HDAC3-Selective Inhibitors CROSS-REFERENCE TO RELATED APPLICATION

This application claims the benefit of U.S. Provisional Application 62/514,528, filed on June 2, 2017, the contents of which are hereby incorporated in its entirety. FIELD OF THE INVENTION

This invention is directed to chemical compounds that selectively inhibit histone deacetylase (“HDAC”) enzymes; in certain embodiments, the compounds are selective HDAC3 inhibitors. BACKGROUND

Eleven different Zn2+-dependent histone deacetylase enzymes have been identified in humans, and are designated HDAC1 through HDAC11, etc. HDAC enzymes are involved in the regulation of a number of cellular processes. Histone acetyltransferases (HATs) and HDACs acetylate and deacetylate lysine residues on the N-termini of histone proteins thereby affecting transcriptional activity. They have also been shown to regulate post-translational acetylation of at least 50 non-KLVWRQH^SURWHLQV^VXFK^DV^Į-tubulin. Inhibiting the HDAC deacetylase activity can alter gene expression through chromatin modification. Cellular transcriptional regulation is also thought to involve acetylation and deacetylation of transcriptional factors. Since these are important steps in regulating cellular survival, proliferation and differentiation, HDAC inhibitors have explored as cancer chemotherapeutics.

This evidence supports the use of HDAC inhibitors in treating various types of cancers. For example, vorinostat (suberoylanilide hydroxamic acid (SAHA)) has been approved by the FDA to treat cutaneous T-cell lymphoma and is being investigated for the treatment of solid and hematological tumors. Further, other HDAC inhibitors are in development for the treatment of acute myelogenous leukemia, Hodgkin's disease, myelodysplastic syndromes and solid tumor cancers.

HDAC inhibitors have also been shown to inhibit pro-inflammatory cytokines, such as those involved in autoimmune and inflammatory disorders (e.g. TNF-Į^^^)RU^H[DPSOH^^WKH^ HDAC inhibitor MS275 was shown to slow disease progression and joint destruction in collagen-induced arthritis in rat and mouse models. Other HDAC inhibitors have been shown to have efficacy in treating or ameliorating inflammatory disorders or conditions in in vivo models or tests for disorders such as Crohn's disease, colitis, and airway inflammation and hyper- responsiveness. HDAC inhibitors have also been shown to ameliorate spinal cord inflammation, demyelination, and neuronal and axonal loss in experimental autoimmune encephalomyelitis.

Triplet repeat expansion in genomic DNA is associated with many neurological conditions (e.g., neurodegenerative and neuromuscular diseases) including myotonic dystrophy, spinal muscular atrophy, fragile X syndrome, Huntington's disease, spinocerebellar ataxias, amyotrophic lateral sclerosis, Kennedy's disease, spinal and bulbar muscular atrophy,

Friedreich's ataxia and Alzheimer's disease. Triplet repeat expansion may cause disease by altering gene expression. For example, in Huntington's disease, spinocerebellar ataxias, fragile X syndrome, and myotonic dystrophy, expanded repeats lead to gene silencing. In Friedreich's ataxia, the DNA abnormality found in 98% of FRDA patients is an unstable hyper-expansion of a GAA triplet repeat in the first intron of the frataxin gene, which leads to frataxin insufficiency resulting in a progressive spinocerebellar neurodegeneration. Since they can affect transcription and potentially correct transcriptional dysregulation, HDAC inhibitors have been tested and have been shown to positively affect neurodegenerative diseases.

HDAC inhibitors may also play a role in cognition-related conditions and diseases. It has indeed become increasingly evident that transcription is likely a key element for long-term memory processes thus highlighting another role for CNS-penetrant HDAC inhibitors. Although studies have shown that treatment with non-specific HDAC inhibitors such as sodium butyrate can lead to long-term memory formation, little is known about the role of specific isoforms. A limited number of studies have shown that, within class I HDACs, main target of sodium butyrate, the prototypical inhibitor used in cognition studies, HDAC2 and HDAC3 have been shown to regulate memory processes and as such are interesting targets for memory

enhancement or extinction in memory-affecting conditions such as, but not limited to,

Alzheimer's disease, post-traumatic stress disorder or drug addiction.

HDAC inhibitors may also be useful to treat infectious disease such as viral infections. For example, treatment of HIV infected cells with HDAC inhibitors and anti-retroviral drugs can eradicate virus from treated cells.

The concept of cancer stem cells (CSCs) or tumor-initiating cells has provided a new paradigm for the functional heterogeneity of cancer cells. Because of their tumorigenic properties and capacity for self-renewal and differentiation, this small subpopulation of cancer cells drives initiation, progression, and metastasis in many types of tumors. Moreover, recent evidence suggests that epithelial-to-mesenchymal transition acts as a critical regulator of the drug-resistant phenotype of CSCs. Consequently, CSCs are more resistant to chemotherapeutic agents than the bulk population of non-CSCs within a tumor, allowing the surviving CSCs to repopulate the tumor and leading to tumor relapse. From a therapeutic perspective, there is an urgent unmet need for CSC-targeting therapeutic agents to achieve optimal patient outcomes. To date, a series of therapeutic agents targeting key signaling pathways, especially those mediated by Notch1, Hedgehog, and Wnt, have proved to be efficacious in eradicating CSCs in preclinical settings. In addition, there is accumulating evidence of the in vitro and/or in vivo efficacy of pan- and class I HDAC inhibitors, such as suppressing the CSC subpopulation in different cancer cell lines. However, two issues remain unclear with respect to the anti-CSC activity of HDAC inhibitors. First, as there are 11 Zn ²⁺ -dependent isoforms in the HDAC family, it is unclear which of these isoforms contribute to the regulation of CSCs. Second, the mechanism by which pan- or class I HDAC inhibitors suppress the CSC subpopulation has not been clearly defined.

Hepatic steatosis, also sometimes referred to as fatty liver disease, is a condition generally characterized by an abnormal retention of lipids in cells of the liver. Hepatic steatosis affects millions of people worldwide. For example, the prevalence of fatty liver disease has been estimated to range from 10-24% in various countries around the globe. Fatty liver disease can have various causes, and may generally be divided between alcoholic steatosis and non- alcoholic steatosis.

Alcoholic steatosis is the first step in the progression of alcoholic liver disease, followed by alcoholic hepatitis and alcoholic cirrhosis. At least 80% of heavy drinkers develop steatosis, 10-35% develop alcoholic hepatitis and approximately 10% develop cirrhosis. Alcoholic hepatic steatosis, also called alcoholic fatty liver, is characterized by a large proportion of the cytoplasm of affected hepatocytes by a single large triglyceride occlusion. This state is reversible if abstinence but may progress in cirrhosis if excess alcohol intake persist.

Alcoholic hepatic steatosis, also called alcoholic fatty liver, consists in the occupation of a large proportion of the cytoplasm of affected hepatocytes by a single large triglyceride occlusion. This state is reversible if abstinence but may progress in cirrhosis if excess alcohol intake persist. Non-alcoholic fatty liver disease (NAFLD) generally refers to a spectrum of hepatic lipid disorders characterized by hepatic steatosis with no known secondary cause.

NAFLD can be subcategorized into (a) non-alcoholic fatty liver (NAFL), defined as the presence of steatosis in the absence of histological evidence of hepatocellular injury, and (b) non-alcoholic steatohepatitis (NASH), hepatic steatosis accompanied by hepatocyte injury and inflammation; NASH may occur with or without fibrosis, but may progress to fibrosis and cirrhosis. NAFLD is generally associated with energy metabolism pathologies, including obesity, dyslipidemia, diabetes and metabolic syndrome. The prevalence of NAFLD is high. Prevalence in the general population is estimated at 20%, with prevalence of NASH estimated to be 3-5%. There is an estimated ˜70% prevalence of NAFLD among patients with obesity or diabetes, and an estimated prevalence of ˜50% prevalence of NAFLD among patients with dyslipidemias. However, there are presently no approved pharmaceuticals for the treatment of NAFLD/NASH.

Cachexia is a condition characterized by weight loss, muscle atrophy, anorexia, fatigue, and weakness. It is commonly seen in patients with chronic progressive diseases such as AIDS, hormone deficiency, chronic obstructive lung disease (COPD), congestive heart failure (CHF), tuberculosis (TB), and cancer. In cachexia, a decline in food intake relative to energy expenditure leads to weight loss. Even with adequate nutritional support, abnormalities in the metabolism of carbohydrates, proteins, and fats causes continued mobilization and ineffective repletion of host tissue. The physiological mechanisms that cause cachexia remain poorly understood, although cachectin/TNF or other inflammatory cytokines have been implicated.

There remains a need for selective HDAC inhibitors, including selective HDAC3 inhibitors, with improved potency, improved selectivity, reduced side effects, improved pharmacokinetic properties. There remains a need for improved therapeutics for the treatment of cancers, including breast cancer, cachexia, and liver steatosis, both of the alcoholic and non- alcoholic type.

SUMMARY

Disclosed herein are com ounds of Formula I :

and pharmaceutically acceptable salts thereof, wherein

R ^1a and R ^1b are independently selected from hydrogen, C _1-8 saturated alkyl, C _3-8 cycloalkyl, C _2-8 alkenyl, and C _2-8 alkynyl;

R ^2a is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ; R ^2b is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^2c is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^2d is each independently selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; - C(O)R ^c , OC(O)R ^c , -COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), - N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, -NO ₂ ;

R ³ is R ^c ;

X ¹ is selected from CR ^4b and N;

X ² is selected from CR ^4a and N;

when present, R ^4a is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; - C(O)R ^c , OC(O)R ^c , -COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), - N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, -NO ₂ ;

when present, R ^4b is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; - C(O)R ^c , OC(O)R ^c , -COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), - N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, -NO ₂ ;

R ^4c is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^4d is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - ^{COORc, -C(O)N(Rc)} ₂ ^{, -OC(O)N(Rc)} ₂ ^{, -N(Rc)C(O), -N(Rc)C(O)N(Rc)} ₂ ^{, -F, -Cl, -Br, -I, -} CN, -NO ₂ ;

R ⁵ is R ^c ;

Z has the formula:

wherein Y ¹ and Y ² are independently selected from O, S, NR ^c , or a chemical bond; n is an integer selected from 0-3;

R ⁶ is in each case independently selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , - SO ^c

2N(R ^c ) ₂ ; -C(O)R , OC(O)R ^c , -COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), - N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, -NO ₂ ; wherein any two or more R ⁶ groups may together form a ring, any adjacent R ⁶ groups may together form a double bond or triple bond, and any two germinal R ⁶ groups may together form an olefin, carbonyl, or imine; and

R ^7a is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^7b is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^7c is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^7d is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^7e is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

wherein R ^c is in each case independently selected from hydrogen, C _1-8 alkyl, C _3-8 cycloalkyl, C _2-8 heterocyclyl, C _6-12 aryl, C _1-12 heteroaryl, C _1-8 alkyl-C _3-8 cycloalkyl, C _1-8 alkyl-C _2-8 heterocyclyl, C _1-8 alkyl-C _6-12 aryl, and C _1-8 alkyl-C _3-12 heteroaryl;

wherein any two or more R ^1a , R ^1b , R ^2a , R ^2b , R ^2c , R ^2d , R ³ may together form a ring;

w ^{herein any two or more R3, R4a and R4c may together form a ring;}

wherein any two or more R ⁵ , R ^4b and R ^4d may together form a ring;

wherein any two or more of R ⁵ and R ⁶ may together form a ring; and

wherein any two or more of R ⁶ and R ^7a , R ^7b , R ^7c , R ^7d , and R ^7e may together form a ring. The compounds disclosed herein are useful for the treatment of a variety of HDAC- implicated diseases and conditions. In particular, the compounds are useful for the treatment of cancers, for instance breast cancer, for the treatment of cachexia, and for the treatment of liver steatosis, including alcoholic steatosis and non-alcoholic steatosis.

The details of one or more embodiments are set forth in the descriptions below. Other features, objects, and advantages will be apparent from the description and from the claims. BRIEF DESCRIPTION OF THE FIGURES Figure 1A depicts Western blot analysis of the effect of the stable depletion of HDAC3 by two different shRNAs (#4994 and #6267) versus control shRNA treatment (Ctl) on the expression and/or phosphorylation levels of HDAC3, Akt, GSK3E, and E-catenin and its target gene products c-Myc and BMI-1 in MDA-MB-231 and SUM-159 cells.

Figure 1B depicts a functional analyses of the effect of the stable depletion of HDAC3 by two different shRNAs versus control on cell proliferation (left; N = 6), colony formation (center; N = 6), and mammosphere formation (right; N = 6) in MDA-MB-231 cells.

Figure 1C depicts a functional analyses of the effect of the stable depletion of HDAC3 by two different shRNAs versus control on cell proliferation (left; N = 6), colony formation (center; N = 6), and mammosphere formation (right; N = 6) in SUM-159 cells.

Figure 1D depicts the effect of the ectopic expression of HDAC3 on the expression and/or phosphorylation levels of HDAC3, Akt, GSK3beta, beta-catenin c-Myc and BMI-1 in MDA-MB-231cells.

Figure 1E depicts the effect of stable HDAC3 knockdown (HDAC3 ^KD ) versus control shRNA on (left) tumor-initiating ability by monitoring tumor incidence, and (right) xenograft tumor growth, measured at Day 27 after implantation, of MDA-MB-231 cells. Data are expressed as means ± S.D. (N = 9).

Figure 2A depicts Western blot analyses of the effects of representative derivatives at indicated concentrations on histone H3 pan and H3K9 acetylation, tubulin acetylation, and Notch 1 expression in MDA-MB-231 cells after 48 h of treatment, in which 1 (0.25 μM) was used as a positive control in each blot.

Figure 2B depicts Western blot analyses of the effects of representative derivatives at indicated concentrations on histone H3 pan and H3K9 acetylation, tubulin acetylation, and Notch 1 expression in MDA-MB-231 cells after 48 h of treatment, for compounds 1, 2, 4, X, 5, and 18.

Figure 2C depicts Western blot analyses of the effects of representative derivatives at indicated concentrations on histone H3 pan and H3K9 acetylation, tubulin acetylation, and Notch 1 expression in MDA-MB-231 cells after 48 h of treatment, for compounds 1, 2, 4, 3, 5, and 6.

Figure 2D depicts Western blot analyses of the effects of representative derivatives at indicated concentrations on histone H3 pan and H3K9 acetylation, tubulin acetylation, and Notch 1 expression in MDA-MB-231 cells after 48 h of treatment, for compounds 1, 5, and 17. Figure 2E depicts Western blot analyses of the effects of representative derivatives at indicated concentrations on histone H3 pan and H3K9 acetylation, tubulin acetylation, and Notch 1 expression in MDA-MB-231 cells after 48 h of treatment, for compounds 1, 9, 6, and X.

Figure 2F depicts Western blot analyses of the effects of representative derivatives at indicated concentrations on histone H3 pan and H3K9 acetylation, tubulin acetylation, and Notch 1 expression in MDA-MB-231 cells after 48 h of treatment, for compounds 1, X, 10, and 16.

