACS these EGFP-negative cells were relatively homogeneous and non-differentiated in appearance (Fig. 1C) and after sorting they were small and round and about 10 μM in diameter (Fig. ID). EGFP-dim and EGFP-negative cells (pOS cells) were selected for blastocyst injection; some were frozen and stored beforehand (Fig. IG). The EGFP-bright cells were of mixed, more complex morphologies and were not selected for blastocyst injection.

Generation of chimeric mice from pOS cells and of Fl from chimerics pOS cells were injected into syngeneic C57BL/6 blastocysts (3.5 d.p.c.) which were then implanted in pseudo-pregnant CD-I females. Chimeric embryos and neonates were identified by the presence in their tissues of the EGFP transgene identified using qPCR or PCR of DNA from tissue samples of tail, limb-bud or liver (Fig. IE, F; Supplementary Fig. 1). Chimeric mice were generated in 5 out of 6 series of blastocyst injections (Fig. IG). In the initial experiments EGFP-dim cells were selected and 15-18 or 20-25 cells were injected into each blastocyst. This produced 18 live born pups, 9 of which were chimeras (Fig. IG). Six of these chimeric founders (3 F, 3M) were bred with wild-type C57BL/6J mice to test for germ-line transmission. Of these, 3 females and 2 males were transgenic, producing 41 offspring, 26 of which were transgenic, identified by qPCR of DNA (Fig. IE and IF) or immunochemistry of tissues (Fig. 2J-N). A transgenic male offspring of a chimeric female founder was bred to produce a second generation of 11 pups, 7 of which were transgenic. Transgenic offspring expressed EGFP throughout their tissues (Figure 2 J and Figure 4).

For the next series of experiments, a new population of pOS cells was generated from a second culture preparation. This time, culturing for an extra week produced EGFP-negative pOS cells (Fig. IB-D), 15-18 of which were injected per blastocyst, producing 39 offspring; 22 were chimeric (Fig. IG). pOS cells were able to be frozen and thawed. The proportion of chimeras was similar whether the pOS cells were taken from fresh cultures or thawed from frozen aliquots of those same cultures (Fig. IG). Taken together these results demonstrate that the pOS cells robustly and repeatedly gave rise to chimeric mice after blastocyst injection. Significantly, we demonstrated germline chimerism in 5 of these chimeras of both sexes and demonstrated passage of the EGFP transgene through two subsequent generations.

As a more stringent test of pluripotency, we injected blastocysts with single pOS cells (Fig. IG). This generated 15 chimeras from a total of 15 embryos (Fig. IG), identified by qPCR for the EGFP transgene in fetal limb bud samples. The tissues of chimeric animals were demonstrably chimeric for the EGFP transgene identified immunochemically at 13.5 d.p.c. Organs from all embryonic germ layers were EGFP-positive in some embryos (Fig. 2A-C; Fig. 5). Negative controls included EGFP-containing tissues without primary antibody (Fig. 2D-F) and wild- type, non-EGFP tissues processed for immunochemistry with the primary antibody (Fig. 2G-I). These single pOS cells were previously frozen, stored and thawed before blastocyst injection (Fig. IG). These results revealed that the progeny of a single cell are capable of proliferation and contributing to multiple tissues of all germ layers in the chimeric offspring.

Assessment of chimerics and Fl for abnormalities and tumours

There were no abnormalities observed in any of the chimeric embryos and the live born chimeric pups were healthy and otherwise indistinguishable from their non- chimeric littermates. None of the 48 chimeras had any obvious tumours. Adult chimeric mice and their offspring were healthy and fertile. Thirteen chimeras were maintained until 14 months old without evidence of any tumours. Independent veterinary pathology analysis revealed no pathologies in any mice except those associated with normal ageing in this strain. Similarly, no tumours were observed in pathological analysis of the first and second generation offspring of the chimeric mice at 6 -12 months of age (n = 10). These results demonstrate that germline chimerism of pOS cells is not associated with the unrestrained growth associated with tumour formation in chimeras or their offspring.

Assessment of teratomas formation by murine pOS cells

The developmental potency of stem cells is often evaluated by their ability to form teratomas when injected into immune deficient mice. Pluripotency demonstrated by teratoma formation is taken as a marker for pluripotency (Okita et al., 2007, Nature 448 313; Takahashi et al., 2007, Cell 131 861; Thomson et al, 1998, Science 282 1145). The ability of pOS cells to form teratomas was assessed by subcutaneous injection of 100,000 cells into each of two sites per mouse (n=3). The injected pOS cells were from the same batch that produced chimeric mice. None of the 6 injection sites showed any tumours or teratomas during the 4 month period of observation. Independent veterinary post-mortem and pathological inspection revealed no tumours in any part of the body. These results suggest that pluripotency defined by teratoma formation and germline chimerism can be dissociated.

Gene expression in murine pOS cells

Several genes are thought to be essential for pluripotency in embryonic stem cells (ES cells). These include Nanog, Oct3/4, Sox2, Myc, and KlfF4 (Yamanaka, 2007 Cell stem cell 1 39). Remarkably, retroviral insertion of the latter 4 genes was able to induce pluripotency in adult fibroblasts (Takahashi & Yamanaka, 2006, Cell 126 663). These "induced pluripotent stem cells" (iPS cells) are germline competent (Okita et al, 2007 supra) and were recently generated without viral vectors (Okita et al., 2008, Science 322 949).

Preliminary analysis of pOS cells indicated that they did not express Ocύ/4 or Sox2, although they robustly expressed Myc and Klf4 and only very low levels of Nanog (Fig. 6). It was therefore of interest to compare the transcriptome of pOS cells with other pluripotent cells, to seek a deeper understanding to the lack of expression of such "essential" pluripotency genes as Oct3/4 and Sox2( Kim et al., 2008, Nature 454 646). Whole transcriptome analysis was undertaken to compare cells at different stages of pOS cell generation: neurosphere-derived cells (Reference cells), EGFP- dim and EGFP-bright (FACS selected but not injected). Overall, the EGFP-bright cells were more similar in gene expression to the Reference cells, with an increasing trend to homogeneity of expression in EGFP-dim and EGFP-negative pOS cells (Fig. 3A).

