Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
HEPATITIS B VIRUS-BINDING POLYPEPTIDES AND METHODS OF USE THEREOF
Document Type and Number:
WIPO Patent Application WO/2009/060316
Kind Code:
A2
Abstract:
The present invention provides non-naturally occurring polypeptides that specifically bind hepatitis B virus (HBV) DNA; and polynucleotides encoding the polypeptides. The present invention further provides methods of detecting HBV DNA; methods of detecting a covalently closed circular DNA (cccDNA) form of HBV; and methods for treating HBV infection.

Inventors:
TYRRELL D LORNE (CA)
ZIMMERMAN KIMBERLEY (CA)
JOYCE MICHAEL A (CA)
FISCHER KARL (CA)
Application Number:
IB2008/003791
Publication Date:
May 14, 2009
Filing Date:
September 10, 2008
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
UNIV ALBERTA (CA)
TYRRELL D LORNE (CA)
ZIMMERMAN KIMBERLEY (CA)
JOYCE MICHAEL A (CA)
FISCHER KARL (CA)
International Classes:
C07K14/00; A61K38/16; A61P31/14; C12N15/11; C12N15/36; C12Q1/68
Other References:
ZIMMERMAN, K.A. ET AL.: 'Zinc finger proteins designed to specifically target duck hepatitis B virus covalently closed circular DNA inhibit viral transcription in tissue culture' J. VIROL. vol. 82, no. 16, August 2008, ISSN 1098-5514 pages 8013 - 8021
MANDELL, J.G. ET AL.: 'Zinc finger tools: custom DNA- binding domains for transcription factors and nucleases' NUCLEIC ACIDS RES. vol. 34, July 2006, ISSN 1362-4962 pages W516 - W523
DREIER, B. ET AL.: 'Insights into the molecular recognition of the 5'-GNN-3' family of DNA sequences by zinc finger domains' J. MOL. BIOL. vol. 303, November 2000, ISSN 0022-2836 pages 489 - 502
SEGAL, D.J. ET AL.: 'Attenuation of HIV-1 replication in primary human cells with a designed zinc fmger transcription factor' J. BIOL. CHEM. vol. 279, no. 15, April 2004, ISSN 0021-9258 pages 14509 - 14519
Download PDF:
Claims:
CLAIMS

What is claimed is:

1. A non-naturally occurring polypeptide comprising an amino acid sequence represented by the formula:

(J 1 )(X 1 X 2 CyS(X) 2-4 CyS(X) 3 PhCSeKB(Hn)HiS(X) 3 HiS(Z))HX 1 X 2 CyS(X) 2- 4 Cys(X) 3 PheSer(B n+1 )His(X) 3 His(J 2 ) (SEQ ID NO:2), wherein each of Ji and J 2 , if present, is independently 1-100 amino acids;

Xi and X 2 , if present, are any amino acid;

X is any amino acid;

Z is a linker of from 2 amino acids to 10 amino acids in length; n is 2 to 5; each of Bo+n and B n +i is seven amino acids in length; and wherein B 0+n and B n+ i collectively provide for binding to a hepatitis B virus (HBV) nucleotide sequence.

2. The polypeptide of claim 1 , wherein the polypeptide binds specifically to covalently closed circular HBV DNA.

3. The polypeptide of claim 1, wherein n is 2 and wherein the polypeptide binds to a contiguous stretch of 9 nucleotides of HBV DNA.

4. The polypeptide of claim 3, wherein the contiguous stretch of 9 nucleotides is present in an HBV enhancer or an HBV promoter region.

5. The polypeptide of claim 1, wherein n is 5 and wherein the polypeptide binds to a contiguous stretch of 18 nucleotides of HBV DNA.

6. The polypeptide of claim 5, wherein the contiguous stretch of 9 nucleotides is present in an HBV enhancer or an HBV promoter region.

7. The polypeptide of claim 1 , wherein the HBV nucleotide sequence has at least about 80% nucleotide sequence identity to nucleotides 3007-3150 of the nucleotide sequence set forth in Figure 40.

8. The polypeptide of claim 7, wherein the HBV nucleotide sequence is selected from: a) 5'-ACCAATCGCCAGACAGGA-S ' (SEQ ID NO:65); b) 5'-GCTCAGGGCATACTACAA-S ' (SEQ ID NO:66); c) 5'-TGGTGGAGGCAGGAGGCG-S ' (SEQ ID NO:67); d) 5'-CAGCGGGGTAGGCTGCCT-S' (SEQ ID NO:68); e) 5'-AGGCCTCCG-S'; f) 5'-AGCCCTCAG-S'; g) 5'-AGTATGCCC -3'; h) 5'-CCAGCAAAT -3'; i) 5'-GGCGATTGG -3'; and j) 5'-CAGCCTACC -3'.

9. The polypeptide of claim 1, wherein Ji is a nuclear localization signal.

10. The polypeptide of claim 1 , wherein Z is TGEKP (SEQ ID NO: 119).

11. The polypeptide of claim 1 , wherein the polypeptide comprises an amino acid sequence of the formula:

(J 1 )(YKCPECGKSFS(Bo +n )HQRTHTGEKP) n YKCPECGKSFS(B n+l )HQRTH(J 2 ) (SEQ ID NO:8).

12. The polypeptide of claim 1, wherein n is 5, and wherein Bi, B 2 , B 3 , B 4 , B 5 , and B 6 are, in order from amino terminus to carboxyl terminus: a) QRAHLER (SEQ ID NO:42); b) SPADLTR (SEQ ID NO:22); c) RADNLTE (SEQ ID NO:26); d) HTGHLLE (SEQ ID NO:39); e) TTGNLTV (SEQ ID NO: 18); and f) DKKDLTR (SEQ ID NO: 16).

13. The polypeptide of claim 1, wherein n is 5, and wherein Bi, B 2 , B 3 , B 4 , B 5 , and B 6 are, in order from amino terminus to carboxyl terminus: a) QSGNLTE (SEQ ID NO:28); b) QNSTLTE (SEQ ID NO:27); c) QKSSLIA (SEQ ID NO: 12); d) DPGHLVR (SEQ ID NO:46); e) RADNLTE (SEQ ID NO:26); and f) TSGELVR (SEQ ID NO:43).

14. The polypeptide of claim 1, wherein n is 5, and wherein Bj, B 2 , B 3 , B 4 , B 5 , and B 6 are, in order from amino terminus to carboxyl terminus: a) RSDDLVR (SEQ ID NO:55); b) RSDNLVR (SEQ ID NO:47); c) RADNLTE (SEQ ID NO:26); d) RSDHLTN (SEQ ID NO: 17); e) RSDHLTT (SEQ ID NO:57); and f) RSDHLTT (SEQ ID NO:57).

15. The polypeptide of claim 1, wherein n is 5, and wherein Bj, B 2 , B 3 , B 4 , B 5 , and B 6 are, in order from amino terminus to carboxyl terminus: a) TKNSLTE (SEQ ID NO:29); b) RNDALTE (SEQ ID NO:33); c) RSDHLTN (SEQ ID NO: 17); d) TSGHLVR (SEQ ID NO:44); e) RSDKLTE (SEQ ID NO:40); and f) RADNLTE (SEQ ID NO:26).

16. The polypeptide of claim 1, wherein n is 2, and wherein Bi, B 2 , and B 3 are, in order from amino terminus to carboxyl terminus: a) RNDTLTE (SEQ ID NO:36); b) TKNSLTE (SEQ ID NO:29); and c) RSDHLTN (SEQ ID NO: 17).

17. The polypeptide of claim 1, wherein n is 2, and wherein Bi, B 2 , and B 3 are, in order from amino terminus to carboxyl terminus: a) RADNLTE (SEQ ID NO:26); b) TKNSLTE (SEQ ID NO:29); and c) ERSHLRE (SEQ ID NO: 14).

18. The polypeptide of claim 1, wherein n is 2, and wherein Bj, B 2 , and B 3 are, in order from amino terminus to carboxyl terminus: a) SKKHLAE (SEQ ID NO:35); b) RRDELNV (SEQ ID NO: 15); and c) HRTTLTN (SEQ ID NO:25).

19. The polypeptide of claim 1, wherein n is 2, and wherein Bi, B 2 , and B 3 are, in order from amino terminus to carboxyl terminus: a) TTGNLTV (SEQ ID NO: 18); b) QSGDLRR (SEQ ID NO:41); and c) TSHSLTE (SEQ ID NO:34).

20. The polypeptide of claim 1 , wherein n is 2, and wherein Bi, B 2 , and B 3 are, in order from amino terminus to carboxyl terminus: a) RSDHLTT (SEQ ID NO:57); b) TSGNLVR (SEQ ID NO:45); and c) DPGHLVR (SEQ ID NO:46).

21. The polypeptide of claim 1, wherein n is 2, and wherein Bi, B 2 , and B 3 are, in order from amino terminus to carboxyl terminus: a) DKKDLTR (SEQ ID NO: 16); b) TKNSLTE (SEQ ID NO:29); and c) RADNLTE (SEQ ID NO:26).

22. A nucleic acid comprising a nucleotide sequence encoding the polypeptide of claim 1.

23. A recombinant expression vector comprising the nucleic acid of claim 22.

24. A genetically modified host cell comprising the nucleic acid of claim 22.

25. A method of reducing the level of covalently closed circular form of hepatitis B virus (HBV) DNA in an individual, the method comprising administering to an individual in need thereof an effective amount of the polypeptide of claim 1.

26. The method of claim 25, further comprising administering to the individual an effective amount of a least a second anti-HBV therapeutic agent.

27. A method of reducing the level of covalently closed circular form of hepatitis B virus (HBV) DNA in an individual, the method comprising administering to an individual in need thereof an effective amount of the recombinant expression vector of claim 23.

28. The method of claim 27, further comprising administering to the individual an effective amount of at least a second anti-HBV therapeutic agent.

29. The method of claim 27, wherein the individual is infected with a drug- resistant HBV.

30. The method of claim 29, wherein the drug-resistant HBV is resistant to lamivudine, adefovir, tenofovir, or entecavir.

Description:

HEPATITIS B VIRUS-BINDING POLYPEPTIDES AND METHODS OF USE THEREOF

CROSS-REFERENCE [0001] This application claims the benefit of U.S. Provisional Patent Application No.

60/972,644, filed September 14, 2007, which application is incorporated herein by reference in its entirety.

BACKGROUND

[0002] Hepatitis B virus (HBV) causes a significant global health burden with an estimated

360 million people persistently infected and 500,000-700,000 deaths annually from HBV- associated liver disease. Five percent of adults and ninety-five percent of neonates exposed to the virus become persistently infected. Persistent infection with HBV leads to liver cirrhosis and hepatocellular carcinoma, which has a five-year survival rate of only 9%. Therapeutics such as nucleoside analogs are effective at clearing the infection in approximately 20-30% of treated patients; however, resistance to nucleoside analogs is an increasing problem, with 70% of patients becoming resistant to lamivudine and 18% becoming resistant to adefovir and tenofovir after four years of treatment.

[0003] HBV is a member of the Hepadnaviridae family and has a small double-stranded DNA genome of approximately 3,200 base pairs and a strict tropism for hepatocytes. A model virus for HBV is the duck hepatitis B virus (DHBV), which has a comparable tropism for avian hepatocytes, and a common viral structure, life cycle and genome. Upon infection, the viral genome is converted from a relaxed circular form to a covalently closed circular (cccDNA) form in the nucleus of hepatocytes. This cccDNA form associates with several proteins to form a 'mini-chromosome' structure, and is the reservoir from which transcription of viral genes and progeny genomes occur. It is highly stable with 3-50 copies per nucleus and a half-life of approximately fifty days. Thus, when treatment with nucleoside analogs is stopped in infected patients, the cccDNA reservoir can result in a resurgence of viral production. There are currently no therapeutics available which target the cccDNA of HBV.

[0004] There remains a need for treatment options for individuals persistently infected with

HBV. Literature

[0005] Mino et al. (2006) J Virol. 80(1 1): 5405-5412; Reynolds et al. (2003) Proc. Natl. Acad.

ScL 100(4): 1615-1620; Segal et al, 2004; Beerli et al. (1998) Proc. Natl. Acad. Sci. 95: 14628-

14633; Lilienbaum et al. (1993) J. Virol. 67(10): 6192-6200; Liu et al. (1994) J. Virol. 68(4): 2286-2296.

SUMMARY OF THE INVENTION

[0006] The present invention provides non-naturally occurring polypeptides that specifically bind hepatitis B virus (HBV) DNA; and polynucleotides encoding the polypeptides. The present invention further provides methods of detecting HBV DNA; methods of detecting a covalently closed circular DNA (cccDNA) form of HBV; and methods for treating HBV infection.

BRIEF DESCRIPTION OF THE DRAWINGS

[0007] Fig. 1 shows a map of the DHBV cccDNA genome.

[0008] Fig. 2 shows the DNA sequence of the DHBV cccDNA enhancer region with the ZFP binding sites identified. SEQ ID NO: 159 is the upper sequence; SEQ ID NO: 160 is the complement of SEQ ID NO: 159.

[0009] Fig. 3 shows a Coomassie blue stain of purified ZFPa.

[0010] Fig. 4 shows a non-linear regression plot and EMSA of ZFPa.

[0011] Figs. 5 A and 5B show non-linear regression plots and EMSAs for ZFPb and ZFPc respectively.

[0012] Fig. 6 shows a competition EMSA of ZFPa.

[0013] Fig. 7 shows a BIAcore kinetic analysis of ZFPa.

[0014] Fig. 8 shows a BIAcore kinetic analysis of ZFPb.

[0015] Figs. 9A and 9B show competition EMSAs of ZFPb and ZFPc respectively.

[0016] Figs. 1OA, 1OB, 1OC and 1OD show BIAcore kinetic anlaysis of ZFPc, ZFPd, ZFPe and

ZFPf respectively. [0017] Fig. 11 shows the results of cccDNA pull-down assays for ZFPa, ZFPb, ZFPc, ZFPd,

ZFPe and ZFPf. [0018] Fig. 12 shows Western Blot analysis of LMH cell lysates co-transfected with pDHBV1.3 and pcDNA3.1(+)-ZFPa, -ZFPb, -ZFPc, -ZFPd, -ZFPe and -ZFPf. [0019] Figs. 13 A-D show Quantitative Lightcycler PCR data for viral RNA.

[0020] Figs. 14A and 14B show a Southern blot of intracellular virus particles (ICV) and quantification of the Southern blot respectively. [0021] Fig. 15 shows an MTT assessment of cell death for transfected LMH (chicken hepatoma) cells.

[0022] Fig. 16A shows a schematic of the HBV pre-S2/s promoter region and the target sites of the ZFPs; and Fig. 16B is a schematic depiction of the HBV genome, showing the location of the pre-S2/s promoter region. [0023] Figs. 17A- 17D show electrophoretic mobility shift assays (EMSA) of ZFPk, ZFPm,

ZFPn and ZFPv respectively. [0024] Figs. 18A- 18D show non-linear regression plots of ZFPk, ZFPm, ZFPn and ZFPv respectively.

[0025] Figs. 19A-19C show competition EMSA of ZFPk, ZFPm and ZFPn respectively.

[0026] Figs. 20A-20G show BIAcore kinetic analysis of ZFPk, ZFPm, ZFPn, ZFPq, ZFPr,

ZFPt and ZFPu respectively.

[0027] Fig. 21 shows the results of a cccDNA pull-down assay for ZFPk.

[0028] Fig. 22 shows the general kinetic equation, which describes the kinetic relationship between a ZFP (A) and its target DNA (B). [0029] Fig. 23a-c show the nucleotide sequence of ZFPa, the amino acid sequence of ZFPa, and the DNA target sequence of ZFPa, respectively. [0030] Fig. 24a-c show the nucleotide sequence of ZFPb, the amino acid sequence of ZFPb, and the DNA target sequence of ZFPb, respectively. [0031] Fig. 25a-c show the nucleotide sequence of ZFPc, the amino acid sequence of ZFPc, and the DNA target sequence of ZFPc, respectively. [0032] Fig. 26a-c show the nucleotide sequence of ZFPd, the amino acid sequence of ZFPd, and the DNA target sequence of ZFPd, respectively. [0033] Fig. 27a-c show the nucleotide sequence of ZFPe, the amino acid sequence of ZFPe, and the DNA target sequence of ZFPe, respectively. [0034] Fig. 28a-c shows the nucleotide sequence of ZFPf, the amino acid sequence of ZFPf, and the DNA target sequence of ZFPf, respectively. [0035] Fig. 29a-c show the nucleotide sequence of ZFPg, the amino acid sequence of ZFPg, and the target sequence of ZFPg, respectively. [0036] Fig. 30a-c show the nucleotide sequence of ZFPk, the amino acid sequence of ZFPk, and the DNA target sequence of ZFPk, respectively. [0037] Fig. 31 a-c show the nucleotide sequence of ZFPm, the amino acid sequence of ZFPm, and the DNA target sequence of ZFPm, respectively. [0038] Fig. 32a-c show the nucleotide sequence of ZFPn, the amino acid sequence of ZFPn, and the DNA target sequence of ZFPn, respectively.

[0039] Fig. 33a-c show the nucleotide sequence of ZFPp, the amino acid sequence of ZFPp, and the DNA target sequence of ZFPp, respectively

[0040] Fig. 34a-c show the nucleotide sequence of ZFPq, the amino acid sequence of ZFPq, and the DNA target sequence of ZFPq, respectively.

[0041] Fig. 35a-c show the nucleotide sequence of ZFPr, the amino acid sequence of ZFPr, and the DNA target sequence of ZFPr, respectively.

[0042] Fig. 36a-c show the nucleotide sequence of ZFPt, the amino acid sequence of ZFPt, and the DNA target sequence of ZFPt, respectively.

[0043] Fig. 37a-c show the nucleotide sequence of ZFPu, the amino acid sequence of ZFPu, and the DNA target sequence of ZFPu, respectively.

[0044] Fig. 38a-c show the nucleotide sequence of ZFPv, the amino acid sequence of ZFPv, and the DNA target sequence of ZFPv, respectively.

[0045] Fig. 39a-c show the nucleotide sequence of ZFPw, the amino acid sequence of ZFPw, and the DNA target sequence of ZFPw, respectively.

[0046] Figure 40 provides a nucleotide sequence of an HBV genome (subtype ayw).

[0047] Figure 41 provides a nucleotide sequence of a duck HBV genome.

[0048] Figures 42 A-F provide nucleotide and amino acid sequences of Fokl endonuclease domain (Figures 42 A and 42B, respectively), nucleotide and amino acid sequences of an HBV DNA-binding ZFP (Figures 42C and 42D, respectively), and nucleotide and amino acid sequences of exemplary Fokl-HBV DNA-binding ZFP fusion proteins (Figures 42E and 42F, respectively). In Figure 42E, upper case letters indicate the endonuclease-encoding nucleotide sequence; lower case letters indicate the HBV DNA-binding ZFP-encoding nucleotide sequences. In Figure 42F, the amino acid sequence of the Fokl endonuclease is in bold text.

[0049] Figures 43 A-F provide nucleotide and amino acid sequences of homothallism (HO) endonuclease domain (Figures 43A and 43B, respectively), nucleotide and amino acid sequences of an HBV DNA-binding ZFP (Figures 43C and 43D, respectively), and nucleotide and amino acid sequences of exemplary HO-HBV DNA-binding ZFP fusion proteins (Figures 43E and 43F, respectively). In Figure 43E, HBV DNA-binding ZFP-encoding nucleotides are in lower case; HO endonuclease-encoding nucleotides are in upper case. In Figure 43F, the amino acid sequence of the HO endonuclease is in bold.

[0050] Figure 44 provides a nucleotide sequence of an HBV genotype D genome.

[0051] Figure 45 provides a nucleotide sequence of an HBV genotype C genome.

[0052] Figure 46 provides a nucleotide sequence of an HBV genotype B genome.

[0053] Figure 47 provides a nucleotide sequence of an HBV genotype E genome.

[0054] Figure 48 provides a nucleotide sequence of an HBV genotype F genome.

[0055] Figure 49 provides a nucleotide sequence of an HBV serotype A genome.

DEFINITIONS

[0056] As used herein, "hepatitis B virus" or "HBV" refers to a member of the

Hepadnaviridae family having a small double-stranded DNA genome of approximately 3,200 base pairs and a tropism for liver cells. "HBV" includes HBV that infects any of a variety of mammalian (e.g., human, non-human primate, etc.) and avian (duck, etc.) hosts. "HBV" includes any known HBV genotype, e.g., serotype A, B, C, D, E, F, and G; any HBV serotype or HBV subtype; any HBV isolate; HBV variants, e.g., HBeAg-negative variants, drug- resistant HBV variants (e.g., lamivudine-resistant variants; adefovir-resistant mutants; tenofovir-resistant mutants; entecavir-resistant mutants; etc.); and the like.

[0057] By "nucleic acid" herein is meant either DNA or RNA, or molecules which contain both deoxy- and ribonucleotides. The nucleic acids include genomic DNA, cDNA and oligonucleotides. The nucleic acid may be double stranded, single stranded, or contain portions of both double stranded or single stranded sequence. As will be appreciated by those in the art, the depiction of a single strand ("Watson") also defines the sequence of the other strand ("Crick"). By the term "recombinant nucleic acid" herein is meant nucleic acid, originally formed in vitro, in general, by the manipulation of nucleic acid by endonucl eases, in a form not normally found in nature. Thus an isolated nucleic acid, in a linear form, or an expression vector formed in vitro by ligating DNA molecules that are not normally joined, are both considered recombinant for the purposes of this invention. It is understood that once a recombinant nucleic acid is made and reintroduced into a host cell or organism, it will replicate non-recombinantly, i.e. using the in vivo cellular machinery of the host cell rather than in vitro manipulations; however, such nucleic acids, once produced recombinantly, although subsequently replicated non-recombinantly, are still considered recombinant for the purposes of the invention.

[0058] Nucleic acid sequence identity (as well as amino acid sequence identity) is calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc. A reference sequence will usually be at least about 18 residues long, more usually at least about 30 residues long, and may extend to the complete sequence that is being compared. Algorithms for sequence analysis are known in the art, such as BLAST, described in Altschul et al (1990), J. MoI. Biol. 215:403-10 (using default settings, i.e. parameters w=4 and T=I 7).

[0059] Where a nucleic acid is said to hybridize to a recited nucleic acid sequence, hybridization is under stringent conditions. An example of stringent hybridization conditions is hybridization at 50°C or higher and 0. IxSSC (15 mM sodium chloride/1.5 mM sodium citrate). Another example of stringent hybridization conditions is overnight incubation at 42°C in a solution: 50 % formamide, 5 x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 μg/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at about 65°C. Stringent hybridization conditions are hybridization conditions that are at least as stringent as the above representative conditions, where conditions are considered to be at least as stringent if they are at least about 80% as stringent, typically at least about 90% as stringent as the above specific stringent conditions. Other stringent hybridization conditions are known in the art and may also be employed to identify nucleic acids of this particular embodiment of the invention.

