HOST CELLS AND METHODS FOR PRODUCING DOUBLE-STRANDED RNA

Reference to a Sequence Listing

This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference.

FIELD OF THE INVENTION

The present invention relates to mutant prokaryotic host cells producing double-stranded RNA (dsRNA) molecules suitable for various applications, including, RNA-interference or gene silencing in one or more target microorganism or organism, such as, plants, insects, nematodes and/or higher animals. The invention also relates to methods of producing dsRNA, compositions produced by such methods as well as applications and uses of such compositions.

BACKGROUND OF THE INVENTION

Based on genetic studies of Drosophila and Caenorhabditis elegans, RNA interference

(RNAi), also known as post-transcriptional gene silencing (in plants), is understood to involve silencing the expression of a gene by assembly of a protein-RNA effector nuclease complex that targets homologous RNAs for degradation (Hannon, 2002, Nature 418: 244-251 ). The processing of double-stranded RNA (dsRNA) into small interfering RNAs is accomplished by a family of enzymes known as Dicer (Bernstein et al., 2001 , Nature 409: 363). Dicer, a member of the RNAse III family of endonucleases that specifically cleaves dsRNA, is responsible for digestion of dsRNA into siRNAs ranging from 20-25 nucleotides (Elbashir et al., 2001 , Nature 41 1 : 494). These siRNAs denature with the anti-sense strand and then associate with the RNA Induced Silencing Complex (RISC) (Elbashir et al., 2001 , Genes and Dev. 15: 188; NyKanen ei al., 2001 , Cell 197: 300; Hammond et al., 2001 , Science 293: 1146.). Although not well understood, RISC targets the mRNA from which the anti-sense fragment was derived followed by endo and exonuclease digestion of the mRNA effectively silencing expression of that gene. RNAi has been demonstrated in plants, nematodes, insects, and mammals (Matzke and Matzke, 1998, supra; Kennerdell er a/., 2000, Nat. Biotechnol. 18: 896-8; Bosher er a/., 1999, Genetics 153: 1245-56; Voorhoeve and Agami, 2003, Trends Biotechnol. 21 : 2-4; and McCaffrey et al., 2003, Nat. Biotechnol. 21 : 639-44).

WO2014151581 discloses compositions and methods for the production of double- stranded RNA and lists various potential microorganism host cells, including, potential RNAse A or RNAse III deficient microorganisms: Examples are provided of in vivo production in RNAse III deficient Escherichia coli HT1 15 (DE-3) cells.

WO2015153339 discloses a method of controlling an insect infestation of a plant through causing mortality or stunting in the insect by providing in the diet of an insect a recombinant RNA, i.e. a double-stranded RNA, comprising a silencing element essentially identical or essentially complementary to a fragment of a target gene sequence of the insect, and where ingestion of the recombinant RNA by the insect results in mortality or stunting in the insect.

In view of the quickly developing field of double-stranded RNA applications, it is of interest to identify commercially relevant methods for producing double-stranded RNA.

SUMMARY OF THE INVENTION

In a first aspect, the present invention relates to Gram positive bacterial host cells comprising an exogenous polynucleotide construct encoding a double-stranded RNA molecule, wherein the cell produces said double-stranded RNA, and wherein the cell is mutated in at least two polynucleotides encoding at least two RNAses selected from the group consisting of:

- an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:61 ;

- an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:66;

- an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:70; - an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:74;

- an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:78; and

- an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:81 ; whereby the host cell is deficient in the production of the at least two RNAses.

In a second aspect, the invention relates to methods of producing a double-stranded RNA molecule, said method comprising the steps of:

a) cultivating a Gram positive bacterial host cell as defined in the first aspect; and optionally b) recovering the double-stranded RNA.

A final aspect of the invention relates to compositions comprising a fermentation broth formulation comprising a double-stranded RNA produced by a cell as defined the first aspect or by a method as defined the second aspect.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 A shows the genetic organization of the Bacillus subtilis TFC7A rnc locus.

Figure 1 B shows the genetic organization of the rnc locus after cai-insertion.

Figure 1 C shows the genetic organization of the rnc locus after resolution of cat.

Figure 2 shows photos of supernatants of fermentation broths loaded on 2% agarose gel at the end of 1 L fermentations. AN1721 : Non-producer in the RNAse deficient host. BKQ2812: Producing dsRNA in reference host. BKQ2732: Producing dsRNA in an RNAse deficient host.

Figure 3 shows an agarose gel electrophoresis with RNAse A digests of supernatants from BKQ2732 fermentations producing dsRNA in the RNAse deficient host in Example 17. RNAse A treatment: 9μΙ supernatant was incubated with 1 μΙ RNAse A at 37C for 5 min. RNAse A concentration from left to right: 250, 25, 2.5, and 0.25 ng/μΙ. Figure 4 shows a DNA fragment (SEQ ID NO:85) suitable for integration of T7pol under the control of the strong promoter Pamyl_4199 (EP1062318) assembled by SOE-PCR in Example 10.

Figure 5 shows plasmid pJI M2278, a high copy number plasmid vector for replication in B. subtilis carrying an erythromycin resistance gene (ermB) and the replication region of ρΑΜβΙ , containing a gene essential for replication (repE) and its regulator (copF) (Renault et al., 1996).

Figure 6 shows pPlasmid::dsRNA4 for expression of dsRNA4 (T4A-loop-T4B) from a T7 promoter. Downstream to dsRNA4 is placed three terminators (rmB T2 terminator, and two T7 terminators). The plasmid contains an ampicillin resistance marker gene (AmpR) and a ColE1 origin of replication (on).

Figure 7 shows plasmid pBKQ2696 for expression of dsRNA4 in B. subtilis from a T7 promoter. The plasmid is a hybrid plasmid between pJIM2278 and pPlasmid::dsRNA4.

Figure 8 shows agarose gel electrophoresis showing supernatants from AN21 10 fermentations (producing dsRNA6 from the chromosome of the RNA'se deficient host AN 1744).

DEFINITIONS

Coding sequence: The term "coding sequence" means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA. The coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.

Control sequences: The term "control sequences" means nucleic acid sequences necessary for expression of a polynucleotide encoding a mature polypeptide of the present invention. Each control sequence may be native (i.e. , from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the polypeptide or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a polypeptide.

Expression: The term "expression" includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

Expression vector: The term "expression vector" means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression. High stringency conditions: The term "high stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 65°C.

Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.

Isolated: The term "isolated" means a substance in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include (1 ) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).

Low stringency conditions: The term "low stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 50°C.

Medium stringency conditions: The term "medium stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 55°C.

Medium-high stringency conditions: The term "medium-high stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 60°C.

Nucleic acid construct: The term "nucleic acid construct" means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.

Operably linked: The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.

Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity". For purposes of the present invention, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice etal., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:

(Identical Residues x 100)/(Length of Alignment - Total Number of Gaps in Alignment) For purposes of the present invention, the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later. The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:

(Identical Deoxyribonucleotides x 100)/(Length of Alignment - Total Number of Gaps in Alignment)

Very high stringency conditions: The term "very high stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 70°C.

Very low stringency conditions: The term "very low stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 45°C.

Double-stranded RNA or dsRNA: The term "double-stranded RNA" or "dsRNA" means two separate single-stranded RNA molecules that have annealed to form a so-called "stem" or duplex, where the bases of one strand form bonds with the corresponding bases of the other strand.

In a preferred embodiment, the stem or duplex is made up of at least 20 consecutive basepairs; preferably at least 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450 or at least 500 consecutive basepairs. There may be 3' or 5' overhangs at one or both ends of the stem of 1-5 unpaired nucleotides.

In another preferred embodiment, the stem or duplex is formed by a single discrete RNA molecule which typically then also forms a loop at one end consisting of unpaired nucleotides; preferably the loop consists of at least 10 nucleotides, more preferably at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450 or at least 500 nucleotides.

The dsRNA is preferably a small interfering RNA (siRNA) or a micro RNA (miRNA). In a preferred aspect, the dsRNA is small interfering RNA for inhibiting transcription in at least one target plant, at least one target microorganism, at least one target insect or at least one target pest. In another preferred aspect, the dsRNA is micro RNA for inhibiting translation.

While the present invention is not limited by any particular mechanism of action, the dsRNA can enter a cell and cause the degradation of a single-stranded RNA (ssRNA) of similar or identical sequences, including endogenous mRNAs. When a cell is exposed to dsRNA, mRNA from the homologous gene is selectively degraded by a process called RNA interference (RNAi).

The dsRNAs of the present invention can be used in gene-silencing. In one aspect, the invention provides methods to selectively degrade RNA using a dsRNAi of the present invention. The process may be practiced in vitro, ex vivo or in vivo. In one aspect, the dsRNA molecules can be used to generate a loss-of-function mutation in a cell, an organ or an animal. Methods for making and using dsRNA molecules to selectively degrade RNA are well known in the art; see, for example, U.S. Patent Nos. 6,489,127; 6,506,559; 6,511 ,824; and 6,515,109 as well as WO2014151581 and WO2015153339.

DETAILED DESCRIPTION OF THE INVENTION Host Cells

The present invention relates to recombinant Gram positive host cells, comprising a polynucleotide encoding a double-stranded RNA molecule (dsRNA), said polynucleotide being operably linked to one or more control sequences that direct the production of the dsRNA. A construct or vector comprising the polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extra- chromosomal vector as described below. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source.

The host cell may be any Gram positive bacterial cell useful in the recombinant production of a dsRNA. Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces.

The Gram-positive bacterial host cell may be any Bacillus cell including, but not limited to, Bacillus alkalophiius, Bacillus altitudinis, Bacillus amyloliquefaciens, B. amyloliquefaciens subsp. plantarum, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus methylotrophicus, Bacillus pumilus, Bacillus safensis, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis cells.

