The present invention concerns haplotypes of D7S 6440 microsatellite internal to the HIPK2 gene as markers of autoimmune thyroiditis. Particularly, the present invention concerns haplotypes of D7S 6440 microsatellite internal to the HIPK2 gene as markers of autoimmune thyroiditis, such as Hashimoto thyroditis and Graves' disease, and related method and kit for in vitro diagnosis of autoimmune thyroiditis.

Chronic autoimmune thyroiditis is a specific form of thyroiditis characterized by chronic lymphocytic infiltration. It is often silent but capable of causing structural damage to the thyroid parenchyma, associated with different functional alterations of thyroid responsible for thyroid conditions either hypofunctional or hyperfunctional.

It is the most common thyroid disease at the global level and predominantly affects women. Its iperactivating form, the Graves' disease, is responsible for a marked stimulation of thyrocytes proliferation, a massive stimulation of hormone-secreting thyroid function and is the most common cause of hyperthyroidism. While its destructive form, Hashimoto's thyroditis (HT), is the most common form of autoimmune diseases in endocrine organs and appears associated with a relative risk for thyroid cancer.

HT pathogenesis is linked to an alteration of lymphocytes' homeostasis induced by both genetic and environmental factors (Chistiakov DA. 2005).These, triggering on blood lymphocytes, induce a failure of T-cell tolerance and destroy the thyroid gland either because of producing of antibodies that attack the follicular cells or by a diffuse lymphocytic infiltration of the thyroid tissue (Weetman AP. 2003). Above all, thyroid tissue damage, clinical manifestation and outcome of HT are mainly coupled with apoptosis of thyrocytes and peripherical lymphocytes infiltrates (Kaczmarek E 2010). Correlation among HT and polymorphisms have been reported by evidence of different single nucleotide polymorphisms occurring in exon 4 of P53, nevertheless the genetic pathways of apoptosis P53 mediated remains controversial in HT and to be carefully studied (Chen RH 2008, Ruggeri 2015).

The current diagnosis of chronic autoimmune thyroiditis forms is based on the measurement of serum levels of specific thyroid autoantibodies. This kind of diagnostic method has limitations represented by the fact that not all forms of chronic autoimmune thyroiditis are accompanied by elevated levels of auto-antibodies in the serum and often the diagnosis is carried out only by cytology or histology. Moreover, in many cases, the presence of auto-antibodies is only transient and regresses after a few months. This behavior is often found in forms of subacute thyroiditis, which could be misinterpreted as chronic on the basis of a positivity of auto-antibodies that are transient and having a limited duration.

In light of the above, it is therefore evident the need to have available new methods for the in vitro diagnosis of HT able to overcome the disadvantages of the known diagnostic methods.

It is known that genomic microsatellit.es (MS) are iterations of small repeated sequences including 1-6 bp nucleotides. Repetitive motifs are present in both coding and non-coding regions of the chromosomes. In human, the most common MS are dinucleotide repeat of cytosine and adenine (CA), which are characterized by high levels of polymorphism. The origin of MS appears most likely to be due to slippage events during DNA replication although this is still under debate. Mostly, alterations of MS may be summarized in destruction of haplotype, loss of heterozygosity (LOH) and microsatellite instability. Destruction of haplotypes occurs through recombinations of alleles at microsatellite loci. These recombinations are more frequently than LOH and causes fluctuations of genetic variants in a population by a process namely genetic drift. Further, the lifespan of a multilocus haplotype is limited in respect with underlying alleles (Koopman WJ 2007).

Specially, when a specific cellular population shows for the same microsatellite simultaneously either haplotypes equally shared by each subject or haplotypes occurring in a subgroup, only, it should be considered as recent gene flow of differentiation.

D7S6440 microsatellite showing a CA tandem repeat has been recently mapped (Gene Bank reference sequence as Accession Number # AY563634). These short motifs are placed at locus 32-34 of long arm of chromosome 7, and then located inside intron 9 of human Homeodomain- interacting protein kinase 2 (HIPK2) gene (Cecchinelli et al). The repetitive frequency of D7S6440 microsatellite is 13, i.e. the CA tandem is repeated thirteen times. The locus of repetition is detectable between 173 ⁰ and 98 ° nucleotides of intron 9.

HIPK2 is a Ser/Thr kinase binding P53 through phosphorylation of Ser46 and this bound is involved in induction of p53-mediated apoptosis response (Cecchinelli 2006). Mainly, LOH of D7S6440 microsatellite has been individualized in thyroid tissues showing either benign or malignant lesions such as follicular adenomas and carcinomas (Lavra 2011).

