HUMAN MONOCARBOXYLATE TRANSPORTER 1 ANTIBODIES AND USES THEREOF The present disclosure is in the field of medicine. Particularly, the present disclosure relates to antibodies that specifically bind human monocarboxylate transporter 1 (MCT1) (“anti- human MCT1 antibodies”), compositions comprising such anti-human MCT1 antibodies, and methods of using such anti-human MCT1 antibodies. The monocarboxylate transporter 1 (also known as MCT1, SLC16A1, HHF7, MCT, MCT1D, or “solute carrier family 16 member 1”) is a multi-pass transmembrane protein responsible for the facilitated transport of critical metabolites, including products of glycolysis. MCT1 is a member of one of the largest family of surface membrane proteins, known as solute channel proteins (SLCs), whose functions involve the transport across membranes of critical cellular nutrients, metabolites, ions, hormones, and lipids. MCT1 belongs to the SLC16 family of transporters, five of which have been shown to transport monocarboxylates, such as pyruvate, lactate, and ketones (such as acetoacetate and β-hydroxybutyrate), in a facilitated, pH dependent and bidirectional manner. SLC16 family of transporters SLC16A1 (MCT1), SLC16A7 (MCT2), SLC16A8 (MCT3) and SLC16A3 (MCT4) have all been shown to transport monocarboxylates with Km in the 1 to 40 mM range (Halestrap AP, IUBMB Life.2012;64(1):1-9). MCT1, MCT3 and MCT4 are co-expressed with the Ig-domain containing surface protein CD147 (Basigin), which in many cells is critical for proper cell surface expression. MCT1 is especially relevant to the transport of lactate in T and B cells (Fischer K, et al., Blood.2007;109(9):3812-9). Immune cells undergo shifts in their metabolic demand throughout growth, and require specific metabolic states for employing their effector functions. For example, both glycolysis and mitochondrial oxidative metabolism are elevated in CD4 ⁺ T cells from lupus-prone B6.Sle1.Sle2.Sle3 (TC) mice as compared to non-autoimmune controls (Yin Y, et al., Sci Transl Med.2015;7(274):274ra18). Treatment of the TC mice with a combination of the mitochondrial metabolism inhibitor metformin and the glucose metabolism inhibitor 2-Deoxy-D-glucose (2DG) normalized T cell metabolism and reversed disease biomarkers (Yin Y, et al., Sci Transl Med. 2015;7(274):274ra18). Both metformin and 2DG also reduced IFNγ production in vitro (Yin Y, et al., Sci Transl Med.2015;7(274):274ra18). Blocking the export of lactate reduces flux through the glycolytic pathway and, by altering Myc, can shift T cells away from effector functions (Doherty JR, et al., Cancer Research.2014;74(3):908-20; Wang R, et al., Immunity. 2011;35(6):871-82). Individuals with homozygous MCT1 loss-of-function (LOF) mutations were identified under stress (infection, starvation) due to alterations in ketone utilization and metabolism; adult humans deficient in MCT1 are otherwise healthy (van Hasselt PM, N Engl J Med.2014, 371(20):1900-7; Balasubramaniam S, et al., JIMD Rep.2016;29:33-8). Infants presented with ketone utilization defects and, sometimes, exercise intolerance. These various symptoms disappeared as they aged, possibly due to growth of skeletal muscle mass during adolescence. Heterozygous family members of individuals with homozygous MCT1 mutations had no history of ketoacidosis, suggesting that LOF mutations cause ketoacidosis only in conjunction with additional genetic/environmental factors (Balasubramaniam S, et al., JIMD Rep.2016, 29:33-8). Outside the immune system, MCT1 is expressed in multiple organs, including skeletal muscle, kidney, liver, testis, heart, and brain, along with other MCTs. The absence of broad toxicity in individuals with MCT1 mutations is likely due to the redundancy of MCTs. For example, MCT1, MCT2 & MCT4 are all expressed in the retina (Philp NJ, Investigative Ophthalmology & Visual Science.2003, 44(3):1305-11), and no retinal defects were observed in MCT1-deficient individuals suggesting functional redundancy. At this time, no overt immune deficiencies have been observed in MCT1-deficient individuals. Additionally, MCT1-deficient humans do not present with any red blood cell dysfunction. Given the broad expression of MCTs across many tissues, small molecule MCT inhibitors have been developed. However, many of these small molecule approaches hit multiple MCTs, posing off target toxicities, including tissue toxicities. As such, there remains a need for therapies that selectively and specifically target MCT1. Antibodies targeting MCT1 have been disclosed for example, as set forth in WO19136300. However, to date, no known antibody that specifically binds human MCT1 has been approved for therapeutic use or is in clinical development. Therefore, there remains a need for antibodies that selectively and specifically bind human MCT1, have desirable