Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
HIGHLY SIALYLATED AUTOANTIBODIES AND USES THEREOF
Document Type and Number:
WIPO Patent Application WO/2019/202153
Kind Code:
A1
Abstract:
The present invention relates to a G-isotype antibody directed against native myelin oligodendrocyte glycoprotein (MOG), comprising: - an Fc fragment having a high level of sialylation, and - a Fab fragment capable of binding to the autoantigen. It also relates to a composition containing such an antibody, and to therapeutic uses thereof.

Inventors:
MONNET, Céline (206 avenue Sainte Cécile, LAMBERSART, 59130, FR)
MARS, Leonardus (206 Avenue Sainte-Cécile, LAMBERSART, 59130, FR)
Application Number:
EP2019/060240
Publication Date:
October 24, 2019
Filing Date:
April 19, 2019
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
LABORATOIRE FRANÇAIS DU FRACTIONNEMENT ET DES BIOTECHNOLOGIES (3 avenue des Tropiques ZA de Courtaboeuf, LES ULIS, LES ULIS, 91940, FR)
INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE (INSERM) (101 Rue de Tolbiac, PARIS, PARIS, 75013, FR)
UNIVERSITÉ DE LILLE (42 Rue Paul Duez, LILLE, 59800, FR)
International Classes:
C07K16/28; A61P25/00
Domestic Patent References:
WO1995007096A11995-03-16
WO2016016586A12016-02-04
WO2011149999A22011-12-01
WO2010109010A12010-09-30
WO2012113863A12012-08-30
Foreign References:
US5591669A1997-01-07
US5598369A1997-01-28
US5545806A1996-08-13
US5545807A1996-08-13
US6150584A2000-11-21
Other References:
F. MIMOTO ET AL: "Engineered antibody Fc variant with selectively enhanced FcyRIIb binding over both FcyRIIaR131 and FcyRIIaH131", PROTEIN ENGINEERING DESIGN AND SELECTION, vol. 26, no. 10, 5 June 2013 (2013-06-05), pages 589 - 598, XP055087986, ISSN: 1741-0126, DOI: 10.1093/protein/gzt022
YUYA ISODA ET AL: "Importance of the Side Chain at Position 296 of Antibody Fc in Interactions with Fc[gamma]RIIIa and Other Fc[gamma] Receptors", PLOS ONE, vol. 10, no. 10, 7 October 2015 (2015-10-07), pages e0140120, XP055516183, DOI: 10.1371/journal.pone.0140120
KABAT: "Sequences of Proteins of Immunological Interest", 1991, PUBLIC HEALTH SERVICE, NATIONAL INSTITUTES OF HEALTH
ZAUNER ET AL.: "Molecular & Cellular Proteomics", vol. 12.4, 2013, AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY
SMITH; WATERMAN, J. MOL EVOL., vol. 18, 1981, pages 38 - 46
PEARSON; LIPMAN, PNAS, vol. 85, 1988, pages 2444 - 2448
VERHOEYN ET AL., BIOESSAYS, vol. 8, 1988, pages 74
JONES ET AL., NATURE, vol. 321, 1986, pages 522 - 525
RIECHMANN ET AL., NATURE, vol. 332, 1988, pages 323 - 327
ALMAGRO ET AL., FRONTIERS IN BIOSCIENCE, vol. 1, no. 3, 1 January 2008 (2008-01-01), pages 1619 - 1633
JAKOBOVITS ET AL., PROC. NATL. ACAD. SCI. USA., vol. 90, 1993, pages 2551
JAKOBOVITS ET AL., NATURE, vol. 362, 1993, pages 255 - 258
BRUGGERMANN ET AL., YEAR IN IMMUNO, vol. 7, 1993, pages 33
DUCHOSAL ET AL., NATURE, vol. 355, 1992, pages 258
HOOGENBOOM ET AL., J. MOL. BIOL, vol. 227, 1991, pages 381
MARKS ET AL., J. MOL. BIOL, vol. 222, 1991
VAUGHAN ET AL., NATURE BIOTECH, vol. 14, 1996, pages 309
BREITHAUPT ET AL., PNAS, vol. 1 00, no. 16, 5 August 2003 (2003-08-05)
NIXON ET AL.: "Drugs derived from phage display, From candidate identification to practice", MABS, vol. 6, no. 1, January 2014 (2014-01-01), pages 73 - 85
VARKI ET AL.: "Essentials of Glycobiology", 2009
MUTA T ET AL., NATURE, vol. 368, 1994, pages 70 - 73
YOUNG L; DONG Q, NUCLEIC ACIDS RES., vol. 32, no. 7, 15 April 2004 (2004-04-15)
HOOVER, D.M.; LUBKOWSKI, J., NUCLEIC ACIDS RES., 2002, pages 30
VILLALOBOS A ET AL., BMC BIOINFORMATICS, vol. 7, 6 June 2006 (2006-06-06), pages 285
"Molecular cloning : a laboratory manual", 2001
"Current Protocols in Molecular Biology", 2007
ZOLLER; SMITH, NUCL. ACIDS RES., vol. 10, 1982, pages 6487 - 6500
KUNKEL, NATL. ACAD. SCI USA, vol. 82, 1985, pages 488
CARTON JM ET AL., PROTEIN EXPR PURIF, 2007
CHECHETKIN, J. OF THEORETICAL BIOLOGY, vol. 242, 2006, pages 922 - 934
RAMADAN A; LUCCA LE; CARRIE N; DESBOIS S; AXISA PP; HAYDER M; BAUER J; LIBLAU RS; MARS LT: "In situ expansion of T cells that recognize distinct self-antigens sustains autoimmunity in the CNS", BRAIN, vol. 139, 2016, pages 1433 - 1446
BREITHAUPT C; SCHAFER B; PELLKOFER H; HUBER R; LININGTON C; JACOB U: "Demyelinating myelin oligodendrocyte glycoprotein-specific autoantibody response is focused on one dominant conformational epitope region in rodents", J IMMUNOL, vol. 181, 2008, pages 1255 - 1263
FIEBIGER BM; MAAMARY J; PINCETIC A; RAVETCH JV: "Protection in antibody- and T cell-mediated autoimmune diseases by antiinflammatory IgG Fcs requires type Il FcRs", PROC NATL ACAD SCI USA, vol. 112, 2015, pages E2385 - E2394, XP055262322, DOI: doi:10.1073/pnas.1505292112
SMITH GP, SCIENCE, vol. 228, 1985, pages 1315
Attorney, Agent or Firm:
BLOT, Philippe et al. (Lavoix, 2 place d'Estienne d'Orves, PARIS CEDEX 09, 75441, FR)
Download PDF:
Claims:
REVENDICATIONS

1. Anticorps d’isotype G dirigé contre la glycoprotéine oligodendrocytaire de la myéline (MOG) native, comprenant :

- un fragment Fc présentant une haute sialylation, et

- un fragment Fab capable de se lier à l’autoantigène.

2. Anticorps selon la revendication 1 , dans lequel le fragment Fc est modifié par rapport à celui d’un anticorps parent, et comprend au moins une mutation d’acide aminé choisi parmi les acides aminés en position 240 à 243, 258 à 267 et 290 à 305 dudit fragment Fc, la numérotation étant celle de l’index EU ou équivalent dans Kabat.

3. Anticorps selon la revendication 2, dans lequel la mutation est choisie parmi V262del,

V263F, V263K, V263W, V264K, V264P, D265A, D265E, D265G, D265L, D265S, D265V, V266A, V266P, V266S, V266T, S267N, S267P, S267R, S267W, P291 C, P291 V, P291Y, P291W, R292A, R292del, R292T, R292V, R292Y, E293del, E293F, E293P, E293W, E293Y, E294del, E294D, E294N, E294W, E294F, E293del/E294del, Q295D, Q295del,

Q295F, Q295G, Q295K, Q295N, Q295R, Q295W, Y296A, Y296C, Y296del, Y296E,

Y296G, Y296Q, Y296R, Y296V, S298del, S298E, S298F, S298G, S298L, S298M,

S298N, S298P, S298R, S298T, S298W, S298Y, Y300D, Y300del, Y300G, Y300N,

Y300P, Y300R, Y300S, R301 A, R301 F, R301 G, R301 H, R301 I, R301 K, R301 Q, R301 V, R301W, R301 Y, V302del, V302A, V302F, V302G, V302P, V303A, V303C, V303P, V303L, V303S, V303Y, S304C, S304M, S304Q, S304T, V305F et V305L, la numérotation étant celle de l’index EU ou équivalent dans Kabat.

4. Anticorps selon l’une des revendications 1 à 3, dans lequel le fragment Fc est modifié par rapport à celui d’un anticorps parent et comprend au moins la mutation E294del, la numérotation étant celle de l’index EU ou équivalent dans Kabat.

5. Anticorps selon l’une des revendications 1 à 4, caractérisé en ce qu’il est dirigé contre MOG native et comprend les 6 CDRs suivants :

H-CDR1 : SEQ ID NO:1 1 ,

H-CDR2: SEQ ID NO:12,

H-CDR3: SEQ ID NO:13,

L-CDR1 : SEQ ID NO:14,

L-CDR2: GAS, et

6. Anticorps selon l’une des revendications 1 à 5, qui est choisi parmi les lgG1 , lgG2, lgG3 et lgG4 humaine, de préférence est une lgG1 .

7. Anticorps selon l’une des revendications 1 à 6, qui est chimérique, humanisé ou humain.

8. Anticorps selon l’une des revendications 1 à 6, qui comprend comme chaîne lourde la séquence SEQ ID NO :24, avec la délétion de l’acide glutamique en position 294 en numérotation de l’index EU ou équivalent dans Kabat, et comme chaîne légère la séquence SEQ ID NO :25.

9. Composition comprenant, dans un milieu physiologiquement acceptable, des anticorps monoclonaux selon l’une des revendications 1 à 8.

10. Anticorps selon l’une des revendications 1 à 8, ou composition selon la revendication 9, pour son utilisation comme médicament.

1 1. Anticorps selon l’une des revendications 1 à 8, ou composition selon la revendication 9, pour son utilisation pour prévenir et/ou traiter une maladie auto-immune.

12. Anticorps selon l’une des revendications 1 à 8, ou composition selon la revendication 9, pour son utilisation pour prévenir et/ou traiter une maladie démyélinisante impliquant des anticorps anti-MOG, de préférence choisie parmi l'encéphalomyélite disséminée aiguë, la neuromyélite optique de Dévie et la sclérose en plaques.

Description:
Autoanticorps hautement sialylés et leurs utilisations

La présente invention concerne un anticorps d’isotype G dirigé contre un autoantigène, de préférence contre la glycoprotéine oligodendrocytaire de la myéline (MOG) native, comprenant :

- un fragment Fc présentant une haute sialylation, et

- un fragment Fab capable de se lier à l’autoantigène.

Elle se rapporte également à une composition contenant un tel anticorps, et à ses utilisations en thérapie, notamment dans la prévention et/ou le traitement de la sclérose en plaques.