Comparison of gene expression in the different cell populations generated a list of genes whose expression was increased in the pOS cell population compared to the Reference population (Table 1). A recent study (Muller et al., 2008, Nature 455 401) compared the transcriptome of 150 pluripotent and non-pluripotent cell lines to define a regulatory network of genes that is shared by pluripotent human cells (ES cells, embryonal carcinomas and iPS cells). This "pluripotency network" (PluriNet) included Nanog and the iPS genes as well as many genes regulated by Oct3/4 and Sox2, but also included many genes outside these better studied regulatory pathways. The existence of a "pluripotency network" of gene regulation (rather than just a few regulatory genes) may help explain how pOS cells are pluripotent by one measure (germline chimerism) but not another (teratoma and tumour formation). This was tested by comparing the list of genes enriched in pOS cells (Table 1) and the list of genes in the pluripotency network (Muller et al., 2008, supra) to derive a list of PluriNet genes expressed in pOS cells (Table 2). Of the 299 PluriNet genes, 273 were represented on the mouse array, of which 166 were detected in pOS cells, and 49 were significantly enriched (pO.Ol) in the pOS cells compared to the original neurosphere population (Reference cells). Taking into account the number of probes on the microarray (24,620), the number of genes expressed by the pOS cells (7,475) and the number of mouse genes in the pluripotency network (273), the probability of finding 166 PluriNet genes expressed by pOS cells by chance was very small (p=l.l le-25, Fisher's exact test). This demonstrates that, while pOS cells share a significant number of pluripotency genes with other pluripotent cells, they do not share the full complement, just as they do not share the full phenotype that includes teratoma and tumour formation. The gene expression analysis confirmed the preliminary qPCR analysis in detecting mRNAs for Klf4 and Myc, but not Oct3/4 and Sox2, genes thought central for pluripotency in iPS cells (Kim et al., 2008, supra). Nanog mRNA was detected at low levels in EGFP-dim pOS cells but not in EGFP-negative pOS cells. Notably, OCT-3/4, SOX2 and NANOG proteins were detected in vitro by immunofluroescence in some clusters of pOS cells (Fig. 3C), indicating that a minority of cells (10%) retained these proteins while their mRNA was undetectable in the pOS cell population (Fig. 3C). Therefore, the high rate of chimerism (66%) after blastocyst injection of single pOS cells indicates that ongoing expression of Nanog, Sox2 and OcU/ 4 may not be required for pluripotency and germline competence, although they may initiate the process. Alternatively, these genes may be induced in pOS cells after they are injected into blastocysts and are exposed to the local milieu. This seems paradoxical given their importance for pluripotency in iPS cells but it is consistent with their transient induction of pluripotency in iPS cells without on-going expression (Okita et al., 2008). We examined this hypothesis indirectly by investigating the expression of genes that are connected to a subnetwork of the PluriNet in which Oct3/4, Sox2 and Nanog are responsible for chromatin modification (Fig. 3B). Low or absent expression of Oct3/4, Sox2 and Nanog were linked with low levels of expression of protein-partners and adjacent network members in pOS cells whereas the chromatin modifiers Myc, Kl/4/5, HDACl and their partners were induced in pOS cells, as were the cell cycle subnetworks associated with PluriNet (Muller et al., 2008, supra).

Murine pOS Cell culture Olfactory neurosphere cultures were prepared from olfactory mucosa

(Murrell et al., 2005, supra) from adult male Rosa-EGFP transgenic (Quah et al., 2008, supra). Neurospheres were grown for 7-8 d in a serum-free medium containing EGF and FGF2 then harvested by trypsin digestion and grown for a further 2 d as single cells. They were then dissociated and plated in flasks, pre-coated with a solution gelatin, and seeded with a confluent monolayer of freshly-thawed, immortalised, S7/S74-mSCF220 mouse stromal cells that were mitotically inactivated. The cells were grown at 37C and 5% CO ₂ in humidified air in pOS enrichment (POSE) medium. After 8 d the cells were harvested by trypsin digestion and grown for 2 passages on gelatin-coated flasks without feeders, and harvested at 70-80% confluence by trypsin digestion. Trypsin was inactivated by the addition of surplus POSE medium. pOS cells were analysed and sorted using a BD FACSVantage SE DiVa Cell Sorter according to levels of EGFP fluorescence.

Blastocyst injection, embryo transfer and detection of EGFP in chimeras and transgenic offspring

Blastocysts were harvested at 3.5 days post coitus (dpc) after mating wild type, adult C57BL/6J females and males. Single or multiple GFP-dim or GFP- negative populations of pOS cells, selected by FACS were injected into blastocysts after which they were placed within the oviduct (0.5 dpc,) or the anterior uterine horn (2.5 dpc) of pseudopregnant CD-I female mice, that were mated with vasectomised CD-I males (Nagy et ah, Manipulating the mouse embryo: a laboratory manual, 3rd ed. (Cold spring Harbor Laboratory Press, Cold Spring Harbor, 2003)). Chimerism was detected in embryos harvested at 13.5 or 16.5 dpc and in neonatal pups by analysing DNA from tail, foetal liver or limb bud tissue, using quantitative, real-time polymerase chain reaction (qPCR). Some chimeric pups were grown to adulthood and mated with adult C57BL/6J mice to test for germ-line transmission of the EGFP transgene to produce transgenic offspring. These were identified by detection of EGFP using qPCR genotyping. Chimeric and transgenic embryos were also analysed for EGFP protein expression using immunofluorescence.

Teratoma formation

In three animals 100,000 pOS cells were injected subcutaneously at two sites in immune deficient NOD. CB 17 -Pr kdc ^scι mice. Mice were examined weekly and underwent a detailed post-mortem 4 months later.

Gene expression profiling

Cells were analysed for their gene expression at different stages of the culture process: reference cells, prior to growing in POSE medium (dissociated neurosphere- derived cells grown in FGF2 and EGF); after 8 d in POSE medium, prior to FACS sorting; after FACS sorting as EGFP-bright and EGFP-negative. Purified RNA was hybridized to the Illumina Mouse-Ref8 vl.l BeadChip (Illumina, Inc.). Genes were identified that were enriched in the pOS cells (EGFP-negative) compared to the reference cells using a a series of stringent statistical criteria (see Example 23). For comparative purposes with human-mouse translation tables were built using Orthology tables at NIH DAVID (http://david.abcc.ncifcrf.gov/; Dennis et al, 2003, Genome biology 4 P3).

Mice

Donor mice were adult male Rosa-EGFP Tg (EGFP-Tg) mice, 15 weeks old. The mice were generated by crossing a Rosa26 stop/flox-EGFP mouse (kindly provided by Martyn Goulding, Department of Neurobiology, SaIk Institute, University of California at San Diego, La Jolla, CA) with a generalized Cre recombinase-expressing mouse TNAP Cre, to activate expression of EGFP (Clarke et al., 2000, Science 288 1660). Blastocysts were obtained from naturally-mated adult female C57B16J mice, 7-12 weeks of age. Outbred wild type CD-I, inbred, wild type C57BL/6J and immune deficient NOD.CB 11-Prkdc ^scid mice were purchased from the Animal Resources Centre, Canning Vale, Western Australia. All mice were maintained in specific pathogen free barrier conditions at all times. All experiments were performed with approval of the Animal Ethics Committees of Griffith University and the University of Queensland in accordance with the guidelines and recommendations of the National Health and Medical Research Council of Australia.

Olfactory mucosa cultures

For each experiment five mice were killed with CO ₂ and olfactory neurosphere cultures were prepared as described previously (Murrell et al., 2005, Dev Dyn 233, 496). The olfactory mucosa was removed from the nasal septum and placed in ice cold Dulbecco's modified Eagle's medium /HAM F12 (DMEM/F12 ; GIBCO- Invitrogen) supplemented with 10% Foetal Bovine Serum (Bovogen, Australia) and 50 U/ml penicillin and 50 μg/ml streptomycin (GIBCO-Invitrogen). After washing twice in Hank's buffered salt solution (HBSS; GIBCO-Invitrogen), the olfactory mucosa was incubated with Dispase II (2.4U/ml; Roche) for 45 minutes. The olfactory epithelium was isolated from lamina propria under the dissection microscope and both tissues were washed separately in HBSS. The lamina propria was further digested with Collagenase I (Sigma- Aldrich) for 10 minutes and gently triturated. The cells were washed with HBSS. In the mean time, the olfactory epithelium was gently triturated to break sheets of tissue into cells and washed with HBSS. The cell pellets resuspended in DMEM/F12 supplement with 10% FBS and 50U/ml Penicillin and 50μg/ml streptomycin and cultured together in a 6-well tissue culture plate (Nunc) in 5% CO ₂ at 37°C. The cells were passaged using 0.25% trypsin n 0.02% EDTA (GIBCO-Invitrogen) and seeded onto poly-L-lysine (0.85μg/cm ² ; Sigma) coated 6-well tissue culture plates (Nunc) in DMEM/F12 supplemented with Insulin, Transferrin and Sodium Selenite (ITS; GIBCO- Invitrogen), 50 ng/ml Epidermal Growth Factor (EGF; Chemicon) and 25 ng/ml Fibroblast Growth Factor 2 (FGF2; Chemicon) to generate neurospheres. After 7-8 days, the neurospheres were collected. They were incubated with ImI of TrypLE (GIBCO-Invitrogen) for 10 minutes to dissociate the spheres. The cells were washed once in DMEM/F12 and cultured in DMEM/F12 supplemented with ITS, 50ng/ml EGF and 25ng/ml FGF2 for 48 hours before culturing in POSE medium (see below).

