Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
HIGH PROTEIN OAT SPECIES
Document Type and Number:
WIPO Patent Application WO/2017/070104
Kind Code:
A1
Abstract:
A high protein (up to 40%) tetraploid oat variety is provided that is suitable for large scale oat production using standard farming practices. A tetraploid oat variety includes one or more of lodging resistance, shattering resistance, erect growth habit, and seeds similar to traditional cultivated hexaploid oat, A. sativa. The tetraploid oat variety of the invention can also include a stable fatty acid profile, high iron content, high folic acid content, or high free essential amino acid content. A tetraploid oat variety may be used as foundational seed in a plant breeding program for development of lines and varieties with high protein content. Oat products produced from the tetraploid oat variety of the invention are also included as well as resultant oat foodstuffs such as high protein granola bars, hot cereals food stuffs, cold cereal foodstuffs, snackbars, cookies, gluten-free products, snacks, muffins, pancake mix and the like.

Inventors:
JACKSON ERIC WAYNE (US)
Application Number:
PCT/US2016/057512
Publication Date:
April 27, 2017
Filing Date:
October 18, 2016
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
GEN MILLS INC (US)
International Classes:
A01G7/00; A01H6/46; A01H1/00; A01H1/06; A01H5/10
Foreign References:
US5773209A1998-06-30
US8607956B22013-12-17
US8574644B22013-11-05
Other References:
LADIZINSKY, G.: "Domestication via hybridization of the wild tetraploid oats Avena magna and A. murphyi", THEORETICAL AND APPLIED GENETICS, vol. 91, no. 4, 1 September 1995 (1995-09-01), pages 639 - 646, XP009509930
OLIVER ET AL.: "New Diversity Arrays Technology (DArT) markers for tetraploid oat (Avena magna Murphy et Terrell) provide the first complete oat linkage map and markers linked to domestication genes from hexaploid A. sativa L.", THEORETICAL AND APPLIED GENETICS, vol. 123, no. 7, 31 July 2011 (2011-07-31), pages 1159 - 1171, XP 019964807
See also references of EP 3364744A4
Attorney, Agent or Firm:
DIEDERIKS, Everett, G., Jr. (US)
Download PDF:
Claims:
What is claimed is:

1. A plant of a tetraploid oat variety that is cultivatable using one or more standard farming practices.

2. The plant of claim 1, wherein the standard farming practices include mechanical planting, mechanical harvesting, and/or mechanical milling.

3. The plant of claim 1, wherein the plant is Avena magna.

4. The plant of claim 1 , wherein the variety has one or more of the following traits being comparable or superior to Avena sativa variety 'Leggett': stature, shattering resistance, lodging resistance, plant height, time to maturity, ease of dehulling, and seed yield.

5. The plant of claim 1 , comprising a seed protein content of greater than 14%.

6. The plant of claim 1 , comprising a seed protein content of greater than 18%.

7. The plant of claim 1 , comprising a seed oleic/linoleic ratio greater than 1.

8. The plant of claim 1 , comprising a seed oleic/linoleic ratio that is superior to that of A. sativa 'Leggett'.

9. The plant of claim 1, comprising a seed iron content that is superior to that of A. sativa 'Leggett'.

10. The plant of claim 1, comprising a seed folic acid content that is superior to that of A. sativa 'Leggett'.

1 1. The plant of claim 1 , comprising a seed protein content that is superior to that of A. sativa 'Leggett'.

12. The plant of claim 1 , comprising a seed free essential amino acid content that is superior to that of A. sativa 'Leggett'.

13. An oat plant produced from growing seed of the plant of claim 1.

14. A progeny plant of the plant of claim 1 that is cultivatable using one or more standard farming practices.

15. A progeny plant of claim 14, further comprising a seed protein content, a seed oleic/linoleic ratio, a seed iron content, a seed folic acid content, or a seed free essential amino acid content that is superior to that of A. sativa 'Leggett'.

16. A progeny plant of claim 13 having a lineage comprising a second oat plant.

17. The plant of claim 1 , wherein the variety is 96.5.6, 96.5.34, 96.5.55, or 100.2.35, or a descendant thereof.

18. An oat ingredient derived from a plant of a tetraploid oat variety that is cultivatable using one or more standard farming practices.

19. A composition comprising the oat ingredient of claim 18.

20. A product comprising the composition of claim 19.

21. A plant of an oat variety having a seed protein content greater than about 18%.

22. The plant of claim 21 , wherein the plant is A. magna.

23. The plant of claim 22, wherein the oat variety is cultivatable using one or more standard farming techniques.

24. The plant of claim 23, wherein the standard farming practices include mechanical planting, mechanical harvesting, and/or mechanical milling.

25. The plant of claim 21 , wherein the oat variety is a tetraploid.

26. The plant of claim 21 , comprising a seed oleic/linoleic ratio greater than 1.

27. The plant of claim 21 , comprising a seed oleic/linoleic ratio that is superior to that of A. sativa 'Leggett'.

28. The plant of claim 21 , comprising a seed iron content that is superior to that of A. sativa 'Leggett'.

29. The plant of claim 21 , comprising a seed folic acid content that is superior to that of A. sativa 'Leggett'.

30. The plant of claim 21 , comprising a seed free essential amino acid content that is superior to that of A. sativa 'Leggett'.

31. The plant claim 21 , wherein said variety has one or more of the following traits being comparable or superior to A. sativa 'Leggett': stature, shattering resistance, lodging resistance, plat height, time to maturity, ease of dehulling, and seed yield.

32. A progeny plant of the plant of claim 21 that is cultivatable using one or more standard farming practices.

33. A progeny plant of claim 32, further comprising a seed protein content, a seed oleic/linoleic ratio, a seed iron content, a seed folic acid content, or a seed free essential amino acid content that is superior to that of A. sativa 'Leggett'.

34. A progeny plant of claim 32 having a lineage comprising a second oat plant.

35. The plant of claim 21 , wherein the variety is 96.5.6, 96.5.34, 96.5.55, or 100.2.35, or a descendant thereof.

36. An oat ingredient derived from a plant of an oat variety having a seed protein content of greater than about 18%.

37. A composition comprising the oat ingredient of claim 36.

38. A product comprising the composition of claim 37.

39. A plant of the species Avena magna ssp domestica.

40. The plant of claim 39, which is fertile with wild Avena magna.

41. A population of plants comprising a plurality of the plant of claim 39.

Description:
HIGH PROTEIN OAT SPECIES

FIELD OF THE INVENTION

[0001] The invention relates to oat breeding, and a new domesticated tetraploid oat species having high protein content. Methods of developing cultivars and varieties of this species, specific lines, uses and products derived therefrom are also disclosed.

BACKGROUND OF THE INVENTION

[0002] Protein is an essential part of the human diet and crops containing a complete amino acid profile are scarce. Common cultivated cereal grains, a staple food source in most of the countries of the world, are primarily rich in starch and fiber (soluble and insoluble). Unfortunately, these grains have modest levels of grain protein (~10%) and few contain all the amino acids required in the human diet. Common cultivated oat (Avena sativa) has long been a healthy food and ingredient primarily due to favorable levels of grain beta glucan (soluble fiber), antioxidants, and a beneficial fatty acid profile. For decades, oat has been widely favored as an ingredient in cold/hot cereals and snack bars. Oats include ten to fifteen species in genera Avena. All oats have edible seeds, though they are small and hard to harvest in most species. The most important cultivated species of oats are common oat (Avena sativa), Abyssinian oat (Avena abyssinica), naked or hulless oats (Avena nuda), and lopsided oat (Avena strigosa).

[0003] Attempts have been made to increase the protein levels in cultivated oat to make oat- based food products a premium amino acid source. Little gain has been made in this endeavor only increasing levels of grain protein from -10-15% to ~20%. Avena magna, a wild relative of cultivated oat, is a promising source of protein. However, the lack of favorable agronomic characteristics (e.g., cultivation and harvestability) have limited the use of A magna as a crop. Prior attempts to domesticate this wild species by crossing with A. sativa, either to transfer traits from A. magna to A. sativa or transfer traits from A. sativa to A. magna, have failed to produce a cultivatable oat plant that retains the favorable nutritional qualities of wild A. magna.