Les maladies auto-immunes surviennent lorsque la réponse immunitaire cible par erreur les constituants naturels des tissus et des organes. La réponse inflammatoire qui s'ensuit interfère avec la fonction naturelle des organes en causant de graves lésions tissulaires, ce qui entraîne les manifestations liées à la maladie. L'activation des lymphocytes T et B est commune à toutes les maladies auto-immunes, et conduit à des réponses inflammatoires cellulaires et humorales délétères. Du fait de la présence des récepteurs des lymphocytes T et des lymphocytes B, ces réponses sont spécifiques de l'antigène, ce qui, dans le cas de l'auto-immunité, impose une agression ciblée sur les autoantigènes dérivés de tissus. En effet, les anticorps et les lymphocytes T isolés des lésions réagissent facilement aux autoantigènes présents dans le tissu enflammé.

Le traitement des maladies auto-immunes spécifiques à un organe repose actuellement sur des approches palliatives qui visent à dépléter les cellules immunitaires, bloquer leur migration vers les lésions tissulaires, neutraliser les cytokines effectrices, ou encore sur l’administration d’immunoglobulines intraveineuses (IVIG). Cependant, même si ces traitements sont efficaces, le cours naturel de la maladie se rétablit une fois le traitement terminé.

Les futures thérapies visant à guérir les maladies inflammatoires à médiation immunitaire doivent augmenter leur efficacité pour persister au-delà de la durée du traitement. Dans le cas des maladies auto-immunes spécifiques à un organe, cela implique de rééduquer le système immunitaire pour restaurer une tolérance immunitaire.

Parmi les maladies auto-immunes spécifiques à un organe, figure la sclérose en plaques (SEP). La SEP est une maladie du système nerveux central (SNC). Le SNC est constitué du cerveau et de la moelle épinière. Au niveau microscopique, le système nerveux central est majoritairement composé d’astrocytes, d’oligodendrocytes responsables de la myélinisation, et des neurones, dont chacun est constitué par un corps cellulaire et par un prolongement (axone), entouré d’une gaine de myéline.

Cette gaine de myéline sert à isoler et à protéger les fibres nerveuses, et joue aussi un rôle dans la vitesse de propagation de l’influx nerveux transportant l’information le long des neurones.

La SEP est caractérisée par des lésions focales dans la substance blanche tant au niveau du cerveau qu’au niveau de la moelle épinière. Les marqueurs pathologiques de la maladie incluent la démyélinisation, l’apoptose des oligodendrocytes, des cicatrices d’axones et enfin une perte neuronale. Ce dommage tissulaire est causé par l’inflammation, comme montré par l’infiltration des lymphocytes et des cellules myéloïdes dans les lésions. Cette physiopathologie entraîne une difficulté de conduction de l’influx nerveux au sein des axones, ce qui provoque des perturbations motrices, sensitives et cognitives. A plus ou moins long terme, ces troubles peuvent progresser vers un handicap irréversible.

De façon la plus fréquente, la SEP débute par une phase de récurrence-rémission, durant laquelle des périodes de déficits cliniques actifs sont suivies par des périodes prolongées de rémission. Au sein des lésions, l’inflammation disparaît et des mécanismes de réparation (la remyélinisation) permettent au patient de retrouver une conduction nerveuse correcte. Mais malheureusement, dans certaines formes évoluées de SEP ou lors d’attaques inflammatoires sévères, les mécanismes de remyélinisation sont dépassés, et des troubles de conduction de l’influx nerveux irréversibles s’installent avec des signes neurologiques correspondants. Cliniquement, ces patients évoluent vers une évolution progressive secondaire caractérisée par une progression graduelle.

La SEP est considérée comme étant une maladie auto-immune. Dans la SEP, le système immunitaire attaque des cibles antigéniques du SNC, notamment la myéline. Tous les composants de la réponse immunitaire participent: les lymphocytes, les cellules myéloïdes, mais aussi des cytokines synthétisées et libérées par les cellules immunitaires qui, tantôt favorisent l’attaque, tantôt la modèrent. La réponse immunitaire dans la SEP n’est pas statique, elle est composite et évolue avec le temps, aussi bien au niveau de la spécificité antigénique que dans les mécanismes pathogènes. Les traitements de fond de la SEP utilisés aujourd’hui agissent soit directement sur les lymphocytes, soit par leur déplétion, soit en inhibant leur migration vers le SNC, pour limiter l’importance de l’attaque inflammatoire.

Cependant, si les traitements actuels permettent de réduire les poussées et améliorent la qualité de vie des patients, ils ont une efficacité insuffisante pour lutter contre la progression de la maladie.

Il existe donc un besoin pour un traitement efficace de la SEP, qui soit notamment capable de freiner et/ou diminuer la progression de la maladie.

Plus généralement, il existe un besoin pour un traitement efficace des maladies auto immunes, et notamment des maladies auto-immunes spécifiques à un organe.

La présente invention répond à ce problème.

Elle se rapporte à un anticorps d’isotype G dirigé contre un autoantigène, comprenant :

- un fragment Fc présentant une haute sialylation, et

- un fragment Fab capable de se lier à l’autoantigène.

Plus préférentiellement, elle se rapporte à un anticorps d’isotype G dirigé contre la glycoprotéine oligodendrocytaire de la myéline (MOG) native, comprenant :

- un fragment Fc présentant une haute sialylation, et

- un fragment Fab capable de se lier à MOG native.

En effet, comme démontré en exemples, les inventeurs ont identifié un anticorps IgG anti- MOG spécifique capable de freiner et/ou diminuer la progression de la maladie. Cet anticorps est dérivé du clone pathogène 8-18C5 (disponible commercialement sous la référence MAB5680 par Merck Millipore) ; il est capable de se lier à la protéine MOG humaine native ou murine native, mais pas au fragment linéaire MOG 35.55 .

En outre, cet anticorps a été modifié par rapport au clone pathogène 8-18C5, notamment car il comprend un fragment Fc hautement sialylé. Plus précisément, son Fc comprend une délétion ponctuelle de l’acide glutamique en position 294 (la numérotation étant celle de l’index EU ou équivalent dans Kabat), ce qui lui confère une sialylation augmentée par rapport au Fc qui ne présente pas cette délétion.

Cette délétion confère notamment au variant des affinités de liaison à FcyRIII et FcyRIIB réduites, alors que la liaison à FcRn n'est pas affectée ; et des propriétés anti- inflammatoires. Cet anticorps atténue la gravité de la maladie dans un modèle murin d'encéphalomyélite auto-immune expérimentale (EAE).

Les définitions utilisées dans la présente demande sont les suivantes :

Par « fragment Fc » ou « région Fc », on entend la région constante d'une immunoglobuline (anticorps) de longueur totale à l'exclusion du premier domaine de région constante d'immunoglobuline (i.e. CH1 -CL). Ainsi le fragment Fc fait référence à un homodimère, chaque monomère comprenant les deux derniers domaines constants des IgG (i.e. CH2 et CH3), et la région charnière flexible N-terminale de ces domaines. Le fragment Fc de l’anticorps selon l’invention est de préférence un fragment Fc humain et peut être choisi parmi les fragments Fc d’IgGI , d’lgG2, d’lgG3 et d’lgG4. De préférence, on utilise dans la présente invention un fragment Fc d’une lgG1 , qui se compose de la charnière flexible N-terminale et des domaines CH2-CH3, c’est-à-dire la portion à partir de l’acide aminé C226 jusqu’à l'extrémité C-terminale, la numérotation étant indiquée selon l’index EU ou équivalent dans Kabat. De préférence, on utilise un fragment Fc d’une lgG1 humaine (i.e. acides aminés 226 à 447 selon l’index EU ou équivalent dans Kabat). Dans ce cas, la charnière inférieure se réfère aux positions 226 à 230, le domaine CH2 fait référence aux positions 231 à 340 et le domaine CH3 se réfère aux positions 341 -447 selon l'index EU ou équivalent dans Kabat. Le fragment Fc utilisé selon l’invention peut comprendre en outre une partie de la région charnière supérieure, en amont de la position 226. Dans ce cas, de préférence, on utilise un fragment Fc d’une lgG1 humaine comprenant une partie de la région située entre les positions 216 à 226 (selon l’indice EU). Dans ce cas, le fragment Fc d’une lgG1 humaine fait référence à la portion à partir de l’acide aminé 216, 217, 218, 219, 220, 221 , 222, 223, 224 ou 225 jusqu’à l’extrémité C- terminale.

De préférence, le fragment Fc de l’anticorps selon l’invention est le fragment Fc d’une lgG1.

Le fragment Fc de l’anticorps selon l’invention est de préférence humain.

Dans la présente demande, la numérotation des résidus du fragment Fc est celle de l'index EU ou équivalent dans Kabat (Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991 )). Cette numérotation convient uniquement pour les fragments Fc humains.

L’équivalent de cette numérotation pour des fragments Fc murins (i.e. de souris ou de rat) est décrit dans Zauner et al, Molecular & Cellular Proteomics 12.4, 2013, by the American Society for Biochemistry and Molecular Biology. Cet article décrit notamment en figure 2 les différences de glycosylation entre les Fc humain et murin.

Par « mutation d'acide aminé », on entend ici un changement dans la séquence d'acides aminés d'un polypeptide. Une mutation est choisie notamment parmi une substitution, une insertion et une délétion.

Par «substitution», on entend le remplacement d'un ou plusieurs acides aminés, à une position particulière dans une séquence de polypeptide parent, par le même nombre d’autres acides aminés. De préférence, la substitution est ponctuelle, i.e. elle ne concerne qu’un seul acide aminé. Par exemple, la substitution N434S se réfère à un variant d’un polypeptide parent, dans lequel l'asparagine en position 434 du fragment Fc selon l’index EU ou équivalent dans Kabat est remplacé par la sérine.

Par « insertion », on entend l'addition d'au moins un acide aminé à une position particulière dans une séquence de polypeptide parent. Par exemple, l’insertion G>235- 236 désigne une insertion de glycine entre les positions 235 et 236.

Par « délétion », on entend l'élimination d'au moins un acide aminé à une position particulière dans une séquence de polypeptide parent. Par exemple, E294del désigne la suppression de l'acide glutamique en position 294.

Par «polypeptide parent» et « anticorps parent », on entend respectivement un polypeptide ou un anticorps non modifié qui est ensuite modifié pour générer un variant. Ledit polypeptide ou anticorps parent peut être d'origine naturelle, un variant d'un polypeptide ou anticorps d'origine naturelle, une version modifiée d'un polypeptide ou anticorps naturel ou un polypeptide ou anticorps synthétique. De préférence, le polypeptide ou anticorps parent comprend un fragment Fc choisi parmi les fragments Fc de type sauvage, leurs fragments et leurs mutants. Par conséquent, le polypeptide ou anticorps parent peut éventuellement comprendre des modifications pré-existantes d’acides aminés dans le fragment Fc par rapport aux fragments Fc de type sauvage. Ainsi de préférence, le fragment Fc du polypeptide ou anticorps parent comprend déjà au moins une mutation additionnelle (i.e. modification pré-existante), de préférence choisie parmi P230S, T256N, V259I, N315D, A330V, N361 D, A378V, S383N, M428L, N434Y.

De préférence, le fragment Fc du polypeptide ou anticorps parent est choisi parmi les séquences SEQ ID NO : 1 , 2, 3, 4 et 5. De préférence, le fragment Fc du polypeptide ou anticorps parent a pour séquence SEQ ID NO : 1 .

Les séquences représentées en SEQ ID NO : 1 , 2, 3, 4 et 5 sont exemptes de région charnière en N-terminal. Les séquences représentées en SEQ ID NO : 6, 7, 8, 9 et 10 correspondent respectivement aux séquences représentées en SEQ ID NO : 1 , 2, 3, 4 et 5 avec leurs régions charnières en N-terminal. Aussi, dans un mode de réalisation particulier, le fragment Fc du polypeptide ou anticorps parent est choisi parmi les séquences SEQ ID NO : 6, 7, 8, 9 et 10.