Figure 2G depicts Western blot analyses of the effects of representative derivatives at indicated concentrations on histone H3 pan and H3K9 acetylation, tubulin acetylation, and Notch 1 expression in MDA-MB-231 cells after 48 h of treatment, for compounds 1, 11, 14 and X.

Figure 2H depicts Western blot analyses of the effects of representative derivatives at indicated concentrations on histone H3 pan and H3K9 acetylation, tubulin acetylation, and Notch 1 expression in MDA-MB-231 cells after 48 h of treatment, for compounds 1, X, 15, and 13.

Figure 2I depicts Western blot analyses of the effects of representative derivatives at indicated concentrations on histone H3 pan and H3K9 acetylation, tubulin acetylation, and Notch 1 expression in MDA-MB-231 cells after 48 h of treatment, for compounds 1, X, 18, 24, 20, 27, and 28.

Figure 2J depicts Western blot analyses of the effects of representative derivatives at indicated concentrations on histone H3 pan and H3K9 acetylation, tubulin acetylation, and Notch 1 expression in MDA-MB-231 cells after 48 h of treatment, for compounds 1, X, 15, and 13.

Figure 2K depicts Western blot analyses of the effects of representative derivatives at indicated concentrations on histone H3 pan and H3K9 acetylation, tubulin acetylation, and Notch 1 expression in MDA-MB-231 cells after 48 h of treatment, for compounds 1, 5, 20, 17, 29, and 19.

Figure 2L depicts Western blot analyses of the effects of representative derivatives at indicated concentrations on histone H3 pan and H3K9 acetylation, tubulin acetylation, and Notch 1 expression in MDA-MB-231 cells after 48 h of treatment, for compounds 1 and 29.

Figure 3A depicts concentration- and time-dependent suppressive effects of 18 and 28 on cell viability by MTT assays. Value, means + S.D. (N = 6).

Figure 3B depicts concentration-dependent suppressive effects of 18 and 28 on (upper) colony formation and (lower) mammosphere formation. Value, means + S.D. (N = 6). Figure 3C (upper) depicts Western blot analysis of concentration-dependent suppressive effects of 18 and 28 on Akt phosphorylation, E-catenin expression, and histone H3 pan and H3K9 acetylation. Figure 3C (lower) depicts RT-PCR analysis of concentration-dependent effects of 28 on E-catenin mRNA expression.

Figure 3D depicts flow cytometric analysis of concentration-dependent suppressive effects of 28 on the CD44 ⁺ /CD24 ^low subpopulation.

Figure 3E depicts the effect of daily 28 at 100 mg/kg via oral gavage (N = 10) versus vehicle control (N = 9) on (left) tumor-initiating ability by monitoring tumor incidence, and (right) xenograft tumor growth, measured at Day 27 after implantation of MDA-MB-231 cells. Data are expressed as means ± S.D.

Figure 4 depicts the chemical structure of certain compounds of the instant invention, and there inhibitory effect of HDAC1, HDAC2, and HDAC3.

Figure 5A depicts an experimental design for the evaluation of HDAC inhibitors to prevent alcoholic steanosis: Nine C57BL/6JNarl male mice were divided into three groups that received the following treatments

Group 1: vehicle (0.5% methylcellulose (w/v) and 0.1% Tween-80 (v/v) in sterile water), followed by saline (450 microL) 10 min after the vehicle treatment. Mice received two additional repeated treatment at 12 h and 24 h, and sacrificed at 28 h, and livers were collected

Group 2: Vehicle, followed by 75% alcohol (450 microL) 10 min after the vehicle treatment. Mice received two additional repeated treatment at 12 h and 24 h, and sacrificed at 28 h, and livers were collected

Group 3: H3-14 (100 mg/kg, p.o), followed by 75% alcohol (450microL) 10 min after the H3-14 treatment

Figure 5B depicts appearance of livers treated with vehicle and saline, vehicle and alcohol, and H3-14 and alcohol.

Figures 5C and 5D depict hematoxylin and eosin stains of livers treated with vehicle and saline, vehicle and alcohol, and H3-14 and alcohol.

Figure 6 depicts an evaluation of the effect of HDAC inhibitors on cancer induced muscle wasting in C-26 tumor bearing mice (N = 8 for each group).

Figure 7 depicts an evaluation of the effect of HDAC inhibitors on tumor size in C-26 tumor bearing mice (N = 8 for each group).

Figure 8 depicts an evaluation of the effect of HDAC inhibitors on skeletal muscle and adipose tissue in C-26 tumor bearing mice (N = 8 for each group). Figure 9 depicts an evaluation of the effect of HDAC inhibitors muscle strength

(measured by grip test) in C-26 tumor bearing mice (N = 8 for each group).

Figures 10 and 11 depict Western blot analysis of cachexia-associated biomarkers in the skeletal muscles in C-26 tumor bearing mice treated with HDAC inhibitors.

Figure 12 depicts qPCR analysis of cachexia-associated biomarkers at the mRNA level (IL-6 related markers) in the skeletal muscles in C-26 tumor bearing mice treated with HDAC inhibitors.

Figure 13 depicts qPCR analysis of cachexia-associated biomarkers at the mRNA level (E3 ligase markers) in the skeletal muscles in C-26 tumor bearing mice treated with HDAC inhibitors.

Figures 14, 15, 16, 17 and 18 depict evaluations of the effect of HDAC inhibitors, compared with a positive control (AR-42; (S)-(+)-N-hydroxy-4-(3-methyl-2-phenyl- butyrylamino) benzamide), on cancer induced muscle wasting in C-26 tumor bearing mice. DETAILED DESCRIPTION

Before the present methods and systems are disclosed and described, it is to be understood that the methods and systems are not limited to specific synthetic methods, specific components, or to particular compositions. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

As used in the specification and the appended claims, the singular forms“a,”“an” and “the” include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from“about” one particular value, and/or to“about” another particular value. When such a range is expressed, another embodiment includesfrom the one particular value and/or to the other particular value. Similarly, when values are expressed as

approximations, by use of the antecedent“about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. “Optional” or“optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

Throughout the description and claims of this specification, the word“comprise” and variations of the word, such as“comprising” and“comprises,” means“including but not limited to,” and is not intended to exclude, for example, other additives, components, integers or steps. “Exemplary” means“an example of” and is not intended to convey an indication of a preferred or ideal embodiment.“Such as” is not used in a restrictive sense, but for explanatory purposes.

Disclosed are components that can be used to perform the disclosed methods and systems. These and other components are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these components are disclosed that while specific reference of each various individual and collective combinations and permutation of these may not be explicitly disclosed, each is specifically contemplated and described herein, for all methods and systems. This applies to all aspects of this application including, but not limited to, steps in disclosed methods. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods.

The term“effective amount” refers to an amount of a compound that confers a therapeutic effect (e.g., treats, e.g., controls, relieves, ameliorates, alleviates, or slows the progression of; or prevents, e.g., delays the onset of or reduces the risk of developing, a disease, disorder, or condition or symptoms thereof) on the treated subject. The therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., subject gives an indication of or feels an effect). An effective amount of the compound disclosed herein above may range from about 0.01 mg/kg to about 1000 mg/kg, (e.g., from about 0.1 mg/kg to about 100 mg/kg, from about 1 mg/kg to about 100 mg/kg). Effective doses will also vary depending on route of administration, as well as the possibility of co-usage with other agents.

The term“alkyl” as used herein is a branched or unbranched hydrocarbon group such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, t-butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, dodecyl, and the like. The alkyl group can also be substituted or unsubstituted. Unless stated otherwise, the term“alkyl” contemplates both substituted and unsubstituted alkyl groups. The alkyl group can be substituted with one or more groups including, but not limited to, alkoxy, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, nitro, silyl, sulfo-oxo, or thiol as described herein. An alkyl group which contains no double or triple carbon-carbon bonds can be designated a saturated alkyl group, whereas an alkyl group having one or more such bonds can be designated an unsaturated alkyl group. Unsaturated alkyl groups having a double bond can be designated alkenyl groups, and unsaturated alkyl groups having a triple bond can be designated alkynyl groups. Unless specified to the contrary, the term alkyl embraces both saturated and unsaturated groups. The term“cycloalkyl” as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc. The term“heterocycloalkyl” is a cycloalkyl group as defined above where at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, selenium or phosphorus. The cycloalkyl group and heterocycloalkyl group can be substituted or unsubstituted. Unless stated otherwise, the terms“cycloalkyl” and“heterocycloalkyl” contemplate both substituted and unsubstituted cyloalkyl and heterocycloalkyl groups. The cycloalkyl group and

heterocycloalkyl group can be substituted with one or more groups including, but not limited to, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, nitro, silyl, sulfo-oxo, or thiol as described herein. A cycloalkyl group which contains no double or triple carbon-carbon bonds is designated a saturated cycloalkyl group, whereas an cycloalkyl group having one or more such bonds (yet is still not aromatic) is designated an unsaturated cycloalkyl group. Unless specified to the contrary, the term alkyl embraces both saturated and unsaturated groups.

The term“aryl” as used herein is an aromatic ring composed of carbon atoms. Examples of aryl groups include, but are not limited to, phenyl and naphthyl, etc. The term“heteroaryl” is an aryl group as defined above where at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, selenium or phosphorus. The aryl group and heteroaryl group can be substituted or unsubstituted. Unless stated otherwise, the terms“aryl” and“heteroaryl” contemplate both substituted and unsubstituted aryl and heteroaryl groups. The aryl group and heteroaryl group can be substituted with one or more groups including, but not limited to, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl,

heterocycloalkyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, nitro, silyl, sulfo-oxo, or thiol as described herein.

Exemplary heteroaryl and heterocyclyl rings include: benzimidazolyl, benzofuranyl, benzothiofuranyl, benzothiophenyl, benzoxazolyl, benzoxazolinyl, benzthiazolyl, benztriazolyl, benztetrazolyl, benzisoxazolyl, benzisothiazolyl, benzimidazolinyl, carbazolyl, 4aH carbazolyl, carbolinyl, chromanyl, chromenyL cirrnolinyl, decahydroquinolinyl, 2H,6H~ 1,5,2-dithiazinyl, dihydrofuro[2,3 b]tetrahydrofuran, furanyl, furazanyl, imidazolidinyl, imidazolinyl, imidazolyl, lH-indazolyl, indolenyl, indolinyl, indolizinyl, indolyl, 3H-indolyl, isatinoyl, isobenzofuranyl, isochromanyl, isoindazolyl, isoindolinyl, isoindolyl, isoquinolinyl, isothiazolyl, isoxazolyl, methylenedioxyphenyl, morpholinyl, naphthyridinyl, octahydroisoquinolinyl, oxadiazolyl, 1,2,3- oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl, oxazolidinyl, oxazolyl, oxindolyl, pyrimidinyl, phenanthridinyl, phenanthrolinyl, phenazinyl, phenothiazinyl, phenoxathinyl, phenoxazinyl, phthalazinyl, piperazinyl, piperidinyl, piperidonyl, 4-piperidonyl, piperonyl, pteridinyl, purinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridooxazole, pyridoimidazole, pyridothiazole, pyridinyl, pyridyl, pyrimidinyl, pyrrolidinyl, pyrrolinyl, 2H-pyrrolyl, pyrrolyl, quinazolinyl, quinolinyl, 4H-quinolizinyl, quinoxalinyl, quinuclidinyl, tetrahydrofuranyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, tetrazolyl, 6H-1,2,5-thiadiazinyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-thiadiazolyl, 1,3,4- thiadiazolyl, thianthrenyl, thiazolyl, thienyl, thienothiazolyl, thienooxazolyl, thienoimidazolyl, thiophenyl, and xanthenyl.

The terms“alkoxy,”“cycloalkoxy,”“heterocycloalkoxy,” “cycloalkoxy,”“aryloxy,” and “heteroaryloxy” have the aforementioned meanings for alkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl, further providing said group is connected via an oxygen atom.

As used herein, the term“substituted” is contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, and aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, for example, those described below. The permissible substituents can be one or more and the same or different for appropriate organic compounds. For purposes of this disclosure, the heteroatoms, such as nitrogen, can have hydrogen substituents and/or any permissible substituents of organic compounds described herein which satisfy the valencies of the heteroatoms. This disclosure is not intended to be limited in any manner by the permissible substituents of organic compounds. Also, the terms“substitution” or“substituted with” include the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., a compound that does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc. Unless specifically stated, a substituent that is said to be“substituted” is meant that the substituent is substituted with one or more of the following: alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, nitro, silyl, sulfo-oxo, or thiol as described herein. In a specific example, groups that are said to be substituted are substituted with a protic group, which is a group that can be protonated or deprotonated, depending on the pH.

Unless stated to the contrary, a formula with chemical bonds shown only as solid lines and not as wedges or dashed lines contemplates each possible isomer, e.g., each enantiomer, diastereomer, and meso compound, and a mixture of isomers, such as a racemic or scalemic mixture. In certain cases, chemical compounds may be depicted showing relative stereochemical configurations. Unless explicitly defined otherwise, such formulae embrace enantiopure compounds, racemic mixtures and scalemic (i.e., enantioenriched) mixtures.

Unless specified otherwise, the term“patient” refers to any mammalian organism, including but not limited to, humans.

Pharmaceutically acceptable salts are salts that retain the desired biological activity of the parent compound and do not impart undesirable toxicological effects. Examples of such salts are acid addition salts formed with inorganic acids, for example, hydrochloric, hydrobromic, sulfuric, phosphoric, and nitric acids and the like; salts formed with organic acids such as acetic, oxalic, tartaric, succinic, maleic, fumaric, gluconic, citric, malic, methanesulfonic, p- toluenesulfonic, napthalenesulfonic, and polygalacturonic acids, and the like; salts formed from elemental anions such as chloride, bromide, and iodide; salts formed from metal hydroxides, for example, sodium hydroxide, potassium hydroxide, calcium hydroxide, lithium hydroxide, and magnesium hydroxide; salts formed from metal carbonates, for example, sodium carbonate, potassium carbonate, calcium carbonate, and magnesium carbonate; salts formed from metal bicarbonates, for example, sodium bicarbonate and potassium bicarbonate; salts formed from metal sulfates, for example, sodium sulfate and potassium sulfate; and salts formed from metal nitrates, for example, sodium nitrate and potassium nitrate. Pharmaceutically acceptable and non-pharmaceutically acceptable salts may be prepared using procedures well known in the art, for example, by reacting a sufficiently basic compound such as an amine with a suitable acid comprising a physiologically acceptable anion. Alkali metal (for example, sodium, potassium, or lithium) or alkaline earth metal (for example, calcium) salts of carboxylic acids can also be made.