SUMMARY OF THE INVENTION

[0004] Applicants have spent significant time breeding and selecting A. magna for domestication traits. Despite its favorable high protein content, high iron content, good taste and fatty acid distribution, the wild oat species has proven difficult to impossible to domesticate for large scale production. With its tetraploid nature, there was concern that the wild variety may not even possess the genetic material for cultivation traits. Wild tetraploid (four sets of chromosomes) A. magna plants are not amenable to standard mechanical farming practices. The plants are very tall and lodge, growing flat on the ground. Seeds are hairy and difficult to hull, plugging traditional hullers, see Figure 1. Applicant has successfully domesticated this tetraploid species, which allows for mechanical planting, harvesting and milling. Applicant has further developed lines and varieties for use in breeding the oat species of the invention. The varieties remain tetraploid, in distinction from A. sativa, which is hexaploid, or having six sets of chromosomes (AA, CC and DD genomes; 2n=6x=42), and have good cultivation traits. Lines developed by Applicants through years of traditional breeding techniques have superior agronomics compared to wild A. magna, but maintain desirable grain protein levels and fatty acid distribution profiles.

[0005] Provided herein is a plant of a tetraploid oat variety that is cultivatable using one or more standard farming practices. Standard farming practices can include mechanical planting, mechanical harvesting, and/or mechanical milling. In some embodiments, a plant of a tetraploid oat variety that is cultivatable using one or more standard farming practices can be Avena magna. In some embodiments, the tetraploid oat variety that is cultivatable using one or more standard farming practices is 96.5.6, 96.5.34, 96.5.55, or 100.2.35, or a descendant thereof. A tetraploid oat variety provided herein can have one or more of the following traits being comparable or superior to Avena sativa variety 'Leggett' : stature, shattering resistance, lodging resistance, plant height, time to maturity, ease of dehulling, and seed yield.

[0006] In some embodiments, a plant of a tetraploid oat variety that is cultivatable using one or more standard farming practices can have a seed protein content of greater than 14% or greater than 18%, a seed oleic/linoleic ratio greater than 1 , a seed oleic/linoleic ratio that is superior to that of A. sativa 'Leggett', a seed iron content that is superior to that of A. sativa 'Leggett', a seed folic acid content that is superior to that of A. sativa 'Leggett', a seed protein content that is superior to that of A. sativa 'Leggett', and/or a seed free essential amino acid content that is superior to that οϊΑ. sativa 'Leggett' .

[0007] Also provided herein is an oat plant produced from growing seed of a plant of a tetraploid oat variety that is cultivatable using one or more standard fanning practices. 10008] Also provided herein is a progeny of a plant of a tetraploid oat variety that is cultivatable using one or more standard farming practices, where the progeny is cultivatable using one or more standard fanning practices. The progeny can have a lineage including a second oat plant. In some embodiments, a progeny of a plant of a tetraploid oat variety that is cultivatable using one or more standard farming practices can have a seed protein content of greater than 14% or greater than 18%, a seed oleic/linoleic ratio greater than 1, a seed oleic/linoleic ratio that is superior to that of A. sativa 'Leggett', a seed iron content that is superior to that of A. sativa 'Leggett', a seed folic acid content that is superior to that of A. sativa 'Leggett', a seed protein content that is superior to that of A. sativa 'Leggett', and/or a seed free essential amino acid content that is superior to that of A. sativa 'Leggett'.

[0009] An oat ingredient derived from a plant of a tetraploid oat variety that is cultivatable using one or more standard farming practices is provided herein. The oat ingredient can be included in a composition or a product.

[0010] Provided herein is an oat plant of an oat variety having a seed protein content greater than about 18%. In some embodiments, an oat plant of an oat variety having a seed protein content greater than about 18% is a tetraploid oat plant. In some embodiments, the oat plant is A. magna. In some embodiments, the oat variety is cultivatable using one or more standard farming techniques, such as mechanical planting, mechanical harvesting, and/or mechanical milling. In some embodiments, the oat variety is 96.5.6, 96.5.34, 96.5.55, or 100.2.35, or a descendant thereof.

[0011] In some embodiments, a plant of an oat variety having a seed protein content greater than about 18%) can have a seed oleic/linoleic ratio greater than 1 , a seed oleic/linoleic ratio that is superior to that of A. sativa 'Leggett', a seed iron content that is superior to that of A. sativa 'Leggett', a seed folic acid content that is superior to that of A. sativa 'Leggett', a seed protein content that is superior to that of A. sativa 'Leggett', and/or a seed free essential amino acid content that is superior to that of A. sativa 'Leggett'.26. In some embodiments, the variety has one or more of the following traits being comparable or superior to A. sativa 'Leggett': stature, shattering resistance, lodging resistance, plat height, time to maturity, ease of dehulling, and seed yield.

[0012] Also provided herein is a progeny plant of a plant of an oat variety having a seed protein content greater than about 18%, where the progeny is cultivatable using one or more standard farming practices. In some embodiments, the progeny has a seed protein content, a seed oleic/linoleic ratio, a seed iron content, a seed folic acid content, and/or a seed free essential amino acid content that is superior to that of A. sativa 'Leggett'. In some embodiments, the progeny has a lineage including a second oat plant.

[0013] An oat ingredient derived from a plant of an oat variety having a seed protein content of greater than about 18% is also provided. The oat ingredient can be included in a composition or a product.

[0014] Provided herein is a plant of the species Avena magna ssp domestica. In some embodiments, the A. magna ssp domestica plant is fertile with wild Avena magna. A population of plants including a plurality of A. magna ssp domestica plants is also provided.

DESCRIPTION OF THE FIGURES

[0015] Figure 1 includes photographs showing tetraploid oat {Avena magna) with varying levels of domestication. Intermediate domestication types were characterized by two articulate awns with dark glumes and basal pubescence (Type A), a single articulate awn with light glumes and reduced basal pubescence (Type B) and a single articulate awn with light glumes and no basal pubescence (Type C).

[0016] Figure 2 is a graph showing the percentage of grain nutritional traits as measured in whole grain flour. A. sativa 'Leggett' was used as the hexaploid oat control to compare with two tetraploid oat lines (BAM 100-2 is Line 100.2 and BAM 96-5 is Line 96.5). All analytical measurements were performed at Medallion Lab in Minneapolis, MN.

[0017] Figure 3 is a graph showing the percent of free essential amino acids as measured in whole grain flour. A. sativa 'Leggett' was used as the hexaploid oat control to compare with two examples of tetraploid oat lines of the invention. All analytical measurements were performed at Medallion Lab in Minneapolis, MN. A. sativa 'Leggett' is a hexaploid Avena sativa hulled spring oat variety that is a standard check for oats. Spring oat varieties typically take 82-98 days from seedling to maturity.

[0018] Figure 4 is a graph showing the percent of fatty acids as measured in whole grain flour. A. sativa 'Leggett' was used as the hexaploid oat control to compare with two tetraploid oat lines. The tetraploid oat lines exhibit an increased oleic content over A. sativa 'Leggett' and decreased linoleic content over A. sativa 'Leggett' . All analytical measurements were performed at Medallion Lab in Minneapolis, MN.

[0019] Figure 5 is an allele sharing similarity matrix comparing allele sharing similarity between A. magna ssp domestica lines (Line 100, Line 100.235, Line 96, Line 96.5.34, Line 96.5.6, Line 96.5.55), wild A magna accessions (PI659392, PI657620, PI659401 , Clav8330), an A.

maroccana accession (PI657380), A. murphyii accessions (PI657356, PI657361 , PI657362, PI657606), an A. sterilis accession (P1657616), common hexaploid oat lines (A.s. 324, A.s. Dancer, A.s. Morgan, A.s. Leggett, A.s. Triactor, A.s. 357, A.s. 423), and strigosa accessions (Clav7010, PI436103, PI401794). All A. magna lines and accessions had greater than 60% allele sharing similarity (i.e., > 0.60) with each other, while hexaploid lines and accessions (A. sterilis and A. sativa) and diploid accessions (A. strigosa) had less than 50% allele sharing similarity (i.e., < 0.50) with any of the A. magna lines and accessions.

DETAILED DESCRIPTION OF THE INVENTION

I. Introduction

[0020] Cultivated oat (Avena sativa) has long been known as a healthy food and ingredient primarily based on favorable levels of grain beta glucan (soluble fiber), antioxidants, and a beneficial fatty acid profile. Unfortunately, like other cereal grains, common cultivated oats typically have modest levels of grain protein (~10%).