According to the present invention, D7S 6440 microsatellite has been studied by haplotype analysis carried out on genomic DNA of circulating lymphocytes taken from HT patients. This assay results more efficient than LOH test because it makes use of the estimation of gene flow, F(ST) based on unlinked loci indicated small (0.032-0.058) but statistically significant differentiation between some populations only. The analysis of haplotypes has been applied to isolate genetic characters of a specific cellular population such as lymphocytes. Hence, aims of the study was to explore frequencies and distributions of D7S6440 microsatellite haplotypes to study the movement of this genetic sequence from healthy subjects into HT patients.

More in detail, 109 genomic DNA samples have been analyzed taken from whole blood of 79 HT patients and 30 healthy controls subjects. Microsatellite characterization was performed by simple sequence length polymorphism (SSLP) analysis. Haplotype frequencies and distributions have been analyzed in the two study groups.

Five haplotypes occurring for D7S 6440 have been isolated. Two of them are shared from both healthy subjects and HT patients. These haplotypes have been named 014 and 014/15. The first one consists in a repeated sequence corresponding to a size of 14 CA di-nucleotide microsatellite. 015 corresponds to a size in which "CA" repeats is 15. 014 is the most frequently detected in both healthy controls (100%), in its homozygous form (73%) or in its heterozygous form, combined with the 015 (27%). It is also frequently observed in Hashimoto's Thyroiditis patients (28%), mostly in its heterozygous form, combined with 015 (20%). In normal subjects, 015 is detected less frequently than the previous one, and it is only found in combination with 014, in its heterozygous from 014/15 in 36% of cases. In patients with Hashimoto's Thyroiditis 015 is present in its heterozygous form in 22%.

All together, these data indicate these combinations as specific for lymphocytic population and independent from health status or HT disease because both are conserved in both groups. Therefore, these two combinations make up wild haplotypes of D7S 6440 in lymphocytes. Further, the genetic loci involved in these combinations may be considered as major ancient of this microsatellite in lymphocytic population.

Three combinations of haplotypes were specifically associated with HT subjects. In particular, D7S 6440 haplotypes such as 015, in its homozygous form, 015/16 and 014/16 haplotypes correspond with domestic haplotypes of HT disease (015 in its homozygous form was specifically found in 6% of patients with HT. No control healthy subject showed this microsatellite in its homozygous form. 015 was specifically associated with microsatellite 016 in 1 % of patients with HT. Heterozugous combination of microsatellite 014 and 016 was detected in 3% of patients with HT).

These three combinations may be considered as novel because exclusively involved in pathological status. Therefore, these three haplotypes are signature of HT lymphocytes and may have practically useful as tool to isolate HT subjects in cases of absence of serum immunoglobulins. Finally, different lengths of haplotypes occurring in HT in respect with healthy subjects have been reported. This is because in the latter the maximum peak of haplotypes never overcome 216.07 values, at opposite in HT patients the minimum peak was crossed 216.13 value. Therefore, in HT disease the combinations of haplotypes involve loci with different lengths in respect with health status. These genetic lengths are hot for emergence of HT. These data let us suppose the genetic information of these loci is HT dependent. This supposition is inferred from the major frequency of recombinations occurring among 215.72 and 216.07 values of genetic length. In so far, this length has been identified as a genomic hot region of D7S 6440 microsatellite for haplotypes recombinations events.

In conclusion, five D7S6440 haplotypes have been detected, namely 014, Ο15, 014/15, 015/16, 014/16. The two microsatellite haplotypes 014 and 014/15 were found in both HT and control samples, while the three haplotypes 015, 015/16, and 014/16 were specifically detected only in HT samples. Therefore, specific intragenic microsatellite haplotypes 015, 015/16, 014/16 represent a useful marker to identify HT, especially in the absence of clinical evidence, and to perform genetic screening in molecular HT epidemiology.

The haplotypes can be used for the realization of molecular tests for identifying the Hashimoto's thyroiditis.

This type of molecular test can be used both in clinical diagnostic practice and in the population screening. Compared to the commercial test commonly used in clinical diagnostics, namely, the dosage of anti thyroid peroxidase (anti-TPO Ab) and anti-thyroglobulin (anti-Tg Ab) (50-60%) antibodies titers, the diagnostic method according to the present invention is able to identify the forms of thyroiditis that do not clinically express antibodies.

A population-based screening by the method of the present invention presents accuracy character since it includes also the silent forms of Hashimoto's thyroiditis, or those that do not express serum antibodies. Therefore, it is an object of the present invention haplotypes of D7S 6440 microsatellite of the HIPK2 gene, said haplotypes being chosen from the group consisting of D7S 6440 haplotype sequence corresponding to a length of 14, 15 or 16 CA dinucleotide. Said length values are measured by sequence length polymorphism technique.

The present invention concerns also the use of the haplotypes as defined above, as markers of autoimmune thyroiditis, such as Hashimoto thyroiditis, Graves' disease.

