CROSS REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. provisional application serial No. 61/332,311 , filed on May 7, 2010, which is incorporated herein by reference in its entirety.

TECHNICAL FIELD

The present invention generally relates to hematopoietic stem cells (HSCs), and more particularly to the expansion of HSCs and their mobilization into the bloodstream, and uses thereof.

BACKGROUND ART

Hematopoietic stem cells (HSCs) are capable of generating all lineages of blood and immune cells throughout life due to their capacity to self-renew and to differentiate into descendant blood and immune cells.

Murine hematopoietic stem cells (HSCs) are highly enriched in a bone marrow fraction defined by a combination of markers (Lin ^" , Sca-1 ⁺ , c-kit ⁺ , (LSK), CD150 ⁺ , CD48 ^" ) (Kiel MJ et al., Cell. 2005; 121 : 1109-1121 ) and are either in a quiescent (dormant) state or undergo cell cycling (Wilson A et al. Cell. 2008. 135: 11 18-1129; Foudi A et al. Nat Biotechnol. 2009, 27:84-90). During cell division, one daughter cell retains its stem cell properties, whereas the other daughter cell remains a stem cell or differentiates into multipotential progenitors (MPPs; LSK, CD150 ⁺ , CD48 ⁺ or CD150 ^" , CD48 ⁺ ), which in turn develop into myeloid, lymphoid and erythroid effector cells. These differentiation processes are controlled by several mechanisms, among which the regulation of transcription figures very prominently.

Donor matched transplantation of bone marrow or hematopoietic stem cells (HSCs) is widely used to treat haematological malignancies and bone marrow dysfunction, but is associated with high mortality. Peripheral blood stem cells are a common source of stem cells for allogeneic hematopoietic stem cell transplantation (HSCT). They are typically collected from the blood through apheresis (or leukapheresis). The success of this type of transplantation depends on the ability of transplanted HSCs to home to the bone marrow and to expand/differentiate to repopulate the blood cell population. Thus, methods for expansion of HSC numbers and their mobilisation into the bloodstream of a donor and/or a recipient could significantly improve therapy. Currently, the peripheral stem cell yield is boosted with administration of Granulocyte-colony stimulating factor (G- CSF) to the donor, which mobilizes stem cells from the donor's bone marrow into the peripheral circulation. However, administration of G-CSF is associated with adverse effects such as mild-to- moderate bone pain after repeated administration, local skin reactions at the site of injection, splenic rupture, adult respiratory distress syndrome (ARDS), alveolar hemorrhage, hemoptysis and allergic reactions.

There is thus a need for novel strategies for increasing the expansion of HSC numbers and their mobilisation into the bloodstream of a donor and/or a recipient.

The present description refers to a number of documents, the content of which is herein incorporated by reference in their entirety.

SUMMARY OF THE INVENTION

In a first aspect, the present invention provides a method of increasing the number of hematopoietic stem cells (HSCs) in a biological system, said method comprising contacting HSCs from said biological system with an inhibitor of growth factor independence 1 b (Gfil b).

In another aspect, the present invention provides a method of increasing the number of HSCs in the bone marrow and/or blood of a subject, said method comprising administering to said subject an effective amount of an inhibitor of Gfil b.

In another aspect, the present invention provides a method of increasing the repopulation of HSCs in an HSC transplant recipient, said method comprising contacting the transplanted HSCs with an inhibitor of Gfi 1 b.

In another aspect, the present invention provides a use of an inhibitor of Gfil b for increasing the number of hematopoietic stem cells (HSCs) in a biological system.

In another aspect, the present invention provides a use of an inhibitor of Gfil b for the preparation of a medicament for increasing the number of hematopoietic stem cells (HSCs) in a biological system.

In another aspect, the present invention provides a use of an inhibitor of Gfil b for increasing the number of hematopoietic stem cells (HSCs) in the bone marrow and/or blood of a subject.

In another aspect, the present invention provides a use of an inhibitor of Gfil b for the preparation of a medicament for increasing the number of hematopoietic stem cells (HSCs) in the bone marrow and/or peripheral blood of a subject.

In another aspect, the present invention provides a use of an inhibitor of Gfil b for increasing the repopulation of HSCs in an HSC transplant recipient.

In another aspect, the present invention provides a use of an inhibitor of Gfil b for the preparation of a medicament for increasing the repopulation of HSCs in an HSC transplant recipient. In another aspect, the present invention provides an inhibitor of Gfil b for use in increasing the number of hematopoietic stem cells (HSCs) in a biological system.

In another aspect, the present invention provides an inhibitor of Gfil b for use in the preparation of a medicament for increasing the number of hematopoietic stem cells (HSCs) in a biological system.

In another aspect, the present invention provides an inhibitor of Gfil b for use in increasing the number of hematopoietic stem cells (HSCs) in the bone marrow and/or blood of a subject.

In another aspect, the present invention provides an inhibitor of Gfil b for use in the preparation of a medicament for increasing the number of hematopoietic stem cells (HSCs) in the bone marrow and/or blood of a subject.

In another aspect, the present invention provides an inhibitor of Gfil b for use in increasing the repopulation of HSCs in an HSC transplant recipient.

In another aspect, the present invention provides an inhibitor of Gfil b for use in the preparation of a medicament for increasing the repopulation of HSCs in an HSC transplant recipient.

In another aspect, the present invention provides a composition comprising the above- mentioned inhibitor of Gfil b and a pharmaceutically acceptable carrier.

In an embodiment, the above-mentioned contacting occurs in a transplant donor prior to the transplantation.

In an embodiment, the above-mentioned contacting occurs in said transplant recipient after the transplantation.

In an embodiment, the above-mentioned inhibitor of Gfil b is an inhibitory nucleic acid. In a further embodiment, the above-mentioned inhibitory nucleic acid is an antisense RNA, an antisense DNA, an siRNA or an shRNA.

In another embodiment, the above-mentioned inhibitor of Gfil b is a zinc-finger inhibitor. In a further embodiment, the above-mentioned zinc-finger inhibitor is Hoechst33342.

In another embodiment, the above-mentioned inhibitor of Gfil b is a peptide comprising the amino acid sequence of SEQ ID NO: 18.

In another embodiment, the above-mentioned inhibitor of Gfil b is an antibody recognizing an epitope within the amino acid sequence of SEQ ID NO: 18.

In an embodiment, the above-mentioned method, use or inhibitor of Gfil b further comprises modulating the expression of at least one gene depicted in Table I in HSCs.

In an embodiment, the above-mentioned modulation is an increase and said at least one gene is at least one of genes Nos. 1 to 288 depicted in Table I. In a further embodiment, the above- mentioned at least one gene is a gene encoding an adhesion molecule involved in the retention of HSCs in their endosteal niche. In a further embodiment, the above-mentioned adhesion molecule involved in the retention of HSCs in their endosteal niche is VCAM-1 , CXCR4 or integrin a4.

In another embodiment, the above-mentioned modulation is a decrease and said at least one gene is at least one of genes Nos. 289 to 573 depicted in Table I. In a further embodiment, the above-mentioned at least one gene is a gene encoding an adhesion molecule involved in endothelial cell adhesion. In a further embodiment, the above-mentioned adhesion molecule involved in endothelial cell adhesion is integrin β1 or integrin β3.

In another aspect, the present invention provides a method for determining whether a test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient, said method comprising: (a) contacting said test compound with a Gfil b polypeptide or a fragment thereof; (b) determining whether said test compound binds to said Gfil b polypeptide or fragment thereof wherein the binding of said test compound to said Gfil b polypeptide or fragment thereof is indicative that said test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient.

In another aspect, the present invention provides a method for determining whether a test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient, said method comprising: (a) contacting said test compound with a cell exhibiting Gfil b expression or activity; (b) determining whether said test compound inhibits said Gfil b expression or activity; wherein the inhibition of said Gfil b expression or activity in the presence of said test compound is indicative that said test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient.

In another aspect, the present invention provides a method for determining whether a test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient, said method comprising: (a) contacting said test compound with a cell comprising a first nucleic acid comprising a transcriptional regulatory element normally associated with a Gfil b gene, operably linked to a second nucleic acid encoding a reporter protein; (b) determining whether reporter gene expression or activity is inhibited in the presence of said test compound; wherein the inhibition of said reporter gene expression or activity in the presence of said test compound is indicative that said test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient.

In another aspect, the present invention provides a method for determining whether a test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient, said method comprising: (a) contacting said test compound with a cell comprising a first nucleic acid comprising a transcriptional regulatory element comprising a Gfil b binding sequence, operably linked to a second nucleic acid encoding a reporter protein; (b) determining whether reporter gene expression or activity is increased in the presence of said test compound; wherein the increase of said reporter gene expression or activity in the presence of said test compound is indicative that said test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient.

In another aspect, the present invention provides a method for determining whether a test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient, said method comprising: (a) contacting said test compound with a nucleic acid comprising a Gfil b binding sequence in the presence of Gfil b; (b) determining whether said test compound inhibits the binding of Gfil b to said nucleic acid; wherein the inhibition of the binding of Gfil b to said nucleic acid in the presence of said test compound is indicative that said test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient.

In an embodiment, the above-mentioned Gfil b binding sequence comprises TAA ATC AC ( A/T) G C A (SEQ ID NO: 19).

In an embodiment, the above-mentioned reporter protein is luciferase. Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings.

BRIEF DESCRIPTION OF DRAWINGS

In the appended drawings:

FIG. 1A shows the gating scheme for HSC and MPPs. Bone marrow cells were stained for the indicated markers and were electronically gated for Lin ^" , Sca-1 ⁺ , c-kit ⁺ cells (LSK) cells. The LSK subset was further analyzed for expression of CD150 and CD48 and was subdivided in HSCs, MPP1 and MPP2 according to published procedures. Results are representative for at least three independent experiments;

FIG. 1 B shows the activity of the Gfilb promoter followed by green fluorescence in cells isolated from Gfi1 b:GFP knock-in mice based on the gating scheme indicated in FIG. 1A. As additional information, the Mean Fluorescence Intensity of GFP (MFI, representing GfHb promoter activity) is indicated. Representative for at least three independent experiments;

FIG. 1C shows the activity of the Gfi1 promoter is followed by green fluorescence in cells isolated from Gfi1 :GFP knock-in mice (dotted lines) or Gfi1 b ^{+ +} mice (full lines) based on the gating scheme indicated in FIG. 1A. As additional information, the Mean Fluorescence Intensity of GFP (MFI, representing Gfi1 promoter activity) is indicated. Representative for at least three independent experiments;

FIG. 1 D shows a schematic representation of the murine GfHb locus, and the targeting strategy to generate the conditional GfHb mouse allele. Exons 2 (which contains the ATG start site of Gfil b), 3 and 4 are flanked by loxP sites. Upon activation of a Cre allele, these exons are excised, thereby abrogating the expression of the Gfil b protein;

FIG. 1 E shows a Southern Blot of DNA obtained from tails of wt (lanes 1 , 2), Gfi1b (lanes 3, 4) or Gfi1b ^m (lanes 5, 6) mice. DNA samples were restricted with Hind\\\. Using the 5' probe depicted in FIG. 1 D, correct recombination of the locus with the targeting vector is demonstrated by appearance of a 6-kb fragment, whereas the endogenous (wild-type) restriction fragment has a length of 10.5 kb;

FIG. 1 F shows a polymerase chain reaction (PCR) genotyping of DNA from tail tip cells of a MxCre tg Gfi1b ^m mouse (1 ) and a wt mouse (2). Mice were injected with plpC and the detection of a ko allele is the result of contaminating lymphocytes in the tail;

FIG. 1G shows a Western Blot of Abelson transformed pre B-cell lines established from bone marrow from plpC-treated Gfi1b ^m and MxCre tg Gfi1b ^m injected mice. Excision of the Gfilb locus was stimulated with interferon treatment and abrogated the expression of Gfil b protein in these cell lines. As loading control, Ponceau staining is shown;

FIG. 2A shows the course of plpC treatment of MxCre tg Gfi1b ^m mice and gating strategy determine HSC and MPP frequencies using the indicated markers to stain bone marrow cells. Loss of Gfil b significantly enhances the number of HSCs defined as LSK (Lin ^" , Sca-1 ⁺ , c-kit ⁺ cells), CD150 ⁺ , CD48 ^" . Results are representative for at least 3 independent experiments;

FIG. 2B shows the frequency of HSCs in the bone marrow (n = 14) of wt and GfHb- deficient mice, as determined by flow cytometry (p≤ 0.001 for both) 30 days after the first plpC injection (equivalent to 21 days after the last injection);

FIG. 2C shows the frequency of CD34 ⁺ and CD34 ^" HSCs in the bone marrow (n = 4) of wt and G/7 ^' 70-deficient mice, as determined by flow cytometry (p < 0.01) 30 days after the first plpC injection (equivalent to 21 days after the last injection).

FIG. 2D shows the frequency of HSCs in the spleen of wt (n = 3) and G/7 ^' 70-deficient (n = 5) mice, as determined by flow cytometry (P≤ 0.01) 30 days after the first plpC injection (equivalent to 21 days after the last injection);

FIG. 2E shows the frequency of HSCs in the peripheral blood (n = 6) of wt and GfHb- deficient mice, as determined by flow cytometry (P≤ 0.01 for both) 30 days after the first plpC injection (equivalent to 21 days after the last injection);

FIG. 2F shows Gfi1b ^m and MxCre tg Gfi1b ^m treated with plpC. 30 days after the first plpC injection, peripheral blood cells were analyzed by an Advia™ blood analyzer. Loss of Gfil b decreases platelet numbers (n = 6 for Gfi1 b/7//7 and MxCre tg Gfi1b ^m ) (P≤ .01). Panel f): As in d) for leukocytes

FIG. 2G shows similar experiments as in FIG. 2F, for red blood cells;

FIG. 2H shows similar experiments as in FIG. 2F, for leukocytes;

FIG. 2I shows a genotyping of sorted HSC from plpC-injected MxCre tg Gfi1b ^m mice. Excision of the Gfil b allele was efficient, and nonexcised alleles are below detection limit in HSCs.

FIG. 3A shows the frequency of apoptosis of HSCs in the bone marrow (n = 3) of wt and G/7 ^' 70-deficient mice was determined by flow cytometry (p < 0.001 for both) using Annexin staining;

FIG. 3B shows mice intraperitoneally injected with BrdU 18h before analysis. Bone marrow cells were stained for the indicated markers and for BrdU. A representative result from three independent examinations is shown. Mean values and standard deviations of the three independent experiments are depicted; p < 0.05 for difference in cell cycle progression between wt and G/7 ^' 70-deficient HSCs; FIG. 3C shows bone marrow cells of plpC-treated Gfi1b ^m and MxCre tg Gfi1b ^m mice stained with the specific antibodies to define HSCs, Hoechst 3342 and Verapamil according to manufacturer's instruction. Cells were then electronically gated to define HSCs (LSK, CD150 ⁺ , CD48 ^" ) and Hoechst levels were determined. A histogram representative for three independent examinations is shown. Lower panel: quantification of three independent experiments for HSCs and different MPP fractions; p < 0.05 for difference in cell cycle progression between wt and GfHb- deficient HSCs. Values were obtained 30 days after the first (equivalent to 21 days after the last) plpC injection;

FIG. 3D shows a schematic outline to detect BrdU ⁺ cells following published procedures. 40% of wt HSCs were qualified as "label retaining" whereas only 12% of Gfi1b ^k0/k0 HSCs still retained the label (BrdU) (n = 4 for Gfi1b ^m and n = 4 for MxCre tg Gfi1b ^m ; p < 0.05);

FIG. 3E shows the detection of reactive oxygen species (ROS) in HSCs. Upper panel: A representative result from three independent experiments is shown. Lower panel: quantification of ROS levels in HSCs from animals with indicated genotypes (MFI, n = 3). Values were obtained 30 days after the first (equivalent to 21 days after the last) plpC injection;

FIG. 3F shows the frequency of HSCs in the bone marrow of wt (n = 7) and G/7 ^' 70-deficient (n = 6) mice, which received N-Acetylcystein (NAC) or were left untreated (n = 14) for wt and GfUb- deficient). Frequency of HSCs was determined by flow cytometry (p < 0.01 between untreated and NAC treated G/7 ^' 70-deficient HSCs). Values were obtained 30 days after the first (equivalent to 21 days after the last) plpC injection;

FIG. 3G shows the frequency of HSCs in the spleen of wt (n = 3) and Gf/i j-deficient (n = 4) mice, which received N-Acetylcystein or were left untreated (n = 3 for wt and n = 5 GfUb- deficient) was determined by flow cytometry (p < 0.01 between untreated and NAC-treated GfUb- deficient HSCs);

FIG. 3H shows the frequency of HSCs in the peripheral blood of wt (n = 3) and GfUb- deficient (n = 5) mice, which received NAC or were left untreated (n = 6 for both genotypes) was determined by flow cytometry (p < 0.01 between untreated and NAC-treated G/7 ^' 70-deficient HSCs);

FIG. 3I shows the genotyping of G/7 ^' 70-deficient HSCs sorted from NAC- and plpC-treated G/7 ^' 70-deficient mice. HSCs: genotyping of HSCs after treatment with NAC. NAC treatment did not affect excision of floxed GfHb exons and non-excised HCSs were below detection level. CTL: Two controls with one sample consisting of cells with a flox/wt constellation and one sample consisting of wt cells.