The Gram-positive bacterial host cell may also be any Streptococcus cell including, but not limited to, Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, and Streptococcus equi subsp. Zooepidemicus cells.

The Gram-positive bacterial host cell may also be any Streptomyces cell including, but not limited to, Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans cells.

The introduction of DNA into a Bacillus cell may be effected by protoplast transformation (see, e.g., Chang and Cohen, 1979, Mol. Gen. Genet. 168: 11 1 -1 15), competent cell transformation (see, e.g., Young and Spizizen, 1961 , J. Bacteriol. 81 : 823-829, or Dubnau and Davidoff-Abelson, 1971 , J. Mol. Biol. 56: 209-221 ), electroporation (see, e.g., Shigekawa and Dower, 1988, Biotechniques 6: 742-751 ), or conjugation (see, e.g., Koehler and Thorne, 1987, J. Bacteriol. 169: 5271-5278). The introduction of DNA into a Streptomyces cell may be effected by protoplast transformation, electroporation (see, e.g., Gong et al., 2004, Folia Microbiol. (Praha) 49: 399-405), conjugation (see, e.g., Mazodier ef al., 1989, J. Bacteriol. 171 : 3583-3585), or transduction (see, e.g., Burke ei al., 2001 , Proc. Natl. Acad. Sci. USA 98: 6289-6294). The introduction of DNA into a Pseudomonas cell may be effected by electroporation (see, e.g., Choi et al., 2006, J. Microbiol. Methods 64: 391-397) or conjugation (see, e.g., Pinedo and Smets, 2005, Appl. Environ. Microbiol. 71 : 51 -57). The introduction of DNA into a Streptococcus cell may be effected by natural competence (see, e.g., Perry and Kuramitsu, 1981 , Infect. Immun. 32: 1295-1297), protoplast transformation (see, e.g., Catt and Jollick, 1991 , Microbios 68: 189-207), electroporation (see, e.g., Buckley et al., 1999, Appl. Environ. Microbiol. 65: 3800-3804), or conjugation (see, e.g., Clewell, 1981 , Microbiol. Rev. 45: 409-436). However, any method known in the art for introducing DNA into a host cell can be used. Removal or Reduction of RNAse Enzyme Activity

The present invention also relates to methods of producing a mutant of a parent Gram- positive bacterial cell, which comprises disrupting or deleting a polynucleotide, or a portion thereof, encoding one or more RNAse enzyme, which results in the mutant cell producing less of the one or more RNAse than the parent cell when cultivated under the same conditions.

The mutant cell may be constructed by reducing or eliminating expression of the one or more RNAse-encoding polynucleotide using methods well known in the art, for example, insertions, disruptions, replacements, or deletions. In a preferred aspect, the one or more RNAse- encoding polynucleotide is inactivated. The polynucleotide to be modified or inactivated may be, for example, the coding region or a part thereof essential for activity, or a regulatory element required for expression of the coding region. An example of such a regulatory or control sequence may be a promoter sequence or a functional part thereof, i.e., a part that is sufficient for affecting expression of the polynucleotide. Other control sequences for possible modification include, but are not limited to, signal peptide sequence, transcription terminator, and transcriptional activator.

Modification or inactivation of the one or more RNAse-encoding polynucleotide may be performed by subjecting the parent cell to mutagenesis and selecting for mutant cells in which expression of the polynucleotide has been reduced or eliminated. The mutagenesis, which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, by use of a suitable oligonucleotide, or by subjecting the DNA sequence to PCR generated mutagenesis. Furthermore, the mutagenesis may be performed by use of any combination of these mutagenizing agents.

Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues.

When such agents are used, the mutagenesis is typically performed by incubating the parent cell to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions, and screening and/or selecting for mutant cells exhibiting reduced or no expression of the gene.

Modification or inactivation of the one or more RNAse-encoding polynucleotide may be accomplished by insertion, substitution, or deletion of one or more nucleotides in the gene or a regulatory element required for transcription or translation thereof. For example, nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of the start codon, or a change in the open reading frame. Such modification or inactivation may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art. Although, in principle, the modification may be performed in vivo, i.e., directly on the cell expressing the polynucleotide to be modified, it is preferred that the modification be performed in vitro as exemplified below.

An example of a convenient way to eliminate or reduce expression of the one or more RNAse-encoding polynucleotide is based on techniques of gene replacement, gene deletion, or gene disruption. For example, in the gene disruption method, a nucleic acid sequence corresponding to the endogenous polynucleotide is mutagenized in vitro to produce a defective nucleic acid sequence that is then transformed into the parent cell to produce a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous polynucleotide. It may be desirable that the defective polynucleotide also encodes a marker that may be used for selection of transformants in which the polynucleotide has been modified or destroyed. In an aspect, the polynucleotide is disrupted with a selectable marker such as those described herein.

Accordingly, in a first aspect the invention relates to Gram positive bacterial host cells comprising an exogenous polynucleotide construct encoding a double-stranded RNA molecule, wherein the cell produces said double-stranded RNA, and wherein the cell is mutated in at least two polynucleotides encoding at least two RNAses selected from the group consisting of:

- an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:61 ; preferably at least 75%, 80%, 85%, 90%, 95%, 97%, 98% or at least 99% identical to SEQ ID NO:61 ;

- an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:66; preferably at least 75%, 80%, 85%, 90%, 95%, 97%, 98% or at least 99% identical to SEQ ID NO:66;

- an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:70; preferably at least 75%, 80%, 85%, 90%, 95%, 97%, 98% or at least 99% identical to SEQ ID NO:70;

- an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:74; preferably at least 75%, 80%, 85%, 90%, 95%, 97%, 98% or at least 99% identical to SEQ ID NO:74;

- an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:78; preferably at least 75%, 80%, 85%, 90%, 95%, 97%, 98% or at least 99% identical to

SEQ ID NO:78; and

- an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:81 ; preferably at least 75%, 80%, 85%, 90%, 95%, 97%, 98% or at least 99% identical to SEQ ID NO:81 ;

whereby the host cell is deficient in the production of the at least two RNAses.

In a preferred embodiment of the first aspect, the Gram positive bacterial host cell is of the genus Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, or Streptomyces; more preferably of the species Bacillus alkalophilus, Bacillus altitudinis, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus methylotrophicus, Bacillus pumilus, Bacillus safensis, Bacillus stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis.

Another preferred embodiment relates to a host cell of the first aspect, wherein the at least two polynucleotides encoding at least two RNAses are selected from the group consisting of:

- an RNAse-encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:60; preferably at least 75%, 80%, 85%, 90%, 95%, 97%, 98% or at least 99% identical to SEQ ID NO:60;

- an RNAse-encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:65; preferably at least 75%, 80%, 85%, 90%, 95%, 97%, 98% or at least 99% identical to SEQ ID NO:65;

- an RNAse-encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:69; preferably at least 75%, 80%, 85%, 90%, 95%, 97%, 98% or at least

99% identical to SEQ ID NO:69;

- an RNAse-encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:73; preferably at least 75%, 80%, 85%, 90%, 95%, 97%, 98% or at least 99% identical to SEQ ID NO:73;

- an RNAse-encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:77; preferably at least 75%, 80%, 85%, 90%, 95%, 97%, 98% or at least 99% identical to SEQ ID NO:77; and

- an RNAse-encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:80; preferably at least 75%, 80%, 85%, 90%, 95%, 97%, 98% or at least 99% identical to SEQ ID NO:80.

The at least two polynucleotides encoding at least two RNAses that are mutated in the Gram positive host cell of the first aspect may be any of those listed in any combination. However, a preferred embodiment relates to the Gram positive bacterial host cell of the first aspect, wherein the at least two RNAses comprise an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:70; preferably an RNAse having an amino acid sequence at least 75% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 75% identical to SEQ ID NO:70; more preferably an RNAse having an amino acid sequence at least 80% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 80% identical to SEQ ID NO:70; more preferably an RNAse having an amino acid sequence at least 85% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 85% identical to SEQ ID NO:70; more preferably an RNAse having an amino acid sequence at least 90% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 90% identical to SEQ ID NO:70; more preferably an RNAse having an amino acid sequence at least 95% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 95% identical to SEQ ID NO:70; more preferably an RNAse having an amino acid sequence at least 97% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 97% identical to SEQ ID NO:70; even more preferably an RNAse having an amino acid sequence at least 98% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 98% identical to SEQ ID NO:70 and most preferably an RNAse having an amino acid sequence at least 99% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 99% identical to SEQ ID NO:70; or wherein the at least two RNAses comprise an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:74; preferably an RNAse having an amino acid sequence at least 75% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 75% identical to SEQ ID NO:74; more preferably an RNAse having an amino acid sequence at least 80% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 80% identical to SEQ ID NO:74; more preferably an RNAse having an amino acid sequence at least 85% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 85% identical to SEQ ID NO:74; more preferably an RNAse having an amino acid sequence at least 90% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 90% identical to SEQ ID NO:74; more preferably an RNAse having an amino acid sequence at least 95% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 95% identical to SEQ ID NO:74; more preferably an RNAse having an amino acid sequence at least 97% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 97% identical to SEQ ID NO:74; even more preferably an RNAse having an amino acid sequence at least 98% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 98% identical to SEQ ID NO:74 and most preferably an RNAse having an amino acid sequence at least 99% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 99% identical to SEQ ID NO:74;