[0021] Attempts have been made to increase the protein levels in cultivated oat so that common oat-based food products can become a premium amino acid source. However, little gain has been made in this endeavor, only increasing levels of grain protein from -10-15% to ~20%. Avena magna, a wild relative of cultivated oat, is a promising source of protein. However, wild A. magna lacks favorable agronomic characteristics for cultivation. For example wild Avena magna oat plants are not amendable to mechanical harvesting because they lodge and shatter, and the seeds/grain are large and furry and clog traditional mechanical threshing and dehulling machines.

[0022] Other attempts of domesticating A. magna failed for a number of reasons. Because A. magna is tetraploid (having 4 sets of chromosomes) while domesticated Avena sativa is hexaploid (6 sets of chromosomes), it was believed that A. magna may lack the genes necessary to produce a variety with traits (e.g., shattering resistance, upright growth habit, and the like) that would make it suitable for cultivation using standard farming practices. Previous attempts to domesticate A. magna thus resorted in either introducing high protein content from A. magna into A. sativa or introducing domestication traits from A. sativa into A. magna, which resulted in largely sterile plants, plants that require female cytoplasm from a hexaploid A. sativa parent, plants that are hexaploids which do not retain the beneficial nutritional traits of wild A. magna, or tetraploid oat plants that have lost the high protein content of wild A. magna.

[0023] Using traditional plant breeding techniques, we succeeded in producing a new tetraploid oat variety that is cultivatable using one or more standard farming practices. Unlike past attempts at domestication of tetraploid oats, this stable and true to form tetraploid oat variety retains a high grain protein content similar to wild A. magna, containing at least 14% grain protein content (e.g., at least 18%, or between 28% to 40% grain protein content) (Figure 2). In some embodiments, grain of a tetraploid oat variety provided herein has at least twice the levels of at least one amino acid (Figure 3) when compared to A. sativa. These characteristics make A. magna a desirable grain for development of high quality protein products.

[0024] In addition, we have discovered a cultivatable tetraploid oat variety provided herein can have a grain fatty acid profile based on the linoleic (18: 1) to linoleic (18:2) fatty acid ratio (Figure 4) that is more stable against oxidation as compared to the fatty acid profile of A. sativa. A more stable fatty acid profile can impart the grain and products made from the grain of a tetraploid oat variety provided herein with an extended shelf life. In addition, reduced fatty acid oxidation can improve the flavor profile over the shelf life of the grain or products.

[0025] Thus, provided herein is a tetraploid oat variety having grain with one or more desirable nutritional qualities, such as high protein content and a stable fatty acid profile, and exhibiting characteristics making it suitable for cultivation using one or more standard farming practices. As used herein, the term "variety", also referred to herein as a "line," refers to a population of plants that are defined by the expression of characteristics resulting from a certain lineage or given genotype or combination of genotypes, distinguished from any other plant grouping by these characteristics and considered as a unit with regard to its suitability for being propagation unchanged. A variety is sufficiently homozygous and homogeneous to be used for commercial grain production or further breeding. II. Nutrition

[0026] A tetraploid oat variety provided herein has a high seed protein content, with at least 15% (e.g., at least 18% or at least 22%) seed protein content. In some embodiments, a tetraploid oat variety has a seed protein content of from about 28% to about 40%. As used herein the term "protein content" includes the typical percentage by weight of protein in the oil free meal of the mature whole dried seeds. This can be determined by AOCS Official Method Ba 4e-93

Combustion Method for the Determination of Crude Protein. Also, protein could be analyzed using NIR (Near Infrared) spectroscopy as long as the instrument is calibrated according to the manufacturer's specifications, reference AOCS Procedure Am 1-92 Determination of Oil, Moisture and Volatile Matter, and Protein by Near-Infrared Reflectance. Generally moisture content of seed is normalized to 10% for reporting of protein content.

[0027] In some embodiments, a tetraploid oat variety has a seed protein content that is superior to A. sativa variety 'Leggett'. The term "superior" when comparing a tetraploid oat variety to A. sativa variety 'Leggett' herein means that the variety demonstrates a measurable improvement (e.g., a statistically significant improvement (p < 0.05)) in a physiological, morphological or nutritional trait when compared to A. sativa 'Leggett'. The term "comparable" when comparing a tetraploid oat variety to A. sativa variety 'Leggett' herein means that the variety demonstrates a physiological, morphological or nutritional trait that is not significantly different (e.g., statistically significantly different (p > 0.05)) as compared to A. sativa variety 'Leggett'.

Comparisons are made when grown under the same environment under the same conditions. An improvement in a trait includes for example, a more erect plant stature, a higher resistance to shattering demonstrated by less seed loss, a higher resistance to lodging demonstrated by fewer plants lodged, a shorter plant height, greater ease of dulling demonstrated by use of mechanical harvesting equipment, higher seed yield per acre, a higher folic acid seed content, a higher ratio of oleic acid content to linoleic acid content in seed, a higher seed iron content, a higher seed protein content, and a higher seed free essential amino acid content, a shorter time to maturity. Content of any specific component of seeds (such as iron, fatty acid, etc.) may be determined by any standard assay methods commonly used in the art.

[0028] In some embodiments, a tetraploid oat variety provided herein has a relatively stable fatty acid profile, based on the seed oleic fatty acid (18: 1) to linoleic fatty acid (18:2) content ratio. The majority of the seed fatty acid content in oats is unsaturated (monounsaturated or polyunsaturated. However, monounsaturated fatty acids are more stable against oxidation than polyunsaturated fatty acids. An oleic fatty acid to linoleic fatty acid ratio that is higher is expected to be more stable against oxidation than a lower ratio. Oxidation of fatty acids can result in "off or rancid flavors or odors, and can result in reduced shelf life of foods containing fatty acids.

[0029] In some embodiments, a tetraploid oat variety has an oleic to linoleic acid ratio that is superior to that of .4. sativa variety 'Leggett " . For example, a tetraploid oat variety can have a ratio of linoleic (18: 1) fatty acids to linoleic (18:2) fatty acids that is greater than 1 (e.g., greater than 1.1 or greater than 1.2).

[0030] In some embodiments, an oat ingredient derived from a tetraploid oat variety provided herein or a product containing an oat ingredient derived from a tetraploid oat variety provided herein can exhibit an increased shelf life, or an improved flavor or odor over the shelf life, of a similar oat ingredient or product containing an oat ingredient derived from A. sativa.

[0031] In some embodiments, a tetraploid oat variety provided herein can have one or more additional nutritional characteristics, such as a seed iron content, seed folic acid content or seed free essential amino acid content, that are superior to that oiA. sativa variety 'Leggett'.

III. Agronomic traits

[0032] A tetraploid oat variety is cultivatable using one or more standard farming practices, which include practices involved in commercial crop production, such as mechanical planting (e.g., using a disc planter), mechanical harvesting (e.g., using a combine harvester), mechanical threshing, and mechanical dehulling, as opposed to hand planting, harvesting, threshing, dehulling, and the like. Characteristics of a tetraploid oat variety provided herein that make it amenable to cultivation using one or more standard farming practice include, without limitation, an upright habit, shattering resistance, lodging resistance, and seeds/grain similar in appearance and threshability to A. sativa. For example, described herein are 6 different lines of tetraploid oat exhibiting varying degrees of shattering resistance, lodging resistance, upright habit, and reduced seed pubescence (hairiness), with 4 lines that are highly shattering resistant, fully upright, highly lodging resistant, and have seeds that are almost visually indistinguishable from A. sativa. [0033] In some embodiments, a tetraploid oat variety provided herein can be mechanically dehulled with at least 50% efficiency (i.e., at least 50 seeds per 100 are removed from their hulls) using an oat dehulling machine, such as Model TFYM 1000 (Envirotextiles, LLC, Glenwood Springs, CO, USA).