developability and patient safety profiles, and can be used for treatment of MCT1 associated disorders, such as autoimmune conditions. DETAILED DESCRIPTION The present disclosure provides antibodies that selectively and specifically bind human MCT1 and inhibit MCT1-mediated responses (e.g., metabolite transport, T cell and B cell proliferation), and/or drive differentiation of regulatory T cells; and compositions comprising such MCT1 antibodies, and methods of using such MCT1 antibodies and compositions. Particularly, the present disclosure provides anti-human MCT1 antibodies that specifically bind human MCT1, have desirable binding affinities, inhibit MCT1 mediated responses, have desirable developability and/ or patient safety profiles, such as having low immunogenicity risk. Desirable developability profiles further reduce potentially complex and costly changes in downstream analytical and manufacturing processes. The anti-human MCT1 antibodies as disclosed herein, can be used to treat MCT1 associated disorders such as, autoimmune conditions (e.g., systemic lupus erythematosus, inflammatory bowel disease, rheumatoid arthritis, psoriasis, or multiple sclerosis), allergic conditions, inflammatory conditions, metabolic disorders, transplant or cell therapy recipients, MCT1-positive cancers, exercise-induced hyperinsulinism (EIHI) conditions, and/ or polycystic kidney disease (ADPKD). As such, the anti-human MCT1 antibodies provided herein have one or more of the following properties: 1) specifically bind human MCT1 with desirable binding affinities, 2) inhibit MCT1 mediated metabolite transport, 3) inhibit CD4 and CD8 T cell proliferation, 4) inhibit B cell proliferation, 5) drive differentiation of regulatory T cells (e.g., Foxp3+ regulatory T cells), 6) do not significantly induce effector function mediated killing (e.g., ADCC, ADCP) or neutrophil activation in vitro, 7) do not significantly induce complement mediated activity, 8) low immunogenicity risk, 9) low in culture oxidation and/ or degradation, 10) low to no detectable human serum protein binding, 11) low hydrophobicity, 12) desirable properties such as stability, solubility, and low nonspecific interactions e.g., binding to analytical column resin, providing desirable developability and patient safety profiles for use in the treatment of MCT1-associated disorders. In some embodiments, the anti-human MCT1 antibodies as disclosed herein are fully humanized antibodies. In some embodiments, the anti-human MCT1 antibodies as disclosed herein specifically bind human and/ or cynomolgus MCT1. In some embodiments, the anti- human MCT1 antibodies as disclosed herein, comprise particular combinations of framework amino acid sequences which support, and allow for optimal presentation of the particular CDR amino acid sequences as disclosed herein. In some embodiments, such anti-human MCT1 antibodies have desirable binding affinities and functional activity, such as those described herein. In further embodiments, the anti-human MCT1 antibodies as disclosed herein, specifically bind human MCT1 and inhibit metabolite transport (e.g., lactate, pyruvate, ketones), and T cell and/ or B cell proliferation. In further embodiments, the anti-human MCT1 antibodies as disclosed herein, specifically bind human MCT1 and drive differentiation of regulatory T cells. In such embodiments, increase in regulatory T cells by the anti-human MCT1 antibodies of the disclosure results in inhibition of autoimmune responses. In further embodiments, anti- human MCT1 antibodies as disclosed herein, have desirable developability and/ or patient safety profiles such as acceptable immunogenicity risk, reduced or eliminated: oxidation and in culture degradation; nonspecific serum protein binding (e.g., serum IgG, apolipoprotein), and/ or hydrophobicity. These desirable developability profiles indicate reduced risk of aggregation and/ or loss of yield, reduced risk of faster clearance, desirable pharmacokinetic profile, solubility, stability, and/ or reduced challenges in downstream purification and analytical processes. In yet other embodiments, the anti-human MCT1 antibodies of the present disclosure do not significantly induce effector function mediated killing and/ or C1q complement activity. Accordingly, in some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 30, the HCDR2 comprises SEQ ID NO: 31, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 34, and a VL comprising SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof comprises a HC comprising SEQ ID NO: 36, and a LC comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 40, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 41, and a VL comprises SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof comprises a HC comprising SEQ ID NO: 