[0060] Similarly, "polypeptide" and "protein" as used interchangeably herein, and can encompass peptides and oligopeptides. Where "polypeptide" is recited herein to refer to an amino acid sequence of a naturally-occurring protein molecule, "polypeptide" and like terms are not necessarily limited to the amino acid sequence to the complete, native amino acid sequence associated with the recited protein molecule, but instead can encompass biologically active variants or fragments, including polypeptides having substantial sequence similarity or sequence identify relative to the amino acid sequences provided herein. In general, fragments or variants retain a biological activity of the parent polypeptide from which their sequence is derived.

[0061] A "variant" of a polypeptide is defined as an amino acid sequence that is altered by one or more amino acids (e.g., by deletion, addition, insertion and/or substitution). The variant can have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties, e.g., replacement of leucine with isoleucine. More rarely, a variant can have "nonconservative" changes, e.g., replacement of a glycine with a tryptophan. Similar minor variations can also include amino acid deletions or insertions, or both. Guidance in determining which and how many amino acid residues may be substituted, added, inserted or deleted without abolishing biological or immunological activity can be found using computer programs well known in the art, for example, DNAStar software.

[0062] The term "isolated" indicates that the recited material (e.g, polypeptide, nucleic acid, etc.) is substantially separated from, or enriched relative to, other materials with which it occurs, e.g., during production of the material. A material (e.g., polypeptide, nucleic acid, etc.)

that is isolated constitutes at least about 0.1%, at least about 0.5%, at least about 1% or at least about 5% by weight of the total material of the same type (e.g., total protein, total nucleic acid) in a given sample.

[0063] By "purified" is meant a compound of interest (e.g., a polypeptide) has been separated from components that may be present during its production. For example, "purified" can refer to a compound of interest (e.g., a polypeptide) separated from components that can accompany it during manufacture (e.g., in chemical synthesis), hi some embodiments, a compound is substantially pure when it is at least 50% to 60%, by weight, free from organic molecules with which it is naturally associated or with which it is associated during manufacture. In some embodiments, the preparation is at least 75%, at least 90%, at least 95%, or at least 99%, by weight, of the compound of interest. A substantially pure polypeptide can be obtained, for example, by recombinant production of the polypeptide, by chemically synthesizing the polypeptide, by one or more purification steps, by a combination of recombinant synthesis and purification, or by a combination of recombinant production (e.g., production in a cell) and purification. Purification steps can include, e.g., size exclusion chromatography, precipitation with salt, immunoprecipitation, affinity chromatography, high performance liquid chromatography, and the like. Purity can be measured by any appropriate method, e.g., chromatography, mass spectroscopy, high performance liquid chromatography analysis, etc.

[0064] "Treating" or "treatment" of a condition or disease includes: (1) preventing at least one symptom of the conditions, i.e., causing a clinical symptom to not significantly develop in an avian species or a mammalian species that may be exposed to a disease-causing agent (e.g., HBV) or predisposed to the disease but does not yet experience or display symptoms of the disease, (2) inhibiting the disease, e.g., arresting or reducing the development of the disease or its symptoms, or (3) relieving the disease, i.e., causing regression of the disease or its clinical symptoms.

[0065] A "therapeutically effective amount" or "efficacious amount" means the amount of a compound that, when administered to a mammal or other subject for treating a disease, is sufficient to effect such treatment for the disease. The "therapeutically effective amount" will vary depending on the compound, the disease and its severity and the age, weight, etc., of the subject to be treated.

[0066] The terms "subject," "host," "individual," and "patient" are used interchangeably herein to refer to a member or members of any mammalian or non-mammalian species that may have a need for the pharmaceutical methods, compositions and treatments described herein. Subjects and patients thus include, without limitation, primate (including humans), canine, feline,

ungulate (e.g., equine, bovine, swine (e.g., pig)), avian, and other subjects. Humans and non- human animals having commercial importance (e.g., livestock and domesticated animals) are of particular interest.

[0067] "Mammal" means a member or members of any mammalian species, and includes, by way of example, canines; felines; equines; bovines; ovines; rodentia, etc. and primates, e.g., humans and non-human primates. Non-human animal models, including avian species; and mammals, e.g. non-human primates, murines, lagomorpha, etc., may be used for experimental investigations.

[0068] The term "unit dosage form," as used herein, refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of compounds calculated in an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier or vehicle.

[0069] A "biological sample" encompasses a variety of sample types obtained from an individual and can be used in a diagnostic or monitoring assay. The definition encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The definition also includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents; washed; or enrichment for certain cell populations, such as liver cells, peripheral blood mononuclear cells (PBMC), and the like. The term "biological sample" encompasses a clinical sample, and also includes cells in culture, cell supernatants, tissue samples, organs, bone marrow, blood, plasma, serum, and the like. In some embodiments, a biological sample comprises nucleated cells, e.g., nucleated blood cells, liver cells, etc.

[0070] "Gene delivery vehicle" refers to a construct which is capable of delivering, and, within some embodiments expressing, one or more gene(s) or nucleotide sequence(s) of interest in a host cell. Representative examples of such vehicles include viral vectors, nucleic acid expression vectors, naked DNA, and certain eukaryotic cells (e.g., producer cells).

[0071] "Operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, control elements operably linked to a coding sequence are capable of effecting the expression of the coding sequence. The control elements need not be contiguous with the coding sequence, so long as they function to direct-the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between a promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.

[0072] Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0073] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0074] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited.

[0075] It must be noted that as used herein and in the appended claims, the singular forms "a,"

"an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an HBV genome" includes a plurality of such genomes and reference to "the HB V-binding polypeptide" includes reference to one or more HB V-binding polypeptides and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.

[0076] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

DETAILED DESCRIPTION

[0077] The present invention provides non-naturally occurring polypeptides that specifically bind hepatitis B virus (HBV) DNA; and polynucleotides encoding the polypeptides. The present invention further provides methods of detecting HBV DNA; methods of detecting a covalently closed circular DNA (cccDNA) form of HBV; and methods for treating HBV infection. HBV-BiNDiNG POLYPEPTIDES

[0078] The present invention provides non-naturally occurring, HBV DNA-binding, polypeptides. A subject polypeptide comprises a "zinc finger" structure, and specifically binds a nucleotide sequence present in HBV DNA.

[0079] In some embodiments, the polypeptide binds specifically to a covalently closed circular

DNA (cccDNA) form of HBV DNA. In some embodiments, in addition to binding an HBV nucleotide sequence, a subject HBV-binding polypeptide exhibits one or more of the following activities when present in an HBV-infected cell: 1) reduces production of HBV RNA in the infected cell; 2) reduces production of a core HBV antigen in the infected cell; 3) reduces production of an HBV surface antigen in the infected cell; and 4) reduces production of HBV intracellular virus particles in the infected cell.

[0080] In some embodiments, a subject non-naturally occurring, HBV DNA-binding polypeptide, when contacted with a eukaryotic cell that comprises HBV DNA, reduces the production of HBV RNA in the cell by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%, or more, compared to the level of HBV RNA produced by the cell in the absence of the subject non-naturally occurring, HBV DNA-binding polypeptide.

[0081] In some embodiments, a subject non-naturally occurring, HBV DNA-binding polypeptide, when contacted with a eukaryotic cell that comprises HBV DNA, reduces the production of an HBV core antigen encoded by the HBV DNA by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%, or more, compared to the level of the HBV core antigen produced by the cell in the absence of the subject non-naturally occurring, HBV DNA- binding polypeptide.

[0082] In some embodiments, a subject non-naturally occurring, HBV DNA-binding polypeptide, when contacted with a eukaryotic cell that comprises HBV DNA, reduces the

production of an HBV surface antigen encoded by the HBV DNA by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%, or more, compared to the level of the HBV surface antigen produced by the cell in the absence of the subject non-naturally occurring, HBV DNA- binding polypeptide.

[0083] In some embodiments, a subject non-naturally occurring, HBV DNA-binding polypeptide, when contacted with a eukaryotic cell that comprises HBV DNA, reduces the level of cccDNA form of HBV by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%, or more, compared to the level of cccDNA form of HBV in the cell in the absence of the subject non-naturally occurring, HBV DNA-binding polypeptide.

[0084] In some embodiments, a subject non-naturally occurring, HBV DNA-binding polypeptide, when contacted with a eukaryotic cell that comprises HBV DNA, reduces production of infectious HBV particles by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%, or more, compared to the level of infectious HBV particles produced the cell in the absence of the subject non-naturally occurring, HBV DNA-binding polypeptide.

[0085] In some embodiments, a subject non-naturally occurring, HBV DNA-binding polypeptide, when administered to an individual in need thereof (e.g., an HBV-infected individual; an individual with a cccDNA HBV reservoir; etc.), reduces the likelihood of relapse. In the following formulas, a subscript immediately adjacent an amino acid or a moiety indicates a designation of the amino acid or the moiety; and a subscript following a parenthesis indicates the number of the amino acid or moiety. For example, "(Ji)" refers to a first flanking sequence; "(J 2 )" refers to a second flanking sequence; "Xj" refers to a first amino acid; "X 2 " refers to a second amino acid sequence; "Bi" refers to a first DNA-binding moiety; "B 2 " refers to a second DNA-binding moiety; etc. In contrast, "(X) 2-4 " indicates a contiguous stretch of two to four amino acids, e.g., XX, XXX, or XXXX; "(X) 3 " indicates a contiguous stretch of three amino acids; and "(XiX 2 Cys(X) 2-4 Cys(X) 3 PheSer(Bo +n )His(X) 3 His(Z)) n " (SEQ ID NO:215) indicates that "(X,X 2 Cys(X) 2-4 Cys(X) 3 PheSer(B o+n )His(X) 3 His(Z))" (SEQ ID NO:1) is present n times (e.g., 2 to 5 times) in tandem.

Formula 1

[0086] In some embodiments, a subject non-naturally occurring, HBV DNA-binding polypeptide comprises an amino acid sequence represented by Formula 1 : (Ji)(XiX 2 CyS(X) 2- 4 Cys(X) 3 PheSer(Bo +n )His(X) 3 His(Z)) n X 1 X 2 Cys(X) 2-4 Cys(X) 3 PheSer(Bo +n )His(X) 3 His(J 2 ) (SEQ ID NO:2), wherein each of Ji and J 2 , if present, is independently flanking sequences of 1 amino acid to about 100 amino acids; Xi and X 2 , if present, are any amino acid; X is any amino acid; Z is a linker of from 2 amino acids to 10 amino acids in length; n is 2 to 5; each of Bo+ n and B n+ 1 is seven amino acids in length; wherein each B individually binds DNA; and wherein Bo+ n and B n+ 1 collectively provide for binding to an HBV nucleotide sequence.

[0087] For example, in some of these embodiments, a subject non-naturally occurring, HBV

DNA-binding polypeptide comprises the amino acid sequence:

[0088] (Ji)X,X 2 Cys(X) 2- 4Cys(X)3PheSer(Bi)His(X) 3 His(Z)X,X 2 Cys(X) 2- 4 Cys(X) 3 PheSer(B 2 )His(X) 3 His(Z)X,X 2 Cys(X) 2-4 Cys(X) 3 PheSer(B 3 )His(X) 3 His(J 2 ) (SEQ ID NO:3), wherein each of Ji and J 2 , if present, is independently flanking sequences of 1 amino acid to about 100 amino acids; Xi and X 2 , if present, are any amino acid; X is any amino acid; Z is a linker of from 2 amino acids to 10 amino acids in length; each of Bj, B 2 and B 3 is seven amino acids in length; wherein each B individually binds DNA; and wherein Bi, B 2 and B 3 collectively provide for binding to an HBV nucleotide sequence.

[0089] As another example, in some embodiments, a subject non-naturally occurring, HBV

DNA-binding polypeptide comprises the amino acid sequence:

[0090] (J,)XiX 2 Cys(X) 2-4 Cys(X) 3 PheSer(Bi)His(X) 3 His(Z)XiX 2 Cys(X) 2- 4 Cys(X) 3 PheSer(B 2 )His(X) 3 His(Z) XiX 2 Cys(X) 2-4 Cys(X) 3 PheSer(B 3 )His(X) 3 His(Z) XiX 2 Cys(X) 2-4 Cys(X) 3 PheSer(B 4 )His(X) 3 His(Z) XiX 2 CyS(X) 2-

4Cys(X) 3 PheSer(B5)His(X) 3 His(Z) XiX 2 Cys(X) 2-4 Cys(X) 3 PheSer(B 6 )His(X) 3 His(J 2 ) (SEQ ID NO:4), wherein each of Ji and J 2 , if present, is independently flanking sequences of 1 amino acid to about 100 amino acids; Xi and X 2 , if present, are any amino acid; X is any amino acid; Z is a linker of from 2 amino acids to 10 amino acids in length; each of Bi, B 2 , B 3 , B 4 , B 5 , and B 6 is seven amino acids in length; wherein each B individually binds DNA; and wherein Bi, B 2 , B 3 , B 4 , B 5 , and B 6 collectively provide for binding to an HBV nucleotide sequence. Formula 2

[0091] In some embodiments, Xi is Tyr and X 2 Lys. Thus, in some embodiments, a subject non-naturally occurring, HBV DNA-binding polypeptide comprises an amino acid sequence represented by Formula 2: (Ji)(TyrLysCys(X) 2- 4 Cys(X)3PheSer(Bo + n)His(X)3His(Z)) n TyrLysCys(X) 2-4 Cys(X) 3 PheSer(Bo + n)His(X) 3 His(J 2 )

(SEQ ID NO:5), wherein each of Ji and J 2 , if present, is independently flanking sequences of 1 amino acid to about 100 amino acids; X is any amino acid; Z is a linker of from 2 amino acids to 10 amino acids in length; n is 2 to 5; each of Bo+ n and B n+ 1 is seven amino acids in length; wherein each B individually binds DNA; and wherein Bo+ n and B n+ 1 collectively provide for binding to an HBV nucleotide sequence.

[0092] For example, in some of these embodiments, a subject non-naturally occurring, HBV

DNA-binding polypeptide comprises the amino acid sequence:

[0093] (Ji)TyrLysCys(X) 2-4 Cys(X) 3 PheSer(Bi)His(X) 3 His(Z) TyrLysCys(X) 2- 4 Cys(X) 3 PheSer(B 2 )His(X) 3 His(Z) TyrLysCys(X) 2-4 Cys(X)3PheSer(B 3 )His(X) 3 His(J 2 ) (SEQ ID NO:6), wherein each of Ji and J 2 , if present, is independently flanking sequences of 1 amino acid to about 100 amino acids; X is any amino acid; Z is a linker of from 2 amino acids to 10 amino acids in length; each of Bi, B 2 and B 3 is seven amino acids in length; wherein each B individually binds DNA; and wherein Bi, B 2 and B 3 collectively provide for binding to an HBV nucleotide sequence.

[0094] As another example, in some embodiments, a subject non-naturally occurring, HBV

DNA-binding polypeptide comprises the amino acid sequence:

[0095] (Ji)TvrLysCys(X) 2-4 Cys(X) 3 PheSer(Bi)His(X) 3 His(Z) TyrLysCys(X) 2- 4 Cys(X) 3 PheSer(B 2 )His(X) 3 His(Z) TyrLysCys(X) 2 - 4 Cys(X) 3 PheSer(B 3 )His(X) 3 His(Z) TyrLysCys(X) 2-4 Cys(X) 3 PheSer(B 4 )His(X) 3 His(Z) TyrLys 2 Cys(X) 2- 4 Cys(X) 3 PheSer(B 5 )His(X) 3 His(Z) TyrLysCys(X) 2 ^Cys(X) 3 PheSer(B 6 )His(X) 3 His(J 2 ) (SEQ ID NO:7), wherein each of Ji and J 2 , if present, is independently flanking sequences of 1 amino acid to about 100 amino acids; X is any amino acid; Z is a linker of from 2 amino acids to 10 amino acids in length; each of Bi, B 2 , B 3 , B 4 , B 5 , and B 6 is seven amino acids in length; wherein each B individually binds DNA; and wherein Bi, B 2 , B 3 , B 4 , B 5 , and B 6 collectively provide for binding to an HBV nucleotide sequence. Formula 3

[0096] In some embodiments, a subject non-naturally occurring, HBV DNA-binding polypeptide comprises an amino acid sequence represented by Formula 3: (Ji)ryKCPECGKSFSrB^n)HORTHTGEKP)nYKCPECGKSFSrBn +1 )HORTH(J9) (SEQ ID NO:8), wherein each of Ji and J 2 , if present, is independently 1-100 amino acids; n is 2 to 5; each of Bo+n and B n+ ) is 5 amino acids in length; and wherein Bo +n and B n+ i collectively provide for binding to an HBV nucleotide sequence. The underlined sequence "TGEKP" (SEQ ID NO:119) is a linker sequence.

[0097] For example, in some of these embodiments, a subject non-naturally occurring, HBV

DNA-binding polypeptide comprises the amino acid sequence:

(J I )YKCPECGKSFS(BI)HQRTHTGEKPYKCPECGKSFSrB 7 )HORTHTGEKPYKCPECGKS FS(B 3 )HQRTH(J 2 ) (SEQ ID NO:9), wherein each of Ji and J 2 , if present, is independently 1- 100 amino acids; each of Bi, B 2 and B 3 is seven amino acids in length; wherein each B individually binds DNA; and wherein Bi, B 2 and B 3 collectively provide for binding to an HBV nucleotide sequence.

[0098] As another example, in some of these embodiments, a subject non-naturally occurring,

HBV DNA-binding polypeptide comprises the amino acid sequence:

(J 1 )YKCPECGKSFS(B 1 )HQRTHTGEKPYKCPECGKSFS(B 2 )HQRTHTGEKPYKCPECGKS FS(B^)HORTHTGEKPYKCPECGKSFS(B 4 )HORTHTGEKPYKCPECGKSFS(BS)HQRTHT GEKPYKCPECGKSFS(Bn)HQRTH(J?) (SEQ ID NO: 10), wherein each of Ji and J 2 , if present, is independently 1-100 amino acids; each of Bi, B 2 , B 3 , B 4 , B 5 , and B 6 is seven amino acids in length; wherein each B individually binds DNA; and wherein Bi, B 2 , B 3 , B 4 , B 5 , and B 6 collectively provide for binding to an HBV nucleotide sequence. DNA-binding moieties

[0099] As noted above, each of Bo +n and B n+ i is seven amino acids in length; each B individually binds DNA; and Bo +n and B n+ ] collectively provide for binding to an HBV nucleotide sequence. Thus, each B is a DNA-binding moiety. In some embodiments, each B binds a sequence of 3 nucleotides. In some embodiments, n is 2, i.e., a subject polypeptide comprises three DNA-binding moieties: B 1 , B 2 , and B 3 . Where n is 2, and where a subject polypeptide comprises three DNA-binding moieties, Bi, B 2 , and B 3 collectively provide for binding to a 9-nucleotide sequence of HBV DNA. In other embodiments, n is 5, i.e., a subject polypeptide comprises six DNA-binding moieties: B 1 , B 2 , B 3 , B 4 , B 5 , and B 6 . Where n is 2, and where a subject polypeptide comprises six DNA-binding moieties, B 1 , B 2 , B 3 , B 4 , B 5 , and B 6 collectively provide for binding to an 18-nucleotide sequence of HBV DNA. Exemplary target HBV nucleotide sequences are provided below.

[00100] As noted above, each B moiety is seven amino acids in length. The fifth amino acid is

Leu, such that each B moiety has the formula, in the amino to carboxyl direction, XXXXLXX, where X is any amino acid.

[00101] Exemplary, non-limiting DNA-binding moieties include the following:

[00102] 1) QRANLRA (SEQ ID NO:11), which can bind AAA;

[00103] 2) QKSSLIA (SEQ ID NO: 12), which can bind ATA;

[00104] 3) QLAHLRA (SEQ ID NO: 13), which can bind AGA;

[00105] 4) ERSHLRE (SEQ ID NO: 14), which can bind AGC;

[00106] 5) RRDELNV (SEQ ID NO: 15), which can bind ATG;

[00107] 6)DKKDLTR (SEQ ID NO: 16), which can bind ACC;

[00108] 7) RSDHLTN (SEQ ID NO: 17), which can bind AGG;

[00109] 8) TTGNLTV (SEQ ID NO: 18), which can bind AAT;

[00110] 9) DSGNLRV (SEQ ID NO: 19), which can bind AAC;

[00111] 10) RKDNLKN (SEQ ID NO:20), which can bind AAG;

[00112] 11) HKNALQN (SEQ ID NO:21), which can bind ATT;

[00113] 12) SPADLTR (SEQ ID NO:22), which can bind ACA;

[00114] 13) THLDLIR (SEQ ID NO:23), which can bind ACT;

[00115] 14) RTDTLRD (SEQ ID NO:24), which can bind ACG;

[00116] 15) HRTTLTN (SEQ ID NO:25), which can bind AGT;

[00117] 16) RADNLTE (SEQ ID NO:26), which can bind CAG;

[00118] 17) QNSTLTE (SEQ ID NO:27), which can bind CTA;

[00119] 18) QSGNLTE (SEQ ID NO:28), which can bind CAA;

[00120] 19) TKNSLTE (SEQ ID NO:29), which can bind CCT;

[00121] 20) TSGNLTE (SEQ ID NO:30), which can bind CAT;

[00122] 21) SKKALTE (SEQ ID NO:31), which can bind CAC;

[00123] 22) TTGALTE (SEQ ID NO:32), which can bind CTT;

[00124] 23) RNDALTE (SEQ ID NO:33), which can bind CTG;

[00125] 24) TSHSLTE (SEQ ID NO:34), which can bind CCA;

[00126] 25) SKKHLAE (SEQ ID NO:35), which can bind CCC;

[00127] 26) RNDTLTE (SEQ ID NO:36), which can bind CCG;

[00128] 27) QSGHLTE (SEQ ID NO:37), which can bind CGA;

[00129] 28) SRRTLRA (SEQ ID NO:38), which can bind CGT;

[00130] 29) HTGHLLE (SEQ ID NO:39), which can bind CGC;

[00131] 30) RSDKLTE (SEQ ID NO:40), which can bind CGG;

[00132] 31) QSGDLRR (SEQ ID NO:41), which can bind GCA;

[00133] 32) QRAHLER (SEQ ID NO:42), which can bind GGA;

[00134] 33) TSGELVR (SEQ ID NO:43), which can bind GCT;

[00135] 34) TSGHLVR (SEQ ID NO:44), which can bind GGT;

[00136] 35) TSGNLVR (SEQ ID NO:45), which can bind GAT;

[00137] 36) DPGHLVR (SEQ ID NO:46), which can bind GGC;

[00138] 37) RSDNLVR (SEQ ID NO:47), which can bind GAG;

[00139] 38) DCRDLAR (SEQ ID NO:48), which can bind GCC;

[00140] 39) QSSNLVR (SEQ ID NO:49), which can bind GAA;

[00141] 40) DPGNLVR (SEQ ID NO:50), which can bind GAC;

[00142] 41) QSSSLVR (SEQ ID NO:51), which can bind GTA;

[00143] 42) TSGSLVR (SEQ ID NO:52), which can bind GTT;

[00144] 43) DPGALVR (SEQ ID NO:53), which can bind GTC;

[00145] 44) RSDELVR (SEQ ID NO:54), which can bind GTG;

[00146] 45) RSDDLVR (SEQ ID NO:55), which can bind GCG;

[00147] 46) RSDKLVR (SEQ ID NO:56), which can bind GGG;

[00148] 47) RSDHLTT (SEQ ID NO:57), which can bind TGG;

[00149] 48) REDNLHT (SEQ ID NO:58), which can bind TAG; and

[00150] 49) QAGHLAS (SEQ ID NO:59), which can bind TGA.