FIG. 4A shows 20,000 bone marrow cells of plpC-treated Gfi1b ^m and MxCre tg Gfi1b ^m mice seeded on methylcellulose. After the indicated time periods (10 days), the number of colonies was determined, cells were resuspended and 10,000 cells of the suspension were replated (n = 6). Cell numbers were analyzed at indicated time points.

FIG. 4B shows a scheme depicting the transplantation of equal number of bone marrow cells. 200 000 bone marrow cells from plpC-treated Gfi1b ^fl/fl or MxCre tg Gfi1b ^fl/fl (Gfi1b ^k0/k0 ) (both CD45.2 ⁺ ) mice were transplanted with 200 000 CD45.1 ⁺ bone marrow cells into lethally irradiated CD45.1 ⁺ mice.

FIG. 4C shows the percentage of CD45.2 positive cells (% CD45.2) in the blood after transplantation acquired at indicated time points (n = 4);

FIG. 4D shows CD45 chimerism in the blood determined 24 weeks after transplantation in recipient mice (n = 4) overall (All) and for the indicated lineages. Myeloid (Mac-1), B-lymphoid (B220), T-lymphoid (CD3). The difference is significant (p < 0.05) for CD45 chimerism between wt and G//7b-deficient cells, when all leukocytes are taken into account (All);

FIG. 4E shows CD45 chimerism determined 24 weeks after transplantation in the blood, bone marrow, spleen and thymus of recipient mice (n = 4);

FIG. 4F shows the frequencies of HSCs determined in mice 24 weeks after transplantation with wt CD45.1 cells and with either wt CD45.2 BM cells or with G/7 ^' 70-deficient CD45.2 ⁺ bone marrow cells (n = 4);

FIG. 4G shows the relative proportion of HSCs originating from CD45.2 wt or CD45.2 G/7 ^' 70-deficient HSCs after electronic gating on CD150 ⁺ CD48 ^" cells depicted in FIG. 4F;

FIG. 4H shows HSCs, bone marrow (BM), splenocytes (SP), thymocytes (thy) from mice transplanted with wt CD45.1 and Gf/i j-deficient CD45.2 bone marrow cells genotyped and tested for the presence of the wt (CD45.1 ) and GfHb flox and GfHb ko alleles;

FIG. 4I shows the frequencies of HSCs in mice either transplanted with wt CD45.1 and wt CD45.2 bone marrow cells or mice transplanted with wt CD45.1 and Gf/i j-deficient (MxCre tg Gfi1b ^m ) bone marrow cells (n = 4, p < 0.01 );

FIG. 4J shows the quantification of which proportion of HSCs originates from CD45.2 wt or CD45.2 G/7 ^' 70-deficient HSCs in mice transplanted with wt CD45.1 and wt CD45.2 bone marrow cells or mice transplanted with wt CD45.1 and G/7 ^' 70-deficient {MxCre tg Gfi1b ^m ) (n = 4, p < 0.01 );

FIG. 4K shows the frequency of HSCs circulating in the peripheral blood of mice either transplanted with wt CD45.1 and wt CD45.2 bone marrow cells or mice transplanted with wt CD45.1 and CD45.2 Gf/ib-deficient (MxCre tg GfHb ^m ) (n = 4, p < 0.01 );

FIG. 4L shows the quantification of which proportion of HSCs circulating in blood originates from CD45.2 wt or CD 45.2 GfHb deficient HSCs in CD45.1 mice transplanted with wt CD45.1 and wt CD45.2 bone marrow cells or CD45.1 mice transplanted with wt CD45.1 and GfHb- deficient bone marrow cells (n = 4, p < 0.01 );

FIG. 4M shows the quantification of which proportion of Lin ^" , Sca-1 ⁺ , c-kit ⁺ (LSK) cells in bone marrow originate from CD45.2 wt or CD45.2 G/7 ^' 7b-deficient HSCs in CD45.1 mice transplanted with wt CD45.1 and wt CD45.2 HSCs or CD45.1 mice transplanted with wt CD45.1 and G/7 ^' 70-deficient bone marrow cells (n = 4, p < 0.01 );

FIG. 5A shows 50 HSCs originating from either wt (CD45.1) or Gfi1b ^k0/k0 (CD45.2) mice transplanted into lethally irradiated CD45.1 ⁺ mice. 24 weeks after transplantation, mice were euthanized and examined for the contribution of GfHb deficient HSCs to the different lineages;

FIG. 5B shows the percentage of CD45.2 positive cells (% CD45.2) in the blood at indicated time points after transplantation (n = 3);

FIG. 5C shows CD45 chimerism in the blood determined 24 weeks after transplantation in recipient mice (n = 3) overall (All) and for the indicated lineages. Myeloid (Mac-1), B-lymphoid (B220), T-lymphoid (CD3). The difference is significant (p < 0.05) for CD45 chimerism between wt and GfHb deficient cells, when all leukocytes are taken into account (All);

FIG. 5D shows CD45 chimerism in the blood determined 24 weeks after transplantation in the blood, bone marrow, spleen and thymus of recipient mice (n = 3);

FIG. 5E shows the frequency of bone marrow HSCs in mice either transplanted with wt CD45.1 and wt CD45.2 HSCs (white) or mice transplanted with wt CD45.1 and G/7 ^' 70-deficient (MxCre tg Gfi1b ^m ) HSCs (black) was determined (n = 3, p < 0.01 );

FIG. 5F shows the quantification of which proportion of HSCs originates from CD45.2 wt or CD45.2 G/7 ^' 70-deficient HSCs in mice transplanted with either wt CD45.1 and wt CD45.2 HSCs or mice transplanted with sorted HSCs cells from wt CD45.1 and Gf/i j-deficient CD45.2 mice (MxCre tg Gfi1b ^m ) (n = 3, p < 0.01 );

FIG. 5G shows the number of HSCs circulating in the peripheral blood of mice either transplanted with wt CD45.1 and wt CD45.2 HSCs or mice transplanted with wt CD45.1 and CD45.2 G/7 ^' 70-deficient HSCs (n = 3, p < 0.01 );

FIG. 5H shows the quantification of which proportion of HSCs circulating in blood originates from CD45.2 wt or CD45.2 Gf/7 >deficient HSCs in CD45.1 mice transplanted with wt CD45.1 and wt CD45.2 HSCs or CD45.1 mice transplanted with wt CD45.1 and G/7 ^' 70-deficient HSCs (n = 3, p < 0.01 );

FIG. 5I shows the quantification of which proportion of Lin ^" , Sca-1 ⁺ , c-kit ⁺ (LSK) cells in bone marrow originate from CD45.2 wt or CD 45.2 Gf/7 j-deficient HSCs in mice transplanted with wt CD45.1 and wt CD45.2 HSCs or CD45.1 mice transplanted with wt CD45.1 and G/7 ^' 70-deficient HSCs (n = 3, p < 0.01 );

FIG. 5J shows the results of a serial transplantation experiment. Mice were transplanted with bone marrow from wt CD45.1 and Gf/7 >deficient (CD45.2) mice. After 24 weeks, chimerism in peripheral blood was determined and 2 Mio. bone marrow of these chimeric mice was transplanted into new lethally irradiated CD45.1 recipient mice. After 16 weeks, chimerism in the blood in these secondary transplanted mice was determined. The percentage of CD45.2 cells in the blood of the secondary transplant recipients was compared to that from the first transplant. The observed chimerism in the first transplant was set to 100%. (n = 7 for second transplant, p < 0.15);

FIG. 5K shows cells from 50 μΙ of blood obtained from wt CD45.2 or Gf/i j-deficient CD45.2 mice and transplanted together with 200 000 bone marrow cells from wt CD45.1 mice. 12 weeks after transplantation, the number of CD45.2 cells (which was set to 1 for CD45.2 Gfi l b- deficient blood cells) within all hematopoietic cells (CD45) in blood was determined. As a control for specificity of the CD45.2 antibody, blood obtained from an untreated CD45.1 mouse was used.

FIG. 6A shows a flow cytometry analysis of bone marrow cells of plpC-treated wt, MxCre tg Gfi1b ^m , MxCre tg Gfi 1 ^m and MxCre tg Gfif ^/fl Gfi1b ^m mice after electronic gating for LSK cells and for the indicated markers. Results for MxCre tg Gfi1 ^m Gfi1b ^m are obtained 15 days after the first plpC injection (4 days after the last plpC injection);

FIG. 6B shows a similar analysis as FIG. 6A, with frequencies depicted in % with regard to total bone marrow (* p < 0.05; ***; p < 0.001 ; n = 14 for wt, n = 14 for MxCre tg Gfi1b ^m and n = 3 for MxCre tg Gfi1 ^m );

FIG. 6C shows that the simultaneous deletion of Gfi 1 and Gfi 1 b reduced the frequency of HSCs in bone marrow by ten-fold about 15 days after the first plpC injection of HSCs (** p < 0.01 ). Frequencies of HSCs reach again normal (wild type) levels in plpC injected MxCre tg Gfi1 ^m Gfi1b ^m mice, when measured 40 days after the first plpC injection (n = 14 for wt, n = 14 for MxCre tg Gfi1b ^m , n = 3 for MxCre tg Gfi1 ^m and n = 3 for MxCre tg Gfi1 ^m Gfi1b ^m );

FIG. 6D shows the genotyping of sorted HSCs of plpC injected MxCre tg Gfi1 ^m Gfi1b ^m mice 15 days after the first plpC injection. Excision of the Gfi1 allele is complete, showing the presence of a functional Cre recombinase, but excision of the GfHb allele is incomplete.

FIG. 7A shows Gfi1 ^GFP/wt (dotted, middle line), wt (full, left line with grey area) and Gfi1b ^m Gfi1 ^GFP/wt (dashed, right line) mice injected with plpC. 30 days after the first injection (equivalent to 21 days after the last injection) mice were sacrificed and examined for expression of GFP, which follows the activity of the Gfi1 promoter. Loss of Gfi 1 b leads to an enhanced activity of the Gfi1 promoter; FIG. 7B shows a real time PCR analysis of Gfi1 gene expression in HSCs from mice with the indicated genotypes (n = 3);

FIG. 7C shows an overview of genes differentially expressed in wt and G/7 ^' 70-deficient HSCs. Light grey bars represent relatively high expression levels and dark grey bars low expression levels (average fold induction or repression) in Gfi1b ^k0/k0 HSCs compared to wt HSCs. CXCR4 (chemokine (C-X-C motif) receptor 4) and VCAM-1 (vascular cell adhesion molecule-1 ) were not included in the GSEA defined adhesion molecule pathway but were also down-regulated at the RNA level.

FIG. 7D shows the expression level of different surface adhesion proteins. The expression of these proteins was changed in a manner analogous to the gene expression array results. Mean Fluorescence Intensities (MFI) of the respective surface molecules in Gfi1b ^k0/k0 (ko, black line) and wt HSCs (wt, grey line) are depicted. Dotted line indicates isotype controls;

FIG. 8A shows the amino acid sequence of human Gfil b polypeptide, isoform 1 (GenBank accession No. NP_004179, SEQ ID NO:2);

FIG. 8B shows the nucleotide sequence of the transcript encoding human Gfil b polypeptide, isoform 1 (GenBank accession No. NM_004188, SEQ ID NO:1 ). The coding region (nucleotides 152 to 1 144) is indicated in bold;

FIG. 8C shows the amino acid sequence of human Gfil b polypeptide, isoform 2 (GenBank accession No. NP_001128503, SEQ ID NO:4);

FIG. 8D shows the nucleotide sequence of the transcript encoding human Gfil b polypeptide, isoform 2 (GenBank accession No. NM_001135031 , SEQ ID NO:3). The coding region (nucleotides 152 to 1006) is indicated in bold;

FIG. 8E shows the amino acid sequence of mouse Gfil b polypeptide, isoform 1 (GenBank accession No. NP_032140, SEQ ID NO:6)

FIG. 8F shows the nucleotide sequence of the transcript encoding mouse Gfil b polypeptide, isoform 1 (GenBank accession No. NM_008114, SEQ ID NO:5). The coding region (nucleotides 156 to 1 148) is indicated in bold;

FIG. 8G shows the amino acid sequence of mouse Gfil b polypeptide, isoform 2 (GenBank accession No. NP_001153878, SEQ ID NO:8);

FIG. 8H shows the nucleotide sequence of the transcript encoding mouse Gfil b polypeptide, isoform 2 (GenBank accession No. NM_001160406, SEQ ID NO:7). The coding region (nucleotides 156 to 1247) is indicated in bold; and

FIGs. 9A to 9E show the nucleotide sequence of the genomic-integrated part of the Gfil b conditional knock-out plasmid construct (SEQ ID NO:9). The sequences of the pBSII-SK+ plasmid backbone and the diphtheria toxin fragment A (DTA) selection marker are not shown, but the sequence of the PGK1-neo resistance gene is included. Introns and exons are shown in lowercase and uppercase, respectively.

DISCLOSURE OF INVENTION

In the studies described herein, the present inventors have shown that Gfi1 b-deficient mice exhibit higher numbers of HSCs in the bone marrow and in peripheral blood. They have also demonstrated that Gfi1 b-deficient HSCs retain their ability to self-renew and to initiate multilineage differentiation, are less quiescent than wild-type HSCs, and that this feature is cell autonomous as they also exhibit these features in a host following transplantation. The present inventors have shown that Gfil b deficiency is associated with a modulation in the expression of several genes, notably genes encoding surface adhesion molecules involved in HSCs homing/trafficking.

Accordingly, in a first aspect, the present invention provides a method of increasing the number of hematopoietic stem cells (HSCs) in a biological system (e.g., a subject, an organ, a tissue, a cell culture), said method comprising inhibiting growth factor independence 1 b (Gfil b) expression or activity in HSCs from said biological system, in an embodiment comprising contacting HSCs from said biological system with an inhibitor of Gfi1 b.

In another aspect, the present invention provides a method of increasing the number of HSCs (e.g., by stimulating the proliferation of HSCs) in a subject (in an organ or a tissue of a subject, such as the bone marrow and/or peripheral blood), said method comprising administering to said subject an effective amount of an inhibitor of Gfil b.

In another aspect, the present invention provides a method of increasing the repopulation of HSCs in an HSC transplant recipient, said method comprising contacting the transplanted (or to be transplanted) HSCs with an inhibitor of Gfil b. In an embodiment, the above-mentioned contacting occurs in a transplant donor prior to the transplantation. In another embodiment, the above-mentioned contacting occurs in said transplant recipient after the transplantation. In another embodiment, the above-mentioned contacting occurs in vitro or ex vivo to increase the number of HSCs in a sample collected from a HSC donor, prior to transplantation to said recipient. In further embodiments, the above-mentioned contacting occurs at multiple times, e.g., in a transplant donor prior to the transplantation, in vitro or ex vivo in a sample obtained from a donor prior to the transplantation, and/or in the transplant recipient after the transplantation.

The present inventors have shown that Gfil b deficiency is associated with a modulation in the expression of several genes in HSCs, and more particularly those depicted in Table 6 that show at least a two-fold difference in expression between GFi1 b-deficient HSCs and wild-type HSCs. Accordingly, in an embodiment, the above-mentioned method comprises modulating the expression of at least one gene depicted in Table 6 in HSCs.

In a further embodiment, the above-mentioned modulation is an increase and said at least one gene is at least one of genes Nos. 1 to 288 depicted in Table 6. In a further embodiment, the above-mentioned at least one gene is a gene encoding an adhesion molecule involved in the retention of HSCs in their endosteal niche, such as VCAM-1 , CXCR4 or integrin a4.

In another embodiment, the above-mentioned modulation is a decrease and said at least one gene is at least one of genes Nos. 289 to 573 depicted in Table 6. In a further embodiment, the above-mentioned at least one gene is a gene encoding an adhesion molecule involved in endothelial cell adhesion, such as integrin β1 or integrin β3.

The term "Hematopoietic stem cells (HSCs)" as used herein refers to multipotent stem cells that give rise to all the blood cell types from the myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells), and lymphoid (T-cells, B-cells, NK-cells) lineages. These cellls may be isolated from the blood or bone marrow, can renew itself, can differentiate to a variety of specialized cells, and/or can mobilize out of the bone marrow into circulating blood. There appear to be two major types of HSCs that differ in their self-renewal capacity, namely short-term HSCs (defined as CD34 ⁺ LSK, CD150 ⁺ , CD48 ^" ) that have the capacity for self-renewal for a limited time prior to full differentiation into a specific lineage, and long-term (CD34 ^" LSK, CD150 ⁺ , CD48 ^" ) HSCs that have the capacity for self-renewal throughout the life span of an organism.