Disclosed herein are compounds of Formula (I):

or a pharmaceutically acceptable salt thereof, wherein

R ^1a and R ^1b are independently selected from hydrogen, C _1-8 alkyl, C _3-8 cycloalkyl, C _2-8 alkenyl, and C _2-8 alkynyl; R ^2a is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^2b is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^2c is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^2d is each independently selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; - C(O)R ^c , OC(O)R ^c , -COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), - N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, -NO ₂ ;

R ³ is R ^c ;

X ¹ is selected from CR ^4b and N;

X ² is selected from CR ^4a and N;

when present, R ^4a is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; - C(O)R ^c , OC(O)R ^c , -COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), - N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, -NO ₂ ;

when present, R ^4b is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; - C(O)R ^c , OC(O)R ^c , -COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), - N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, -NO ₂ ;

R ^4c is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - ^{COORc, -C(O)N(Rc)} ₂ ^{, -OC(O)N(Rc)} ₂ ^{, -N(Rc)C(O), -N(Rc)C(O)N(Rc)} ₂ ^{, -F, -Cl, -Br, -I, -} CN, -NO ₂ ;

R ^4d is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ⁵ is R ^c ;

Z has the formula:

wherein Y ¹ and Y ² are independently selected from O, S, NR ^c , or a chemical bond; n is an integer selected from 0-3; R ⁶ is in each case independently selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , - SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , -COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), - N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, -NO ₂ ;

wherein any two or more R ⁶ groups may together form a ring, any adjacent R ⁶ groups may together form a double bond or triple bond, and any two germinal R ⁶ groups may together form an olefin, carbonyl, or imine; and

R ^7a is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^7b is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^7c is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^7d is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

R ^7e is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, - CN, -NO ₂ ;

wherein R ^c is in each case independently selected from hydrogen, C _1-8 alkyl, C _3-8 c ^{ycloalkyl, C} _2-8 ^{heterocyclyl, C} _6-12 ^{aryl, C} _1-12 ^{heteroaryl, C} _1-8 ^alkyl-C _3-8 ^{cycloalkyl, C} _1-8 alkyl-C _2-8 heterocyclyl, C _1-8 alkyl-C _6-12 aryl, and C _1-8 alkyl-C _3-12 heteroaryl;

wherein any two or more R ^1a , R ^1b , R ^2a , R ^2b , R ^2c , R ^2d , R ³ may together form a ring;

wherein any two or more R ³ , R ^4a and R ^4c may together form a ring;

wherein any two or more R ⁵ , R ^4b and R ^4d may together form a ring;

wherein any two or more of R ⁵ and R ⁶ may together form a ring; and

wherein any two or more of R ⁶ and R ^7a , R ^7b , R ^7c , R ^7d , and R ^7e may together form a ring. In instance where R ^c is alkyl or cycloalkyl, the alkyl and cycloalkyl can be saturated or unsaturated (e.g., alkenyl, cycloalkenyl, alkynyl, cycloalkynyl).

In certain embodiments, the central ring is a pyridine ring, for instance X ¹ is N and X ² is CR ^4a , or X ¹ is CR ^4b and X ² is N, whereas in other cases, the central ring is a phenyl ring, i.e., X ¹ is CR ^4b and X ² is CR ^4a . In other cases, the central may be a bicyclic (or higher order ring), for instance when R _4d and R _4a together form a ring, or R _4c and R _4b together form a ring. The additional ring may or may not have additional heteroatoms. By way of example, the additional ring may have an oxygen atom, leading to a benzofuran ring (when X ¹ is CR ^4b and X ² is CR ^4a ).

Generally, the two nitrogen atoms adjacent to the carbonyl groups are secondary, i.e., R ³ and R ⁵ are each hydrogen. However, in some cases, either or both of R ³ and R ⁵ can be alkyl, e.g., C _1-6 alkyl. Bicyclic (and higher order) ring systems are also contemplated, by way of example, R ⁵ may form a ring either with R ^4d or R ^4b .

In certain embodiments, R ^1a and R ^1b are each hydrogen. In other cases, one or both R ^1a and R ^1b may a pro-drug moiety, e.g., a phosphonate, phosphamide, aminomethylenes (- CH ₂ NR ₂ ), methylene ethers, and the like.

Various substituents can be included on the ring systems, as well as the higher order rings if two or more substituents themselves form a ring. In some cases, R ^2a , R ^2c and R ^2d are each hydrogen, and R ^2b is either a halogen (e.g., F, Cl, Br, I) or an alkyl group. Preferred alkyls include unsubstituted, e.g., methyl, ethyl, isopropyl, and the like, as well as substituted alkyls, e.g., haloalkyl groups such as trifluoromethyl, perfluoroethyl, 2,2,2-trifluoroethyl, and the like. In some cases, R ^7a , R ^7b , R ^7d and R ^7e are each hydrogen, and R ^7c is either a halogen (e.g., F, Cl, Br, I) or an alkyl group. Preferred alkyls include unsubstituted, e.g., methyl, ethyl, isopropyl, and the like, as well as substituted alkyls, e.g., haloalkyl groups such as trifluoromethyl, perfluoroethyl, 2,2,2-trifluoroethyl, and the like.

In certain embodiments, Y ¹ and Y ² can each be a chemical bond, and n is 1, i.e., a compound of Formula (II) or (IIa):

wherein R ^1a , R ^1b , R ^2a , R ^2b , R ^2c , R ^2d , R ³ , X ¹ , X ² , R ^4a , R ^4b , R ^4c , R ^4d , R ⁵ , R ^7a , R ^7b , R ^7c , R ^7d , and R ^7e have the meanings given above; and

R ^6a is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, - NO ₂ ; and

R ^6b is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, - NO ₂ .

In certain embodiments, R ^6a is selected from hydrogen and C _1-6 alkyl, and R ^6b is selected from hydrogen and C _1-6 alkyl. In some cases, R ^6a and R ^6b can together form a ring, e.g., cyclopropyl, cyclohexyl and the like. In other cases, R ^6a and R ^6b are hydrogen, while is yet other cases, R ^6a is hydrogen and R ^6b is C _1-6 alkyl, e.g., methyl, ethyl, isopropyl and the like. In still yet other cases, R ^6b is hydrogen and R ^6a is C _1-6 alkyl, e.g., methyl, ethyl, isopropyl and the like.

In certain embodiments, Y ¹ and Y ² can each be a chemical bond, and n is 2, i.e., a com ound of Formula III or IIIa :

wherein R ^1a , R ^1b , R ^2a , R ^2b , R ^2c , R ^2d , R ³ , X ¹ , X ² , R ^4a , R ^4b , R ^4c , R ^4d , R ⁵ , R ^7a , R ^7b , R ^7c , R ^7d , and R ^7e have the meanings given above; and R ^6a is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, - NO ₂ ;

R ^6b is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, - NO ₂ ;

R ^6c is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, - NO ₂ ;

R ^6d is selected from -R ^c , -OR ^c, , -N(R ^c ) ₂ , -SR ^c , -SO ₂ R ^c , -SO ₂ N(R ^c ) ₂ ; -C(O)R ^c , OC(O)R ^c , - COOR ^c , -C(O)N(R ^c ) ₂ , -OC(O)N(R ^c ) ₂ , -N(R ^c )C(O), -N(R ^c )C(O)N(R ^c ) ₂ , -F, -Cl, -Br, -I, -CN, - NO ₂ .

In certain embodiments, R ^6a is selected from hydrogen and C _1-6 alkyl; R ^6b is selected from hydrogen and C _1-6 alkyl; R ^6c is selected from hydrogen and C _1-6 alkyl; and R ^6d is selected from hydrogen and C _1-6 alkyl. In certain cases, R ^6a and R ^6c together form a double bond, in either the cis or trans configuration.

R ^6a and R ^6c can together form a ring, e.g., cyclopropyl, cyclohexyl and the like. The ring may have the cis or trans configuration. Cyclopropyl rings are especially preferred in some embodiments.

The compounds disclosed herein can be formulated into pharmaceutical compositions for administration to a patient, e.g., a human patient. Pharmaceutical compositions of formula (I) compounds described herein suitable for oral administration can be in the form of (1) discrete units such as capsules, sachets, tablets, or lozenges each containing a predetermined amount of the HDAC inhibitor; (2) a powder or granules; (3) a bolus, electuary, or paste; (4) a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or (5) an oil-in-water liquid emulsion or a water-in-oil liquid emulsion. Compositions suitable for topical administration in the mouth, for example buccally or sublingually, include lozenges. Compositions suitable for parenteral administration include aqueous and non-aqueous sterile suspensions or injection solutions.

Compositions suitable for rectal administration can be presented as a suppository.

Pharmaceutical compositions of formula (I) compounds described herein can be formulated using a solid or liquid carrier. The solid or liquid carrier should be compatible with the other ingredients of the formulation and not deleterious to the recipient. If the

pharmaceutical composition is in tablet form, then the HDAC inhibitor is mixed with a carrier having the necessary compression properties in suitable proportions and compacted in the shape and size desired. If the composition is in powder form, the carrier is a finely divided solid in admixture with the finely divided active ingredient. The powders and tablets can contain up to 99% of the active ingredient. Suitable solid carriers include, for example, calcium phosphate, magnesium stearate, talc, sugars, lactose, dextrin, starch, gelatin, cellulose, methyl cellulose, sodium carboxymethyl cellulose, polyvinylpyrrolidine, low melting waxes and ion exchange resins. A solid carrier can include one or more substances that can act as flavoring agents, lubricants, solubilizers, suspending agents, fillers, glidants, compression aids, binders or tablet- disintegrating agents. A suitable carrier can also be an encapsulating material.

If the composition is a solution, suspension, emulsion, syrup, elixir, or pressurized composition, then liquid carriers can be used. In this case, the HDAC inhibitor is dissolved or suspended in a pharmaceutically acceptable liquid carrier. Suitable examples of liquid carriers for oral and parenteral administration include (1) water; (2) alcohols, e.g. monohydric alcohols and polyhydric alcohols such as glycols, and their derivatives; and (3) oils, e.g. fractionated coconut oil and arachis oil. For parenteral administration, the carrier can also be an oily ester such as ethyl oleate and isopropyl myristate. Liquid carriers for pressurized compositions include halogenated hydrocarbon or other pharmaceutically acceptable propellants. The liquid carrier can contain other suitable pharmaceutical additives such as solubilizers; emulsifiers; buffers; preservatives; sweeteners; flavoring agents; suspending agents; thickening agents; colors; viscosity regulators; stabilizers; osmo-regulators; cellulose derivatives such as sodium carboxymethyl cellulose; antioxidants; and bacteriostatics. Other carriers include those used for formulating lozenges such as sucrose, acacia, tragacanth, gelatin and glycerin as well as those used in formulating suppositories such as cocoa butter or polyethylene glycol.

If the composition is to be administered intravenously or intraperitoneally by infusion or injection, solutions of the HDAC inhibitor can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The composition suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient, which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium as described above. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens,

chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. Sterile injectable solutions are prepared by incorporating the HDAC inhibitor in the required amount in the appropriate solvent with some of the other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying techniques, which yield a powder of the HDAC inhibitor, plus any additional desired ingredient present in the previously sterile-filtered solutions.

Pharmaceutical compositions can be in unit-dose or multi-dose form or in a form that allows for slow or controlled release of the HDAC inhibitor. Each unit-dose can be in the form of a tablet, capsule or packaged composition such as, for example, a packeted powder, vial, ampoule, prefilled syringe or sachet containing liquids. The unit-dose form also can be the appropriate number of any such compositions in package form. Pharmaceutical compositions in multi-dose form can be packaged in containers such as sealed ampoules and vials. In this case, the HDAC inhibitor can be stored in a freeze-dried (lyophilized) condition requiring only the addition of a sterile liquid carrier immediately prior to use. In addition, extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets of the kind previously described.

The HDAC inhibitors disclosed herein can be employed to treat a variety of different conditions. For instance, a therapeutically effective amount of an HDAC inhibitor as described herein, or pharmaceutically acceptable salt thereof can be used to treat a patient with cancer. In some embodiments, the cancer is a solid tumor, neoplasm, carcinoma, sarcoma, leukemia, or lymphoma. In some embodiments, leukemias include acute leukemias and chronic leukemias such as acute lymphocytic leukemia (ALL), acute myeloid leukemia, chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML) and Hairy Cell Leukemia; lymphomas such as cutaneous T-cell lymphomas (CTCL), noncutaneous peripheral T-cell lymphomas, lymphomas associated with human T-cell lymphotrophic virus (fITLV) such as adult T-cell leukemia/lymphoma (ATLL), Hodgkin's disease and non-Hodgkin's lymphomas, large-cell lymphomas, diffuse large B-cell lymphoma (DLBCL); Burkitt's lymphoma; primary central nervous system (CNS) lymphoma; multiple myeloma; childhood solid tumors such as brain tumors, neuroblastoma, retinoblastoma, Wilm's tumor, bone tumors, and soft-tissue sarcomas, common solid tumors of adults such as head and neck cancers (e.g., oral, laryngeal and esophageal), genitor-urinary cancers (e.g., prostate, bladder, renal, uterine, ovarian, testicular, rectal and colon), lung cancer, breast cancer. In a particularly preferred embodiments, the compounds disclosed herein are used to treat breast cancer.

In other embodiments, the compounds disclosed herein can be used to treat inflammatory disorders, rheumatoid arthritis (RA) and psoriatic arthritis; inflammatory bowel diseases such as Crohn's disease and ulcerative colitis; spondyloarthropathies; scleroderma; psoriasis (including T-cell mediated psoriasis) and inflammatory dermatoses such an dermatitis, eczema, atopic dermatitis, allergic contact dermatitis, urticaria; vasculitis (e.g., necrotizing, cutaneous, and hypersensitivity vasculitis); eosinophilic myositis, eosinophilic fasciitis; cancers with leukocyte infiltration of the skin or organs, ischemic injury, including cerebral ischemia (e.g., brain injury as a result of trauma, epilepsy, hemorrhage or stroke, each of which may lead to

neurodegeneration); HIV, heart failure, chronic, acute or malignant liver disease, autoimmune thyroiditis; systemic lupus erythematosus, Sjogren's syndrome, lung diseases (e.g., ARDS); acute pancreatitis; amyotrophic lateral sclerosis (ALS); Alzheimer's disease; cachexia/anorexia; asthma; atherosclerosis; chronic fatigue syndrome, fever; diabetes (e.g., insulin diabetes or juvenile onset diabetes); glomerulonephritis; graft versus host rejection (e.g., in transplantation); hemorrhagic shock; hyperalgesia: inflammatory bowel disease; multiple sclerosis; myopathies (e.g., muscle protein metabolism, esp. in sepsis); osteoarthritis; osteoporosis; Parkinson's disease; pain; pre-term labor; psoriasis; reperfusion injury; cytokine-induced toxicity (e.g., septic shock, endotoxic shock); side effects from radiation therapy, temporal mandibular joint disease, tumor metastasis; or an inflammatory condition resulting from strain, sprain, cartilage damage, trauma such as burn, orthopedic surgery, infection or other disease processes. The compounds can be used to treat allergic diseases and conditions, include but are not limited to respiratory allergic diseases such as asthma, allergic rhinitis, hypersensitivity lung diseases, hypersensitivity pneumonitis, eosinophilic pneumonias (e.g., Loeffler's syndrome, chronic eosinophilic pneumonia), delayed-type hypersensitivity, interstitial lung diseases (ILD) (e.g., idiopathic pulmonary fibrosis, or ILD associated with rheumatoid arthritis, systemic lupus erythematosus, ankylosing spondylitis, systemic sclerosis, Sjogren's syndrome, polymyositis or

dermatomyositis); systemic anaphylaxis or hypersensitivity responses, drug allergies (e.g., to penicillin, cephalosporins), insect sting allergies, and the like. In a preferred embodiment, the compounds of the present invention can be used to treat In other embodiments, the compounds disclosed herein can be used to treat various neurological disorders, for instance, Friedreich's ataxia (FRDA), myotonic dystrophy, spinal muscular atrophy, fragile X syndrome, Huntington's disease, a spinocerebellar ataxia, Kennedy's disease, amyotrophic lateral sclerosis, Niemann Pick, Pitt Hopkins, spinal and bulbar muscular atrophy, Alzheimer's disease, schizophrenia, bipolar disorder, and related diseases).