[00151] Thus, for example, each B (e.g., each of Bi, B 2 , and B 3 , or each of Bi, B 2 , B 3 , B 4 , B 5 , and B 6 ) can be selected from one of amino acid sequences 1-49, as shown above, to form a DNA-binding moiety set, such that a stretch of 9 or 18 contiguous nucleotides will be collectively bound by a subject polypeptide comprising the DNA-binding moiety set. Exemplary, non-limiting DNA-binding moiety sets, which provide for binding a target nucleotide sequence, are provided below. Target nucleotide sequences

[00152] A subject polypeptide can bind to a nucleotide sequence in an HBV enhancer and/or an

HBV promoter region. HBV promoter and enhancer sequences are known in the art. For example, a duck HBV (e.g., an HBV that infects duck liver cells) nucleotide sequence is found under GenBank Accession No. AF047045 (DHBV Canada isolate; see Figure 41); and a human HBV (e.g., an HBV that infects human liver cells) nucleotide sequence is found under GenBank Accession No. U95551 (HBV subtype ayw; see Figure 40); a nucleotide sequence of HBV genotype C is found under GenBank Accession No. AB033550, and is presented in Figure 45; a nucleotide sequence of HBV genotype D is found under GenBank Accession No. AJ344117, and is presented in Figure 44; a nucleotide sequence of HBV genotype B is found under GenBank Accession No. AB033554, and is presented in Figure 46; a nucleotide sequence of HBV genotype E is found under GenBank Accession No. AB032431, and is presented in Figure 47; a nucleotide sequence of HBV genotype F is found under GenBank Accession No. AB036905, and is presented in Figure 48; a nucleotide sequence of HBV genotype A is found under GenBank Accession No. AJ309369, and is presented in Figure 49. Suitable target nucleotides include promoter and/or enhancer regions present in HBV genotype

A, B, C, D, E, F, and G. Suitable target nucleotides include promoter and/or enhancer regions present in HBV serotypes ayw, adr, and adw (e.g., adwl, adw2).

[00153] In some embodiments, a subject polypeptide binds to a sequence of from about 9 contiguous nucleotides to about contiguous 18 nucleotides of an HBV nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% nucleotide sequence identity to nucleotides 2171-2361 of the nucleotide sequence depicted in Figure 41, or the complement thereof.

[00154] For example, in some embodiments, a subject polypeptide binds to a sequence of from about 9 contiguous nucleotides to about contiguous 18 nucleotides of an HBV nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% nucleotide sequence identity to Target Sequence 1 or the complement thereof:

[00155] Target Sequence 1

[00156] 5'-accccaacac atggcgcaat atcccatatc accggcggga gcgcagtgtt tgctttttca aaggtcagag atatacatgt tcaggaacta ttgatgtctt gtttagccaa gataatgatt aaaccgcgct gtctcttatc tgattcaact tttgtttgcc ataagcgtta tcagacgtta ccatggcatt t-3' (SEQ ID NO: 60), or the complement thereof.

[00157] The following are non-limiting examples of target sequences within Target Sequence 1 to which a subject polypeptide can bind:

[00158] Target Sequence Ia:

[00159] 5'-GCCAAGATAATGATTAA-S ' (SEQ ID NO:61), corresponding to nucleotides

2276-2293 (forward strand) of the nucleotide sequence depicted in Figure 41. Target Sequence Ia is bound by the exemplary polypeptide ZFPa.

[00160] Target Sequence Ib:

[00161] 5'-ATGGCAAACAAAAGTTGA-3' (SEQ ID NO:62), nucleotides 690-707 on the reverse strand, corresponding to forward strand nucleotides 2315-2332 of the nucleotide sequence depicted in Figure 41. Target Sequence Ia is bound by the exemplary polypeptide ZFPb.

[00162] Target Sequence Ic:

[00163] 5'-AGAGATATA-3', corresponding to nucleotides 2237-2245 (forward strand) of the nucleotide sequence depicted in Figure 41. Target Sequence Ia is bound by the exemplary polypeptide ZFPc.

[00164] Target Sequence 1 d :

[00165] 5'-AAAAGCAAA-3', nucleotides 794-782 of the reverse strand, corresponding to forward strand nucleotides 2219-2227 of the nucleotide sequence depicted in Figure 41. Target Sequence Ia is bound by the exemplary polypeptide ZFPd.

[00166] Target Sequence Ie:

[00167] 5'-ATAATGATT-3 ', nucleotides 2292-2290 (forward strand) of the nucleotide sequence depicted in Figure 41. Target Sequence Ia is bound by the exemplary polypeptide ZFPe.

[00168] Target Sequence If:

[00169] 5 '-AAC AAG AC A-3\ nucleotides 749-757 of the reverse strand, corresponding to forward strand nucleotides 2265-2273 of the nucleotide sequence depicted in Figure 41. Target Sequence 1 a is bound by the exemplary polypeptide ZFPf.

[00170] Target Sequence Ig:

[00171] 5'-ATAAGAGACAGCGCGGTT-S' (SEQ ID NO:63), nucleotides 713-730 of the reverse strand, corresponding to forward strand nucleotides 2292-2309 of the nucleotide sequence depicted in Figure 41. Target Sequence Ia is bound by the exemplary polypeptide ZFPg.

[00172] In other embodiments, a subject polypeptide binds to a sequence of from about 9 contiguous nucleotides to about 18 contiguous nucleotides of an HBV nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% nucleotide sequence identity to nucleotides 3007-3150 of the nucleotide sequence depicted in Figure 40, or the complement thereof.

[00173] For example, in some embodiments, a subject polypeptide binds to a sequence of from about 9 contiguous nucleotides to about contiguous 18 nucleotides of an HBV nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% nucleotide sequence identity to Target Sequence 2, or the complement thereof:

[00174] Target Sequence 2:

[00175] 5'- ggct gggtttcacc ccaccgcacg gaggcctttt ggggtggagc cctcaggctc agggcatact acaaactttg ccagcaaatc cgcctcctgc ctccaccaat cgccagacag gaaggcagcc taccccgctg tctccacctt-3 ' (SEQ ID NO:64).

[00176] The following are non-limiting examples of target sequences within Target Sequence 2 to which a subject polypeptide can bind:

[00177] Target Sequence 2a:

[00178] 5'-ACCAATCGCCAGACAGGA-S ' (SEQ ID NO:65), nucleotides 3105-3121

(forward strand) of the nucleotide sequence depicted in Figure 40. Target Sequence 2a is bound by the exemplary polypeptide ZFPk. [00179] Target Sequence 2b:

[00180] 5'-GCTCAGGGCATACTACAA-S' (SEQ ID NO:66), nucleotides 3056-3074 (forward strand) of the nucleotide sequence depicted in Figure 40. Target Sequence 2b is bound by the exemplary polypeptide ZFPm. [00181] Target Sequence 2c:

[00182] 5 ' -TGGTGG AGGC AGG AGGCG-3 ' (SEQ ID NO : 67), reverse strand, corresponding to nucleotides 3091-3108 of the nucleotide sequence depicted in Figure 40. Target Sequence 2c is bound by the exemplary polypeptide ZFPn. [00183] Target Sequence 2d:

[00184] 5'-CAGCGGGGTAGGCTGCCT-S ' (SEQ ID NO:68), reverse strand, corresponding to nucleotides 3123-3140 of the nucleotide sequence depicted in Figure 40. Target Sequence 2d is bound by the exemplary polypeptide ZFPp. [00185] Target Sequence 2e:

[00186] 5 ' - AGGCCTCCG-3 ' , reverse strand, corresponding to nucleotides 3029-3037 of the nucleotide sequence depicted in Figure 40. Target Sequence 2e is bound by the exemplary polypeptide ZFPq. [00187] Target Sequence 2f:

[00188] 5'-AGCCCTCAG-3', forward strand, corresponding to nucleotides 3048-3056 of the nucleotide sequence depicted in Figure 40. Target Sequence 2f is bound by the exemplary polypeptide ZFPr. [00189] Target Sequence 2g:

[00190] 5'-AGTATGCCC -3', reverse strand, corresponding to nucleotides 3062-3070 of the nucleotide sequence depicted in Figure 40. Target Sequence 2g is bound by the exemplary polypeptide ZFPt. [00191] Target Sequence 2h:

[00192] 5'-CCAGCAAAT -3', forward strand, corresponding to nucleotides 3081-3089 of the nucleotide sequence depicted in Figure 40. Target Sequence 2h is bound by the exemplary polypeptide ZFPu. [00193] Target Sequence 2i:

[00194] 5'-GGCGATTGG -3', reverse strand, corresponding to nucleotides 3106-3114 of the nucleotide sequence depicted in Figure 40. Target Sequence 2i is bound by the exemplary polypeptide ZFPv. [00195] Target Sequence 2j :

[00196] 5'-CAGCCTACC -3', forward strand, corresponding to nucleotides 3126-3134 of the nucleotide sequence depicted in Figure 40. Target Sequence 2j is bound by the exemplary polypeptide ZFPw.

Exemplary DNA bindinfi moiety sets [00197] The following are exemplary DNA binding moiety set suitable for inclusion in a subject HBV DNA-binding polypeptide.

Exemplary DNA binding moiety set 1 [00198] As one non-limiting example, Bj, B 2 , B 3 , B 4 , B 5 , and B 6 can have the amino acid sequences:

[00199] B 1 : QRANLRA (SEQ ID NO:11), binding AAA;

[00200] B 2 : HKNALQN (SEQ ID NO:21), binding ATT;

[00201] B 3 : RRDELNV (SEQ ID NO: 15), binding ATG;

[00202] B 4 : QKSSLIA (SEQ ID NO: 12), binding ATA;

[00203] B 5 : RKDNLKN (SEQ ID NO:20), binding AAG; and

[00204] B 6 : DCRDLAR (SEQ ID NO:48) binding GCC,

[00205] where Bj, B 2 , B 3 , B 4 , B 5 , and B 6 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-GCCAAGATAATGATTAAA-S ' (SEQ ID

NO:69), as depicted in Figure 23C. For example, DNA-binding moiety set 1 is present in

ZFPa.

Exemplary DNA binding moiety set 2 [00206] As another non-limiting example, B 1 , B 2 , B 3 , B 4 , B 5 , and B 6 can have the amino acid sequences:

[00207] Bi : QAGHLAS (SEQ ID NO:59), binding TGA;

[00208] B 2 : HRTTLTN (SEQ ID NO:25), binding AGT;

[00209] B 3 : QRANLRA (SEQ ID NO:1 1), binding AAA;

[00210] B 4 : DSGNLRV (SEQ ID NO: 19), binding AC;

[00211] B 5 : QSGDLRR (SEQ ID NO:41), binding GCA; and

[00212] B 6 : RRDELNV (SEQ ID NO: 15), binding ATG,

[00213] where Bj, B 2 , B 3 , B 4 , B 5 , and B 6 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-ATGGCAAACAAAAGTTGA-S ' (SEQ ID

NO:62), as depicted in Figure 24C. For example, DNA-binding moiety set 2 is present in

ZFPb.

Exemplary DNA-binding moiety set 3

[00214] As another non-limiting example, Bi, B 2 , and B 3 can have the amino acid sequences:

[00215] B 1 : QKSSLIA (SEQ ID NO:12), binding ATA;

[00216] B 2 : TSGNLVR (SEQ ID NO:45), binding GAT; and

[00217] B 3 : QLAHLRA (SEQ ID NO: 13), binding AGA,

[00218] where Bi, B 2 , and B 3 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-AGAGATATA-3', as depicted in Figure 25C. For example, DNA-binding moiety set 3 is present in ZFPc.

Exemplary DNA-binding moiety set 4

[00219] As another non-limiting example, Bi, B 2 , and B 3 can have the amino acid sequences:

[00220] Bi : QRANLRA (SEQ ID NO: 11), binding AAA;

[00221] B 2 : ERSHLRE (SEQ ID NO: 14), binding AGC; and

[00222] B 3 : QRANLRA (SEQ ID NO:11), binding AAA,

[00223] where Bi, B 2 , and B 3 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-AAAAGCAAA-3', as depicted in Figure 26C. For example, DNA-binding moiety set 4 is present in ZFPd.

Exemplary DNA-binding moiety set 5

[00224] As another non-limiting example, Bj, B 2 , and B 3 can have the amino acid sequences:

[00225] Bi: HKNALQN (SEQ ID NO:21), binding ATT;

[00226] B 2 : RRDELNV (SEQ ID NO: 15), binding ATG; and

[00227] B 3 : QKSSLIA (SEQ ID NO: 12), binding ATA,

[00228] where Bi, B 2 , and B 3 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-ATAATGATT-3', as depicted in Figure 27C. For example, DNA-binding moiety set 5 is present in ZFPe.

Exemplary DNA-binding moiety set 6

[00229] As another non-limiting example, Bi, B 2 , and B 3 can have the amino acid sequences:

[00230] Bi: SPADLTR (SEQ ID NO:22), binding ACA;

[00231] B 2 : RKDNLKN (SEQ ID NO:20) binding AAG; and

[00232] B 3 : DSGNLRV (SEQ ID NO: 19), binding AAC,

[00233] where Bi, B 2 , and B 3 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-AACAAGACA-3', as depicted in Figure 28C. For example, DNA-binding moiety set 6 is present in ZFPf.

Exemplary DNA-binding moiety 7 [00234] As another non-limiting example, Bj, B 2 , B 3 , B 4 , B 5 , and B 6 can have the amino acid sequences:

[00235] Bi : TSGSLVR (SEQ ID NO:52), binding GTT;

[00236] B 2 : RSDDLVR (SEQ ID NO:55), binding GCG;

[00237] B 3 : ERSHLRE (SEQ ID NO: 14), binding AGC;

[00238] B 4 : DPGNLVR (SEQ ID NO:50), binding GAC;

[00239] B 5 : QLAHLRA (SEQ ID NO: 13), binding AGA; and

[00240] B 6 : QKSSLIA (SEQ ID NO: 12), binding ATA,

[00241] where Bj, B 2 , B 3 , B 4 , B 5 , and B 6 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-ATAAGAGACAGCGCGGTT-S ' (SEQ ID

NO:63), as depicted in Figure 29C. For example, DNA-binding moiety set 7 is present in

ZFPg.

Exemplary DNA-binding moiety set 8 [00242] As another non-limiting example, Bi, B 2 , B 3 , B 4 , B 5 , and B 6 can have the amino acid sequences:

[00243] Bi : QRAHLER (SEQ ID NO:42), binding GGA;

[00244] B 2 : SPADLTR (SEQ ID NO:22), binding ACA;

[00245] B 3 : RADNLTE (SEQ ID NO:26), binding CAG;

[00246] B 4 : HTGHLLE (SEQ ID NO:39), binding CGC;

[00247] B 5 : TTGNLTV (SEQ ID NO: 18), binding AAT; and

[00248] B 6 : DKKDLTR (SEQ ID NO: 16), binding ACC,

[00249] where B u B 2 , B 3 , B 4 , B 5 , and B 6 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-ACCAATCGCCAGACAGGA-S ' (SEQ ID

NO:65), as depicted in Figure 30C. For example, DNA-binding moiety set 8 is present in

ZFPk.

Exemplary DNA-binding moiety set 9 [00250] As another non-limiting example, Bi, B 2 , B 3 , B 4 , B 5 , and B 6 can have the amino acid sequences:

[00251] Bi : QSGNLTE (SEQ ID NO:28), binding CAA;

[00252] B 2 : QNSTLTE (SEQ ID NO:27), binding CTA;

[00253] B 3 : QKSSLIA (SEQ ID NO: 12), binding ATA;

[00254] B 4 : DPGHLVR (SEQ ID NO:46), binding GGC;

[00255] B 5 : RADNLTE (SEQ ID NO:26), binding CAG; and

[00256] B 6 : TSGELVR (SEQ ID NO:43), binding GCT,

[00257] where Bi, B 2 , B 3 , B 4 , B 5 , and B 6 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-GCTCAGGGCATACTACAA-S ' (SEQ ID NO:66), depicted in Figure 31C. For example, DNA-binding moiety set 9 is present in ZFPm. Exemplary DNA-binding moiety set 10

[00258] As another non-limiting example, B 1 , B 2 , B 3 , B 4 , B 5 , and B 6 can have the amino acid sequences:

[00259] Bi: RSDDLVR (SEQ ID NO:55), binding GCG;

[00260] B 2 : RSDNLVR (SEQ ID NO:47), binding GAG;

[00261] B 3 : RADNLTE (SEQ ID NO:26), binding CAG;

[00262] B 4 : RSDHLTN (SEQ ID NO: 17), binding AGG;

[00263] B 5 : RSDHLTT (SEQ ID NO:57), binding TGG; and

[00264] B 6 : RSDHLTT (SEQ ID NO: 57), binding TGG,

[00265] where Bj, B 2 , B 3 , B 4 , B 5 , and B 6 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-TGGTGGAGGCAGGAGGCG-S' (SEQ ID NO:67), depicted in Figure 32C. For example, DNA-binding moiety set 10 is present in ZFPn. Exemplary DNA-binding moiety set 11

[00266] As another non-limiting example, Bi, B 2 , B 3 , B 4 , B 5 , and B 6 can have the amino acid sequences:

[00267] B 1 : TKNSLTE (SEQ ID NO:29), binding CCT;

[00268] B 2 : RNDALTE (SEQ ID NO:33), binding CTG;

[00269] B 3 : RSDHLTN (SEQ ID NO: 17), binding AGG;

[00270] B 4 : TSGHLVR (SEQ ID NO:44), binding GGT; and

[00271] B 5 : RSDKLTE (SEQ ID NO:40), binding CGG;

[00272] B 6 : RADNLTE (SEQ ID NO:26), binding CAG,

[00273] where Bi, B 2 , B 3 , B 4 , B 5 , and B 6 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-CAGCGGGGTAGGCTGCCT-S ' (SEQ ID NO:68), depicted in Figure 33C. For example, DNA-binding moiety set 11 is present in ZFPp. Exemplary DNA-binding moiety set 12

[00274] As another non-limiting example, Bj, B 2 , and B 3 can have the amino acid sequences:

[00275] B, : RNDTLTE (SEQ ID NO:36), binding CCG;

[00276] B 2 : TKNSLTE (SEQ ID NO:29), binding CCT; and

[00277] B 3 RSDHLTN (SEQ ID NO: 17), binding AGG,

[00278] where Bi, B 2 , and B 3 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-AGGCCTCCG-S', as depicted in Figure 34C. For example, DNA-binding moiety set 12 is present in ZFPq.

Exemplary DNA-binding moiety set 13

[00279] As another non-limiting example, Bi, B 2 , and B 3 can have the amino acid sequences:

[00280] B, : RADNLTE (SEQ ID NO:26), binding CAG;

[00281] B 2 : TKNSLTE (SEQ ID NO:29), binding CCT; and

[00282] B 3 : ERSHLRE (SEQ ID NO: 14), binding AGC,

[00283] where Bj, B 2 , and B 3 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-AGCCCTCAG-3', as depicted in Figure 35C. For example, DNA-binding moiety set 13 is present in ZFPr.

Exemplary DNA-binding moiety set 14

[00284] As another non-limiting example, Bi, B 2 , and B 3 can have the amino acid sequences:

[00285] B, : SKKHLAE (SEQ ID NO:35), binding CCC;

[00286] B 2 : RRDELNV (SEQ ID NO: 15), binding ATG; and

[00287] B 3 : HRTTLTN (SEQ ID NO:25), binding AGT,

[00288] where Bi, B 2 , and B 3 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-AGTATGCCC -3', as depicted in Figure 36C. For example, DNA-binding moiety set 14 is present in ZFPt.

Exemplary DNA-binding moiety set 15

[00289] As another non-limiting example, Bi, B 2 , and B 3 can have the amino acid sequences:

[00290] B, : TTGNLTV (SEQ ID NO: 18), binding AAT;

[00291] B 2 : QSGDLRR (SEQ ID NO:41), binding GCA; and

[00292] B 3 : TSHSLTE (SEQ ID NO:34), binding CCA,

[00293] where Bi, B 2 , and B 3 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-CCAGCAAAT -3', as depicted in Figure 37C. For example, DNA-binding moiety set 15 is present in ZFPu.

Exemplary DNA-binding moiety set 16

[00294] As another non-limiting example, Bj, B 2 , and B 3 can have the amino acid sequences:

[00295] Bj: RSDHLTT (SEQ ID NO:57), binding TGG;

[00296] B 2 : TSGNLVR (SEQ ID NO:45), binding GAT; and

[00297] B 3 : DPGHLVR (SEQ ID NO:46), binding GGC,

[00298] where Bj, B 2 , and B 3 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-GGCGATTGG -3', as depicted in Figure 38C. For example, DNA-binding moiety set 16 is present in ZFPv. Exemplary DNA-binding moiety set 17

[00299] As another non-limiting example, Bj, B 2 , and B 3 can have the amino acid sequences:

[00300] B 1 : DKKDLTR (SEQ ID NO: 16), binding ACC;

[00301] B 2 : TKNSLTE (SEQ ID NO:29), binding CCT; and

[00302] B 3 : RADNLTE (SEQ ID NO:26), binding CAG,

[00303] where Bj, B 2 , and B 3 , when present in a subject HBV DNA-binding polypeptide, collectively provide for binding to 5'-CAGCCTACC -3', as depicted in Figure 39C. For example, DNA-binding moiety set 17 is present in ZFPw. Exemplary HBV DNA-binding polypeptides

[00304] Exemplary HBV DNA-binding polypeptides are described in the Examples; amino acid sequences of exemplary HBV DNA-binding polypeptides are presented in Figures 23-39. In some embodiments, a subject HBV DNA-binding polypeptide has at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% amino acid sequence identity to the amino acid sequence set forth in one of Figure 23B, 24B, 25B, 26B, 27B, 28B, 29B, 30B, 3 IB, 32B, 33B, 34B, 35B, 36B, 37B, 38B, and 39B.