[0034] Surprisingly, a tetraploid oat variety provided herein can have one or more agronomic traits being comparable or superior to A. sativa variety 'Leggett'. For example, a tetraploid oat variety can have one or more of the following characteristics: semi-dwarf (e.g, a height at maturity of from about 120 cm to about 150 cm), early maturing (e.g., maturity until 50% flowering of about 1 10 days to about 120 days), or a similar groat weight to A. sativa variety 'Leggett' (e.g., from about 30 mg to about 50 mg). In some embodiments, a tetraploid oat variety can have a similar or greater seed yield to A. sativa variety 'Leggett'. For example, a tetraploid oat variety can have a similar number of seeds per panicle to A. sativa variety 'Leggett' (e.g., from 17 to 25 seeds per panicle), or have a similar or greater number of panicles per plant as A. sativa variety 'Leggett' (e.g., from about 4 to about 15 panicles per plant). A trait of a tetraploid oat variety can be considered superior to A. sativa variety 'Leggett' if it provides one or more advantage to, for example, planting, growing, harvesting, milling, and yield. For example, a higher yield or greater lodging resistance when plants are grown under the same conditions are considered superior traits.

IV. Genetics and Breeding

[0035] A tetraploid oat variety provided herein includes 28 chromosomes (e.g., CC and DD genomes, each with 7 pairs of chromosomes), in contrast to A. sativa, which is hexaploid (AA, CC, and DD genomes; 2n = 6x = 42 chromosomes). In addition, a tetraploid oat variety provided herein is fertile with itself or other tetraploid oat varieties and wild accessions via standard pollination techniques, and without the need for embryo rescue or other

biotechnological techniques. A tetraploid oat variety provided herein can have greater than 50% allele sharing similarity (e.g., greater than 60% or greater than 70%) xX Avena magna ssp domestica line 96.5.34, 96.5.6, or 100.2.235.

[0036] A plant of a tetraploid oat variety (e.g., A. magna ssp domestica line 96.5.34, 96.5.6, or 100.2.235) provided herein can serve as a parent in a genetic cross with a second oat plant to produce progeny. In some embodiments, such as when the second oat plant is a tetraploid oat plant, progeny of such a cross can be fertile. In some embodiments, such as when the second oat plant is not a tetraploid oat plant, progeny of such a cross can be infertile.

[0037] In some embodiments, a plant of a tetraploid oat variety provided herein can be used to develop additional oat varieties that are cultivatable using one or more standard farming practice. Additional oat varieties can be produced using any standard breeding technique, and can take advantage of the plant's method of pollination. Oat plants (Avena sp.), are recognized to be naturally self-pollinated plants which, while capable of undergoing cross-pollination, rarely do so in nature. Thus, control of pollination can be used to develop additional oat varieties.

[0038] A plant is self-pollinated if pollen from one flower is transferred to the same or another flower of the same plant. A plant is sib-pollinated when individuals within the same family or line are used for pollination. A plant is cross-pollinated if the pollen comes from a flower on a different plant from a different family or line. The term cross-pollination herein does not include self-pollination or sib-pollination.

[0039] A cross between two different homozygous lines produces a uniform population of hybrid plants that may be heterozygous for many gene loci. A cross of two heterozygous plants each that differ at a number of gene loci will produce a population of plants that differ genetically and will not be uniform. Regardless of parentage, plants that have been self- pollinated and selected for type for many generations become homozygous at almost all gene loci and produce a uniform population of true breeding progeny. The term "homozygous plant" is hereby defined as a plant with homozygous genes at 95% or more of its loci.

[0040] Choice of breeding or selection methods can depend on the mode of plant reproduction, heritability of the trait(s) being improved, and type of variety used commercially (e.g., Fl hybrid variety, pureline variety, etc.). A breeding program can include five or more generations of selection and breeding to obtain a population of plants with desired traits that are stably heritable. A breeding program can include any appropriate breeding technique or combination of breeding techniques. Known breeding techniques include, without limitation, pedigree breeding, backcross breeding, single seed descent, bulk breeding. Breeding programs typically include a periodic, objective evaluation of the efficiency of the breeding procedure. Evaluation criteria vary depending on the goal and objectives, but can include gain from selection per year based on comparisons to an appropriate standard, overall value of the advanced breeding lines, and number of successful varieties produced per unit of input (e.g., per year, per dollar expended, etc.).

[0041] In addition, methods such as outcrossing to wild populations, mutation induction, or transgene introduction, can be used for introducing genetic variability during one or more breeding step. Such methods can be used to introduce new traits, such as disease resistance or tolerance to various environmental conditions (e.g., drought), or improve existing traits.

[0042] Selection of plants for each generation of breeding can be based on one or more criteria, including phenotypic and/or genotypic traits. Phenotypic traits can be used to select one or more parent plants for breeding by examining physical and/or biochemical characteristics. For example, plants having an upright habit and/or possessing a seed protein content of greater than 15% can be selected for use in a breeding program at one or more stage of the breeding program. Additional phenotypic traits can include seed yield, head configuration, glume configuration, seed configuration, lodging resistance, disease resistance, plant height, rate of maturity, and the like.

[0043] Genotypic traits can be identified using one or more molecular markers in marker- assisted selection. Marker-assisted selection can use one or more techniques, such as Starch Gel Electrophoresis, Isozyme Electrophoresis, Restriction Fragment Length Polymorphisms

(RFLPs), Randomly Amplified Polymorphic DNAs (RAPDs), Arbitrarily Primed Polymerase Chain Reaction (AP-PCR), DNA Amplification Fingerprinting (DAF), Sequence Characterized Amplified Regions (SCARs), Amplified Fragment Length Polymorphisms (AFLPs), Simple Sequence Repeats (SSRs), and Single Nucleotide Polymorphisms (SNPs) may be used in plant breeding methods. One use of molecular markers is Quantitative Trait Loci (QTL) mapping. QTL mapping identifies molecular markers, which are known to be closely linked to alleles that have measurable effects on a phenotypic trait.

[0044] For highly heritable traits, a choice of superior individual plants evaluated at a single location can be effective, whereas for traits with low heritability, selection may be based on mean values obtained from replicated evaluations of families of related plants. Popular selection methods commonly include pedigree selection, modified pedigree selection, mass selection, and recurrent selection.

[0045] Also provided herein is a descendant of A. magna ssp domestica line 96.5.34, 96.5.6, or 100.2.235. A descendant of magna ssp domestica line 96.5.34, 96.5.6, or 100.2.235 is cultivatable using one or more standard farming practices and can retain one or more traits exhibited by magna ssp domestica line 96.5.34, 96.5.6, or 100.2.235, such as protein content greater than 15%, a ratio of linoleic (18: 1 ) fatty acids to linoleic (18:2) fatty acids that is greater than 1 , or the like.

[0046] Another embodiment of the invention is an essentially derived variety of A. magna ssp domestica line 96.5.34, 96.5.6, or 100.2.235 or a locus conversion of A. magna ssp domestica line 96.5.34, 96.5.6, or 100.2.235. As determined by the UPOV Convention, essentially derived varieties may be obtained for example by the selection of a natural or induced mutant, or of a somaclonal variant, the selection of a variant individual from plants of the initial variety, backcrossing, or transformation by genetic engineering. An essentially derived variety of A. magna ssp domestica line 96.5.34, 96.5.6, or 100.2.235 is further defined as one whose production requires the repeated use of A. magna ssp domestica line 96.5.34, 96.5.6, or

100.2.235 or is predominately derived from A. magna ssp domestica line 96.5.34, 96.5.6, or 100.2.235. International Convention for the Protection of New Varieties of Plants, as amended on Mar. 19, 1991 , Chapter V, Article 14, Section 5(c). A locus conversion refers to plants within a variety that have been modified in a manner that retains the overall genetics of the variety and further comprises one or more loci with a specific desired trait, such as male sterility, insect, disease or herbicide resistance. Examples of single locus conversions include mutant genes, transgenes and native traits finely mapped to a single locus. One or more locus conversion traits may be introduced into a single oat variety.

V. Processing, Ingredients and Products

[0047] After harvest, oat grains can be processed in preparation for making an oat ingredient, or a composition or product containing an oat ingredient. Processing steps can include, without limitation drying, cleaning, sizing or grading, dehulling, steaming, or kilning.

[0048] An oat ingredient derived from a tetraploid oat variety that is cultivatable using one or more standard farming practices, or a composition or product comprising such an oat ingredient, can have one or more benefit over an oat ingredient derived from A. sativa (or composition or product containing such an ingredient). For example, an oat ingredient derived from a tetraploid oat variety can have a higher protein content, a longer shelf life, a higher iron content, or a higher folic acid content than an oat ingredient derived from A. sativa. In some embodiments, a composition or product comprising an oat ingredient derived from a tetraploid oat variety provided herein can have a benefit of providing a desired protein content, shelf life, iron content, or folic acid content without the need, or with reduced need, of other ingredients traditionally used to supplement such nutritional and shelf life benefits, such as soy protein, antioxidants, and inorganic iron supplements.