Enrichment of pOS cells from adherent neurospheres

Medium was aspirated from cultures containing confluent neurospheres. Cells were detached from the poly-L-lysine substratum by digestion with 0.25% trypsin- EDTA in HBSS (5 mins; 37C; 5% CO ₂ in humidified air). Trypsin was inactivated by the addition of surplus pOS enrichment (POSE) medium (Dulbecco's modifed Eagle's medium containing 4.5 g L-glucose/mL (Invitrogen), and supplemented with 20% (v/v) heat-inactivated (56C; 30 mins) foetal bovine serum (Cambrex), 2 mM Glutamax-1 (Invitrogen), 20 units penicillin/mL: 20 ug streptomycin /mL (Invitrogen), 50 ug gentamicin/mL (Invitrogen), 30 uM adenosine (Sigma-Aldrich), 30 uM cytidine (Sigma-Aldrich), 30 uM guanosine (Sigma-Aldrich), 10 uM thymidine (Sigma-Aldrich), 30 uM uridine (Sigma-Aldrich), 1,000 units ESGRO murine Leukemia Inhibitory Factor (LIF)/mL (Millipore), 40 ng recombinant murine Stem Cell Factor (SCF)/mL (Millipore), 20 ng recombinant human FGF2/mL (Millipore), 25 ng recombinant human FGF9/mL (Sigma-Aldrich), and 0.1 mM 2- mercaptoethanol (Sigma-Aldrich)). Cell clumps were disaggregated by gentle, repeated pipetting. Cell suspensions were transferred to polypropylene tubes and centrifuged (1,000 x g; 5 mins; 4C). Medium was aspirated. Cell pellets were dislodged by gently tapping the tubes. Cells were resuspended in fresh POSE medium and plated at 40% - 50% confluence in ventilated tissue culture-grade flasks, pre-coated with a solution of 0.1% (w/v) gelatin type A (Sigma- Aldrich), and seeded with a confluent monolayer of freshly-thawed, immortalised, S7/S7¥-mSCF220 mouse stromal cells (a kind gift from Prof. B. Hogan, Duke University), that were mitotically inactivated by incubation in 10 μg Mitomycin C (Sigma- Aldrich M-4287) / mL POSE medium, minus LIF, SCF, FGF2 and FGF9, (3 hrs; 37C; 5% CO ₂ in humidified air). Culture medium was replaced daily. Cells were passaged every two days and seeded into sterile flasks, pre-coated with gelatin and seeded with freshly- thawed, mitotically-inactivated feeders. The culture medium caused feeders to detach from the gelatin substratum, and so were replenished every passage (every 2 days). When sufficient pOS cells were generated for blastocyst injections or tumour studies, pOS cells were pre-plated onto gelatin without feeders for 2 passages. Short-term culture without feeders did not appear to compromise pluripotency, as indicated by FACS, microarray, and qPCR data.

FACS analysis and sorting

Cells were pre-plated for 2 passages on 0.1% (w/v) gelatin-coated flasks without feeders, and harvested at 70-80% confluence by trypsin digestion. Trypsin was inactivated by the addition of surplus POSE medium. Between 5xlO ⁵ and IxIO ⁶ cells were deposited into each 5 mL, polystyrene round-bottomed tube (Becton Dickinson BD352054), and centrifuged (1,000 x g; 5 mins; 4C). Supernatants were aspirated and cells washed once in PBS containing 2% (v/v) heat-inactivated FBS (1,000 x g; 5 mins; 4C). Cells were resuspended in 0.5 mL - 1 mL PBS/2% FBS and maintained on ice when not in use. Cells were analysed and sorted using a BD FACSVantage SE DiVa Cell Sorter. EGFP fluorescence was detected using a Coherent Innova 7OC argon laser at 488 nm wavelength.

Blastocyst injection and embryo transfer Wild type, adult C57BL/6J females (7-12 weeks of age), in oestrus, were naturally mated with adult C57BL/6J males (8-24 weeks of age). The morning after the mice were paired, females were examined for the presence of a copulatory plug. Noon on the day of the plug was designated 0.5 days post coitus (dpc). At 3.5 dpc, plug-positive females were euthanased by cervical dislocation or CO ₂ overdose. Uterine horns were resected and blastocysts harvested by flushing with FHM (Specialty Media). Blastocysts were transferred to a dish containing KSOM-AA medium (Specialty Media) and incubated for 2-3 hrs (37C; 5% CO2 in humidified air). Immediately before microinjection into blastocysts, pOS cells were harvested and FACS-sorted. EGFP-dim or EGFP-negative populations were collected in PBS/2% FBS, washed, resuspended in POSE medium and placed on ice prior to blastocyst injection.

Blastocysts were removed from the incubator, transferred to a dish containing FHM medium and pOS cells. The dish was placed on a cooling stage set to 14C attached to a DM-IRB inverted microscope (Leica) fitted with DIC objectives and microinjectors (Narishige). Single or multiple pOS cells were injected into each blastocyst, as described elsewhere. Following microinjection, blastocysts were washed through KSOM medium and incubated in KSOM medium (37C ; 5% CO2 in humidified air) for 1 hr or until blastocysts re-expanded. Blastocysts were placed within the oviduct (0.5 dpc,) or the anterior uterine horn (2.5 dpc) of pseudopregnant CD-I female mice, that were mated with vasectomised CD-I males. CD-I females were placed under general anaesthesia during embryo transfers, as described in Nagy et alλ

DNA isolation and QPCR genotyping

Tail, foetal liver or limb bud tissue was digested in a solution containing 50 mM Tris-HCl (pH 7.6) (Sigma- Aldrich), 100 mM Na ₂ EDTA (Sigma- Aldrich), 100 mM NaCl (Sigma- Aldrich), 1% (w/v) sodium dodecyl sulfate (Sigma- Aldrich) and 0.4 mg Proteinase K (Roche) / mL. Tissue was incubated at 55C for 16 hours. Genomic DNA was then extracted by the addition of 0.5 vol. of Tris-buffered phenol (Fluka) biopsies plus 0.5 vol. chloroform :isoamyl alcohol (24:1) (Fluka). The organic and aqueous phases were mixed thoroughly by inversion, then centrifuged (12,000 x g; 15 mins; room temp.). The upper, aqueous phase minus the interface, was transferred to a clean tube. An equal volume of chloroform:isoamyl alcohol (24:1) was added to the aqueous solution, mixed by inversion, and centrifuged as before. The upper, aqueous phase was transferred to a clean tube and residual isoamyl alcohol allowed to evaporate. An equal volume of isopropanol was added to each tube, shaken thoroughly, and centrifuged (12,000 x g; 20 mins; room temp.). The supernatant was aspirated. Nucleic acid was rinsed with 70% EtOH and centrifuged for 5 mins. Ethanol was aspirated and residual moisture evaporated by incubating tubes at 37C for 10 mins. DNA was resuspended in TE buffer (10 mM Tris-HCl (pH 7.6): 1 mM EDTA), incubated at 37C for 1 hr, and then stored at 4C. QPCR forward and reverse primers (Sigma-Aldrich) were designed to anneal within the same exon FoxL2 FP 5'GCTACCCCGAGCCCGAAGAC3 ^• (SEQ ID NO:1) FoxL2 RP 5 ^t GTGTTGTCCCGCCTCCCTTG3 ¹ (SEQ ID NO:2)