Growth factor independence-1 b (Gfil b) is a transcriptional repressor expressed in various hematopoietic cell populations, and more particularly in erythroid and megakaryocyte cells. It comprises at its N-terminus a highly conserved Snail/Gfi1 (SNAG) domain (extending from residue 1 to about residue 20) involved in transcriptional repression (notably involved in the suppression of GATA-1-mediated transcription of the Gfi-1 B promoter, Huang et al., Nucleic Acids Res. 2005; 33(16): 5331-5342). The SNAG domain of Gfil b is involved in the interaction with the chromatin regulatory proteins REST corepressor (CoREST) and lysine-specific demethylase 1 (LSD1 or KDM1), which in turn play a role in Gfil b-mediated transcriptional repression (Saleque et al. 2007, Mol. Cell, 27(4), pp. 562-572). HDACs 1 and 2 are also part of the repression complex. Gfil b also comprises six C2H2-type zinc finger domains (residues 163-186; 192-214; 220-242; 248-270; 276- 298; and 304-327) involved in DNA binding and acting as an activation domain at its C-terminus (UniProtKB/Swiss-Prot accession No. Q5VTD9). Residues 91-330 are involved in the interaction with the E3 ubiquitin-protein ligase ARIH2, which is involved in protein ubiquitination and proteasomal degradation. Residues 164-330 are involved in the interaction with GATA-1 (Huang et a/., Nucleic Acids Res. 2005; 33(16): 5331-5342). It also interacts with histone methyltransferases EHMT2 and SUV39H1 , and thus alters histone methylation by recruiting them to target genes promoters. Mutation at residues 290 (Asn to Ser substitution) has been shown to prevent DNA binding (Wei X. and Kee B.L. Blood 109:4406-4414 (2007)). Two Gfil b isoforms exist, with isoform 2 lacking residues 171-216 relative to isoform 1 (see FIGs. 8A and 8C).

As used herein, an inhibitor of Gfil b (or Gfil b antagonist) refers to an agent that is capable of reducing Gfil b activity and/or its protein or nucleic acid levels (directly or indirectly), which in an embodiment includes agents that act directly on a Gfil b protein or nucleic acid. In embodiments, such a decrease comprises a decrease Gfil b protein activity or levels, a decrease Gfil b mRNA levels, a decrease Gfil b transcription or translation, or any combination thereof. General classes of inhibitors of Gfil b include, but are not limited to, inhibitory nucleic acids, e.g., oligonucleotides containing the Gfil b binding site, siRNA, antisense, DNAzymes, and ribozymes; small organic or inorganic molecules, e.g., zinc finger inhibitors; peptides (e.g., peptides that bind Gfil b or to a binding partner thereof such as LSD1 and inhibit Gfil b-mediated transcriptional repression); proteins, (e.g., dominant negatives of Gfil b, which compete with Gfil b for binding to its sequence on DNA but do not exert transcriptional regulation activity, or compete with Gfil b for binding to LSD1 and/or CoREST), antibodies (antibodies that block the interaction between Gfil b and one or more of its binding partners such as LSD1 and/or CoREST, or that block the interaction between Gfil b and its target sequence). An inhibitor that acts directly on Gfil b, for example, can affect binding of Gfil b to its target nucleic acid (Wu et al., Nucleic Acids Research 35(7): 2390-2402), can sequester Gfil b away from the nucleus (thus inhibiting its transcriptional regulation activity), can induce the degradation of Gfil b protein or mRNA (e.g. increasing proteosomal degradation), can impair Gfi1 b transcription and/or translation.

Inhibitors of zinc finger proteins

Inhibitors of zinc finger proteins may be used to inhibit Gfil b activity. Zinc finger inhibitors can work by, e.g., disrupting the zing finger by modification of one or more cysteine residues in the binding sites for Zn ²⁺ in the zinc finger protein, resulting in the ejection of zinc ion; removing the zinc from the zinc finger moiety, e.g., by specific chelating agents, also known as "zinc ejectors", including azodicarbonamide (ADA); or forming a ternary complex at the site of zinc binding on zinc finger proteins, resulting in inhibition of the DNA or RNA binding activity of zinc finger proteins. A number of small molecule inhibitors of zinc fingers are known in the art. For example, picolinic acid derivatives such as a small molecule called Picolinic acid drug substance (PCL-016), and a derivative thereof FSR-488, as described in U.S. Patent Publication No. 2005/0239723, and commercially available from Novactyl (St. Louis, Mo.). Other picolinic acid derivatives with zinc- binding capabilities are described in U.S. Patent No. 6,410,570. In an embodiment, the agent is a compound that interferes with the binding of zinc-finger containing proteins to DNA, such as Hoechst33342 (Wu et a/., Nucleic Acids Research 35(7): 2390-2402).

RNA/DNA interference

RNAi is a process whereby double-stranded RNA (dsRNA) induces the sequence-specific degradation of homologous mRNA in cells. In mammalian cells, RNAi can be triggered by duplexes of small interfering RNA (siRNA) (Chiu et a/., Mol. Cell. 10:549-561 (2002); Elbashir et al. , Nature 411 :494-498 (2001)), or by micro-RNAs (miRNA), functional small-hairpin RNA (shRNA), or other dsRNAs which are expressed in vivo using DNA templates with RNA polymerase III promoters.

The initial agent for RNAi in some systems is thought to be dsRNA or modified dsRNA molecules corresponding to a target nucleic acid (e.g., Gfil b). The dsRNA is then thought to be cleaved into short interfering RNAs (siRNAs) which are for example 21-23 nucleotides in length (19-21 bp duplexes, each with 2 nucleotide 3' overhangs). The enzyme thought to effect this first cleavage step (the Drosophila version is referred to as "Dicer") is categorized as a member of the RNase III family of dsRNA-specific ribonucleases. Alternatively, RNAi may be effected via directly introducing into the cell, or generating within the cell by introducing into the cell an siRNA or siRNA- like molecule or a suitable precursor (e.g., vector encoding precursor(s), etc.) thereof. An siRNA may then associate with other intracellular components to form an RNA-induced silencing complex (RISC). The RISC thus formed may subsequently target a transcript of interest via base-pairing interactions between its siRNA component and the target transcript by virtue of homology, resulting in the cleavage of the target transcript approximately 12 nucleotides from the 3' end of the siRNA. Thus the target mRNA is cleaved and the level of protein product it encodes is reduced.

The nucleic acid molecules or constructs can include dsRNA molecules comprising about 16 to 30 residues, e.g., 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, wherein one of the strands is substantially identical, e.g., at least 80% (or more, e.g., 85%, 90%, 95%, or 100%) identical, e.g., having 3, 2, 1 , or 0 mismatched nucleotide(s), to a target region in the mRNA, and the other strand is complementary to the first strand. The nucleic acid compositions can include both siRNA and modified siRNA derivatives, e.g., siRNAs modified to alter a property such as the pharmacokinetics of the composition, for example, to increase half-life in the body, as well as engineered RNAi precursors.

RNAi may be effected by the introduction of suitable in vitro synthesized siRNA or siRNA- like molecules into cells. RNAi may for example be performed using chemically-synthesized RNA or modified RNA molecules. Alternatively, suitable expression vectors may be used to transcribe such RNA either in vitro or in vivo. In vitro transcription of sense and antisense strands (encoded by sequences present on the same vector or on separate vectors) may be effected using for example T7 RNA polymerase, in which case the vector may comprise a suitable coding sequence operably- linked to a T7 promoter. The in v/ ^' fro-transcribed RNA may in embodiments be processed (e.g., using E. coli RNase III) in vitro to a size conducive to RNAi. The sense and antisense transcripts are combined to form an RNA duplex which is introduced into a target cell of interest. Other vectors may be used, which express small hairpin RNAs (shRNAs) which can be processed into siRNA-like molecules. Various vector-based methods have been described (see, e.g., Brummelkamp et al. [2002] Science 296: 550). Various methods for introducing such vectors into cells, either in vitro or in vivo (e.g., gene therapy) are known in the art.

Reagents and kits for performing RNAi are available commercially from, for example, Ambion Inc. (Austin, TX, USA), New England Biolabs Inc. (Beverly, MA, USA) and Invitrogen (Carlsbad, CA, USA).

siRNA directed against human Gfil b are commercially available from several suppliers, including Invitrogen (Gfil b Stealth RNAi™ siRNA, cat. # HSS188732, HSS188733 and HSS188734), Santa Cruz Biotechnology, inc. (Cat. # sc-37909), Sigma-Aldrich (MISSION ^® siRNA, Cat. # SASI_Hs01_00223543, SASI_Hs01_00223544, SASI_Hs01_00223545, SASI_Hs01_00223546, SASI_Hs02_00337076, SASI_Hs01_00223547, SASI_Hs01_00223548, SASI_Hs01_00223549, SASI_Hs01_00223550, SASI_Hs01_00223551 and

SASI_Hs01_00223552). ShRNA molecules targeting human Gfil b are described, for example, in Randrianarison-Huetz et al., Blood, 2010; 115: 2784-2795 (sequences of encoding DNA: 5'- GCCTAGCTTCTCCTGGGACTTCAAGAGAGTCCCAGGAGAAGCTAG-3', SEQ ID NO: 15; 5'- CCCATTCTACAAGCCTAGCTT-3', SEQ ID NO: 16; and 5'-CCTTAGCACTCTATTCCCAAA-3\ SEQ ID NO: 17;) and are also commercially available from several suppliers including OriGene Technologies (Cat. # TR312792); Santa Cruz Biotechnology, inc. (Cat. # sc-37909-SH), GeneCopoeia (Cat. # HSH020142), Sigma-Aldrich, (Cat. No. SHCLNG-NM_004188).

In addition, Morpholinos represent an advanced form of antisense DNA, which allows repression of a target gene (e.g., Gfil b) expression with a greater efficiency and are commercially available (GENE TOOLS).

Antibodies

In an embodiment, the above-mentioned Gfil b inhibitor is a Gfil b-specific antibody.

By Gfil b-specific antibody in the present context is meant an antibody capable of detecting (i.e. binding to) a Gfil b or a Gfil b protein fragment. In an embodiment, the above-mentioned antibody inhibits the biological activity of Gfil b, such as Gfil b interaction with its target sequence on DNA (e.g., by binding to one or more of its zinc finger domains). In an embodiment, the antiboby blocks the interaction between Gfil b and one or more of its partners involved in transcriptional repression (e.g., CoREST and/or LSD1) for example by binding to an epitope located within the SNAG domain of Gfil b (residues 1 to 20, SEQ ID NO: 18).

The term antibody or immunoglobulin is used to refer to monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies, and antibody fragments so long as they exhibit the desired biological activity. Antibody fragments comprise a portion of a full length antibody, generally an antigen binding or variable region thereof. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments, diabodies, linear antibodies, single-chain antibody molecules, single domain antibodies (e.g., from camelids), shark NAR single domain antibodies, and multispecific antibodies formed from antibody fragments. Antibody fragments can also refer to binding moieties comprising CDRs or antigen binding domains including, but not limited to, V _H regions (V _H , V _H -V _H ), anticalins, PepBodies, antibody-T-cell epitope fusions (Troybodies) or Peptibodies. Additionally, any secondary antibodies, either monoclonal or polyclonal, directed to the first antibodies would also be included within the scope of this invention.

In general, techniques for preparing antibodies (including monoclonal antibodies and hybridomas) and for detecting antigens using antibodies are well known in the art (Campbell, 1984, In "Monoclonal Antibody Technology: Laboratory Techniques in Biochemistry and Molecular Biology", Elsevier Science Publisher, Amsterdam, The Netherlands) and in Harlow et al., 1988 (in: Antibody A Laboratory Manual, CSH Laboratories).

Polyclonal antibodies are preferably raised in animals by multiple subcutaneous (s.c), intravenous (i.v.) or intraperitoneal (i.p.) injections of the relevant antigen (e.g., Gfil b polypeptide or a fragment thereof) with or without an adjuvant. It may be useful to conjugate the relevant antigen to a protein that is immunogenic in the species to be immunized, e.g., keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor using a bifunctional or derivatizing agent, for example, maleimidobenzoyl sulfosuccinimide ester (conjugation through cysteine residues), N-hydroxysuccinimide (through lysine residues), glutaraldehyde, succinic anhydride, SOCI ₂ , or R ¹ N=C=NR, where R and R ¹ are different alkyl groups.

Animals may be immunized against the antigen (e.g., a Gfil b polypeptide or a fragment thereof), immunogenic conjugates, or derivatives by combining the antigen or conjugate (e.g., 100ig for rabbits or 5 ig for mice) with 3 volumes of Freund's complete adjuvant and injecting the solution intradermally at multiple sites. One month later the animals are boosted with the antigen or conjugate (e.g., with 1/5 to 1/10 of the original amount used to immunize) in Freund's complete adjuvant by subcutaneous injection at multiple sites. Seven to 14 days later the animals are bled and the serum is assayed for antibody titer. Animals are boosted until the titer plateaus. Preferably, for conjugate immunizations, the animal is boosted with the conjugate of the same antigen, but conjugated to a different protein and/or through a different cross-linking reagent. Conjugates also can be made in recombinant cell culture as protein fusions. Also, aggregating agents such as alum are suitably used to enhance the immune response.

Monoclonal antibodies may be made using the hybridoma method first described by Kohler et al., Nature, 256: 495 (1975), or may be made by recombinant DNA methods (e.g., U.S. Patent No. 6,204,023). Monoclonal antibodies may also be made using the techniques described in U.S. Patent Nos. 6,025, 155 and 6,077,677 as well as U.S. Patent Application Publication Nos. 2002/0160970 and 2003/0083293.

In the hybridoma method, a mouse or other appropriate host animal, such as a rat, hamster or monkey, is immunized (e.g., as hereinabove described) to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the antigen used for immunization. Alternatively, lymphocytes may be immunized in vitro. Lymphocytes then are fused with myeloma cells using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell.

The hybridoma cells thus prepared are seeded and grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells. For example, if the parental myeloma cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT medium), which substances prevent the growth of HGPRT-deficient cells.

Antibodies directed against Gfil b and which may inhibit Gfil b activity are known in the art (see, e.g., Laurent et al., Stem Cells. 2009; 27(9):2153-2162) and are also commercially available (Abnova Corporation, Cat. # H00008328-A01 ; Abeam, Cat. # ab26132; Sigma-Aldrich, Cat. # HPA007012 and AV30093).

Other inhibitors

Gfil b inhibitors may also be in the form of non-antibody-based scaffolds, such as avimers (Avidia); DARPins (Molecular Partners); Adnectins (Adnexus), Anticalins (Pieris) and Affibodies (Affibody). The use of alternative scaffolds for protein binding is well known in the art (see, for example, Binz and Pluckthun, 2005, Curr. Opin. Biotech. 16: 1-11 ).

In an embodiment, the Gfil b inhibitor is a dominant negative of Gfil b (or a nucleic acid encoding same), for example a variant of Gfil b (in which one or more domains are mutated or deleted, for example) which compete with Gfil b (for binding to DNA or to one or more of its binding partner) but do not exert transcriptional regulation activity. In an embodiment, the dominant negative comprises one or more of the C2H2-type zinc finger domains but lacks a functional SNAG domain (e.g., lack residues 1 to 20 or a portion thereof), and thus competes with endogenous Gfil b for binding to DNA but is unable to bind to its partners involved in transcriptional repression (e.g., CoREST and/or LSD1) and to exert transcriptional repression activity.

In another embodiment, the dominant negative comprises the SNAG domain of Gfil b (residues 1 to 20, SEQ ID NO: 18) but lack one or more of the C2H2-type zinc finger domains and thus competes with endogenous Gfil b for binding to its partners involved in transcriptional repression (e.g., CoREST and/or LSD1), but cannot bind DNA.

In an embodiment, the Gfil b inhibitor is a peptide comprising the sequence of SEQ ID NO: 18, or a fragment thereof, or a variant thereof, having Gfil b inhibiting activity. In an embodiment, the above-mentioned peptide (or fragment/variant thereof) contains from about 10 to about 200 amino acids, e.g., from about 20 to about 200 amino acids. In a further embodiment, the above- mentioned peptide (or fragment/variant thereof) contains from about 10 to about 100 amino acids. In a further embodiment, the above-mentioned peptide (or fragment/variant thereof) contains from about 10 to about 90 amino acids. In a further embodiment, the above-mentioned peptide (or fragment/variant thereof) contains from about 10 to about 80 amino acids. In a further embodiment, the above-mentioned peptide (or fragment/variant thereof) contains from about 10 to about 70 amino acids. In a further embodiment, the above-mentioned peptide (or fragment/variant thereof) contains from about 10 to about 60 amino acids. In a further embodiment, the above-mentioned peptide (or fragment/variant thereof) contains from about 10 to about 50 amino acids. In a further embodiment, the above-mentioned peptide (or fragment/variant thereof) contains from about 10 to about 40 amino acids, e.g., from about 10 to about 30, from about 15 to about 25. In an embodiment, the peptide (or fragment/variant thereof) contains about 20 amino acids (18, 19, 20, 21 or 22 amino acids). In another embodiment, the above-mentioned fragment or variant binds to CoREST and/or LSD1. In an embodiment, the above-mentioned variant comprises a domain that is at least 75, 80, 85, 90, or 95% identical to the sequence of SEQ ID NO: 18.