In some embodiments, the compounds can be used to treat cachexia, including the symptoms thereof. Examples of such symptoms include weakness, fatigue, gastrointestinal distress, sleep/wake disturbances, pain, listlessness, shortness of breath, lethargy, depression, malaise, anorexia, weight loss, muscle atrophy, and loss lean body mass. The improvement, if measurable by percent, can be at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, or 90%. Symptoms such as weakness, fatigue, pain, listlessness, depression, and malaise can be measured by techniques known in the art (e.g., using tests such as EORTC-global quality of life, the Beck Depression Inventory, the Zung Self-rating Depression Scale, the Center for

Epidemiologic Studies-Depression Scale, the Hamilton Rating Scale for Depression, and patient self-reporting). For assessing anorexia, muscle mass, or lean body mass assessment, dual- emission X-ray absorptiometry scan (DEXA), bioelectrical impedance analysis (BIA), indirect calorimetry, nutrition diaries, and similar known methods can be used.

In other embodiments, the compounds can be used to treat or prevent alcoholic steatosis, in which an effective amount of the compound is administered to a patient diagnosed with alcoholic steatosis, or at risk for developing alcoholic steatosis. EXAMPLES

The following examples are set forth below to illustrate the methods and results according to the disclosed subject matter. These examples are not intended to be inclusive of all aspects of the subject matter disclosed herein, but rather to illustrate representative methods, compositions, and results. These examples are not intended to exclude equivalents and variations of the present invention, which are apparent to one skilled in the art.

Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.) but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric. There are numerous variations and combinations of reaction conditions, e.g., component concentrations, temperatures, pressures, and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described process. Only reasonable and routine experimentation will be required to optimize such process conditions.

All commercially available reagents were used without further purification unless otherwise stated. Anhydrous THF was obtained by distilling commercial reagent over sodium, and anhydrous DMF was commercially available. Silica gel for column chromatography was purchased from Merck Silica gel 60 (0.040– 0.063 mm). Routine ¹ H and ¹³ C nuclear magnetic resonance spectra were recorded on the Bruker NMR AV 400 or Bruker AVII 500 NMR.

Samples were dissolved in deuterated chloroform (CDCl ₃ ) or dimethyl sulfoxide (DMSO-d ₆ ), and tetramethylsilane (TMS) was used as a reference. Mass spectrometry analyses were performed with a Waters, LCT orthogonal acceleration time-of-flight (oa-TOF) LC/MS system. All compounds for bioassays were identified with ¹ H NMR, ¹³ C NMR and HRMS, and purities confirmed to be higher than 95%. Purities of all tested compounds were determined by a Shimadzu LCMS-2020 system (comprised of a LC-20AD pump, a SPD-M30A detector, an SIL- 20AC autosampler and a Shim-SDFN^*,67^&^^^^^P^^^^^^;^^^^^PP^,^'^^&^^^FROXPQ ^^ The general procedures for the synthesis of compounds 2-31 are depicted in Scheme 1, and detailed synthesis is described in the Supplementary Information. HDAC isoform profiling and IC ₅₀ determination of individual compounds were conducted by Reaction Biology Cooperation (Malvern, PA).

Cell Lines, Cell Culture, Reagents, and Antibodies. The breast cancer cell lines, MDA-MB-231 and SUM-159, were purchased from American Type Culture Collection

(Manassas, VA) and Asterand Biosciences (Detroit, MI), respectively. MDA-MB-231 cells were maintained in DMEM medium containing 10% fetal bovine serum, and SUM159 cells were cultured in Ham’s F-12 (Life Technologies) supplemented with 5% fetal bovine serum, 5 ^J^PO^LQVXOLQ^^and ^^^J^PO^K\GURFRUWLVRQH^^$OO^FHOOV^ZHUH^FXOWXUHG^DW^^^^&^ LQ^D^KXPLGLILHG^ incubator containing 5% CO2. AR-42 (1) was a kind gift from Arno Therapeutics (Flemington, NJ). $QWLERGLHV^IRU^YDULRXV^SURWHLQV^ZHUH^SXUFKDVHG^IURP^IROORZLQ J^VRXUFHV^^+'$&^^^ȕ- catenin, Histone H3, tubulin, acetyl-tubulin DQG^ȕ-actin (Santa Cruz, CA); p-Ser473-Akt, AKT, p-Ser9-*6.^ȕ^^*6.^ȕ^^F-Myc, BMI-1, and Ac-H3K9 (Cell Signaling Technology; Beverly, MA); pan-Ac-H3 (Millipore; Billerica, MA); APC-conjugated CD44 and PE-conjugated CD24, (Thermo Fisher Scientific, Waltham, MA); horseradish peroxidase-conjugated anti-mouse IgG or anti-rabbit IgG (Jackson ImmunoResearch Laboratories; West Grove, PA).

Generation of HDAC3-depleted stable clones or HDAC3-overexpressing MDA-MB- 231 cells. For lentivirus generation, psPAX2 (#12260, Addgene), pMD2.G (#12259, Addgene) and shRNA of HDAC3 (TRCN0000194993, TRCN0000196267; RNAi Core of Academia Sinica, Taipei, Taiwan) were cotransfected in 293T cells with Lipofectamine 2000 (Life Technologies) according to the manufacturers’ instructions. Viral particles were used for infection of target cells and stable clones were maintained with puromycin (Life Technologies; Grand Island, NY). pLAS.Void plasmid served as negative control. The HDAC3 expression plasmid (#13819, Addgene; Cambridge, MA) was transfected with Lipofectamine 2000 in MDA-MB-231 cells according to the manufacturers’ instructions.

Cell Lysis and Immunoblotting. Drug-treated cells were collected and then lysed in a buffer containing 1% sodium dodecyl sulfate (SDS), 10 mM EDTA, 50 mM Tris–HCl (pH 8.1), and 1% protease and phosphatase inhibitor mixture. Lysates were sonicated and then centrifuged at 13,000 rpm for 10 min. Protein concentrations in the supernatants were determined (Micro BCA Protein Assay Kit, Pierce Biotechnology, Rockford, IL) and equal amounts of proteins were resolved via SDS-PAGE and transferred to a nitrocellulose membrane (GE Healthcare Life Sciences, Pittsburgh, PA). The membrane was washed twice with Tris-buffered saline containing 0.1% Tween-20 (TBST), blocked with TBST containing 5% non-fat milk for 30 min, and then incubated with primary antibody (1:1000 dilution) in TBST at 4°C overnight. After washing with TBST, the membrane was incubated with goat anti-rabbit or anti-mouse IgG–HRP conjugates (1:5000 dilution) for 1 h at room temperature. The immunoblots were visualized by enhanced chemiluminescence.

RNA Extraction and RT-PCR. Total RNA was isolated with TRIzol (Thermo Fisher Scientific) according to the manufacturer's protocol. From each sample, 2 ^J^WRWDO^51$^ZDV^ reverse-transcribed into cDNA using the iScriptTM cDNA Synthesis Kit (Bio-Rad; Hercules, CA) and the cDNA were separated by electrophoresis. PCR products were resolved by electrophoresis in 2% agarose gels and visualized by ethidium bromide staining. The sequences of primers used for RT-PCR were as follows. ȕ-catenin, forward primer:

GCTGATTTGATGGAGTTGGA; reverse primer: GCTACTTGTTCTTGAGTGAA (SEQ ID NO:1); ȕ-actin, forward primer: GCTCGTCGTGGACAACGGCTC (SEQ ID NO:2), reverse primer: CAAACATGATCTGGGTCAT-CTTCTC (SEQ ID NO.3).

Colony Formation Assays. MDA-MB-231 or SUM-159 cells were seeded in six-well plates at a density of 1,000 cells per well and were left to attach overnight. Vehicle control (DMSO) or increasing concentrations of test agents were added to the cells in the presence of 5% FBS for 48 h. The drug mixture was washed out, and the plates were incubated with media for 7-14 days until colonies were visible. Each drug concentration was assessed in triplicate. The colonies were fixed with 4% formaldehyde (Sigma-Aldrich) and stained with crystal violet (5 mg/ml in 2% ethanol, Sigma-Aldrich). Colonies containing more than 50 cells were counted. Cell survival is expressed as a percentage and was determined from the numbers of colonies present in the drug-treated groups relative to the vehicle-treated control group.

Mammosphere formation assays. MDA-MB-231 (1,000 cells/well) and SUM159 (500 cells/well) cells were seeded onto ultra-low attachment 24-well flat bottom plates (Corning) in serum-free culture medium (MammoCult™, STEMCELL Technologies; Vancouver, Canada) VXSSOHPHQWHG^ZLWK^^^^0^K\GURFRUWLVRQH^^0DPPR&XOW^^^DQG^^ ^^J^ml heparin

(MammoCult™). Cells were then treated with 28 at the indicated concentrations in triplicate for 7 days. The number of mammospheres was counted at 100X magnification.

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) Assays. To determine the drug effects on cell viability, MDA-MB-231 cells were seeded onto 96-well plates at a density of 5,000 cells per well in the presence of 10% FBS. After overnight incubation, cells were exposed to test agents in the presence of 5% FBS for 24, 48, and 72 h. After treatment, cells were incubated with MTT (Biomatik, Wilmington, DE) for an additional 1 h. The medium was then removed from each well and replaced with DMSO to dissolve the reduced MTT dye for subsequent colorimetric measurement of absorbance at 560 nm. Cell viabilities are expressed as percentages of viable cells relative to the corresponding vehicle-treated control group. For the cell proliferation analysis of HDAC3 ^KD stable clones versus parental MDA-MB-231 cells, a total of 500 cells per well were seeded in 96-well plates and incubated for the indicated time at 37°C. The cell proliferation was analyzed by detecting the absorbance of reduced MTT dye.

Flow cytometry. DMSO- or 28-treated MDA-MB-231 cells were harvested, washed with stain buffer (BD, Franklin Lakes, NJ), and incubated with specific FITC- or phycoerythrin- conjugated monoclonal antibodies for CD44 and CD24 on ice in the dark for 30 min. Cells were washed with stain buffer, and the pellets were collected and suspended in PBS. The

CD44 ⁺ /CD24 ^low subpopulation was analyzed using a FACSCalibur (BD Biosciences) flow cytometer.

In Vivo Tumorigenesis Study. Female NOD/SCID mice (NOD.CB17-Prkdcscid /NCrHsd; 5–6 weeks of age; Harlan, Indianapolis, IN) were group-housed under constant photoperiod (12-h light/12-h dark) with ad libitum access to sterilized food and water. All experimental procedures were done according to protocols approved by The Ohio State

University Institutional Animal Care and Use Committee. To assess the effect of HDAC3 knockdown on tumor initiation in vivo, stable HDAC3 ^KD clone #6267 cells [50,000 cells/0.1 ml in 50% Matrigel (BD Biosciences)] were implanted into the 4 ^th inguinal mammary fat pads of NOD/SCID mice. An equal number of MDA-MB-231 cells transfected with control lentiviral constructs were injected into the contralateral mammary fat pads to serve as negative control. Tumors were measured with calipers and the volumes were calculated using V = (width ² x length) x 0.52. To assess the effect of 28 on tumor initiation in vivo, MDA-MB-231 cells were preWUHDWHG^ZLWK^^^^0^28 for 48 h, and control cells were treated with the same amount of DMSO. Treated cells were then collected by trypsin (Gibco), the cell density was adjusted to 50,000 cells/0.1ml in 50% Matrigel, and implanted into the left 4 ^th inguinal mammary fat pads of NOD/SCID mice. The day after cell implantation, mice were treated with 28 at 100 mg/kg body weight or vehicle (0.5% methylcellulose/0.1% Tween 80 [v/v] in sterile water) once daily by oral gavage.

Statistical Analysis. In vitro experiments were performed at least three times and data are presented as means ± SD. Group means were compared using one-way ANOVA followed by Student’s t tests. For the in vivo experiments, differences in tumor incidence and tumor volume were analyzed by log-rank test and Student’s t-test, respectively. Differences were considered significant at P < 0.05.

Cachexia stud: We used the Colon-26 (C-26) model of cachexia to conduct the experiments. Tumors were established by subcutaneous injection of C-26 cells (0.5 x 106 cells in 0.1 ml) into the right flank of male CD2F1 mice (approximately 6 weeks of age). Tumor- bearing mice, as well as tumor-free mice serving as non-cachectic controls, were randomized into groups that were treated with AR-42 (15 mg/kg, p.o., daily), HDAC3-selective inhibitors (at indicated doses, p.o., daily), including H3-14 (compound 18), H3-16 (compound 5), H3-17 (compound 18), and KD-7 (compound 29), or vehicle (0.5% methylcellulose (w/v) and 0.1% Tween-80 (v/v) in sterile water) starting at 6 days after C-26 cell injection. Body weights, tumor volumes, and diet consumption were examined, and grip strengths of individual mice were measured at day 8 and day 15. The results are depict in Figures 6-18.at Scheme 1. Synthesis of compound 35, 36, 37

Reagents and conditions: (a) Thionyl Chloride, MeOH, Reflux.

General synthetic procedures

Step a: A mixture of 4-aminobenzoic acid (32-34, 5.0 mmol), thionyl chloride (1.487 g, 5.0 mmol), and MeOH (20.0 mL) was flushed with argon, and stirred at 80 ^o C for 12 hours. Remove reaction solvent by rota vapor. The reaction mixture was neutralized with NaHCO _3(sat) (20.0 mL) and extracted with ethyl acetate (100 mL × 3). The combined organic extracts were washed with brine, dried by Na ₂ SO ₄ , filtered, and evaporated, to get cmopound 35-37 (63-89%) as a white solid.

Reagents and conditions: (a) (BOC) ₂ O, THF, Et ₃ N, DMAP, (b) H ₂ , Pd/C, EtOH.

Step a: A mixture of 5-fluoro-2-nitroaniline (38, 3.12 g, 20 mmol), di-tert-butyl dicarbonate (8.27 g, 40 mmol), Triethylamine (2.80 mL, 20 mmol), 4-dimethylaminopyridine (61 mg, 0.5 mmol) and THF (100.0 mL) was flushed with argon, and stirred at 80 ^o C for 12 hours. Remove solvent by rota vapor. Washed by 2N HCl _(aq) , and extracted with ethyl acetate (100 mL ǘ 3), dried over sodium sulfate, filtered and concentrated. The crude product purified with silica gel chromatography with the mixture of hexane and ethyl acetate as eluent to give the desired compound.