EGFP FP 5'CTGAGCAAAGACCCCAACGAS' (SEQ ID NO:3) EGFP RP 5'TCGTCCATGCCGAGAGTGA3 ¹ (SEQ ID NO:4)

Reactions were performed in 25 uL volumes, in the following conditions: Stage 1: 50C; 2 mins (1 cycle); Stage 2: 95C; 10 mins (1 cycle); Stage 3: 95C; 15 sees; 6OC; 1 min (40 cycles). Reactions contained 5 uL genomic DNA, diluted 1:10 in 10 mM Tris (pH 7.6): 1 mM EDTA, 0.15 uM forward and reverse primers, Ix SYBR Green PCR Mastermix (Applied Biosystems). Volumes were adjusted to 25 uL with MiIIiQ water. For each primer pair, a "no template" control reaction was included, as a test of primer specificity and to ensure the water was not contaminated with gDNA. QPCR reactions were undertaken in 96-well plates, in an ABI Prism Detection System 7000 plate reader. Analyses were performed using ABI Prism SDS software (Applied Biosystems).

Non-denaturing polyacrylamide gel electrophoresis QPCR amplicons were electrophoresed through a 12% non-denaturing polyacrylamide gel, prepared according to Sambrook et al. Molecular Cloning: A Laboratory Manual 2 ⁿ Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989).

Teratoma assay

FACS-sorted pOS (GFP negative) and GFP-bright cells were each resuspended in sterile PBS at a concentration of 10 ⁶ cells/mL. 0.1 mL (10 ⁵ ) pOS cells was injected subcutaneously at the right shoulder and hip of 3 male NOD/SCID mie (5 wks of age), The same mice were injected at the contralateral sites with 0.1 mL PBS. A second group of 3 NOD/SCID males (5 wks of age) was injected s.c. at the right shoulder and hip with 0.1 mL (3 x 10 ³ ) GFP-bright cells, and with 0.1 mL PBS at the contralateral sites. Mice were maintained for 4 months, then euthanased prior to full histopathological analysis by an independent veterinary pathologist (Institute for Medical and Veterinary Science, Adelaide, S.A.).

Histology of embryos

Pregnant females (12.5-16.5 dpc) were euthanased by cervical dislocation. Foetuses were resected and placed in pre-chilled petri dishes containing sterile PBS, maintained on ice. Foetuses were euthanased by hypothermia. Foetuses were transferred to a dissecting microscope, to remove extra-embryonic structures. A small piece of tissue (e.g. tail or hindlimb) was removed from each foetus for DNA extraction and determination of genotype. Whole foetuses were fixed in Bouin's solution (Sigma- Aldrich) and incubated on a rocking platform at room temperature for 24 hrs. Surplus fixative was decanted and diluted by washing foetuses in several changes of 70% (v/v) ethanol over a period of 2-3 days. Foetuses were processed overnight (Leica tissue processor), and embedded in Paraplast Extra embedding wax (Lomb Scientific). 7-10 um thickness saggital sections (Jung Biocut 2035 microtome (Leica)) were dried onto Menzel-Glaser Superfrost™ Plus glass microscope slides (Lomb Scientific) and dried at room temperature.

Immunofluorescent detection of EGFP Sections were immersed in two changes of xylene (20 mins each; room temp.), then rehydrated through an ethanol series (100%, 100%, 95%, 80%, 70%, 50%, 30%), and finally, through two changes of MiIIiQ water. Sections were immersed in each solution for 3 mins and then in antigen unmasking solution (Vector Laboratories H-3300), prepared according to the manufacturer's instruction and brought to boiling point immediately before slides were boiled for a further 5 mins in a microwave. Slides were cooled to room temperature in the antigen retrieval solution, submerged in MiIIiQ water (10 mins; room temp.), then PBTX (PBS containing 0.1% (v/v) Triton X-100), (10 mins; room temp.). Surplus PBTX was drained from the slides before they were overlaid with blocking solution (PBTX containing 10% (v/v) heat-inactivated horse serum), sealed within a humidified chamber, and incubated overnight at 4C. Excess blocking solution was drained from the slides before they were overlaid with either fresh blocking solution, or, with the primary rabbit anti-EGFP polyclonal antibody (Invitrogen A6455), diluted 1 :200 in blocking solution. Slides were sealed within a humidified chamber and incubated overnight at 4C. Slides were drained, immersed in PBTX, blocked for 30 mins at room temp., then overlaid with an Alexa 488-goat anti-rabbit IgG _H+L secondary antibody (Invitrogen Al 1008), diluted 1:200 in blocking solution. Slides were sealed within a light-resistant humidified chamber and incubated at room temp, for 1 hr. Slides were rinsed with PBTX, and overlaid with DAPI (4'-6'-Diamidino-2- phenylindole dihydrochloride (2.5 ng/mL) (Sigma-Aldrich)), for 5 mins at room temp, in a light-resistant, humidified chamber. Slides were rinsed with PBTX, mounted with 70% (v/v) glycerol: 30% (v/v) PBS, and sealed with coverslips. Slides were stored at 4C in the dark when not in use. Sections were photographed using either an Olympus BX-51 fluorescent microscope with DP Controller and DP Manager imaging software or an Olympus FVlOOO Confocal Microscope system. Figures were compiled in Adobe Photoshop 7.0 and Adobe Illustrator 10.0 (Adobe Systems Incorporated).

RNA isolation and q RT-PCR genotyping

Total RNA was extracted from cells using an SV Total RNA Isolation System (Promega), with manufacturer's instructions. Total RNA was reverse transcribed using a Superscript III First Strand Synthesis System (Invitrogen) with manufacturer's instructions. QRT-PCR amplification of cDNA was performed in 25 uL reaction volumes, using a dissociation temperature of 6OC. Reactions contained 5 uL cDNA (diluted 1:5 in MiIIiQ water), 0.15 uM forward and reverse primers, and IX SYBR Green PCR Mastermix (Applied Biosystems). Volumes were adjusted to 25 uL with MiIIiQ water. For each primer pair, a "no template" control reaction was included, as a test of primer specificity and to ensure the water was not contaminated with cDNA. To guard against amplification of genomic DNA contaminants, forward and reverse primers (Sigma-Aldrich) were designed to span an intron. 18SrRNA 5' GATCC ATTGGAGGGCAAGTCT3' (SEQ ID NO:5) 18S rRNA 3' CCAAGATCCAACTACGAGCTTTTπ ¹ (SEQ ID NO:6)

Oct-3/4 FP 5 ¹ TGCGGAGGGATGGCATACTG3' (SEQ ID NO:7) Oct-3/4 RP 5' GCACAGGGCTCAGAGGAGGTTCS' (SEQ ID NO:8)

Stra8 FP 5' CCTAAGGAAGGCAGTTTACTCCCAGTC3' (SEQ ID NO:9) Stra8 RP 5 ¹ GCAGGTTGAAGGATGCTTTGAGCS' (SEQ ID NO: 10)