In an embodiment, the Gfil b inhibitor is a peptide consisting of the sequence of SEQ ID

NO: 18.

Other reagents for inhibiting Gfil b expression include the CompoZr™ Knockout ZFNs kit from Sigma-Aldrich (Cat. # CKOZFN9240-1 KT). Such reagent creates targeted double strand breaks at the specific gene (Gfil b) locus, and, through the cellular process of Non-Homologous End Joining (NHEJ), this double strand break can result in modification of the DNA sequence and therefor create a functional knockout of the targeted gene (Gfil b). Other reagents for inhibiting Gfil b expression include agents that indirectly act on Gfil b transcription. For example, GATA-1 is known to bind to the Gfil b promoter and stimulate Gfil b transcription. Therefore, the inhibitor of Gfil b may be an agent that decrease the activity or expression of GATA-1. Similarly, Gfil b interacts with the E3 ubiquitin-protein ligase ARIH2 (also known as TRIAD1), which is involved in protein ubiquitination and subsequent proteasomal degradation. E3 ubiquitin ligases catalyze the covalent conjugation of ubiquitin to specific substrate proteins and depending on the type/nature of the ubiquitin chain conjugated to the protein, ubiquitination can regulate its activity or stability. TRIAD1 has been shown to interact with the DNA- binding domain of Gfi1 and Gfil b (whose zinc finger domain are 97% identical), and to inhibit Gfi1 ubiquitination, resulting in a prolonged half-life and in increased endogenous Gfi1 protein levels (Marteijn JA et al., Blood. 2007 Nov 1 ;110(9):3128-35. Epub 2007 Jul 23). Thus, decreasing the activity or expression of ARIH2/TRIAD1 in a HSC may be used to increase ubiquitination and proteasomal degradation of Gfil b, thus decreasing its expression/activity. In an embodiment, ARIH2 expression is decreased using a siRNA, such as those described in Marteijn JA et al., 2007, supra (uugugaggaagaggaagaa, SEQ ID NO: 13; aauugugaggaagaggaagaa, SEQ ID NO: 14). Also, siRNA directed against human HMGB2 are commercially available from Sigma-Aldrich (MISSION ^® siRNA, Cat. # SASI_Hs01_00230799 to SASI_Hs01_00230808, SASI_Hs02_00341344 and SASI_Hs02_00341345) and Origene (Cat. # SR307069). ShRNA directed against human ARIH2 are also commercially available from Sigma-Aldrich (MISSION ^® shRNA Plasmid DNA, Cat. # SHCLND-NM_006321) and Origene (Cat. # TG314665).

Similarly, the high-mobility group HMG protein HMGB2 has been shown to bind to the Gfil b promoter in vivo and to up-regulate its trans-activation (and expression), and knockdown of HMGB2 in immature hematopoietic progenitor cells leads to decreased Gfi-1 B expression (Laurent B et al., Blood. 2010 Jan 21 ;115(3):687-95. Epub 2009 Nov 24). Thus, decreasing the activity or expression of HMGB2 in a HSC may be used to decrease the expression/activity of Gfil b. Inhibitors of HMGB2 are known in the art. For example, siRNA directed against human HMGB2 are commercially available from Sigma-Aldrich (MISSION ^® siRNA, Cat. # SASI_Hs01_00017264 to SASI_Hs01_00017275) and Origene (Cat. # SR302141 ), and shRNA directed against human HMGB2 are also commercially available from Sigma-Aldrich (MISSION ^® shRNA Plasmid DNA, Cat. # SHCLND-NM_002129) and Origene (Cat. # TG316577).

In embodiment, the above-mentioned inhibitor of Gfil b (e.g., nucleic acid, polypeptide, peptide, antibodies, drugs) further comprises a moiety for increasing their entry into a cell and/or into the nucleus of a cell. Molecules or moieties capable of increasing the entry of macromolecules into a cell are well known in the art and include, for example peptides known as protein transduction domains (sometimes termed cell-penetrating peptides (CPP) or Membrane Translocating Sequences (MTS)), such as those found in the HIV-1 Transactivator of transcription (TAT) and the HSV-1 VP22 proteins, the homeodomain of Homeoproteins (e.g., Drosophila's Antennapedia homeodomain (AntpHD), Hox proteins), as well as other synthetic peptides (see, e.g., Beerens AM et al., Curr Gene Ther. 2003 Oct;3(5): 486-94). Also, the conjugatuon of macromolecules to certain lipids or glycolipids increases the hydrophobic character of the macromolecules and their lipid-solubility, thus faciliting their translocation across the cell membrane. Nuclear localization signals or sequences (NLS), which target a protein to the cell nucleus, are well known in the art.

In another aspect, the present invention provides a composition comprising the above- mentioned inhibitor of Gfil b and a pharmaceutically acceptable carrier, diluent and/or excipient, for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient.

Such compositions may be prepared in a manner well known in the pharmaceutical art. Supplementary active compounds can also be incorporated into the compositions. As used herein "pharmaceutically acceptable carrier" or "excipient" or "diluent" includes any and all solvents, buffers, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. The carrier can be suitable, for example, for intravenous, parenteral, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intrathecal, epidural, intracisternal, intraperitoneal, intranasal or pulmonary (e.g., aerosol) administration (see Remington: The Science and Practice of Pharmacy by Alfonso R. Gennaro, 2003, 21th edition, Mack Publishing Company).

Formulations suitable for oral administration can consist of (a) liquid solutions, such as an effective amount of active agent(s)/composition(s) suspended in diluents, such as water, saline or PEG 400; (b) capsules, sachets or tablets, each containing a predetermined amount of the active ingredient, as liquids, solids, granules or gelatin; (c) suspensions in an appropriate liquid; and (d) suitable emulsions. Tablet forms can include one or more of lactose, sucrose, mannitol, sorbitol, calcium phosphates, corn starch, potato starch, microcrystalline cellulose, gelatin, colloidal silicon dioxide, talc, magnesium stearate, stearic acid, and other excipients, colorants, fillers, binders, diluents, buffering agents, moistening agents, preservatives, flavoring agents, dyes, disintegrating agents, and pharmaceutically compatible carriers. Lozenge forms can comprise the active ingredient in a flavor, e.g., sucrose, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin or sucrose and acacia emulsions, gels, and the like containing, in addition to the active ingredient, carriers known in the art.

Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for compounds/compositions of the invention include ethylenevinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, (e.g., lactose) or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.

For preparing pharmaceutical compositions from the compound(s)/composition(s) of the present invention, pharmaceutically acceptable carriers are either solid or liquid. Solid form preparations include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules. A solid carrier can be one or more substance, which may also act as diluents, flavoring agents, binders, preservatives, tablet disintegrating agents, or an encapsulating material.

In powders, the carrier is a finely divided solid, which is in a mixture with the finely divided active component. In tablets, the active component (an inhibitor of Gfi 1 b) is mixed with the carrier having the necessary binding properties in suitable proportions and compacted in the shape and size desired. The powders and tablets may typically contain from 5% or 10% to 70% of the active compound/composition. Suitable carriers are magnesium carbonate, magnesium stearate, talc, sugar, lactose, pectin, dextrin, starch, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, a low melting wax, cocoa butter, and the like. The term "preparation" is intended to include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it. Similarly, cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be used as solid dosage forms suitable for oral administration.

Liquid form preparations include solutions, suspensions, and emulsions, for example, water or water/propylene glycol solutions. For parenteral injection, liquid preparations can be formulated in solution in aqueous polyethylene glycol solution.

Aqueous solutions suitable for oral use are prepared by dissolving the Gfil b inhibitor in water and adding suitable colorants, flavors, stabilizers, and thickening agents as desired. Aqueous suspensions suitable for oral use can be made by dispersing the finely divided active component in water with viscous material, such as natural or synthetic gums, resins, methylcellulose, sodium carboxymethylcellulose, and other well-known suspending agents.

In embodiments, the pharmaceutical compositions are formulated to target delivery of the active agent (e.g., an inhibitor of Gfil b) to a particular cell, tissue and/or organ, such as the bone marrow, which is enriched in HSCs, or the peripheral blood. For example, it is known that formulation of an agent in liposomes results in a more targeted delivery to the bone marrow while reducing side effects (Hassan ef a/., Bone Marrow Transplant. 1998; 22(9):913-8). Myeloid-specific antigens can also be used to target the bone marrow (Orchard and Cooper, Q. J. Nucl. Med. Mol. Imaging. 2004; 48(4):267-78). In embodiments, the pharmaceutical compositions are formulated to increase the entry of the agent into a cell and/or into the nucleus of a cell.

An "effective amount" is an amount sufficient to effect a significant biological effect, such as (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient. In an embodiment, the above- mentioned agent or composition is used in an effective amount so as to (i) increase the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increase the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increase the repopulation of HSCs in an HSC transplant recipient, by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% (i.e. 2-fold), 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 30-fold, 50-fold or 100-fold. An effective amount can be administered in one or more administrations, applications or dosages. The compositions can be administered one from one or more times per day to one or more times per week; including once every other day. The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to previous treatments, the general health and/or age of the subject, the target site of action, the patient's weight, special diets being followed by the patient, concurrent medications being used, the administration route, other diseases present and other factors. Moreover, treatment of a subject with a therapeutically effective amount of the compositions described herein can include a single treatment or a series of treatments. The dosage will be adapted by the clinician in accordance with conventional factors such as the extent of the disease and different parameters from the patient. Typically, 0.001 to 1000 mg/kg of body weight/day will be administered to the subject. In an embodiment, a daily dose range of about 0.01 mg/kg to about 500 mg/kg, in a further embodiment of about 0.1 mg/kg to about 200 mg/kg, in a further embodiment of about 1 mg/kg to about 100 mg/kg, in a further embodiment of about 10 mg/kg to about 50 mg/kg, may be used. The dose administered to a patient, in the context of the present invention should be sufficient to effect/induce a beneficial biological effect in the patient over time. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration. Effective doses may be extrapolated from dose response curves derived from in vitro or animal model test systems. For example, in order to obtain an effective mg/kg dose for humans based on data generated from rat studies, the effective mg/kg dosage in rat may be divided by six.

In embodiments, the methods include administering a combination of active agents, for example an inhibitor of Gfil b in combination with an agent currently used in HSC-based therapies (e.g., in bone marrow and/or HSC transplantation). In an embodiment, the inhibitor of Gfil b is used in combination with one or more agents used to increase HSC expansion and/or mobilization, such as granulocyte-colony stimulating factor (G-CSF), interleukin-17 (IL-17), cyclophosphamide (Cy), Docetaxel (DXT), or with an anti-rejection agent, such as immunosuppressive drugs. The above- mentioned inhibitor of Gfil b may be formulated in a single composition with a second active agent, or in several individual compositions which may be co-administered in the course of the treatment. Co-administration in the context of the present invention refers to the administration of more than one active agent in the course of a coordinated treatment to achieve a biological effect and/or an improved clinical outcome. Such co-administration may also be coextensive, that is, occurring during overlapping periods of time. For example, a first agent may be administered to a patient before, concomitantly, before and after, or after a second active agent is administered. The agents may in an embodiment be combined/formulated in a single composition and thus administered at the same time.

The invention further provides a kit or package comprising the above-mentioned inhibitor of Gfil b or the above-mentioned composition, together with instructions for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient. The kit may further comprise, for example, containers, buffers, a device (e.g., syringe) for administering the inhibitor of Gfil b or a composition comprising same to a subject.

The methods, uses, compositions and kits defined above may be useful for reconstituting the HSCs population in a patient in need of HSC renewal, for example for the treatment of patients affected with disorders, diseases, and/or conditions that would benefit from an increase in the number of HSCs, for example to reconstitute damaged or depleted hematopoietic system. Examples of disorders, diseases, and/or conditions contemplated for treatment by the present methods, uses, compositions and kits include diseases of the blood and bone marrow, such as cancers (e.g., leukemia, lymphoma, multiple myeloma), anemia (aplastic anemia, sickle-cell anemia), immunological disorders, thalassemia major, myelodysplasia syndrome, Blackfan- Diamond syndrome, globoid cell leukodystrophy, severe combined immunodeficiency (SCID), X- linked lymphoproliferative syndrome, and Wiskott-Aldrich syndrome. Patients that may benefit from treatments that utilize the present methods, uses, compositions and kits include candidates for bone marrow transplantation ("BMT") and hematopoietic stem cell transplantation ("HSCT"), which patients are subjected to radiotherapy and/or chemotherapy regimen to eradicate or severely comprise the recipient's hematopoietic system before transplantation. Other diseases that may be treated through bone marrow transplants include: Hunter's syndrome, Hurler's syndrome, Lesch Nyhan syndrome, and osteopetrosis.

A HSC population obtained from a donor can be induced to proliferate ex vivo or in vitro, or an endogenous HSC population within a patient can be induced to proliferate in vivo or in situ by exposing the HSC population of interest to an agent that inhibit Gfil b expression and/or activity.

In embodiments, the source of HSCs may be bone marrow, peripheral blood, cord blood (umbilical cord blood), amniotic fluid, fetal liver, or placenta l/fetal blood.

A given HSC population obtained from a donor or within a recipient host (i.e., a patient) can be induced to expand and/or to egress from the bone marrow by providing compounds/compositions that can inhibit Gfil b expression and/or activity. For example, the compounds/compositions may be administered to a potential HSC transplant donor (an autologous or heterologous donor) to increase the number of HSCs in the peripheral blood prior to collecting the HSCs using standard methods (e.g., leukapheresis). The compounds/compositions may be administered to an HSC recipient to increase the number of HSCs in the peripheral blood following HSC transplantation. The compounds/compositions may also be used to increase the number of HSCs in a sample (e.g., in vitro or ex vivo) collected from a potential HSC or bone marrow donor. Thus, in embodiments, the methods and used described above further include obtaining a bone marrow and/or peripheral blood sample from a subject, using standard methods (e.g., bone marrow harvest, leukapheresis). The bone marrow and/or peripheral blood sample is maintained in vitro and contacted with an effective amount of an inhibitor of as described herein. The bone marrow and/or peripheral blood sample thus treated can be reintroduced into the subject (autologous transplantation), or transplanted/infused into a second subject, the transplant recipient (allogeneic transplantation), which is preferably HLA-matched with the donor.

Sources of human HSCs include peripheral blood. The HCSs could be mobilized to migrate from marrow to peripheral blood in greater numbers by treating the human donor with a cytokine, such as granulocyte-colony stimulating factor (G-CSF). In the following days, HSCs are collected, for example, based on size and density by counterflow centrifugal elutriation or any other methods known in the art see as equilibrium density centrifugation, velocity sedimentation at unit gravity, immune resetting and immune adherence, T lymphocyte depletion, and/or fluorescence- activated cell sorting (FACS) (see, e.g., Blood and marrow stem cell transplantation: principles, practice, and nursing insights. Marie Bakitas Whedon; Debra Wujcik, Sudbury, Mass.: Jones and Bartlett Publishers ^® , 1997, Jones and Bartlett series in oncology).

Expansion of HSCs in accordance with methods of the present invention can be performed by treating a HSC population with an effective amount of a Gfil b inhibitor. When it is used to expand HSCs ex vivo or in vivo in a subject in need of such expansion (ex. subject needing a bone marrow/HSC transplantation, etc.), the expansion treatment with an inhibitor of Gfil b may also further comprise at least one other active agent capable of directly or indirectly expanding HSCs and/or hematopoietic progenitor cells. Expansion of HSCs can be performed in a bioreactor such as the AastromReplicell™ system from Aastrom Biosciences (USA) or the Cytomatrix™ Bioreactor from Cytomatrix. It can also be performed using low molecular chelate for copper binding such as the StemEx™ from Gamida (Israel) or using culture systems such as MainGen (Germany) or culture medium such as ViaCell (USA). Examples of media used to culture hematopoietic stem cells include a minimum essential medium (MEM) containing about 5 to 20% bovine fetal serum, Dulbecco's modified Eagle medium (DMEM), RPMI 1640 medium, 199 medium and the like. As required, cytokines such as stem cell factor (SCF), interleukin-3 (IL-3), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-11 (IL-11 ), fms-like tyrosine kinase-3 (Flt-3) ligand (FLT), erythropoietin (EPO), and thrombopoietin (TPO), hormones such as insulin, transportation proteins such as transferrin, and the like may further be contained in the medium.