De préférence, le fragment Fc du polypeptide ou anticorps parent a une séquence correspondant aux positions 1 -232, 2-232, 3-232, 4-232, 5-232, 6-232, 7-232, 8-232, 9- 232, 10-232 ou 1 1 -232 de la séquence SEQ ID NO : 6.

Par «variant», on entend une séquence polypeptidique qui est différente de la séquence du polypeptide parent par au moins une modification d'acide aminé.

De préférence, la séquence du variant a au moins 80% d'identité avec la séquence du polypeptide parent, et plus préférentiellement au moins 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% ou 99,5% d'identité.

Dans toute la présente demande, par "pourcentage d'identité" entre deux séquences d'acides aminés au sens de la présente invention, on entend désigner un pourcentage de résidus d'acides aminés identiques entre les deux séquences à comparer, obtenu après le meilleur alignement, ce pourcentage étant purement statistique et les différences entre les deux séquences étant réparties au hasard et sur toute leur longueur. Par "meilleur alignement" ou "alignement optimal", on entend l'alignement pour lequel le pourcentage d'identité déterminé comme ci-après est le plus élevé. Les comparaisons de séquences entre deux séquences d'acides aminés sont traditionnellement réalisées en comparant ces séquences après les avoir alignées de manière optimale, ladite comparaison étant réalisée par segment ou par « fenêtre de comparaison » pour identifier et comparer les régions locales de similarité de séquence. L'alignement optimal des séquences pour la comparaison peut être réalisé, outre manuellement, au moyen de l'algorithme d'homologie locale de Smith et Waterman (1981 , J. Mol Evol., 18:38-46), au moyen de l'algorithme d'homologie locale de Neddleman et Wunsch (1970), au moyen de la méthode de recherche de similarité de Pearson et Lipman (1988, PNAS, 85: 2444-2448), au moyen de logiciels informatiques utilisant ces algorithmes (GAP, BESTFIT, BLAST P, BLAST N, FASTA et TFASTA dans le Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wl).

Plus préférentiellement, l’anticorps selon l’invention est choisi parmi les lgG1 , lgG2, lgG3 et lgG4, de préférence est une lgG1. L’anticorps selon l’invention peut être chimérique, humanisé ou humain.

Par anticorps « chimérique », on entend désigner un anticorps qui contient une région variable (chaîne légère et chaîne lourde) naturelle dérivée d'un anticorps d'une espèce donnée en association avec les régions constantes de chaîne légère et chaîne lourde d'un anticorps d'une espèce hétérologue à ladite espèce donnée. Avantageusement, si l’anticorps est chimérique, celui-ci comprend des régions constantes humaines. Partant d'un anticorps non humain (notamment murin), un anticorps chimérique peut être préparé en utilisant les techniques de recombinaison génétique bien connues de l'homme du métier. Par exemple, l'anticorps chimérique pourra être réalisé en clonant pour la chaîne lourde et la chaîne légère un ADN recombinant comportant un promoteur et une séquence codant pour la région variable de l'anticorps non humain, et une séquence codant pour la région constante d'un anticorps humain. Pour les méthodes de préparation d'anticorps chimériques, on pourra par exemple se référer au document Verhoeyn et al (Verhoeyn et al. BioEssays, 8 : 74, 1988).

Par anticorps « humanisé », on entend désigner un anticorps qui contient des régions déterminant la complémentarité (CDRs) dérivées d'un anticorps d'origine non humaine, les autres parties de la molécule d'anticorps étant dérivées d'un (ou de plusieurs) anticorps humains. En outre, certains des résidus des régions charpentes (ou « frameworks » ou « FR ») peuvent être modifiés pour conserver l'affinité de liaison (Jones et al. Nature, 321 : 522-525, 1986; Verhoeyen et al- 1988 ; Riechmann et al. Nature, 332 : 323-327, 1988). Les anticorps humanisés peuvent être préparés par des techniques connues de l'homme de l'art telles que les technologies de «CDR grafting», de « resurfacing », de « Human string content », de « FR libraries », de « Guided sélection », de « FR shuffling » et de « Humaneering », comme résumé dans la revue d’Almagro et al (Almagro ét al. Frontiers in Bioscience 1 3, 1619-1633, January 1 , 2008).

Par anticorps « humain », on entend un anticorps dont toute la séquence est d'origine humaine, c'est-à-dire dont les séquences codantes ont été produites par recombinaison de gènes humains codant pour les anticorps. En effet, il est maintenant possible de produire des animaux transgéniques (par exemple des souris) qui sont capables, sur immunisation, de produire un répertoire complet d'anticorps humains en l'absence de production endogène d'immunoglobuline (voir Jakobovits et al, Proc. Natl. Acad. Sci. USA. 90:2551 (1993); Jakobovits et al, Nature, 362:255-258 (1993); Bruggermann et al, Year in Immuno, 7: 33 (1993); Duchosal et al. Nature 355:258 (1992) ; brevets US5,591 ,669 ; US5,598,369 ; US5,545,806 ; US5,545,807 ; US6, 150,584). Les anticorps humains peuvent aussi être obtenus à partir de banques de présentation de phages (Hoogenboom et al, J. Mol. Biol, 227: 381 (1991 ); Marks et al, J. Mol. Biol, 222: 581 - 5 597 (1991 ); Vaughan et al. Nature Biotech 14: 309 (1996)).

L’anticorps selon l’invention est dirigé contre un autoantigène.

Par « autoantigène », on entend un antigène qui, bien qu’étant un constituant du tissu normal, est la cible d’une réponse immunitaire humorale ou cellulaire, comme dans le cas d’une maladie auto-immune (voir la définition dans l’encyclopédie Miller-Keane).

De préférence, l’anticorps selon l’invention est dirigé contre un autoantigène choisi parmi la glycoprotéine oligodendrocytaire de la myéline (MOG) native, la sous-unité catalytique 2 de la glucose-6 phosphatase (IGRP, codée par le gène G6PC2 ; Q9NQR9 dans Uniprot), le collagène de type 2 et l’aquaporine-4 (P55087 dans Uniprot).

Ces autoantigènes sont notamment pertinents pour la prévention et/ou le traitement d’une maladie auto-immune choisie parmi :

- les maladies démyélinisantes impliquant des anticorps anti-MOG, telle que la sclérose en plaques ;

- la neuromyélite optique de Dévie (NMO/NMOSD), en ciblant l’aquaporine-4 (AQP- 4) et/ou MOG ;

- le diabète de type 1 , en ciblant la sous-unité catalytique 2 de la glucose-6 phosphatase (IGRP). L’IGRP est spécifique des îlots de Langerhans ; et

- l’arthrite rhumatoïde, en ciblant le collagène de type 2.

La glycoprotéine oligodendrocytaire de la myéline (MOG) est l'un des divers antigènes de la myéline et des neurones auxquels la réactivité immunitaire est détectée dans la SEP. Cette glycoprotéine est un composant mineur de la gaine de myéline qui isole les axones du SNC.

La séquence de cette protéine native humaine est accessible dans Uniprot avec le numéro d’accession Q16653. La protéine mature (native) humaine contient 218 acides aminés (i.e. après clivage du peptide signal de 29 acides aminés).

De façon similaire, la séquence de MOG native de souris est accessible dans Uniprot avec le numéro d’accession Q61885. La protéine mature (native) de souris contient 218 acides aminés (i.e. après clivage du peptide signal de 28 acides aminés).

Les protéines MOG natives humaine et de souris sont identiques à 89%. De préférence, l’invention se rapporte à un anticorps d’isotype G dirigé contre MOG native, comprenant :

- un fragment Fc présentant une haute sialylation, et

- un fragment Fab capable de se lier à MOG native.

En particulier, comme détaillé dans Breithaupt et al, PNAS, August 5, 2003, vol.100, no.16, l’épitope de MOG native est constitué de trois boucles situées du côté distal de la membrane de MOG, et notamment au niveau des résidus 101 -108 de séquence SEQ ID NO : 26 (R101 DHSYQEE108, correspondant aux résidus 101 -108 sur les 218 de MOG humaine mature) ; ces résidus contiennent une boucle qui forme le bord supérieur du site de liaison du ligand putatif.

De préférence, l’invention se rapporte à un anticorps d’isotype G dirigé contre MOG native, comprenant :

- un fragment Fc présentant une haute sialylation, et

- un fragment Fab capable de se lier à MOG native, en particulier aux résidus 101 -108 de séquence SEQ ID NO : 26.

De préférence, l’anticorps selon l’invention est dirigé contre MOG native. Préférentiellement, il comprend les 6 CDRs de l’anticorps murin 8-18C5. Préférentiellement, il comprend les 6 CDRs suivants :

H-CDR1 : SEQ ID NO:1 1 ,

H-CDR2: SEQ ID NO:12,

H-CDR3: SEQ ID NO:13,

L-CDR1 : SEQ ID NO:14,

L-CDR2: GAS, et

L-CDR3: SEQ ID NO:15.

Selon un mode de réalisation particulier, l’anticorps dirigé contre MOG native selon l’invention est chimérique et comprend comme VH la séquence SEQ ID NO :16, et comme VL la séquence SEQ ID NO :17. Selon un mode de réalisation particulier, l’anticorps selon l’invention est chimérique, et comprend comme chaîne lourde la séquence SEQ ID NO :24 avec la délétion de l’acide glutamique en position 294 en numérotation de l’index EU ou équivalent dans Kabat, et comme chaîne légère la séquence SEQ ID NO :25. La présente demande décrit également un anticorps murin dirigé contre MOG native ; typiquement, il comprend comme chaîne lourde la séquence SEQ ID NO :19, cette séquence comprenant la délétion de l’acide glutamique en position 171 , et comme chaîne légère la séquence SEQ ID NO :20. La position 171 sur le Fc murin correspond à la position 294 sur le Fc humain avec la numérotation de l’index EU ou équivalent dans Kabat.

De manière avantageuse, la région variable de chacune des chaînes légères de l'anticorps dirigé contre MOG native selon l'invention est codée par une séquence possédant au moins 80%, de préférence au moins 85%, de préférence au moins 90%, de préférence au moins 95%, de préférence au moins 99%, d'identité avec la séquence murine SEQ ID NO: 17, et la région variable de chacune des chaînes lourdes de l'anticorps dirigé contre MOG native selon l'invention est codée par une séquence possédant au moins 80%, de préférence au moins 85%, de préférence au moins 90%, de préférence au moins 95%, de préférence au moins 99%, d'identité avec la séquence d'acide nucléique murine SEQ ID NO: 16.

Les anticorps de l'invention s'entendent aussi de tout anticorps dirigé contre MOG native possédant les régions CDR (Complementary Determining Région) de l'anticorps 8-18C5, associées à des régions FR (framework, régions très conservées des régions variables, nommées aussi "charpente"). De tels anticorps possèdent une affinité et une spécificité très comparables, de préférence identiques, à l'anticorps murin 8-18C5.

Préférentiellement, comme indiqué ci-dessus, l’anticorps dirigé contre MOG native selon l’invention comprend les 6 CDRs de l’anticorps murin 8-18C5. Préférentiellement, il comprend les 6 CDRs suivants :

H-CDR1 : SEQ ID NO:1 1 ,

H-CDR2: SEQ ID NO:12,

H-CDR3: SEQ ID NO:13,

L-CDR1 : SEQ ID NO:14,

L-CDR2: GAS, et

L-CDR3: SEQ ID NO:15.