Mvh FP 5' AAGCAGAGGGTTTTCCAAGC3' (SEQ ID NO: 11) Mvh RP 5' GCCTGATGCTTCTGAATCGS' (SEQ ID NO: 12)

LIFR FP 5 ¹ GACTGGTCGCAATCCACTG3' (SEQ ID NO: 13) LIFR RP 5 ¹ GTCGGATCATGAGGAGCAACS' (SEQ ID NO: 14)

Sox2 FP 5' AGGGTGGGGAAAGGAGATT3' (SEQ ID NO: 15) Sox2 RP 5' CGTCGCCAGCCTCTTACTT3' (SEQ ID NO: 16)

Ifitm3 (Fragilisl) FP 5' GTCGGTGCCTGACCATGT3' (SEQ ID NO: 17) Ifitm3 (Fragilisl) RP 5 ' C ATCTTCCGATCCCTAGACTTC3 ' (SEQ ID NO: 18)

Nanog FP 5' AGCCTCC AGC AGATGC AA3' (SEQ ID NO: 19) Nanog RP 5' GGTTTTGAAACCAGGTCTTAACC3' (SEQ ID NO:20)

c-Kit FP 5' GGTTGTCCAACTTATTGAGAAGCS' (SEQ ID NO:21) c-KH RP 5' GCAGTTTGCCAAGTTGGAGTS' (SEQ ID NO:22)

Klf4 FP 5' CGGGAAGGGAGAAGACACTS' (SEQ ID NO:23) Klf4 RP 5' GAGTTCCTCACGCCAACG3' (SEQ ID NO:24)

CdM FP 5' CAGAAGGCGCTGTTCCAG3' (SEQ ID NO:25) CdM RP 5' GTTGACGTCATCGTCTGCAT3' (SEQ ID NO:26) Reactions were performed in 25 uL volumes, in the following conditions: Stage 1: 50C; 2 mins (1 cycle); Stage 2: 95C; 10 mins (1 cycle); Stage 3: 95C; 15 sees; 6OC; 1 min (40 cycles). Reactions contained 5 uL cDNA, diluted 1:5 in MiIIiQ water, 0.15 uM forward and reverse primers, Ix SYBR Green PCR Mastermix (Applied Biosystems). Volumes were adjusted to 25 uL with MiIIiQ water. For each primer pair, a "no template" control reaction was included, as a test of primer specificity and to ensure the water was not contaminated with gDNA.

QRT-PCR reactions were undertaken in 96-well plates, in an ABI Prism Detection System 7000 plate reader. Analyses were performed using ABI Prism SDS software (Applied Biosystems).

RNA extraction, labelling and microarray hybridization

Total RNA was isolated by RNaqueous Micro column (Ambion). Quality was checked with an Agilent 2100 Bioanalyser (RNA Pico chips). 50ng of RNA was biotin labelled using a Illumina® TotalPrep™ Amplification Kits (Ambion, Inc) with a 14 hour in vitro transcription. 750ng of cRNA was hybridized to Illumina Mouse- Ref8 vl.l BeadChip (Illumina, Inc.). Slides were then scanned on an Illumina Beadstation and bead summarization was performed using BeadStudio Version 3.1.7 (Illumina, Inc). After summarization raw data was exported from BeadStudio with no additional processing.

Data normalisation and filtering

The data exported from BeadStudio was imported into R/BioConductor using the readBead function from the BeadExplorer package (http://bioconductor.Org/packages/l.9/bioc/vignettes/BeadExp lorer/inst/doc/BeadHel p.pdf). Background adjustment and quantile normalization ⁵ was performed using algorithms within the Affymetrix package

(http://bioconductor.Org/packages/l.8/bioc/vignettes/affy /inst/doc/affy.pdf) (function: bg.adjust and normalize.quantiles). The normalized data was exported out off R/BioConductor using write.beadData function for further analysis in Genespring GX 7.3.1. software (Agilent Technologies). Genes were initially filtered using Illumina® detection p-value of 0.99 and a floor of 100FU. Genes enriched in the pOS (EGFP-negative) state compared to the reference cells were identified using a Welch parametric t-test, p- value cutoff 0.01, multiple testing correction: Benjamini and Hochberg False Discovery Rate. This restriction tested 8,511 genes. Genes were further described as differentially expressed using a volcano plot fold difference of 2 with a P-value < 0.01. Human-mouse translation tables were built for the Loring dataset using Orthology tables at NIH DAVID (http://david.abcc.ncifcrf.gov/).

Immunochemistry

Cultures of pOS cells plated onto gelatin without feeders on glass coverslips, were cultured for two days, then incubated for 30 minutes in HBSS prior to fixation in modified Zamboni's fixative (2% paraformaldehyde and 0.2% picric acid in 0.1 M phosphate buffer, pH 7.2) from 5 to 30 minutes. The adherent cells were stored in PBS azide (PBS containing 0.1% sodium azide) at 4 ⁰ C until immunofluorescence processing.

The specimens were rinsed in PBS triton (0.1 M PBS and 0.1% Triton-X-100 [TX-IOO]) and permeabilised in DMSO (100%) for 10 minutes, then rinsed in PBS triton for 5 min before being blocked with 10% donkey serum (Sigma Chemical Corporation)) in PBS triton. DMSO was omitted for cell-surface immunostaining. The specimens were incubated with primary antibodies diluted in block buffer over night, at room temperature. The primary antibodies used in single and multiple labelling are listed in Table 1. The specimens were incubated for 30 minutes in block buffer before being incubated for 3 hours with the secondary antibodies diluted in block buffer, followed by washing. The secondary antibodies were donkey anti- rabbit, anti-goat or anti-mouse antibodies (Invitrogen) conjugated with Alexa-488 (green), 594 (red), or 647 (far red). The coverslips with adherent cells were mounted on glass slides using Vectashield DAPI (4'6-diamidino-2-phenylindole-2HCl, Vector Labs) mounting media which labels cell nuclei. No cross-reactivity occurred between the primary and secondary antisera combinations. Control experiments showed omission of either primary antisera abolished visible labelling with the appropriate secondary antibody/fluorophore combination. The specimens were imaged on an Axio Imager Zl epi-fluorescence microscope using 1OX and 2OX Plan-Apochromatic objectives and an oil immersion 63X Plan-Apochromatic objective. Images were captured on an Axiocam Mrm camera using Axio Vision software. Figures were compiled in Adobe Photoshop 7.0 and Adobe Illustrator 10.0 (Adobe Systems Incorporated).

Production of pOS cells in vitro Cells obtained as previously described were resuspended in fresh POSE medium and plated at 30% - 40% confluence in ventilated tissue culture-grade flasks, pre-coated with a solution of 0.1% (w/v) gelatin type A (Sigma- Aldrich), and seeded with a confluent monolayer of freshly-thawed, immortalised, iS7/57¥-mSCF220 mouse stromal cells that were mitotically inactivated by incubation in 10 μg Mitomycin C (Sigma- Aldrich M-4287) / mL POSE medium, minus LIF, SCF, FGF2 and FGF9, (3 hrs; 37C; 5% CO2 in humidified air). POSE culture medium is replaced daily. Cells are passaged every 2 - 3 days and seeded into sterile flasks, pre-coated with gelatin and seeded with freshly-thawed, mitotically-inactivated feeders. The cells may be passaged up to 10 times or more without loss of developmental potency.