Before transplantation, the number of stem cells may be tested by taking a sample from the stem cells (called pilot sample) and plating these stem cells on a methylcellulose agar complemented with the appropriate cytokines. After 10-20 days, the number of colonies is determined and this allows evaluating how many stem cells were present in the pilot sample. Knowing this number, it is possible to estimate the number of functional stem cells in the original sample.

The present invention also provides methods (in vitro or in vivo methods) for screening of test compounds, to identify compounds that may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient. In general, the methods will include evaluating the effect of a test compound on the expression and/or activity of Gfil b, or of a reporter protein, in a sample. Accordingly, in another aspect, the present provides a method (in vitro or in vivo) for determining whether a test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient, said method comprising:

(a) contacting said test compound with a Gfil b polypeptide or a fragment thereof having Gfil b activity;

(b) determining whether said test compound binds to said Gfil b polypeptide or fragment thereof;

wherein the binding of said test compound to said Gfil b polypeptide or fragment thereof is indicative that said test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient. In an embodiment, the method further comprises determining whether said test compound inhibits Gfil b expression and/or Gfil b activity.

In another aspect, the present provides a method (in vitro or in vivo) for determining whether a test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient, said method comprising:

(a) contacting said test compound with a cell exhibiting Gfil b expression and/or activity;

(b) determining whether said test compound inhibits said expression and/or Gfil b activity;

wherein the inhibition of said Gfil b expression and/or activity in the presence of said test compound is indicative that said test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient.

In another aspect, the present provides a method (in vitro or in vivo) for determining whether a test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient, said method comprising: (a) contacting said test compound with a cell comprising a first nucleic acid comprising a transcriptional regulatory element normally associated with a Gfil b gene, operably linked to a second nucleic acid encoding a reporter protein;

(b) determining whether reporter gene expression or activity is inhibited in the presence of said test compound;

wherein the inhibition of said reporter gene expression or activity in the presence of said test compound is indicative that said test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient.

In another aspect, the present provides a method (in vitro or in vivo) for determining whether a test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient, said method comprising:

(a) contacting said test compound with a nucleic acid comprising a Gfil b binding sequence (e.g., a sequence comprising TAAATCAC(A/T)GCA) in the presence of Gfil b;

(b) determining whether said test compound inhibits the binding of Gfil b to said nucleic acid;

wherein the inhibition of the binding of Gfil b to said nucleic acid in the presence of said test compound is indicative that said test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient.

In another aspect, the present invention provides a method (in vitro or in vivo) for determining whether a test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient, said method comprising:

(a) contacting said test compound with a cell comprising a first nucleic acid comprising a transcriptional regulatory element comprising a Gfil b binding sequence, operably linked to a second nucleic acid encoding a reporter protein; (b) determining whether reporter gene expression or activity is increased in the presence of said test compound (i.e. determining whether the test compound is able to block the transcription repressor activity of Gfil b, thus resulting in an increase in the expression of the reporter gene);

wherein the increase of said reporter gene expression or activity in the presence of said test compound is indicative that said test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient.

The above-noted screening method or assay may be applied to a single test compound or to a plurality or "library" of such compounds (e.g., a combinatorial library). Any such compounds may be utilized as lead compounds and further modified to improve their therapeutic, prophylactic and/or pharmacological properties for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient.

Test compounds (drug candidates) may be obtained from any number of sources including libraries of synthetic or natural compounds, including peptide/polypeptide librairies, small molecule libraries, RNAi libraries. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means.

Screening assay systems may comprise a variety of means to enable and optimize useful assay conditions. Such means may include but are not limited to: suitable buffer solutions, for example, for the control of pH and ionic strength and to provide any necessary components for optimal activity and stability (e.g., protease inhibitors), temperature control means for optimal activity and/or stability, of Gfil b, and detection means to enable the detection of its activity. A variety of such detection means may be used, including but not limited to one or a combination of the following: radiolabelling, antibody-based detection, fluorescence, chemiluminescence, spectroscopic methods (e.g., generation of a product with altered spectroscopic properties), various reporter enzymes or proteins (e.g., horseradish peroxidase, green fluorescent protein), specific binding reagents (e.g., biotin/(strept)avidin), and others. As noted above, the invention further relates to methods (in vitro or in vivo) for the identification and characterization of compounds capable of decreasing Gfil b gene expression. Such a method may comprise assaying Gfil b gene expression in the presence versus the absence of a test compound. Such gene expression may be measured by detection of the corresponding RNA or protein, or via the use of a suitable reporter construct comprising one or more transcriptional regulatory element(s), such as a promoter, normally associated with a Gfil b gene, operably-linked to a reporter gene (i.e., any gene whose expression and/or activity may be detected, e.g., enzymatically or fluorescently), such as a luciferase gene (see, for example, Vassen et al., Nucleic Acids Research, 2005, Vol. 33, No. 3: 987-998) or other genes whose expression and/or activity may be detected (e.g., chloramphenicol acetyltransferase (CAT), beta-D galactosidase (LacZ), beta-glucuronidase (gus), luciferase, or fluorescent proteins (e.g., GFP, YFP, CFP, dsRed).

A first nucleic acid sequence is "operably-linked" with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably-linked to a coding sequence if the promoter affects the transcription or expression of the coding sequences.

Generally, operably-linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in reading frame. However, since, for example, enhancers generally function when separated from the promoters by several kilobases and intronic sequences may be of variable lengths, some polynucleotide elements may be operably-linked but not contiguous. "Transcriptional regulatory element" is a generic term that refers to DNA sequences, such as initiation and termination signals, enhancers, and promoters, splicing signals, polyadenylation signals which induce or control transcription of protein coding sequences with which they are operably-linked. The expression of such a reporter gene may be measured on the transcriptional or translational level, e.g., by the amount of RNA or protein produced. RNA may be detected by for example Northern analysis or by the reverse transcriptase-polymerase chain reaction (RT-PCR) method (see for example Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA).

Protein levels may be detected either directly using affinity reagents (e.g., an antibody or fragment thereof (for methods, see for example Harlow, E. and Lane, D (1988) Antibodies : A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY); a ligand which binds the protein) or by other properties (e.g., fluorescence in the case of green fluorescent protein) or by measurement of the protein's activity, which may entail enzymatic activity to produce a detectable product (e.g., with altered spectroscopic properties) or a detectable phenotype (e.g., alterations in cell growth/function). Suitable reporter genes include but are not limited to chloramphenicol acetyltransferase (CAT), beta-D galactosidase (LacZ), beta-glucuronidase (gus), luciferase, or fluorescent proteins (e.g., GFP, YFP, CFP, dsRed).

Gfil b protein expression levels could be determined using any standard methods known in the art. Non-limiting examples of such methods include Western blot, tissue microarray, immunoblot, enzyme-linked immunosorbant assay (ELISA), radioimmunoassay (RIA), immunoprecipitation, surface plasmon resonance, chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical analysis, matrix-assisted laser desorption/ionization time- of-flight (MALDI-TOF) mass spectrometry, microcytometry, microscopy, fluorescence activated cell sorting (FACS), flow cytometry, and assays based on a property of the protein including but not limited to DNA binding, ligand binding, or interaction with other protein partners.

Methods to determine Gfil b nucleic acid (mRNA) levels are known in the art, and include for example polymerase chain reaction (PCR), reverse transcriptase-PCR (RT-PCR), in situ PCR, SAGE, quantitative PCR (q-PCR), in situ hybridization, Southern blot, Northern blot, sequence analysis, microarray analysis, detection of a reporter gene, or other DNA/RNA hybridization platforms. For RNA expression, preferred methods include, but are not limited to: extraction of cellular mRNA and Northern blotting using labeled probes that hybridize to transcripts encoding all or part of one or more of the genes of this invention; amplification of Gfil b mRNA expressed using gene-specific primers, polymerase chain reaction (PCR), quantitative PCR (q-PCR), and reverse transcriptase-polymerase chain reaction (RT-PCR), followed by quantitative detection of the product by any of a variety of means; extraction of total RNA from the cells, which is then labeled and used to probe cDNAs or oligonucleotides encoding all or part of Gfil b, arrayed on any of a variety of surfaces.

In embodiments, competitive screening assays may be done by combining a Gfil b polypeptide, or a fragment thereof and a probe (e.g., a nucleic acid probe comprising a Gfi l b- binding sequence, such as TAA ATC AC ( A/T) G C A , SEQ ID NO: 19) to form a probe:Gfi1 b binding domain complex in a first sample followed by adding a test compound. The binding of the test compound is determined, and a change, or difference in binding of the probe in the presence of the test compound indicates that the test compound is capable of binding to the Gfil b binding domain and potentially modulating Gfil b activity.

The binding of the test compound may be determined through the use of competitive binding assays. In this embodiment, the probe is labeled with an affinity label such as biotin. Under certain circumstances, there may be competitive binding between the test compound and the probe, with the probe displacing the candidate agent. In one case, the test compound may be labeled. Either the test compound, or a compound of the present invention, or both, is added first to the Gfil b binding domain for a time sufficient to allow binding to form a complex.

The assay may be carried out in vitro utilizing a source of Gfil b which may comprise a naturally isolated or recombinantly produced Gfil b (or a variant/fragment thereof having Gfil b activity), in preparations ranging from crude to pure. Such assays may be performed in an array format. In certain embodiments, one or a plurality of the assay steps are automated.

In embodiments, the assays described herein may be performed in a cell or cell-free format.

A homolog, variant and/or fragment of Gfil b which retains Gfil b activity (e.g., transcription repression activity) may also be used in the methods of the invention. A fusion protein comprising Gfil b or a variant/fragment thereof having Gfil b activity, fused to a second polypeptide, such as a fluorescent tag (or any tag facilitating detection of the fusion protein), may also be used to assess the effect of a test compound on Gfil b activity and/or expression.

In an aspect, the present invention provides a method (in vitro or in vivo) for determining whether a test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient, said method comprising:

(a) contacting said test compound with a cell comprising a first nucleic acid comprising a transcriptional regulatory element comprising a Gfil b binding sequence, operably linked to a second nucleic acid encoding a reporter protein;

(b) determining whether reporter gene expression or activity is increased in the presence of said test compound (i.e. determining whether the test compound is able to block the transcription repressor activity of Gfil b, thus resulting in an increase in the expression of the reporter gene);

wherein the increase of said reporter gene expression or activity in the presence of said test compound is indicative that said test compound may be useful for (i) increasing the number of hematopoietic stem cells (HSCs) in a biological system; (ii) increasing the number of HSCs in the bone marrow and/or peripheral blood of a subject; and/or (iii) increasing the repopulation of HSCs in an HSC transplant recipient.

In embodiment, the method includes determining whether the test compound affects Gfil b-mediated transcriptional repression. Thus, the sample can include a Gfil b binding/recognition sequence operably linked to a reporter gene, such as a gene encoding a fluorescent protein (e.g., green, red, blue, cyan or yellow fluorescent protein) or any other detectable gene product (e.g., luciferase, beta-galactosidase, chloramphenicol acetyltransferase (CAT)). The effect of the test compound on Gfil b-mediated transcriptional repression of the reporter gene can be measured by determining expression of the reporter gene, e.g., by detecting fluorescent emission in the case of a fluorescent protein, in the presence or absence of the test compound.

MODE(S) FOR CARRYING OUT THE INVENTION

The present invention is illustrated in further details by the following non-limiting examples.

Example 1 : Materials and Methods

Mice. Gfi1b ^m mice were generated by homologous recombination in R1 embryonic stem cells. The nucleotide sequence of the genomic-integrated part of the Gfil b conditional knock-out construct is depicted in Figs. 9A-9E (the sequences of the pBSII-SK+ plasmid backbone and the diphtheria toxin fragment A (DTA) selection marker are not shown, but the sequence of the PGK1- neo resistance gene is included). All mice were backcrossed with C57BI/6 mice and the C57BI/6 background was verified by specific satellite PCR. Gfi1 ^m , Gfi1 ^GFP/WT and Gfi1b ^GFP/WT mice were described previously (Yucel R et al. , J Biol Chem. 2004; 279:40906-40917; Vassen L et al. Blood. 2007; 109: 2356-2364; Zhu J et al. Proc Natl Acad Sci U S A. 2006; 103: 18214-18219). All mice were housed under (SPF) conditions.

Treatment. MxCre tg Gfi1 ^m or Gfi1b ^m mice were injected with polyinosinic-polycytidylic acid (plpC) (Sigma-Aldrich) at a dose of 500 μg per injection every other day for a total of 5 injections. As control, wt or Gfi1b ^m mice not carrying the MxCre tg were injected with plpC. With regard to N-Acetyl-Cystein (Sigma-Aldrich, Mississagua) treatment, mice were fed every day with 500 μΙ N-Acety-Cystein (50 mg/ml)

Flow cytometry analysis, sorting of HSC and progenitors. HSCs and progenitors were analyzed with a LSR™, or Cyan flow cytometers and HSC were sorted with a MoFlo™ from adult mouse bone marrow as described previously (Kiel et al., 2005, supra; Adolfsson J et al., Cell 2005; 121 :295-306). The BrdU experiments and the determination of cell cycle phases by Hoechst staining was done according to described procedures (Wilson et al., 2005, supra). Reactive oxygen species (ROS) were analyzed by staining HSCs with 5-(and-6)-carboxy-2',7'- dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA) (Invitrogen, Burlington, Canada) for 30 min at 37°C. After staining, cells were analyzed by flow cytometry for level of ROS in HSCs.

Methylcellulose culture. 20,000 bone marrow cells were seed on methylcellulose (M3434, StemCell technologies, Vancouver, Canada) supplemented with EPO, IL-3, IL-6 and SCF. After 10 days, the number of colonies was determined. Subsequently, cells were resuspended and 10,000 cells of the suspension were replated on fresh methylcellulose medium.

Transplantation. The number of functional stem cells was determined in vivo using a limiting dilution assay, as described previously (Akala OO et al., Nature 2008; 453:228-232). Different amounts bone marrow cells from plpC-treated Gfi1b ^m and MxCre tg Gfi1b ^m mice (both CD45.2 ⁺ ) were transplanted together with 200,000 CD45.1 ⁺ bone marrow cells into lethally irradiated CD45.1 ⁺ mice. 18 weeks after transplantation, the peripheral blood of the recipient mice was analyzed for the contribution of CD45.2 ⁺ cells and a percentage of higher than 1 % was considered a positive call. Using the L-Calc™ software from Invitrogen, the frequency of functional stem cells was determined.

PCR genotyping. Genotyping of Gfi1b ^m mice was performed using the following primers:

LP5-3s : GGTTTCTACCAGTCTGGCCCTGAACTC (SEQ ID NO: 10);

LP3-3r : CTCACCTCTCTGTGGCAGTTTCCTATC (SEQ ID NO:1 1);

LP5-4r : TACATTCATGCTTAGAAACTTGAGTC (SEQ ID NO: 12).

The product length of the wt allele is 255 bp, 295 bp for the floxed allele and 540 bp for the deleted allele.

Microarray Studies. Microarray data have been deposited in the GEO database (Accession No. = 20655). Samples were hybridized with Affymetrix™ Mouse Gene 1.0 ST Arrays. Data was processed using the Affymetrix™ Expression Console software; algorithm-name: rma- gene-default. Only genes up- or down-regulated more than 2 times were taken into consideration.

Statistical Analysis. The unpaired Student t-test was chosen for analyzing the differences in the number of HSCs, CMPs, GMPs and platelets. ANOVA was used to compare plating efficiency between wt and G/7 ^' 70-deficient bone marrow cells. All p-values were calculated two- sided, and values of p < 0.05 were considered statistically significant. Statistical analysis was done with GraphPad™ Prism software (GraphPad software, La Jolla, CA, USA).

Example 2: GfM b is highly expressed in HSCs and loss of GfM b drastically increases HSC numbers

Using previously described Gfi1 b:GFP knock-in mice (Gfi1b ^GFP/+ ), in which the level of GFP follows GfHb promoter activity and GfHb mRNA levels (Vassen et al., 2007, supra), it was observed that GfM b is highly expressed in virtually all HSCs (defined as: Lin ^" , Sca-1 ⁺ , c-kif, (LSK), CD150 ⁺ , CD48 ^" ) but is significantly down-regulated in the more differentiated MPP subsets (defined as MPP1 : Lin , Sca-1 ⁺ , c-kit ⁺ , (LSK), CD150 ⁺ , CD48 ⁺ and MPP2: Lin , Sca-1 ⁺ , c-kit ⁺ , (LSK), CD150 ^" , CD48 ⁺ ) (FIGs. 1A and 1 B). The dormant CD34 ^" HSC fraction (Wilson et al., 2005, supra) from Gfi1b ^GFP/WT mice showed similar mean fluorescence intensities (MFI) than the activated CD34 ⁺ HSCs (FIG. 1 B). In addition, using similar reporter mice for Gfi1 (Gfi1 :GFP knock-in mice (Gfi1 ^GFP/+ ), in which the Gfi1 promoter activity and mRNA levels can be measured by monitoring green fluorescence (Yucel R et al., J Biol Chem. 2004; 279:40906-40917; Vassen et al., 2007, supra)), it was determined that expression levels of Gfi1 and Gfil b were different in HSC and MPP subsets. In particular, the Gfil b gene is highly expressed in HSCs and downregulated upon differentiation to the MPPs (FIGs. 1 B, 1 C), whereas Gfi1 shows lowest levels in HSCs and is upregulated in the MPP fractions, pointing to the possibility that both transcription factors are differentially regulated and have different roles in these cells.