[00305] In some embodiments, a subject HBV DNA-binding polypeptide comprises an amino acid sequence that differs from a "parent" amino acid sequence set forth in one of Figure 23B, 24B, 25B, 26B, 27B, 28B, 29B, 30B, 31B, 32B, 33B, 34B, 35B, 36B, 37B, 38B, and 39B, by one amino acid, two amino acids, three amino acids, four amino acids, five amino acids, six amino acids, seven amino acids, eight amino acids, nine amino acids, ten amino acids, or from ten amino acids to fifteen amino acids. In some embodiments, the amino acid differences are present only within one or more DNA-binding moieties. In other embodiments, the amino acid differences are present only within the "scaffolding" or non-DNA-binding moiety portion of the polypeptide. In other embodiments, the amino acid differences are present in both a DNA- binding moiety and the scaffolding portion of the polypeptide. In some embodiments, the one or more amino acid differences are present only in one or more DNA-binding moieties, and the one or more amino acid differences provide for a binding to a target DNA having a nucleotide sequence that differs by at least one nucleotide from the nucleotide sequence of the target DNA bound by the "parent" or unmodified polypeptide.

Flanking sequences

[00306] If present, Ji and J 2 are each independently flanking peptides of from about 1 amino acid to about 100 amino acids in length, e.g., if present, J 1 and J 2 are each independently from about 1 amino acid to about 5 amino acids, from about 5 amino acids to about 10 amino acids, from about 10 amino acids to about 15 amino acids, from about 15 amino acids to about 20 amino acids, from about 20 amino acids to about 25 amino acids, from about 25 amino acids to about 30 amino acids, from about 30 amino acids to about 35 amino acids, from about 35 amino acids to about 40 amino acids, from about 40 amino acids to about 45 amino acids, from about 45 amino acids to about 50 amino acids, from about 50 amino acids to about 60 amino acids, from about 60 amino acids to about 70 amino acids, from about 70 amino acids to about 80 amino acids, from about 80 amino acids to about 90 amino acids, or from about 90 amino acids to about 100 amino acids in length. In some embodiments, a subject polypeptide comprises Ji and not J 2 (i.e., J 2 is absent), hi other embodiments, a subject polypeptide comprises J 2 and not Jj (i.e., J 1 is absent), hi other embodiments, a subject polypeptide comprises both Jj and J 2 .

[00307] Ji and J 2 can each independently be a nuclear localization signal; an epitope tag (e.g., glutathione-S-transferase, hemagglutinin (HA; e.g., CYPYD VPDYA; SEQ ID NO:70), FLAG (e.g., DYKDDDDK; SEQ ID NO:71), c-myc (e.g., CEQKLISEEDL; SEQ ID NO:72), and the like); a polypeptide that provides a detectable signal (e.g., an enzyme that converts a substrate into a product that can be detected colorimetrically, fluorimetrically, etc., where suitable enzymes include, but are not limited to luciferase, alkaline phosphatase, peroxidase, and the like; a fluorescent protein (e.g., a green fluorescent protein, a red fluorescent protein, a yellow fluorescent protein, etc.); a luminescent protein; etc.); a polypeptide that provides for ease of purification of the polypeptide (e.g., a metal ion affinity peptide e.g., (His) n , e.g., 6His (SEQ ID NO:216), and the like); glutathione-S-transferase; and the like); a polypeptide that provides for insertion into a eukaryotic cell membrane; a polypeptide that provides for solubility; a polypeptide that provides for attachment to another moiety, to a solid support, etc.; polypeptides that are members of a specific binding pair (e.g., a peptide ligand for a receptor; a peptide antigen specifically bound by an antibody binding site; an antibody binding site, such as a single-chain antibody; a sugar-binding polypeptide, such as a maltose-binding protein; etc.); and the like.

[00308] In some embodiments, a protease cleavage site ("proteolytic cleavage site") is positioned between Ji and the remainder of the polypeptide and/or between J 2 and the

remainder of the polypeptide. For example, in some embodiments, a subject polypeptide comprises an amino acid sequence of the formula:

[00309] (J 1 )(O 1 )(X 1 X 2 CyS(X) 2-4 CyS(X) 3 Ph 6 SeKB 0+11 )HiS(X) 3 HiS(Z))^ 1 X 2 CyS(X) 2- 4 Cys(X) 3 PheSer(Bo +n )His(X) 3 His(0 2 )(J 2 ) (SEQ ID NO:73), where Oi and O 2 , if present, is each independently a protease cleavage site, where the other elements of the formula are as described above.

[00310] Proteolytic cleavage sites are known to those skilled in the art; a wide variety are known and have been described amply in the literature, including, e.g., Handbook of Proteolytic Enzymes (1998) AJ Barrett, ND Rawlings, and JF Woessner, eds., Academic Press. Proteolytic cleavage sites include, but are not limited to, an enterokinase cleavage site: (Asp) 4 Lys (SEQ ID NO:217); a factor Xa cleavage site: Ile-Glu-Gly-Arg (SEQ ID NO:74); a thrombin cleavage site, e.g., Leu-Val-Pro-Arg-Gly-Ser (SEQ ID NO:75); a renin cleavage site, e.g., His-Pro-Phe-His-Leu-Val-Ile-His (SEQ ID NO:76); a collagenase cleavage site, e.g., X- Gly-Pro (where X is any amino acid); a trypsin cleavage site, e.g., Arg-Lys; a viral protease cleavage site, such as a viral 2 A or 3 C protease cleavage site, including, but not limited to, a protease 2A cleavage site from a picornavirus (see, e.g., Sommergruber et al. (1994) Virol. 198:741-745), a Hepatitis A virus 3C cleavage site (see, e.g., Schultheiss et al. (1995) J. Virol. 69:1727-1733), human rhinovirus 2A protease cleavage site (see, e.g., Wang et al. (1997) Biochem. Biophys. Res. Comm. 235:562-566), and a picornavirus 3 protease cleavage site (see, e.g., Walker et al. (1994) Biotechnol. 12:601-605. Nuclear localization signals

[00311] In some embodiments, a subject HBV DNA-binding polypeptide comprises a nuclear localization signal (NLS).

[00312] Suitable NLS are 6 to 15 amino acids in length, and facilitate transport of the associated polypeptide into the nucleus of a eukaryotic cell. Suitable NLS include, e.g., a Simian Virus 40 (SV40) large T antigen nuclear localization signal sequence, a polyoma large T antigen nuclear localization signal sequence, an adenovirus EIa nuclear localization signal sequence, and an adenovirus EIb nuclear localization signal sequence.

[00313] Suitable NLS include, but are not limited to:

[00314] 1) KIPIK (SEQ ID NO:77);

[00315] 2) VRILESWFAKNI (SEQ ID NO:78);

[00316] 3) PKKKRKV (SEQ ID NO:79);

[00317] 4) AAFEDLRVRS (SEQ ID NO:80);

[00318] 5) PRKR (SEQ ID NO: 81);

[00319] 6) VSRKRPRPA (SEQ ID NO:82);

[00320] 7) APTKRK (SEQ ID NO:83);

[00321 ] 8) KRPRP (SEQ ID NO: 84);

[00322] 9) PNKKKRK (SEQ ID NO:85);

[00323] 10) RPAATKKAGQAKKKKLD (SEQ ID NO: 86);

[00324] 11) KKKIK (SEQ ID NO:87);

[00325] 12) RVTIRTVRVRRPPKGKHRK (SEQ ID NO:88);

[00326] 13) DGKKWS (SEQ ID NO: 89);

[00327] 14) KAKRQR (SEQ ID NO:90);

[00328] 15) DRLRR (SEQ ID NO:91);

[00329] 16) PKQKRK (SEQ ID NO:92);

[00330] 17) VRKKRKT (SEQ ID NO:93);

[00331] 18) AKKSKQE (SEQ ID NO:94);

[00332] 19) PAAKRVKLD (SEQ ID NO:95);

[00333] 20) RQRRNELKRSF (SEQ ID NO:96);

[00334] 21) TKKRKLE (SEQ ID NO:97);

[00335] 22) PKTRRRP (SEQ ID NO:98);

[00336] 23) SQRKRPP (SEQ ID NO:99);

[00337] 24) RLPVRRRRRVP (SEQ ID NO: 100);

[00338] 25) GRKKR (SEQ ID NO: 101);

[00339] 26) VWTTKGKRKRIDV (SEQ ID NO: 102);

[00340] 27) RKFKK (SEQ ID NO: 103);

[00341] 28) RRNRRRRW (SEQ ID NO: 104);

[00342] 29) PRESGKKRKRKRLKPT (SEQ ID NO: 105);

[00343] 30) SALIKKKKMAP (SEQ ID NO: 106);

[00344] 31 ) PPKKR (SEQ ID NO: 107);

[00345] 32) PKKKKK (SEQ ID NO: 108);

[00346] 33) SKRVAKRKL (SEQ ID NO: 109);

[00347] 34) PLLKKIKQ (SEQ ID NO: 110);

[00348] 35) PPQKKIKS (SEQ ID NO: 11 1);

[00349] 36) PQPKKKP (SEQ ID NO: 112);

[00350] 37) FKRKHKKDISQNKRAVRR (SEQ ID NO: 113);

[00351] 38) SKCLGWLWG (SEQ ID NO: 114);

[00352] 39) GKRKNKPK (SEQ ID NO: 115);

[00353] 40) KTRKHRG (SEQ ID NO: 116);

[00354] 41) KHRKHPG (SEQ ID NO:1 17); and

[00355] 42) MCPKKRKV (SEQ ID NO: 118).

Endonucleases

[00356] In some embodiments, one or both of Ji and J 2 are endonucleases that specifically cleave HBV cccDNA. Suitable endonucleases include, but are not limited to, a Fokl endonuclease, a yeast homothallism endonuclease, and the like.

[00357] For example, in some embodiments, a suitable endonuclease comprises an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to the amino acid sequence depicted in Figure 42B, which depicts a Fokl endonuclease domain amino acid sequence. Suitable nucleotide sequences encoding an endonuclease include nucleotide sequences encoding an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to the amino acid sequence depicted in Figure 42B. For example, a suitable nucleotide sequence encoding an endonuclease can have at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, nucleotide sequence identity to the nucleotide sequence depicted in Figure 42A.

[00358] As another example, in some embodiments, a suitable endonuclease comprises an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to the amino acid sequence depicted in Figure 43 B, which depicts a yeast homothallism (HO) endonuclease domain amino acid sequence. Suitable nucleotide sequences encoding an endonuclease include nucleotide sequences encoding an amino acid sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, amino acid sequence identity to the amino acid sequence depicted in Figure 43B. For example, a suitable nucleotide sequence encoding an endonuclease can have at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, nucleotide sequence identity to the nucleotide sequence depicted in Figure 43 A.

Additional components

[00359] A subject HBV DNA-binding polypeptide can comprise, in addition to above-described features, one or more additional components. For example, in some embodiments, a subject HBV DNA-binding polypeptide comprises one or more of: a radiolabel; a biotin moiety; a poly(ethyleneglycol) (PEG) or other polymer moiety; a targeting moiety (e.g., a moiety that provides for targeting to a specific cell type, e.g., a liver cell; a fluorophore (e.g., fluorescein, rhodamine, tetramethylrhodamine, eosin, erythrosin, coumarin, methyl-coumarins, pyrene, Malacite green, stilbene, Lucifer Yellow, Cascade Blue™, Texas Red, IAEDANS, EDANS, BODIPY FL, LC Red 640, Cy 5, Cy 5.5, LC Red 705 and Oregon green); etc. Preparation of a subject polypeptide

[00360] A subject HBV DNA-binding polypeptide may be synthesized chemically or enzymatically, may be produced recombinantly, or a combination of the foregoing. A subject HBV DNA-binding polypeptide may be isolated from a sample (e.g., a recombinant cell expressing the HBV DNA-binding polypeptide; or other sample comprising the synthesized HBV DNA-binding polypeptide) using standard methods of protein purification known in the art, including, but not limited to, high performance liquid chromatography, exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification technique. One may employ solid phase peptide synthesis techniques, where such techniques are known to those of skill in the art. See Jones, The Chemical Synthesis of Peptides (Clarendon Press, Oxford)(1994). Generally, in such methods a peptide is produced through the sequential additional of activated monomelic units to a solid phase bound growing peptide chain. Peptides can be synthesized in solution or on a solid support in accordance with conventional techniques. Various automatic synthesizers are commercially available and can be used in accordance with known protocols. See, for example, Stewart and Young, Solid Phase Peptide Synthesis, 2d. ed., Pierce Chemical Co. (1984); Tarn et al., J. Am. Chem. Soc. 105:6442 (1983); Merrifield, Science 232:341-347 (1986); and Barany and Merrifield, The Peptides, Gross and Meienhofer, eds., Academic Press, New York, pp. 1-284 (1979), each of which is incorporated herein by reference. Well-established recombinant DNA techniques can be employed for production of a subject polypeptide.

[00361] For production of a subject HBV DNA-binding polypeptide by recombinant means, a subject polynucleotide (described in more detail below) comprising a nucleotide sequence encoding the HBV DNA-binding polypeptide is expressed in any convenient expression system, including, for example, bacterial, yeast, insect, amphibian and mammalian systems. Suitable vectors and host cells are described in U.S. Patent No. 5,654,173. In the expression

vector, a subject polynucleotide is linked to a regulatory sequence as appropriate to obtain the desired expression properties. These regulatory sequences can include promoters (attached either at the 5' end of the sense strand or at the 3' end of the antisense strand), enhancers, terminators, operators, repressors, and inducers. The promoters can be regulated or constitutive. In some situations it may be desirable to use conditionally active promoters, such as tissue-specific (e.g., liver-specific) promoters. These are linked to the desired nucleotide sequence using the techniques described above for linkage to vectors. Any techniques known in the art can be used. In other words, the expression vector will provide a transcriptional and translational initiation region, which may be inducible or constitutive, where the coding region is operably linked under the transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region. These control regions may be native to the subject species from which the subject nucleic acid is obtained, or may be derived from exogenous sources.

[00362] Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding heterologous proteins. A selectable marker operative in the expression host may be present.

[00363] Expression cassettes may be prepared comprising a transcription initiation region, the gene or fragment thereof, and a transcriptional termination region. After introduction of the expression cassette containing a subject polynucleotide, the cells containing the construct may be selected by means of a selectable marker, the cells expanded and then used for expression.

[00364] The above described expression systems may be employed with prokaryotes or eukaryotes in accordance with conventional ways, depending upon the purpose for expression. For large scale production of the protein, a unicellular organism, such as Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, insect cells in combination with baculovirus vectors, or cells of a higher organism such as vertebrates, e.g. COS 7 cells, HEK 293, CHO, Xenopus oocytes, etc., may be used as the expression host cells. In some situations, it is desirable to express the polynucleotide in eukaryotic cells, where the expressed protein will benefit from native folding and post-translational modifications. Specific expression systems of interest include bacterial, yeast, insect cell and mammalian cell derived expression systems, which expression systems are well known in the art. Compositions comprising a subject HBV DNA-binding polypeptide

[00365] The present invention provides compositions comprising a subject HBV DNA-binding polypeptide. Compositions comprising a subject HBV DNA-binding polypeptide can include one or more of: a salt, e.g., NaCl, MgCl, KCl, MgSO 4 , etc.; a buffering agent, e.g., a Tris

buffer, N-(2-Hydroxyethyl)piρerazine-N'-(2-ethanesulfonic acid) (HEPES), 2-(N- Morpholino)ethanesulfonic acid (MES), 2-(N-Morpholino)ethanesulfonic acid sodium salt (MES), 3-(N-Morpholino)propanesulfonic acid (MOPS), N-tris[Hydroxymethyl]methyl-3- aminopropanesulfonic acid (TAPS), etc.; a solubilizing agent; a detergent, e.g., a non-ionic detergent such as Tween-20, etc.; a protease inhibitor; and the like.

[00366] In some instances, a subject HBV DNA-binding polypeptide composition can comprise a pharmaceutically acceptable excipient, a variety of which are known in the art and need not be discussed in detail herein. Pharmaceutically acceptable excipients have been amply described in a variety of publications, including, for example, "Remington: The Science and Practice of Pharmacy", 19 th Ed. (1995), or latest edition, Mack Publishing Co; A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H. C. Ansel et al., eds 7 th ed., Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) A.H. Kibbe et al., eds., 3 rd ed. Amer. Pharmaceutical Assoc. NUCLEIC ACIDS, VECTORS, HOST CELLS

[00367] The present invention provides nucleic acids encoding a subject HBV DNA-binding polypeptide, as well as recombinant vectors and recombinant host cells comprising the nucleic acids or recombinant vectors. In many embodiments, a subject nucleic acid is isolated, and can be synthetic. In some embodiments, a subject nucleic acid is pure, e.g., at least about 50% pure, at least about 60% pure, at least about 70% pure, at least about 80% pure, at least about 90%, or at least about 95% or more pure. In many embodiments, a subject host cell is isolated. In some embodiments, a subject host cell is in vitro and is cultured as a unicellular entity.

[00368] A subject nucleic acid comprises a nucleotide sequence encoding a subject HBV DNA- binding polypeptide. A subject recombinant vector comprises a subject nucleic acid. In many embodiments, a subject recombinant vector comprises a subject nucleic acid operably linked to one or more control elements, such as a promoter, a transcription terminator, and the like. A subject recombinant vector in some embodiments provides for amplification of the copy number of a subject nucleic acid. A subject recombinant vector is in some embodiments an expression vector that provides for synthesis of a subject HBV DNA-binding polypeptide in a host cell, e.g., a prokaryotic host cell or a eukaryotic host cell.

[00369] In some embodiments, a subject nucleic acid comprises a nucleotide sequence encoding a subject HBV DNA-binding polypeptide, where the HBV DNA-binding polypeptide comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100% amino acid sequence

identity to the amino acid sequence set forth in one of Figure 23B, 24B, 25B, 26B, 27B, 28B, 29B, 30B, 3 IB, 32B, 33B, 34B, 35B 5 36B, 37B, 38B, and 39B.

[00370] In some embodiments, a subject nucleic acid comprises a nucleotide sequence encoding a subject HBV DNA-binding polypeptide that comprises an amino acid sequence that differs from a "parent" amino acid sequence set forth in one of Figure 23B, 24B, 25B, 26B, 27B, 28B, 29B, 30B, 3 IB, 32B, 33B, 34B, 35B, 36B, 37B, 38B, and 39B, by one amino acid, two amino acids, three amino acids, four amino acids, five amino acids, six amino acids, seven amino acids, eight amino acids, nine amino acids, ten amino acids, or from ten amino acids to fifteen amino acids, as described above.

[00371] In some embodiments, a subject nucleic acid comprises a nucleotide sequence encoding a subject HBV DNA-binding polypeptide, where the nucleotide sequence has at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or 100%, nucleotide sequence identity to the nucleotide sequence set forth in one of Figure 23A, 24A, 25A, 26A, 27A, 28A, 29A, 30A, 3 IA, 32A, 33A, 34A, 35A, 36A, 37A, 38A, or 39A.

[00372] A subject nucleic acid will in some embodiments be an expression construct, e.g., a nucleic acid comprising a nucleotide sequence encoding a subject HBV DNA-binding polypeptide; and including elements that provide for expression of the HBV DNA-binding polypeptide-encoding nucleic acid in a eukaryotic cell (e.g., a liver cell) and production of the HBV DNA-binding polypeptide in the cell. The expression vector will provide a transcriptional and translational initiation region, which may be inducible or constitutive, where the HBV DNA-binding polypeptide coding region is operably linked to and under the transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region.

[00373] Any expression vector known in the art can be used to express an HBV DNA-binding polypeptide-encoding nucleic acid. An expression vector will generally include a promoter and/or other transcription control elements which are active in the cell, and appropriate termination and polyadenylation signals. Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding a subject HBV DNA-binding polypeptide. A selectable marker operative in the expression host may be present.

[00374] Suitable expression vectors include, but are not limited to, viral vectors (e.g. viral vectors based on vaccinia virus; poliovirus; adenovirus (see, e.g., Li et al., Invest Opthalmol Vis Sci 35:2543 2549, 1994; Borras et al., Gene Ther 6:515 524, 1999; Li and Davidson,

PNAS 92:7700 7704, 1995; Sakamoto et al., H Gene Ther 5:1088 1097, 1999; WO 94/12649, WO 93/03769; WO 93/19191 ; WO 94/28938; WO 95/11984 and WO 95/00655); adeno- associated virus (see, e.g., AIi et al., Hum Gene Ther 9:81 86, 1998, Flannery et al., PNAS 94:6916 6921, 1997; Bennett et al., Invest Opthalmol Vis Sci 38:2857 2863, 1997; Jomary et al., Gene Ther 4:683 690, 1997, Rolling et al., Hum Gene Ther 10:641 648, 1999; AIi et al., Hum MoI Genet 5:591 594, 1996; Srivastava in WO 93/09239, Samulski et al., J. Vir. (1989) 63:3822-3828; Mendelson et al., Virol. (1988) 166:154-165; and Flotte et al., PNAS (1993) 90:10613-10617); SV40; herpes simplex virus; human immunodeficiency virus (see, e.g., Miyoshi et al., PNAS 94:10319 23, 1997; Takahashi et al., J Virol 73:7812 7816, 1999); a retroviral vector (e.g., Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, a lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus); and the like.

[00375] Numerous suitable expression vectors are known to those of skill in the art, and many are commercially available. The following vectors are provided by way of example; for eukaryotic host cells: pCMV, pcDNA3, pXTl, pSG5 (Stratagene), pSVK3, pBPV, pMSG, and pSVLSV40 (Pharmacia). However, any other vector may be used so long as it is compatible with the host cell.

[00376] Depending on the host/vector system utilized, any of a number of suitable transcription and translation control elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. may be used in the expression vector (see e.g., Bitter et al. (1987) Methods in Enzymology, 153:516-544).

[00377] In some embodiments, the HBV DNA-binding polypeptide-encoding nucleotide sequence is operably linked to a promoter, e.g., a eukaryotic promoter. Non-limiting examples of suitable eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, long terminal repeats (LTRs) from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art. The expression vector may also contain a ribosome binding site for translation initiation and a transcription terminator. The expression vector may also include appropriate sequences for amplifying expression.

[00378] In some embodiments, the HBV DNA-binding polypeptide-encoding nucleotide sequence is operably linked to a cell type-specific control element (e.g., a promoter, an enhancer). For example, in some embodiments, a liver cell-specific control element is included.

[00379] In some embodiments, cells containing a subject nucleic acid are identified by including a marker in the expression vector; and detecting the marker or selecting for expression of the marker. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression vector. A selectable marker is one that confers a property that allows for selection. A positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection. An example of a positive selectable marker is a drug resistance marker.

[00380] The inclusion of a drug selection marker aids in identification of transformants; for example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers. Also suitable for inclusion in an El A expression vector are screenable markers such as a green fluorescent protein (GFP), which provides a fluorescent signal, are also contemplated. Alternatively, screenable enzymes such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be utilized. One of skill in the art would also know how to employ immunologic markers, possibly in conjunction with FACS analysis.