Cryopreservation of pOS cells pOS cells are harvested by trypsin digestion (3 mins; 37C; 5% CO2 in humidified air). Trypsin is inactivated by the addition of surplus pOS cell enrichment medium. The cell suspension is transferred to polypropylene centrifuge tubes. Cells are pelleted (1,000 x g; 5-8 mins; 4C or room temp). The supernatant is aspirated and discarded. Cells are resuspended in 90% (v/v) FBS; 10% (v/v) cell culture-tested DMSO, dispensed into cryovials. The cryovials are placed on dry ice for 15 mins then stored for 24 hrs at -80C before transfer to LN2 (preferably vapour phase) for long-term storage.

Culturing of thawed pOS cells pOS cells are removed from the LN2 source and placed on dry ice. Cells are then thawed rapidly by immersion of the cryovial in a 37C waterbath. The cell suspension is diluted in surplus pOS cell enrichment medium and centrifuged (1,000 x g; 5-8 mins; 4C or room temp). The supernatant is aspirated and discarded. The cell pellet is resusupended gently in fresh pOS cell enrichment medium then plated into TC-grade plastic, pre-coated with gelatin and containing a confluent monolayer of feeders. EXAMPLE 2 Further characterization of murine pOS cells

Cell culture protocol Cell source

For each experiment five mice were killed with CO2 and olfactory neurosphere cultures were prepared as described previously (Murrell et al., 2005, Dev Dyn 233, 496). The olfactory mucosa was removed from the nasal septum and placed in ice cold Dulbecco's modified Eagle's medium /HAM F12 (DMEM/F12 ; GIBCO- Invitrogen) supplemented with 10% Foetal Bovine Serum (Bovogen, Australia) and 50 U/ml penicillin and 50 μg/ml streptomycin (GIBCO- Invitrogen). After washing twice in Hank's buffered salt solution (HBSS; GIBCO-Invitrogen), the olfactory mucosa was incubated with Dispase II (2.4U/ml; Roche) for 45 minutes. The olfactory epithelium was isolated from lamina propria under the dissection microscope and both tissues were washed separately in HBSS. The lamina propria was further digested with Collagenase I (Sigma- Aldrich) for 10 minutes and gently triturated. The cells were washed with HBSS. In the mean time, the olfactory epithelium was gently triturated to break sheets of tissue into cells and washed with HBSS. The cell pellets resuspended in DMEM/F12 supplement with 10% FBS and 50U/ml Penicillin and 50μg/ml streptomycin and cultured together in a 6-well tissue culture plate (Nunc) in 5% CO2 at 37°C.

Alternatively, expanded neurospheres were cultured as a monolayer from disrupted neurospheres that are in turn, derived from primary olfactory mucosal cells (olfactory epithelium + lamina propria), as described in Murrell et al., 2005, supra. Briefly, cells were passaged using 0.25% trypsin in 0.02% EDTA (GIBCO-Invitrogen) and seeded onto poly-L-lysine (0.85μg/cm2; Sigma) coated 6-well tissue culture plates (Nunc) in DMEM/F12 supplemented with Insulin, Transferrin and Sodium Selenite (ITS; GIBCO- Invitrogen), 50 ng/ml Epidermal Growth Factor (EGF; Chemicon) and 25 ng/ml Fibroblast Growth Factor 2 (FGF2; Chemicon) to generate neurospheres. After 7-8 days, the neurospheres were collected. They were incubated with 1 ml of TrypLE (GIBCO- Invitrogen) for 10 minutes to dissociate the spheres. The cells were washed once in DMEM/F12 and cultured in DMEM/F12 supplemented with ITS, 50ng/ml EGF and 25ng/ml FGF2 for 48 hours before culturing in pOS cell enrichment medium.

pOS cell enrichment medium DMEM containing 4.5 g glucose/L; 20% (v/v) heat-inactivated (56C; 30 mins) foetal bovine serum; 2 mM Glutamax-1 or 2 mM L-glutamine; 1 mM Na pyruvate; 0.1 mM non-essential amino acids; 30 μM adenosine; 30 μM guanosine; 30 μM cytidine; 30 μM uridine; 10 μM thymidine; 50 U penicillin/mL; 50 μg streptomycin/mL; 50 μg gentamicin/mL; 0.1 mM beta-mercaptoethanol.

Mouse pOS cells

Mouse pOS cells were cultured on mitotically-inactivated S1/S14 mSCF220 stromal feeders, in pOS cell enrichment medium supplemented wtih 1 or more of: 1,000 units ESGRO murine LIF/mL; 40 ng recombinant murine Stem Cell Factor/mL; 20 ng recombinant human FGF-2/mL; 25 ng recombinant human FGF9/mL.

Cell manipulation

Medium was aspirated. Primary cells or their expanded neurosphere derivatives, were flooded with a solution of 0.25% trypsin/EDTA in HBSS. Cells are detached by incubation in the trypsin solution (3-5 mins; 37C; 5% CO2 in humidified air). Trypsin is inactivated by the addition of surplus pOS cell enrichment medium. A uniform cell suspension was generated by gentle pipetting. The cells were then seeded into a tissue culture-grade flask / dish / multi-well plate, pre-coated with 0.1% (w/v) gelatin (type A from porcine skin) and containing a confluent monolayer of mitotically-inactivated S1/S14 stromal cells, expressing a truncated, surface membrane-bound form of murine Stem Cell Factor. pOS cells are cultivated on feeders in pOS cell enrichment medium (37C; 5% CO2 in humidified air). Medium is replaced daily. Cells are passaged every 2-3 days at 60-70% confluency and are seeded into new flasks, pre-coated with gelatin and containing new feeders at a dilution of 1:5 - 1:10. pOS cells may be cultivated on gelatin in the absence of feeders for a short period without detectable changes to their phenotype. Depending on the species and strain, the attainment of a stable, homogeneous population of pOS cells occurs as early as three weeks following initiation of culture of primary cells or expanded neurospheres in pOS cell enrichment medium.

Generation of mouse pOS cells

Cells were cultivated on feeders, and in the presence of one or more of: LIF, SCF, FGF-2, FGF9. Mouse pOS cells that are derived from primary cells, exhibited a stable and homogeneous phenotype that is very similar to that shown by murine pOS cells that are derived from expanded neurospheres.

An example of an isolated mouse cell designated B6 Rosa26-EGFP XY pOS was deposited at the European Collection of Cell Cultures (ECACC) on December 16 2009 with accession number 09121601

CD antigen expression by murine pOS cells

Murine pOS cells were produced as hereinbefore described and analysed for expression of CD antigens, intracellular OCT-3/4 and SCA-I by flow cytometry. CD (cluster of differentiation) antigens are proteins expressed on the cell surface that are antigenic. Mouse pOS cells were plated into a 96-well plate format. Each well was coated with one antibody, reactive against one species-specific CD or other antigen. All antigens tested are shown in Table 6. Table 7 provides a ranking of expression levels according to mean fluorescence intensity. Highest mean expression levels (>18,000 MFI units) were identified for CD13; CD16/32; CD23; CD34; CD28; CD38; CD40; CD45; CD61; CD69; CD95; CDl 17; CD122; CD124; CD201; and CD309.

Demonstration of pluripotencv in vivo

GFP-dim or GFP-negative pOS cells from C57BL/6J ROSA26- EGFP/ROSA26-EGFP mice (see Figure. 1), were collected by fluorescence-activated cell sorting (FACS), and injected into wild type C57BL/6J pre-implantation-stage mouse blastocysts. PCR analysis of EFGP expression was performed using one or both of two sets of primers and cycling conditions: Protocol 1 Forward primer 5' CGA CGT AAA CGG CCA CAA GTT CA 3'(SEQ ID NO:27) Reverse primer 5' GCT TTA CTT GTA CAG CTC GTC CAT 3' (SEQ ID NO:28) under the following PCR cycling conditions: 95 ⁰ C 3 mins; 41 cycles of: 95 ⁰ C 15 sees; 65 ⁰ C for 15 sees, 72 ⁰ C for 1 min; followed by one cycle of 72 ⁰ C for 3 mins; followed by one cycle of 25 ⁰ C for 5 mins and pause at 8 ⁰ C. This generated a 661 bp product from the EGFP template.