or wherein the at least two RNAses comprise an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:61 ; preferably an RNAse having an amino acid sequence at least 75% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 75% identical to SEQ ID NO:61 ; more preferably an RNAse having an amino acid sequence at least 80% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 80% identical to SEQ ID NO:61 ; more preferably an RNAse having an amino acid sequence at least 85% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 85% identical to SEQ ID NO:61 ; more preferably an RNAse having an amino acid sequence at least 90% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 90% identical to SEQ ID NO:61 ; more preferably an RNAse having an amino acid sequence at least 95% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 95% identical to SEQ ID NO:61 ; more preferably an RNAse having an amino acid sequence at least 97% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 97% identical to SEQ ID NO:61 ; even more preferably an RNAse having an amino acid sequence at least 98% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 98% identical to SEQ ID NO:61 and most preferably an RNAse having an amino acid sequence at least 99% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 99% identical to SEQ ID NO:61 ;

or wherein the at least two RNAses comprise an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:78; preferably an RNAse having an amino acid sequence at least 75% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 75% identical to SEQ ID NO:78; more preferably an RNAse having an amino acid sequence at least 80% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 80% identical to SEQ ID NO:78; more preferably an RNAse having an amino acid sequence at least 85% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 85% identical to SEQ ID NO:78; more preferably an RNAse having an amino acid sequence at least 90% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 90% identical to SEQ ID NO:78; more preferably an RNAse having an amino acid sequence at least 95% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 95% identical to SEQ ID NO:78; more preferably an RNAse having an amino acid sequence at least 97% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 97% identical to SEQ ID NO:78; even more preferably an RNAse having an amino acid sequence at least 98% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 98% identical to SEQ ID NO:78 and most preferably an RNAse having an amino acid sequence at least 99% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 99% identical to SEQ ID NO:78;

or wherein the at least two RNAses comprise an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 70% identical to SEQ ID NO:81 ; preferably an RNAse having an amino acid sequence at least 75% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 75% identical to SEQ ID NO:81 ; more preferably an RNAse having an amino acid sequence at least 80% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 80% identical to SEQ ID NO:81 ; more preferably an RNAse having an amino acid sequence at least 85% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 85% identical to SEQ ID NO:81 ; more preferably an RNAse having an amino acid sequence at least 90% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 90% identical to SEQ ID NO:81 ; more preferably an RNAse having an amino acid sequence at least 95% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 95% identical to SEQ ID NO:81 ; more preferably an RNAse having an amino acid sequence at least 97% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 97% identical to SEQ ID NO:81 ; even more preferably an RNAse having an amino acid sequence at least 98% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 98% identical to SEQ ID NO:81 and most preferably an RNAse having an amino acid sequence at least 99% identical to SEQ ID NO:66 and an RNAse having an amino acid sequence at least 99% identical to SEQ ID NO:81.

Another preferred embodiment relates to the Gram positive bacterial host cell of the first aspect, wherein the at least two polynucleotides encoding RNAses comprise an RNAse-encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:69; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 75% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 75% identical to SEQ ID NO:69; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 80% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 80% identical to SEQ ID NO:69; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 85% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 85% identical to SEQ ID NO:69; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 90% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 90% identical to SEQ ID NO:69; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 95% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 95% identical to SEQ ID NO:69; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 97% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 97% identical to SEQ ID NO:69; more preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 98% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 98% identical to SEQ ID NO:69 and most preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 99% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 99% identical to SEQ ID NO:69;

or wherein the at least two polynucleotides encoding RNAses comprise an RNAse- encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:73; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 75% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 75% identical to SEQ ID NO:73; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 80% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 80% identical to SEQ ID NO:73; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 85% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 85% identical to SEQ ID NO:73; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 90% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 90% identical to SEQ ID NO:73; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 95% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 95% identical to SEQ ID NO:73; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 97% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 97% identical to SEQ ID NO:73; more preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 98% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 98% identical to SEQ ID NO:73 and most preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 99% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 99% identical to SEQ ID NO:73;

or wherein the at least two polynucleotides encoding RNAses comprise an RNAse- encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:60; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 75% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 75% identical to SEQ ID NO:60; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 80% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 80% identical to SEQ ID NO:60; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 85% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 85% identical to SEQ ID NO:60; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 90% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 90% identical to SEQ ID NO:60; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 95% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 95% identical to SEQ ID NO:60; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 97% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 97% identical to SEQ ID NO:60; more preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 98% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 98% identical to SEQ ID NO:60 and most preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 99% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 99% identical to SEQ ID NO:60;

or wherein the at least two polynucleotides encoding RNAses comprise an RNAse- encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:77; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 75% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 75% identical to SEQ ID NO:77; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 80% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 80% identical to SEQ ID NO:77; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 85% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 85% identical to SEQ ID NO:77; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 90% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 90% identical to SEQ ID NO:77; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 95% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 95% identical to SEQ ID NO:77; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 97% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 97% identical to SEQ ID NO:77; more preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 98% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 98% identical to SEQ ID NO:77 and most preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 99% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 99% identical to SEQ ID NO:77;

or wherein the at least two polynucleotides encoding RNAses comprise an RNAse- encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 70% identical to SEQ ID NO:80; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 75% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 75% identical to SEQ ID NO:80; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 80% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 80% identical to SEQ ID NO:80; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 85% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 85% identical to SEQ ID NO:80; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 90% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 90% identical to SEQ ID NO:80; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 95% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 95% identical to SEQ ID NO:80; preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 97% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 97% identical to SEQ ID NO:80; more preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 98% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 98% identical to SEQ ID NO:80 and most preferably an RNAse-encoding polynucleotide having a nucleotide sequence at least 99% identical to SEQ ID NO:65 and an RNAse-encoding polynucleotide having a nucleotide sequence at least 99% identical to SEQ ID NO:80.

In a preferred embodiment, the Gram positive cell of the first aspect is mutated in at least three polynucleotides encoding at least three RNAses; more preferably, the cell is mutated in at least four polynucleotides encoding at least four RNAses; even more preferably, the cell is mutated in at least five polynucleotides encoding at least five RNAses; most preferably the cell is mutated in at least six polynucleotides encoding at least six RNAses.

Preferably, the host cell of the first aspect is or has been mutated by an insertion mutation, a deletion mutation or a frameshift mutation in the at least two polynucleotides; preferably the cell is mutated by partial or complete deletion of the at least two polynucleotides.

A preferred embodiment relates to a Gram positive host cell of the first aspect, wherein the double-stranded RNA produced is stable in an overnight cell culture for at least 24 hours; preferably for at least 48 hours; most preferably for at least 72 hours, determined as follows:

- 2 μg of the double-stranded RNA is incubated in 200 μΙ overnight cell culture and incubated at 37°C for up to 72 hours;

20 μΙ samples are withdrawn at suitable time intervals and tested for the presence of the double-stranded RNA by agarose gel electrophoresis.

Polynucleotides

The present invention relates to isolated DNA polynucleotides encoding a double- stranded RNA, as described herein.

The techniques used to isolate or clone a polynucleotide are known in the art and include isolation from genomic DNA or cDNA, or a combination thereof. The cloning of the polynucleotides from genomic DNA can be effected, e.g., by using the well known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g., Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligation activated transcription (LAT) and polynucleotide-based amplification (NASBA) may be used.

Modification of a polynucleotide encoding a polypeptide of the present invention may be necessary for synthesizing polypeptides substantially similar to the polypeptide. The term "substantially similar" to the polypeptide refers to non-naturally occurring forms of the polypeptide. These polypeptides may differ in some engineered way from the polypeptide isolated from its native source, e.g., variants that differ in specific activity, thermostability, pH optimum, or the like. For a general description of nucleotide substitution, see, e.g., Ford et al., 1991 , Protein Expression and Purification 2: 95-107. Nucleic Acid Constructs

The present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a double-stranded RNA operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

The polynucleotide may be manipulated in a variety of ways to provide for expression of the dsRNA. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.

The control sequence may be a promoter, a polynucleotide that is recognized by a host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter contains transcriptional control sequences that mediate the expression of the polypeptide. The promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.

Examples of suitable promoters for directing transcription of the nucleic acid constructs of the present invention in a bacterial host cell are the promoters obtained from the Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus licheniformis penicillinase gene (penP), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus subtilis levansucrase gene (sacB), Bacillus subtilis xylA and xylB genes, Bacillus thuringiensis crylllA gene (Agaisse and Lereclus, 1994, Molecular Microbiology 13: 97-107), E. coli lac operon, E. coli trc promoter (Egon et al., 1988, Gene 69: 301-315), Streptomyces coelicolor agarase gene (dagA), and prokaryotic beta-lactamase gene (Villa- Kamaroff ei al., 1978, Proc. Natl. Acad. Sci. USA 75: 3727-3731 ), as well as the tac promoter (DeBoer ei al., 1983, Proc. Natl. Acad. Sci. USA 80: 21-25). Other suitable promoters include the T7 promoter, SP6 promoter or the M13 promoter. Further promoters are described in "Useful proteins from recombinant bacteria" in Gilbert et al., 1980, Scientific American 242: 74-94; and in Sambrook et al., 1989, supra. Examples of tandem promoters are disclosed in WO 99/43835.

The control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription. The terminator is operably linked to the 3'-terminus of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell may be used in the present invention.

Preferred terminators for bacterial host cells are obtained from the genes for Bacillus clausii alkaline protease [aprH), Bacillus licheniformis alpha-amylase (amyL), and Escherichia coli ribosomal RNA (rrnB).

The control sequence may also be an mRNA stabilizer region downstream of a promoter and upstream of the coding sequence of a gene which increases expression of the gene.

Examples of suitable mRNA stabilizer regions are obtained from a Bacillus thuringiensis crylllA gene (WO 94/25612) and a Bacillus subtilis SP82 gene (Hue et al., 1995, Journal of Bacteriology 177: 3465-3471 ).

It may also be desirable to add regulatory sequences that regulate expression of the polypeptide relative to the growth of the host cell. Examples of regulatory sequences are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory sequences in prokaryotic systems include the lac, tac, and trp operator systems. Other examples of regulatory sequences are those that allow for gene amplification.