42, and a LC comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 30, the HCDR2 comprises SEQ ID NO: 44, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 45, and a VL comprises SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof comprises a HC comprising SEQ ID NO: 46, and a LC comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises the HCDR1 comprises SEQ ID NO: 48, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 49, and a VL comprising SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof comprises a HC comprising SEQ ID NO: 50, and a LC comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 52, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof, comprises a VH comprising SEQ ID NO: 53, and a VL comprising SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof comprises a HC comprising SEQ ID NO: 54, and a light chain (LC) comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 30, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 56, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments the antibody or antigen binding fragment thereof, comprises a VH comprising SEQ ID NO: 57, and a VL comprising SEQ ID NO: 35. In some embodiments the antibody or antigen binding fragment thereof, comprises a heavy chain (HC) comprising SEQ ID NO: 58, and a light chain (LC) comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 60, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof, comprises a VH comprising SEQ ID NO: 61, and a VL comprising SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof comprises a HC comprising SEQ ID NO: 62, and a LC comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 30, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 64, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof, comprises a VH comprising SEQ ID NO: 65, and a VL comprising SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof, comprises a HC comprising SEQ ID NO: 66, and a LC comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 30, HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 68, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 69, and a VL comprising SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof, comprises a HC comprising SEQ ID NO: 70, and a LC comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 30, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 72, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 73, and a VL comprising SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof, comprises a HC comprising SEQ ID NO: 74, and a LC comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 76, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 77, and a VL comprising SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof, comprises a HC comprising SEQ ID NO: 78, and a LC comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 80, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 81, and a VL comprising SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof, comprises a HC comprising SEQ ID NO: 82, and a LC comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 84, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 85, and a VL comprising SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof, comprises a HC comprising SEQ ID NO: 86, and a LC comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 30, the HCDR2 comprises SEQ ID NO: 88, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 89, and a VL comprising SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof, comprises a HC comprising SEQ ID NO: 90, and a LC comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 30, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 72, the LCDR1 comprises SEQ ID NO: 4, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 73, and a VL comprising SEQ ID NO: 8. In some embodiments, the antibody or antigen binding fragment thereof, comprises a HC comprising SEQ ID NO: 74, and a LC comprising SEQ ID NO: 10. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 30, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 68, the LCDR1 comprises SEQ ID NO: 4, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 69, and a VL comprising SEQ ID NO: 8. In some embodiments, the antibody or antigen binding fragment thereof, comprises a HC comprising SEQ ID NO: 70, and a LC comprising SEQ ID NO: 10. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 40, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 60, SEQ ID NO: 76, SEQ ID NO: 80 or SEQ ID NO: 84, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 41, 49, 53, 61, 77, 81 or 85 and the VL comprises SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof, comprises a HC comprising SEQ ID NO: 42, 50, 54, 62, 78, 82, or 86 and a LC comprising SEQ ID NO: 37. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 97, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, Xaa ₂ of SEQ ID NO: 97 is Valine or Arginine, Xaa ₇ of SEQ ID NO: 97 is Arginine or Leucine, Xaa9 of SEQ ID NO: 97 is Asparagine or Glycine, Xaa10 of SEQ ID NO: 97 is Tyrosine or Isoleucine, Xaa12 of SEQ ID NO: 97 is Leucine or Isoleucine, and Xaa13 of SEQ ID NO: 97 is Glutamine, Valine or Glycine. In some embodiments the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 41, 49, 53, 61, 77, 81 or 85 and the VL comprises SEQ ID NO: 35. In some embodiments, the antibody or antigen binding fragment thereof, comprises a HC comprising SEQ ID NO: 42, 50, 54, 62, 78, 82, or 86 and a LC comprising SEQ ID NO: 37. In such embodiments, the anti-human MCT1 antibodies as disclosed herein have desirable binding and functional activity. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 30, the HCDR2 comprises SEQ ID NO: 44 or SEQ ID NO: 88, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 45 or 89 and the VL comprises SEQ ID NO: 35. In some embodiments the antibody or antigen binding fragment thereof comprises a HC comprising SEQ ID NO: 46 or 90 and a LC comprising SEQ ID NO: 37. In such embodiments, the anti- human MCT1 antibodies as disclosed have desirable binding and functional activity. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 30, the HCDR2 comprises SEQ ID NO: 98, the HCDR3 comprises SEQ ID NO: 32, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, Xaa4 of SEQ ID NO: 98 is Arginine or Serine, and Xaa9 of SEQ ID NO: 98 is Isoleucine or Glutamic Acid, and Xaa13 of SEQ ID NO: 98 is Glutamic Acid or Arginine. In some embodiments the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 45 or 89 and the VL comprises SEQ ID NO: 35. In some embodiments the antibody or antigen binding fragment thereof comprises a HC comprising SEQ ID NO: 46 or 90 and a LC comprising SEQ ID NO: 37. In such embodiments, the anti-human MCT1 antibodies as disclosed herein have desirable binding and functional activity. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 30, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 56, SEQ ID NO: 64, SEQ ID NO: 68, or SEQ ID NO: 72, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 57, 65, 69, or 73 and the VL comprises SEQ ID NO: 35. In some embodiments the antibody or antigen binding fragment thereof comprises a HC comprising SEQ ID NO: 58, 66, 70, or 74 and a LC comprising SEQ ID NO: 37. In such embodiments, the anti-human MCT1 antibodies as disclosed herein have desirable binding and functional activity. In some embodiments, the present disclosure provides an antibody or antigen binding fragment thereof, that specifically binds human MCT1, and comprises a VH and VL, wherein the VH comprises heavy chain complementarity determining regions HCDR1, HCDR2, and HCDR3, and the VL comprises light chain complementarity determining regions LCDR1, LCDR2, and LCDR3, wherein the HCDR1 comprises SEQ ID NO: 30, the HCDR2 comprises SEQ ID NO: 2, the HCDR3 comprises SEQ ID NO: 99, the LCDR1 comprises SEQ ID NO: 33, the LCDR2 comprises SEQ ID NO: 5, and the LCDR3 comprises SEQ ID NO: 6. In some embodiments, Xaa ₄ of SEQ ID NO: 99 is Arginine or Leucine, and Xaa ₆ of SEQ ID NO: 99 is Histidine, Arginine, or Tyrosine, and Xaa20 of SEQ ID NO: 99 is Alanine or Proline. In some embodiments the antibody or antigen binding fragment thereof comprises a VH comprising SEQ ID NO: 57, 65, 69, or 73 and the VL comprises SEQ ID NO: 35. In some embodiments the antibody or antigen binding fragment thereof comprises a HC comprising SEQ ID NO: 58, 66, 70, or 74 and a LC comprising SEQ ID NO: 37. In such embodiments, the anti-human MCT1 antibodies as disclosed herein have desirable binding and functional activity. In some embodiments, the present disclosure provides an antibody comprising a heavy chain (HC) and a light chain (LC), wherein the HC and the LC comprise the following amino acid sequences: a. the HC comprises SEQ ID NO: 9 and the LC comprises SEQ ID NO: 10; b. the HC comprises SEQ ID NO: 9 and the LC comprises SEQ ID NO: 15; c. the HC comprises SEQ ID NO: 19 and the LC comprises SEQ ID NO: 15; d. the HC comprises SEQ ID NO: 23 and the LC comprises SEQ ID NO: 24; or e. the HC comprises SEQ ID NO: 28 and the LC comprises SEQ ID NO: 24. In some embodiments, the present disclosure provides an antibody comprising a heavy chain (HC) comprising SEQ ID NO: 9, 19, 23, or 28, and a light chain (LC) comprising SEQ ID NO: 10, 15, or 24. In some embodiments, the present disclosure provides an antibody comprising a heavy chain comprising SEQ ID NO: 9, and a light chain comprising SEQ ID NO: 10. In some embodiments, the present disclosure provides an antibody comprising a heavy chain comprising SEQ ID NO: 9, and a light chain comprising SEQ ID NO: 15. In some embodiments, the