Protocol 2

Forward primer 5' CCT GAA GTT CAT CTG CAC CA 3' (SEQ ID NO: 29) Reverse primer 5 ' CCG TCC TCC TTG AAG TCG 3 ' (SEQ ID NO: 30) under the following PCR cycling conditions: 95 ⁰ C 10 mins; 41 cycles of: 95 ⁰ C 15 sees; 65 ⁰ C 30 sees; 72 ⁰ C 50 sees; followed by one cycle of 72 ⁰ C 2 mins and pause at 8 ⁰ C. This generated a 273 bp product from the EGFP template.

Injection of 1 pOS cell into one blastocyst was sufficient to generate chimaeric founder (Fo) mice, and to colonise tissues of endo-, meso- and ectodermal origin, plus the germ cells. All transgenic mice (Fo, Fl, F2) were viable, fertile and remained tumour-free, even after 14 months. The pOS cell-derived EGFP transgene was confirmed in tissues of founder (Fo) mice, and in their Fl and F2 offspring, by qPCR and also by PCR (Figure 8) and Southern analysis. These data show conclusively that pOS cell-derived gDNA contributes to all three embryonal germ layers plus sperm and oocytes.

Protein expression by murine pOS cells

Immunophenotypic analysis of pOS cells was performed on GFP negative cells grown at 37C and 5% CO2 in humidified air in pOS enrichment (POSE) medium, treated with trypsin and then fixed in 4% paraformaldehyde for 10 min at room temperature (RT). Approximately 1 x 10 ⁵ cells were washed twice with HBSS and incubated 30 min at RT in 0.2 ml PBS/ 1% BSA/ 1% NGS (normal goat serum)/ 0.1% Triton-X 100 together with the following antibodies: anti-human/mouse SOX2 Allophycocyanin (APC)-conjugated (IC2018A, R&D), anti-human NESTIN phycoerythrin-conjugated (IC1259P, R&D), rabbit anti-OCT4 (AB3209, Chemicon), rabbit anti-human-NANOG (AB9220, Millipore), rabbit anti-KLF4 (AB4138, Millipore) and anti-MYC (9402, Cell Signalling Technology). All antibodies and their isotype controls were diluted according to the manufacturer's instructions, or were determined empirically. Cells were washed twice in PBS/1%BSA and incubated 30 min RT with goat anti-rabbit Alexa-488 (Al 1078, Invitrogen). After two washes the cells were resuspended in 200 μL of PBS and analysed by flow cytometry (BD FAC S Aria flow cytometer). Isotype-matched controls were run in parallel for all antibodies. Results shown correspond to a representative flow cytometry histogram chosen from the analysis of 3 independent experiments. For each marker the mean fluorescence intensity (MFI) was normalized to the MFI of the corresponding isotype control. The % of positive cells was calculated as the staining observed above the isotype control.

The level of expression of the pluripotentiality markers OCT-3/4 and SOX2, KLF4, c-MYC, NANOG and a neuronal stem cell marker (NESTIN) were analysed in murine ES cells and pOS cells (Figure 9). OCT-3/4 and SOX2 expression were also compared between MEF, mouse ES cells and mouse pOS cells, as summarized in Figure 10. OCT-3/4-positive staining was observed in all cell types but the level of expression was greater in the ES cells (48.6 vs 25.1). In both cases the staining was considered moderate to high. In addition, SOX2 staining was moderate to high in ES cells and was low to moderate in 47% of pOS cells. NESTIN was positive in only 5% of the ESC with very low levels of expression and in 23% of the pOS cells with low to moderate levels of expression. KLF4, c-MYC and NANOG expression was clearly detected. The MFI of each of these proteins was similar in mouse ES cells and mouse pOS cells. This suggests that these factors may be active in the maintenance of pluripotency in pOS cells.

Immunohistochemistry

Expression of SOX2 and OCT-3/4, NANOG, KLF4, MVH, KIT and NESTIN proteins was compared between murine ES cells and pOS cells. Cells were fixed in Zamboni's solution (13.33% (w/v) paraformaldehyde in phosphate-buffered saturated picric acid, (pH 7.3) 5 mins; room temp.), washed in situ with three changes of PBS then permeabilised with PBS containing 0.1% (v/v) Triton X-100. Nucleic acid was visualised with DAPI stain. Antibodies were Alexa-conjugated, except for anti-SOX2, which was an APC conjugate. All antibodies were used at a 1:200 dilution together with a 1 :200 diluted isotype control. Mouse pOS cells expressed low but detectable levels of SOX2 and OCT-3/4, whereas NANOG, KLF4, MVH, KIT and NESTIN proteins were expressed more abundantly. Murine pOS cells were also analysed for CDl 17 and AP-2γ expression Mouse anti- mouse AP-2γ Ab was used at a 1 :200 dilution with a rabbit anti-mouse Alexa 594 secondary Ab at a 1:200 dilution. Rat anti-mouse CDl 17 Ab was used at a 1:50 dilution with a donkey anti-rat Alexa 594 secondary Ab at a 1 :200 dilution. Secondary antibody controls were used at the same dilution. AP-2γ is a transcription factor and downstream target of Prdml. AP-2γ mediates the suppression of somatic differentiation and the reacquisition of pluripotency (Weber, S. et al. Biol Reprod 2009 [PMID: 19776388]). CDl 17 is a regulator of gametogenesis, mast cell development, haematopoiesis and melanogenesis. Loss of function mutations in CDl 17 results in dose-dependent anaemia, hypopigmentation, infertility and survival. Gain of function mutations in CDl 17 are associated with a range of neoplasms, including acute myelogenous leukaemia, gastrointestinal stromal tumours and mastocytomas (Roskoski, 2005, Biochem Biophys Res Commun; 337: 1-13). Both AP-2γ and CDl 17 were expressed abundantly by pOS cells, suggesting a role for these factors in the maintenance of pOS cell pluripotency.

NOD-SCID tumour assay 1-1.5 million pOS cells were injected beneath the capsule of the left testis of immune-deficient NOD-SCID adult mice (n=8), to test whether pOS cells were similar to mouse ES cells in their capacity to form teratoma in this tissue. None of the mice developed a teratoma. Instead, each mouse developed a slow-growing fibrosarcoma that infiltrated the abdominal wall anterior to the left (injected) testis. Within the testis, there was extensive proliferation of the injected pOS cells, which compromised the blood supply. This led to a loss of integrity of the testis cords, and impaired spermatogenesis. Typically, the fibrosarcoma was evident on palpation, 3 months after injection of the pOS cells.

Testis morphology Fixed testis sections (3 um thickness) of left (injected) and right (uninjected) testes, harvested from NOD-SCID male mouse at 3 months after injection of 1-1.5 x 10e6 pOS cells beneath the capsule of the left testis.

Fibrosarcoma

A 3 μm section of fibrosarcoma, resected from left abdominal wall, anterior to left testis. The tumour mass comprised fibrocytes of mesenchymal origin. The morphology of the injected pOS cells was the same as that of the cells making up the bulk of the fibrosarcoma. These observations suggest that the fibrosarcoma originated from the injected pOS cells. The sub-capsular niche failed to elicit teratoma formation from pOS cells. This phenomenon distinguishes pOS cells from ES cells.