[00381] Any of a variety of methods can be used to deliver a subject expression vector into a target cell (e.g., into liver cells, e.g., HBV-infected liver cells, etc.). Suitable methods include various mechanical methods, including the use of fusogenic lipid vesicles (liposomes incorporating cationic lipids such as lipofection); pneumatic delivery of DN A-coated gold particles with a device referred to as the gene gun; and administration of any of a variety of viral vectors (e.g., non-replicative mutants/variants of adenovirus, adeno-associated virus- based vectors, herpes simplex virus (HSV) vectors, cytomegalovirus (CMV) vectors, vaccinia virus vectors, retroviral vectors, lentiviral vectors, and poliovirus vectors). Suitable delivery vehicles and methods for introducing a subject nucleic acid into a target host cell are those discussed above for delivering a subject nucleic acid into a target cell.

[00382] The present invention further provides compositions comprising a subject nucleic acid.

Compositions comprising a subject nucleic acid will in many embodiments include one or more of: a salt, e.g., NaCl, MgCl, KCl, MgSO 4 , etc.; a buffering agent, e.g., a Tris buffer, N- (2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES), 2-(N- Morpholino)ethanesulfonic acid (MES), 2-(N-Morpholino)ethanesulfonic acid sodium salt (MES), 3-(N-Morpholino)propanesulfonic acid (MOPS), N-tris[Hydroxymethyl]methyl-3- aminopropanesulfonic acid (TAPS), etc.; a solubilizing agent; a detergent, e.g., a non-ionic detergent such as Tween-20, etc.; a nuclease inhibitor; and the like.

[00383] The present invention provides genetically modified host cells, including in vitro host cells that are cultured as unicellular entities, comprising a subject nucleic acid, hi some embodiments, a subject genetically modified host cell is a prokaryotic cell. A prokaryotic host cell that is genetically modified to contain a subject nucleic acid (including a subject recombinant vector) can be used to propagate the nucleic acid. In other embodiments, a subject genetically modified host cell is a eukaryotic cell. A eukaryotic host cell that is genetically modified to contain a subject nucleic acid (including a subject recombinant vector) can be used to produce a subject HBV DNA-binding polypeptide.

[00384] To generate a genetically modified host cell, a subject nucleic acid or a subject recombinant vector is introduced stably or transiently into a host cell, using established techniques, including, but not limited to, electroporation, calcium phosphate precipitation, DEAE-dextran mediated transfection, liposome-mediated transfection, and the like. For stable transformation, a nucleic acid will generally further include a selectable marker, e.g., any of several well-known selectable markers such as neomycin resistance, ampicillin resistance, tetracycline resistance, chloramphenicol resistance, kanamycin resistance, and the like.

[00385] Suitable host cells for cloning or expressing a subject nucleic acid (including a subject recombinant vector) include prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes for this purpose include eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceae such as Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and Shigella, as well as Bacilli such as B. subtilis and B. licheniformis (e.g., B. licheniformis 41 P disclosed in DD 266,710 published 12 Apr. 1989), Pseudomonas such as P. aeruginosa, and Streptomyces. These examples are illustrative rather than limiting.

[00386] In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among lower eukaryotic host microorganisms. However, a number of other genera, species, and strains are commonly available and useful herein, such as Schizosaccharomyces pombe; Kluyveromyces hosts such as, e.g., K. lactis, K.fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906), K. thermotolerans, and K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070); Candida; Trichoderma reesia (EP 244,234); Neurospora crassa; Schwanniomyces such as Schwanniomyces occidentalis; and filamentous fungi such as, e.g., Neurospora, Penicillium, Tolypocladium, and Aspergillus hosts such as A. nidulans and A. niger.

[00387] In some embodiments, a subject genetically modified host cell is a mammalian cell.

Suitable mammalian cells include primary cells and immortalized cell lines. Suitable mammalian cell lines include human cell lines, non-human primate cell lines, rodent (e.g., mouse, rat) cell lines, and the like. Suitable mammalian cell lines include, but are not limited to, HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2), CHO cells (e.g., ATCC Nos. CRL9618, CCL61, CRL9096), 293 cells (e.g., ATCC No. CRL-1573), Vero cells, NIH 3T3 cells (e.g., ATCC No. CRL-1658), Huh-7 cells, BHK cells (e.g., ATCC No. CCLlO), PC12 cells (ATCC No. CRL1721), COS cells, COS-7 cells (ATCC No. CRL1651), RATl cells, mouse L cells (ATCC No. CCLI.3), human embryonic kidney (HEK) cells (ATCC No. CRLl 573), HLHepG2 cells, and the like. Also suitable are avian cells and cell lines.

[00388] The present invention further provides compositions comprising a subject genetically modified host cell. A subject composition comprises a subject genetically modified host cell; and will in some embodiments comprise one or more further components, which components are selected based in part on the intended use of the genetically modified host cell. Suitable components include, but are not limited to, salts; buffers; stabilizers; protease-inhibiting agents; cell membrane- and/or cell wall-preserving compounds, e.g., glycerol, dimethylsulfoxide, etc.; nutritional media appropriate to the cell; and the like. UTILITY

[00389] A subject polypeptide is useful for various in vitro and in vivo applications. In vitro applications include detection methods. In vivo applications include therapeutic methods. Detection methods

[00390] A subject polypeptide is useful in various in vitro detection methods. For example, a subject polypeptide can be used to detect the presence of HBV DNA, e.g., HBV cccDNA, in a biological sample. A subject detection method is useful in diagnostic assays. For example, a subject detection method can provide for detection of cccDNA form of HBV in a liver cell in an individual, thereby providing an indication that the individual has a reservoir of HBV DNA and may experience a relapse. Where cccDNA is detected, treatment of the individual to reduce the level of or eradicate the cccDNA form of HBV may be recommended.

[00391] In some embodiments, a subject detection method comprises contacting a biological sample with a subject HBV DNA-binding polypeptide; and detecting binding, if any, of the HBV DNA-binding polypeptide with molecules in the sample, e.g., detecting formation of a complex between the HBV DNA-binding polypeptide and an HBV DNA which may be present in the sample. In some of these embodiments, the HBV DNA-binding polypeptide detects cccDNA form of HBV DNA.

[00392] In some embodiments, the HBV DNA-binding polypeptide that it used in the assay is detectably labeled, e.g., is directly detectably labeled. Suitable detectable labels include, e.g., radiolabels; enzymes that act on a substrate to yield a colored, luminescent, or fluorescent product; fluorescent proteins (a green fluorescent protein, a yellow fluorescent protein, a red fluorescent protein, etc.); a fluorophore (e.g., fluorescein, rhodamine, tetramethylrhodamine, eosin, erythrosin, coumarin, methyl-coumarins, pyrene, Malacite green, stilbene, Lucifer Yellow, Cascade Blue™, Texas Red, IAEDANS, EDANS, BODIPY FL, LC Red 640, Cy 5, Cy 5.5, LC Red 705 and Oregon green); and the like. In other embodiments, the HBV DNA- binding polypeptide is indirectly labeled. Indirect labels include, e.g., detectably labeled antibodies that are specific for the HBV DNA-binding polypeptide; detectably-labeled avidin, e.g., where the HBV DNA-binding polypeptide is biotinylated; and the like.

[00393] In some embodiments, the detection method comprises an immunological-based assay, e.g., an enzyme-linked immunosorbent assay (ELISA); a radioimmunoassay (RIA); and the like, wherein an antibody specific for a subject HBV DNA-binding polypeptide is used to detect any complexes formed between the HBV DNA-binding polypeptide and HBV DNA. In other embodiments, the detection method comprises use of an electrophoretic mobility shift assay. In other embodiments, the detection method comprises formation of insoluble complexes between a subject HBV DNA-binding polypeptide and HBV DNA.

[00394] In some embodiments, the biological sample includes liver cells obtained from an individual. The biological sample is in some embodiments a liver biopsy. Therapeutic methods

[00395] The present invention further provides methods of treating an HBV infection; methods of reducing the level of cccDNA form of HBV in an individual; and methods of reducing the likelihood that an individual will suffer a relapse of an HBV infection. The methods generally involve administering to an individual in need thereof an effective amount of a subject HBV DNA-binding polypeptide and/or a subject nucleic acid.

[00396] Treating an HBV infection can provide for treating sequelae of an HBV infection, e.g., treating one or more of chronic liver inflammation caused by HBV, cirrhosis, acute hepatitis, fulminant hepatitis, chronic persistent hepatitis, and fatigue.

[00397] In some embodiments, an effective amount of a subject HBV DNA-binding polypeptide, or an effective amount of a subject nucleic acid, is an amount that, when administered to an individual in need thereof in one or more doses, reduces the level of cccDNA form of HBV in the individual by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at

least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%, compared to the level of cccDNA form of HBV in the individual not treated with the polypeptide or the nucleic acid.

[00398] In some embodiments, an effective amount of a subject HBV DNA-binding polypeptide, or an effective amount of a subject nucleic acid, is an amount that, when administered to an individual in need thereof in one or more doses, reduces the HBV viral load in the individual by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%, compared to the viral load in the individual not treated with the polypeptide or the nucleic acid.

[00399] In some embodiments, an effective amount of a subject HBV DNA-binding polypeptide, or an effective amount of a subject nucleic acid, is an amount that, when administered to an individual in need thereof in one or more doses, increases liver function in the individual. Administration and Formulation of Polypeptide Agents

[00400] Formulation of a subject HBV DNA-binding polypeptide to a subject, as well as method of delivery of polypeptide agents, are available in the art. A subject HBV DNA- binding polypeptide can be administered together with a suitable pharmaceutically acceptable carrier or excipient. Pharmaceutically acceptable excipients have been amply described in a variety of publications, including, for example, A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy," 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H. C. Ansel et al., eds., 7 th ed., Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) A.H. Kibbe et al., eds., 3 rd ed. Amer. Pharmaceutical Assoc. The pharmaceutically acceptable excipients, such as vehicles, adjuvants, carriers or diluents, are readily available to the public. Moreover, pharmaceutically acceptable auxiliary substances, such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, wetting agents and the like, are readily available to the public.

[00401] Suitable pharmaceutically acceptable carriers include essentially chemically inert and nontoxic pharmaceutical compositions that do not interfere with the effectiveness of the biological activity of the pharmaceutical composition. Examples of suitable pharmaceutical carriers include, but are not limited to, saline solutions, glycerol solutions, ethanol, N-(l(2,3-dioleyloxy)propyl)- N,N,N-trimethylammonium chloride (DOTMA), diolesylphosphotidylethanolamine (DOPE), and liposomes. Such pharmaceutical compositions

should contain a therapeutically effective amount of the compound, together with a suitable amount of carrier so as to provide the form for proper administration to the subject. The formulation should suit the mode of administration. For example, a formulation suitable for oral administration can include an enteric coating to protect a subject HBV DNA-binding polypeptide from degradation within the gastrointestinal tract. In another example, a subject HBV DNA-binding polypeptide may be administered in a liposomal formulation, to shield the polypeptide from degradative enzymes, facilitate transport in circulatory system, and effect delivery across cell membranes to intracellular sites.

[00402] hi another embodiment, a pharmaceutical composition comprises a subject HBV DNA- binding polypeptide, and/or one or more additional therapeutic agents; and a pharmaceutically acceptable carrier. In one embodiment, a pharmaceutical composition, comprising a subject HBV DNA-binding polypeptide, with or without other therapeutic agents; and a pharmaceutically acceptable carrier, is at an effective dose.

[00403] A subject HBV DNA-binding polypeptide can be formulated as neutral or salt forms.

Pharmaceutically acceptable salts include those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.

[00404] In some embodiments, a subject HBV DNA-binding polypeptide composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for subcutaneous injection or intravenous administration to humans. Typically, pharmaceutical compositions for subcutaneous injection or intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lidocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as an ampule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle, bag, or other acceptable container, containing sterile pharmaceutical grade water, saline, or other acceptable diluents. Where the composition is administered by injection, an ampule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.

[00405] Pharmaceutical compositions adapted for oral administration may be provided, for example, as capsules or tablets; as powders or granules; as solutions, syrups or suspensions (in aqueous or non-aqueous liquids); as edible foams or whips; or as emulsions. Tablets or hard gelatine capsules may comprise, for example, lactose, starch or derivatives thereof, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, stearic acid or salts thereof. Soft gelatine capsules may comprise, for example, vegetable oils, waxes, fats, semi-solid, or liquid polyols, etc. Solutions and syrups may comprise, for example, water, polyols and sugars.

[00406] A subject HBV DNA-binding polypeptide intended for oral administration may be coated with or admixed with a material {e.g., glyceryl monostearate or glyceryl distearate) that delays disintegration or affects absorption of the polypeptide in the gastrointestinal tract. Thus, for example, the sustained release of a subject HBV DNA-binding polypeptide may be achieved over many hours and, if necessary, the polypeptide can be protected from being degraded within the gastrointestinal tract. Taking advantage of the various pH and enzymatic conditions along the gastrointestinal tract, pharmaceutical compositions for oral administration may be formulated to facilitate release of subject HBV DNA-binding polypeptide at a particular gastrointestinal location.

[00407] Pharmaceutical compositions adapted for parenteral administration include, but are not limited to, aqueous and non-aqueous sterile injectable solutions or suspensions, which may contain antioxidants, buffers, bacteriostats and solutes that render the pharmaceutical compositions substantially isotonic with the blood of an intended recipient. Other components that may be present in such pharmaceutical compositions include water, alcohols, polyols, glycerine and vegetable oils, for example. Compositions adapted for parenteral administration may be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring the addition of a sterile liquid carrier, e.g., sterile saline solution for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets. Such pharmaceutical compositions should contain a therapeutically or cosmetically effective amount of an active agent, together with a suitable amount of carrier so as to provide the form for proper administration to the subject. The formulation should suit the mode of administration.

[00408] Pharmaceutical compositions adapted for transdermal administration may be provided as discrete patches intended to remain in intimate contact with the epidermis for a prolonged period of time. Pharmaceutical compositions adapted for topical administration may be provided as, for example, ointments, creams, suspensions, lotions, powders, solutions, pastes,

gels, sprays, aerosols or oils. A topical ointment or cream is used for topical administration to the skin, mouth, eye or other external tissues. When formulated in an ointment, the active ingredient may be employed with either a paraffinic or a water-miscible ointment base. Alternatively, the active ingredient may be formulated in a cream with an oil-in-water base or a water-in-oil base.

[00409] Pharmaceutical compositions adapted for topical administration to the eye include, for example, eye drops or injectable pharmaceutical compositions. In these pharmaceutical compositions, the active ingredient can be dissolved or suspended in a suitable carrier, which includes, for example, an aqueous solvent with or without carboxymethylcellulose. Pharmaceutical compositions adapted for topical administration in the mouth include, for example, lozenges, pastilles and mouthwashes.

[00410] Pharmaceutical compositions adapted for nasal administration may comprise solid carriers such as powders (e.g., having a particle size in the range of 20 to 500 microns). Powders can be administered in the manner in which snuff is taken, i.e., by rapid inhalation through the nose from a container of powder held close to the nose. Alternatively, pharmaceutical compositions adopted for nasal administration may comprise liquid carriers such as, for example, nasal sprays or nasal drops. These pharmaceutical compositions may comprise aqueous or oil solutions of the active ingredient. Compositions for administration by inhalation may be supplied in specially adapted devices including, but not limited to, pressurized aerosols, nebulizers or insufflators, which can be constructed so as to provide predetermined dosages of the active ingredient. In yet another embodiment, a subject HBV DNA-binding polypeptide may be administered using long-acting HBV DNA-binding polypeptide formulations that either delay the clearance of the HBV DNA-binding polypeptide from the site or cause a slow release of the HBV DNA-binding polypeptide from, e.g., an injection or administration site. The long-acting formulation that prolongs clearance of sa ubject HBV DNA-binding polypeptide may be in the form of a subject HBV DNA-binding polypeptide complexed, or covalently conjugated (by reversible or irreversible bonding) to a macromolecule such as a water-soluble polymer selected from poly(ethylene glycol) (PEG) and polypropylene glycol homopolymers and polyoxyethylene polyols, i.e., those that are soluble in water at room temperature. See, e.g., U.S. Patent No. 5,824,642, hereby expressly incorporated by reference in its entirety. Alternatively, a subject HBV DNA-binding polypeptide may be complexed or bound to a polymer to increase its circulatory half-life. Examples of polyethylene polyols and polyoxyethylene polyols useful for this purpose include polyoxyethylene glycerol, polyethylene glycol, polyoxyethylene sorbitol, polyoxyethylene

glucose, or the like. The glycerol backbone of polyoxyethylene glycerol is the same backbone occurring in, for example, animals and humans in mono-, di-, and triglycerides. The polymer need not have any particular molecular weight. In some embodiments, the molecular weight is between about 3500 and 100,000, or between 5000 and 40,000. In some embodiments, the PEG homopolymer is unsubstituted, but it may also be substituted at one end with an alkyl group. In some embodiments, the alkyl group is a C1-C4 alkyl group, and most preferably a methyl group. In some embodiments, the polymer is an unsubstituted homopolymer of PEG, a monomethyl-substituted homopolymer of PEG (mPEG), or polyoxyethylene glycerol (POG) and has a molecular weight of about 5000 to 40,000.

[00411] Suitable routes and modes of administration of a subject HBV DNA-binding polypeptide include, but are not limited to, oral, intravenous infusion, subcutaneous injection, intramuscular, topical, depot injection, implantation, time-release mode, intracavitary, intranasal, inhalation, intraocular, and controlled release. A subject HBV DNA-binding polypeptide polypeptide also may be introduced parenterally, transmucosally (e.g., orally), nasally, rectally, intravaginally, sublingually, submucosally, intracranially, or transdermally. In some embodiments, administration is parenteral, i.e., not through the alimentary canal but rather through some other route via, for example, intravenous, subcutaneous, intramuscular, intraperitoneal, intraorbital, intracapsular, intraspinal, intrasternal, intra-arterial, or intradermal administration. The skilled artisan can appreciate the specific advantages and disadvantages to be considered in choosing a route and mode of administration.

[00412] In one embodiment, a subject HBV DNA-binding polypeptide is delivered by a controlled-release or sustained release system. For example, a subject HBV DNA-binding polypeptide may be administered using intravenous infusion, an implantable osmotic pump, a transdermal patch, liposomes, or other modes of administration. In one embodiment, a pump may be used (See, e.g., Langer, 1990, Science 249:1527-33; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201 ; Buchwald et al, 1980, Surgery 88:507; Saudek et al. , 1989, N. Engl. J. Med. 321 :574). In another embodiment, a subject HBV DNA-binding polypeptide can be delivered in a vesicle, e.g., a liposome (See, e.g., Langer, Science 249:1527-33 (1990); Treat et al., 1989, in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-65; Lopez-Berestein, ibid., pp. 317-27 International Patent Publication No. WO 91/04014; U.S. Patent No. 4,704,355). In another embodiment, polymeric materials can be used (See, e.g., Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Press: Boca Raton, Florida, 1974; Controlled Drug Bioavailability, Drug Product Design and Performance. Smolen and Ball (eds.), Wiley: New

York (1984); Ranger and Peppas, 1953, J. Macromol. Sci. Rev. Macromol. Chem. 23:61 ; Levy et ai, 1985, Science 228:190; During et al, 1989, Ann. Neurol. 25:351 ; Howard et al., 1989, J. Neurosurg. 71 :105). Suitable examples of sustained-release compositions include semipermeable polymer matrices in the form of shaped articles, e.g., films, or microcapsules. Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate {see Sidman et al, 1983, Biopolymers, 22:547-556), poly(2-hydroxyethyl methacrylate) (Langer et al, 1981, J. Biomed Mater Res, 15:167-277), and Langer, 1982, Chem Tech, 12:98-105), ethylene vinyl acetate (Langer et al, supra) or poly-D-(-)-3-hydroxybutyric acid (EP 133,988). Sustained-release HBV DNA-binding polypeptide compositions also include liposomally entrapped HBV DNA- binding polypeptide. Liposomes containing a subject HBV DNA-binding polypeptide are prepared by methods known per se: DE 3,218, 121 ; Epstein et al. , 1985, Proc Natl Acad Sci USA, 82:3688-3692; Hwang et al, 1980, Proc Natl Acad Sci USA, 77: 4030-4034; EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Pat. Appln. 83-118008; U.S. Patent Nos. 4,485,045 and 4,544,545; and EP 102,324. The liposomes can be of the small (from or about 200 to 800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol percent cholesterol, the selected proportion being adjusted for the optimal therapy.

[00413] In yet another embodiment, a controlled release system can be placed in proximity of the target. For example, a micropump may deliver controlled doses directly into the liver, thereby requiring only a fraction of the systemic dose {See, e.g., Goodson, 1984, in Medical Applications of Controlled Release, vol. 2, pp. 115-138).

[00414] In one embodiment, it may be desirable to administer the agent locally to the area in need of treatment; this may be achieved, for example, and not by way of limitation, by local infusion during surgery, topical application, injection, by means of a catheter, by means of a suppository, or by means of an implant. An implant can be of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. Administration and Formulation of Nucleic Acid Agents

[00415] Formulation of a subject nucleic acid for delivery to a subject, as well as method of delivery of nucleic acid agents, are available in the art. These include formulations and delivery methods to effect systemic delivery of a nucleic acid agent, as well as formulation and delivery methods to effect local delivery of a nucleic acid agent (e.g., to effect to a particular organ or compartment (e.g., to effect delivery to liver tissue, etc.). Nucleic acid agents can be formulated to include a delivery vehicle for administration to a subject, carriers and diluents and their salts, and/or can be present in pharmaceutically acceptable formulations.

[00416] Suitable formulations at least in part depend upon the use or the route of entry, for example parenteral, oral, or transdermal. The term "parenteral" as used herein includes percutaneous, subcutaneous, intravascular (e.g., intravenous), intratumoral, peritumoral, intramuscular, or intrathecal injection or infusion techniques, and the like. Formulations include pharmaceutically acceptable salts of an agent of interest, e.g., acid addition salts.

[00417] In one embodiment, a nucleic acid agent is administered to a subject by systemic administration in a pharmaceutically acceptable composition or formulation. By "systemic administration" is meant in vivo systemic absorption or accumulation of drugs in the blood stream to facilitate distribution through the body. Systemic administration routes include, e.g., intravenous, subcutaneous, portal vein, intraperitoneal, inhalation, oral, intrapulmonary and intramuscular.

[00418] Formulations of a nucleic acid agent can also be administered orally, topically, parenterally, by inhalation or spray, or rectally in dosage unit formulations containing pharmaceutically acceptable carriers, adjuvants and/or vehicles. Pharmaceutically acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A.R. Gennaro edit. 1985), hereby incorporated herein by reference. For example, preservatives, stabilizers, dyes and flavoring agents can be provided. These include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. In addition, antioxidants and suspending agents can be used.

[00419] A pharmaceutically effective dose is that dose required to prevent, inhibit the occurrence, or treat (alleviate a symptom at least to some extent) of a disease state. The pharmaceutically effective dose depends on the type of disease, the composition used, the route of administration, the type of subject being treated, subject-dependent characteristics under consideration, concurrent medication, and other factors that those skilled in the medical arts will recognize. Generally, an amount between 0.1 mg/kg and 100 mg/kg body weight/day of active ingredients (e.g., a nucleic acid agent) is administered.