De manière avantageuse, les régions FR de la région VL de l'anticorps dirigé contre MOG native selon l'invention est codée par une séquence possédant au moins 80%, de préférence au moins 85%, de préférence au moins 90%, de préférence au moins 95%, de préférence au moins 99%, d'identité avec les régions FR de la séquence murine SEQ ID NO: 17, et les régions FR de la région VH de l'anticorps dirigé contre MOG native selon l'invention est codée par une séquence possédant au moins 80%, de préférence au moins 85%, de préférence au moins 90%, de préférence au moins 95%, de préférence au moins 99%, d'identité avec les régions FR de la séquence murine SEQ ID NO: 16.

De manière avantageuse, l'anticorps dirigé contre MOG native selon l'invention comprend comme région Fc une région Fc humaine, de préférence choisie parmi SEQ ID NO :1 à 10, de préférence la région Fc codée par SEQ ID NO :1 , et comprenant la délétion de l’acide glutamique en position 294 en numérotation de l’index EU ou équivalent dans Kabat.

L’anticorps d’isotype G dirigé contre un autoantigène, et notamment dirigé contre la glycoprotéine oligodendrocytaire de la myéline (MOG) native, selon l’invention, peut être obtenu par sélection sur banque de phages, tel que notamment décrit dans Nixon et al, Drugs derived from phage display, From candidate identification to practice, mAbs 6:1 , 73-85; January/February 2014.

La présente invention se rapporte également à une composition d’anticorps d’isotype G tels que mentionnés précédemment, qui comprend des fragments Fc présentant une haute sialylation. Cette haute sialylation sur les Fc est typiquement augmentée ou améliorée par rapport à celle d’une composition d’anticorps parents.

Par « augmentation de la sialylation » ou « sialylation améliorée », on entend que la sialylation des Fc de la composition d’anticorps obtenue est augmentée d’au moins 10%, de préférence au moins 15%, de préférence au moins 20%, de préférence au moins 25%, de préférence au moins 30%, de préférence au moins 35%, de préférence au moins 40%, de préférence au moins 45%, de préférence au moins 50%, de préférence au moins 55%, de préférence au moins 60%, de préférence au moins 65%, de préférence au moins 70%, de préférence au moins 75%, de préférence au moins 80%, de préférence au moins 85%, de préférence au moins 90%, de préférence au moins 95%, par rapport à la sialylation des Fc de ladite composition d’anticorps parents.

La sialylation d’une protéine est un mécanisme de glycosylation bien connu (voir notamment Essentials of Glycobiology, 2 nd édition, Varki et al, 2009). Elle correspond à un ajout, par liaison covalente, d’au moins un acide sialique (i.e. acide N-acétylneuraminique et ses dérivés, comme l’acide N-glycosylneuraminique, l’acide N- acétylglycosylneuraminique) dans la chaîne glycosylée de la protéine. De préférence, la sialylation sur le fragment Fc est obtenue par mutation de ce dernier. Ainsi, de préférence, le fragment Fc, notamment humain, est modifié par rapport à celui d’un anticorps parent et comprend au moins une mutation d’acide aminé choisi parmi les acides aminés en position 240 à 243, 258 à 267 et 290 à 305 dudit fragment Fc, la numérotation étant celle de l’index EU ou équivalent dans Kabat.

De préférence, la mutation est effectuée sur au moins un acide aminé du fragment Fc situé en position 240, 241 , 242, 243, 258, 259, 260, 261 , 262, 263, 264, 265, 266, 267, 290, 291 , 292, 293, 294, 295, 296, 297, 298, 299, 300, 301 , 302, 303, 304 ou 305, la numérotation étant celle de l’index EU ou équivalent dans Kabat.

De préférence, la mutation est choisie parmi V262del, V263F, V263K, V263W, V264K, V264P, D265A, D265E, D265G, D265L, D265S, D265V, V266A, V266P, V266S, V266T, S267N, S267P, S267R, S267W, P291 C, P291 V, P291Y, P291W, R292A, R292del,

R292T, R292V, R292Y, E293del, E293F, E293P, E293W, E293Y, E294del, E294D,

E294N, E294W, E294F, E293del/E294del, Q295D, Q295del, Q295F, Q295G, Q295K,

Q295N, Q295R, Q295W, Y296A, Y296C, Y296del, Y296E, Y296G, Y296Q, Y296R,

Y296V, S298del, S298E, S298F, S298G, S298L, S298M, S298N, S298P, S298R, S298T, S298W, S298Y, Y300D, Y300del, Y300G, Y300N, Y300P, Y300R, Y300S, R301A, R301 F, R301 G, R301 H, R301 I, R301 K, R301 Q, R301 V, R301W, R301 Y, V302del, V302A, V302F, V302G, V302P, V303A, V303C, V303P, V303L, V303S, V303Y, S304C, S304M, S304Q, S304T, V305F et V305L, la numérotation étant celle de l’index EU ou équivalent dans Kabat.

Plus préférentiellement, le fragment Fc de l’anticorps selon l’invention est modifié par rapport à celui d’un anticorps parent et comprend au moins la mutation E294del, la numérotation étant celle de l’index EU ou équivalent dans Kabat.

De préférence, le fragment Fc de l’anticorps selon l’invention, notamment humain, est modifié par rapport à celui d’un anticorps parent et consiste en la mutation E294del, la numérotation étant celle de l’index EU ou équivalent dans Kabat.

Selon l’invention, lorsque le fragment Fc de l’anticorps selon l’invention est un Fc de souris, il est modifié par rapport à celui d’un anticorps parent, notamment de séquence SEQ ID NO :18, et consiste en la mutation E171 del.

De préférence, le fragment Fc de l’anticorps selon l’invention, notamment humain, est modifié par rapport à celui d’un anticorps parent et consiste en la mutation Y300del, la numérotation étant celle de l’index EU ou équivalent dans Kabat. De préférence, un tel anticorps est produit dans des cellules HEK. De préférence, l’anticorps selon l’invention présente au moins une activité effectrice médiée par ledit fragment Fc diminuée par rapport à l’activité effectrice de l’anticorps parent.

Par « activité effectrice médiée par le fragment Fc », on entend notamment la cytotoxicité cellulaire dépendante des anticorps (ADCC ou Antibody-Dependent Cell-mediated Cytotoxicity), la cytotoxicité dépendante du complément (CDC ou Complément Dépendent Cytotoxicity), la phagocytose cellulaire dépendante des anticorps (ADCP), l'activité d'endocytose ou encore la sécrétion de cytokines. De préférence, l’activité effectrice médiée par le fragment Fc considérée dans l’invention est sélectionnée parmi la cytotoxicité cellulaire dépendante des anticorps (ADCC), la cytotoxicité dépendante du complément (CDC) et la phagocytose cellulaire dépendante des anticorps (ADCP) et la sécrétion de cytokines.

Par activité effectrice « diminuée » on entend une activité effectrice diminuée ou abolie. Ainsi, l’anticorps selon l’invention peut présenter au moins une activité effectrice médiée par le fragment Fc abolie. De préférence, l’anticorps selon l’invention présente une activité effectrice médiée par la région Fc diminuée, par rapport à celle de l’anticorps parent, d’au moins 10%, de préférence d’au moins 20 %, 30%, 40%, 50%, 60%, 70%, 80%, ou 90%.

De préférence, l’anticorps selon l’invention est dépourvu de toute activité effectrice médiée par ledit fragment Fc.

Selon un autre aspect, l’anticorps selon l’invention présente une affinité médiée par le fragment Fc, diminuée par rapport à l’affinité de l’anticorps parent, pour au moins un des récepteurs de la région Fc (FcR).

Par « récepteur de la région Fc » ou « FcR » on entend notamment le C1q et les Récepteurs Fcy (FcyR). Les « Récepteurs Fcy » ou « FcyR » se réfèrent aux récepteurs des IgG, appelés CD64 (FcyRI), CD32 (FcyRIl), et CD16 (FcyRIII), en particulier aux cinq récepteurs exprimés FcyRIa, FcyRIla, FcyRIIb, FcyRIIIa et FcyRIIIb. Tous sont des récepteurs activateurs des cellules effectrices, hormis le FcyRIIb humain qui est un récepteur inhibiteur de l’activation des cellules immunitaires (Muta T et al., Nature, 1994, 368 :70-73).

Le complément C1q est impliqué dans l’activité CDC.

Le récepteur FcgRIIIa (CD16a) est, quant à lui, impliqué dans l’ADCC ; il présente un polymorphisme V/F en position 158. Le récepteur FcgRIla (CD32a) est, quant à lui, impliqué dans l’activation plaquettaire et la phagocytose ; il présente un polymorphisme H/R en position 131.

Enfin, le récepteur FcgRIIb (CD32b) est impliqué dans l’inhibition de l’activité cellulaire.

Par affinité « diminuée » on entend une affinité diminuée ou abolie. Préférentiellement, l’affinité est diminuée, par rapport à celle de l’anticorps parent comprenant le fragment Fc, d’au moins 10%, de préférence d’au moins 20 %, 30%, 40%, 50%, 60%, 70%, 80%, ou 90%.

De préférence, l’anticorps selon l’invention présente une affinité médiée par ledit fragment Fc diminuée par rapport à l’affinité de l’anticorps parent, pour au moins un des récepteurs de la région Fc (FcR) choisi parmi le complément C1 q et les récepteurs FcgRI lia (CD16a), FcgRIla (CD32a) et FcgRIIb (CD32b). De préférence, l’anticorps selon l’invention présente une affinité médiée par ledit fragment Fc diminuée par rapport à l’affinité de l’anticorps parent, pour les deux récepteurs C1q et CD16a.

L'affinité d’un anticorps comprenant un fragment Fc pour un FcR peut être évaluée par des procédés bien connus de l'art antérieur. Par exemple, l'homme de l'art peut déterminer l’affinité (Kd) en utilisant par exemple la résonance plasmonique de surface (SPR), ou la technologie Octet® (technologie BLI « Bio-Layer Interferometry », Pall). Alternativement, l'homme de l'art peut effectuer un test ELISA approprié. Un dosage ELISA approprié permet de comparer les forces de liaison du Fc parent et du Fc muté. Les signaux détectés spécifiques du Fc muté et du Fc parent sont comparés. L'affinité de liaison peut être indifféremment déterminée en évaluant les anticorps entiers ou en évaluant les régions Fc isolées de ceux-ci.

De préférence, l’anticorps de type IgG selon l’invention est dirigé contre MOG native et comprend :

- les 6 CDRs suivants :

H-CDR1 : SEQ ID NO:1 1 ,

H-CDR2: SEQ ID NO:12,

H-CDR3: SEQ ID NO:13,

L-CDR1 : SEQ ID NO:14,

L-CDR2: GAS, et

L-CDR3: SEQ ID NO:15; et - un fragment Fc humain modifié par rapport à celui d’un anticorps parent, comprenant au moins une mutation d’acide aminé choisi parmi les acides aminés en position 240 à 243, 258 à 267 et 290 à 305 dudit fragment Fc, la numérotation étant celle de l’index EU ou équivalent dans Kabat ; de préférence un fragment Fc humain modifié par rapport à celui d’un anticorps parent, comprenant au moins la mutation E294del (ou au moins la mutation Y300del), la numérotation étant celle de l’index EU ou équivalent dans Kabat.