Step b: A mixture of tert-butyl (5-fluoro-2-nitrophenyl)carbamate (39, 2.56 g, 10 mmol), EtOH (50 mL), Pd/C ( 128 mg, 5% wt %), The reaction was stirred for 2 hours at room temperature under hydrogen. Filtered by celite, remove solvent by rota vapor, and the crude compound was pure enough.

tert-butyl (5-fluoro-2-nitrophenyl)carbamate (39). Yellow solid, 80% yield. ¹ H NMR (DMSO, 400 MHz): į 1.47 (s, 9H), 7.12 (td, 1H, J = 7.9, 1.4Hz), 7.79 (dd, 1H, J = 11.2, 2.8 Hz), 8.13 (dd, 1H, J = 8.8, 6.6 Hz), 9.72 (s, 1H). tert-butyl (2-nitro-5-(trifluoromethyl)phenyl)carbamate (66). Yellow solid, 91% yield. ¹ H NMR (CDCl ₃ , 500 MHz): į 1.56 (s, 9H), 7.32 (d, 1H, J = 8.5 Hz), 8.30 (d, 1H, J = 8.5 Hz), 8.97 (s, 1H), 9.68 (s, 1H).

tert-butyl (2-amino-5-fluorophenyl)carbamate (40). White solid, 95% yield. ¹ H NMR (DMSO, 400 MHz): į 1.47 (s, 9H), 4.76 (s, 2H), 6.65 (dd, 2H, J = 7.2, 8.1 Hz), 7.20 (d, 1H, J = 10.93 Hz), 8.39 (s, 1H).

tert-butyl (2-amino-5-(trifluoromethyl)phenyl)carbamate (67). White solid, 92% yield. ¹ H NMR (CDCl ₃ , 500 MHz): į 1.52 (s, 9H), 4.05 (s, 2H), 6.19 (s, 1H), 6.79 (d, 1H, J = 8.5 Hz), 7.34 (d, 1H, J = 8.5 Hz), 7.54 (s, 1H).

Scheme 3. Resolution of (R)-2-Isopropylphenylacetic Acid.

_{( )}

2-Isopropylphenylaceticacid (8.91 g), (+)-Į-phenylethylamine (6.45 mL), and 63% aqueous ethanol (193 mL) were refluxed and allowed to cool slowly. The resulting salt was recrystallized three times from 63% aqueous ethanol. The salt was treated

with 10% sulfuric acid at 0 °C, extracted with ethyl acetate, dried, and concentrated to yield 3.52 g (Yield is 39%) of (R)-(-)-2-isopropylphenylacetic DFLG^^>Į@ ²⁵

D -58.6° (CHCl ₃ , c = 0.02).

Use same procedure, 2-Isopropylphenylaceticacid (5.34 g), (-)-Į-phenylethylamine (3.87

Scheme 4. Synthesis of compound 2, 3, 4, 5, 11, 14, 17, 18, 20, 21, 23, 24, 25, 26, 27, 28.

Reagent and condition: (a) HATU, Et ₃ N, DMF, rt. (b) LiOH, MeOH, H ₂ O, rt. (c) HATU, Et ₃ N, DMF, rt. (d) TFA, DCM, rt. (e) HATU, Et ₃ N, DMF, rt.

Step a:

A mixture of 2-phenylacetic acid (2.72 g, 20.0 mmol), methyl 4-aminobenzoate (3.02 g, 20.0 mmol), triethylamine (6.07 g, 60 mmol), and HATU (7.60 g, 20.0 mmol) in

dimethylformamide (40.0 mL) was flushed with argon, and stirred at r.t. for 12 hours. The reaction mixture was extracted with ice water (200.0 mL) and ethyl acetate (50.0 mL x 3). The combined organic extracts were washed with 2M HCl _(aq) (50.0 mL), NaHCO _3(sat) (50.0 mL), dried with Na ₂ SO ₄ , filtered, and evaporated. The crude product was purified with flash column chromatography on silica gel, and using 20% Ethyl acetate/Hexanes to afford 46 [methyl 4-(2- phenylacetamido)benzoate] (5.027 g, 18.7 mmol, 93%) as a white solid.: ¹ H NMR (DMSO, 300

Step b:

A mixture of Methyl 4-(2-phenylacetamido)benzoate (46) (5.027 g, 18.3 mmol), and LiOH (1.970 g, 80.0 mmol) in THF/MeOH/H ₂ O (40:40:20, 100.0 mL) and flushed with argon, and stirred at 60 ^o C for 1 hour. Remove reaction solvent by rota vapor. The reaction mixture was neutralized with 2M HCl _(aq) (50.0 mL) and extracted with ethyl acetate (100 mL ǘ 3). The combined organic extracts were washed with brine, dried by Na ₂ SO ₄ , filtered, and evaporated, to afford compound 58 [4-(2-phenylacetamido)benzoic acid] (4.60 g, 18.0 mmol, 97%) as a white solid. The crude product is pure enough to next sept.

3H), 7.23-7.35 (m, 5H), 7.71 (d, 2H, J = 8.8 Hz), 7.88 (d, 2H, J = 8.7 Hz), 10.49 (s, 1H), 12.72 (s, 1H);

Step c & d:

A mixture of 4-(2-phenylacetamido)benzoic acid (2.042 g, 8.0 mmol), tert-butyl (2- amino-5-fluorophenyl)carbamate (2.13 g, 9.6 mmol), and HATU (3.65 g, 9.6 mmol) in dimethylformamide (16.0 mL) was flushed with argon, and stirred at r.t. for 12 hours. The reaction mixture extracted with ice water (100.0 mL) and ethyl acetate (30.0 mL ǘ 3). The combined organic extracts were washed with 2M HCl _(aq) (25.0 mL), NaHCO _3(sat) (25.0 mL). The combined organic layers were dried over Na ₂ SO ₄ The crude product was purified with flash column chromatography on silica gel, and using 20% Ethyl acetate/Hexanes to afford the Boc- 58 [tert-butyl (5-fluoro-2-(4-(2-phenylacetamido)benzamido)phenyl)carbamate ] as a dark yellow oil. Then added DCM (50.0 mL), trifluoroacetic acid (5.0 mL) and stirred at r.t. for 2 hours. Remove DCM by rota vapor, neutralized by NaHCO _3(aq) to pH > 8.0, extracted by ethyl acetate. Use EA/Pentane to recrystallize it and get pale white powder 18 [N-(2-amino-4- fluorophenyl)-4-(2-phenylacetamido)benzamide] (2.13 g, 5.86 mmol, 71%): ¹ H NMR (CDCl ₃ ,

Step e:

A mixture of (S)-4-(3-methyl-2-phenylbutanamido)benzoic acid (89 mg, 0.3 mmol), benzene-1,2-diamine (97 mg, 0.9 mmol), and HATU (136 mg, 0.36 mmol) in

dimethylformamide (1.0 mL) was flushed with argon, and stirred at r.t. for 12 hours. The reaction mixture extracted with ice water (20.0 mL) and ethyl acetate (5.0 mL ǘ 3). The combined organic extracts were washed with 2M HCl _(aq) (5.0 mL), NaHCO _3(sat) (25.0 mL). The combined organic layers were dried over Na ₂ SO ₄ The crude product was purified with flash column chromatography on silica gel, and using 20% Ethyl acetate/Hexanes to afford the 2 [(S)- N-(2-aminophenyl)-4-(3-methyl-2-phenylbutanamido)benzamide]. The yield is 67%, and as white solid.: ¹ +^105^^'062^^^^^^0+]^^^į^^^^^^^G^^^+^^J = 6.7 Hz), 1.02 (d, 3H, J = 6.4 Hz),

= 8.8 Hz), 7.93 (d, 2H, J= 8.7 Hz), 9.54 (s, 1H), 10.33 (s, 1H); ¹³ C NMR (DMSO, 100MHz): δ 20.1, 21.2, 31.1, 60.6, 116.1, 116.3, 118.3(2C), 123.5, 126.3, 126.6, 126.9, 128.2(2C),128.3(2C), 128.6(2C), 129.0, 139.5, 141.8, 143.1, 164.6, 172.1;[a] ²⁵ _D = +93.6° (c 0.015 , MeOH), HRMS exact mass of (M-H) ^" , 386.1869 amu; observed mass of (M-H) ^" , 386.1862 amu.

Methyl (S)-5-(3-methyl-2-phenylbutanamido)picolinate (43)

The yield is 64%, and as white solid.: ¾ NMR (CDCb, 300 MHz): δ 0.67 (d, 3H, J= 6.7), 1.01 (d, 3H, J= 6.5 Hz),2.29-2.41 (m, 1H), 3.29 (d, 1H, J= 10.6 Hz), 3.83 (s, 3H), 7.22-7.42 (m, 5H), 8.01 (d, 1H, J= 8.6 Hz), 8.27 (dd, 1H, J= 8.6, 2.5 Hz), 8.80 (d, 1H, J= 2.2 Hz), 10.69 (s, 1H);

Methyl (R)-5-(3-methyl-2-phenylbutanamido)picolinate (44)

The yield is 60%, and as white solid.: ¾ NMR (DMSO, 500 MHz): δ 0.67 (d, 3H, J= 6.7), 1.01 (d, 3H, J= 6.4 Hz),2.32-2.50 (m, 1H), 3.30 (d, 1H, J= 10.7 Hz), 3.83 (s, 3H), 7.25 (t, 1H, J = 7.2 Hz), 7.33 (t, 1H, J= 7.4 Hz), 7.40 (d, 1H, J= 7.5 Hz), 8.01 (d, 1H, J= 8.6 Hz), 8.26 (dd, 1H, J= 8.7, 1.8 Hz), 8.81 (d, 1H, J= 1.5 Hz),10.86 (s, 1H);

Methyl (R)-6-(3-methyl-2-phenylbutanamido)nicotinate (45)

The yield is 52%, and as white solid.: ¾ NMR (CDCb, 400 MHz): δ 0.74 (d, 3H, J= 6.7), 1.10 (d, 3H, J= 6.4 Hz),2.45-2.58 (m, 1H), 3.29 (d, 1H, J= 10.6 Hz), 3.83 (s, 3H), 7.24-7.36 (m, 5H), 8.25-8.33 (m, 2H), 8.49 (s, lH br), 8.86 (d, 1H, J= 1.5 Hz);

Methyl 4-(2-(4-(trifluoromethyl)phenyl)acetamido)benzoate (47)

The yield is 47%, and as white solid.: ¾ NMR (CDCb, 300 MHz): δ 3.81 (s, 3H), 3.82 (s,

2H), 7.56 (d, 2H, J= 8.0 Hz), 7.70 (d, 2H, J= 8.1 Hz), 7.73 (d, 2H, J= 8.9 Hz), 7.92 (d, 2H, J = 8.9 Hz), 10.60 (s, 1H);

Methyl 5-(2-phenylacetamido)picolinate (48)

The yield is 71%, and as white solid.: ¾ NMR (DMSO, 400 MHz): δ 3.72 (s, 2H), 3.85 (s, 3H), 7.23-7.35 (m, 5H), 8.03 (d, 1H, J= 8.6 Hz), 8.25 (dd, 1H, J= 8.6, 2,4 Hz), 8.83 (d, 1H, J = 2.4 Hz), 10.74 (s, 1H);

Methyl 5-(2-(4-(trifluoromethyl)phenyl)acetamido)picolinate (49)

The yield is 72%, and as white solid.: ¾ NMR (CDCb, 400 MHz): δ 3.85 (s, 2H), 3.99 (s, 3H), 7.48 (d, 2H, J= 8.5 Hz), 7.63 (d, 2H, J= 8.5 Hz), 7.93 (s, 1H), 8.10 (d, 1H, J= 8.5 Hz), 8.44 (dd, 1H, J= 8.5 3.2 Hz), 8.57(d, 1H, J= 3.2 Hz);

Methyl 4-(3-phenylpropanamido)benzoate (50)

The yield is 37%, and as white solid.: ¾ NMR (CDCb, 300 MHz): δ 2.69 (t, 2H, J =7.8 Hz), 3.06 (t, 2H, J = 7.44 Hz), 3.89 (s, 3H), 7.20-7.33 (m, 5H), 7.28 (s, 1H), 7.52(d, 2H, J= 8.7 Hz), 7.97(dt, 2H, J= 8.8 Hz); Methyl 5-(3-phenylpropanamido)picolinate (51)

The yield is 70%, and as white solid.: ¾ NMR (DMSO, 400 MHz): δ 2.70 (d, 2H, J= 7.1 Hz), 2.93 (d, 2H, J= 7.2 Hz), 3.84 (s, 3H), 7.16-7.30 (m, 5H), 8.03 (d, 1H, J= 9.0 Hz), 8.24 (dd, 1H, J= 9.0, 2,4 Hz), 8.80 (d, 1H, J = 2.4 Hz), 10.49 (s, 1H);

Methyl 4-(2-methyl-2-phenylpropanamido)benzoate (52)

The yield is 80%, and as white solid.: ¾ NMR (CDCb, 300 MHz): δ 1.60 (s, 6H), 3.81 (s, 3H), 7.22-7.36 (m, 5H), 7.78(d, 2H, J= 8.8 Hz), 7.88(d, 2H, J= 8.8 Hz);

(S)-4-(3-methyl-2-phenylbutanamido)benzoic acid (53)

The yield is 17%, and as white solid.: ¾ NMR (CDCb, 300 MHz): δ 0.78 (d, 3H, J= 6.7 Hz), 1.19 (d, 3H, J= 6.5 Hz), 2.40-2.53 (m, 1H), 3.37 (d, 1H, J= 10.2), 6.56 (d, 2H, J= 8.8 Hz), 7.35-7.37 (m, 5H), 7.65(d, 2H, J= 8.8 Hz);

(R)-4-(3-methyl-2-phenylbutanamido)benzoic acid (54)

The yield is 23%, and as white solid.: ¾ NMR (CDCb, 300 MHz): δ 0.75 (d, 3H, J= 6.7 Hz), 1.11 (d, 3H, J= 6.5 Hz), 2.46-2.56 (m, 1H), 3.06 (d, 1H, J= 10.1), 7.27-7.40 (m, 5H), 7.57 (d, 2H, J= 8.6 Hz), 7.47 (s, 1H, br), 8.01 (d, 2H, J= 8.7 Hz);

(S)-5-(3-methyl-2-phenylbutanamido)picolinic acid (55)

The yield is 48%, and as white solid.: ¾ NMR (DMSO, 300 MHz): δ 0.66 (d, 3H, J= 6.63 Hz), 1.01 (d, 3H, J= 6.42 Hz), 2.30-2.38 (m, 1H), 3.31 (d, 1H, J=10.5 Hz), 7.21-7.42 (m, 5H), 7.87 (d, 1H, J= 8.4 Hz), 7.98 (dd, 1H, J= 8.4, 2.4 Hz), 8.70 (d, 1H, J= 2.3 Hz), 10.53 (s, 1H);

(R)-5-(3-methyl-2-phenylbutanamido)picolinic acid (56)