[00420] Formulations and methods of delivery of agents (including nucleic acid molecules) to the liver are known in the art, see, e.g., Wen et al., 2004, World J Gastroenterol., 10, 244-9; Murao et al., 2002, Pharm Res., 19, 1808-14; Liu et al., 2003, Gene Ther., 10, 180-7; Hong et al., 2003, J Pharm Pharmacol., 54, 51-8; Herrmann et al., 2004, Arch Virol., 149, 1611-7; and Matsuno et al., 2003, Gene Ther., 10, 1559-66.

[00421] Where pulmonary delivery is desired, a nucleic acid agent can be administered by, e.g., inhalation of an aerosol or spray dried formulation administered by an inhalation device (e.g.,

nebulizer, insufflator, metered dose inhaler, and the like), providing uptake of the agent into pulmonary tissues. Solid particulate compositions containing respirable dry particles of micronized compositions containing a compound of interest (e.g., nucleic acid) can be prepared by standard techniques. A solid particulate composition can optionally contain a dispersant which serves to facilitate the formation of an aerosol. A suitable dispersant is lactose, which can be blended with the agent in any suitable ratio, such as a 1 to 1 ratio by weight. The active ingredient typically in about 0.1 to 100 w/w of the formulation. The agent can be delivered as a a suspension or solution formulation, and may involve use of a liquified propellant, e.g., a chlorofluorocarbon compound such as dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane and mixtures thereof. Aerosol formulation can additionally contain one or more co-solvents, for example, ethanol, emulsifiers and other formulation surfactants, such as oleic acid or sorbitan trioleate, anti-oxidants and suitable flavoring agents. Other methods for pulmonary delivery are described in, for example US 2004/0037780, and US 6,592,904; US 6,582,728; US 6,565,885, each of which are incorporated herein by reference.

[00422] Formulations and methods of delivery of a nucleic acid agent to hematopoietic cells, including monocytes and lymphocytes, are known in the art, see, e.g., Hartmann et al., 1998, J. Phamacol. Exp. Ther., 285(2), 920-928; Kronenwett et al., 1998, Blood, 91(3), 852-862; Filion and Phillips, 1997, Biochim. Biophys. Acta., 1329(2), 345-356; Ma and Wei, 1996, Leuk. Res., 20(11/12), 925-930; and Bongartz et al., 1994, Nucleic Acids Research, 22(22), 4681-8. Such methods, as described above, include the use of free compound (e.g., oligonucleotide), cationic lipid formulations, liposome formulations including pH sensitive liposomes and immunoliposomes, and bioconjugates including oligonucleotides conjugated to fusogenic peptides, for delivery of compounds into hematopoietic cells.

[00423] Formulations and methods of delivery of a nucleic acid agent to the skin or mucosa are known in the art. Such delivery systems include, e.g., aqueous and nonaqueous gels, creams, multiple emulsions, microemulsions, liposomes, ointments, aqueous and nonaqueous solutions, lotions, patches, suppositories, and tablets, and can contain excipients such as solubilizers, permeation enhancers (e.g., fatty acids, fatty acid esters, fatty alcohols and amino acids), and hydrophilic polymers (e.g., polycarbophil and polyvinylpyrolidone).

[00424] Delivery to the central nervous system (CNS) and/or peripheral nervous system can be accomplished by, for example, local administration of a nucleic acid agent to nerve cells. Conventional approaches to CNS delivery that can be used include, but are not limited to, intrathecal and intracerebroventricular administration, implantation of catheters and pumps,

direct injection or perfusion at the site of injury or lesion, injection into the brain arterial system, or by chemical or osmotic opening of the blood-brain barrier. Other approaches can include the use of various transport and carrier systems, for example though the use of conjugates and biodegradable polymers. See also, US 6,180,613; WO 04/013280, describing delivery of nucleic acid molecules to the CNS, which are incorporated herein by reference.

[00425] Oral administration can be accomplished using pharmaceutical compositions containing a nucleic acid agent formulated as tablets, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs. Such oral compositions can contain one or more such sweetening agents, flavoring agents, coloring agents or preservative agents in order to provide pharmaceutically elegant and palatable preparations. Tablets, which can be coated or uncoated, can be formulated to contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients, e.g., inert diluents; such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc. Where a coating is used, the coating delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.

[00426] Where the formulation is an aqueous suspension, such can contain the active agent in a mixture with a suitable excipient(s). Such excipients can be, as appropriate, suspending agents (e.g., sodium carboxymethylcellulose, methylcellulose, hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia); dispersing or wetting agents; preservatives; coloring agents; and/or flavoring agents.

[00427] Suppositories, e.g., for rectal administration of agents, can be prepared by mixing the agent with a suitable non-irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials include cocoa butter and polyethylene glycols.

[00428] Dosage levels can be readily determined by the ordinarily skilled clinician, and can be modified as required, e.g., as required to modify a subject's response to therapy. Dosage levels can be on the order of from about 0.1 mg to about 100 mg per kilogram of body weight per day. The amount of active ingredient that can be combined with the carrier materials to produce a single dosage form varies depending upon the host treated and the particular mode of administration. Dosage unit forms can contain between from about 1 mg to about 500 mg of an active ingredient.

[00429] A nucleic acid agent can be administered to a subject in combination with other therapeutic compounds, e.g., so as to increase the overall therapeutic effect. For example, as described in more detail below, a subject nucleic acid can be administered to an individual in need thereof in conjunction with administration of at least a second agent suitable for the treatment of an HBV infection.

[00430] Exemplary formulations and methods for the delivery of nucleic acid molecules are known in the art. For example, nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as biodegradable polymers, hydrogels, cyclodextrins (see for example Gonzalez et al., 1999, Bioconjugate Chem., 10, 1068-1074; Wang et al., International PCT publication Nos. WO 03/47518 and WO 03/46185), poly(lactic-co-glycolic)acid (PLGA) and PLCA microspheres (see for example U.S. Pat. No. 6,447,796 and US Patent Application Publication No. U.S. 2002130430), biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors (Oηare and Normand, International PCT Publication No. WO 00/53722). In another embodiment, nucleic acids can also be formulated or complexed with polyethyleneimine and derivatives thereof, such as polyethyleneimine-polyethyleneglycol-N-acetylgalactosamine (PEI-PEG-GAL) or polyethyleneimine-polyethyleneglycol-tri-N-acetylgalacto- samine (PEI- PEG-triGAL) derivatives. In one embodiment, the nucleic acid is formulated as described in U.S. Patent Application Publication No. 20030077829, incorporated by reference herein in its entirety.

[00431] In one embodiment, a nucleic acid agent is complexed with membrane disruptive agents such as those described in US 2001/0007666, incorporated by reference herein in its entirety. In another embodiment, the membrane disruptive agent or agents and a nucleic acid agent are also complexed with a cationic lipid or helper lipid molecule, such as those lipids described in US 6,235,310, incorporated by reference herein in its entirety. In one embodiment, a nucleic acid agent is complexed with delivery systems as described in US 2003/077829, WO 00/03683 and WO 02/087541, each incorporated herein by reference.

[00432] Alternatively, a nucleic acid agent can be expressed within cells from eukaryotic promoters (e.g., promoters that are functional in a eukaryotic cell) (e.g., Izant and Weintraub, 1985, Science, 229, 345; McGarry and Lindquist, 1986, Proc. Natl. Acad. Sci., USA 83, 399; Scanlon et al., 1991, Proc. Natl. Acad. Sci. USA, 88, 10591-5; Kashani-Sabet et al., 1992, Antisense Res. Dev., 2, 3-15; Dropulic et al., 1992, J. Virol., 66, 1432-41; Weerasinghe et al., 1991, J. Virol., 65, 5531-4; Ojwang et al., 1992, Proc. Natl. Acad. Sci. USA, 89, 10802-6;

Chen et al., 1992, Nucleic Acids Res., 20, 4581-9; Sarver et al., 1990 Science, 247, 1222-1225; Thompson et al., 1995, Nucleic Acids Res., 23, 2259; Good et al., 1997, Gene Therapy, 4, 45. Those skilled in the art realize that any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA/RNA vector.

[00433] A nucleic acid agent can be expressed from transcription units inserted into a vector.

The recombinant vectors can be DNA plasmids, non-viral vectors or viral vectors. An HBV DNA-binding polypeptide-expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, a lentivirus, or alphavirus. The recombinant vectors capable of expressing a nucleic acid agent can be delivered as described above, and provide for transient or stable expression. Combination therapy

[00434] In some embodiments, a subject HBV DNA-binding polypeptide, or a subject nucleic acid, is administered in conjunction with at least a second anti-HBV therapeutic agent. Suitable second anti-HBV therapeutic agents include, but are not limited to, nucleotide and nucleoside analogs, e.g., Epivir-HBV (lamivudine; 3TC); Hepsera (Adefovir Dipivoxi); Coviracil (emtricitabine; FTC); Entecavir; Clevudine (L-FMAU); ACH 126, 443 (L-Fd4C); AM 365; Amdoxovir; LdT (telbivudine); MCC 478; VaILdC (valtorcitabine); ICN 2001 ; Fluoro L and D nucleosides; Racivir; and Robustaflavone. Suitable second anti-HBV therapeutic agents also include inteferons, e.g., Intron A (interferon α2b); monoclonal antibodies, e.g., XTL 001 (XTL Biopharm); immunostimulatory compounds, e.g., Theradigm, Zadaxin (thymosin), and the like; etc.

[00435] A subject HBV DNA-binding polypeptide, or a subject nucleic acid, can be administered within 15 minutes, within one hour, within 24 hours, within one week, or within one month, of the time at which the second anti-HBV therapeutic agent is administered. SUBJECTS SUITABLE FOR TREATMENT

[00436] Subjects suitable for ("in need of) treatment using a subject treatment method include:

1) individuals who have been infected with HBV of any genotype or serotype; 2) individuals who are at risk of being infected with HBV; 3) individuals who are considered "treatment failure" patients, including "non-responder" individuals who were treated with an anti-HBV agent and who failed to respond to such treatment, and "relapsers," e.g., individuals who were treated with an anti-HBV agent, who initially responded to such treatment, and in whom the infection re-emerged (e.g., viral load increased, e.g., to pre-treatment levels); 4) individuals infected with a drug-resistant strain of HBV, e.g., individuals who were treated with lamivudine, and in whom lamivudine-resistant HBV have emerged; 5) individuals infected

with an HBV surface antigen-negative strain of HBV; 6) individuals having a chronic HBV infection; 7) individuals having an acute HBV infection. Also suitable for treatment with a subject method are individuals having a disease caused by HBV infection, including, e.g., chronic liver inflammation caused by HBV, cirrhosis caused by HBV infection, acute hepatitis caused by HBV infection, fulminant hepatitis caused by HBV infection, and chronic persistent hepatitis caused by HBV infection. Also suitable for treatment with a subject method are HBV- infected individuals in which the HBV is resistant to, e.g., lamivudine, adefovir, tenofovir, or entecavir.

EXAMPLES

[00437] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric. Standard abbreviations may be used, e.g., bp, base pair(s); kb, kilobase(s); pi, picoliter(s); s or sec, second(s); min, minute(s); h or hr, hour(s); aa, amino acid(s); kb, kilobase(s); bp, base pair(s); nt, nucleotide(s); i.m., intramuscular(ly); i.p., intraperitoneal(ly); s.c, subcutaneous(ly); and the like.

Example 1: Designing ZFPs to target DHBV cccDNA and HBV cccDNA MATERIALS AND METHODS

[00438] The Zinc Finger Tools site, which can be located on the world wide web at the following address (www.scripps.edu/mb/barbas/zfdesign/zfdesignhome.php) (Mandell and Barbas, Nucleic Acids Res. 2006 JuI 1;34 (Web Server issue): W516-23), provides several tools for selecting zinc finger protein (ZFP) target sites and for designing the proteins that will target them. The first tool, "Search DNA Sequence for Contiguous or Separated Target Sites", was used to scan a given DNA sequence for consecutive DNA triplets that can be targeted with the zinc finger domains published (Dreier B et al, 2000 JMo/ Biol. 303(4): 489-502; Dreier B et al, 2001 J Biol Chem. 276(31): 29466-78; Dreier et al, 2005 J Biol Chem. 280(42): 35588-97; Segal DJ et al, 1999 J Biol Chem. 279(15): 14509-14519). Specifically, the entire DHBV genome (Canada isolate, AF047045) was scanned and the entire HBV genome (subtype ayw

U95551) to find DNA sites that can be targeted by zinc finger domains. After selecting target sites within the enhancer region of DHBV or the preS/S2 promoter region of HBV, the second tool, "Design a Zinc Finger Protein," was used to input the valid zinc finger target site. This tool then outputs the amino acid sequence required in the zinc finger, in order to bind that target site.

[00439] Design of DHBV-specifϊc zinc finger proteins. Zinc finger proteins (ZFPs) were designed to target DHBV Canada isolate (AF047045) using the program "Zinc Finger Tools" (Mandell and Barbas, Nucleic Acids Res. 2006 JuI 1;34 (Web Server issue): W516-23). ZFPs were designed with flanking Xhol and Spel restriction endonuclease sites, and each zinc finger was linked in tandem to the next by the canonical TGEKP (SEQ ID NO: 19) linker. All ZFPs were designed to bind to target sites within the enhancer region of DHBV (2170-2361) as shown in Figures 1 and 2.

[00440] Design of HBV-specific zinc finger proteins. Zinc finger proteins (ZFPs) were designed to target HBV subtype ayw (U95551) using the program "Zinc Finger Tools" (Mandell and Barbas, 2006). ZFPs were designed with flanking Xhol and Spel restriction endonuclease sites, and each zinc finger was linked in tandem to the next by the canonical TGEKP (SEQ ID NO: 119) linker. All ZFPs were designed to bind to target sites within the preS/S2 promoter region of HBV (3007-3150) as shown in Figure 16.

[00441] Expression and purification of DHBV-specifϊc ZFPs. ZFPs sequences were codon optimized for Anas platyrhyncos (Peking duck) and synthesized by Blue Heron Biotechnology (Bothell, WA) before being cloned into pUC19 vectors lacking the multiple cloning site. ZFPs were transferred to pMAL (NEB E8000S) using the flanking Xhol and Spel sites, creating maltose-binding protein (MBP) fusion proteins. These constructs were expressed in BL21(DE3) Escherichia coli and purified on amylose resin (NEB E8021L) according to manufacturer's specifications, with the addition of 15% glycerol to the elution buffer. Proteins were stored at -80°C. Proteins were approximately 95% pure, as assessed by SDS-PAGE and Coomassie blue staining.

[00442] Expression and purification of HBV-specific ZFPs. ZFPs sequences were codon optimized for Homo sapiens and synthesized by Blue Heron Biotechnology (Bothell, WA) before being cloned into pUC19 vectors lacking the multiple cloning site. ZFPs were transferred to pMAL (NEB E8000S) using the flanking Xhol and Spel sites, creating maltose- binding protein (MBP) fusion proteins. These constructs were expressed in BL21(DE3) Escherichia coli and purified on amylose resin (NEB E8021L) according to manufacturer's specifications, with the addition of 15% glycerol to the elution buffer. Proteins were stored at -

80 0 C. Proteins were approximately 95% pure, as assessed by SDS-PAGE and Coomassie blue staining.

[00443] Electrophoretic mobility shift (EMSA) for DHBV-specific ZFPs. ZFPs were incubated with dsDNA oligonucleotides at 2.5uM (ZFPa and ZFPb) or IuM (ZFPc) in gel-shift buffer (25mM Tris-HCl pH 8, 10OmM NaCl, 2mM DTT, lOOuM ZnCl 2 , 10% glycerol, 50μg/mL BSA, 4μg/mL polyI:C and 0.01% bromophenol blue) for 1 hour at room temperature with 1 A serial dilutions of ZFP from 15OnM down to 9.5nM, in duplicate (Smith et al. 1999 Nucleic Acids Res. 27(2): 674-681; Moore et al. 2001 PNAS 98:1432-1436). The oligonucleotides were as follows: ZFPa: 5 '-AGTACTGCCAAGATAATGAJTAAAAGTACT-3 ' (SEQ ID NO: 120) and its complement. ZFPb: 5 '-

AGTACTATGGCAAACAAAAGTTGAAGTACT -3 ' (SEQ ID NO:121) and its complement. ZFPc: 5 '-AGTACTAGAGATATAAGTAC T-3 ' (SEQ ID NO:122) and its complement. ZFPd: 5 ' -AGTACTAAAAGCAAAAGTACT^ ' (SEQ ID NO: 123) and its complement ZFPe: 5 '- AGTACTATAATGATTAGTACT^ ' (SEQ ID NO: 124) and its complement. ZFPf: 5 ' AGTACTAAC AAG AC AAGTACT-3 ' (SEQ ID NO: 125) and its complement. Reactions were run on 7% non-denaturing polyacrylamide gels at 100V for 1 hour, and then stained with SYBR-Green using the Molecular Probes EMSA kit (catalog #E33075) according to manufacturer's specifications and scanned using the Fujifilm FLA-5100 phosphoimager. EMSAs were quantified using Fujifilm ImageGauge v4.22 (2003) software. Non-linear regression plots were produced from this data using the program Enzyme Kinetics vl.l 1 (Trinity Software).

[00444] Radioactive [ 32 P] -dsDN A probes for competition EMSAs were made using T4 polynucleotide kinase (Invitrogen 18004-010) according to manufacturer's specifications, and unincorporated [γ- 32 P]ATP was removed using the Qiagen QIAquick Nucleotide Removal Kit (28304) (Smith et al. 1999 Nucleic Acids Res. 27(2): 674-681). 15OnM of each ZFP was incubated with 10,000cpm of radioactive dsDNA probe in gel-shift buffer for 1 hour at room temperature. Cold competitor oligonucleotides were added at concentrations of 5, 10 and 5OuM. Reactions were run on 7% non-denaturing polyacrylamide gels at 100V for 1 hour, then the gels were sealed in a plastic bag and exposed to an image plate overnight at room temperature. Image plates were scanned using the Fujifilm FLA-5100 phosphoimager.

[00445] Electrophoretic mobility shift (EMSA) for HBV-specific ZFPs. ZFPs were incubated with dsDNA oligonucleotides at IuM in gel-shift buffer (25mM Tris-HCl pH 8, 10OmM NaCl, 2mM DTT, lOOuM ZnCl 2 , 10% glycerol, 50ug/mL BSA, 4ug/mL polyLC and 0.01% bromophenol blue) for 1 hour at room temperature with ι δ serial dilutions of ZFP from

15OnM down to 9.5nM, in duplicate (Smith et al, 1999; Moore et al, 2001). The oligonucleotides were as follows:

ZFPk: 5 '- AGTA CTACCAATCGCCAGACAGGAAGTACT -3 1 (SEQ ID NO: 126) and its complement. ZFPm: 5 '- AGTACTGCTCAGGGCATACTACAAAGTACT -3 ' (SEQ ID NO:127) and its complement. ZFPn: 5 '- AGT ACTTGGTGG AGGC AGG AGGCG AGTACT -3 ' (SEQ ID NO: 128) and its complement. ZFPq: 5 '- AGTACTAGGCCTCCGAGTACT-3 ' (SEQ ID NO: 129) and its complement. ZFPr: 5 '- A GTA CTA GCCCTCA GA GTA CT -3 ' (SEQ ID NO: 130) and its complement.

ZFPt: 5 '- AGTACTAGTATGCCCAGTACT -3 ' (SEQ ID NO: 131) and its complement. ZFPu: 5 '- AGTACTCCAGCAAATAGTACT -3 ' (SEQ ID NO: 132) and its complement. ZFPv: J '- AGTACTGGCGATTGGAGTACT -3 ' (SEQ ID NO: 133) and its complement. ZFPw: 5 - AGTACTCAGCCTACCAGTACT -3 ' (SEQ ID NO: 134) and its complement. Reactions were run on 7% non-denaturing polyacrylamide gels at 100V for 1 hour, then stained with SYBR-Green using the Molecular Probes EMSA kit (catalog #E33075) according to manufacturer's specifications and scanned using the Fujifilm FLA-5100 phosphoimager. EMSAs were quantified using Fujifilm ImageGauge v4.22 (2003) software. Non-linear regression plots were produced from this data using the program Enzyme Kinetics vl .11 (Trinity Software).

[00446] Radioactive [ 32 P]-dsDNA probes for competition EMSAs were made using T4 polynucleotide kinase (Invitrogen 18004-010) according to manufacturer's specifications, and unincorporated [γ- 32 P] ATP was removed using the Qiagen QIAquick Nucleotide Removal Kit (28304) (Smith et al, 1999). 15OnM of each ZFP was incubated with 10,000cpm of radioactive dsDNA probe in gel-shift buffer for 1 hour at room temperature. Cold competitor oligonucleotides were added at concentrations of 5, 10 and 5OuM. Reactions were run on a 7% non-denaturing polyacrylamide gels at 100V for 1 hour, then gels were sealed in a plastic bag and exposed to an image plate overnight at room temperature. Image plates were scanned using the Fujifilm FLA-5100 phosphoimager.