[0049] An oat ingredient is "derived" from an oat plant by milling, purifying, isolating, extracting or other production methods applied to the plants of the invention. The term "plant" as used herein refers to whole plants, plant parts (e.g., pollen, ovule, tissues such as leaves, stems, flowers, roots, seed), cultured or uncultured plant cells (e.g., callus) and progeny of same. The term "plant" refers to plants of any variety of ploidy levels, including polyploid, diploid, haploid and hemizygous. Examples of oat ingredients include but are not limited to oat oil extract, oat flour, oat groats, steel-cut oats, rolled oats, quick oats, oat bran, or individual components thereof.

[0050] A composition comprising an oat ingredient includes a mixture incorporating one or more oat ingredients provided herein. Examples of compositions comprising an oat ingredient include but are not limited to a flour mix, a pre-mix, dough, and the like.

[0051] An oat ingredient can be included in a product. A "product" with reference to a composition comprising an oat ingredient includes any of a number of consumer products made from oat ingredients, or compositions comprising oat ingredients such as granola, muesli, granola bars, hot cereal food stuffs, cold cereal foodstuffs, snackbars, cookies, gluten-free products, snacks, muffins, pasta, pancake mix, dairy substitute, animal feed, or any other product which employs the use of an oat ingredient. In some embodiments, an oat ingredient provided herein can be included in an animal feed or animal feed supplement to increase the amount of at least one nutrient (e.g., protein or iron) in the milk of a milk producing animal fed the animal feed or animal feed supplement.

EXAMPLES

Example 1— Tetraploid Oat Line Agronomic Traits

[0052] Several tetraploid oat lines were developed displaying one or more traits suitable for cultivation using one or more standard farming practices. Avena magna ssp domestica lines designated 96.5.6, 96.5.34, 96.5.55, and 100.2.235 display spring habit with erect growth and short stature (<91.0cm). Plants head in early-to-mid season and are resistant to lodging and shattering. Stems contain dense green-to-dark green board (>1.6mm, penultimate) leaves with erect angles and terminate with long (>27.0cm) broad (>17.8cm) equilateral panicles. The panicles have a straight hairless rachis that is highly branched and produces abundant spikelets (>18.0). The spikelets are white-to-yellow in color and display basal semi-abscission without scars or hairs. Spikelets contain an average of two fertile florets (<3.8% sterility) with long (>2.8mm) glumes that are yellow in color. Spikelets for lines 96.5.6 and 96.5.34 contain yellow hairless lemma, while 100.2.235 lemmas are yellow-to-gray and glabose. Awns are normally absent and are non-twisted when they do occur on the lemma. Seed is similar to cultivated oat (A. sativa, 2n=6x=42, AACCDD) and appears white-to-yellow in color with absence of basal hair and marginal pubescence. Groats are easily separated from the glumes via mechanical separation with an efficiency of approximately 65% and are plump (>2.54cm L and >0.64cm W) with a mean 1 ,000 kernel weight of 30.3g. Nutrient profile of the grain is highlighted by an average of tocopherols (vitamin E), and 9.1% (DV) oil of which 49.6% (DV) is oleic acid (18:0) to 37.2% (DV) linoleic acid (18: 1). The total grain fiber is 8.5% (DV) of which 2.9% (DV) is beta glucan and 1.0% (DV) resistant starch.

[0053] Table 1 below shows the total seed, groat percentage and shattering comparisons among several cultivatable tetraploid oat lines. Lines 96.5.6, 96.5.55, 100.2.235 and 96.5.34 all have good shattering resistance, high groat percentage and high seed yield in pounds as compared to parental lines 96.5 and 100.2. Lines 100.2.231 and 100.2.233 have a moderate seed yield and high groat percentage as compared to parental lines 96.5 and 100.2.

Table 1

100.2.233 1.2 60.0 4.0

100.2.235 3.9 70.0 1.0

96.5 A 32.0* 4.0

100.2 NA 20.0* 4.0

[0054] Table 2 shows various trait observations of various cultivatable tetraploid oat lines. Lines 100.2.235, 96.5.34 and 96.5.6 are stable for the described traits reported over different years and locations.

Table 2

96.5.55 1.0 3.2 1.0 3.1 8.2 1.3 0.0 17.8 83.3 0.0

96.5.6 1.0 3.3 1.0 3.3 8.6 1.4 0.0 43.8 84.8 0.1

Trait (Year 4)

LineJD Awn Glume Habit (0= Head Leaf Leaf Lodging Percent Plant Seed

No. Length prostrate; Category Density Width (%) Tertiary Height Pubescence (mm) 1 = erect) (cm)

100 1.0 2.5 0.0 0.0 2.5 1.0 70.6 93.1 141.4 4.0

96 1.0 2.8 0.0 0.0 2.3 0.9 55.6 97.0 126.1 0.0

100.2.231 1.0 2.3 1.0 3.0 2.0 1.0 0.0 80.0 86.0 3.0

100.2.233 1.0 2.4 1.0 3.0 2.0 1.8 0.0 80.0 86.0 4.0

100.2.235 0.2 2.9 1.0 3.0 4.0 1.3 13.8 48.1 91.2 0.7

96.5.34 0.1 2.8 1.0 3.0 4.0 1.8 0.0 17.2 86.2 0.0

96.5.55 0.3 3.0 1.0 3.0 4.0 1.8 15.0 18.3 89.0 0.0

96.5.6 0.2 3.0 1.0 3.0 4.0 1.6 0.0 22.0 83.0 0.0

[0055] Table 3 shows improvements in sterility, tiller number, number of seeds, panicles and

leaf angle achieved for varieties 96.5.6, 96.5.34, 96.5.55, and 100.2.235, and improvements in

sterility, tiller number, number of seeds, and panicles of 100.2.231 and 100.2.233 over lines 100 and 96.

Table 3

[0056] Table 4 shows traits across tetraploid oat lines as compared to selected A. sativa lines, wild type A. magna accessions, wild type A. murphyii accessions, and wild type A. strigosa accessions.

Table 4

PI657380 A. murphyi NSGC 0.0 163.0 5.0 207.8

PI657606 A. murphyi NSGC 0.0 163.0 5.0 193.0 Table 4 Leaf

(cont.)

Line ID Carriage/Leaf Color (1 - Penultimate Ligule (1 - Leaf Margin (1 - Angle (1 - Yellow/Green, 2 - Width (mm) Absent, 2 - Glabrous/Hairless, Drooping, 2 - Erect) Light Green, 3 - Dark Present) 2 - Ciliate/Hairy)

Green, 4 - Blue/Green)

324 1.0 3.0 16.8 2.0 1.0

357 1.0 2.0 16.5 2.5 1.0

423 1.0 2.3 16.8 2.0 1.0

Dancer 1.0 3.0 16.8 2.0 1.0

Leggett 1.0 2.3 16.3 2.0 1.0

Morgan 1.0 2.5 13.3 2.0 1.0

Triactor 1.0 2.0 17.0 1.0 1.0

100 1.0 3.0 18.8 2.0 2.0

100.2.235 2.0 2.0 13.0 2.0 1.5

96 1.8 2.5 16.5 1.3 2.0

96.5.34 2.0 3.0 17.7 1.0 1.0

96.5.55 2.0 2.0 15.0 1.0 1.8

96.5.6 2.0 3.0 14.8 2.0 2.0

PI657620 2.0 2.0 14.5 2.0 2.0

Clav8330 1.5 2.8 13.5 2.0 1.5

PI659392 1.0 2.5 12.0 2.0 1.5

PI659401 1.0 2.0 16.3 2.0 1.5

Clav7010 2.0 3.0 13.5 1.3 1.0

PI401794 1.0 2.0 11.0 1.0 1.0

PI436103 1.0 2.5 13.3 1.0 1.0

PI657356 1.0 2.5 16.5 1.5 2.0

PI657361 1.0 3.0 15.3 1.0 2.0

PI657380 2.0 2.0 16.5 2.0 2.0

PI657606 2.0 2.0 16.8 2.0 2.0

Line ID Leaf Sheath Leaf density (0 Heading date Panicle Shape (1- Attachment of Lower