De préférence, l’anticorps de type IgG selon l’invention est dirigé contre MOG native et comprend :

- les 6 CDRs suivants :

H-CDR1 : SEQ ID NO:1 1 ,

H-CDR2: SEQ ID NO:12,

H-CDR3: SEQ ID NO:13,

L-CDR1 : SEQ ID NO:14,

L-CDR2: GAS, et

L-CDR3: SEQ ID NO:15; et

- un fragment Fc de souris modifié par rapport à celui d’un anticorps parent, comprenant au moins la mutation E171 del (qui correspond à E294del sur le fragment Fc humain avec la numérotation de l’index EU ou équivalent dans Kabat). De préférence, le fragment Fc de souris a pour séquence SEQ ID NO :18 et comprend la mutation E171 del.

Dans un mode de réalisation préféré, l’anticorps de type IgG tel que défini ci-dessus est dirigé contre MOG native et comprend :

- un domaine variable de la chaîne lourde comprenant ou consistant en une séquence sélectionnée dans le groupe consistant en la séquence SEQ ID NO: 29, SEQ ID NO: 31 , SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41 , SEQ ID NO: 43, SEQ ID NO: 45,

SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51 , SEQ ID NO: 53,

SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 59, SEQ ID NO: 61 , SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69,

SEQ ID NO: 71 , SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77 SEQ ID NO: 79,

SEQ ID NO: 81 , SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91 , SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101 , SEQ ID NO: 103, SEQ ID NO: 105 and SEQ ID NO: 107, et/ou un domaine variable de la chaîne légère comprenant ou consistant en une séquence sélectionnée dans le groupe consistant en la séquence SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44 SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56,

SEQ ID NO: 58, SEQ ID NO: 6, 0SEQ ID NO: 62 , SEQ ID NO: 64,

SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80,

SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88,

SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106 and SEQ ID NO: 108.

Dans un mode de réalisation préféré, l’anticorps de type IgG tel que défini ci-dessus est dirigé contre MOG native et comprend un domaine variable de la chaîne lourde et un domaine variable de la chaîne légère de séquences:

- SEQ ID NO: 29 et SEQ ID NO: 30,

- SEQ ID NO: 31 et SEQ ID NO: 32,

- SEQ ID NO: 33 et SEQ ID NO: 34,

- SEQ ID NO: 35 et SEQ ID NO: 36,

- SEQ ID NO: 37 et SEQ ID NO: 38,

- SEQ ID NO: 39 et SEQ ID NO: 40,

- SEQ ID NO: 41 et SEQ ID NO: 42,

- SEQ ID NO: 43 et SEQ ID NO: 44,

- SEQ ID NO: 45 et SEQ ID NO: 46,

- SEQ ID NO: 47 et SEQ ID NO: 48,

- SEQ ID NO: 49 et SEQ ID NO: 50,

- SEQ ID NO: 51 et SEQ ID NO: 52,

- SEQ ID NO: 53 et SEQ ID NO: 54,

- SEQ ID NO: 55 et SEQ ID NO: 56,

- SEQ ID NO: 57 et SEQ ID NO: 58,

- SEQ ID NO: 59 et SEQ ID NO: 60,

- SEQ ID NO: 61 et SEQ ID NO: 62,

- SEQ ID NO: 63 et SEQ ID NO: 64,

- SEQ ID NO: 65 et SEQ ID NO: 66,

- SEQ ID NO: 67 et SEQ ID NO: 68, SEQ ID NO: 69 et SEQ ID NO: 70,

SEQ ID NO: 71 et SEQ ID NO: 72,

SEQ ID NO: 73 et SEQ ID NO: 74,

SEQ ID NO: 75 et SEQ ID NO: 76,

SEQ ID NO: 77 et SEQ ID NO: 78,

SEQ ID NO: 79 et SEQ ID NO: 80,

SEQ ID NO: 81 et SEQ ID NO: 82,

SEQ ID NO: 83 et SEQ ID NO: 84,

SEQ ID NO: 85 et SEQ ID NO: 86,

SEQ ID NO: 87 et SEQ ID NO: 88,

SEQ ID NO: 89 et SEQ ID NO: 90,

SEQ ID NO: 91 et SEQ ID NO: 92,

SEQ ID NO: 93 et SEQ ID NO: 94,

SEQ ID NO: 95 et SEQ ID NO: 96,

SEQ ID NO: 97 et SEQ ID NO: 98,

SEQ ID NO: 99 et SEQ ID NO: 100,

SEQ ID NO: 101 et SEQ ID NO: 102,

SEQ ID NO: 103 et SEQ ID NO: 104,

SEQ ID NO: 105 et SEQ ID NO: 106, ou

SEQ ID NO: 107 et SEQ ID NO: 108.

Les séquences décrites dans la présente demande peuvent être résumées comme suit (à titre informatif, l’acide glutamique du Fc en position 294 selon Kabat est indiqué en gras souligné dans les séquences humaines):

SEQ ID NO :27 = Séquence nucléique de la chaîne lourde de l’anticorps murin 8-18C5 recombinant de séquence SEQ ID NO :19 :

GAAGTGAAGCTGCACGAGTCTGGCGCCGGACTGGTGAAACCTGGCGCCAGCGTGG AAATCAGCTGCAAGGCCACCGGCTACACCTTCAGCAGCTTTTGGATCGAGTGGGTG AAACAGCGGCCTGGCCACGGCCTGGAATGGATCGGCGAGATCCTGCCCGGCAGAG GCCGG ACCAACT ACAACG AG AAGTT CAAGGGCAAGGCCACATT CACCGCCG AG ACA

La présente invention a également pour objet un procédé d’obtention d’un anticorps selon l’invention, comprenant les étapes suivantes :

i) on fournit une séquence nucléique codant pour une chaîne lourde d’IgG, ladite chaîne lourde comprenant (a) dans le domaine variable, les 3 CDRs de liaison à un autoantigène, et (b) dans le fragment Fc, une mutation d’acide aminé choisi parmi les acides aminés en position 240 à 243, 258 à 267 et 290 à 305, et de préférence au moins la mutation E294del ou Y300del, la numérotation étant celle de l’index EU ou équivalent dans Kabat ; ii) on fournit une séquence nucléique codant pour une chaîne légère d’IgG, ladite chaîne légère comprenant dans le domaine variable, les 3 CDRs de liaison du même autoantigène que celui ciblé en i); et

iii) on exprime les séquences nucléiques obtenues en i) et ii) dans une cellule hôte, et on récupère l’anticorps. La séquence nucléique (polynucléotide ou séquence nucléotidique) codant pour la chaîne lourde d’IgG comprend un fragment Fc ayant une mutation. La séquence nucléique codant pour la chaîne lourde d’IgG peut être synthétisée par voie chimique (Young L and Dong Q., 2004, Nucleic Acids Res., Apr 1 5;32(7), Hoover, D.M. and Lubkowski, J. 2002, Nucleic Acids Res., 30, Villalobos A, et al., 2006. BMC Bioinformatics, Jun 6;7:285). La séquence nucléotidique codant pour la chaîne lourde d’IgG peut être également amplifiée par PCR en utilisant des amorces adaptées. La séquence nucléotidique codant pour la chaîne lourde d’IgG peut également être clonée dans un vecteur d'expression.

Par exemple, on peut utiliser la séquence nucléique SEQ ID NO :27 (codant pour la chaîne lourde SEQ ID NO :19).

Ces techniques sont décrites en détails dans les manuels de référence : Molecular cloning : a laboratory manual, 3 ieme édition-Sambrook and Russel eds. (2001 ) et Current Protocols in Molecular Biology - Ausubel et al. eds (2007).

La séquence nucléique fournie en i) (polynucléotide), qui code pour le polypeptide parent, est ensuite modifiée pour obtenir une séquence nucléique codant pour le variant.

Cette étape est l’étape de mutation à proprement parler. Elle peut être effectuée par toute méthode connue de l’art antérieur, notamment par mutagénèse dirigée.

De préférence, les substitutions et délétions d'acides aminés sont réalisées par mutagénèse dirigée, par la technique de PCR d’assemblage utilisant des oligonucléotides correspondants aux modifications insérées (voir, par exemple, Zoller et Smith, 1982, Nucl. Acids Res. 10:6487-6500; Kunkel, 1985, Proc. Natl. Acad. Sci USA 82:488).

A l’étape ii), on fournit une séquence nucléique codant pour une chaîne légère d’IgG, ladite chaîne légère comprenant dans le domaine variable, les 3 CDRs de liaison du même autoantigène que celui ciblé en i).

Par exemple, on peut utiliser la séquence nucléique SEQ ID NO :28 (codant pour la chaîne légère SEQ ID NO :20).

Enfin, dans l’étape iii), on exprime les séquences nucléiques obtenues en i) et ii) dans une cellule hôte, et on récupère l’anticorps ainsi obtenu.

Les séquences nucléiques obtenues en i) et ii) peuvent être insérées dans un vecteur bicistronique.

L'hôte cellulaire peut être choisi parmi des systèmes procaryotes ou eucaryotes, par exemple les cellules bactériennes mais également les cellules de levure ou les cellules animales, en particulier les cellules de mammifères. On peut également utiliser des cellules d'insectes ou des cellules de plantes.

Les cellules hôtes préférées sont la lignée de rat YB2/0, la lignée de hamster CHO, en particulier les lignées CHO dhfr- et CHO Lec13, la lignée PER.C6™ (Crucell), la lignée HEK notamment HEK293 (ATCC # CRL1573), les lignées EB66, K562, NSO, SP2/0, BHK, HeLa, NIH/3T3 ou COS. De préférence encore, on utilise la lignée de rat YB2/0. Ces cellules hôtes, par exemple les cellules CHO, peuvent être transfectées avec au moins un gène codant pour une sialyltransférase.

De préférence, lorsque le fragment Fc de l’anticorps selon l’invention, notamment humain, est modifié par rapport à celui d’un anticorps parent et consiste en la mutation Y300del, il est produit dans des cellules HEK telles que des cellules HEK293.

Les polynucléotides codant pour les chaînes lourde et légère peuvent également comprendre des codons optimisés, notamment pour son expression dans certaines cellules (étape iii)). L'optimisation de codon a pour but de remplacer les codons naturels par des codons dont les ARN de transfert (ARNt) portant les acides aminés sont les plus fréquents dans le type cellulaire considéré. Le fait de mobiliser des ARNt fréquemment rencontrés a pour avantage majeur d'accroître la vitesse de traduction des ARN messagers (ARNm) et donc d'augmenter le titre final (Carton JM et al, Protein Expr Purif, 2007). L'optimisation de codons joue aussi sur la prédiction des structures secondaires d'ARNm qui pourraient ralentir la lecture par le complexe ribosomal. L'optimisation de codons a également un impact sur le pourcentage de G/C qui est directement lié à la demi-vie des ARNm et donc à leur potentiel de traduction (Chechetkin, J. of Theoretical Biology 242, 2006 922-934).

L’optimisation de codons peut être faite par substitution des codons naturels en utilisant des tables de fréquence des codons (codon Lisage Table) pour mammifères et plus particulièrement pour Homo sapiens. Il existe des algorithmes présents sur internet et mis à disposition par les fournisseurs de gènes de synthèse (DNA2.0, GeneArt, MWG, Genscript) qui permettent de faire cette optimisation de séquence.