[00447] Surface plasmon resonance for DHBV-specifϊc ZFPs. Surface plasmon resonance

(SPR) was performed using BIAcore technology, which measures real-time interactions between a ligand anchored to a detection surface and an analyte that flows over the detection surface. ZFPs were dialyzed into Ix HBS-EP (BIAcore BR-1001-88), which was used as running and sample buffers. All solutions were filtered and degassed before use, and protein samples were centrifuged at 14,000rpm for 5 minutes to remove any precipitate. Oligonucleotides were produced by Operon Biotechnologies (Huntsville, Alabama) and were

biotinylated at the 5' end of the sense strand only. Sequences were as shown above for EMSA. Biotinylated oligonucleotides were annealed to the bottom oligonucleotide strands and then coupled to the Sensor Chip SA (BIAcore BR- 1003-98) on the BIAcore 3000 using manual inject mode. 5OnM solutions of biotinylated oligonucleotides were injected onto one flow cell at 5uL/min until the calculated R L was reached (R L =105RU for ZFPa and ZFPb and R L =182RU for ZFPc, ZFPd, ZFPe and ZFPf). R L =RMAx(l/Sm)(MWL/MW A ) where RM AX =100RU for kinetic analysis, Sm=stoichiometry of binding (1 :1) and MW L and MW A =molecular weight of ligand and analyte (2OkDa for biotin-DNA and 19kDa for ZFPa and ZFPb or 1 IkDa for ZFPc, ZFPd, ZFPe and ZFPf), respectively. Actual amounts of immobilized oligonucleotides was 139 RU for ZFPa, 183 RU for ZFPb, 181 RU for ZFPc, 80 RU for ZFPd, 257 RU for ZFPe and 156 RU for ZFPf. Free streptavidin sites were blocked on the flow cell and an empty reference flow cell by injecting 3OuL of IuM biotin at 30uL/min. After coupling, 3-5 rounds of surface regeneration tests were carried out using ZFP concentrations around the Kd for ZFPa, ZFPb and ZFPc (see Table 2), or at 128nM for ZFPd, ZFPe and ZFPf. 3OuL of ZFP was injected at 30uL/min, followed by 1 minute of buffer and 3OuL of 0.5% SDS at 30uL/min to remove the bound ZFP. Once baseline remained constant after regeneration tests, kinetic analysis with direct binding was carried out using ZFP concentrations ranging from O.lx to 10x Kd in doubling dilutions for ZFPa, ZFPb and ZFPc or InM to 256nM, 512nM or 94OnM in doubling dilutions for ZFPd, ZFPe and ZFPf, respectively. Samples were measured from low to high concentrations with a flow rate of 30μL/min, 3 minute injection time and 15 minute dissociation time. Regeneration between concentrations were completed with a single 30μL injection of 0.5% SDS at a flow rate of 30μL/min, followed by 5 minute stabilization time between runs. Bulk shift was accounted for by subtracting the signal from the reference flow cell. Kinetic analysis was done on the BIAeval software program and curves were fit to a 1 : 1 binding with drifting baseline model, except for ZFPf , which fit a 1 : 1 Langmuir binding model because the baseline did not drift. Surface plasmon resonance for human HBV-specific ZFPs. Surface plasmon resonance (SPR) was performed using BIAcore technology, which measures real-time interactions between a ligand anchored to a detection surface and an analyte that flows over the detection surface. ZFPs were dialyzed into Ix HBS-EP (BIAcore BR-1001-88), which was used as running and sample buffers. All solutions were filtered and degassed before use, and protein samples were centrifuged at 14,000rpm for 5 minutes to remove any precipitate. Oligonucleotides were produced by Operon Biotechnologies (Huntsville, Alabama) and were biotinylated at the 5' end of the sense strand only. Sequences were as shown above for EMSA.

Biotinylated oligonucleotides were annealed to the bottom oligonucleotide strands and then coupled to the Sensor Chip SA (BIAcore BR-1003-98) on the BIAcore 3000 using manual inject mode. 5OnM solutions of biotinylated oligonucleotides were injected onto one flow cell at 5uL/min until the calculated R L was reached (R L =95RU for ZFPk, ZFPm and ZFPn and Ru=I 82RU for ZFPq, ZFPr, ZFPt, ZFPu and ZFPv). R L =R MA x(l/Sm)(MWιyMW A ) where R MAX =100RU for kinetic analysis, Sm=stoichiometry of binding (1 :1) and MW L and MW A =molecular weight of ligand and analyte (2OkDa for biotin-DNA and 2IkDa for ZFPk, ZFPm and ZFPn or 1 IkDa for ZFPq, ZFPr, ZFPt, ZFPu and ZFPv), respectively. Actual amount of immobilized oligonucleotides was 110 RU for ZFPk, 87 RU for ZFPm, 95 RU for ZFPn, 194 RU for ZFPq, 180 RU for ZFPr, 185 RU for ZFPt, 167 RU for ZFPu and 193 RU for ZFPv. Free streptavidin sites were blocked on the flow cell and an empty reference flow cell by injecting 3OuL of IuM biotin at 30uL/min. After coupling, 3-5 rounds of surface regeneration tests were carried out using ZFP concentrations around the Kd for ZFPk, ZFPm and ZFPn (see Table 2) or at 128nM for ZFPd, ZFPe and ZFPf. 3OuL of ZFP was injected at 30uL/min, followed by 1 minute of buffer and 3OuL of 0.5% SDS at 30uL/min to remove the bound ZFP. Once baseline remained constant after regeneration tests, kinetic analysis with direct binding was carried out using ZFP concentrations ranging from O.lx to 10x Kd in doubling dilutions for ZFPk, ZFPm and ZFPn or InM to 256nM in doubling dilutions for ZFPq, ZFPr, ZFPt, ZFPu and ZFPv. Samples were measured from low to high concentrations with a flow rate was 30uL/min, 3 minute injection time and 15 minute dissociation time. Regeneration between concentrations were completed with a single 3OuL injection of 0.5% SDS at a flow rate of 30uL/min, followed by 5 minute stabilization time between runs. Bulk shift was accounted for by subtracting the signal from the reference flow cell. Kinetic analysis was done on the BIAeval software program and curves were fit to a 1 : 1 binding with drifting baseline model. CccDNA pulldown assay for DHBV-specific ZFPs. In a 1.7mL microfuge tube, 30μL of amylose resin was washed three times with wash buffer (1OmM Tris-HCl pH 7.5, 20OmM NaCl, ImM EDTA, ImM sodium azide and 1OmM β-mercaptoethanol). 15OnM of purified ZFP-MBP fusion proteins was added to the amylose resin and incubated on ice for 30 minutes, then washed three times with wash buffer. 50μL (12.5μg) of DHBV cccDNA was added, or wash buffer as control, or pUCl 8 non-specific DNA for 30 minutes at room temperature. Samples were centrifuged for 30 seconds at 14,000rpm and supernatants collected as 'input'. Samples were washed three times with wash buffer and then lOOμL of elution buffer (wash buffer plus 15% glycerol and 1 OmM maltose) was added and incubated for 5 minutes at room

temperature. Samples were centrifuged again as above and supernatant was collected as 'output'. Samples were dot-blotted onto Hybond-XL membranes (Amersham Bioscience RPN303S), and membranes were denatured by laying face up on filter paper soaked with denaturation solution (0.5M NaOH, 1.5M NaCl). Next, membranes were neutralized on filter paper with neutralization solution (0.5M Tris HCl pH 8, 1.5M NaCl), followed by 3 minutes of exposure to UV light to cross-link the DNA to the membrane. Membranes were prehybridized with 5X SSC, 2% SDS, IX Denhardt's solution and 50 μg/ml herring sperm DNA for 4 hours at 65°C. Radioactive probe was produced from EcoRI-digested fragments of pDHBV1.3 using the random primer labeling kit (Invitrpgen 18187-013) and 32 P[dCTP], and incubated with the membranes overnight at 65°C. Membranes were washed twice with IX SSC, 0.1% SDS and twice with 0.1 X SSC, 0.1% SDS, each for 10 minutes. Image plates were exposed to the membranes overnight and then scanned by the Fujifilm FLA-5100 phosphoimager. [00450] CccDNA pulldown assay for human HBV-specific ZFPs. In a 1.7mL microfuge tube, 3OuL of amylose resin was washed three times with wash buffer (1OmM Tris-HCl pH 7.5, 20OmM NaCl, ImM EDTA, ImM sodium azide and 1OmM β-mercaptoethanol). 15OnM of purified ZFP-MBP fusion proteins was added to the amylose resin and incubated on ice for 30 minutes, then washed three times with wash buffer. 50μL (0.75ug) of HBV cccDNA was added, or wash buffer as control, or pUC18 non-specific DNA for 30 minutes at room temperature. Samples were centrifuged for 30 seconds at 14,000rpm and supernatants collected as 'input'. Samples were washed three times with wash buffer and then lOOμL of elution buffer (wash buffer plus 15% glycerol and 1OmM maltose) was added and incubated for 5 minutes at room temperature. Samples were centrifuged again as above and supernatant was collected as 'output'. Samples were dot-blotted onto Hybond-XL membranes (Amersham Bioscience RPN3O3S), and membranes were denatured by laying face up on filter paper soaked with denaturation solution (0.5M NaOH, 1.5M NaCl). Next, membranes were neutralized on filter paper with neutralization solution (0.5M Tris HCl pH 8, 1.5M NaCl), followed by 3 minutes of exposure to UV light to cross-link the DNA to the membrane. Membranes were prehybridized with 5X SSC, 2% SDS, IX Denhardt's solution and 50 μg/ml herring sperm DNA for 4 hours at 65°C. Radioactive probe was produced from EcoRI-digested fragments of pDHBVl .3 using the random primer labeling kit (Invitrogen 18187-013) and 3 2 P[dCTP], and incubated with the membranes overnight at 65°C. Membranes were washed twice with IX SSC, 0.1% SDS and twice with 0.1 X SSC, 0.1% SDS, each for 10 minutes. Image plates were exposed to the membranes overnight and then scanned by the Fujifilm FLA-

5100 phosphoimager.

[00451] Isolation of cccDNA from primary duck hepatocytes. CccDNA was isolated from primary duck hepatocytes (PDH) by taking a portion of liver and slicing it into small pieces. Liver pieces were incubated in PBS supplemented with 0.21g/L CaCl 2 , 0.1 g/L MgCl 2 ^oH 2 O and 0.1 g/L MgSOWH 2 O and lmg/mL collagenase at 37°C for 1 hour with stirring, then the slurry was transferred into 5OmL tubes. Larger pieces were allowed to settle out and the single cell suspension was decanted into a new tube. Cells were centrifuged for 5 minutes at 1 OOOrpm and washed twice with PBS. A modified miniprep protocol was performed using the QIAprep Spin Miniprep kit (Qiagen 27106) (Zeigler et al, 2004). Briefly, cells were aliquoted into 1.7mL microfuge tubes and then 25OuL of buffers Pl and P2 were added and incubated for 5 minutes at room temperature. Cell lysates were then incubated with 800μg/mL of proteinase K (Invitrogen 25530-015) for 55 0 C for 2 hours. Next, 35OuL of Buffer N3 was added and mixed by gentle agitation, followed by incubation on ice for 5 minutes. Lysates were spun at 14,000rpm for 10 minutes and then supernatant was loaded onto a spin column. Columns were spun at 14,000rpm for 1 minute. Columns were washed once each with 750μL of buffers PB and PE, then spun an additional minute to remove residual wash buffer. Columns were left open in a sterile hood for 5 minutes and then eluted with 80μL of elution buffer (1OmM Tris- HCl, pH8.5) incubated at 37°C for 5 minutes. Columns were spun at 14,000rpm for 1 minute, and then the elution step was repeated with another 80μL of elution buffer.

[00452] Isolation of cccDNA from HepAD38 cells. CccDNA was isolated from HepaD38 cells grown in the absence of tetracycline for two weeks. A modified miniprep protocol was performed using the QIAprep Spin Miniprep kit (Qiagen 27106) (Zeigler et al, 2004). Briefly, cells were trypsinized and washed with PBS, then aliquoted into 1.7mL microfuge tubes. 250μL of buffers Pl and P2 were added and incubated for 5 minutes at room temperature. Cell lysates were then incubated with 800ug/mL of proteinase K (Invitrogen 25530-015) for 55°C for 2 hours. Next, 35OuL of Buffer N3 was added and mixed by gentle agitation, followed by incubation on ice for 5 minutes. Lysates were spun at 14,000rpm for 10 minutes and then supernatant was loaded onto a spin column. Columns were spun at 14,000rpm for 1 minute. Columns were washed once each with 750μL of buffers PB and PE, then spun an additional minute to remove residual wash buffer. Columns were left open in a sterile hood for 5 minutes and then eluted with 8OuL of elution buffer (1OmM Tris-HCl, pH8.5) incubated at 37°C for 5 minutes. Columns were spun at 14,000rpm for 1 minute, and then the elution step was repeated with another 8OuL of elution buffer.

[00453] Cloning of ZFPs into mammalian expression vector. Primers encoding an S V40 nuclear localization signal and a 6x histidine (SEQ ID NO:216) tag at the 5' end were used to

amplify each ZFP by PCR. PCR products were cloned into pCR4 using the TOPO TA cloning kit and then transferred into the mammalian expression vector pcDNA3.1(+) (Invitrogen V790- 20) using BamHI and EcoRI restriction endonuclease sites.

[00454] Cell lines and culture conditions. LMH cells were maintained in 1 :1 MEM/F-12 medium (MEM: Gibco 11700-077; F- 12: Gibco 21700-026) supplemented with 10% fetal calf serum (Gibco 12483-020), 50 IU/mL penicillin, lOug/mL streptomycin and ImM glutamine. LMH cells (2 x 10 5 cells/9.5cm 2 well) were cotransfected with lug of pDHBV1.3 and 3ug of pcDNA3.1(+) or pcDN A3. \{+)-ZFPa, -ZFPb, -ZFPc, -ZFPd, -ZFPe or -ZFPf ' using Lipofectamine 2000 (LF2000: Invitrogen 11668-027) according to the manufacturer's specifications, with a DNA:LF2000 ratio of 2:1. After 24 hours, cells were harvested for RNA, DNA and whole cell lysates as described below.

[00455] Isolation of intracellular viral DNA. LMH cells were lysed in 1 OmM Tris-HCl pH

7.5, 50 mM NaCl, 1 mM EDTA, 0.3% Triton X 100 and 8% sucrose. Nuclei and cellular debris were pelleted by centrifugation at 14,000rpm for 4 minutes, then supernatants were incubated at 37°C for 30 minutes with 6mM MgC12, lOOug/mL DNase and lOug/mL RNase A to digest cellular nucleic acids. Samples were centrifuged again as above and virus was precipitated from the supernatants with 0.3 volumes of 26% polyethylene glycol 8000, 1.4M NaCl, 10 mM EDTA overnight at 4°C. Virus was pelleted by centrifugation as above and resuspended in 100 ul of 50 mM Tris-HCl pH8, 150 mM NaCl, and 10 mM EDTA. Samples were incubated overnight at 42°C with 800ug/mL Proteinase K and 0.1% SDS to digest capsid and polymerase, then phenol: chloroform extracted. DNA was precipitated with lOug yeast tRNA as carrier, 0.1 volume 3M sodium acetate and 2x volume 95% ethanol. Virus was resuspended in 15μL DNA loading buffer and the entire sample was used for Southern analysis.

[00456] RNA isolation and quantitative PCR. RNA was isolated from LMH cells using

Trizol reagent (Invitrogen 15596-018) according to the manufacturer's specifications. cDNA was produced from lμg of total RNA using oligo(dT) 20 (Invitrogen 18418-020) and Superscript II Reverse Transcriptase (Invitrogen 18064-022) according to the manufacturer's specifications. Quantitative PCR was performed on the Roche LightCycler using the LightCycler FastStart DNA Master PLUS SYBR Green I kit (Roche 3515885001) and the following primer pairs: DHBV.Pol.462.fw 5 '-TG AAGGGCTGT ACTTTT AACCCAG-υ (SEQ ID NO: 135) and DHBV.Pol.641.rv 5' -CAGGATACTTTGGTTTAACCCC-3 ' (SEQ ID NO:136). DHBV.S.1480.fw 5' -CGTGGGGATGCCCAGGATTTCTTT-3 ' (SEQ ID NO:137) and DHBV.S.1670.rv 5 '-AGATTTCGGATCCGAGGGCAGT-3 ' (SEQ ID NO:138).

DHBV.core.2553.fw S '-AGCTGCTTGCCAAGGTATCTTTS ' (SEQ DD NO: 139) and DHBV.core.2752.rv 5 ' -GCTCT AAAGCGTCTTT AGC ATCTC-3 ' (SEQ ID NO: 140). DHBV.Pol.2324.fw 5 ' -GTTTGCC AT AAGCGTT ATC AG ACG-S ' (SEQ ID NO:141) and DHBV.Pol.2485.rv 5 '- AGGGGTGT ATGG AAAAGCCGTC-3 ' (SEQ ID NO: 142).

[00457] Western blot. Whole cell extracts were produced by lysing LMH cells in 1OmM Tris-

HCl pH 7.5, 5OmM NaCl, ImM EDTA, 0.3% Triton X and 8% sucrose. Protein concentrations of lysates were measured using the BCA Protein Assay kit (Pierce 23235). SDS-PAGE was performed on 20ug total protein on 10% polyacrylamide gels, then transferred to Hybond-ECL nitrocellulose membranes (Amersham Biosciences RPN3O3D) using semi-dry transfer. Membranes were blocked for 1 hour at room temperature with 2.5% skim milk powder in TBS-T (TBS plus 1% Tween 20). Primary antibodies to DHBV core (Jl 12) and DHBV preS (IHl) were produced in house and used at dilutions of 1/10,000 and 1/500, respectively. 1/4000 goat anti-rabbit HRP (BioRad 1706515) and 1/5000 goat anti-mouse HRP (Jackson ImmunoResearch 115-035-174) were used as secondary antibodies, respectively. Anti-actin (Chemicon MAB1501) was used at 1/10,000 dilution with goat anti-mouse HRP as secondary, as above. SuperSignal West Dura Extended Substrate (Pierce 34076) was used to visualize on film.

[00458] MTT assay. Cells were plated at 2x10 4 cells/well in 96 well plates and transfected 24 hours later with LF2000 at a ratio of 2:1 DNA to LF2000. Twenty-four hours after transfection, lOμL of 5mg/mL MTT in PBS was added to the cells for 2 hours and incubated at 37°C in 5% CO 2 . Cells were washed once with PBS and then lOOuL of acidic isopropanol (0.1N HCl) was added to each well for 5 minutes before measuring at 570nm on a Spectramax PLUS plate reader (Molecular Devices).

[00459] Statistical analysis. Results from the MTT assay were analyzed in Microsoft Excel

2004 for Mac (vl 1.3.6) using the ANOVA statistical package. Results from quantitative Lightcycler PCR were analyzed in Excel also, using two-tailed paired t-tests for two sample for means.

[00460] Confocal microscopy. LMH cells were transfected with 4 μg of pcDNA3.1(+)-ZFPα-

EGFP or pcDN A3 A (+)-ZFPb-EGFP in 32 mm dishes with glass coverslips affixed. After 24 hours, 10 u/mL of 0.1 mg/mL Hoechst 33342 (14533 Biochemika) was added to the media and cells were incubated at 37°C/5% CO 2 for 15 minutes. The media was replaced and live cells were visualized using the Zeiss NLO510 multi-photon microscope. The emission/excitation was 488 nm/509 nm for εGFP and 355 nm/465 nm for Hoechst 33342.

RESULTS

[00461] Design of DHBV-specific zinc finger proteins. The program "Zinc Finger Tools"

(Mandell and Barbas, Nucleic Acids Res. 2006 JuI 1 ;34 (Web Server issue):W516-23) was used to select ZFP binding sites within the DHBV Canada isolate (Addison et al. 2000 Antiviral Res. 48(1): 27-37) enhancer region where other cis-acting transcription factors (TF), such as hepatocyte nuclear factor 1 (HNFl), HNF3 and CCAAT/enhancer binding protein beta (C/EBPβ), are known to bind (Liu et al. 1994 J. Virol. 68(4): 2286-2296; Lilienbaum et al. 1993 J. Virol. 67(10): 6192-6200). The sequence of the duck genome is not available, however, BLAST searches of the selected DNA sequences against the chicken genome were performed and zero matches were found, indicating these sequences were unique to DHBV. This is relevant because the LMH (chicken hepatoma) cell line was used for in vitro analysis.

[00462] Figure 1 shows a map of the DHBV cccDNA genome. The grey circle represents the cccDNA of DHBV. The open arrows represent the open reading frames for core (C) and pre- core (preC), Pol (P) and surface (preS and S). The square approximates the location of the enhancer region of DHBV, in which the ZFP binding sites can be found.

[00463] Figure 2 is a schematic of the DHBV enhancer region and the target sites of all six

DHBV-specific ZFPs. The enhancer is in light grey and the binding sites for other transcription factors, such as C/EBPβ, HNFl and HNF3, are outlined.

[00464] Table 1 provides a summary of the DNA binding sites and corresponding amino acid sequences of the zinc fingers of ZFPs a-f. The entire DNA binding site sequence is shown from 5'-3'. Each subsite is shown with its corresponding zinc finger amino acid sequence displayed, with amino acid positions from -1 up to +6 representing the amino acids of the alpha helix that make site specific contacts with the DNA. The 3' base pair of the DNA subsite (small case) makes minor interactions with the alpha helix of the zinc finger. Table 1

Example 2: Assessment of dissociation constants and binding affinities for ZFPs a-f using electrophoretic mobility shift assays (EMSA)

[00465] ZFPs a-f were expressed and purified in Escherichia coli as fusions to maltose binding protein (MBP). ZFP-MBP fusion proteins were isolated on amylose columns and found to be approximately 95% pure by SDS-PAGE and Coomassie blue stain. Figure 3 shows the results of a Coomassie blue stain of purified ZFPa. BL21(DE3) cells were transformed with the pMAL-ZFPa vector and induced using IPTG for 2 hours. Cells were lysed and ZFPa was isolated on an amylose resin column, then eluted using 1OmM maltose. Lane 1: Whole cell lysates. Lane 2: Whole cell lysates induced by IPTG. Lane 3: Soluble fraction. Lane 4. Insoluble fraction. Lane 5: Amylose column eluate.

[00466] Electrophoretic mobility shift assays (EMSA) were performed to assess the binding capacities of each ZFP. Three of the six ZFPs, caused a shift in the mobility of their cognate double-stranded (ds) DNA oligo, indicating binding by the ZFP to the target DNA (Figure 4 and Figures 5a and 5b). Figure 4 shows a Non-linear regression plot and EMSA for ZFPa. The non-linear regression plot of ZFPa is derived from quantifying the EMSA (inset) using the program Enzyme Kinetics vl .11. The inset EMSA shows the unbound probe in the absence of ZFPa {lane J) and the mobility shift in the presence of ZFPa at 15OnM (lane 2), serial diluted 1 in 2 (lanes 3-5) down to 9.5nM (lane 6). Figures 5A and 5B show Non-linear regression plots and EMSAs for ZFPb and ZFPc respectively. The non-linear regression plots of ZFPb and ZFPC were derived by quantifying the EMSA (inset) using the program Enzyme Kinetics vl .11. The inset EMSA shows the unbound probe in the absence of ZFP (lane J) and the mobility shift in the presence of ZFP at 15OnM (lane 2), serial diluted 1 in 2 (lanes 3-5) down

to 9.5nM (lane 6). The dissociation constants (IQ), calculated by non-linear regression, were 36.9nM (ZFPa), 179.4nM (ZFPb) and 115.InM (ZFPc), respectively (Table 2).

[00467] The specificity of the designed ZFPs to their target sequence was assessed using competition EMSAs (Smith et al. 1999 Nucleic Acids Res. 27(2): 674-681 ; Reidling and Said 2007 Am J Physiol Cell Physiol. 292: 1305-1312). In preliminary experiments, 50-100 fold excess unlabeled oligonucleotides specific for each ZFP were added and no reduction in the intensity of the ZFP/DNA complex was visible. By adding 1000-10,000 fold excess unlabeled oligonucleotides, competition off by specific unlabeled oligonucleotides (Figure 6, lanes 3-5) but not by non-specific unlabeled oligonucleotides (Figure 6, lane 6) was visible, indicating the ZFPs had high affinities and specific binding to their target oligonucleotides.