Expression Vectors

The present invention also relates to recombinant expression vectors comprising a polynucleotide of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the polypeptide at such sites. Alternatively, the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vectorfor expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.

The recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid.

The vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon, may be used.

The vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.

Examples of bacterial selectable markers are Bacillus licheniformis or Bacillus subtilis dal genes, or markers that confer antibiotic resistance such as ampicillin, chloramphenicol, kanamycin, neomycin, spectinomycin, or tetracycline resistance.

The vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.

For integration into the host cell genome, the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.

For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell. The term "origin of replication" or "plasmid replicator" means a polynucleotide that enables a plasmid or vector to replicate in vivo.

Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli, and pUB110, pE194, pTA1060, and ρΑΜβΙ permitting replication in Bacillus.

More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a polypeptide. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.

More than one copy may also be inserted into the genome of a host cell through the use of a suitable site-specific integrase and its recognition sequences (see, e.g., WO 2006/042548).

The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sam brook ei a/., 1989, supra).

Methods of Double-Stranded RNA Production

In a second aspect, the invention relates to methods of producing a double-stranded RNA molecule, said method comprising the steps of:

c) cultivating a Gram positive bacterial host cell as defined in the first aspect; and optionally d) recovering the double-stranded RNA.

The host cells are cultivated in a nutrient medium suitable for production of the dsRNA using methods known in the art. For example, the cells may be cultivated by shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors in a suitable medium and under conditions allowing the dsRNA to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the one or more dsRNA is secreted or released into the nutrient medium, it can be recovered directly from the medium. If the one or more dsRNA is not secreted, it can be recovered from cell lysates.

The one or more dsRNA may be detected using methods known in the art that are specific for the dsRNA. These detection methods include, but are not limited to, use of specific antibodies, formation of an enzyme product, Northern blotting, digital PCR, RT-PCR or disappearance of an enzyme substrate.

The dsRNA may be recovered using methods known in the art. For example, the dsRNA may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation. In one aspect, a fermentation broth comprising the dsRNA is recovered.

The dsRNA may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g. , preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation) to obtain substantially pure dsRNA.

In an alternative aspect, the one or more dsRNA is not recovered, but rather a host cell of the present invention expressing the one or more dsRNA is used as a source of the dsRNA.

The present invention also relates to methods of expressing in the cell one or more double-stranded RNA (dsRNA) molecule.

Fermentation Broth Formulations or Cell Compositions

A final aspect of the invention relates to compositions comprising a fermentation broth formulation comprising a double-stranded RNA produced by a cell as defined in the first aspect of the invention or by a method as defined in the second aspect.

The fermentation broth product further comprises additional ingredients used in the fermentation process, such as, for example, cells (including, the host cells containing the construct encoding the dsRNA of the present invention), cell debris, biomass, fermentation media and/or fermentation products. In some embodiments, the composition is a cell-killed whole broth containing organic acid(s), killed cells and/or cell debris, and culture medium.

The term "fermentation broth" as used herein refers to a preparation produced by cellular fermentation that undergoes no or minimal recovery and/or purification. For example, fermentation broths are produced when microbial cultures are grown to saturation, incubated under carbon-limiting conditions to allow protein synthesis (e.g., expression of enzymes by host cells) and secretion into cell culture medium. The fermentation broth can contain unfractionated or fractionated contents of the fermentation materials derived at the end of the fermentation. Typically, the fermentation broth is unfractionated and comprises the spent culture medium and cell debris present after the microbial cells (e.g. , filamentous fungal cells) are removed, e.g. , by centrifugation. In some embodiments, the fermentation broth contains spent cell culture medium, extracellular enzymes, and viable and/or nonviable microbial cells.

In an embodiment, the fermentation broth formulation and cell compositions comprise a first organic acid component comprising at least one 1 -5 carbon organic acid and/or a salt thereof and a second organic acid component comprising at least one 6 or more carbon organic acid and/or a salt thereof. In a specific embodiment, the first organic acid component is acetic acid, formic acid, propionic acid, a salt thereof, or a mixture of two or more of the foregoing and the second organic acid component is benzoic acid, cyclohexanecarboxylic acid, 4-methylvaleric acid, phenylacetic acid, a salt thereof, or a mixture of two or more of the foregoing.

In one aspect, the composition contains an organic acid(s), and optionally further contains killed cells and/or cell debris. In one embodiment, the killed cells and/or cell debris are removed from a cell-killed whole broth to provide a composition that is free of these components.

The fermentation broth formulations or cell compositions may further comprise a preservative and/or anti-microbial (e.g. , bacteriostatic) agent, including, but not limited to, sorbitol, sodium chloride, potassium sorbate, and others known in the art.

The cell-killed whole broth or composition may contain the unfractionated contents of the fermentation materials derived at the end of the fermentation. Typically, the cell-killed whole broth or composition contains the spent culture medium and cell debris present after the microbial cells are grown to saturation, incubated under carbon-limiting conditions to allow protein synthesis. In some embodiments, the cell-killed whole broth or composition contains the spent cell culture medium, extracellular enzymes, and killed filamentous fungal cells. In some embodiments, the microbial cells present in the cell-killed whole broth or composition can be permeabilized and/or lysed using methods known in the art.

A whole broth or cell composition as described herein is typically a liquid, but may contain insoluble components, such as killed cells, cell debris, culture media components, and/or insoluble enzyme(s). In some embodiments, insoluble components may be removed to provide a clarified liquid composition.

The whole broth formulations and cell compositions of the present invention may be produced by a method described in WO 90/15861 or WO 2010/096673.

EXAMPLES

Materials and methods

Media

Bacillus strains were grown on LB agar (10 g/l Tryptone, 5 g/l yeast extract, 5 g/l NaCI,

15 g/l agar) plates or in TY liquid medium (20 g/l Tryptone, 5 g/l yeast extract, 7 mg/l FeC , 1 mg/l MnC , 15 mg/l MgCI ₂ ).

To select for erythromycin resistance, agar and liquid media were supplemented with 5 μg/ml erythromycin. To select for chloramphenicol resistance, agar and liquid media were supplemented with 6 pg/ml chloramphenicol.

Transformation of Bacilli was in Spizizen I medium which consists of 1 x Spizizen salts (6 g/l KH2PO4, 14 g/l K ₂ HP0 ₄ , 2 g/l (NH ₄ ) ₂ S0 ₄ , 1 g/l sodium citrate, 0.2 g/l MgS0 ₄ , pH 7.0), 0.5% glucose, 0.1% yeast extract, and 0.02% casein hydrolysate.

RNA was visualized by agarose gel electrophoresis. Gels were 2% agarose in 0,5x TBE buffer (5.4 g/L Trizma Base gels, 2.75 g/L Boric acid, 0.465 g/L EDTA, pH 8.5). Electrophoresis was in 0.5x TBE at 5 V/cm. 1x loading dye was 24% formamide, 0.005% SDS, 0.005% bromophenol blue, 0.0025% xylene cyanol, 0.25%mM EDTA. Quantification of RNA was by reference to a standard dilution series of purified RNA of known concentrations run in the gel.

Strains

Bacillus subtilis 168: Kunst F, Ogasawara N, Moszer I, (151 co-authors), Nature. 1997 Nov 20;390(6657): 249-56.

TFC7A: B. subtilis 168 trpC2; ΔΘΡβ, Askin (Westers et al, Mol Biol Evol. 2003 Dec;20(12):2076- 90.).

AEB2631 : B. subtilis 168; pel::res-ermC-res-PamyL4199-T7pol.

AEB2663: B. subtilis TFC7A; Arnc, Amrnc, Absn, pel::res-ermC-res-PamyL4199-T7pol.

AEB2668: B. subtilis TFC7A; Arnc, Amrnc, Absn, pel::res-PamyL4199-T7pol.

AN 1602: B. subtilis TFC7A

AN 1607: B. subtilis TFC7A; rnc::cat.

AN1619: B. subtilis TFC7A; Arnc.

AN1615: B. subtilis TFC7A; mrnc::cat.

AN 1629: B. subtilis TFC7A; Amrnc.

AN1631 : B. subtilis TFC7A; bsn::cat.

AN 1657: B. subtilis TFC7A; Arnc, Amrnc.

AN 1667: B. subtilis TFC7A; Arnc, Amrnc, Absn.

AN1710: B. subtilis TFC7A; Arnc, Armrnc, Absn, pel::PamyL4199-T7pol, yhcR::cat

AN1716: B. subtilis TFC7A; Arnc, Armrnc, Absn, nrnA.

AN1721 : B. subtilis AN1710/pJIM2278.

AN 1739: B. subtilis TFC7A; Arnc, Amrnc, Absn, rimM::cat.

AN 1742: B. subtilis TFC7A; Arnc, Amrnc, Absn, AyhcR

AN 1748: B. subtilis TFC7A; Arnc, Amrnc, Absn, AyhcR, rim::cat.

AN 1758: B. subtilis TFC7A; Arnc, Amrnc, Absn, AyhcR , AnrnA.

AN 1780: B. subtilis TFC7A; nrnA::cat.

AN 1796: B. subtilis TFC7A; rimM::cat.

AN1816: B. subtilis TFC7A; Absn.

AN1817: B. subtilis TFC7A; yhcR::cat.

AN1818: B. subtilis TFC7A; AyhcR.

AN1819: B. subtilis TFC7A; AnrnA.

AN 1895: B. subtilis 168; Absn, rimM::cat. AN1880: B. subtilis 168; Absn, AyhcR.

BKQ2732: AN 1710/pBKQ2696

BKQ2812: TFC7A/pBKQ2696 Plasmids

pE194: Plasmid isolated from Staphylococcus aureus (Horinouchi, S.; Weisblum, B.. Journal of Bacteriology, 1982, 150(2):804-814).