The yield is 78%, and as white solid.: ¾ NMR (DMSO, 500 MHz): δ 0.67 (d, 3H, J= 6.7 Hz), 1.01 (d, 3H, J= 6.5 Hz),2.32-2.39 (m, 1H), 3.52 (d, 1H, J= 10.6 Hz), 7.25 (t, 1H, J= 7.3 Hz), 7.33 (t, 2H, J= 7.5 Hz), 7.40(d, 2H, J= 7.4 Hz), 8.00 (d, 2H, J= 8.6 Hz), 8.25 (dd, 1H, J = 8.6, 2.4 Hz), 8.83 (d, 1H, J= 2.4 Hz), 10.72 (s, 1H);

(R)-6-(3-methyl-2-phenylbutanamido)nicotinic acid (57)

The yield is 71%, and as white solid.: ¾ NMR (DMSO, 300 MHz): δ 0.65 (d, 3H, J= 6.6 Hz), 1.00 (d, 3H, J= 6.5 Hz),2.30-2.41 (m, 1H), 3.52 (d, 1H, J= 10.7 Hz), 7.24 (t, 1H, J= 7.4 Hz), 7.32 (t, 2H, J= 7.6 Hz), 7.40(d, 2H, J= 7.5 Hz), 8.17-8.23 (m, 2H), 8.78 (d, 1H, J= 1.7 Hz), 11.05 (s, 1H);

4-(2-(4-(Trifluoromethyl)phenyl)acetamido)benzoic acid (59)

The yield is 48%, and as white solid.: ¾ NMR (DMSO, 300 MHz): δ 3.82 (s, 2H), 7.56 (d, 2H, J= 8.1 Hz), 7.69-7.72 (m, 4H), 7.89 (d, 2H, J= 8.7 Hz), 10.55 (s, 1H); 5-(2-Phenylacetamido)picolinic acid (60)

The yield is 80%, and as white solid.: ¾ NMR (DMSO, 400 MHz): δ 3.76 (s, 2H), 7.23- 7.38 (m, 5H), 7.98 (d, 1H, J= 8.5 Hz), 8.20 (dd, 1H, J= 8.5, 2.0 Hz), 8.90 (s, 1H);

5-(2-(4-(Trifluoromethyl)phenyl)acetamido)picolinic acid (61)

The yield is 77%, and as white solid. ¾ NMR (DMSO, 400 MHz): δ 3.86 (s, 2H), 7.57 (d,

2H, J= 8.5 Hz), 7.70 (d, 2H, J= 8.0 Hz), 8.02 (d, 1H, J= 8.5 Hz), 8.20 (m, 1H), 8.84(m, 1H), 10.84 (s, 1H);

4- (3-phenylpropanamido)benzoic acid (62)

The yield is 51%, and as white solid.: ¾ NMR (DMSO, 300 MHz): δ 2.67 (t, 2H, J= 8.1 Hz), 2.91 (t, 2H, J= 7.23 Hz), 7.15-7.31 (m, 5H), 7.69 (dt, 2H, J= 8.8, 2.1 Hz), 7.88 (dt, 2H, J = 8.8, 2.2 Hz);

5- (3-Phenylpropanamido)picolinic acid (63)

The yield is 68%, and as white solid. ¾ NMR (DMSO, 400 MHz): δ 2.72 (d, 2H, J= 7.4 Hz), 2.93 (d, 2H, J= 7.4 Hz), 7.17-7.31 (m, 5H), 8.04 (d, 1H, J= 8.3 Hz), 8.26 (dd, 1H, J= 8.3, 2,5 Hz), 8.86 (d, 1H, J= 1.9 Hz), 10.67 (s, 1H);

4-(2-Methyl-2-phenylpropanamido)benzoic acid (64)

The yield is 85%, and as white solid. ¾ NMR (CDCb, 300 MHz): δ 0.75 (d, 3H, J= 6.7 Hz), 1.11 (d, 3H, J= 6.5 Hz), 2.46-2.56 (m, 1H), 3.06 (d, 1H, J= 10.1), 7.27-7.40 (m, 5H), 7.57 (d, 2H, J= 8.6 Hz), 7.47 (s, 1H, br), 8.01 (d, 2H, J= 8.7 Hz);

(S)-N-(2-Amino-4-fluorophenyl)-4-(3-methyl-2-phenylbutanamid o)benzamide (4)

The yield is 36%, and as white solid. ¾ NMR (DMSO, 400 MHz): δ 0.68 (d, 3H, J= 6.7 Hz), 1.02 (d, 3H, J= 6.5 Hz), 2.31-2.40 (m, 1H), 3.37 (d, 1H, J= 10.6), 5.18 (s, 2H, br), 6.34 (td, 1H, J= 8.5, 2.8 Hz), 6.53 (dd, 1H, J= 11.2, 2.8 Hz), 7.09 (dd, 1H, J= 8.4, 6.7 Hz), 7.25 (t, 1H, J= 7.4 Hz), 7.34 (t, 2H, J= 7.3 Hz), 7.41 (t, 2H, J= 7.8 Hz), 7.69 (d, 2H, J= 8.7 Hz), 7.92 (d, 2H, J= 8.5 Hz), 9.47 (s, 1H), 10.32 (s, 1H); ¹³ C NMR (DMSO, 100MHz): δ 20.2, 21.2, 31.1, 60.6, 101.4, 101.7, 118.2(2C), 119.4, 126.9, 128.2, 128.3(2C), 128.5(2C), 128.6, 128.9, 139.5, 141.8, 145.3, 145.4, 159.7, 162.1, 164.8, 172.1.; [a] ²⁵ _D = +89. Γ (c 0.015 , MeOH), HRMS exact mass of (M-H)-, 404.1774 amu; observed mass of (M-H)-, 404.1764 amu.

(R)-N-(2-aminophenyl)-4-(3-methyl-2-phenylbutanamido)benzami de (3)

The yield is 51%, and as white solid. ¾ NMR (DMSO, 300 MHz): δ 0.68 (d, 3H, J= 6.7

Hz), 1.02 (d, 3H, J= 6.4 Hz), 2.32-2.40 (m, 1H), 3.33 (d, 1H, J= 10.7), 4.87 (s, 2H, br), 6.59 (td, 1H, J= 7.7, 1.2 Hz), 6.77 (dd, 1H, J= 8.0, 1.2 Hz), 6.97 (td, 1H, J= 7.9, 1.4 Hz), 7.15 (d, 1H, J= 7.0 Hz), 7.25 (t, 1H, J= 7.2 Hz), 7.34 (t, 2H, J= 7.3 Hz), 7.43 (d, 2H, J= 7.1 Hz), 7.71 (d, 2H, J= 8.7 Hz), 7.93 (d, 2H, J= 8.7 Hz), 9.57 (s, 1H), 10.36 (s, 1H); ¹³ C NMR (DMSO, 100MHz): 5 20.2, 21.2, 31.1, 60.6, 116.1, 116.3, 118.3(2C), 123.5, 126.3, 126.6, 126.9,

128.2(2C), 128.3(2C), 128.6(2C), 129.0, 139.5, 141.8, 143.1, 164.6, 172.1; [a] ²⁵ _D = -87.2° (c 0.015 , MeOH), HRMS exact mass of (M-H) ^" , 386.1869 amu; observed mass of (M-H) ^" , 386.1863 amu.

(R)-N-(2-amino-4-fluorophenyl)-4-(3-methyl-2-phenylbutanamid o)benzamide (5)

The yield is 76%, and as white solid. ¾ NMR (DMSO, 400 MHz): 5 0.68 (d, 3H, J= 6.6 Hz), 1.02 (d, 3H, J= 6.4 Hz), 2.31-2.40 (m, 1H), 3.28 (d, 1H, J= 10.6), 5.18 (s, 2H, br), 6.35 (td, 1H, J= 8.6, 2.7 Hz), 6.53 (dd, 1H, J= 11.2, 2.8 Hz), 7.09 (t, 1H, J= 7.04 Hz), 7.25 (t, 1H, J = 7.3 Hz), 7.34 (t, 2H, J= 7.4 Hz), 7.42 (t, 2H, J= 7.6 Hz), 7.69 (d, 2H, J= 8.6 Hz), 7.92 (d, 2H, J= 8.4 Hz), 9.48 (s, 1H), 10.34 (s, 1H); ¹³ C NMR (DMSO, lOOMHz): 5 20.2, 21.2, 31.1,

60.6, 101.7, 118.2(2C), 119.4(2C), 126.9, 128.2(2C), 128.3(2C), 128.4, 128.6(2C), 128.9, 139.5, 141.8, 145.4, 162.1, 162.7, 172.1; [a] ²⁵ _D = -89.6° (c 0.010 , MeOH),HRMS exact mass of (M- H)-, 404.1774 amu; observed mass of (M-H)-, 404.1764 amu

(S)-N-(2-amino-4-fluorophenyl)-5-(3-methyl-2-phenylbutanamid o)picolinamide (11) The yield is 37%, and as white solid. ¾ NMR (DMSO, 300 MHz): 5 0.69 (d, 3H, J= 6.6

Hz), 1.03 (d, 3H, J= 6.5 Hz), 2.33-2.43 (m, 1H), 3.31 (d, 1H, J= 10.6), 6.40 (td, 1H, J= 8.6, 2.8 Hz), 6.68 (dd, 1H, J= 11.6, 2.8 Hz), 7.24-7.43 (m, 6H), 8.06 (d, 2H, J= 8.6 Hz), 8.24 (dd, 1H, J = 8.6, 2.4 Hz), 8.87 (d, 1H, J= 2.1 Hz), 9.86 (s, 1H), 10.64 (s, 1H); ¹³ C NMR (DMSO, lOOMHz): 5 20.1, 21.2, 31.1, 60.6, 102.3, 119.7, 119.7, 122.8, 126.6, 126.8, 126.9, 127.1, 128.2, 128.4, 138.1, 138.9, 139.1, 144.5, 159.4, 162.2, 172.6; [a] ²⁵ _D = +88.0° (c 0.015 , MeOH), HRMS exact mass of (M-H)-, 405.1727 amu; observed mass of (M-H)-, 405.1719 amu.

(R)-N-(2-amino-4-fluorophenyl)-5-(3-methyl-2-phenylbutanamid o)picolinamide (14) The yield is 44%, and as white solid. ¾ NMR (DMSO, 400 MHz): 5 0.68 (d, 3H, J= 6.6 Hz), 1.03 (d, 3H, J= 6.3 Hz), 2.32-2.41 (m, 1H), 3.31 (d, 1H, J= 10.9), 5.18 (s, 2H), 6.39 (td, 1H, J= 8.8, 2.7 Hz), 6.68 (dd, 1H, J= 11.6, 2.1 Hz), 7.26 (dd, 1H, J= 7.6, 1.1 Hz), 7.30-7.36 (m, 3H), 7.41 (d, 1H, J = 8.1 Hz), 8.06 (d, 1H, J= 8.4 Hz), 8.25 (dd, 1H, J= 8.5, 1.6 Hz), 8.87 (d, lH, J= 2.3 Hz), 9.85 (s, 1H), 10.67 (s, 1H); ¹³ C NMR (DMSO, lOOMHz): 5 20.1, 21.2, 31.1, 60.6, 102.3, 119.7, 119.7, 122.8, 126.6, 126.8, 126.9, 127.1, 128.2, 128.4, 138.1, 138.9, 139.1, 144.5, 159.4, 162.2, 172.6; [a] ²⁵ _D = -87.5° (c 0.015 , MeOH), HRMS exact mass of (M-H) ^" , 405.1727 amu; observed mass of (M-H) ^" , 405.1724 amu.

(R)-N-(2-amino-4-fluorophenyl)-6-(3-methyl-2-phenylbutanamid o)nicotinamide

(17)

The yield is 37%, and as white solid. ¾ NMR (DMSO, 400 MHz): 5 0.66 (d, 3H, J= 6.7 Hz), 1.02 (d, 3H, J= 6.4 Hz), 2.34-2.41 (m, 1H), 3.52 (d, 1H, J= 10.6), 5.27 (s, 2H), 6.33 (td, 1H, J= 8.5, 2.7 Hz), 6.52 (dd, 1H, J= 11.2, 2.8 Hz), 7.09 (dd, 1H, J= 8.25, 6.6 Hz), 7.25 (t, 1H, J= 7.3 Hz), 7.33 (t, 2H, J= 7.5 Hz), 7.42 (d, 2H, J= 7.4 Hz), 8.18 (d, 1H, J= 8.8 Hz), 8.30 (dd, 1H, J= 8.7, 1.9 Hz), 8.89 (s, 1H), 9.62 (s, 1H), 10.99 (s, 1H); ¹³ C NMR (CDCb, 100MHz); δ 20.3, 21.8, 31.5, 63.1, 105.2, 113.1, 119.4, 119.5, 125.4, 127.8(2C), 128.4(2C), 129.0(2C), 137.5, 138.3, 147.8, 153.7, 161.0, 164.1, 171.4, 172.7; [a] ²⁵ _D = -87.2° (c 0.020 , MeOH);

(M+H) ⁺ , 407.1883 amu; observed mass of (M+H) ⁺ , 407.1885 amu.

N-(2-amino-4-fluorophenyl)-4-(2-(4-(trifluoromethyl)phenyl)a cetamido)benzamide

(20)

The yield is 65%, and as white solid. ¾ NMR (DMSO, 300 MHz): δ 3.84 (s, 2H), 6.37 (td, 1H, J= 8.3, 2.3 Hz), 6.56 (dd, 1H, J= 11.0, 2.4 Hz), 7.11 (t, 1H, J= 8.3 Hz), 7.8 (d, 1H, J= 7.8 Hz), 7.69-7.73 (m, 4H), 7.96 (d, 2H, J= 8.4 Hz), 9.52 (s, 1H), 10.59 (s, 1H); ¹³ C NMR (DMSO, lOOMHZ): 5 42.8, 101.9, 118.2(2C), 119.6, 125.1, 125.1, 125.7, 127.2, 127.5, 128.4, 128.5(2C), 128.7, 129.0(2C), 130.1, 140.6, 141.9, 145.1, 159.7, 165.0, 168.8; HRMS exact mass of (M-H) ^" , 430.1179 amu; observed mass of (M-H) ^" , 430.1174 amu.

N-(2-amino-4-fluorophenyl)-5-(2-phenylacetamido)picolinamide (21)

The yield is 41%, and as white solid. ¾ NMR (DMSO, 400 MHz): δ 3.74 (s, 2H), 5.20 (s, 2H), 6.39 (td, 1H, J= 8.9, 2.8 Hz), 6.58 (dd, 1H, 7= 11.1, 2.8 Hz), 7.25-7.37 (m, 6H), 8.08 (d, 1H, 7= 8.5 Hz), 8.24 (dd, 1H, 7= 8.5, 2.4 Hz), 8.91 (d, 1H, 7= 2.4 Hz), 9.88 (s, 1H), 10.72 (s, 1H); ¹³ C NMR (DMSO, 100MHz): 5 43.2, 102.4, 119.8, 119.8, 122.9, 126.6, 126.8, 127.0, 128.5(2C), 129.3(2C), 135.4, 138.4, 139.1, 144.5, 144.5, 144.6, 159.5, 161.9, 162.5, 170.2; HRMS exact mass of (M-H) ^" , 363.1257 amu; observed mass of (M-H) ^" , 363.1252 amu

N-(2-amino-4-fluorophenyl)-5-(2-(4-(trifluoromethyl)phenyl)a cetamido)

picolinamide (23)

The yield is 64%, and as white solid. ¾ NMR (DMSO, 400 MHz): 5 3.88 (s, 2H), 5.20 (s, 2H), 6.39 (td, 1H, 7= 8.5, 3.2 Hz), 6.57 (dd, 1H, 7= 11.2, 3.2 Hz), 7.33 (dd, 1H, 7= 9.1, 6.4

Hz), 7.33 (d, 2H, 7= 8.0 Hz), 7.71 (d, 2H, 7= 8.0 Hz), 8.09 (d, 1H, 7= 8.7 Hz), 8.23 (dd, 1H, 7 = 8.5, 2.0 Hz), 8.91 (d, 1H, 7= 2.0 Hz), 9.87 (s, 1H), 10.78 (s, 1H); ¹³ C NMR (DMSO,

100MHz): 5 42.6, 102.3, 119.7, 119.7, 122.8, 123.0, 125.1, 125.7, 126.6, 126.8, 127.5, 130.2, 138.2, 138.9, 140.1, 144.4, 144.5, 159.4, 165.3, 169.3; HRMS exact mass of (M+H) ⁺ , 433.1288 amu; observed mass of (M+H) ⁺ , 433.1287 amu.