present disclosure provides an antibody comprising a heavy chain comprising SEQ ID NO: 19, and a light chain comprising SEQ ID NO: 15. In some embodiments, the present disclosure provides an antibody comprising a heavy chain comprising SEQ ID NO: 23, and a light chain comprising SEQ ID NO: 24. In some embodiments, the present disclosure provides an antibody comprising a heavy chain comprising SEQ ID NO: 28, and a light chain comprising SEQ ID NO: 24. In some embodiments, the present disclosure provides an antibody comprising a heavy chain variable region (VH) comprising SEQ ID NO: 7, 18, 21, or 27, and a light chain variable region (VL) comprising SEQ ID NO: 8, 13, or 22. In some embodiments, the VH comprises SEQ ID NO: 7 and the VL comprises SEQ ID NO: 8. In some embodiments, the VH comprises SEQ ID NO: 7 and the VL comprises or SEQ ID NO: 13. In some embodiments, the VH comprises SEQ ID NO: 18 and the VL comprises SEQ ID NO: 13. In some embodiments, the VH comprises SEQ ID NO: 21 and a VL comprises SEQ ID NO: 22. In some embodiments, the VH comprises SEQ ID NO: 27 and a VL comprises SEQ ID NO: 22. In some embodiments, the anti-human MCT1 antibodies as disclosed herein, have modified variable regions. In some embodiments, the modifications are in the VH. In some embodiments, the modifications are in the VL. In some embodiments, the modifications are in the VH and VL. In some embodiments, the anti-human MCT1 antibodies as disclosed herein, have different human framework regions. In some embodiments the VH and the VL of the anti- human MCT1 antibodies as disclosed herein, comprise of a specific combination of framework amino acid sequences to support the particular CDR amino acid sequences as disclosed herein. In some embodiments the VH and the VL of the anti-human MCT1 antibodies as disclosed herein, have a specific combination of framework amino acid sequences, that allow for optimal presentation of the CDR amino acid sequences as disclosed herein. In some embodiments, the specific combination of framework amino acid sequences as provided herein support the particular CDR amino acid sequences provided herein, and allow for optimal presentation of the CDR amino acid sequences, providing desirable binding affinity and functional activity of the antibodies (e.g., inhibition of metabolite transport and B and/ or T cell proliferation, and drive regulatory T cell differentiation) and/ or developability properties and/ or improved patient safety. Accordingly, in some embodiments, the anti-human MCT1 antibodies of the present disclosure have improved developability and/ or safety profiles when compared to MCT1 antibodies known in the art, e.g., INX444 as described in WO19136300. In such embodiments, the anti-human MCT1 antibodies as disclosed herein have reduced immunogenicity risk when compared to INX444. In yet other embodiments, the anti-human MCT1 antibodies as disclosed herein have reduced oxidation and in culture degradation when compared to INX444. In yet other embodiments, the anti-human MCT1 antibodies as disclosed herein have eliminated or reduced nonspecific human serum protein binding when compared to INX444. In yet other embodiments, the anti-human MCT1 antibodies as disclosed herein have reduced nonspecific interactions, such as binding to purification column resin, when compared to INX444. In further embodiments, the anti-human MCT1 antibodies as disclosed herein have reduced hydrophobicity, when compared to INX444. As such, the anti-human MCT1 antibodies as disclosed herein have reduced challenges in downstream purification and analytical processes, and/ or improved pharmacokinetic profiles when compared to INX444. In some embodiments, the anti-human MCT1 antibodies as disclosed herein, have a modified human IgG1 or human IgG4 constant region. In some embodiments, the anti-human MCT1 antibody as disclosed herein, has a modified Fc region (e.g., a modified IgG1, IgG2, IgG3 or IgG4 Fc region) that has reduced or eliminated Fc effector functions. Such anti-human MCT1 antibodies as described herein show reduced or eliminated binding to the FcγR receptors, thus have reduced cytotoxicity, when compared to the antibodies comprising the wild type IgG Fc region. Patient safety can be improved with sufficiently reduced or eliminated effector functions of such anti-human MCT1 antibodies comprising a modified Fc region. In some embodiments, the anti-human MCT1 antibody has a human IgG1 isotype. In such embodiments, the anti-human MCT1 antibodies described herein have a modified IgG1 Fc region having eliminated Fc effector functions, i.e., IgG1 Fc effector null. For example, such anti-human MCT1 antibodies comprise an IgG1 Fc region comprising amino acid substitutions L234A, L235E, G237A, A330S, and P331S show reduced binding to FcγR and C1q