PJIM2278: A high copy number plasmid vector containing erythromycin resistance marker and theta replicating pambeta origin for replication in B subtilis (Renault P, Corthier G, Goupil N, Delorme C, Ehrlich SD.Gene. 1996 Dec 12;183(1-2):175-82.)

pPlasmid::dsRNA4

PBKQ2696: Plasmid for expression of dsRNA in B. subtilis (this study).

Primers

Table 1 : Primer and sequence overview

AN 1940 21 tctgcatattgtgttgatcacggcttctatcttttatagggtcattag

AN 1941 22 caatgtcaccgccgcaccgattacgattttcctcctctaatatgctca

AN 1942 23 tgagcatattagaggaggaaaatcgtaatcggtgcggcggtgacattg

AN 1943 24 atacgcttcgacaccaggtctcgc

AN 1962 25 caatatcggaataaattggatg

AN 1963 26 taaatcaattttattaaagttcatatgatcacctctggcgaatttcaa

AN 1964 27 ttgaaattcgccagaggtgatcatatgaactttaataaaattgattta

AN 1965 28 gcgtcaaaaaatcgattttcattctaaaagccagtcattaggcctatc

AN 1966 29 gataggcctaatgactggcttttagaatgaaaatcgattttttgacgc

AN 1967 30 gcggtgcaattcagttgggccg

AN 1950 31 cggtgatcatgattggcaccaccctgc

AN 1951 32 ctaatgaccctataaaagatagaactgtgatccgtaggcatccggatc

AN 1952 33 gatccggatgcctacggatcacagttctatcttttatagggtcattag

AN 1953 34 gctgtaaatagaggcgcctgaagcgattttcctcctctaatatgctca

AN 1954 35 tgagcatattagaggaggaaaatcgcttcaggcgcctctatttacagc

AN 1955 36 caagatggtccatcgcgtattgcg

paebl 37 gcctattttttgtgaatcgacctgcaggcatgcaagcttaagattcctcgatgatttcc paeb2 38 ggaaatcatcgaggaatcttaagcttgcatgcctgcaggtcgattcacaaaaaataggc paeb3 39 gcccgaatcagtgaagcaggtcgacgagaccgaaatcggccg

paeb4 40 cggccgatttcggtctcgtcgacctgcttcactgattcgggc

gttgtcttcgcagcagctacgcgttaaaaatgaggagggaagctttatgaacacgattaa catcg paeb5 41

ctaag

cttagcgatgttaatcgtgttcataaagcttccctcctcatttttaacgcgtagctgctg cgaagaca paeb6 42

ac

paeb7 43 gtcggacttcgcgttcgcgtaagctcttcgttagcggtcttactgtggtg

paeb8 44 caccacagtaagaccgctaacgaagagcttacgcgaacgcgaagtccgac

paeb9 45 gaagaattgccggttaaacgaattcgagctcattattaatctgttcagc

paebl 0 46 gctgaacagattaataatgagctcgaattcgtttaaccggcaattcttc

paebl 1 47 cagctggactaaaaggcagagctcggtacccggggatcctctagagtcgattatgtcttt tgcgc paebl 2 48 gcgcaaaagacataatcgactctagaggatccccgggtaccgagctctgccttttagtcc agctg pab337 49 gcatgggcgttggctttagag

pab1073 50 tccctgtgtatgctgaacggctaac

pab1074 51 cagcaccagccgtcctttctaccta

pab1629 52 gcatccgtttggccgtcatggtgcttacgcgaacgcgaagtccg

pab1630 53 caccatgacggccaaacggat

pab1631 54 acgcgttaaaaatgaggagggaagc pab1605 55 ccttttgctggccttttgctcac

pab1676 56 aagtctgagcagatcaaaaaacgcaaag

pr1 152 57 ctttgcgttttttgatctgctcagactt

pr1 175 58 gttagtatttgctagtcaaagtg

pr1 176 59 caattcgccctatagtgagtcg

Molecular biological methods

DNA manipulations and transformations were performed by standard molecular biology methods as described in:

· Sambrook et al. (1989): Molecular cloning: A laboratory manual. Cold Spring Harbor laboratory, Cold Spring Harbor, NY.

• Ausubel et al. (eds) (1995): Current protocols in Molecular Biology. John Wiley and Sons.

• Harwood and Cutting (eds) (1990): Molecular Biological Methods for Bacillus. John Wiley and Sons.

Enzymes for DNA manipulation were obtained from New England Biolabs, Inc. and used essentially as recommended by the supplier.

Competent cells and transformation of B. subtilis was obtained as described in Yasbin et al. (1975): Transformation and transfection in lysogenic strains of Bacillus subtilis: evidence for selective induction of prophage in competent cells. J. Bacteriol. 121 , 296-304.

Genomic DNA was prepared by using the commercial available QIAamp DNA Blood Kit from

Qiagen.

The respective DNA fragments were amplified by PCR using the Phusion Hot Start DNA Polymerase system (Thermo Scientific). PCR amplification reaction mixtures contained 1 μΙ (-0,1 μg) of template DNA, 1 μΙ of sense primer (20 pmol/μΙ), 1 μΙ of anti-sense primer (20 pmol/μΙ), 10 μΙ of 5X PCR buffer with 7,5 mM MgCI ₂ , 8ΠμΙ of dNTP mix (1 ,25 mM each), 39 μΙ water, and 0.5 μΙ (2 U/μΙ) DNA polymerase. A thermocycler was used to amplify the fragment. The PCR products were purified from a 1.2% agarose gel with 1 x TBE buffer using the Qiagen QIAquick Gel Extraction Kit (Qiagen, Inc., Valencia, CA) according to the manufacturer's instructions.

The condition for SOE-PCR is as follows: purified PCR products were used in a subsequent PCR reaction to create a single fragment using splice overlapping PCR (SOE) using the the Phusion Hot Start DNA Polymerase system (Thermo Scientific) as follows. The PCR amplification reaction mixture contained 50 ng of each of the three gel purified PCR products. Primers complementary to the very 3 ^' -end of each strand of the outer PCR products were added and a thermocycler was used to assemble and amplify the SOE fragment (Fig. 1 B). The resulting PCR product was used directly for transformation to B. subtilis host TFC7A.

Resolution of marker genes: The marker gene (f.ex.: cat) is flanked by two directly repeated resolutions sites (res) specific for the ρΑΜβΙ plasmid resolvase (US5882888). The marker inserted is deleted by resolution between the two res sites flanking the marker gene by the ρΑΜβΙ resolvase (as described for deletion of the spectinomycin resistance gene in US5882888).

Example 1. Deletion of the gene encoding RNAse III (rnc) in B. subtilis TFC7A.

By performing SOE-PCR with the primers and templates listed in Table 2, the cat marker was flanked by rnc-upstream and rnc-downstream regions amplified from the rnc locus of β. subtilis TFC7A (Fig 1A, SEQ ID NO:60; rnc is shown in positions 2744 to 3490), the amino acid sequence of the encoded RNAse is shown in SEQ ID NO:61. The entire SOE-PCR product is depicted in Fig. 1 B and the nucleotide sequence of the product can be found in SEQ ID NO:62 (rnc::cat). The nucleotide sequence of the mc-deleted region can be found in SEQ ID NO:63.

Table 2: SOE-PCR strategy for inserting the cat gene into the rnc gene of TFC7A

B. subtilis TFC7A was transformed with the rncr.cat SOE-PCR product and the chromosomal copy of the rnc gene was disrupted by insertion of the cat gene via homologous recombination. The caf gene product renders the strain resistant to chloramphenicol allowing for selection of correct recombinants on LB plates supplemented with 6 μg/ml chloramphenicol. Recombinants (transformants) were tested for correct insertion of the cat gene by PCR on chromosomal DNA and subsequent sequencing of the resulting PCR product using appropriate primers. One correct strain was named AN 1607.

The cat gene in AN 1607 is flanked by two directly repeated resolution sites (res) specific for the ρΑΜβΙ plasmid resolvase (US5882888). The cat gene was deleted by resolution between the two res sites flanking the marker gene by the ρΑΜβΙ resolvase (as described for deletion of the spectinomycin resistance gene in US5882888). cai-resolved transformants were identified as chloramphenicol sensitive-colonies by replica plating on LB plates with and without 6 μg/ml chloramphenicol. Resolution of cat and deletion of rnc was verified by PCR using appropriate primers. One correct clone was named AN 1619.

Example 2. Deletion of the gene encoding RNAse Mini-Ill (mrnc) of B. subtilis TFC7A.

Deletion of mrnc was carried out essentially as described for the rnc gene in example 1.

By performing SOE-PCR with the primers and templates listed in Table 3, the cat marker was flanked by mrnc-upstream and mrnc-downstream regions amplified from the mrnc locus of B. subtilis TFC7A (SEQ ID NO:65; mrnc is shown in positions 3273 to 3701 ), the amino acid sequence of the encoded RNAse is shown in SEQ ID NO:66. The nucleotide sequence of the SOE-PCR product can be found in SEQ ID NO:67 (mrnc::cat).

Table 3: SOE-PCR strategy for inserting the cat gene into the mrnc gene of TFC7A

B. subtilis TFC7A was transformed with the mrnc::cat SOE-PCR product and chloramphenicol resistant transformants were tested for correct insertion of the cat gene by PCR on chromosomal DNA and subsequent sequencing of the resulting PCR product using appropriate primers. One correct strain was named AN1615. The cat gene of AN1615 was deleted by resolution between two res sites as described in example 3. Resolution of cat and deletion of mrnc was verified by PCR using appropriate primers. One correct clone was named AN 1629. The nucleotide sequence of the mrnc-deleted region can be found in SEQ ID NO:68.

Example 3. Deletion of the gene encoding RNAse Bsn (bsn) of B. subtilis TFC7A.