N-(2-aminophenyl)-4-(2-(4-(trifluoromethyl)phenyl)acetamido) benzamide (24)

The yield is 54%, and as white solid. ¾ NMR (DMSO, 300 MHz): 5 3.83 (s, 2H), 4.90 (s, 2H), 6.60 (td, 1H, 7= 7.7, 1.1 Hz), 6.78 (dd, 1H, 7= 7.9, 1.1 Hz), 6.97 (td, 1H, 7= 8.1, 1.4 Hz), 7.16 (d, 1H, 7= 6.9 Hz), 7.58 (d, 2H, 7= 8.4 Hz), 7.69-7.73 (m, 4H), 7.96 (d, 2H, 7= 8.6 Hz), 9.56 (s, 1H), 10.20 (s, 1H); ¹³ C MR (DMSO, 100MHz): δ 42.8, 116.2, 118.3(2C), 123.1, 123.5, 125.0, 125.1, 125.7, 126.5, 127.2, 127.5, 128.7(2C), 129.1, 130.1(2C), 140.5, 141.8, 143.1, 164.4, 168.8; HRMS exact mass of (M-H) ^" , 412.1273 amu; observed mass of (M-H) ^" , 412.1266 amu.

N-(2-amino-4-fluorophenyl)-4-(3-phenylpropanamido)benzamide (25)

The yield is 53%, and as white solid. ¾ NMR (DMSO, 300 MHz): δ 2.67 (t, 2H, J= 8.1 Hz), 2.91 (t, 2H, J= 7.23 Hz), 6.60 (t, 1H, J= 7.7 Hz), 6.78 (d, 1H, J= 7.9 Hz), 6.99 (td, 1H, J = 8.2, 1.3 Hz), 7.15-7.32 (m, 6H), 7.70 (d, 2H, J= 8.6 Hz), 7.91 (d, 2H, J= 8.6 Hz); 9.53 (s, 1H), 10.15 (s, 1H); ¹³ C NMR (DMSO, 100MHz): δ 30.7, 38.0, 101.7, 118.1(2C), 119.2, 126.0, 128.2(2C), 128.3(2C), 128.4, 128.7(2C), 128.7, 141.1, 141.1, 142.0, 145.4, 162.1, 163.1, 170.8; HRMS exact mass of (M-H)-, 376.1461 amu; observed mass of (M-H)-, 376.1453 amu.

N-(2-amino-4-fluorophenyl)-5-(3-phenylpropanamido)picolinami de (26)

The yield is 48%, and as white solid. ¾ NMR (DMSO, 400 MHz): δ 2.72 (d, 2H, J= 7.3 Hz), 2.95 (d, 2H, J= 7.3 Hz), 5.20 (s, 2H), 6.39 (td, 1H, J= 8.5, 2.9 Hz), 6.58 (dd, 1H, J= 11.2, 2.9 Hz), 7.17-7.37 (m, 6H), 8.07 (d, 1H, J= 8.7 Hz), 8.23 (dd, 1H, J= 8.5, 2.4 Hz), 8.87 (d, 1H, J= 2.4 Hz), 9.86 (s, 1H), 10.48 (s, 1H); ¹³ C NMR (DMSO, 100MHz): δ 30.6, 38.0, 102.4, 119.8, 119.8, 122.9, 126.1, 126.5, 126.9, 127.0, 129.3(2C), 128.5(2C), 138.4, 139.0, 141.0, 144.4, 161.9, 162.5, 171.5 HRMS exact mass of (M-H) ^" , 377.1414 amu; observed mass of (M- H)-, 377.1405 amu.

N-(2-aminophenyl)-4-(2-methyl-2-phenylpropanamido)benzamide (27)

The yield is 54%, and as white solid. ¾ NMR (DMSO, 300 MHz): δ 1.59 (s, 6H), 4.87 (s, 2H, br), 6.59 (t, 1H, J= 7.4 Hz), 6.78 (d, 1H, J= 7.65 Hz), 6.96 (t, 1H, J= 7.62 Hz), 7.15 (d, 1H, J= 7.6 Hz), 7.24-7.37 (m, 5H), 7.75 (d, 2H, J= 8.6 Hz), 7.92 (d, 2H, J= 8.5 Hz), 9.37 (s, 1H), 9.57 (s, 1H); ¹³ C NMR (DMSO, 100MHz): δ 26.7(2C), 47.5, 116.1, 116.3, 119.2(2C), 123.5, 125.7(2C), 126.3, 126.5, 126.6, 128.2(2C), 128.4(2C), 129.0, 142.1, 143.1, 145.5, 164.7, 175.1 HRMS exact mass of (M-H)-, 372.1712 amu; observed mass of (M-H)-, 372.1705 amu.

N-(2-amino-4-fluorophenyl)-4-(2-methyl-2-phenylpropanamido)b enzamide (28) The yield is 78%, and as white solid. : ¾ NMR (DMSO, 300 MHz): δ 1.58 (s, 6H), 5.19 (s, 2H, br), 6.35 (td, 1H, J= 8.4, 2.8 Hz), 6.54 (dd, 1H, J= 11.2, 2.9 Hz), 7.10 (td, 1H, J= 6.64, 1.72 Hz), 7.23-7.37 (m, 5H), 7.74 (d, 2H, J= 8.7 Hz), 7.91 (d, 2H, J= 8.6 Hz), 9.35 (s, 1H),

9.48 (s, 1H); ¹³ C NMR (DMSO, 100MHz): δ 26.7, 47.5, 101.4, 101.6, 101.9, 102.1, 119.1(2C), 119.4, 119.5, 125.7, 126.4, 128.3(2C), 128.4(2C), 128.5, 128.9, 142.1, 145.3, 145.4, 145.5, 159.7, 162.1, 165.0, 175.1.; HRMS exact mass of (M+H) ⁺ , 392.1774 amu; observed mass of (M+H) ⁺ , 392.1775 amu. 31.

6, 7, 8, 9, 10, 12, 13, 15, 16, 19, 22, 29, 30, 31

Reagent and condition: (a) THF, Et ₃ N, r.t. (b) LiOH, MeOH, H ₂ 0, rt. (c) HATU, Et ₃ N, DMF, rt. (d) HATU, Et ₃ N, DMF (e) TFA, DCM, rt.;

Step a.

A mixture of 4-nitrobenzoyl chloride (204 mg, 1.1 mmol), tert-butyl (2-amino-5- fluorophenyl)carbamate (248 mg, 1.1 mmol), and triethylamine (333 mg, 3.3 mmol) in THF (5.0 mL) was flushed with argon, and stirred at r.t. for 8 hours. The reaction mixture extracted with NaHC03(sat) (30 mL) and ethyl acetate (30.0 mL x 3). The organic solvent dried with Na ₂ S0 ₄ , filtered, and evaporated. The crude product was purified with flash column chromatography on silica gel, and using 20% Ethyl acetate/Hexanes to afford 68 [tert-butyl (5-fluoro-2-(4- nitrobenzamido)phenyl)carbamate]. The yield is 80%, and as off white solid. : ¹ H NMR (CDCb, 500 MHz): δ 1.52 (s, 9H), 6.76 (s, 1H), 6.96-6.99 (m, 2H), 7.75-7.77 (m, 1H), 8.12 (d, 2H, J = 8.45 Hz), 8.32 (d, 2H, J= 8.45 Hz), 9.45 (s, 1H).

Step b:

A mixture of tert-butyl (5-fluoro-2-nitrophenyl)carbamate (68, 187 mg, 0.5 mmol), EA (10 mL), MeOH (10 mL), Pd/C ( 20 mg, 10% wt %), The reaction was stirred for 2 hours at room temperature under hydrogen. Filtered by celite, remove solvent by rota vapor. The crude product was purified with flash column chromatography on silica gel, and using 20% ethyl

acetate/hexanes to afford 69 [tert-butyl (2-(4-aminobenzamido)-5-fluorophenyl)carbamate]. The yield is 95%, and as off white solid.: ¾ NMR (DMSO, 500 MHz): δ 1.46 (s, 9H), 5.81 (s, 2H), 6.61 (d, 2H, J= 8.7 Hz), 6.96 (td, 1H, J= 8.3, 2.9 Hz), 7.42-7.47 (m, 2H), 7.69 (d, 2H, J= 8.6 Hz), 8.68 (s, 1H) 9.45 (s, 1H) Step c:

A mixture of 5-aminopicolinic acid (159 mg, 1.1 mmol), tert-butyl (2-amino-5- fluorophenyl)carbamate (69, 248 mg, 1.1 mmol), triethylamine (333 mg, 3.3 mmol) in dimethylformamide (2.0 mL) was flushed with argon, and stirred at r.t. for 12 hours. The reaction mixture extracted with ice water (20.0 mL) and ethyl acetate (5.0 mL x 3). The combined organic extracts were washed with 2M HCl(aq) (5.0 mL), NaHC0 ₃ ( _Sa t) (25.0 mL). The combined organic layers were dried over Na ₂ S04 The crude product was purified with flash column chromatography on silica gel, and using 20% Ethyl acetate/Hexanes to afford the 72 [tert-butyl(2-(5-aminopicolinamido)-5-fluorophenyl)carbamate ]. The yield is 72%, and as off white solid.: ¾ NMR (DMSO, 500 MHz): δ 1.49 (s, 9H), 6.11 (s, 2H), 7.02-7.07 (m, 2H), 7.14- 7.16 (m, 1H), 7.81 (d, 1H, J= 8.5 Hz), 7.87-7.90 (m, lH), 7.93 (s, 1H), 9.09 (s, 1H), 10.10 (s, 1H).

Step d & e.

A mixture of (R)-2-phenylbutanoic acid (328 mg, 2.0 mmol), tert-butyl(2-(5- aminopicolinamido)-5-fluorophenyl)carbamate (621 mg, 1.8 mmol), triethylamine (374 mg, 3.7 mmol), and HATU (684 mg, 1.8 mmol) in dimethylformamide (5.0 mL) was flushed with argon, and stirred at r.t. for 12 hours. The reaction mixture extracted with ice water (50.0 mL) and ethyl acetate (15.0 mL x 3). The combined organic extracts were washed with 2M HCl(aq) (20.0 mL), NaHC03(sat) (20.0 mL). The combined organic layers were dried over Na ₂ S0 ₄ The crude product was purified with flash column chromatography on silica gel, and using 20% Ethyl

acetate/Hexanes to afford the Boc-15 [tert-butyl (R)-(5-fluoro-2-(5-(2- phenylbutanamido)picolinamido)phenyl)carbamate] as a dark yellow oil. Then added DCM (20.0 mL), trifluoroacetic acid (2.0 mL) and stirred at r.t. for 2 hours. Remove DCM by rota vapor, neutralized by NaHC0 ₃ ( _aq )to pH > 8.0, extracted by ethyl acetate. Use EA/Pentane to recrystallize it and get pale white powder 15 [(R)-N-(2-amino-4-fluorophenyl)-5-(2- phenylbutanamido)picolinamide]. The yield is 60%, and as white solid. : ¾ NMR (DMSO, 500 MHz): δ 0.87 (t, 3H, J= 7.2 Hz), 1.72-1.78 (m, 1H), 2.05-2.11 (m, 1H), 3.63 (t, 1H, 7= 7.6 Hz), 5.19 (s, 2H), 6.39 (td, 1H, 7= 8.6, 2.4 Hz), 6.58 (dd, 1H, 7= 10.9, 2.0 Hz), 7.25 (t, 1H, 7= 7.3 Hz), 7.31-7.36 (m, 3H), 7.40-7.41 (m, 2H), 8.07 (d, 1H, 7= 8.6 Hz), 8.26 (dd, 1H, 7= 8.6, 2.0 Hz), 8.89 (s, 1H), 9.86 (s, 1H), 10.63 (s, 1H); ¹³ C NMR (DMSO, 125 MHz): δ 12.6, 26.9, 54.5, 102.6, 103.0, 120.2, 123.3, 127.1, 127.3, 127.3, 127.5, 128.2, 129.0, 138.8, 139.4, 140.4, 144.9, 144.9, 160.1, 162.0, 162.8, 173.1; HRMS exact mass of (M-H) ^" , 391.1571 amu; observed mass of (M-H)-, 391.1564 amu. [a] ²⁰ _D = -93° (c 0.025 , MeOH) tert-butyl (2-(4-nitrobenzamido)-5-(trifluoromethyl)phenyl)carbamate (70)

The yield is 70%, and as white solid.: ¾ NMR (CDCb, 500 MHz): δ 1.54 (s, 9H), 6.76- 6.77 (m, lH), 7.41 (s, 1H), 7.53-7.55 (m, 1H), 8.13-8.15 (m, 3H), 8.31-8.33 (m, 2H), 9.89 (s, 1H) tert-butyl (2-(4-aminobenzamido)-5-(trifluoromethyl)phenyl)carbamate (71)

The yield is 95%, and as white solid. : 'H NMR (DMSO, 500 MHz): δ 1.47 (s, 9H), 5.86 (s, 2H),

6.60-6.63 (m, 2H), 7.46-7.48 (m, 1H), 7.68-7.71 (m, 2H), 7.78-7.80 (m, 1H), 7.89-7.79 (m, 1H), 8.94 (s, 1H), 9.60 (s, 1H)

(R)-N-(2-amino-4-(trifluoromethyl)phenyl)-4-(3-methyl-2-phen ylbutanamido) benzamide (6)

The yield is 50%, and as white solid. : ¾ NMR (DMSO, 500 MHz): δ 0.67 (d, 3H, J= 6.65

Hz), 1.03(d, 3H, J= 6.45 Hz), 2.35-2.39 (m, 1H), 3.28-3.30 (m, 1H), 5.38 (s, 2H), 6.88 (dd, 1H, J= 8.2, 2.0 Hz), 7.09 (d, 1H, J= 1.6 Hz), 7.26 (t, 1H, J= 7.5 Hz), 7.34 (t, 2H, J= 7.5 Hz), 7.41- 7.43 (m, 3H), 7.72 (d, 2H, J= 8.7 Hz), 7.94 (d, 2H, J= 8.7 Hz), 9.65 (s, 1H), 10.36 (s, 1H) ¹³ C NMR (DMSO, 125 MHz): 5 20.6, 21.7, 31.6, 61.1, 112.4, 112.4, 112.7, 112.7, 118.8, 123.9, 126.0, 126.9, 127.1, 127.2, 127.3, 127.4, 128.7, 128.8, 129.2, 129.3, 139.9, 142.5, 143.8, 165.4, 172.6; HRMS exact mass of (M-H) ^" , 454.1743 amu; observed mass of (M-H) ^" , 454.1734 amu.