(1 - Hairless, = thin, 1 = (days from Equilateral, 2 - Whorl of Branches (1 -

2 - Hairy) medium, 2 = planting) Intermediate, 3 - First Node, 2 - Second dense) Unilateral) Node/False Node)

324 1.0 2.0 50.0 1.5 1.0

357 1.0 1.0 50.0 1.0 1.0

423 1.0 1.0 50.0 1.0 1.0

Dancer 1.0 2.0 50.0 1.0 1.0

Leggett 1.0 1.8 57.0 1.0 1.0

Morgan 1.0 0.5 74.0 2.0 1.0

Triactor 1.0 1.3 61.0 1.0 1.0

100 1.0 2.0 75.0 1.3 1.0

100.2.235 1.0 1.0 50.0 1.0 1.0

96 2.0 0.5 75.0 1.5 1.0

96.5.34 1.0 2.0 57.0 1.7 1.0

96.5.55 1.0 2.0 50.0 1.8 1.0

96.5.6 1.0 2.0 53.5 2.0 1.0

PI657620 1.0 2.0 109.0 1.0 1.0

Clav8330 1.0 1.0 90.5 2.0 1.0

PI659392 1.0 1.0 106.0 2.0 1.0

PI659401 1.0 1.0 72.0 2.0 1.0

Clav7010 1.0 0.0 66.0 1.3 2.0

PI401794 1.0 2.0 60.0 2.0 1.0

PI436103 1.0 1.5 62.0 1.0 1.0

PI657356 1.0 1.0 88.3 2.0 1.0

PI657361 1.0 2.0 107.0 3.0 1.0

PI657380 1.0 1.5 98.5 1.0 1.0

PI657606 1.0 1.0 106.0 3.0 2.0

Confused)

324 8.0 92.5 178.8 4.8 2.0

357 5.8 132.5 220.0 4.5 3.0

423 7.8 116.3 197.5 4.8 2.0

Dancer 7.3 107.5 190.0 5.8 1.5

Leggett 4.8 97.5 175.0 5.0 2.5

Morgan 3.3 77.5 234.5 5.5 1.0

Triactor 8.5 80.0 307.5 5.8 1.0

100 8.3 120.0 210.0 5.5 3.0

100.2.235 10.3 125.0 167.5 4.0 2.5

96 6.8 192.5 255.0 4.0 3.0

96.5.34 11.7 120.0 186.7 4.3 1.0

96.5.55 14.0 280.8 203.8 5.0 1.0

96.5.6 11.3 102.5 180.0 4.5 2.0

PI657620 8.5 130.0 155.0 5.0 3.0

Clav8330 10.5 96.3 203.8 4.3 3.0

PI659392 8.0 101.3 200.0 3.8 3.0

PI659401 9.0 118.8 225.0 4.0 3.0

Clav7010 10.0 123.8 227.5 6.3 1.0

PI401794 20.3 107.5 201.3 6.3 2.0

PI436103 11.3 117.5 222.5 6.3 2.0

PI657356 5.8 125.0 227.5 5.5 1.5

PI657361 6.0 128.8 248.8 6.0 1.0

PI657380 7.8 147.5 182.5 4.8 2.0

PI657606 5.5 103.8 220.0 5.3 2.5

Dancer 40.3 1.5 58.8 1.0 2.0

Leggett 24.8 1.0 49.0 1.0 2.0

Morgan 35.8 1.0 58.8 1.0 2.0

Triactor 19.8 2.0 48.8 1.0 2.0

100 23.8 1.0 49.5 1.0 2.0

100.2.235 18.0 1.5 43.0 1.0 2.0

96 19.8 1.0 77.5 1.0 2.0

96.5.34 20.0 1.0 51.7 1.0 2.0

96.5.55 24.3 1.0 53.5 1.0 2.0

96.5.6 19.5 1.0 46.3 1.0 2.0

PI657620 24.0 1.0 62.5 1.0 2.0

Clav8330 11.5 1.0 60.0 1.0 2.0

PI659392 10.8 2.0 68.8 1.0 2.0

PI659401 12.8 2.0 63.8 1.0 2.0

Clav7010 89.8 1.5 56.8 1.0 2.0

PI401794 63.3 1.0 40.0 1.0 2.0

PI436103 79.5 2.0 50.0 1.0 2.0

PI657356 22.3 1.0 51.3 1.0 2.0

PI657361 18.0 1.0 46.0 1.0 2.0

PI657380 20.3 1.0 43.8 1.0 2.0

PI657606 19.5 1.0 48.8 1.0 2.0

Morgan 1.0 1.0 1.0 1.0 0.0

Triactor 1.0 1.0 1.0 1.0 0.0

100 3.0 3.0 4.0 2.0 2.0

100.2.235 1.0 1.0 1.3 1.0 0.0

96 3.0 3.0 3.3 2.0 4.0

96.5.34 1.0 1.0 1.0 1.0 0.0

96.5.55 1.0 1.0 1.0 1.0 0.0

96.5.6 1.0 1.0 1.0 1.0 0.0

PI657620 3.0 3.0 4.0 2.0 3.0

Clav8330 3.0 3.0 4.0 2.0 2/3

PI659392 3.0 3.0 4.0 2.0 3/5

PI659401 3.0 3.0 4.0 2.0 2/3

Clav7010 1.0 1.0 1.0 1.0 0.0

PI401794 1.0 1.0 1.0 1.0 0.0

PI436103 1.0 1.0 1.0 1.0 0.0

PI657356 3.0 3.0 4.0 2.0 2/3

PI657361 3.0 3.0 4.0 2.0 2.0

PI657380 3.0 3.0 4.0 2.0 2.0

PI657606 3.0 3.0 4.0 2.0 2.0

96 3.0 30.0 8.0 39.3 9.8

96.5.34 2.3 13.3 7.0 32.3 9.3

96.5.55 2.5 2.5 7.0 31.3 9.3

96.5.6 2.8 27.5 5.0 33.5 8.0

PI657620 3.0 0.0 7.5 41.0 8.5

Clav8330 3.8 22.5 8.0 37.0 10.0

PI659392 3.0 2.5 8.3 44.5 10.8

PI659401 3.0 25.0 7.3 37.5 9.8

Clav7010 1.0 5.0 4.0 19.0 8.0

PI401794 3.0 0.0 2.5 23.3 7.0

PI436103 1.0 0.0 4.5 17.8 7.8

PI657356 3.0 30.0 10.3 43.3 9.3

PI657361 3.0 67.5 10.8 46.0 8.5

PI657380 3.0 2.5 8.3 42.0 10.8

PI657606 3.5 75.0 8.0 43.8 7.5

96.5.55 1.0 22.3 2.0 1.0 3.0

96.5.6 1.0 22.8 2.0 1.0 2.5

PI657620 1.0 28.0 2/5 2.0 4.0

Clav8330 1.0 26.8 3/5 2.0 4.0

PI659392 1.0 30.5 3.0 2.0 4.0

PI659401 1.0 28.0 2/5 2.0 4.0

Clav7010 1.0 15.5 2/5 1.0 3.8

PI401794 1.0 19.0 1/3 1.0 4.0

PI436103 1/3 13.8 5.0 1.0 4.0

PI657356 1.0 28.3 3.0 1.8 4.0

PI657361 1.0 27.8 3.3 2.0 4.0

PI657380 1.0 29.5 2.0 2.0 4.0

PI657606 1.0 26.3 2.0 1.0 4.0

PI657620 3.0 66.5 5.0 7.5 45.7

Clav8330 3.0 58.5 5.0 10.5 45.8

PI659392 3.0 65.3 5.0 6.3 38.9

PI659401 3.0 61.3 5.0 6.5 30.5

Clav7010 2.0 13.5 1.0 0.0 21.0

PI401794 1.0 23.5 1.0 0.0 8.8

PI436103 3.0 20.3 1.0 0.0 19.3

PI657356 3.0 70.5 5.0 5.0 11.4

PI657361 3.0 70.8 5.0 8.5 12.6

PI657380 3.0 68.3 5.0 5.0 28.0

PI657606 3.0 72.5 5.0 10.5 8.9

Table 4 Seed

(cont.)