According to the present invention, the markers of autoimmune thyroiditis can be the following haplotypes or combination thereof: D7S 6440 haplotype sequence corresponding to a length of 15 CA dinucleotide, or a combination of the D7S 6440 haplotype sequences corresponding to a length of 14 and 16 CA dinucleotide or 15 and 16 CA dinucleotide.

Further object of the present invention is a method for in vitro diagnosis of autoimmune thyroiditis, such as Hashimoto thyroiditis, Graves' disease, said method comprising detecting the haplotypes as defined above by simple sequence length polymorphism technique.

According to the method of the present invention, D7S 6440 haplotype sequence corresponding to a length of 15 CA dinucleotide, or a combination of the D7S 6440 haplotype sequences corresponding to a length 14 and 16 CA dinucleotide or 15 and 16 CA dinucleotide are detected in autoimmune thyroiditis, such as Hashimoto thyroiditis, Graves' disease.

According to an embodiment of the present invention, the method can comprise or consist of:

a) isolating DNA from limphocytes of a biological sample;

b) amplifying D7S 6440 microsatellite sequence of the HIPK2 gene of the isolated DNA by the use of the following primers: Forward AGTGACTATGCTTTAAGTGTCC (SEQ ID NO: 1)

Reverse TGGACACTTAAAGCATAGTCAC (SEQ ID NO:2); c) detecting haplotypes as defined above by simple sequence length polymorphism technique. As mentioned above, D7S 6440 haplotype sequence corresponding to a length of 15 CA dinucleotide, or a combination of the D7S 6440 haplotype sequences corresponding to a length 14 and 16 CA dinucleotide or 15 and 16 CA dinucleotide are detected in autoimmune thyroiditis, such as Hashimoto thyroiditis, Graves' disease.

In addition, the present invention concerns a kit for in vitro diagnosis of autoimmune thyroiditis, such as Hashimoto thyroiditis, Graves' disease, said kit comprising the following primers:

Forward AGTGACTATGCTTTAAGTGTCC (SEQ ID NO: 1 ) Reverse TGGACACTTAAAGCATAGTCAC (SEQ ID NO:2).

The kit can further comprising reactant agents suitable for detection.

EXAMPLE 1 : Detection of haplotypes of D7S6440 microsatellite internal to the HIPK2 gene and study of haplotype frequencies and distributions in HT patients and in healthy controls subjects

MATERIAL AND METHODS

Patients and control subjects

For this study have been recruited 109 unrelated subjects of which 79 were affected by HT autoimmune disease. These patients included 11 men and 68 women (mean age ± SD: 45 ± 15) HT was diagnosed at Unit of Endocrinologist of Messina University by clinical, laboratory and ultrasound (US) criteria. Each subject received a careful medical evaluation, including recording of past medical history, and physical examination. Subjects with a history of cancer or other autoimmune diseases were excluded. Whereas, as healthy controls have been enrolled 30 subjects matching for age and sex with TH patients (5 men and 25 women, mean age ± SD: 40 ± 17).

Peripheral blood samples were collected after overnight fasting from both patients and controls and stored at -20°. Informed consent was obtained, and the study was approved by the local Ethics Committee.

DNA extraction and PCR analysis and sequencing

Genomic DNA was isolated from fresh whole blood with a Eurogold Blood DNA Mini Kit (Euroclone, Italy), according to the manufacturer's instructions. Quantification of extracted DNA was performed using Qubit 2.0 Fluorometer (Life Technologies, Italy).

Genomic DNA (100 ng) was sent to Eurofins MWG Operon using genome sequencing service that has performed PCR amplification and resolution of D7S 6440 sequence by microcapillary analysis.

Microsatellite characterization was performed by simple sequence length polymorphism (SSLP) analysis. Haplotype frequencies and distributions have been analyzed in the two study groups.

To design primers was used GenBank reference sequence as Accession Number # AY563634. All oligonucleotide primers used in this study were synthesized and purchased from MWG. Primers for D7S 6440 PCR were the following: Forward AGTGACTATGCTTTAAGTGTCC (SEQ ID NO: 1) ; Reverse TGGACACTTAAAGCATAGTCAC (SEQ ID NO:2).

Quality assurances came from high throughput for PCR, purification and sequencing performed from Eurofins MWG Operon as appearing at www.eurofinsgenomics.com. Briefly, PCR products were purified, their quality was checked via agarose gel and finally, all PCR products were sequenced in double strand quality. So that, if a reaction was failing there was one repetition of the sequencing reaction. Instead, when both reactions were failing, the PCR amplification was repeated for the sample. This process was ensuring the highest data accuracy of 99.999%.

Statistical analysis

The haplotypes frequencies and distributions occurring either in HT patients or healthy controls were separately recorded and statistically compared. For this purpose, we used the chi-square test. P< 0.05 indicated a statistically significant difference.