(S)-N-(2-amino-4-fluorophenyl)-4-(2-phenylbutanamido)benzami de (7)

The yield is 55%, and as white solid.: ¾ NMR (DMSO, 500 MHz): δ 0.87 (t, 3H, J= 7.2 Hz), 1.70-1.76 (m, 1H), 2.05-2.10 (m, 1H), 3.61 (t, 1H, J= 7.7 Hz), 5.19 (s, 2H), 6.33-6.37 (m, 1H), 6.54 (dd, 1H, J= 2.4, 11.3 Hz), 7.10 (t, 1H, J= 7.55 Hz), 7.24-7.27 (m, 1H), 7.34 (t, 2H, J = 7.4 Hz), 7.40-7.41 (m, 2H), 7.71 (d, 2H, J= 8.5 Hz), 7.93 (d, 2H, J= 8.3 Hz), 9.48 (s, 1H), 10.33 (s, 1H); ¹³ C NMR (DMSO, 125 MHz): δ 12.7, 26.8, 54.5, 101.9, 102.1,102.4,118.7, 119.9, 127.3, 128.2, 128.9, 128.9, 129.0, 129.1, 129.3, 140.7, 142.4, 145.8, 145.9, 160.5, 165.4, 172.5; HRMS exact mass of (M-H) ^" , 390.1618 amu; observed mass of (M-H) ^" , 390.1613 amu. [a] ²⁰ _D = +82.3° (c 0.01 , MeOH)

(S)-N-(2-amino-4-fluorophenyl)-4-(2-phenylpropanamido)benzam ide (8)

The yield is 36%, and as white solid.: ¾ NMR (DMSO, 500 MHz): δ 1.44 (d, 3H, J= 7.0 Hz), 3.87 (q, lH, J= 6.9 Hz), 5.19 (s, 2H), 6.33-6.37 (m, 1H,), 6.54 (dd, 1H, J= 11.1, 2.6 Hz), 7.10 (t, 1H, J= 6.9 Hz), 7.25 (t, 1H, J= 7.3 Hz), 7.34 (t, 2H, J= 7.4 Hz), 7.40-7.41 (m, 2H), 7.70 (d, 2H, J= 8.6 Hz), 7.93 (d, 2H, J= 8.4 Hz), 9.48 (s, lH), 10.30 (s, lH); ¹³ C NMR (DMSO, 125 MHz): δ 19.2, 46.5, 101.9, 102.1, 102.4, 102.6, 118.7, 119.9, 127.3, 127.8, 128.9, 129.0, 129.1, 129.3, 142.1, 142.5, 145.9, 146.0, 160.5, 162.4, 165.4, 173.1; HRMS exact mass of (M- H)-, 376.1462 amu; observed mass of (M-H) ^" , 376.1458 amu. [a] ^D ₂₀ = +42° (c 0.005, MeOH) (R)-N-(2-amino-4-fluorophenyl)-4-(2-phenylbutanamido)benzami de (9)

The yield is 54%, and as white solid.: ¾ NMR (DMSO, 500 MHz): δ 0.88 (t, 3H, J= 7.2 Hz), 1.71-1.77 (m, 1H), 2.05-2.11 (m, 1H), 3.61 (t, 1H, J= 7.1 Hz), 5.16 (s, 2H), 6.34-6.37 (m, 1H), 6.55 (dd, 1H, J= 10.9, 2.5 Hz), 7.09-7.12 (m, 1H), 7.24-7.27 (m, 1H), 7.34 (t, 2H, J= 7.3 Hz), 7.41 (d, 2H, J= 7.5 Hz), 7.71 (d, 2H, J= 8.4 Hz), 7.93 (d, 2H, J = 8.2 Hz), 9.46 (s, 1H), 10.30 (s, 1H); ¹³ C NMR (DMSO, 125 MHz): δ 12.7, 26.8, 54.5, 101.9, 102.1, 102.4, 102.6, 118.7, 119.9, 127.3, 128.2, 128.3, 128.9, 129.0, 129.1, 129.4, 140.7, 142.4, 145.8, 145.9, 160.5, 165.4, 172.5; HRMS exact mass of (M-H) ^" , 390.1618 amu; observed mass of (M-H) ^" , 390.1617 amu. [a] ²⁰ D = -90. Γ (c 0.005, MeOH)

(R)-N-(2-amino-4-fluorophenyl)-4-(2-phenylpropanamido)benzam ide (10)

The yield is 45%, and as white solid.; ¾ NMR (DMSO, 500 MHz): δ 1.44 (d, 3H, J= 6.9 Hz), 3.87 (q, 1H, J= 6.8 Hz), 5.19 (s, 2H), 6.33-6.37 (m, 1H,), 6.54 (dd, 1H, J= 11.7, 2.3 Hz), 7.10 (t, 1H, J= 7.7 Hz), 7.25 (t, 1H, J= 6.7 Hz), 7.34 (t, 2H, J= 7.7 Hz), 8.41 (d, 2H, J=7.7 Hz), 7.70 (d, 2H, J= 8.3 Hz), 7.93 (d, 2H, J= 7.9 Hz), 9.48 (s, lH), 10.30 (s, lH); ¹³ C NMR (DMSO, 125 MHz): δ 19.1, 46.5, 101.8, 102.1, 102.4, 102.6, 118.7, 119.9, 127.2, 127.7, 128.9, 129.1, 129.3, 142.1, 142.5, 145.8, 145.9, 160.5, 162.4, 165.4, 173.1; HRMS exact mass of (M- H)-, 376.1462 amu; observed mass of (M-H) ^" , 376.1463 amu. [a] ²⁰ _D = -80.3° (c 0.01 , MeOH) (S)-N-(2-amino-4-fluorophenyl)-4-(2-phenylbutanamido)benzami de (12)

The yield is 59%, and as white solid.; ¾ NMR (DMSO, 500 MHz): δ 0.88 (t, 3H, J= 7.3 Hz), 1.73-1.79 (m, 1H), 2.06-2.12 (m, 1H), 3.64 (t, 1H, J= 7.2 Hz), 5.19 (s, 2H), 6.39 (td, 1H, J = 8.7, 2.6 Hz), 6.58 (dd, 1H, J= 10.9, 2.5 Hz), 7.27 (t, 1H, J= 7.2 Hz), 7.31-7.37 (m, 3H), 7.41 (d, 2H, J= 7.5 Hz), 8.07 (d, 1H, J= 8.6 Hz), 8.26 (dd, 1H, J= 8.6, 2.0 Hz), 8.89 (d, 1H, J= 1.7 Hz), 9.86 (s, 1H), 10.63 (s, 1H) ); ¹³ C NMR (DMSO, 125 MHz): δ 12.6, 26.9, 54.5, 102.4, 102.6, 102.9, 103.1, 123.3, 127.1, 127.3, 127.3, 127.5, 128.2, 129.0, 138.7, 139.4, 140.4, 145.0(2C), 160.1, 162.8, 173.1; HRMS exact mass of (M-H) ^" , 391.1571 amu; observed mass of (M-H) ^" , 391.1566 amu. [a] ²⁰ _D = +81° (c 0.01 , MeOH)

(S)-N-(2-amino-4-fluorophenyl)-5-(2-phenylpropanamido)picoli namide (13)

The yield is 50%, and as white solid.; ¾ NMR (DMSO, 500 MHz): δ 1.46 (d, 3H, J= 7.0 Hz), 3.91 (q, 1H, J= 7.1 Hz), 5.19 (s, 2H), 6.39 (td, 1H, J= 2.75, 8.45 Hz), 6.57 (dd, 1H, J = 2.95, 11.5 Hz), 7.25-7.28 (m, 1H), 7.31-7.37 (m, 3H), 704-7.42 (m, 2H), 8.06 (d, 1H, J= 8.5 Hz), 8.25 (dd, 1H, J= 8.7, 2.6 Hz), 8.90 (d, 1H, J= 2.3 Hz), 9.86 (s,lH), 10.61 (s,lH); ¹³ C NMR (DMSO, 125 MHz): δ 19.2, 30.9, 46.6, 102.6, 103.0, 120.3, 123.3, 127.1, 127.3, 127.3, 127.4, 127.8, 129.0, 138.8, 139.4, 141.8, 144.9, 145.0, 160.1, 162.8, 173.6; HRMS exact mass of (M-H) ^" , 377.1414 amu; observed mass of (M-H) ^" , 377.1413 amu. [a] ²⁰ _D = +40° (c 0.005, MeOH) (R)-N-(2-amino-4-fluorophenyl)-5-(2-phenylpropanamido)picoli namide (16)

The yield is 38%, and as brown solid.; 1H MR (DMSO, 500 MHz): δ 1.46 (d, 3H, J= 7.0 Hz), 3.91 (q, lH, J= 6.8 Hz), 5.19 (s, 2H), 6.39 (td, 1H, J= 8.8, 2.9 Hz), 6.58 (dd, 1H, J= 11.1, 2.8 Hz), 7.25-7.28 (m, 1H), 7.31-7.37 (m, 3H), 7.40-7.42 (m, 2H), 8.07 (d, 1H, J= 8.6 Hz), 8.25 (dd, 1H, J= 8.7, 1.9 Hz), 8.90 (d, 1H, J= 1.5 Hz), 9.86 (s,lH), 10.60 (s,lH) ); ¹³ C MR

(DMSO, 125 MHz): δ 19.18, 46.5, 102.4, 102.6, 102.9, 103.1, 120.2, 123.3, 127.1, 127.3, 127.3, 127.4, 127.8,129.0, 138.8, 139.4, 141.8, 144.9, 145.0, 160.1, 162.8, 173.6; HRMS exact mass of (M-H)-, 377.1414 amu; observed mass of (M-H) ^" , 377.1406 amu. [a] ²⁰ _D = -36° (c 0.005, MeOH) N-(2-amino-4-fluorophenyl)-4-(2-(4-fluorophenyl)acetamido)be nzamide (19)

The yield is 65%, and as white solid.; ¾ NMR (DMSO, 500 MHz): δ 3.69 (s, 2H), 5.20 (s,

2H), 6.36 (td, 1H, J= 8.5, 2.7 Hz), 6.54 (dd, 1H, J= 11.3, 2.8 Hz), 7.09-7.11(m, 1H), 7.15-7.18 (m, 2H), 7.37-7.39 (m, 2H), 7.70-7.72 (m, 2H), 7.94-7.95 (m, 2H), 9.49 (s, 1H), 10.42 (s, 1H); ¹³ C NMR (DMSO, 125 MHz): δ 42.8, 102.0, 102.5, 115.5, 118.7, 119.9, 128.9, 129.0, 129.2, 129.4, 131.6, 132.3, 142.4, 145.9, 146.0, 160.5, 160.7, 162.4, 162.6, 165.4, 169.9; HRMS exact mass of (M-H) ^" , 380.1211 amu; observed mass of (M-H) ^" , 380.1209 amu.

N-(2-amino-4-fluorophenyl)-5-(2-(4-fluorophenyl)acetamido)pi colinamide (22)

The yield is 43%, and as light brown solid.; ¾ NMR (DMSO, 500 MHz): δ 3.75 (s, 2H), 5.20 (s, 2H), 6.40 (td, 1H, J= 8.1, 1.9 Hz), 6.34 (dd, 1H, 7= 11.1, 2.9 Hz), 7.17 (t, 2H, 7= 8.9 Hz), 7.33 (dd, 1H, 7= 8.5, 6.8 Hz), 7.38 (dd, 2H, 7= 8.3, 5.4 Hz), 8.07 (d, 1H, 7= 8.6 Hz), 8.22- 8.25 (m, 1H), 8.91 (d, 1H, 7= 1.8 Hz), 9.88 (s, 1H), 10.72 (s, 1H); ¹³ C NMR (DMSO, 125

MHz): δ 42.5, 102.6, 103.0, 115.4, 115.6, 120.2, 123.3, 127.0, 127.3(2C), 131.6, 131.7, 131.9,

138.8, 139.4, 144.9, 160.1, 160.7, 162.8, 170.5; HRMS exact mass of (M-H) ^" , 381.1163 amu; observed mass of (M-H) ^" , 381.1160 amu.

N-(2-amino-4-fluorophenyl)-4-(2-phenylcyclopropane-l-carboxa mido) benzamide (29)

The yield is 70%, and as white solid. ;¾ NMR (DMSO, 500 MHz): δ 1.40-1.43 (m, 1H), 1.52-1.54 (m, 1H), 2.12-2.13 (m, 1H), 2.40-2.44 (m, 1H), 5.20 (s, 2H), 6.34-6.37 (m, 1H), 6.55 (dd, 1H, 7= 11.1, 2.7 Hz), 7.09-7.12 (m, 1H), 7.20-7.23 (m, 3H), 7.29-7.33 (m, 2H), 7.71 (d, 2H, 7= 8.6 Hz), 7.94 (d, 2H, 7= 8.3 Hz), 9.48 (s, 1H), 10.51 (s, 1H); ¹³ C NMR (DMSO, 125 MHz): 16.2, 25.6, 27.1, 102.0, 102.2, 102.5, 102.7, 118.6, 120.1, 126.6, 126.6, 128.8, 128.8,

128.9, 129.2, 129.3, 141.1, 142.5, 144.8, 145.9, 160.5, 165.5, 170.7; HRMS exact mass of (M- H)-, 388.1462 amu; observed mass of (M-H) ^" , 388.1466 amu.

Table 1. HDAC isoform inhibition profiles of 1 and representative derivatives (see Figure 4), each at 1 μM.

The compositions and methods of the appended claims are not limited in scope by the specific compositions and methods described herein, which are intended as illustrations of a few aspects of the claims and any compositions and methods that are functionally equivalent are intended to fall within the scope of the claims. Various modifications of the compositions and methods in addition to those shown and described herein are intended to fall within the scope of the appended claims. Further, while only certain representative compositions and method steps disclosed herein are specifically described, other combinations of the compositions and method steps also are intended to fall within the scope of the appended claims, even if not specifically recited. Thus, a combination of steps, elements, components, or constituents may be explicitly mentioned herein or less, however, other combinations of steps, elements, components, and constituents are included, even though not explicitly stated. The term“comprising” and variations thereof as used herein is used synonymously with the term“including” and variations thereof and are open, non-limiting terms. Although the terms“comprising” and“including” have been used herein to describe various embodiments, the terms“consisting essentially of” and “consisting of” can be used in place of“comprising” and“including” to provide for more specific embodiments of the invention and are also disclosed. Other than in the examples, or where otherwise noted, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood at the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, to be construed in light of the number of significant digits and ordinary rounding approaches.