receptors (all amino acid residues are numbered according to the EU Index numbering). In some embodiments the anti-human MCT1 antibodies described herein have a modified human IgG1 Fc region comprising an alanine at residue 234, a glutamic acid at residue 235, an alanine at residue 237, a serine at residue 330, and a serine at residue 331 (all residues are numbered according to the EU Index numbering) also referred to as IgG1EN Fc region. In other embodiments, the anti- human MCT1 antibodies describe herein have a modified human IgG1 Fc region comprising an alanine at residue 234, an alanine at residue 235, an arginine at residue 269, and an alanine at residue 322 (all residues are numbered according to the EU Index numbering) also referred to as INX LALA Fc region. Different allotypes (polymorphisms) of human IgG1, for example, G1m3, G1m17, G1m1 and G1m2 allotypes, have been described before (Jefferis R., et al., mAbs 1(4): 1-7, 2009; Webster C., et al., mAbs 2016, 8 (2): 253–263). The heavy chain of human IgG1 protein may express as G1m3, G1m17,1 or G1m17,1,2 allotype; no allotypes have been defined for IgG4 (Jefferis R., et al., mAbs 1(4): 1-7, 2009). In some embodiments, the anti-human MCT1 antibodies described herein comprise a heavy chain of the IgG1 G1m3 allotype, which comprises arginine at position 214, glutamate at position 356 and methionine at position 358 (all residues numbered according to the EU Index numbering). In some embodiments, the anti-human MCT1 antibodies described herein comprise a heavy chain of the IgG1 G1m17,1 allotype, which comprises lysine at position 214, aspartate at position 356, and leucine at position 358 (all residues numbered according to the EU Index numbering). Human MCT1 is expressed on activated T cells and B cells. The anti-human MCT1 antibodies described herein, upon binding to MCT1, reduce, suppress, diminish, or otherwise inhibit the MCT1 functions in MCT1 expressing cells, such as activated T cells and B cells. In such embodiments, the anti-human MCT1 antibody or antigen binding fragment thereof, binds human MCT1 and inhibits MCT1 mediated transport, CD4 and CD8 T cell proliferation and/ or B cell proliferation. In some embodiments, the anti-human MCT1 antibody or antigen binding fragment thereof, inhibits MCT1 mediated transport in T cells and leads to changes in T cell differentiation. Such changes in T cell differentiation may further enhance differentiation of regulatory T cells (Tregs). Regulation of regulatory T cells include, but are not limited to FoxP3 ⁺ and Foxp3- Tregs. In some embodiments, the antibody or antigen binding fragment thereof of the present disclosure binds human MCT1 and inhibits MCT1 mediated transport by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some embodiments, the antibody or antigen binding fragment thereof of the present disclosure binds human MCT1 and inhibits MCT1 mediated metabolite transport by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some embodiments, the antibody or antigen binding fragment thereof of the present disclosure binds human MCT1 and inhibits MCT1 mediated pyruvate transport by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some embodiments, the antibody or antigen binding fragment thereof of the present disclosure binds human MCT1 and inhibits MCT1 mediated lactate transport by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some embodiments, the antibody or antigen binding fragment thereof of the present disclosure binds human MCT1 on T cells and inhibits MCT1 mediated CD4 T cell proliferation by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some embodiments, the antibody or antigen binding fragment thereof of the present disclosure binds human MCT1 on T cells and inhibits MCT1 mediated CD8 T cell proliferation by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some embodiments, the antibody or antigen binding fragment thereof of the present disclosure binds human MCT1 on T cells and inhibits MCT1 mediated CD4 and CD8 T cell proliferation by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some embodiments, the antibody or antigen binding fragment thereof of the present disclosure binds human MCT1 on B cells and inhibits MCT1 mediated B cell proliferation by about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%. In some embodiments, the anti-human MCT1 antibodies of the present disclosure bind human MCT1 and inhibit human MCT1 mediated transport in a conformational dependent manner. In some embodiments the present disclosure provides nucleic acids encoding a heavy chain or light chain, or a VH or VL, of the novel anti-human MCT1 antibodies, or vectors comprising such nucleic acids. In some embodiments, the present disclosure provides a nucleic acid comprising a sequence of SEQ ID NO: 11, 20, 