Deletion of bsn was carried out essentially as described for the rnc gene in example 1. By performing SOE-PCR with the primers and templates listed in Table 4, the cat marker was flanked by bsn-upstream and 6sn-downstream regions amplified from the bsn locus of B. subtilis TFC7A (SEQ ID NO:69; bsn is shown in positions 2886 to 3749), the amino acid sequence of the encoded RNAse is shown in SEQ ID NO:70. The nucleotide sequence of the SOE-PCR product can be found in SEQ ID NO:71 (bsn::cat). The nucleotide sequence of the 6sn-deleted region can be found in SEQ ID NO:72.

Table 4: SOE-PCR strategy for inserting the cat gene into the bsn gene of TFC7A

B. subtilis TFC7A was transformed with the bsn::cat SOE-PCR product and chloramphenicol resistant transformants were tested for correct insertion of the cat gene by PCR on chromosomal DNA and subsequent sequencing of the resulting PCR product using appropriate primers. One correct strain was named AN1631. The cat gene of AN1631 was deleted by resolution between two res sites as described in example 1. Resolution of cat and deletion of bsn was verified by PCR using appropriate primers. One correct clone was named AN1816.

Example 4. Deletion of the gene encoding RNAse YhcR (yhcR) of B. subtilis TFC7A.

Deletion of yhcR was carried out essentially as described for the rnc gene in example 1.

By performing SOE-PCR with the primers and templates listed in Table 5, the cat marker was flanked by yhcR-upstream and yfrcR-downstream regions amplified from the yhcR locus of B. subtilis TFC7A (SEQ ID NO:73; yhcR is shown in positions 2818 to 6468), the amino acid sequence of the encoded RNAse is shown in SEQ ID NO:74. The nucleotide sequence of the SOE-PCR product can be found in SEQ ID NO:75 (yhcR::cat).

Table 5: SOE-PCR strategy for inserting the cat gene into the yhcR gene of TFC7A

upstream and ID NO: 63 AN1941

downstream res- sites

yhcR fragment AN 1942 &

TFC7A chr DNA 3100

downstream AN 1943

B. subtilis TFC7A was transformed with the yhcR::cat SOE-PCR product and chloramphenicol resistant transformants were tested for correct insertion of the cat gene by PCR on chromosomal DNA and subsequent sequencing of the resulting PCR product using appropriate primers. One correct strain was named AN 1817. The cat gene of AN1817 was deleted by resolution between two res sites as described in example 1. Resolution of cat and deletion of yhcR was verified by PCR using appropriate primers. One correct clone was named AN 1818. The nucleotide sequence of the yhcR-deleted region can be found in SEQ ID NO 76.

Example 5. Inactivation of the gene encoding RNAse RimM (rimM) in B. subtilis TFC7A.

Inactivation of rimM was carried out essentially as described for the rnc gene in example 1. By performing SOE-PCR with the primers and templates listed in Table 6, the cat marker was flanked by r/ ^' m/W-upstream and rimM-d own stream regions amplified from the rimM locus of B. subtilis TFC7A (SEQ ID NO:77; rimM is shown in positions 878 to 1399), the amino acid sequence of the encoded RNAse is shown in SEQ ID NO:78. The nucleotide sequence of the SOE-PCR product can be found in SEQ ID NO:79 (rimM::cat).

Table 6: SOE-PCR strategy for inserting the cat gene into the rimM gene of TFC7A

B. subtilis TFC7A was transformed with the rimMv.cai SOE-PCR product and chloramphenicol resistant transformants were tested for correct insertion of the cat gene by PCR on chromosomal DNA and subsequent sequencing of the resulting PCR product using appropriate primers. One correct strain was named AN 1796. Example 6. Deletion of the gene encoding RNAse NrnA (nrnA) of B. subtilis TFC7A.

Deletion of nrnA was carried out essentially as described for the rnc gene in example 1 . By performing SOE-PCR with the primers and templates listed in Table 7, the cat marker was flanked by regions amplified from the nrnA locus of B. subtilis TFC7A (SEQ ID NO:80; nrnA is shown in positions 1557 to 2495); the amino acid sequence of the encoded RNAse is shown in SEQ ID NO:81 . The nucleotide sequence of the SOE-PCR product can be found in SEQ ID NO:82 (nrnA::cat).

Table 7: SOE-PCR strategy for inserting the cat gene into the nrnA gene of TFC7A

B. subtilis TFC7A was transformed with the nrnAwcat SOE-PCR product and chloramphenicol resistant transformants were tested for correct insertion of the cat gene by PCR on chromosomal DNA and subsequent sequencing of the resulting PCR product using appropriate primers. One correct strain was named AN 1780. The cat gene of AN1817 was deleted by resolution between two res sites as described in example 1 . Resolution of cat and deletion of nrnA was verified by PCR using appropriate primers. One correct clone was named AN 1819. The nucleotide sequence of the nrn/A-deleted region can be found in SEQ I D NO:83.

Example 7. Construction of a B. subtilis TFC7A Arnc, AmrnC strain.

mrnC was deleted in strain AN1619 as described in Example 2. The resultant B. subtilis

TFC7A rnc, AmrnC strain was named AN 1657.

Example 8. Construction of a B. subtilis TFC7A Arnc, AmrnC, Absn strain.

bsn was deleted in strain AN 1657 as described in Example 3. The resultant B. subtilis TFC7A Arnc, AmrnC, Absn strain was named AN 1667. Example 9. Cloning of T7 polymerase on a plasmid vector for Bacillus

As a first step to assembling the 8371 -bp plasmid pJA3883, the PCR fragments listed in Table 8 were amplified. The purified PCR products were subsequently used in a PCR reaction to create a single plasmid using prolonged overlapping ends PCR (POE). The resulting POE product was used directly for transformation to B. subtilis host JA1622 to establish the plasmid pJA3883. The entire annotated plasmid is depicted in Fig. 1 . The nucleotide sequence of the plasmid can be found in SEQ ID NO:84.

Table 8: POE-PCR strategy for construction of pJA3883

Example 10. Assembling DNA fragment with the Pamyl_4199 promoter in front of T7pol by SOE-PCR

A DNA fragment (SEQ ID NO:85, Figure 4) suitable for integration of T7pol under the control of the strong promoter PamyL4199 (EP1062318) was assembled by SOE-PCR on three DNA fragments.

Fragment A: This 3.7-kb fragment was obtained as synthetic DNA. It contains an approximately 1.9 kb region of the B. subtilis pel region and the Pamyl_4199 promoter separated by the ermC gene form pE194 conferring resistance towards erythromycin. The ermC gene is flanked by two directly repeated resolutions sites (res) specific for the ρΑΜβΙ plasmid resolvase (US5882888).

Fragment B: This 2.7 kb fragment contains the T7pol gene and was amplified using pJA3883, obtained in example 9 as a template and primers pab1629 and pab1631 .

Fragment C: Encompasses 2.3 kb of the B. subtilis pel region and was obtained by PCR using chromosomal DNA from B. subtilis 168 as template and primers pab1073 and pab1630.

Finally the three fragments were assembled by SOE-PCR with the primers pab337 and pab1074, resulting in a 8.3 kb fragment containing the res-ermC-res-PamyL4199-T7po/ structure surrounded by fragments enabling homologous integration of the construct into the pel locus in B. subtilis.

Example 11. Insertion of res-ermC-res-Pamyl_4199-T7pol in pel in B. subtilis

The SOE-fragment with the res-ermC-res-Pamyl_4199-77po/ structure surrounded by sequences enabling homologous integration into the B. subtilis pel locus, obtained in example 10 was transformed into the host strain B. subtilis 168, selecting for resistance against erythromycin, since the ermC gene on the SOE-PCR renders the strain resistant against this antibiotic. Correct insertion of the fragment was selected as erythromycin resistant transformants. Transformants were tested by PCR on chromosomal DNA and subsequent sequencing of the resulting PCR fragment using primers suitable to confirm correct insertion of the res-ermC-res-Pamyl_4199- T7pol structure in the pel locus. One correct strain was named AEB2631.

Example 12. Construction of a B. subtilis TFC7A Lrnc, AmrnC, Absn, pel::P4199-T7 RNA polymerase.

Chromosomal DNA from AEB2631 , obtained in example 1 1 , was used to transform

AN 1667, obtained in example 8 to insert the res-ermC-res-Pamyl_4199-T7po/ construct in the pe/ locus. Correct insertion of the fragment was selected as erythromycin resistant transformants, which were further tested by PCR on chromosomal DNA using primers suitable to confirm correct insertion of the res-ermC-res-Pamyl_4199-T7po/ structure in pel. One correct strain was named AEB2663. The ermC marker was deleted by resolution between the two res sites flanking ermC by the ρΑΜβΙ resolvase (as described for deletion of the spectinomycin resistance gene in US5882888).

Correct strains were identified as being sensitive to growth on erythromycin, since loss of the ermC gene renders the strain sensitive towards this antibiotic. Erythromycin sensitive isolates were further verified by PCR on chromosomal DNA using primers that were suitable to verify correct loss of the ermC gene. One correct strain was named AEB2668. AEB2668 has res- Pamyl_4199-T7po/ inserted in the pel locus and is sensitive towards erythromycin

Example 13. Construction of a B. subtilis TFC7A Arnc, AmrnC, Absn, pel::P4199-T7 RNA polymerase, yhcR::cat strain.

yhcR was inactivated in strain AeB2668 as described in Example 4. The resultant B. subtilis TFttAArnc, AmrnC, Absn, pel::P4199-T7 RNA polymerase, yhcR::cat strain was named AN1710.