De préférence, les polynucléotides codant pour les chaînes lourde et légère comprennent des codons optimisés pour leur expression dans les cellules HEK, telles que des cellules HEK293, les cellules CHO, ou les cellules YB2/0. Plus préférentiellement, les polynucléotides codant pour les chaînes lourde et légère comprennent des codons optimisés pour leur expression dans les cellules YB2/0. L’invention a également pour objet une composition comprenant, dans un milieu physiologiquement acceptable, des anticorps monoclonaux selon l’invention.

Par « anticorps monoclonal » ou « composition d'anticorps monoclonal », ou « mAb » pour monoclonal Antibody, on entend une composition comprenant des molécules d'anticorps possédant une spécificité antigénique identique et unique. Les molécules d'anticorps présentes dans la composition sont toutes codées par les mêmes séquences de chaînes lourde et légère et ont donc la même séquence protéique.

L’invention a également pour objet l’utilisation d’un anticorps selon l’invention, ou bien l’utilisation d’une composition telle que précitée, comme médicament.

L’anticorps selon l’invention peut être combiné avec des excipients pharmaceutiquement acceptables, et éventuellement des matrices à libération prolongée, comme des polymères biodégradables, pour former une composition thérapeutique.

La composition pharmaceutique peut être administrée par voie orale, sublinguale, sous- cutanée, intramusculaire, intraveineuse, intra-artérielle, intrathécale, intra-oculaire, intra cérébrale, transdermique, pulmonaire, locale ou rectale. Le principe actif peut alors être administré sous forme unitaire d'administration, en mélange avec des supports pharmaceutiques classiques. Des formes unitaires d'administration comprennent les formes par voie orale telles que les comprimés, les gélules, les poudres, les granules et les solutions ou suspensions orales, les formes d'administration sublinguale et buccale, les aérosols, les implants sous-cutanés, transdermique, topique, intrapéritonéale, intramusculaire, intraveineuse, sous-cutanée, intrathécale, les formes d'administration par voie intranasale et les formes d'administration rectale.

De préférence, la composition pharmaceutique contient un véhicule pharmaceutiquement acceptable pour une formulation susceptible d'être injectée. Il peut s'agir en particulier de formules isotoniques, stériles, de solutions salines (avec phosphate monosodique ou disodique, chlorure de sodium, de potassium, de calcium ou de magnésium et analogues, ou des mélanges de tels sels), ou de compositions lyophilisées, qui, lors de l'addition d'eau stérilisée ou de sérum physiologique selon les cas, permettent la constitution de solutés injectables.

Les formes pharmaceutiques appropriées pour une utilisation injectable comprennent des solutions aqueuses stériles ou des dispersions, des formulations huileuses, y compris l'huile de sésame, l'huile d'arachide, et des poudres stériles pour la préparation extemporanée de solutions injectables stériles ou de dispersions. Dans tous les cas, la forme doit être stérile et doit être fluide dans la mesure où elle doit être injectée par seringue. Elle doit être stable dans les conditions de fabrication et de stockage et doit être préservée contre l'action contaminante de micro-organismes, comme les bactéries et les champignons.

Les dispersions selon l’invention peuvent être préparées dans du glycérol, des polyéthylèneglycols liquides ou leurs mélanges, ou dans des huiles. Dans des conditions normales de stockage et d'utilisation, ces préparations contiennent un conservateur pour empêcher la croissance des micro-organismes.

Le véhicule pharmaceutiquement acceptable peut être un solvant ou milieu de dispersion contenant, par exemple, l'eau, l'éthanol, un polyol (par exemple, la glycérine, le propylène glycol, le polyéthylène glycol, et analogues), des mélanges appropriés de ceux-ci, et/ou les huiles végétales. La fluidité convenable peut être maintenue, par exemple, par l'utilisation d'un tensioactif, tel que la lécithine. La prévention de l'action de micro organismes peut être provoquée par divers agents antibactériens et antifongiques, par exemple, des parabènes, le chlorobutanol, le phénol, l'acide sorbique ou encore le thimérosal. Dans de nombreux cas, il sera préférable d'inclure des agents isotoniques, par exemple, des sucres ou du chlorure de sodium. L'absorption prolongée des compositions injectables peut être provoquée par l'utilisation dans les compositions d'agents retardant l'absorption, par exemple, le monostéarate d'aluminium ou la gélatine.

Les solutions injectables stériles sont préparées en incorporant les substances actives en quantité requise dans le solvant approprié avec plusieurs des autres ingrédients énumérés ci-dessus, le cas échéant, suivie d'une stérilisation par filtration. En règle générale, les dispersions sont préparées en incorporant les ingrédients actifs stérilisés dans un véhicule stérile qui contient le milieu de dispersion basique et les autres ingrédients requis parmi ceux énumérés ci-dessus. Dans le cas de poudres stériles pour la préparation de solutions injectables stériles, les procédés de préparation préférés sont le séchage sous vide et la lyophilisation. Lors de la formulation, les solutions seront administrées d'une manière compatible avec la formulation posologique et en une quantité thérapeutiquement efficace. Les formulations sont facilement administrées dans une variété de formes galéniques, telles que les solutions injectables décrites ci-dessus, mais les capsules de libération de médicament et similaires peuvent également être utilisés. Pour l'administration parentérale dans une solution aqueuse par exemple, la solution doit être convenablement tamponnée et le diluant liquide rendu isotonique avec suffisamment de solution saline ou de glucose. Ces solutions aqueuses particulières conviennent particulièrement pour une administration intraveineuse, intramusculaire, sous-cutanée et intrapéritonéale. À cet égard, les milieux aqueux stériles qui peuvent être utilisés sont connus de l'homme de l'art. Par exemple, une dose peut être dissoute dans 1 ml de solution de NaCI isotonique puis ajoutée à 1000 ml de liquide approprié, ou injectée sur le site proposé de la perfusion. Certaines variations de posologie peuvent être appliquées en fonction de l'état du sujet traité.

La composition pharmaceutique de l'invention peut être formulée dans un mélange thérapeutique comprenant environ 0.0001 à 1.0 milligrammes, soit environ 0.001 à 0.1 milligrammes, soit environ de 0.1 à 1.0 milligrammes, voire environ 10 milligrammes par dose ou plus. Des doses multiples peuvent également être administrées. Le niveau de dose thérapeutiquement efficace spécifique pour un patient particulier peut dépendre d'une variété de facteurs, y compris le trouble qui est traité et la gravité de la maladie, l'activité du composé spécifique employé, la composition spécifique utilisée, l'âge, le poids corporel, la santé générale, le sexe et le régime alimentaire du patient, le moment de l'administration, la voie d'administration, le taux d'excrétion du composé spécifique utilisé, la durée du traitement, ou encore les médicaments utilisés en parallèle.

De préférence, la présente invention a pour objet l’utilisation d’un anticorps selon l’invention dans la prévention et/ou le traitement d’une maladie auto-immune. Elle a également pour objet l’utilisation d’une composition comprenant des anticorps monoclonaux selon l’invention pour prévenir et/ou traiter une maladie auto-immune.

De préférence, la maladie auto-immune est choisie parmi :

- les maladies démyélinisantes impliquant des anticorps anti-MOG, telle que la sclérose en plaques ;

- la neuromyélite optique de Dévie (NMO/NMOSD), notamment en ciblant l’aquaporine-4 (AQP-4) et/ou MOG ;

- le diabète de type 1 , notamment en ciblant la sous-unité catalytique 2 de la glucose-6 phosphatase (IGRP). L’IGRP est spécifique des îlots de Langerhans ; et

- l’arthrite rhumatoïde, notamment en ciblant le collagène de type 2.

De préférence, l’anticorps ou la composition selon l’invention est utilisé(e) dans la prévention et/ou le traitement d’une maladie démyélinisante impliquant des anticorps anti- MOG.

Une telle maladie est de préférence choisie parmi l'encéphalomyélite disséminée aiguë (ADEM), la neuromyélite optique de Dévie (NMO/NMOSD) et la sclérose en plaques (SEP). En effet, 40% des patients atteints d'encéphalomyélite disséminée aiguë (ADEM), qui survient principalement chez les enfants, sont séropositifs pour les anticorps anti-MOG. Dans la neuromyélite optique de Dévie (NMO/NMOSD), un sous-groupe de patients adultes séronégatifs pour les anti-aquaporine-4 (AQP-4) montre des titres élevés d’anticorps anti-MOG.

FIGURES

Figure 1 : Expérience pilote des variants traités avec l’anticorps 8-18C5 dans un modèle d’EAE avec MOG35 55

Les souris ont été injectées le jour 7 avec 50 pg d’anticorps 8-18C5-Del produit en cellules YB2/0 ((« Del », n = 4), 8-18C5-WT produit en cellules HEK ((« WT », n = 4), ou un équivolume de PBS ((« PBS », n = 4). A) Score clinique, B) Courbe de survie Kaplan Meier.

Figure 2 : Histogrammes du nombre absolu de macrophages infiltrant le SNC CD45 hl CD11 b hl de souris traitées par l’anticorps 8-18C5-WT produit en cellules HEK (« WT », n = 3), le variant 8-18C5-Del produit en cellules YB2/0 (« Del ») (n = 2), ou un équivolume de PBS ((« PBS », n = 4).

Figure 3 : Histogrammes du nombre absolu de lymphocytes T régulateurs Foxp3+ activés infiltrant le SNC sur des cellules T CD4+ Th1.2+ viables de souris traitées par l’anticorps 8-18C5-WT produit en cellules HEK (« WT », n = 3), le variant 8-18C5-Del produit en cellules YB2/0 (« Del ») (n = 2), ou un équivolume de PBS ((« PBS », n = 4). Les données sont représentées en moyenne +/- SEM.

Figure 4 : Western Blot utilisant une lectine (SNA) spécifique de l'acide sialique en a2,6 pour les différents anticorps : anticorps 8-18C5-Del produit en cellules YB2/0 (« Del (YB2/0) »), anticorps 8-18C5-WT produit en cellules YB2/0 (« WT (YB2/0) ») et anticorps 8-18C5-WT produit en cellules HEK (« WT (HEK) »).

Figure 5 : Expérience pilote des variants traités avec l’anticorps 8-18C5 dans un modèle modéré d’EAE avec MOG35 55

Les souris ont été injectées le jour 9 avec 50 pg d’anticorps 8-18C5-Del (« Del », n=8), 8- 18C5-WT (« YB2 », n=8), ou un équivolume de PBS ((« PBS », n =7). A) Score clinique, B) Courbe de survie Kaplan Meier. EXEMPLES

Les exemples suivants sont donnés en vue d'illustrer divers modes de réalisation de l'invention.

Exemple 1 : Clonage et ingénierie Fc de l'anticorps monoclonal murin 8-18C5, et caractérisation des liaisons aux récepteurs Fc de type I, à FcRn et à son antigène

L’ingénierie de Fc a été réalisée à partir d’un vecteur d'ADN codant pour le clone murin recombinant mAb 8-18C5 d’IgGI . Les inventeurs ont créé la construction de clonage in silico en associant les séquences codant pour un domaine constant consensus avec le domaine variable (Fab) du mAb 8-18C5. La structure cristallisée du fragment Fab 8-18C5 est disponible dans PDB (Protein Data Bank) sous le numéro d'accession 1 PKQ. Pour le domaine constant, les inventeurs ont choisi une séquence consensus d'une lgG1 murine ( Mus musculus, IGHG1 * 01 ) répertoriée dans la base de données en ligne IMGT (Immunogenetics). Les séquences correspondant aux chaînes lourde et légère ont été synthétisées in vitro et clonées dans des vecteurs pCDNA3 distincts (par exemple, Geneart). Les deux séquences ont ensuite été sous-clonées dans un seul vecteur bi- cistronique de mammifère, permettant la production du mAb 8-18C5 murin (8-18C5-WT).