[00468] Figures 6, 9A and 9B show the results of competition EMSA for ZFPa, ZFPb and ZFPc respectively. Lane 1: [ P]-labeled specific oligonucleotides alone without ZFP. Lane 2: 15OnM ZFP with labeled specific oligonucleotides. Lane 3-5: 15OnM ZFP with labeled specific oligonucleotides and 5, 10 or 5OuM (respectively) of unlabeled specific oligonucleotides. Lane 6: 15OnM ZFP with labeled specific oligonucleotides and 5OuM of unlabeled non-specific oligonucleotides. Example 3: Assessment of dissociation constants for ZFPs a-f using SPR

[00469] Surface plasmon resonance (SPR) is a more sensitive technique than EMSA and was able to detect binding by all six ZFPs to their target oligonucleotides. Figure 22 shows the general kinetic equation, which describes the kinetic relationship between a ZFP (A) and its target DNA (B). The association constant (Ka) is the ratio of the K 0n over the K 0 ^ rates, while the dissociation constant (Kd) is the inverse of the Ka.

[00470] Kinetic graphs such as seen in Figures 7, 8 and 10A- 1OD were produced using BIA- evaluation software. Figures 7 and 8 show BIAcore kinetic analysis of ZFPa and ZFPb respectively. Each line represents duplicate analysis of different concentrations of ZFP, ranging from 4nM to 128nM (ZFPa) or 1.7nM to 22OnM (ZFPb). Three blanks in duplicate were also performed. Response difference is measured in resonance units (RU) and represents the binding of the ZFP to the anchored oligonucleotides. Figures 1OA, 1OB, 1OC and 1OD show BIAcore kinetic analysis of ZFPc, ZFPd, ZFPe and ZFPf respectively. Each line represents duplicate analysis of different concentrations of ZFP, ranging from 12nM-384nM (ZFPc), lnM-256nM (ZFPd), lnM-512nM (ZFPe), and lnM-940nM (ZFPf). Three blanks in duplicate were also performed. Response difference is measured in resonance units (RU) and represents the binding of the ZFP to the anchored oligonucleotides.

[00471] Dissociation contants (IQ) were calculated for each ZFP by fitting the data to a model of 1 : 1 Langmuir binding with drifting baseline, except for ZFPf, which was fit to a 1 : 1 Langmuir binding. As shown in Table 2, ZFPf had a IQ in the micromolar range at 185μM. Four ZFPs had IQ's in the nanomolar range, with ZFPa at 12.3 nM, ZFPb at 40.2 nM, ZFPc at 99 nM and ZFPe at 67.1 nM. Lastly, ZFPd had a IQ in the picomolar range at 471 pM. The dissociation constants derived from EMSA and SPR are comparable for ZFPs which were analyzed under both methods. All three Kd 's from both protocols are within the same scale of magnitude of each other. In addition, the highly sensitive SPR method was able to detect binding for ZFPd, ZFPe and ZFPf, whose binding could not be demonstrated using EMSA. It is surprising that the BIAcore protocol detected a dissociation constant in the picomolar range for ZFPe, while the EMSA did not detect binding; however the curves fit the model well with a Chi squared value of 3.9. The lower the Chi squared value, the better the fit to the model. SPR is a much more sensitive method of determining kinetic interactions, thus the more sensitive method may have detected interactions that were not detected by the less sensitive EMSA method.

[00472] The size of the ZFP target sequence does not appear to directly affect the affinity of the designed ZFPs. ZFPa and ZFPb both recognize 18 base pairs of DNA and have dissociation constants in the nanomolar range. ZFPc-f each recognize 9 base pairs, however their dissociation constants have a larger range from the micromolar down to the nanomolar range. Thus, the size of the sequence does not affect the affinity of a ZFP for its target oligonucleotide. This relates to the design approach used for the subject ZFPs. Rather than using phage display or bacterial two-hybrid approaches (Jamieson et al. 2003 Nature Rev Drug Discovery. 2: 361-368; Wu et al. 1995 Proc Nat Acad Sci. 92, 344-348; Joung et al. 2000 Proc Nat Acad Sci. 97, 7382-7387), the design library in the "Zinc Finger Tools" program was used to design the subject ZFPs (Mandell and Barbas, Nucleic Acids Res. 2006 JuI 1;34 (Web Server issue): W516-23). There are some amino acid sequences of zinc fingers that have inherently higher affinities to their target DNA sequence, while others have lower affinities. It is not possible to tell this ahead of time using the program, thus the actual DNA sequence chosen may favor selection of a zinc finger that strongly binds its target.

[00473] Table 2 provides a summary of the dissociation constants (IQ) of ZFPs a-f derived from

EMSA or BIAcore surface plasmon resonance, na = not available.

Table 2

Example 4: Assessment of binding to cccDNA by ZFPs a-f

[00474] In order to demonstrate that the ZFPs could bind directly to cccDNA, as well as their specific oligonucleotides, a modified pulldown assay was performed. Purified ZFP-MBP fusion proteins were incubated with amylose resin, to which the ZFPs will bind due to the presence of the MBP. cccDNA was then incubated with the resin-bound ZFPs. After extensive washing, the ZFP was eluted from the resin and the resulting eluate was assessed for the presence of cccDNA, indicating ZFP was bound to cccDNA. It was demonstrated that ZFPa, ZFPb, ZFPd and ZFPf were able to bind cccDNA (Figure 11), but not the control DNA, pUCl 8. ZFPc and ZFPe bound much less cccDNA - in fact, ZFPc does not appear to bind cccDNA. Importantly, however, it has been shown directly herein that ZFPs can bind cccDNA, in addition to the oligonucleotides designed for EMSA and SPR.

[00475] Figure 11 shows the results of the CccDNA pulldown assay for ZFPs a-f. ZFP-MBP fusion proteins were incubated with amylose resin, followed by incubation with DHBV cccDNA. Amylose resin was washed and then ZFPs were eluted from the resin with elution buffer. The bound cccDNA was measured by blotting the eluate onto Hybond XL and hybridizing a radioactive probe, followed by quantitation on the Fujifilm FLA-5100 phosphoimager. The chart is the quantification by the phosphoimager of triplicates, (a) p<0.05. Example 5: Effects of ZFPs a-f on viral protein expression in LMH cells

[00476] The effect of ZFP expression on the DHBV life cycle was investigated in tissue culture cells. The DHBV live cycle is replicated when LMH cells are transfected with pDHBVl .3. Since these cells cannot be re-infected with progeny viruses, the only source for viral mRNA, protein and progeny production is the transfected pDHBVl .3. Once in the nucleus, pDHBVl .3 produces subgenomic RNA and pregenomic RNA. Subgenomic RNA is translated into viral core and surface proteins, while pregenomic RNA is translated into the polymerase protein or is packaged into the capsids of progeny viruses.

[00477] LMH cells were co-transfected with pDHBVl .3 and an excess of pcDNA3.1 (+)-ZFPα,

-ZFPb, -ZFPc, -ZFPd, -ZFPe or -ZFPf. Since, each ZFP had an SV40 nuclear localization

signal, they were targeted to the nucleus where they could interact with pDHBV1.3. After 24 hours, lysates were collected and protein expression was analyzed by SDS-PAGE followed by Western blot. As seen in Figure 12, there is a significant reduction in the amount of viral core and preS surface protein being produced in cells co-transfected with any of the six ZFPs, as compared to empty vector control. Actin controls were equivalent in all samples and these results were repeated five times. In addition, an MTT assay was performed on transfected LMH cells to determine whether there was greater cell death due to ZFP expression (Figure 15). LMH cells were transfected in a 96-well plate and then assayed after 24 hours for cell death by incubating with 5mg/mL of MTT for 2 hours at 37°C, 5% CO 2 , followed by the addition of acidic isopropanol and measurement on a plate reader at 570nm. There was no significant difference between any of the groups as analyzed by ANOVA, i.e., there was no significant difference in cell death in ZFP-transfected LMH compared to cells transfected with the empty vector control. Example 6: Effects of ZFPs a-f on viral RNA production

[00478] The effect of expressed ZFPs on viral RNA production was assessed using quantitative

PCR. Since the designed ZFPs are specific for dsDNA, it was expected that the decrease in protein expression seen in Figure 12 was due to their effect on pDHBV1.3 transcription and not viral RNA translation. If this were so, viral RNA expression should also be decreased similar to that seen with protein expression. Using primers specific for DHBV core, surface or polymerase RNAs, it was demonstrated this was the case. As seen in Figure 13, panels B-E, there was a significant reduction in the amount of all three viral RNAs during co-transfection with any of the six ZFPs.

[00479] The average reduction of RNAs ranged from 82.04 - 88.09% for ZFPa, 57.83 - 73.50% for ZFPb, 64.92 - 80.64% for ZFPc, 75.02 - 85.15% for ZFPd, 80.44 - 87.98% for ZFPe and 67.60 - 80.21% for ZFPf. The results from two independent experiments were pooled together by normalizing each experiment as a percent of the control. Each control had a different standard deviation, thus there are two empty vector control columns in Figure 13, panels B-E.

[00480] Figures 13A-D. Quantitative Lightcyler PCR for viral RNA. Fig 13 A. Surface antigen primers. Fig 13B. Core primers. Fig 13C. Polymerase 462 primers. Fig 13D. Polymerase 2324 primers. Total RNA was collected and reverse transcribed into cDNA, upon which quantitative PCR was performed with various primers, (a) p<0.05, (b) p<0.01 using two-tailed paired t-tests for two sample for means.

[00481] There does not appear to be a direct correlation in the ability of an individual ZFP to reduce expression of viral protein and mRNA compared to its dissociation constant, however

this may be due to the competition for the DHBV enhancer between endogenously expressed transcription factors and ZFPs. ZFPa, ZFPb and ZFPc, each with a Kd in the nanomolar range, reduce the expression of viral core and surface proteins to an equal extent. ZFPe, which has a Kd in the picomolar range, causes a smaller reduction in the expression of viral core and surface protein expression than might be expected for its high affinity. The binding site for ZFPe, however, is completely buried within the binding site for HNFl, thus there may be competition between these two proteins, resulting in decreased ZFPe binding and decreased inhibition by the ZFP. In addition, ZFPf, which has a dissociation constant in the micromolar range, was just as capable of decreasing viral protein and RNA levels as ZFPs with dissociation constants in the nanomolar range, such as ZFPb or ZFPc. This suggests the effects of ZFP expression are more complicated than simply the strength of binding, and likely includes other factors such as competition for binding sites with endogenous proteins and associated chromatin structure. Example 7: Effects of ZFPs a-f on intracellular virus production in LMH cells

[00482] Viral RNA is encapsidated in the cytoplasm along with the polymerase protein. The polymerase reverse transcribes the viral RNA into relaxed circular DNA, which is partially double stranded. Intracellular virus (ICV) includes the capsid and polymerase proteins, and the viral DNA, and gives an indication of the amount of viral progeny being produced. ICV DNA was isolated from LMH cells co-transfected as above and analyzed by Southern blot analysis. Figure 14A shows a Southern blot of intracellular virus particles (ICV) and Figure 14B shows the quantification of the Southern blot. LMH cells were co-transfected with pDHBV1.3 and pcDNA3.1(+)-ZFPα, -ZFPb, -ZFPc, -ZFPd, -ZFPe or -ZFPf, or with an empty vector. After 24 hours, cells were harvested for ICV, which was used for Southern blot. There is a significant reduction in the amount of ICV being produced in the presence of ZFPa and ZFPb, and some reduction, albeit to a lesser extent, by ZFPc, ZFPd and ZFPe. ZFPf appears to have equivalent ICV as empty vector control. Example 8: Designing ZFPs to target human HBV pre-S2/S promoter region

[00483] Zinc finger proteins (ZFPs) were designed to target HBV subtype ayw (U95551) using the program 'Zinc Finger Tools' (Mandell and Barbas, 2006). ZFPs were designed with flanking Xhol and Spel restriction endonuclease sites, and each zinc finger was linked in tandem to the next by the canonical TGEKP (SEQ ID NO:1 19) linker. All ZFPs were designed to bind to target sites within the preS/S2 promoter region of HBV (3007-3150) as shown in Figure 16.

[00484] Tables 3 (below) provides a summary of the DNA binding sites and corresponding amino acid sequences of the zinc fingers of each ZFP. The entire DNA binding site sequence is shown from 5 '-3'. Each subsite is shown with its corresponding zinc finger amino acid sequence displayed, with amino acid positions from -1 up to +6 representing the amino acids of the alpha helix that make site specific contacts with the DNA. The 3' base pair of the DNA subsite (lower case) makes minor interactions with the alpha helix of the zinc finger. Example 9: Expression and localization of ZFPs

[00485] To confirm the expression of the designed ZFPs, LMH cells were transfected with

ZFPs fused to EGFP; the ZFPs were visualized using confocal microscopy. Cells were co- stained with DAPI to visualize the nucleus. Both ZFPa and ZFPb are found predominantly in the nucleus of cells, although the distribution within the nucleus differed between the two ZFPs. ZFPb was distributed homogeneously throughout the nucleus, while ZFPa appeared to collect into focused regions in the nucleus. Expression of the ZFPs was also confirmed by Western blot on total cell lysates using an anti-EGFP antibody.

Table 3

Example 9: Assessment of dissociation constants and binding affinities for human HBV- specific ZFPs using EMSA Electrophoretic mobility shift assays (EMSA) were performed to assess the binding capacities of ZFPs k, m, n, q, r, t, u and v. The results of these assays are shown in Figs. 17A-

17D and 18A-18D. Each EMSA (Figs. 17A- 17D) shows the unbound probe in the absence of ZFP (lane 1) and the mobility shift in the presence of ZFP at 15OnM (lane 2), serial diluted 1 in 2 (lanes 3-5) down to 9.5nM (lane 6). Figs. 18A-18D show non-linear regression plots derived from quantifying the EMSA data of Figs. 17A-17D using the program Enzyme Kinetics vl.l 1. Analysis of these results indicated that each of ZFPk, ZFPm and ZFPn has a dissociation constant in the nano-molar range, and that ZFPv has a dissociation constant in the μM range (see Table 4).

[00487] The specificity of the designed ZFPs to their target sequence was assessed using competition EMSAs (Smith et al. 1999 Nucleic Acids Res. 27(2): 674-681 ; Reidling and Said 2007 Am J Physiol Cell Physiol. 292 : 1305- 1312). Figs. 19A- 19C show the results of competition EMSAs for ZFPk, ZFPm and ZFPn respectively. Lane 1 represents [ P] -labeled specific oligonucleotides alone without ZFP. Lane 2 represents 15OnM ZFPa with labeled specific oligonucleotides. Lanes 3-5 represent 15OnM ZFPa with labeled specific oligonucleotides and 5, 10 or 50 μM (respectively) of unlabeled specific oligonucleotides. Lane 6 represents 15OnM ZFPa with labeled specific oligonucleotides and 50 μM of unlabeled non-specific oligonucleotides.

[00488] By adding 1000-10,000 fold excess unlabeled oligonucleotides, competition off by specific unlabeled oligonucleotides (Figures 19A, lanes 3-5) but not by non-specific unlabeled oligonucleotides (Figure 19A, lane 6) was visible, indicating the ZFPs had high affinities and specific binding to their target oligonucleotides. Competition EMSAs for ZFPm and ZFPn

(Figs. 19B and 19C respectively) showed similar results.

Example 10: Assessment of dissociation constants for human HBV-specific ZFPs using

SPR

[00489] Binding of the human HBV-specific ZFPs: ZFPk, ZFPm, ZFPn, ZFPq, ZFPr, ZFPt,

ZFPu and ZFPv to their respective target nucleic acids was assayed using surface plasmon resonance (SPR). Kinetic graphs (Figures 20A-20G) were produced using BIAcore kinetic analysis software. Each line represents duplicate analysis of different concentrations of ZFP, ranging from 3.7nM to 23OnM (ZFPk), 2.6nM to 28OnM (ZFPm), 2.6nM to 338nM (ZFPn), InM to 256nM (ZFPq, ZFPr, ZFPt, ZFPu) and InM to 24OnM (ZFPv). Three blanks in duplicate were also performed. Response difference is measured in resonance units (RU) and represents the binding of the ZFP to the anchored oligonucleotides.

[00490] Dissociation constants (IQ) were calculated for the ZFPs. As shown in Table 4, ZFPk had a IQ in the nanomolar range at 5.14 nM, ZFPm had a IQ in the nanomolar range at 2.76 nM, ZFPn had a IQ in the nanomolar range at 69.4 nM, ZFPq had a K d in the micromolar range

at 1.29 μM, ZFPr had a K < j in the micromolar range at 0.5 μM, ZFPt had a K < j in the micromolar range at 1.07 μM and ZFPu had a K < j in the micromolar range at 2.47 μM

[00491] Table 4 provides a summary of the dissociation constants (IQ) of the ZFPs derived from EMSA or BIAcore surface plasmon resonance. Summary of the dissociation constants (IQ) of all ZFPs derived from EMSA or BIAcore surface plasmon resonance, na = not available, nd = no data.

Table 4

ZFP Kd

EMSA BIAcore

ZFPk 43.6 nM 5.14 nM

ZFPm 41.4 nM 2.76 nM

ZFPn 116.3 nM 69.4 nM

ZFPq na 1.29 μM

ZFPr na .502 μM

ZFPt na 1.07 μM

ZFPu na 2.47 μM

ZFPv 1.19 μM na

ZFPw nd nd

Example 11: Assessment of binding to cccDNA by a human HBV-specific ZFP

[00492] In order to demonstrate that a ZFP specific for a human HBV could bind directly to cccDNA, as well as its specific oligonucleotide, a modified pulldown assay was performed. A ZFPk-MBP fusion protein was incubated with amylose resin, to which the ZFP will bind due to the presence of the MBP. cccDNA was then incubated with the resin-bound ZFP. After extensive washing, the ZFP was eluted from the resin and the resulting eluate was assessed for the presence of cccDNA, indicating ZFP was bound to cccDNA. The bound cccDNA was measured by blotting the eluate onto Hybond XL and hybridizing a radioactive probe, followed by quantitation on the Fujifilm FLA-5100 phosphoimager. The chart is the quantification by the phosphoimager of triplicates. ZFPk was able to bind the HBV cccDNA directly as shown in Fig. 21. Example 12: Testing of human HBV-specific ZFPs in tissue culture

[00493] The activity of the HBV-specific ZFPs in reducing viral RNA levels, viral protein levels, and viral particle levels is tested in the HepAD38 cell line, which has an integrated form of the HBV genome under tetracycline control. In the presence of tetracycline, viral transcription is repressed, and vice versa. When viral transcription occurs in the absence of tetracycline, it results in the formation of virus particles and an accumulation of cccDNA in the nucleus. Another benefit of this cell lines is that HBV E antigen (HBeAg) is secreted only when cccDNA is present, providing an easy diagnostic marker for the presence of cccDNA.

Cells are transfected with 3 μg of pcDNA3.1(+) or pcDNA3.1(+)-ZFP)t, -ZFPm, -ZFPn, - ZFPp, -ZFPq, ZFPr, ZFPt, ZFPu, ZFPv or -ZFPw using Lipofectamine 2000 (LF2000: Invitrogen 11668-027) according to the manufacturer's specifications, with a DNA:LF2000 ratio of 2:1. After 24 hours, cells are harvested for RNA, DNA and whole cell lysates as described above. Example 13: Testing of human HBV-specifϊc and DHBV-speeifie ZFPs in vivo

[00494] The SCID/ AIb-UPa mouse model is used as an in vivo model for testing the HBV- specific ZFPs. In this mouse, the albumin promoter controls a tandem array of four murine urokinase genes. This establishes liver-specific urokinase over-production and accelerated hepatocyte death. The mice are transplanted at a young age with freshly isolated human hepatocytes, which repopulate the mouse liver due to their survival advantage over murine hepatocytes. These human cells are permissive to infection by human hepatotropic pathogens, such as HBV. In addition, adenovirus vectors can be used to deliver a subject ZFP to the infected liver.

[00495] The Peking duck (Anas platyhrynchos) model is used as an in vivo model for testing the

DHBV-specific ZFPs. These animals can be either congenitally infected or postnatally infected with DHBV without serious side effects to the animal. Adenoviruses can also be used to deliver ZFPs to the duck liver. Example 14: Chimeric HBV DNA-binding ZFP/endonuclease polypeptides

[00496] The Fokl endonuclease is a type II restriction endonuclease from Flavobacterium okeanokoites. It has an N-terminal DNA-binding domain and a C-terminal domain with nonspecific DNA-cleavage activity. Native Fokl binds its target DNA as a monomer but requires dimerization of its endonuclease for cleavage. Thus, a chimeric endonuclease is generated that includes an HBV DNA-binding ZFPs and a Fokl endonuclease domain. An example of a nucleotide sequence encoding a fusion protein comprising an HBV DNA-binding ZFP and a Fokl endonuclease domain is presented in Figure 42. A nucleotide sequence encoding a Fokl endonuclease domain is presented in Figure 42A; and the encoded amino acid sequence is presented in Figure 42B. An example of a nucleotide sequence encoding a fusion protein comprising an HBV DNA-binding ZFP (ZFPq) and a Fokl endonuclease domain is presented in Figure 42E. The amino acid sequence of the encoded protein is presented in Figure 42F.

[00497] Another example of a fusion protein comprising an HBV DNA-binding ZFP and an endonuclease is a fusion protein comprising an HBV DNA-binding ZFP and a yeast homothallism (HO) endonuclease. The HO endonuclease makes double stranded DNA breaks

in a sequence specific manner. HO is the only member of the LAGLIDADG (SEQ ID NO:218) family with a C-terminal zinc finger domain through which DNA recognition occurs, and is thus an ideal endonuclease to use in generating a subject HBV DNA-binding ZFP/endonuclease polypeptide. The zinc finger domain of HO is replaced with a subject HBV DNA-binding ZFP, thereby generating a fusion protein comprising an HBV DNA-binding ZFP and a homothallism endonuclease domain. A nucleotide sequence encoding an HO endonuclease domain is presented in Figure 43A; and the encoded amino acid sequence is presented in Figure 43B. An example of a nucleotide sequence encoding a fusion protein comprising an HBV DNA-binding ZFP (ZFPk) and a homothallism endonuclease domain is presented in Figure 43E. The amino acid sequence of the encoded protein is presented in Figure 43F.

[00498] As shown in the Examples above, a number of ZFPs were designed, which target the enhancer or promoter regions of the HBV genome, an accessible region of the cccDNA mini- chromosome, as determined by DNA footprinting assays. Using electrophoretic mobility shift assays and surface plasmon resonance, it was shown that one ZFP binds with dissociation constants in the micromolar range, four in the nanomolar range and one in the picomolar range. It was demonstrated that several of our designed ZFPs can also directly bind cccDNA using an in vitro co-immunoprecipitation method. The ZFPs were cloned into the mammalian expression vector pcDNA3.1(+); and the ZFP-encoding expression vectors were co-transfected into LMH (chicken hepatoma) cells with the plasmid pDHBVl .3, which replicates the DHBV life cycle in these cells. It was found that production of viral mRNA, protein and virus progeny was decreased in the presence of each ZFP, indicating ZFPs binding the DHBV enhancer are capable of inhibiting the viral replicative process at the DNA level.

[00499] While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claims appended hereto.