It was investigated whether Gfil b plays a particular role, different from Gfi1 , in HSCs. Since constitutively deficient Gfil b mice die at mid-gestation (Saleque S et al., Genes Dev. 2002; 16:301-306) and thus cannot be used for analysing adult HSCs, a GfHb conditional mouse carrying floxed GfHb alleles and an MxCre transgene was generated (FIG. 1 D). In these MxCre tg Gfi1b ^m mice, GfHb exons 2-4 can be deleted after injection of plpC, leading to the abrogation of Gfil b expression (FIGs. 1 E to 1G). In order to exclude possible effects of plpC and interferon-alpha on HSCs, MxCre Gfi1b ^m and Gfi1b ^m mice were examined 20 days after the last plpC injection. It has been shown that this time period is sufficient to wean off effects of plpC or interferon-alpha on HSCs (Essers MA et al. Nature. 2009; 458:904-908). As shown in Figs. 2A to 2E and Table 1 , G/7 ^' 70-deficient mice show increased frequencies of HSCs in bone marrow, spleen and in the peripheral blood (between 30- to 100-fold, respectively) relative to wild-type mice, a feature that is not observed in G/7 ^' 7-deficient mice (Zeng H et al. EMBO J. 2004; 23:4116-4125; Hock H et al. Nature. 2004; 431 : 1002-1007). The expansion affected both short-term (defined as CD34 ⁺ LSK, CD150 ⁺ , CD48 ^" ) and long-term (CD34 ^~ LSK, CD150 ⁺ , CD48 ^" ) HSCs (FIG. 2C, Table 1 ).

Table 1 : Change of hematological compartments and cell populations after Gfil b deletion

The number of bone marrow (BM) cells, splenocytes and % of Lin ^" cells was determined in wt and Gfilb deficient mice. The increase in number of splenocytes is mostly due to increase of number of erythroid progenitors. HSCs are defined by immunophenotype as Lin ^" , Sca-1 ⁺ , Kit ⁺ , CD150 ⁺ , CD48 ^" . Depicted are Mean values, SEM and number of samples. P-values are based on unpaired two-sided t-test.

The deletion of Gfil b increased the number of Lin ^" cells in the bone marrow but did not significantly alter the overall cellularity of the bone marrow (Table 1). In contrast there was an increase in the number of splenocytes in G/7 ^' 70-deleted mice (Table 1), which was mainly the result of an expansion of erythroid progenitors in the spleen. Since the total number of bone marrow cells was not altered, the increased frequencies of HSCs correlated well with the increased absolute numbers of HSCs in bone marrow, spleen and blood indicating and expansion between 39- and over 100-fold, respectively (Table 1 ). It was also found that the number of platelets and erythrocytes in the peripheral blood was reduced compared to wt mice, albeit to different extents, whereas the total number of leukocytes was not changed (FIGs. 2F-2H). This is consistent with the established role of Gfil b in the erythroid-megakaryocytic lineage (Anguita E et al., Haematologica Jan 2010; 95(1 ):36-46; Hernandez A, et al., Ann Hematol. Aug 2010;89(8):759-765; Laurent B, et al. Blood. Jan 21 2010;115(3):687-695; Osawa M, et al. Blood. Oct 15 2002;100(8):2769-2777; Randrianarison-Huetz V et al. Blood. Apr 8 2010;115(14):2784-2795; Garcon L, et al. Blood. Feb 15 2005; 105(4): 1448-1455; Huang DY et al. Nucleic Acids Res. 2004;32(13):3935-3946; Saleque S, et al. Mol Cell. Aug 17 2007;27(4):562-572; Saleque S, et al. Genes Dev. Feb 1 2002;16(3):301- 306). Finally, it was also verified whether the excision of the floxed Gfilb regions was efficient in HSCs after plpC induction and observed that cells with non-excised GfHb alleles were below detection level (Fig. 2I).

Example 3: HSCs from Gfi1 i -deficient mice are less quiescent that wt HSCs and contain more reactive oxygen species (ROS) The increased numbers of HSCs in G/7 ^' 70-deficient mice could be the result of a lower rate of spontaneous cell death or more proliferation. Gfilb deficient (Gfi1b ^k0/k0 ) HSCs underwent a slightly higher rate of spontaneous apoptosis than wt HSCs, but remained still under 2.5% (Fig. 3A). Using a BrdU pulse chase approach, it was found that the loss of Gfil b correlated with increased frequencies of cycling HSCs, but had no or little effect on cells from the MPP subsets (FIG. 3B). Staining with Hoechst showed that Gfi1b ^k0/k0 mice had a higher percentage of HSCs in S and G2/M phases than wt mice (FIG. 3C), but that cell cycle progression of the MPPs was not altered. These two results indicate that Gfil b restricts specifically the proliferation of HSCs and hence might control HSCs dormancy, but does not affect the rate of cell cycle progression in the different MPP fractions (Fig. 3c). In support of this, a label retention assay showed that only 10% of Gfi1b ^k0/k0 HSCs were quiescent, i.e., did not divide during the observation period (FIG. 3D). In contrast, 45% of the plpC-treated wt HSCs did not undergo a cell division at the end of the same time period (Fig. 3D). These findings indicates that a significant proportion of Gfi1b ^k0/k0 HSCs is no longer dormant and has entered the cell cycle. HSCs are kept in a dormant state at the endosteal niche, which provides a hypoxic environment and protects them against oxidative damage by reactive oxygen species (ROS), whereas high ROS are characteristic for activated HSCs and MPPs (Eliasson P and Jonsson Jl. J Cell Physiol. 2010; 222: 17-22; Arai F and Suda T. Ann N Y Acad Sci. 2007; 1106:41-53. As shown in FIG. 3E, Gfi1b ^k0/k0 HSCs had a significantly increased level of ROS, when compared to the wt HSC population.

To verify whether loss of Gfil b activates HSCs and that this activation leads to increased level of ROS which in turn could lead to an expansion of HSCs, mice were fed with N-Acetyl- Cystein (NAC), which counteracts the effects of ROS (Ito K, et al. Nat Med. Apr 2006;12(4):446- 451). It was found that administration of NAC significantly limited the expansion of Gfi1b ^k0/k0 HSCs in the bone marrow, spleen and peripheral blood both with regard to frequencies and absolute numbers (FIGs. 3F to 3H, Table 2) but did not affect the plpC-mediated excision of the floxed Gfil b exons in HSCs (FIG. 31). This indicated that elevated levels of ROS are at least partially responsible for the expansion of Gf/7 >deficient HSCs.

Table 2: Change of hematological compartments and cell populations after Gfil b deletion and N-Acetyl-Cystein injection

Gfi1b ^mi

Gfi1b ^fl/fl fold

Mx-Cre tg p-value

change Number of BM cells

45±4,(n=7) 44±2,(n=6) 1 0.8

x 10 ^s NAC treatment

Number of splenocytes

86±22,(n=4) 104±22, (n=5) 1.2 0.5

x 10 ⁶ NAC treatment

% Lin ^" cells

1.5±0.1 ,(n=7) 2.45±0.5, (n=6) 1.6 0.15

in BM NAC treatment

Number of Lin ^" cells

0.8±0.1 ,(n=7) 1.1 ±0.4,(n=6) 1.4 0.32

x 10 ^s NAC treatment

Number of HSCs 1700±700,

5700±1 100, (n=6) 3 0.01

in BM NAC treatment (n=7)

Number of HSCs

197±77,

in Spleen NAC 6000±2000, (n=4) 30 0.07

(n=3)

treatment

Number of HSCs

per 1 ml blood 11 ±1 , (n=3) 307±100, (n=5) 28 0.03 NAC treatment

The number of bone marrow (BM) cells, splenocytes and % of Lin ^" cells was determined in wt and GfHb deficient mice. Mice were fed daily with N-Acetyl-Cystein. HSCs are defined by immunophenotype as Lin ^" , Sca-1 ⁺ , Kit ⁺ , CD150 ⁺ , CD48 ^" . Depicted are Mean values, SEM and number of samples. P-values are based on unpaired two-sided t-test.

Example 4: Loss of Gfil b does not affect the multipotency or self-renewal capacity of HSCs

Next, it was investigated whether loss of Gfil b might change the self-renewal capacity of HSCs. Gfi1b ^k0/k0 bone marrow cells generated the same type of colonies (including CFU-E, BFU-E, CFU-G, CFU-M, CFU-GM, CFU-GEMM) as wt cells, when seeded in methylcellulose and showed initially a higher replating efficiency and generated a higher number of colonies than wt bone marrow (FIG. 4A), which is in contrast to findings for Gfi1 (Zeng H et al. 2004, supra; Hock H et al. 2004, supra). However, after the 4 ^th cycle, Gfi1b ^k0/k0 cells exhausted their replating ability similar to wt cells (Fig. 4A). A limiting dilution assay was also performed to verify the number of functional HSCs in vivo, and a HSCs frequency of 1/7,000 cells was detected in Gfi1b ^kolko mice, as compared to 1/46,000 cells in wt mice (Tables 3 and 4, p ≤ 0.03). These findings suggested that Gfilb deficiency enhances the number of functional HSCs by a factor of about 6 to 7 (Table 4).

Table 3: Determination o functional stem cells by limiting dilution assay

Genotype Dose (# of cells) Positive recipients

Wt 200 000 3/3

Wt 100 000 3/3

Wt 20 000 1/3

Wt 10 000 0/3

Wt 5 000 0/3

GfHbko 200 000 3/3

GfHbko 100 000 3/3

GfHbko 20 000 3/3

GfHbko 5 000 1/3 The number of functional stem cells was determined in-vivo by limiting dilution.

Indicated number of plpC treated Gfi1b ^m and MxCre tg Gfi1b ^fl/fl (Gfi1b ^k0/k0 ) (both CD45.2 ⁺ ) bone marrow cells were transplanted with 200 000 CD45.1 ⁺ bone marrow cells into lethally irradiated CD45.1 ⁺ mice. About 18 weeks after transplantation, peripheral blood was examined for presence of CD45.2 ⁺ cells. A percentage higher than 1 % was a positive call.

Based on the results in Table 2 number of functional stem cells was determined. * denotes a statistically significant difference with p < 0.05.

To further examine whether loss of Gfil b alters self-renewal and multipotency of HSCs, 200 000 bone marrow cells from either wt or G/7 ^' 70-deficient CD45.2 mice were transplanted in competition with wt CD45.1 bone marrow cells (FIG. 4B). Transplanted G/7 ^' 70-deficient bone marrow cells were able to compete with wt CD45.1 cells with regard to blood, bone marrow, spleen and thymus repopulation and recipient mice transplanted with Gf/i j-deficient bone marrow cells even showed a significantly higher level of chimerism (measured as the percentage of CD45.2 ⁺ cells) in blood than recipients that received wt CD45.2 cells (FIGs. 4C and D). However, when frequencies of CD45.2 ⁺ myeloid or lymphoid cells were measured in bone marrow, spleen and thymus, there was no difference between mice that had received wt or Gf/i j-deficient bone marrow (FIG. 4E). In addition, a strong and highly significant expansion of transplanted CD45.2 ⁺ Gfilb deficient HSCs in blood and bone marrow was observed (FIGs. 4F to 4M). G/^b-deficient (CD45.2 ⁺ ) HSCs represented almost 90 % of all HSCs in the recipient animals (FIGs. 4F to 4J). A similar expansion of Gf/7 >deficient HSCs was also detectable in the peripheral blood of recipients that received Gf/7 >deficient bone marrow indicating that the phenotype of HSCs expansion observed in mice lacking Gfil b is cell autonomous (FIGs. 4K and 4L).

The bone marrow of Gf/7 >deficient mice contains about 39 times more phenotypically defined stem cells (HSCs, FIG. 2B, and Table 1). Yet, limiting dilution experiments suggested only 6-times more functional stem cells in G/7 ^' 70-deficient bone marrow (Tables 3 and 4). One possible explanation for this discrepancy would be that, as a result of activation, Gfi1b ^k0/k0 HSCs are at least partially compromised in their sternness and their ability to compete with wt HSCs. To test this, a mixture of 50 sorted wt CD45.1 ⁺ HSCs (defined as above as LSK, CD48 ^" , CD150 ⁺ ) was transplanted with either 50 sorted CD45.2 ⁺ wt HSCs or 50 sorted CD45.2 ⁺ HSCs from Gfi1b ^kolko mice into syngenic recipient animals (CD45.1 ⁺ ) (FIG. 5A). It was observed that, Gfi1b ^k0/k0 HSCs could contribute to the same extent to myeloid and lymphoid lineage differentiation in blood and peripheral organs as wt CD45.2 ⁺ HSCs (FIGs. 5B to 5D). A significant expansion of G/7 ^' 70-deficient CD45.2 ⁺ HSCs and LSK cells was again detected in the bone marrow and peripheral blood of recipient animals (FIGs. 5E to 5I). This expansion of HSCs is comparable to the result obtained after transplantation of the same number of wt and G/7 ^' 70-deficient bone marrow cells (FIGs. 4I to L, FIGs. 5E to 5I).

It was next examined whether loss of Gfil b might exhaust the self-renewal capacity of G/7 ^' 70-deficient HSCs in a serial transplantation assay. Syngeneic mice (CD45.1) were transplanted with wt (CD45.1 ) and CD45.2 ⁺ G/7 ^' 70-deficient bone marrow and the degree of chimerism in the primary and secondary recipient was determined by measuring the percentage of CD45.2 ⁺ cells in the blood (FIG. 5J). The experiment showed that the degree of chimerism in a secondary transplantation is maintained. The results of these experiments indicate that Gfi1b ^k0/k0 HSCs maintain their sternness and multipotency, as well as their ability to expand in blood and bone marrow beyond wt HSC numbers. It is thus unlikely that the difference between over 30-fold elevated numbers of phenotypically defined HSCs on one hand and a 6-fold elevated number of functional HSCs (limiting dilution assay) on the other hand is due to a loss of multipotency and self- renewal capacity.

HSCs residing in peripheral blood of mice have long-term potential capacity (Wright DE, et al. Science. Nov 30 2001 ;294(5548): 1933-1936). Since a significant expansion of phenotypically defined HSCs was observed in the blood of Gf/i j-deficient mice, experiments to verify whether these blood HSCs represent true functional stem cells were performed. To test this, 50 μΙ of blood originating either from wt or Gfi1b ^k0/k0 (both CD45.2 ⁺ ) mice was transplanted alongside with 200 000 bone marrow cells from wt CD45.1 mice. Gfi1b ^k0/k0 HSCs from peripheral blood were able to give rise to CD45.2 ⁺ cells (FIG. 5K), indicating that Gfi1b ^k0/k0 HSCs found in blood are functionally intact stem cells. Taken together, these data indicate that Gfi1b ^k0/k0 HSCs are not compromised in their ability to compete with wt HSCs and maintain their sternness, self-renewal capacity and multipotency.

Example 5: Either Gfi1 b or Gfi1 play a role in the maintenance of HSCs

A direct comparison of both Gfi1- and Gf/i j-deficient mice confirmed that loss of Gfi1 led to an increase of HSCs, very likely due to higher cell proliferation (Zeng H et al. 2004, supra; Hock H et al. 2004, supra), but that this increase was by far not as pronounced as in Gf/7 >deficient mice (FIGs. 5A and 5B). However, when both Gfi1 and Gfil b were deleted and mice were examined 15 days after the first plpC injection, a drastic (>5-fold) reduction of HSCs over wt numbers was observed (FIGs. 6A and 6C). Genotyping of the few HSCs remaining in these double-deficient mice showed repeatedly that one Gfil b allele was not excised, but both Gfi1 alleles were deleted, indicating a functional Cre recombinase (FIG. 6D). It was also found that, if double GfiVGfUb- deficient mice were observed for a longer period of time (40 days after the first plpC injection), HSCs numbers were restored to wt levels (FIG. 6C), but these HSCs showed again only a partial excision of the Gfilb locus. In addition, an upregulation of Gfi1 was measured in HSCs in which Gfil b was deleted (FIG. 7A), and that HSCs, in which Gfilb was deleted, up-regulated the expression of Gfi1 mRNA (FIG. 7B), showing the ability of Gfil b and Gfi1 for crossregulation (Vassen L, et al. Nucleic Acids Res. 2005;33(3):987-998; Doan LL, et al. Nucleic Acids Res. 2004;32(8):2508-2519). These data demonstrate that down-regulation of Gfil b leads to upregulation of Gfi1 in HSCs and suggest that the complete deletion of both Gfi1 and Gfil b is incompatible with the generation or maintenance of HSCs.