Puis les inventeurs ont créé une délétion homologue à la délétion E294Del humaine (la numérotation étant celle de l’index EU ou équivalent dans Kabat) : ils ont délété l’acide glutamique en position 171 de SEQ ID NO :18 (région constante) du mAb 8-18C5 recombinant, afin d’obtenir le variant 8-18C5-Del.

L’anticorps murin 8-18C5 recombinant 8-18C5-WT a été produit dans des cellules HEK. Les anticorps murins 8-18C5 recombinants 8-18C5-WT et variant 8-18C5-Del ont été produits dans des cellules YB2/0 pour optimiser le niveau de sialylation (50-90%). De façon avantageuse, la lignée cellulaire YB2/0 permet d’obtenir un variant 8-18C5-Del, avec un niveau de sialylation très élevé.

Après production en cellules YB2/0 (ou également en cellules HEK pour 8-18C5-WT), les anticorps 8-18C5-WT et 8-18C5-Del ont été purifiés sur protéine G et caractérisés par SDS-PAGE et SEC, pour valider leur pureté (>97%) et leur intégrité (taux agrégés <2%).

Ils ont ensuite été caractérisés par ELISA sur le FcRn et sur les différents FcyRs : ELISA sur FcRn (humain ou murin) :

La liaison des anticorps 8-18C5-WT et 8-18C5-Del au FcRn a été mesurée par un test ELISA classique. Pour cela des immunoplaques Maxisorp ont été revêtues avec les protéines recombinantes FcRn humain ou murin. Après saturation des plaques en PBS- LE 5%, les solutions d’anticorps 8-18C5-WT ou 8-18C5-Del ont été ajoutées dans chaque puits à différentes concentrations (de 5ng/mL à 0,5pg/mL) et incubées pendant 1 h30 à 37°C. Les F(ab')2 d’IgG HRP de chèvre anti-humaines (ou anti-murine) ont ensuite été incubés au 1/2500 eme pendant 1 h30 à 37°C. Les plaques ELISA ont ensuite été révélées avec du TMB (Pierce) et les absorbances ont été lues à 450 nm.

ELISA sur FCYRS (humains ou murins) :

La liaison des anticorps 8-18C5-WT et 8-18C5-Del aux FcyRs humains ou murins a été mesurée par ELISA après incubation, avec les F(ab')2 d’IgG HRP de chèvre anti humaines pendant 2h à température ambiante (à une concentration finale de 0,5pg/ml pour chaque molécule) sous faible agitation. Les IgG agrégées aux F(ab')2 ont ensuite été incubées sous agitation douce pendant 1 h à 30°C sur les immunoplaques Maxisorp ou NiNTA préalablement revêtues avec le FcyR et saturée en PBS-BSA 4%. Les plaques ELISA ont ensuite été révélées avec du TMB (Pierce) et les absorbances ont été lues à 450 nm.

La caractérisation ELISA des anticorps 8-18C5-WT et 8-18C5-Del a confirmé que l'introduction d'une délétion ponctuelle dans le domaine Fc n'affectait pas la reconnaissance de l'antigène (en utilisant la protéine MOG recombinante, rMOG). Comme le montre le tableau 1 ci-dessous, il est frappant de constater que la liaison à FcRn n'est pas affectée, alors que la liaison à FCYRII I et FcyRIIB est réduite :

Tableau 1 : caractérisation préliminaire des anticorps 8- 18C5-WT et 8- 18C5-Del. Les liaisons ont été évaluées par ELISA sur rMOG, et sur FcRs de type I et FcRn murins. Comme l'isotype d’IgGI murin ne se lie pas à FcyRIA (CD64) et FcyRIV, ceci indique que le variant 8-18C5-Del ne se lie plus à aucun des récepteurs Fc (FcRs) de type I murins. En outre, l'augmentation de la sialylation induite par l'introduction de la mutation « Del » a été confirmée par Western Blot en utilisant une lectine (SNA) spécifique de l'acide sialique en a2,6 (Figure 4). Pour cela, après l’étape d’électrophorèse SDS-PAGE, les anticorps ont été transférés sur membrane de nitrocellulose puis soumis à un Western Blot SNA : les conditions étaient les suivantes :

Saturation : TBS + BSA 1 % + Tween-20 0.05%, pendant 1 nuit à 4°C,

Lavages : Eau Phy + Tween-20 0.05%, 5 x 5 minutes,

1 ère incubation : SNA Biotinylées (VECTOR) au 1/1000 e , 90 min à température ambiante 2ème incubation : Streptavidine péroxydase au 1 /2000 e , 60 min à température ambiante Détection par Chimioluminescence

Exemple 2 : Impact de l’inaériierie Fc présente dans le variant mAb 8-18C5-Del sur la maladie auto-immune du cerveau

Une barrière hémato-encéphalique intacte empêche l'infiltration d'anticorps dans le parenchyme du SNC. Il est donc essentiel d'induire une légère inflammation auto-immune dans le SNC pour «amorcer» le tissu. Cela permet aux anticorps d'entrer dans le parenchyme et d'exercer leur fonction immunitaire.

Le modèle expérimental de choix est l'encéphalomyélite auto-immune expérimentale (« Experimental Autoimmune Encephalomyelitis » ou EAE), une maladie inflammatoire auto-immune invalidante du système nerveux central. Depuis sa description en 1933, il a servi de modèle prototypique d'hypersensibilité (notamment de type IV) et de modèle préclinique de la sclérose en plaques (SEP) dans lequel la plupart des traitements modificateurs de la maladie actuellement commercialisés ont été validés. La forme la plus courante est IΈAE active, dans laquelle une maladie démyélinisante est induite par immunisation avec le peptide 35-55 linéaire de la protéine MOG chez des souris C57BI/6 (Ramadan A, Lucca LE, Carrie N, Desbois S, Axisa PP, Hayder M, Bauer J, Liblau RS, Mars LT. In situ expansion of T cells that recognize distinct self-antigens sustains autoimmunity in the CNS. Brain (2016) 139: 1433-1446). Le mAb 8-18C5 est spécifique d'un épitope conformationnel de MOG (Breithaupt C, Schafer B, Pellkofer H, Huber R, Linington C, Jacob U. Demyelinating myelin oligodendrocyte glycoprotein-specific autoantibody response is focused on one dominant conformational epitope région in rodents. J Immunol (2008) 181 : 1255-1263) : Le mAb 8-18C5 ne reconnaît pas le peptide MOG35-55 linéaire utilisé pour l'immunisation, et n'interagit qu'avec la protéine MOG native intacte présente dans le SNC. Les effets à médiation immunitaire induits par le mAb 8-18C5 sont donc une conséquence de la liaison au MOG natif localement au sein des lésions inflammatoires.

L'impact des anticorps 8-18C5-WT (produits en HEK) et 8-18C5-Del sur la maladie paralytique encéphalomyélite auto-immune expérimentale (EAE) a été déterminé dans une expérience pilote dont les résultats sont présentés en figure 1 et 5.

• Essai 1 :

L’induction de IΈAE est réalisée chez des souris C57BI/6 par immunisation avec 50pg de MOG35-55 dans du CFA (Adjuvant complet de Freund) comprenant 600pg de Mycobacterium tuberculosis inactivé H37RA, suivi de 2 injections de toxine pertussique à jour 0 (200ng) et à jour 2 (400ng).

7 jours après l'immunisation, chaque anticorps a été injecté à une dose unique de 50 pg/souris. Cette dose de 2,5 mg/kg des anticorps 8-18C5 est délibérément inférieure à la dose d'IglV pour traiter la même maladie (4 g/kg au total: 4 x 1 g/kg).

Les résultats sont les suivants :

Par rapport aux souris témoins ayant reçu une injection de PBS, les souris traitées avec l’anticorps 8-18C5-WT (WT) ont montré une EAE aggravée, ce qui a provoqué la mort de toutes ces souris 5-6 jours après l'injection (figure 1 B).

Le variant 8-18C5-Del fournit le résultat inverse : ce variant a non seulement perdu son pouvoir pathogène inhérent (dans ce cas, la sévérité de la maladie aurait été similaire à celle des souris traitées au PBS), mais il a atténué la gravité de la maladie. Aucune des souris traitées par le variant 8-18C5-Del n'est morte, contre 2 souris sur 4 pour le PBS (figure 1 B), la sévérité de IΈAE stagnant à un score clinique de 2 qui reflète un retard de l'éclaircissement. Les stades les plus sévères de paralysie (> 3) n'ont jamais été atteints (figure 1 A).

• Essai 2 :

L’induction de IΈAE modérée est réalisée chez des souris C57BI/6 par immunisation avec 100pg de MOG35-55 dans du CFA (Adjuvant complet de Freund) comportant 100pg de Mycobacterium tuberculosis inactivé H37RA, suivi de 2 injections de toxine pertussique à jour 0 (200ng) et jour 2 (200ng). Au jour 9, deux jours avant l’induction de IΈAE au jour 1 1 , chaque anticorps (8-18C5 murin produits en cellules YB2/0 (YB2), variant porteur de la délétion E171 (Del) (correspondant à la délétion Del294 chez l’humain), est injecté à une dose unique de 50 pg/souris. Du PBS est injecté chez les souris témoins.

Les résultats sont les suivants :

Par rapport aux souris témoins ayant reçu une injection de PBS, les souris traitées avec l’anticorps 8-18C5-WT (YB2) ont montré une EAE aggravée, ce qui a provoqué la mort de 38% des souris environ 15 jours après immunisation (figure 5B et tableau 2)

Le variant 8-18C5-Del (Del) a perdu son pouvoir pathogène inhérent (dans ce cas, la sévérité de la maladie aurait été similaire à celle des souris traitées au PBS) et a atténué la gravité de la maladie. La sévérité de IΈAE stagne à un score de 2 et les stades les plus sévères de paralysie ne sont jamais atteints (Figure 5A).

Enfin, le variant 8-18C5-Del (Del) permet une récupération clinique complète de toutes les souris, alors que le traitement au PBS permet une récupération clinique de 57% des souris et que le traitement avec l’anticorps 8-18C5 permet la récupération clinique de seulement 38% des animaux (tableau 2).

Tableau 2 : Effets des traitements au PBS, 8-18C5WT 5YB2) et 8-18C5Del (Del) sur la mortalité des souris et leur récupération clinique.

Conclusion:

- Le variant 8-18C5-Del améliore IΈAE à une dose unique, qui est 400 fois plus faible que les IglV, et 40 fois plus faible que le variant sialylé recombinant F241A (décrit dans Fiebiger BM, Maamary J, Pincetic A, Ravetch JV. Protection in antibody- and T cell- mediated autoimmune diseases by antiinflammatory IgG Fcs requires type II FcRs. Proc Natl Acad Soi U S A (2015) 1 12: E2385-E2394). La différence critique entre ces paramètres est que l’anticorps 8-18C5 reconnaît un autoantigène lié à la maladie.