EXAMPLE 3

Production and characterization of a human pluripotent olfactory stem "pOS" cell

Cell culture protocol

Cell source Cells were obtained from expanded neurospheres cultured as a monolayer from disrupted neurospheres that are in turn, derived from primary olfactory mucosal cells (olfactory epithelium + lamina propria), as hereinbefore described. It is anticipated that cells may be obtained from expanded primary adult human olfactory mucosal cells (olfactory epithelium + lamina propria).

Human pOS cells

Human cells were cultured on mitotically-inactivated S1/S14 hSCF220 stromal feeders, in pOS cell enrichment medium supplemented with one or more of: 1,000 units glycosylated human LIF/mL; 40 ng recombinant human Stem Cell Factor/mL; 20 ng recombinant human FGF-2/mL; 25 ng recombinant human FGF9/mL; 5 ng recombinant human TGF-β2/mL; 10 ng recombinant human BMP-4/mL.

Table 8 shows all of the growth factor combinations tested that have yielded human pOS cells from expanded neurospheres. The attainment of a stable, homogeneous population of human pOS cells occurs as early as three weeks following initiation of culture expanded neurospheres in pOS cell enrichment medium.

An example of a human pOS cell is shown in Figure 7B. An example of a human pOS cell human XY pOS-17 was deposited at the

European Collection of Cell Cultures (ECACC) on December 16 2009 with accession number 09121602. pOS cells represent a new member of the pluripotent stem cell family with significant potential clinical application. Unlike other pluripotent stem cells, pOS cells do not form teratomas or tumours after transplantation and they could provide a source of autologous or non-autologous human stem cells for therapy. Human olfactory mucosa is safely accessible via biopsy through the external naris and multipotent olfactory neurosphere-derived cells. These may provide a source of human pOS cells.

Illumina Microarray analyses of pOS cell transcriptomes

Microarray analysis of human pOS cell gene expression. Human pOS cell cultures were initiated from expanded human neurospheres in flasks pre-coated with 0.1% (w/v) gelatin and seeded with a confluent monolayer of mitotically-inactivated Sl/S14-hSCF220 feeders. The cells were cultured in POSE medium, either without added growth factors, or supplemented with the six growth factors (LIF, SCF, FGF- 2, FGF9, TGFβ2, as indicated in Table 8.

In Tables 9-12, the following code is used. "XS" refers to expanded neurospheres; "no GF 's" refers to an absence of growth factors "6 GF 's" refers to culture in the presence of LIF, FGF-2, FGF9, SCF, BMP-4 and TGF-β2.

Table 9 shows a ranked, fold change in expression of genes compared between pOS cells cultured with or without a combination of LIF, FGF-2, FGF9, SCF, BMP-4 and TGF-β2 and expanded neurospheres from which the pOS cells were derived. Table 10 shows a ranked, fold increase or induction in expression of genes in pOS cells cultured with a combination of LIF, FGF-2, FGF9, SCF, BMP-4 and TGF- β2 comp-red to expanded neurospheres from which the pOS cells -wzxe derived. Table 11 shows fold decrease in expression of genes compared between pOS cells cultured with or without a combination of LIF, FGF-2, FGF9, SCF, BMP-4 and TGF-β2 and expanded neurospheres from which the pOS cells were derived.

Table 12 shows a ranked, fold difference in expression of genes compared between pOS cells cultured with and without a combination of LIF, FGF-2, FGF9, SCF, BMP-4 and TGF-β2.

Analysis of these data using Ingenuity™ software shows that human pOS cells cultured with or without added growth factors, exhibit an increase in expression of transcripts that encode chromatin modifying proteins, including transcriptional repressors, histone proteins, histone modifying enzymes, and the Ubiquitin pathway. This is coordinated with the down regulation of expression of the interferon signalling pathways that are mediated by SRC, STAT5 and IRF1/7. AKT is implicated as a central coordinator of these events.

PluriNet gene expression in human neurospheres

The expressed PluriNet genes in human neurospheres from which a human isolated mammalian cell may be derived are shown in Table 5. These genes were expressed in neurospheres before transfer to the POSE medium, and not because of the POSE medium.

EXAMPLE 4 Production and characterization of a rat pluripotent olfactory stem "pOS" cell

Cell source Cells were obtained from expanded primary adult rat olfactory mucosal cells

(olfactory epithelium + lamina propria), as hereinbefore described. It is anticipated that cells may be obtainable from expanded neurospheres cultured as a monolayer from disrupted neurospheres that are in turn, derived from primary rat olfactory mucosal cells (olfactory epithelium + lamina propria)

pOS cell enrichment medium

DMEM containing 4.5 g glucose/L; 20% (v/v) heat-inactivated (56C; 30 mins) foetal bovine serum; 2 mM Glutamax-1 or 2 mM L-glutamine; 1 mM Na pyruvate; 0.1 mM non-essential amino acids; 30 uM adenosine; 30 uM guanosine; 30 uM cytidine; 30 uM uridine; 10 uM thymidine; 50 U penicillin/mL; 50 ug streptomycin/mL; 50 μg gentamicin/mL; 0.1 mM beta-mercaptoethanol.

Rat pOS cells

Rat pOS cells are cultured on mitotically-inactivated S1/S14 mSCF220 stromal feeders, in pOS cell enrichment medium supplemented with 1 or more of:

1,000 units ESGRO murine or rat LIF/mL; 40 ng recombinant murine or rat Stem

Cell Factor/mL; 20 ng recombinant human FGF-2/mL; 25 ng recombinant human FGF9/mL.

Cell manipulation

Medium was aspirated. Primary cells or their expanded neurosphere derivatives, were flooded with a solution of 0.25% trypsin/EDTA in HBSS. Cells are detached by incubation in the trypsin solution (3-5 mins; 37C; 5% CO2 in humidified air). Trypsin is inactivated by the addition of surplus pOS cell enrichment medium. A uniform cell suspension was generated by gentle pipetting. The cells were then seeded into a tissue culture-grade flask / dish / multi-well plate, pre-coated with 0.1%

(w/v) gelatin (type A from porcine skin) and containing a confluent monolayer of mitotically-inactivated S1/S14 stromal cells, expressing a truncated, surface membrane-bound form of murine Stem Cell Factor. pOS cells are cultivated on feeders in pOS cell enrichment medium (37C; 5%

CO2 in humidified air). Medium is replaced daily. Cells are passaged every 2-3 days at 60-70% confluency and are seeded into new flasks, pre-coated with gelatin and containing new feeders at a dilution of 1:5 - 1:10. pOS cells may be cultivated on gelatin in the absence of feeders for a short period without detectable changes to their phenotype.

The attainment of a stable, homogeneous population of human pOS cells occurs as early as three weeks following initiation of culture of primary cells or expanded neurospheres in pOS cell enrichment medium. An example of a rat pOS cell is shown in Figure 7C. An example of a isolated rat cell designated SD Rat XY pOS was deposited at the European Collection of Cell Cultures (ECACC) on December 16 2009 with accession number 09121603.

Throughout the specification the aim has been to describe the preferred embodiments of the invention without limiting the invention to any one embodiment or specific collection of features. It will therefore be appreciated by those of skill in the art that, in light of the instant disclosure, various modifications and changes can be made in the particular embodiments exemplified without departing from the scope of the present invention. All computer programs, algorithms, patent and scientific literature referred to herein is incorporated herein by reference.

VO

VO

Ul