Example 6: Loss of Gfi1 b affects expression of surface molecules important for the

hematopoietic stem cell niche

To further explore how Gfil b might function in HSCs and how its function differs from Gfi1 , the relative expression levels of several genes in wt and Gfi1b ^k0/k0 HSCs was determined using Affymetrix™ gene arrays. The list of genes exhibiting at least a 2-fold difference in expression in wt vs. Gfi1b ^k0/k0 HSCs is provided in Table 6. It was found that the expression of genes encoding cell adhesion molecules and integrins was significantly deregulated in Gfi1b ^k0/k0 HSCs (FIG. 7C). Notably, the expression of VCAM-1 , CXCR4 and integrin a4, which play a role in the retention of HSCs in their endosteal niche (Kiel MJ et al., 2005, supra; Forsberg EC and Smith-Berdan S. Haematologica. 2009; 94: 1477-1481 ; Wilson A et al., Curr Opin Genet Dev. 2009; 19:461-468; Kiel MJ and Morrison SJ. Nat Rev Immunol. 2008; 8:290-301 ; Martinez-Agosto JA et al., Genes Dev. 2007; 21 :3044-3060; Wlson A and Trumpp A. Nat Rev Immunol. 2006; 6:93-106) were expressed at lower levels in Gfi1b ^k0/k0 HSCs as compared to wt HSCs (FIG. 7C, Table 5). On the other hand, adhesion molecules such as integrin β1 and β3 that mediate endothelial cell adhesion (Sixt M et al., Curr Opin Cell Biol. 2006; 18:482-490; Cantor JM et al., Immunol Rev. 2008; 223:236-251) were upregulated at mRNA and protein levels (FIG. 7D, Table 5), indicating that loss of Gfil b directly or indirectly affects expression of cell surface molecules that have a role in niche organization.

Table 5: Change of expression of different surface proteins on stem cells after deletion of

Gfil b.

Surface protein Gfi1b ^fl/fl MxCre tg Gfi1b ^fl/fl p-value

Relative expression Relative expression level level

Integrin α4 (CD49d) 1 0.48±0.18 0.02

CXCR4 1 0.53±0.09 0.01

VCAM-1 1 0.46±0.07 0.01

Integrin β 3 (CD61 ) 1 13.7±1.9 0.02

Integrin β 1 (CD29) 1 1.53±0.2 0.05

In three independent experiments expression by Mean Fluorescence level of the different proteins was measured. To facilitate differences in up or down regulation of the different proteins, the expression in the Gfi1b ^m was set to 1 (n=3 for all sets). Depicted are mean values and SEM. P- values are based on unpaired two-sided t-test.

Table 6: Genes exhibiting at least a 2-fold difference in expression in wf vs. GfHb HSCs.

Genes showing higher expression in Gfi1b ^k0/k0 HSCs are highlighted in grey.