Example 14. Construction of shuttle plasmid pBKQ2696 for expression of dsRNA in Bacillus

Plasmid pBKQ2696 (SEQ ID NO 86, Figure 7) was designed as a shuttle vector to enable replication and expression of dsRNA in E. coli and B. subtilis as follows:

Plasmid pJIM2278 (SEQ ID NO 87, Figure 5) was digested with restriction enzyme BssHII as follows: 25 μΙ pJIM22778, 7.5 μΙ CutSmart buffer, 2.5 μΙ BssHII, and 40 μΙ H ₂ 0 and incubated for 1 hour at 50°C. The restriction mixture was then treated with 1 μΙ Calf Intestine Phosphatase. The digested DNA was subsequently purified using Qiagen PCR purification kit according to manufacturer's instructions. Plasmid pPlasmid::dsRNA4 (SEQ ID NO 88, Figure 6) was digested with restriction enzyme Ascl as follows: 10 μΙ pPlasmid::dsRNA4, 5 μΙ CutSmart buffer, 34 μΙ hbO, and 1 μΙ Ascl and incubated for 3 hours at 37°C.

The two digested plasmids were mixed and ligated as follows: 5 μΙ of digested pJIM2278, 10 μΙ of digested pPlasmid::dsRNA4, 2 μΙ of H ₂ 0, 2 μΙ of 10 x Ligation buffer and 1 μΙ of T4 DNA ligase. The ligation mixture still contained Ascl which enabled continued digestion of re-ligated plasmid pPlasmid::dsRNA4. The ligation mixture was incubated overnight at 16°C. Then 2 μΙ aliquot of the ligation mixture was used to transform E. coli C3040 cells according to the manufacturer's instructions. The transformation mixture was then incubated for two hours at 37°C before plating at LB+200 g/ml erythromycin. The plate was incubated at 30°C overnight.

Colony PCR was performed on E. coli transformants in order to identify colonies containing shuttle plasmids. Following primer sets were used: (pr1 175; pabl 676) - 0.64 kb and (pr1 152; pr1176) - 3 kb. Plasmid DNA was then prepared from E. coli transformants and confirmed by restriction analysis with Pstl and subsequent sequencing with primers: pr1175 and pab1605.

Example 15. Construction of a Bacillus subtilis production strain for production of dsRNA.

B. subtilis AN 1710 was transformed with plasmids pBKQ2696 and pJIM2278. Transformants were isolated on LB agar plates supplemented with 5 μg/ml erythromycin. The presence of pBKQ2696 or pJIM2278 was verified by standard plasmid isolation methods and PCR. One correct strain AN1710/pBKQ2696 was named BKQ2732, and one correct strain AN1710/pJIM2278 was named AN 1721. In parallel, and for use as a reference strain, B. subtilis TFC7A was transformed with pBKQ2696 and a correct clone isolated as described for BKQ2732 above. One correct strain was named BKQ2812.

Example 16. In vivo production of dsRNA in Bacillus subtilis.

A fed-batch fermentation process of the Bacillus subtilis strains from Example 15 was conducted as described below. All media were sterilized by methods known in the art. Unless otherwise described, tap water was used. The ingredient concentrations referred to in the below recipes are before any inoculation. Media

LB agar: 10 g/l peptone from casein; 5 g/l yeast extract; 10 g/l sodium chloride; 12 g/l Bacto-agar adjusted to pH 7.0 +/- 0.2. Premix from Merck was used (LB-agar (Miller) 1 10283).

M-9 buffer: Di-Sodiumhydrogenphosphate, 2H2O 8.8 g/l; potassiumdihydrogenphos- phate 3 g/l; sodium chloride 4 g/l; magnesium sulphate, 7H2O 0.2 g/l (deionized water is used in this buffer).

PRK-50: 1 10 g/l soy grits; Di-sodiumhydrogenphosphate, 2H2O 5 g/l; Antifoam (Struktol SB2121 ; Schill & Seilacher, Hamburg, Germany) 1 m\l\. pH adjusted to 8.0 with NaOH/H ₃ P0 ₄ before sterilization.

Make-up medium: Tryptone (Casein hydrolysate from Difco (Bacto™ Tryptone pancreatic Digest of Casein 211699) 30 g/l; magnesium sulphate, 7H2O 4 g/l; di- potassiumhydrogenphosphate 7 g/l; di-sodiumhydrogenphosphate, 2H2O 7 g/l; di-ammonium- sulphate 4 g/l; citric acid 0.78 g/l; vitamins (thiamin-dichlorid 34.2 mg/l; riboflavin 2.9 mg/l; nicotinic acid 23 mg/l; calcium D-pantothenate 28.5 mg/l; pyridoxal-HCI 5.7 mg/l; D-biotin 1 .1 mg/l; folic acid 2.9 mg/l); trace metals (MnS0 ₄ , H ₂ 0 39.2 mg/l; FeS0 ₄ , 7H ₂ 0 157 mg/l; CuS0 ₄ , 5H ₂ O 15.6 mg/l; ZnCI ₂ 15.6 mg/l); Antifoam (Struktol SB2121 ; Schill & Seilacher, Hamburg, Germany) 1.25 ml/l; pH adjusted to 6.0 with NaOH/H3P0 ₄ before sterilization.

Feed-medium: Glucose, 1 H ₂ 0 820 g/l Fermentation Procedure:

Bacillus subtilis strains was grown on LB agar slants for one day at 37°C. The agar was then washed with M-9 buffer, and the optical density (OD) at 650 nm of the resulting cell suspension was measured. Inoculum shake flasks (with 100 ml medium PRK-50) were inoculated with an inoculum of OD (650 nm) x ml cell suspension = 0.1 . The shake flasks were incubated at 37°C at 300 rpm for 20 hr.

The fermentors used were standard lab fermentors equipped with a temperature control system, pH control with ammonia water and phosphoric acid, dissolved oxygen electrode to measure >20% oxygen saturation through the entire fermentation.

The fermentation in the main fermentor (fermentation tank) was started by inoculating the main fermentor with the growing culture from a shake flask. The inoculated volume was 10% (80 ml for 720 ml make-up media, resulting in 800 ml initial broth after inoculation).

The fermentation parameters were: Temperature 38°C; pH between 6.8 and 7.2 (using ammonia water and phosphoric acid, control 6.8 (ammonia water), 7.2 phosphoric acid).

Aeration: 1.5 liter/min, agitation: 1500 rpm.

Feed-medium was added as follows: Initial feed rate 0.05 g/min/kg at the start of the fermentation, increasing linear to 0.16 g/min/kg after 8 hours and remaining at 0.16 g/min/kg until the end of fermentation, by reference to the starting weight of the fermentation broth, just after the inoculation. The fermentation was terminated after 3 days (approx. 70 hours).

Example 17. Yield of dsRNA production in strains BKQ2732, BKQ2812, and AN1721.

Samples from lab-scale fermentations of BKQ2732 (=AN1710/pBKQ2696, producing dsRNA in the RNAse deficient host), AN1721 (=AN1710/pJIM2278, non-producer in the RNAse deficient host), and BKQ2812 (TFC7A/pBKQ2696, producing dsRNA in reference host) (described in Example 15 and 16) were harvested and centrifuged at 5000 rpm for 5 minutes. 10 μΙ supernatants was mixed with 10 μΙ loading dye (x2) and loaded on a 2% agarose gel. The result is shown in Figure 2.

Two bands in sizes corresponding to full-length double-stranded and loop processed

(running as single-stranded) RNA. The transcripts produced from the T7 polymerase promoter PT7 in BKQ2732 are found in the supernatant of BKQ2732 (RNAse deficient producer) as expected. These bands are not visible in supernatants from cultures of BKQ2812 (non-producer) or AN 1721 (TFC7A host).

The full-length dsRNA transcript is loop processed to dsRNA with unlinked strands upon treatment with the single-strand specific ribonuclease RNAse A (Figure 3).

Example 18. Construction of B. subtilis strains deleted for two or more genes encoding RNAses.

Constructions of AN 1716 (B. subtilis TFC7A; Arnc, Amrnc, Absn, nrnA), AN 1739 (B. subtilis TFC7A; Arnc, Amrnc, Absn, rimM::cat), AN1742 (B. subtilis TFC7A; Arnc, Amrnc, Absn, AyhcR), AN1748 (B. subtilis TFC7A; Arnc, Amrnc, Absn, AyhcR, rim::cat), AN1758 (B. subtilis TFC7A; Arnc, Amrnc, Absn, AyhcR, AnrnA), AN1895 (B. subtilis 168; Absn, rimM::cat), and AN 1880 (B. subtilis 168; Absn, AyhcR) were done by sequential use of the methods described in Examples 1 through 6.

Example 19. Measurements of dsRNA stability in cultures of different RNAse deficient B. subtilis strains.

Studies of dsRNA3 (SEQ ID NO:89, synthetic dsRNA) incubated in cultures of various RNAse deficient strains of B. subtilis revealed increased survival of dsRNA3 in strains deleted for one or more of the following RNAse-encoding genes rnc, mrnC, bsn, nrnA, yhcR, and rimM in various combinations. 2 μg of dsRNA3 was incubated in 200 μΙ (table 9) o/n culture and incubated at 37°C for up to 6 days. 20 μΙ samples were withdrawn for agarose gel electrophoresis at the time points indicated in Table 9.

Table 9. Survival of dsRNA in overnight cultures of RNAse deficient strains of B. subtilis; stability ranges from less than 5 minutes survival (-) to full survival at 72 hours (++++). Note: The Δ genotype-label signifies that the gene has been inactivated, as shown, e.g. , in example 6 herein; the "caf-label signifies an insertion of the chloramphenicol resistance marker within the coding sequence of the gene.

Example 20. Chromosomal integration in B. subtilis.