Line ID Groat Groat Groat color (0 = light Groat pubescence (0 = Ease of dehulling (0 = length width tan, 1 = brown, 2 = none, 1 = minimal, 2 = easy, 1 = medium, 2 = (mm) (mm) dark brown) medium, 3 = dense) hard)

324 9.3 3.5 1.0 1.0 0.0

357 10.8 3.0 1.0 2.0 0.0

423 11.0 3.3 1.0 1.8 0.0

Dancer 10.5 3.8 1.0 1.0 030

Leggett 10.8 3.3 1.0 1.0 030

Morgan 11.0 3.0 0.0 1.0 030

Triactor 10.5 3.0 0.0 1.0 030

100 12.3 4.0 1.0 2.0 2.0

100.2.235 10.8 3.0 1.0 1.0 0.0

96 12.0 4.0 1.0 2.0 2.0

96.5.34 11.3 4.0 1.0 1.0 1.0

96.5.55 12.5 4.0 1.0 1.0 0.0

96.5.6 11.8 3.8 1.0 1.0 1.0

PI657620 14.5 4.0 5.0 3.0 2.0

Clav8330 10.5 4.3 2.0 3.0 2.0

PI659392 11.8 3.8 1.0 3.0 2.0

PI659401 11.8 4.0 0.0 3.0 2.0 Clav7010 10.0 2.0 0.0 1.0 2.0

PI401794 7.5 2.0 0.0 1.0 0.0

PI436103 9.8 2.0 1.0 1.0 0.0

PI657356 10.5 4.0 0.0 3.0 2.0

PI657361 10.0 4.0 0.0 3.0 2.0

PI657380 11.3 4.0 0.0 3.0 2.0

PI657606 10.3 4.0 0.0 3.0 2.0

Example 2— Tetraploid Oat Line Nutritional Traits

[0057] Nutrition

[0058] Figure 2 is a graph showing the grain content of fats, amino acids, fatty acids as measured in whole grain flour of A. magna ssp domestica line 100.2 and 96.5 compared to Leggett. As can be seen the varieties of the invention are higher in zinc, protein, amino acid, unsaturated and polyunsaturated fatty acids.

[0059] Figure 3 is a graph showing the amino acid content and distribution of line 100.2 and line 96.5 compared to Leggett as measured in whole grain flour. The graph demonstrates that the varieties of the invention are much higher in arginine, glutamic and aspartic acids compared to Leggett, and are in fact, higher in every amino acid.

[0060] Figure 4 is a graph showing the fatty acid content and distribution of line 100.2 and line

96.5 compared to Leggett as measured in whole grain flour. The graph shows that the varieties of the invention are much higher in oleic acid, linoleic, linolenic and palmitic, the unsaturated fatty acids that stearic and myristic where they are lower than Leggett.

[0061] Additional nutritional trait comparisons were made with some A. magna ssp domestica lines (96.5.34, 100.2.235, and 96.5.6) with a hexaploid control. Results are shown in Tables 5-

11.

[0062] From Table 5, one can see that the tetraploid oat lines have more than double the protein content of control hexaploid lines. Table 5— General nutritional composition

[0063] From Table 6 one can see that A. magna ssp domestica lines can have a lower beta glucan content than traditional hexaploid oat varieties.

Table 6— Fiber and beta glucan content

[0064] From Table 7 one can see that A. magna ssp domestica lines can have higher total fatty acid percentage and a lower saturated acid percentage than traditional hexaploid oat varieties. Table 7— Fatty acid content profile

[0065] From Tables 8 and 9, one can see that A. magna ssp domestica lines can have a higher oleic acid content and lower content of saturated fatty acids than traditional hexaploid oat varieties.

Table 8— Fatty acid content profile

Table 9— Fatty acid content profile

[0066] From Table 10 one can see that A. magna ssp domestica lines can have a higher iron, magnesium, and/or zinc content than traditional hexaploid oat varieties.

Table 10— Mineral profile

*not measured

[0067] From Table 1 1 one can see that A. magna ssp domestica lines can have a higher vitamin Bl , B2, B6, niacin, and/or folic acid content than traditional hexaploid oat varieties.

Table 11— Vitamin B profile

*not measured

10068] Digestibility

[0069] Protein digestibility of A. magna ssp domestica was compared to traditional hexaploid oats. Briefly, a group of Sprague-Dawley derived, albino male rats was received from Harlan Laboratories, Inc. The animals were singly housed in suspended stainless steel perforated bottom caging. Litter paper was placed beneath the cages and was changed at least three times per week. The animal room was temperature controlled and had a 12-hour light/dark cycle. During a 2-day acclimation period, they were fed Harlan Teklad Global 16% Protein Rodent Diet® #2016 and filtered tap water was supplied ad libitum throughout the study.

[0070] Following acclimation to the laboratory, 16 male rats were selected for test on the basis of good health and body weight (58.9-71.7 grams). Four rats were assigned to each group as provided in Table 12.

Table 12

[0071] The test diets and the positive control (casein) diet were formulated to contain 10% protein (N x 6.25) and levels of vitamins, minerals and calories to satisfy the requirements of the rats. The endogenous control (protein free) diet was formulated to contain the same levels of all nutrients except protein (e.g., protein was replaced with cornstarch). Each rat was provided with 15 grams per day of their respective diets for a total of 9 days.

[0072] Body weights were recorded at test initiation and at the start (Day 5) and end (Day 9) of the fecal collection period. Diet consumption was measured daily. Feces were collected daily at 24-hour intervals for the last five days of the study. At the end of the 5-day collection period, the feces of each animal were composited, dried and analyzed for nitrogen content.

[0073] True Digestibility was calculated as follows:

TD = I - (F - Fk) x 100

I [0074] TD = true digestibility; I = intake of dietary nitrogen (g) for test or casein control groups;

F = fecal nitrogen (g) from the test or casein control groups; Fk = metabolic (endogenous) fecal nitrogen from the protein free group. Fk is calculated as follows:

Fk = fecal nitrogen of protein free group (g) x I from Test Group

I from Protein Free Group

[0075] Protein Digestibility Corrected Amino Acid Score (PDCAAS) was calculated as follows: PDCAAS = (Amino Acid Score) x (True Protein Digestibility)

[0076] The amino acid score was determined in accordance with FAO Guidelines for Protein Quality Evaluation, 1990.

[0077] Amino Acid Analysis was conducted using Ion-exchange chromatography.

[0078] Tables 13-15 show the results of the digestibility study.

Table 13

In keeping with published recommendations the PDCAAS value for Casein is truncated to 100% Table 14

Consumption during the 5 day fecal collection period

(Average Diet Consumption x Measured Protein Concentration)/! 00

Average Protein Consumption/6.25

Table 15

Example 3— Tetraploid Oat Line Genetics

[0079] Genotypic relationship of tetraploid oat lines to A. sativa varieties and wild type A.

magna, A. moroccana, A. murphyii, and A. strigosa accessions was compared based on allele sharing and hierarchical clustering using the following materials and methods.

[0080] Genotyping. DNA from leaf tissue was extracted using the Qiagen DNeasy 96 Plant Kit (Qiagen, Hilden) and quantified using PicoGreen (LifeTechnologies, Carlsbad). After DNA

quantification and normalization to 20 ng^L, samples were prepared for sequencing using a modified double-restriction enzyme digestion protocol (Poland et ai, 2012, PLoS ONE, 7.2:e32253). In brief, total genomic DNA (100 ng) was digested with 5U of Pstl-HF and Mspl endonucleases (New England Biolabs, Ipswich) in a 1 Ox NEB CutSmart buffer (IX final concentration). Thermocycler conditions for digestion were 34° C for 120 minutes followed by 65° C for 20 minutes. The restricted DNA was then ligated to forward adapters designed with a Pstl overhang (M = 0.00333μΜ) and reverse Y-adapters (M = 0.5μΜ) with an Mspl overhang. The forward adapters contained in-line barcode sequences which enable sample deconvolution after sequencing. Ligation was performed at 19° C for 120 minutes followed by 65° C for 20 minutes using a buffer containing 100 cohesive end units of T4 DNA ligase (New England Biolabs, Ipswich) and 10X NEB T4 Ligase Buffer (IX final). Following ligation, samples were pooled and PCR-amplified at 95° C for 30 seconds; 16 cycles of 95° C for 30 seconds, 62° C for 20 seconds, 68° C for 1 minute 30 seconds; and a final extension step at 72° C for 5 minutes. The libraries were cleaned up using the QlAquick PCR Purification Kit (QIAGEN, Venlo) and verified using the Experion IK DNA chip (BioRad, Hercules).