RESULTS

Five different haplotypes have been individualized in D7S6440 microsatellite, namely, Ο14, Ο15, 014/15, 015/16, and 014/16, respectively (Table 1). Table 1. Haplotypes of D7S 6440 in healthy subjects and HT patients.

They showed a different pattern of distribution in healthy subjects in respect with HT patients.

Exclusively two haplotypes such as 014 and 014/ 5 were detected in healthy subjects. Therefore, the genetic pattern of distribution of D7S 6440 haplotypes was characterized through exclusive recombinations of two loci such as 014 and 015; whereas the lengths of two haplotypes displayed a range of variation included among 215.72 and 216.07 values. Further, 014 haplotype occurred more frequently than 014/15. This is because the former was observed in 73% of healthy population while the latter was seen in 27% (χ ² 40.500, P < 0.05). Lastly, 015, 015/16, and 014/16 haplotypes were inconsistent under healthy controls.

Conversely, the full set of D7S 6440 haplotypes (Table 1) appeared in HT population. The genetic pattern of haplotypes distribution was concerning the recombinations of three loci such as 014, 15 and 16, respectively, hence as a result the range of lengths varied among 216.13 and 220.21 values. Above all, 015, 015/16 and 014/16 haplotypes were specific of HT because comes up in HT subjects, only. In line with healthy controls, 014 haplotypes occurred in a major percentage of HT subjects in respect with 014/15 (70% vs 20%; χ ² 48.505, P < 0.05). However, in HT population, both 014 and 014/15 haplotypes were observed in twice of many cases in respect with control. REFERENCES

Chistiakov DA. Immunogenetics of Hashimoto's thyroiditis. J

Autoimmune Dis. 2005; 2:1.

Weetman AP. Autoimmune thyroid disease: propagation and progression. Eur J Endocrinol. 2003 Jan; 148(1 ): 1 -9

Koopman WJ, Li Y, Coart E, van de Weg WE, Vosman B, Roldan-

Ruiz I, Smulders MJ. Linked vs unlinked markers: multilocus microsatellite haplotype-sharing as a tool to estimate gene flow and introgression. Mol Ecol. 2007 Jan; 16(2):243-56.

Cecchinelli.B., Ulivieri.A., Rinaldo.C, Lavra,L., Gasparri,A-, lacovelli.S. , Trovato, M., Bartolazzi.A., Soddu, S. and

Sciacchitano, S. HIPK2 deficiency impairs p53 tumor suppressing activity.

Unpublished. ^β Genetic sequence of a microsatellite showing 360 bp namely "D7S 6440" at GenBank. Homo sapiens, on 7q 32-34, inside

HIPK2 gene, intron 9; tandem "ca" 173..198 bp. ACCESSION LOCUS in

GenBank for NCBI Sequence Viewer: AY5 63 634; taxon:9606.

Lavra L, Rinaldo C, Ulivieri A, Luciani E, Fidanza P, Giacomelli L,

Bellotti C, Ricci A, Trovato M, Soddu S, Bartolazzi A, Sciacchitano S. The loss of the p53 activator HIPK2 is responsible for gaIectin-3 overexpression in well differentiated thyroid carcinomas. PLoS One.

201 1 ;6(6):e20665. doi: 10.1371/journal.pone.0020665. Epub 201 1 Jun 17.

Chen RH, Chang CT, Wang TY, Huang WL, Tsai CH, Tsai FJ. p53

Codon 72 Proline/Arginine Polymorphism and Autoimmune Thyroid Diseases. J Clin Lab Anal. 2008;22(5):321 -6.

Kaczmarek E, Lacka K, Jarmolowska-Jurczyszyn D, Sidor A,

Majewski P. Changes of B and T lymphocytes and selected apopotosis markers in Hashimoto's thyroiditis. J Clin Pathol. 201 1 Jul;64(7):626-30. doi: 10.1 36/jcp.2010.086553. Epub 201 1 Jan 17.

Schnitzler A, Arnold C, Cornille A, Bachmann O, Schnitzler C. Wild

European apple (Malus sylvestris (L.) Mill.) population dynamics: insight from genetics and ecology in the Rhine Valley. Priorities for a future conservation programme. PLoS One. 2014 May 14;9(5):e96596. doi: 10.1371/journal.pone.0096596. eCollection 2014.

R. M. Ruggeri, T. M. Vicchio, S. Giovinazzo, R. Certo, A. Alibrandi, F. Trimarchi, S. Benvenga, M. Trovato. TP53 polymorphism may contribute to genetic susceptibility to develop Hashimoto's thyroiditis. J Endocrinol Invest DOI 10.1007/s40618-0 5-0292-9.