Strains

AN 1744: B. subtilis TFC7A; Arnc, Armrnc, Absn, AyhcR, pel::PamyL4199-T7pol

AN21 10: B. subtilis TFC7A; Arnc, Armrnc, Absn, AyhcR; pel::PamyL4199-T7pol; amyE::PT7- dsRNA6, cat

E. coli: NEB® Stable Competent E. coli (High Efficiency) New England Biolabs cat#3040l Plasmids

pPlasmid::dsRNA6: Plasmid for expression of dsRNA6 in E. coli.

PAN2108: Plasmid for integration of dsRNA6 in amyE locus of B. subtilis. Primers

Table 10: Primers and sequence overview

Example 20a. Construction of a marker-free Bacillus subtilis host for production of dsRNA.

The cat gene in yhcR of AN 1710 (see Example 13) was deleted by resolution between two res sites as described in Example 1. cai-resolved transformants were identified as chloramphenicol sensitive-colonies by replica plating on LB plates with and without 6 μg/ml chloramphenicol. Resolution of cat and deletion of yhcR was verified by PCR using appropriate primers. One correct clone was named AN 1744.

Example 20b. Construction of a plasmid to facilitate chromosomal integration of an expression cassette producing dsRNA6.

pPlasmid::dsRNA6 (SEQ ID NO:94) encode a transcriptional unit defined by a T7 promoter (PT7) sequence and an inverted repeat (dsRNA6) followed by three transcriptional terminators. The dsRNA6 expression cassette was flanked by amyE-upstream and amyE- downstream regions by ligation to the PCR products listed in Table 1 1 using standard cloning procedures. The final plasmid was established in E. coli by transformation and plated on LB plates + 6 μg/ml chloramphenicol. The plasmid was verified by DNA sequence analysis and named pAN2108 (SEQ ID NO:95).

Table 11 : Strategy for PCR and cloning of dsRNA6 flanking regions containing amyE sequences.

Example 20c. Integration of an expression cassette producing dsRNA6 on the chromosome of Bacillus subtilis AN1744.

B. subtilis AN 1744 was transformed with the plasmid pAN2108 (SEQ ID NO:95) and cells were plated on LB plates supplemented with 6 g/ml chloramphenicol and incubated o/n at 37°C. Since pAN2108 does not contain a Bacillus origin of replication, only cells in where a double homologous recombination event leading to insertion of the dsRNA expression cassette and flanking cat gene on the chromosome can grow. One correct strain was isolated, verified by DNA sequence analysis, and named AN21 10.

Example 20d. In vivo production of dsRNA in Bacillus subtilis AN2110.

A fed-batch fermentation process of Bacillus subtilis AN21 10 was conducted as described in Example 16. Samples from the lab-scale fermentation were harvested and centrifuged at 5000 rpm for 5 minutes. 2 μΙ supernatants was mixed with 10 μΙ loading dye (x2) and loaded on a 2% agarose gel. The result is shown in Figure 8. A band corresponding to the loop-processed dsRNA6 is clearly appearing during the time course of the 5-day fermentation being most prominent from day 3 onwards. The dsRNA is stable throughout the whole fermentation period.

Example 21. Proof of concept in Bacillus licheniformis.

Methods

DNA was introduced into B. licheniformis by conjugation from B. subtilis, essentially as previously described (EP2029732 B1 ), using a modified B. subtilis donor strain PP3724, containing pLS20, wherein the methylase gene M.blil 904II (US20130177942) is expressed from a triple promoter at the amyE locus, the pBC16-derived orf beta and the B. subtilis comS gene (and a kanamycin resistance gene) are expressed from a triple promoter at the air locus (making the strain D-alanine requiring), and the B. subtilis comS gene (and a cat gene) are expressed from a triple promoter at the pel locus.

Bacillus subtilis JA1343: JA1343 is a sporulation negative derivative of PL1801 (WO 2005042750). Part of the gene spollAC has been deleted to obtain the sporulation negative phenotype.

The temperature-sensitive plasmids used in this patent was incorporated into the genome of B. licheniformis by chromosomal integration and excision according to the method previously described (U.S. Patent No. 5,843,720). B. licheniformis transformants containing plasmids were grown on LBPG selective medium with erythromycin at 50°C to force integration of the vector at identical sequences to the chromosome. Desired integrants were chosen based on their ability to grow on LBPG + erythromycin selective medium at 50°C. Integrants were then grown without selection in LBPG medium at 37°C to allow excision of the integrated plasmid. Cells were plated on LBPG plates and screened for erythromycin-sensitivity. The sensitive clones were checked for correct integration of the desired construct.

Strains

JA1343: This strain is the B. subtilis PL1801 with a disrupted spollAC gene (sigF). The genotype is: aprE, nprE, amyE, spollAC

PP3724: Containing pLS20, wherein the methylase gene M.blil 904II (US20130177942) is expressed from a triple promoter at the amyE locus, the pBC16-derived orf beta and the B. subtilis comS gene (and a kanamycin resistance gene) are expressed from a triple promoter at the air locus (making the strain D-alanine requiring), and the B. subtilis comS gene (and a cat gene) are expressed from a triple promoter at the pel locus.

AN1914: Bacillus licheniformis BKQ1879/Absn

AN 1936: Bacillus licheniformis BKQ1879/Absn, AyhcR

BKQ1879: Bacillus licheniformis A(amyL, aprL, mprL, catL, cypX, ggt, gntP, sacB, spollAC, forD).

SJ1904: Bacillus licheniformis ATCC PTA-7992

pAN883: This plasmid is a pE194 derivative (Plasmid isolated from Staphylococcus aureus (Horinouchi and Weisblum, 1982). It contains a temperature sensitive origin of replication and an erythromycin resistance gene.

Primers

Table 12: Primer and sequence overview

102 ATACTC C C C GTG CAG ATAC C C G C ACTG C C AG AC GAG C GTG AAG A

AN2061 GCGC

AN2062 103 TTTCAGCGGCCGCGCATAAATAATATAGCGCTCAGGCGC

Example 21 a. Construction of a Bacillus licheniformis host strain BKQ1879 for deletion of dsRNA destabilizing ribonucleases

A Bacillus licheniformis host strain was developed as a starting host for dsRNA expression. The strain was developed from Bacillus licheniformis SJ1904 and has deletions in the amyL, the aprL, the mprL, the catL, the cypX, the ggt, the gntP, the sacB, the spollAC loci, and has an inactivating mutation at the forD locus.

None of these additional modifications have any relevance for the demonstration of the dsRNA stabilizing effect of the bsn and yhcR deletions.

Example 21 b. Deletion of the gene encoding RNAse Bsn (bsn) in B. licheniformis BKQ1879.

By performing SOE-PCR with the primers and templates listed in Table 13, a linear DNA construct with a bsn deletion was constructed by the joining of bsn-upstream and bsn- downstream regions (SEQ ID NO:104). The SOE-PCR product was digested with restriction enzymes Bglll and NotI and ligated to the temperature sensitive plasmid vector pAN883 cut with the same enzymes (SEQ ID NO:105). The resulting plasmid was established by standard transformation methods in Bacillus subtilis JA1343 and named pAN1905 (SEQ ID NO:106). Table 13: SOE-PCR strategy for deletion of the bsn gene of BKQ1879

pAN1905 DNA was introduced into B. licheniformis BKQ1879 by conjugation from B. subtilis, essentially as previously described (EP2029732 B1 ), using a modified B. subtilis donor strain PP3724. pAN1905 was incorporated into the genome of BKQ1879 by chromosomal integration and excision according to the method previously described (U.S. Patent No.

5,843,720). Following the integration-excision process, the cells were plated on LBPG plates and screened for erythromycin-sensitivity. The sensitive clones were checked for integration of the bsn deletion and a correct clone was named AN1914. Example 21c. Deletion of the gene encoding RNAse YhcR (yhcR) in B. licheniformis AN 1914.

By performing SOE-PCR with the primers and templates listed in Table 14, a linear DNA construct with an yhcR deletion was constructed by the joining of yhcR-upstream and yhcR- downstream regions (SEQ ID NO:107). The SOE-PCR product was digested with restriction enzymes Bglll and Notl and ligated to the temperature sensitive plasmid vector pAN883 cut with the same enzymes (SEQ ID NO:105). The resulting plasmid was established by standard transformation methods in Bacillus subtilis JA1343 and named pAN1932 (SEQ ID NO:108).

Table 14: SOE-PCR strategy for deletion of the yhcR gene of AN1914

pAN1932 DNA was introduced into B. licheniformis AN1914 by conjugation from B. subtilis, essentially as previously described (EP2029732 B1 ), using a modified B. subtilis donor strain PP3724. pAN1905 was incorporated into the genome of BKQ1879 by chromosomal integration and excision according to the method previously described (U.S. Patent No. 5,843,720). Following the integration-excision process, the cells were plated on LBPG plates and screened for erythromycin-sensitivity. The sensitive clones were checked for integration of the yhcR deletion and a correct clone was named AN 1936.

Example 21 d. Measurements of dsRNA stability in cultures of different RNAse deficient B. licheniformis strains.

Studies of dsRNA3 (SEQ ID NO:89, synthetic dsRNA) incubated in cultures of BKQ1879 and AN1936 revealed increased survival of dsRNA3 in the RNAse deleted strain AN1936. 2 μg of dsRNA3 was incubated in 200 μΙ (Table 15) o/n culture and incubated at 37°C for up to 5 days. 20 μΙ samples were withdrawn for agarose gel electrophoresis at the time points indicated in Table 15.

Table 15: Survival of dsRNA in overnight cultures of RNAse deficient strains of B. subtilis; stability ranges from less than 5 minutes survival to full survival at 72 hours. Note: The Δ genotype-label signifies that the gene has been deleted. Strain RNAse deletion 5 min 30 min 4 hr's 24 hr's 48 hr's 72 hr's

BKQ1879 wt ++++ ++++ + - - -

AN 1936 Absn, AyhcR ++++ ++++ ++++ ++++ ++++ ++++