[0081] The library was pooled with additional sample libraries (n = 192) and sequenced using one Illumina HiSeq2500 lane at the David H. Murdock Research Institute in Kannapolis, North Carolina. The UNEAK pipeline (Lu et al., 2013, PLoS Genet, 9:el00315) of the TASSEL 3.0 standalone software package (Bradbury et al., 2007, Bioinformatics, 23:2633-5) was used to analyze the FASTQ sequencing data and call sequence variants. The UNEAK pipeline does not require a reference genome and calls genotypes from alignment of sequence tag pairs. Parameters include a minimum sequence count of 5, the default error tolerance rate of 0.03, a minimum minor allele frequency of 0.02, a default maximum minor allele frequency of 0.5, and no limitation on the number of individuals covered by a sequence tag.

[0082] Although there is no reference genome for oat, there is an oat consensus map of hexaploid oat using EST-based and genomic-based markers (Oliver et al., 2013, PLoS ONE, 8(3):e58068; Huang et al. , 2014, PloS ONE, 9(7):el 02448; and Tinker et al , 2014, The Plant Genome, 7:3). To obtain physical positions of sequence tags called by the UNEAK pipeline, the FASTA sequences of mapped markers were indexed using Bowtie v 1.1.1 (Langmead et al. , 2009, Genome Biol, 10(3):R25). The FASTA sequence of the UNEAK tag pairs was aligned to mapped markers allowing for 2 mismatches in the local alignment. 3.07% of tag sequences aligned to previously mapped markers, representing 6,096 alignments. The positions of these tags were merged with the genotype call file (HapMap) output from the UNEAK pipeline. Genotypes were re-coded using custom scripts (homozygous allele 1 = 0;

homozygous allele 2 = 2; heterozygous =1 ).

[0083] Statistical Analyses. A single genotype matrix was developed for each of the oat species {Avena sativa = common hexaploid; A. magna, A. maroccana, and A. murphyii = tetraploid, and A. strigosa = diploid oat). Marker properties for each individual genotype matrix were evaluated for minor allele frequency (MAF) and proportion of missing genotypes. Markers with a MAP < 0.01 and > 30% missing genotypes were removed. The cleaned data matrices were then used to evaluate genetic relationships between lines within a species. A kinship analyses was used to build an allele sharing covariate matrix. The overall matrix was then clustered using Ward's minimum variance method (Ward, 1963, J Am Stat Assoc, 55:236-44) to visualized the genetic relationships.

[0084] To evaluate the relationship between common oat (A. sativa) and tetraploid oat {A. magna and A. maroccana), a combined genotypic matrix was developed using shared markers from each of the species- specific cleaned genotype matrices. The combined matrix contained 10,776 loci that were shared between species. Of the remaining loci, 20,654 loci were unique to A. sativa and 1 ,382 were unique to A. magna. Table 16 provides 15 markers, each with 2 alleles, that were found in A. magna, including each of the tetraploid oat lines in Figure 5, but not in A. sativa.

Table 16

(SEQ ID NO: 13) (SEQ ID NO: 14)

TGCAGCCATGCCCGCCGCGAA TGCAGCCATGCCCGCCGCGAA TGCAAACGGGAATCACAGATT TGCAAACGGGAATCACAGATT CCAATCAACAAACCAGAGAAA CCAATCAACAAACCAGAGCAA

TP15998 T (SEQ ID NO: 15) T (SEQ ID NO: 16)

TGCAGAAGCACCGCAGCAAGC TGCAGAAGCACCGCAGCAAGC AAGCTTCGCTAATGCTTACGCT AAGCTTCGCTAATGCTTACGGT CGGATCGGATGAGGCCAAGCA CGGATCGGATGAGGCCAAGCA

TP1797 (SEQ ID NO: 17) (SEQ ID NO: 18)

TGCAGGACCTCGACCTCAGCG TGCAGGACCTCGACCTCGGCG CCAACTACCTCTACGGCGCCGT CCAACTACCTCTACGGCGCCGT CCCGAGATCGGAAGAGCGGTT CCCGAGATCGGAAGAGCGGTT

TP28663 (SEQ ID NO: 19) (SEQ ID NO: 20)

TGCAGACACAAAGGCATGGGT TGCAGACACAAAGGCATGGGT ACGACGAGCCCCGACAGCAAC ACGACGAGCCTCGACAGCAAC CGCACGTCCGCATGGAGGGTA CGCACGTCCGCATGGAGGGTA

TP3032 C (SEQ ID NO: 21 ) C (SEQ ID NO: 22)

TGCAGTTAGGTAGCACAGCTA TGCAGTTAGGTAGCACAGCTA GCTGTTCTTATTTTGCCCAACA GCTGTTCTTATTTTGCCCAACA CTTTTTTCTATTGGCCGAGAT TTTTTTTCTATTGGCCGAGAT

TP44513 (SEQ ID NO: 23) (SEQ ID NO: 24)

TGCAGTTTTGGAGAATATTTCA TGCAGTTTTGGAGAATATTTCA GTTTTCAAAACCACAGTATTTA GTTTTCAAAACCACAGTATTTA TTGCATACAAATACCTCAAA TTGCATCCAAATACCTCAAA

TP46645 (SEQ ID NO: 25) (SEQ ID NO: 26)

TGCAGCACCAGCAGCACCACC TGCAGCACCAGCAGCACCACC AGCTGGACGAGACGCAGCAGA AGCTGGACGAGACGCAGCAGA GCTGGCTGCTCGGCCCGCCGA GCTGGCTGCTGGGCCCGCCGA

TP11161 G (SEQ ID NO: 27) G (SEQ ID NO: 28)

TGCAGAAGGACAGGCTACGTG TGCAGAAGGACAGGCTACGTG ACTTAACAAACAAGGGATGCA GCTTAACAAACAAGGGATGCA ACTTGTTACCTTGATTGAACTT ACTTGTTACCTTGATTGAACTT

TP1999 (SEQ ID NO: 29) (SEQ ID NO: 30) [0085] A kinship analyses based on allele sharing and hierarchical clustering using the Ward's minimum variance method were used to evaluate the overall genetic relationships between and within both species as preciously described.

[0086] Results. Figure 5 shows the results of genetic marker Global variance based on over 12,000 different loci. From the figure, you can see that there is variation that is specific to A. magna ssp domestica lines, Avena maroccana lines as well as Avena sativa (common oat hexaploid) and Avena murphyi (tetraploid), and Avena strigosa (dipolid) which can differentiate between the different species and varieties.

[0087] Tetraploid oat lines 100, 100.2.235, 96, 96.5.34, 96.5.6, and 96.5.55 have greater than 60% allele sharing similarity with each other and with each of the tested wild A. magna accessions. The similarity between each line and the wild A. magna accessions was similar to the similarity between each of the wild A. magna accessions. In addition, tetraploid oat accessions of A. maroccana and A. murphyii species had greater than 50% allele sharing similarity to tetraploid oat lines 100.2.235, 96, 96.5.34, 96.5.6, and 96.5.55. In contrast, the traditional hexaploid oat varieties and the hexaploid A. sterilis accession had less than 50% allele sharing similarity to the tetraploid oat lines. Diploid A. strigosa accessions had less than 10% allele sharing similarity to any of the tetraploid oat lines.

DEPOSIT STATEMENT

[0088] A deposit of seed of oat varieties 96.5.6, 96.5.34, and 100.2.235 disclosed herein, is and has been maintained by Applicant General Mills (One General Mills Blvd, Minneapolis, MN 55426) since prior to the filing date of this application. A deposit of at least 2500 seeds of each variety or line has also been submitted under the Budapest Treaty to the American Type Culture Collection (ATCC), Rockville, Maryland, 20852. Certificates of Deposit were granted on October 12, 2015, for oat variety 96.5.6 as ATCC designation PTA-122534, oat variety 96.5.34 as ATCC designation PTA-122532, and oat variety 100.2.235 as ATCC designation PTA- 122533. Applicant will meet all the requirements of 37 C.F.R. §§1.801 - 1.809 and the Budapest Treaty.