- Le moment de l'injection, i.e. juste avant l'apparition de la maladie, montre fortement que le variant 8-18C5-Del a un effet sur les mécanismes pathologiques en cours. De plus, cet effet est susceptible de se produire localement dans le tissu objet de l’inflammation, car l’anticorps 8-18C5 reconnaît seulement la protéine MOG native, qui est exclusivement exprimée dans le système nerveux central.

Exemple 3 : Effet du variant 8-18C5-Del sur la de l'infiltrat cellulaire dans le cerveau

La restauration de la tolérance immunitaire par des mécanismes induits par l'autoantigène à faible dose aboutit fréquemment à l'accumulation de cellules T régulatrices FoxP3+. Pour déterminer si le variant 8-18C5-Del peut promouvoir l'enrichissement en cellules T régulatrices FoxP3+, les inventeurs ont effectué une expérience au cours de laquelle ils ont évalué l'ampleur de la réponse des cellules T régulatrices FoxP3+ dans les cerveaux des souris traitées à l’exemple 2.

Au jour 16 après l'immunisation, les inventeurs ont isolé les cellules mononucléées infiltrant le cerveau en utilisant un gradient de Percoll, et ont analysé la composition cellulaire de l'infiltrat immunitaire par cytométrie de flux.

Comme le montre la figure 2, l'activité inflammatoire chez les souris traitées avec le variant 8-18C5-Del est réduite, étant donné la proportion inférieure et le nombre total de macrophages infiltrants par rapport au groupe témoin PBS.

Concomitamment à la réduction des macrophages, l'infiltration du SNC chez les souris traitées avec le variant 8-18C5-Del a montré une augmentation notable de la proportion et du nombre absolu de lymphocytes T régulateurs Foxp3+ activés par rapport aux souris EAE traitées avec du PBS (Figure 3).

Conclusion :

Ces études sont cohérentes avec un scénario au cours duquel le variant 8-18C5-Del rééduque le système immunitaire en pilotant l'expansion des lymphocytes T régulateurs spécifiques de l'antigène cible MOG. Ce mécanisme nécessite probablement que l’autoantigène MOG soit présenté par des cellules présentatrices d'antigènes (APC) tolérogènes, qui activent préférentiellement les cellules T régulatrices au détriment de la réponse pathogène des cellules T effectrices.

Ceci identifierait le variant 8-18C5-Del selon l’invention comme un vecteur unique pour transférer sélectivement l'autoantigène aux APC tolérogènes exprimant les récepteurs Fc de type II. Exemple 4 : Sélection des anticorps équivalant à 8-18C5 par phaqe displav

Sélection de la banque de scFv humain (MG-UmAb) :

Au cours des étapes de sélection, la banque de scFv humain (MG-UmAb) a été exprimée à la surface du bactériophage M13 en utilisant des procédures standards (Smith GP, Science 228: 1315 (1985)). Des bactéries E. coli XL1 -Blue, contenant la banque à exprimer clonée dans le vecteur pMG72, ont été cultivées dans 60 ml de milieu 2YT additionné de 100 pg/ml d'ampicilline, 15 pg/ml de tétracycline et 1% (p/v) de glucose à 30°C. Les cellules ont ensuite été infectées avec le phage auxiliaire M13 (M13K07, Biolabs, rapport bactéries / phages = 1/3) à 37°C pendant 20 min et la production de phage-scFv a été poursuivie pendant une nuit à 26°C, à 230rpm 2YT/ampicilline/glucose avec de l'IPTG 0,5 mM et 50 pg de kanamycine/ml. Le jour suivant, les phages ont été précipités avec du PEG6000 en utilisant des protocoles standards, remis en suspension dans 1 ml de tampon PBS à pH 7,4 et titrés en infectant des cellules XL1 -Blue.

Pour les sélections en phase solide, les phages-scFv dilués en PBS / 4% de lait écrémé / 0,1% de Tween 20 ont été incubés dans 8 puits de plaques Maxisorp (1 -2x10 11 phages / puits dans 100mI final) préalablement revêtues avec la protéine recombinante humaine MOG ou MOG Biotinylée (sur plaque streptavidine) et bloqués avec 4% de lait écrémé en PBS. Après une incubation de 2 heures à 37°C, les puits ont été lavés 10 fois avec du PBS/0,1 % Tween 20 et 2 fois avec du PBS. Les phages sélectionnés ont ensuite été élués par infection avec des bactéries XL1 -Blue en phase de croissance exponentielle (2x150pl/puits, 20 min. à 37°C sans agitation). Les bactéries infectées ont ensuite été étalées sur milieu solide 2YT/ampicilline/glucose. Le jour suivant, les cellules ont été resuspendues en milieu 2YT avec 15% de glycérol, congelées et conservées à -80°C jusqu’au tour de sélection suivant.

Pour les sélections en phase liquide, 4x10 11 phages ont été d'abord incubés avec de la protéine recombinante humaine MOG biotinylée pendant 1 heure à température ambiante sous faible agitation. Des billes magnétiques revêtues de streptavidine (Dynal) préalablement bloquée avec 4% de lait écrémé en PBS ont ensuite été ajoutées aux phages pendant 30 minutes à température ambiante. Les complexes phage-billes ont été lavés 10 fois avec du PBS/0,1 % Tween 20 et 2 fois avec du PBS en utilisant un aimant. Les complexes phages-billes ont ensuite été utilisés pour infecter 5 ml de bactéries XL1 - Blue en croissance exponentielle, qui ont été étalées sur milieu solide 2YT/ampicilline/glucose. Le jour suivant, les cellules ont été resuspendues en milieu 2YT avec 15% de glycérol, congelées et conservées à -80°C jusqu’au tour de sélection suivant. Pour s’assurer de sélectionner des scFv spécifiques, plusieurs tours de sélections dans différentes conditions (4-6 phase solide et/ou 4-6 phase liquide) ont été mises en oeuvre. Les concentrations de cible (protéine recombinante humaine MOG) ont progressivement été diminuées afin de sélectionner les scFv les plus affins. Des tours de sélection ont aussi été réalisés sur les protéines recombinantes MOG homologues murines et cynomolgus afin d’obtenir des scFv qui reconnaissent aussi ces protéines (conditions de criblage similaires à partir du 2 ou 3 eme tour de sélection). Enfin, afin d’obtenir des scFv qui ciblent un épitope similaire à l’anticorps de référence 818-05, cet anticorps a été utilisé comme compétiteur direct dans des étapes avancées de sélection (à partir du 4 eme tour de sélection).

Les séquences des scFv obtenues sont les suivantes :

Détermination de la liaison à la protéine MOG : Tests ELISA des phaaes-ScFv sur la protéine MOG (humaine et murine) :

Les caractéristiques de liaison des scFv exprimés à la surface des phages isolés pendant le criblage ont été déterminées à l’aide d’un test ELISA en utilisant la protéine recombinante MOG (R&D System). En parallèle des clones sélectionnés, le phage-scFv- 8-18C5 est exprimé afin de servir de contrôle positif de l’ELISA. En bref, les phage-scFv ont été produits sous forme de clones isolés sur une plaque de 96 puits dans 800 mI de cultures 2YT / ampicilline / glucose infectées par le phage auxiliaire M13K07 (comme décrit précédemment). Les phages produits pendant la nuit à 26°C ont ensuite été récupérés dans les surnageants après 30 minutes de centrifugation à 3000g. Ces surnageants ont été directement dilués au 1/2 en PBS / 4% de BSA / 0,1 % de Tween 20 et testés sur des immunoplaques Maxisorp préalablement coatées avec 0,5 pg de MOG humaine ou murine ou PBS (contrôle bruit de fond (bdf) en BSA)/ puits et bloquées avec 4% de BSA en PBS. Après incubation pendant 2 heures à 37 0 C, les puits ont été lavés 3 fois avec du PBS / 0,1% de Tween-20 et les phages-scfv liés ont été détectés avec un anticorps HRP anti-M13 (GE Healthcare). La plaque est lue à 450nm (DO) sur un lecteur de plaque (TECAN). Les résultats sont exprimés en ratio : DO sur cible/DO bdf (DO sur plaque non coatée et saturée en BSA) et les ratios sont comparés à celui obtenu pour le contrôle positif.

Résultats :

Les clones générés décrits ci-dessus ont un ratio supérieur au ratio du contrôle positif 8- 18C5 ; ils se lient donc mieux à la protéine MOG.

En outre, les expériences suivantes peuvent être menées en complément:

Déterminer l'impact sur la réponse des cellules T :

Au jour 16 après l'immunisation, les inventeurs ont isolé les cellules mononucléées infiltrant le cerveau en utilisant un gradient de Percoll, et ont analysé la composition cellulaire de l'infiltrat immunitaire par cytométrie de flux. L'amplitude des réponses des lymphocytes T régulateurs (Foxp3+) et pathogènes (Th 1 /Th 17) peut être déterminée pour montrer formellement si, chez les souris traitées par 8-18C5-Del, la contraction de la réponse pathogène est corrélée avec l'expansion d'une réponse des cellules T régulatrices.

Déterminer la spécificité de la réponse des cellules T pathogène et immunorégulateur :

En utilisant des expériences de rappel d'antigène, des tétramères du CMH et des cellules T expriment un TCR transgénique spécifiques du MOG35-55, la spécificité de la réponse des lymphocytes T régulateurs et pathogènes peut être établie. L'objectif est d'établir le rôle central de l'auto-antigène MOG dans la médiation de l'effet thérapeutique de l'anticorps monoclonal 8-18C5.

Identifier le sous-ensemble myéloïde tolérogène qui interagit avec 8-18C5-Del :

Pendant l'amélioration de la maladie, il est concevable que le variant m8-18C5-Del (non lié aux récepteurs de type I) permette de se lier aux FcR de type II qui comprennent, entre autres, le récepteur CD209 de la lectine de type C (SIGN-R1 ) et CD23. Pour identifier les cellules cibles de l'anticorps 8-18C5-Del, 2 approches peuvent être avantageusement développées:

0 8-18C5-Del et 8-18C5-WT sont marqués avec des fluorochromes distincts et on analyse par cytométrie en flux les cellules immunitaires infiltrant le cerveau qui lient l'un ou l'autre ou les deux anticorps.

0 le profil du récepteur Fc de type I ou II sur les cellules immunitaires infiltrant le cerveau est établi en utilisant une approche de cytométrie de flux.

Une attention particulière est accordée aux macrophages DC-SIGN+/microglies immunorégulateurs et aux macrophages M2/microglies anti-inflammatoires Arg-1 + CD45+ CD1 1 B+ F4/80+ CD68+. Les cellules suppressives dérivées des myéloïdes et les DC plasmocytoïdes sont des candidats moindres car ils ont été signalés comme aggravant IΈAE.

Comme les stratégies mentionnées ci-avant, ces approches sont réalisées au jour 16 après l’immunisation, en isolant les cellules mononuclées infiltrant le cerveau en utilisant un gradient de Percoll.

Implication fonctionnelle du sous-ensemble myéloïde tolérogène identifié :

Après isolement du SNC, les sous-ensembles tolérogènes sont co-cultivés avec des cellules T à TCR transgénique pour démontrer que la présentation de l'antigène MOG entraîne l'expansion des cellules T régulatrices. Deuxièmement, des approches d'anticorps neutralisants sont utilisées in vivo pour retarder l'induction ou le fonctionnement des cellules impliquées.