Fold

# Gene Symbol mRNA Accession mRNA Source difference

KO/wt

1 Cled b NM_019985 RefSeq 19.6412476

2 — ENSMUST00000082993 ENSEMBL 12.002045

3 Gm10708 ENSMUST00000098988 ENSEMBL 10.0391972

4 Clec9a NM_172732 RefSeq 9.1810002

5. Kcnj5 NM_010605 RefSeq 8.53254036

6 Tmem215 NM_177175 RefSeq 7.76875995

7 — ENSMUST00000084002 ENSEMBL 7.74047625

8 Itgb3 NM_016780 RefSeq 6.99160978

9 Syne2 NM_001005510 RefSeq 6.78823417

10 — GENSCAN00000010455 ENSEMBL 6.42319754

11 Timp3 NM_011595 RefSeq 6.33038539

12 PlagH NM_009538 RefSeq 6.17908692

13 Rasgrp3 NM_207246 RefSeq 5.99025326

14 Sdpr NM_138741 RefSeq 5.53041726

15 Pde5a NM_153422 RefSeq 5.43749059

16 Myoml NMJ310867 RefSeq 5.42024726

17 Ppbp NM_023785 RefSeq 5.41060029

18 — ENSMUST00000103487 ENSEMBL 5.40434834

19 Snord35b NR_000004 RefSeq 5.36765024

20 Serpine2 NM_009255 RefSeq 5.26843937

21 Chd7 NM_001081417 RefSeq 5.17642953

22 Xist NR_001463 RefSeq 5.00369551

23 Gm10419 AK165889 GenBank HTC 4.84903276

24 Chl1 NM_007697 RefSeq 4.82780699

25 Car8 NM_007592 RefSeq 4.70776182

26 lgk-V19-14 U59155 GenBank 4.52832446 Gucy1 b3 N _017469 RefSeq 4.51227397

— ENSMUST00000083225 ENSEMBL 4.45350434

Slc35d3 NM_029529 RefSeq 4.44797188

— ENSMUST00000082808 ENSEMBL 4.35498877

— BC150794 GenBank 4.31589969 miRBase Micro RNA

— mmu-mir-695 4.30135439

Database

F2rl2 NM_010170 RefSeq 4.21320856

Havcr2 NM_134250 RefSeq 4.19345004

— ENSMUST00000093651 ENSEMBL 4.18346587

Alox12 NM_007440 RefSeq 4.04664231

Npas2 NM_008719 RefSeq 4.01622845

Myo6 NM_001039546 RefSeq 3.99224889

— BC056623 GenBank 3.9791437

Chd7 NM_001081417 RefSeq 3.96072993

Robo3 AF060570 GenBank 3.93144953

Pf4 NM_019932 RefSeq 3.92209822

Lphn2 NM_001081298 RefSeq 3.9056906

Psd3 N _030263 RefSeq 3.86716235

Ufspl NM_027356 RefSeq 3.86301871

Mrvil NM_010826 RefSeq 3.79151387

Ltbpl NM_019919 RefSeq 3.78793787

Dsp NM_023842 RefSeq 3.62579829

Gfi1 b* NM_008114 RefSeq 3.60898964

Gm10047 ENSMUST00000069263 ENSEMBL 3.60829594

LOC100045278 XR_031496 RefSeq 3.60375933

Rnf160 NM_001081068 RefSeq 3.59485522

Cled a NM_175526 RefSeq 3.57895152

Cstf3 N _145529 RefSeq 3.56563905

— U65535 GenBank 3.56516538

Prkca NM_011101 RefSeq 3.55182951

Rnf160 N _001081068 RefSeq 3.53729776

— ENSMUST00000083993 ENSEMBL 3.40032505

Gm1964 NM_001033488 RefSeq 3.35997539

Ppp1 r12b NM_001081307 RefSeq 3.35700108

Earl NM_007894 RefSeq 3.29725013

— miRBase Micro RNA

mmu-mir-350 3.29099158

Database

— ENSMUST00000093657 ENSEMBL 3.28758228

— ENSMUST00000082804 ENSEMBL 3.26215274

Aim NR_002853 RefSeq 3.25121058

8430427H17Rik NM_001134300 RefSeq 3.24796481

— BC150794 GenBank 3.23954081

— BC150794 GenBank 3.23392525 Slc35e3 NM_029875 RefSeq 3.21894814

— ENSMUST00000100336 ENSEMBL 3.20950024

Nckapl NM_016965 RefSeq 3.19407532

Grap2 NM_010815 RefSeq 3.19122796

— ENSMUST00000083425 ENSEMBL 3.18889663

Psd3 N _177698 RefSeq 3.1871384

Med12l NM_177855 RefSeq 3.16238862

Gm7112 ENS UST00000103479 ENSEMBL 3.15727735

— ENSMUST00000083025 ENSEMBL 3.14520343

Gm16485 ENS UST00000104915 ENSEMBL 3.12595137

Sfxn4 NM_053198 RefSeq 3.12149539

■ — GENSCAN000Q0021 131 ENSEMBL 3.11431239

Car5b N _181315 RefSeq 3.1026888

P2rx7 NM_011027 RefSeq 3.08494478

Gm5970 XR_033405 RefSeq 3.06496656

Slc14a1 NM_028122 RefSeq 3.05475216

D rs3 N _011303 RefSeq 3.05375644

Ehd3 NM_020578 RefSeq 3.04405551

— ENSMUST00000082631 ENSEMBL 3.0194365

Tremll NM_027763 RefSeq 2.99446306

Chd7 NM_001081417 RefSeq 2.98764555

Rai2 NM_198409 RefSeq 2.93456297

— ENSMUST00000082752 ENSEMBL 2.93345325

Cc2d2a NM_172274 RefSeq 2.92606469

Rab27b NM_001082553 RefSeq 2.92276938

Myo9a NMJ73018 RefSeq 2.9176233830037G11Rik AK087889 GenBank HTC 2.91421032

Xlr N _011725 RefSeq 2.89981393

— ENSMUST00000082922 ENSEMBL 2.88819737

Syne2 N _001005510 RefSeq 2.86852084

Amelx NM_001081978 RefSeq 2.84120383

Nuprl NM_019738 RefSeq 2.83390881

Srgap3 NM_080448 RefSeq 2.811 16409

AY512938 AY512938 GenBank HTC 2.80765694

Gm10419 ENSMUST00000100944 ENSEMBL 2.80560777

— ENSMUST00000082831 ENSEMBL 2.77954422 knkl NM_021461 RefSeq 2.77319616

Plek N _019549 RefSeq 2.74602673

Kif3c NMJ308445 RefSeq 2.74101458

Itga2b N _010575 RefSeq 2.72787714

Trpc6 NM_013838 RefSeq 2.71369265

Cd9 NM_007657 RefSeq 2.69784787

Gnb4 NM_013531 RefSeq 2.68972871 Tpk1 NM_013861 RefSeq 2.29570458

6720487G11Rik BC082605 GenBank 2.29038903

Ptpladl NM_021345 RefSeq 2:28945943

Lrrc8b NM_001033550 RefSeq 2.28944303

P2ry1 NM_008772 RefSeq 2.28767747

Qtrtdl NM_029128 RefSeq 2.2727269

Cd46 NM_010778 RefSeq 2.25861911

— ENSMUST00000083026 ENSEMBL 2.25595038

Gbp4 NM_008620 RefSeq 2.25408408

Nrgn NM_022029 RefSeq 2.25276683

— ENSMUST00000082656 ENSEMBL 2.25137285

Chd7 NM_001081417 RefSeq 2.23844934

Gm14636 ENSMUST00000101675 ENSEMBL 2.23531528

5430417C01 Rik AKO 19946 GenBank HTC 2.23499303

Clcal NM_009899 RefSeq 2.23460784

Gata2 NM_008090 RefSeq 2.2270825

— ENSMUST0000Q082587 ENSEMBL 2.22594303

Slain2 NM_153567 RefSeq 2.21667203

SamdS NM_177271 RefSeq 2.21328566

Arfipl NM_0Q1081093 RefSeq 2.21201627

1700012L04Rik NM_029588 RefSeq 2.20665384

— AK089564 GenBank HTC 2.20316773

Adamts9 NMJ75314 RefSeq 2.20133595

Rnu73a NR_004417 RefSeq 2.19945589

Heatr5b BC019508 GenBank 2.19445294 l830077J02Rik BC147821 GenBank 2.1933099

Pdel Oa NM_011866 RefSeq 2.18966475

Dennd5b NMJ77192 RefSeq 2.1876329

Naaladl2 XM_975226 RefSeq 2.18713004

Septl 1 NM_001009818 RefSeq 2.18705171

Olfr99 NMJ46515 RefSeq 2.18097263

Myo9a N _173018 RefSeq 2.18033628

Spata22 NM_001045531 RefSeq 2.1764185

Vcl NM_009502 RefSeq 2.17618167

Snord49a AF357372 GenBank 2.17193109

Ear10 NM_053112 RefSeq 2.17088454

Mug1 NM_008645 RefSeq 2.1687664

— mi ^' RBase Micro RNA

mmu-let-7f-1 2.16547923

Database

Gm10880 ENSMUST00000103344 ENSEMBL 2.16497195

Gm4979 NM_001 142411 RefSeq 2.16380176

Pnet-ps AY223547 GenBank 2.16144481

St8sia6 NM_145838 RefSeq 2.15965121 Dockl NM_001033420 RefSeq 2.15532237

Bmp2k NM_080708 RefSeq 2.14612335

Gm14501 NM_001085537 RefSeq 2.14097656

Cep63 ENSMUST00000098450 ENSEMBL 2.13921428

Myo9a NMJ73018 RefSeq 2.13408701

F2r NM_010169 RefSeq 2.1296736

— ENS UST00000083236 ENSEMBL 2.12315741

— miRBase Micro RNA

mmu-mir-677 2.12141175

Database

1810011 H11Rik AK007434 GenBank HTC 2.11449478

Top2a AK028218 GenBank HTC 2.10827004

Abhd2 NM_018811 RefSeq 2.10684182

Gm15441 ENSMUST00000098839 ENSEMBL 2.10566948

Rhoj NM_023275 RefSeq 2.10440201

Ttll7 NM_027594 RefSeq 2.10266546

— ENSMUST00000082812 ENSEMBL 2.09883536

Ear10 NM_053112 RefSeq 2.09709856

Alpkl ENSMUST00000029662 ENSEMBL 2.091 13567

Nexn NM_199465 RefSeq 2.08889745

Dnahc12 ENSMUST00000100792 ENSEMBL 2.08536415

Hivep2 NM_010437 RefSeq 2.07956003

Gm129 BC132471 GenBank 2.07634139

2810409K11 Rik BC117497 GenBank 2.06818083

Fert2 N _001037997 RefSeq 2.06737294

Stx3 NM_001025307 RefSeq 2.06497121

Arl10 N _019968 RefSeq 2.06460673

Ankrd29 ENSMUST00000118525 ENSEMBL 2.06077881

Mpp7 NM_001081287 RefSeq 2.06049315

5430411C19Rik AK017294 GenBank HTC 2.05636353

Vwf NM_011708 RefSeq 2.05558638

Fyb NM_011815 RefSeq 2.05466425

K drbs3 NM_010158 RefSeq 2.05442453

Gm10002 ENSMUST00000070887 ENSEMBL 2.05428498

Nf1 NM_010897 RefSeq 2.05069604

C1galt1 NM_052993 RefSeq 2.05001244

Kctdl NM_134112 RefSeq 2.04895315

Slc36a4 NM_172289 RefSeq 2.04659835

— ENSMUST00000083018 ENSEMBL 2.0410403

Rnu2 NR_004414 RefSeq 2.03890374

Uhrf1 bp1 l NM_029166 RefSeq 2.0379519

Pon3 NM_173006 RefSeq 2.03683248

— ENS UST00000082858 ENSEMBL 2.02959049

Sgk1 NM_001 161845 RefSeq 2.02533469 Itpripl2 NM_001033380 RefSeq 2.02460622

Gm10759 AY344585 GenBank 2.02425728 lpo7 AF357383 GenBank 2.02066944

Gas2l3 NM_001033331 RefSeq 2.0192847

Ncoa3 NM_008679 RefSeq 2.01684004

Prg2 NM_008920 RefSeq 2.01583236

Fam129a NM_022018 RefSeq 2.01257145

Srgap3 NM_080448 RefSeq 2.00818753

Rarb NM_011243 RefSeq 2.00420905

A230067G21 Rik NM_001033348 RefSeq 2.00045984

Ccnbl NM_172301 RefSeq 0.49972443

Snora52 AF357388 GenBank 0.49882926

Spacal NM_026293 RefSeq 0.49849928

Tmodl NM_021883 RefSeq 0.49756653

Pde3b NM_01 1055 RefSeq 0.49742261

Zrsrl NM_01 1663 RefSeq 0.49658709

Pglyrpl NM_009402 RefSeq 0.49657677

Kynu NM_027552 RefSeq 0.49565459

Nlrc5 FJ889356 GenBank 0.49526331

Ifitm6 NM_001033632 RefSeq 0.49497778

Ncam2 NM_001 1 13208 RefSeq 0.49452785

— ENSMUST00000082836 ENSEMBL 0.49437819

— NM_001025575.1 — 0.49432782

Bardl NM_007525 RefSeq 0.49379632

Dok1 NM_010070 RefSeq 0.49348244

1810033B17Rik NM_026985 RefSeq 0.49345679

Cdca3 NM_013538 RefSeq 0.49293876

Rarresl ENSMUST00000054825 ENSEMBL 0.49287578

Rsl1 NM_001013769 RefSeq 0.49265548

Adamts3 NM_001081401 RefSeq 0.49210872

Gm5226 XM_914955 RefSeq 0.49186126

Dcafl 1 NM_133734 RefSeq 0.49170082

2310047B19Rik NM_025870 RefSeq 0.49086005

Bex2 NM_009749 RefSeq 0.49076094

Macrod2 NM_001013802 RefSeq 0.49035075

Gna15 NM_010304 RefSeq 0.49032254

Pstpipl NM_01 1 193 RefSeq 0.49028493

— ENSMUST00000122729 ENSEMBL 0.4898842

Chi3l1 NM_007695 RefSeq 0.48973097

E430024C06Rik AK14941 1 GenBank HTC 0.48863214

E430024C06Rik AK14941 1 GenBank HTC 0.48863214

Myo9a NMJ 73018 RefSeq 0.48861543

Prtn3 NM_01 1 178 RefSeq 0.48830496 Gm447 BC025881 GenBank 0.48830146

1700048O20Rik BC048726 GenBank 0.48810057

IrfB NM_008320 RefSeq 0.48755132

Mtx2 NM_016804 RefSeq 0.48727969

Aoah NM_012054 RefSeq 0.48727857

Rsad2 NM_021384 RefSeq 0.48720663

Fam132a NM_026125 RefSeq 0.4871 1883

P2ry10 NM_172435 RefSeq 0.48601935

— ENSMUST00000083454 ENSEMBL 0.48516252

Epb4.1 l3 NM_013813 RefSeq 0.4847905

— ENSMUST00000082972 ENSEMBL 0.48460818

KIM12 NMJ 53128 RefSeq 0.48371 181

5730471 H19Rik AK133873 GenBank HTC 0.48305387

B9d2 NMJ 72148 RefSeq 0.48057516

Bcdin3d NM_029236 RefSeq 0.47950164

— ENSMUST00000093902 ENSEMBL 0.47894016

— ENSMUST00000083264 ENSEMBL 0.47877631

Ms4a4b NM_021718 RefSeq 0.47836763

Cd2 NM_013486 RefSeq 0.47774047

Snord1 18 X04239 GenBank 0.47710322

Snord1 18 X04239 GenBank 0.47710322

Fam171 b NMJ 75514 RefSeq 0.4770858

Alad NM_008525 RefSeq 0.47657373

Igk // Igk BC128281 GenBank 0.47610367

Zfp420 BC055817 GenBank 0.47582973

Hmgal NM_016660 RefSeq 0.47425745

Pcp4l1 NM_025557 RefSeq 0.47422501

Adamts3 NM_001081401 RefSeq 0.47382142

Ccnbl NM_172301 RefSeq 0.47367332

4932438A13Rik NM_172679 RefSeq 0.47347309

— AF263910 GenBank 0.47331362

— AF263910 GenBank 0.47331362

— ENSMUST00000083155 ENSEMBL 0.47038838

Slco3a1 NM_023908 RefSeq 0.47024668

Aqp9 NM_022026 RefSeq 0.4687041

Hmbs NM_013551 RefSeq 0.46790212

— AK138466 GenBank HTC 0.46302136

Igh // Igh BC092065 GenBank 0.46270053

Hmcnl NM_001024720 RefSeq 0.4620557

Dbf4 NM_013726 RefSeq 0.46060416

Mnd1 NM_029797 RefSeq 0.45913002

— ENSMUST00000082868 ENSEMBL 0.4591035

Wfdc2 NM_026323 RefSeq 0.45893826 Zfp30 NM_013705 RefSeq 0.45844715

Kcnip3 NM_019789 RefSeq 0.4582776

Tacstd2 NM_020047 RefSeq 0.4582741

4930547N16Rik NM_029249 RefSeq 0.4571 1 107

Rassf2 NM_175445 RefSeq 0.45701803

— NC_005089 GenBank 0.4561258

C530030P08Rik ENSMUST00000101381 ENSEMBL 0.45367991

— ENSMUST00000083930 ENSEMBL 0.45361083

Gm6455 NR_003596 RefSeq 0.45308763

Bglapl NM_001037939 RefSeq 0.45246413

Ttc8 NM_19831 1 RefSeq 0.45209964

Gpr128 NM_172825 RefSeq 0.45200261

— ENSMUST00000101881 ENSEMBL 0.45164235

Tm6sf1 NM_145375 RefSeq 0.45099833

— ENSMUST00000082984 ENSEMBL 0.45029343

Ifit1 NM_008331 RefSeq 0.45023174

Cd244 NM_018729 RefSeq 0.44982009

— NM_021319.2 — 0.4494759

H19 NR_001592 RefSeq 0.44927624

Dkkl1 NM_015789 RefSeq 0.44902769

Lcn2 NM_008491 RefSeq 0.44868287

Klf9 NM_010638 RefSeq 0.44808986

— GENSCAN00000047042 ENSEMBL 0.44715275

Enkur NM_027728 RefSeq 0.4471416

— ENSMUST00000083834 ENSEMBL 0.44619389

Ccnel NM_007633 RefSeq 0.4461675

Pkhdl H NM_138674 RefSeq 0.44613946

Hemgn NM_053149 RefSeq 0.44602289

Arsb NM_009712 RefSeq 0.44452609

Got1 NM_010324 RefSeq 0.44441508

Haao NM_025325 RefSeq 0.44375338

Pla2g12a NM_183423 RefSeq 0.44357173

Eef1 e1 NM_025380 RefSeq 0.44323273

— ENSMUST00000082731 ENSEMBL 0.44322771

AdssH NM_007421 RefSeq 0.44204148

Etv3 NM_001083318 RefSeq 0.44086352

— ENSMUST00000082455 ENSEMBL 0.43961982

Kdm5d NM_01 1419 RefSeq 0.4395142

— NM_001080941 .1 — 0.4389826

Sgms2 NM_028943 RefSeq 0.43886679

— ENSMUST00000082985 ENSEMBL 0.43865664

— ENSMUST00000082550 ENSEMBL 0.43812962

— ENSMUST00000082550 ENSEMBL 0.43812962 4932438A13Rik NM_172679 RefSeq 0.43647482

Gm10828 ENSMUST00000100068 ENSEMBL 0.43634989

Epb4.2 NM_013513 RefSeq 0.43562309

Cnn3 NM_028044 RefSeq 0.43543019

Abcd2 NM_01 1994 RefSeq 0.434001 12

Uty NM_009484 RefSeq 0.43378007

Prss35 NM_178738 RefSeq 0.43215607

BC065397 BC065397 GenBank 0.43127909 l830012O16Rik NM_001005858 RefSeq 0.43124063

Cfh NM_009888 RefSeq 0.42993844

Ctsg NM_007800 RefSeq 0.42933737

Acer3 NM_025408 RefSeq 0.4293213

Kmo NM_133809 RefSeq 0.42828142

C530030P08Rik ENSMUST00000101381 ENSEMBL 0.42812461

Myol d NM_177390 RefSeq 0.42713973

Map3k12 NM_009582 RefSeq 0.42669349

Natl NM_008673 RefSeq 0.4233124

Mc2r NM_008560 RefSeq 0.42265146

Tnfrsf26 NM_175649 RefSeq 0.42217733

Cd36 NM_001 159557 RefSeq 0.42215674

Bloc1 s3 NM_177692 RefSeq 0.42134464

Dhrs1 1 NM_177564 RefSeq 0.42063282

Sla2 NM_029983 RefSeq 0.41888854

Fabp7 NM_021272 RefSeq 0.41813895

Snord85 AJ278763 GenBank 0.4175894

Atp1 b1 NM_009721 RefSeq 0.41748135

— GENSCAN00000010976 ENSEMBL 0.41717251

17001 13l22Rik NM_026865 RefSeq 0.41595787

6330403K07Rik NM_134022 RefSeq 0.41484434

— ENSMUST00000122699 ENSEMBL 0.41456618

— ENSMUST00000083970 ENSEMBL 0.4131591

Foxa3 NM_008260 RefSeq 0.41282808

Abca3 NM_013855 RefSeq 0.41 122247

Tfrc NM_01 1638 RefSeq 0.41062983 lgl-V1 M94350 GenBank 0.40999077

Nudt15 NM_172527 RefSeq 0.40929596

111 rl2 NMJ 33193 RefSeq 0.407584

Art2b // Art2b NM_019915 RefSeq 0.40738883

Lclatl NM_001081071 RefSeq 0.4069007

— ENSMUST00000083987 ENSEMBL 0.40669261

Fcnb NM_010190 RefSeq 0.40632565

Hmcnl NM_001024720 RefSeq 0.4049238

— ENSMUST00000101 134 ENSEMBL 0.40361 135 Isg20l2 NM_177663 RefSeq 0.401881 1 1

Snora7a AF357398 GenBank 0.40174139

Hebpl NM_013546 RefSeq 0.40058927

EG665955 FJ556972 GenBank 0.398947

EG665955 FJ556972 GenBank 0.398947

EG665955 FJ556972 GenBank 0.398947

EG665955 FJ556972 GenBank 0.398947

ENSMUSG00000068790 AK049619 GenBank HTC 0.39816123

Alas2 NM_009653 RefSeq 0.39667224

Igf2bp2 NM_183029 RefSeq 0.39437855

Dntt NM_009345 RefSeq 0.39329798

Slc38a5 NM_172479 RefSeq 0.391 19378

— ENSMUST00000107780 ENSEMBL 0.3892868

2310014D1 1 Rik AK009333 GenBank HTC 0.38923877

— AK087207 GenBank HTC 0.38886941

Cpox NM_007757 RefSeq 0.3873031 1

Blvrb NM_144923 RefSeq 0.38379407

— ENSMUST00000083324 ENSEMBL 0.38371374

Hmcnl NM_001024720 RefSeq 0.38155431

Ly6g ENSMUST00000023246 ENSEMBL 0.38148494

Trem3 NM_021407 RefSeq 0.381 15543

— ENSMUST00000102339 ENSEMBL 0.3809539

St8sia4 NM_009183 RefSeq 0.38081 142

Triml O NM_01 1280 RefSeq 0.37975442

Hbb-b1 NM_008220 RefSeq 0.37904

— ENSMUST00000101363 ENSEMBL 0.37729093

111 r1 NM_008362 RefSeq 0.37635403

SigmaM NM_01 1014 RefSeq 0.37604963

— M34598 GenBank 0.37487382

Gm7039 XR_035024 RefSeq 0.37348451

Hbb-b1 ENSMUST00000023934 ENSEMBL 0.37296418

— ENSMUST00000083166 ENSEMBL 0.37230503

Ly6c2 NM_001099217 RefSeq 0.371 1 1237

— ENSMUST00000082735 ENSEMBL 0.36717023

— ENSMUST00000100797 ENSEMBL 0.36649625

Gm51 1 1 NM_183309 RefSeq 0.36432107

Sphkl NM_01 1451 RefSeq 0.36390918

Npm3 NM_008723 RefSeq 0.36297305

F420014N23Rik AK165234 GenBank HTC 0.36041459

Aspn NM_02571 1 RefSeq 0.35872984

Bex6 NM_001033539 RefSeq 0.35810792

Lhcgr NM_013582 RefSeq 0.35672989

Camp NM_009921 RefSeq 0.35088398 Gm1 1428 NM_001081957 RefSeq 0.35020308

BzrpH NM_027292 RefSeq 0.34967082

Camsapl H NM_001081360 RefSeq 0.34891 108

Snora74a NR_002905 RefSeq 0.34554855 miRBase Micro RNA

— mmu-mir-186 0.34288143

Database

Gjb3 NM_008126 RefSeq 0.34168536

C330018D20Rik ENSMUST00000025488 ENSEMBL 0.34147053

LOC100043377 XM_001480493 RefSeq 0.34139504

Ublcpl NM_024475 RefSeq 0.34122628

Flt3 NM_010229 RefSeq 0.33993339

Slc28a2 NM_172980 RefSeq 0.33991447

— ENSMUST00000082606 ENSEMBL 0.33686863

Rgs5 ENSMUST00000027997 ENSEMBL 0.33626309

2610036L1 1 Rik NM_001 109747 RefSeq 0.32966874

Gm14207 ENSMUST00000099535 ENSEMBL 0.32651541

— ENSMUST00000082713 ENSEMBL 0.32615975

Hba-a1 NM_008218 RefSeq 0.32575864

Ms4a3 NM_133246 RefSeq 0.3246331

Snhgl AK051045 GenBank HTC 0.32402559

Hba-a2 NM_001083955 RefSeq 0.32344575

1810034E14Rik ENSMUST00000099440 ENSEMBL 0.32056548

9230105E10Rik NM_001 146007 RefSeq 0.31626636

Ddx3y NM_012008 RefSeq 0.31596281

Snora34 AF357396 GenBank 0.31423614

Ly6c1 NM_010741 RefSeq 0.31294362

Snord49b AF357373 GenBank 0.31224853

Ak3l1 NM_009647 RefSeq 0.31215663 miRBase Micro RNA

— mmu-mir-15a 0.30842131

Database

Pyhinl NM_175026 RefSeq 0.30500229

Mc5r NM_013596 RefSeq 0.30401814

5830405N20Rik NM_183264 RefSeq 0.30400318

Ms4a6c NM_028595 RefSeq 0.29961941

— NM_024475.3 — 0.29915519

Ublcpl NM_024475 RefSeq 0.29674748 l830127L07Rik ENSMUST00000100541 ENSEMBL 0.29654542

Tspan5 NM_019571 RefSeq 0.29578108

Spnal NM_01 1465 RefSeq 0.29577923

Snord58b AF357379 GenBank 0.29543022

Snord58b AF357379 GenBank 0.29191374

Anxa3 NM_013470 RefSeq 0.28838213

5830472F04Rik ENSMUST00000097661 ENSEMBL 0.28522882

Cd48 NM_007649 RefSeq 0.28456727 536 — ENSMUST00000082747 ENSEMBL 0.2840146

537 Den NM_007833 RefSeq 0.28379138

538 Ltb NM_008518 RefSeq 0.28251447

539 Ccl3 NM_01 1337 RefSeq 0.28099863

540 lgh-6 BC053409 GenBank 0.27814286

541 Butr1 NM_138678 RefSeq 0.27689994

542 — ENSMUST00000082580 ENSEMBL 0.27491757

543 Atp1 b2 NM_013415 RefSeq 0.2743449

544 9030619P08Rik NM_001039720 RefSeq 0.26549072

545 — ENSMUST00000082475 ENSEMBL 0.26505163

546 Gm10384 ENSMUST00000100713 ENSEMBL 0.26073292

547 Eif2s3y NM_01201 1 RefSeq 0.25959971

548 Rpl13 BC083148 GenBank 0.25689238

549 Rhd NM_01 1270 RefSeq 0.25650817

550 V165-D-J-C mu ENSMUST00000103526 ENSEMBL 0.25267923

551 Clec12a NM_177686 RefSeq 0.25047016

552 LOC625360 BC147527 GenBank 0.25015185

553 Mt2 NM_008630 RefSeq 0.24444854

554 Ela2 NM_015779 RefSeq 0.24061303

555 Ms4a6b NM_027209 RefSeq 0.2335936

556 Ermap NM_013848 RefSeq 0.22461855

557 Slc4a1 NM_01 1403 RefSeq 0.21352314

558 Gria3 NM_016886 RefSeq 0.2095268

559 Fut1 1 AK034234 GenBank HTC 0.18888639

560 Ctse NM_007799 RefSeq 0.18262831

561 Fam55b NM_030069 RefSeq 0.16886848

562 Kel NM_032540 RefSeq 0.16225266

563 2610301 F02Rik ENSMUST00000049544 ENSEMBL 0.15791495

564 Tmem56 NM_178936 RefSeq 0.15123591

565 Sparc NM_009242 RefSeq 0.14588728

566 Gypa NM_010369 RefSeq 0.13078515 miRBase Micro RNA

567 — mmu-mir-1 -2 0.10017536

Database

568 Cldn13 NM_020504 RefSeq 0.07325046

569 — NM_133245.1 — 0.07123743

570 Rhag NM_01 1269 RefSeq 0.06179809

571 Bglap2 NM_001032298 RefSeq 0.05752344

572 Carl NM_009799 RefSeq 0.049431 12

573 Tspan8 NM_146010 RefSeq 0.04529559

*The apparent "higher" expression of Gfil b mRNA in Gfil b KO mice may be explained as follows. In the Gfil b KO mice, those exons that are not flanked by the flox sites remain in the genome after Cre mediated deletion. Since the promoter is not deleted, a truncated Gfil b mRNA is made, which encodes a nonfunctional Gfil b protein. However, this mRNA is detected by probes on the Affymetrix array used herein that cover sequences of the remaining exons. The level of the truncated Gfil b mRNA is relatively up-regulated since the Gfil b locus is under auto-regulatory control. Hence the knockout, i.e. the lack of Gfi1 protein, leads to a de-repression of the locus and the non-functional RNA is made at a higher level relative to the endogenous mRNA in non deleted cells.

Although the present invention has been described hereinabove by way of specific embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims. In the claims, the word "comprising" is used as an open-ended term, substantially equivalent to the phrase "including, but not limited to". The singular forms "a", "an" and "the" include corresponding plural references unless the context clearly dictates otherwise.