25, 29, 38, 43, 47, 51, 55, 59, 63, 67, 71, 75, 79, 83, 87, 91, 12, 17, 26, or 39. In some embodiments, nucleic acids encoding a heavy chain or light chain of the antibodies specifically binding human MCT1 are provided. In some embodiments nucleic acids comprising a sequence encoding SEQ ID NO: 9, 19, 23, 28, 36, 42, 46, 50, 54, 58, 62, 66, 70, 74, 78, 82, 86, 90, 10, 15, 24, or 37 are provided. In some embodiments, nucleic acids comprising a sequence encoding an antibody heavy chain that comprises SEQ ID NO: 9, 19, 23, 28, 36, 42, 46, 50, 54, 58, 62, 66, 70, 74, 78, 82, 86, or 90 are provided. For example, the nucleic acid can comprise a sequence selected from SEQ ID NO: 11, 20, 25, 29, 38, 43, 47, 51, 55, 59, 63, 67, 71, 75, 79, 83, 87, or 91. In some embodiments, nucleic acids comprising a sequence encoding an antibody light chain that comprises SEQ ID NO: 10, 15, 24, or 37 is provided. For example, the nucleic acid can comprise a sequence selected from SEQ ID NO:12, 17, 26, or 39. In some embodiments of the present disclosure, nucleic acids encoding a VH or VL of the antibodies specifically binding human MCT1 are provided. In some embodiments, nucleic acids comprising a sequence encoding SEQ ID NO: 7, 18, 21, 27, 34, 41, 45, 49, 53, 57, 61, 65, 69, 73, 77, 81, 85, 89, 8, 13, 22, or 35 are provided. In some embodiments, nucleic acids comprising a sequence encoding an antibody VH that comprises SEQ ID NO: 7, 18, 21, 27, 34, 41, 45, 49, 53, 57, 61, 65, 69, 73, 77, 81, 85, or 89 are provided. In some embodiments, nucleic acids comprising a sequence encoding an antibody VL that comprises SEQ ID NO: 8, 13, 22, or 35 are provided. Some embodiments of the present disclosure provide vectors comprising a nucleic acid sequence encoding an antibody heavy chain or light chain. For example, such vectors can comprise a nucleic acid sequence encoding SEQ ID NO: 9, 19, 23, 28, 36, 42, 46, 50, 54, 58, 62, 66, 70, 74, 78, 82, 86, or 90. In some embodiments, the vector comprises a nucleic acid sequence encoding SEQ ID NO: 10, 15, 24, or 37. Provided herein are also vectors comprising a nucleic acid sequence encoding an antibody VH or VL. For example, such vectors can comprise a nucleic acid sequence encoding SEQ ID NO: 7, 18, 21, 27, 34, 41, 45, 49, 53, 57, 61, 65, 69, 73, 77, 81, 85, or 89. In some embodiments, the vector comprises a nucleic acid sequence encoding SEQ ID NO: 8, 13, 22, or 35. Provided herein are also vectors comprising a first nucleic acid sequence encoding an antibody heavy chain and a second nucleic acid sequence encoding an antibody light chain. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 9, 19, 23, 28, 36, 42, 46, 50, 54, 58, 62, 66, 70, 74, 78, 82, 86, or 90. and a second nucleic acid sequence encoding SEQ ID NO: 10, 15, 24, or 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 9 and a second nucleic acid sequence encoding SEQ ID NO: 10. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 9 and a second nucleic acid sequence encoding SEQ ID NO: 15. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 19 and a second nucleic acid sequence encoding SEQ ID NO: 15. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 23 and a second nucleic acid sequence encoding SEQ ID NO: 24. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 28 and a second nucleic acid sequence encoding SEQ ID NO: 24. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 36 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 42 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 46 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 50 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 54 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 58 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 62 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 66 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 70 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 74 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 78 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 82 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 86 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 90 and a second nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 74 and a second nucleic acid sequence encoding SEQ ID NO: 10. In some embodiments, the vector comprises a first nucleic acid sequence encoding SEQ ID NO: 70 and a second nucleic acid sequence encoding SEQ ID NO: 10. Also provided are compositions comprising a first vector comprising a nucleic acid sequence encoding an antibody heavy chain, and a second vector comprising a nucleic acid sequence encoding an antibody light chain. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 9, 19, 23, 28, 36, 42, 46, 50, 54, 58, 62, 66, 70, 74, 78, 82, 86, or 90 and a second nucleic acid sequence encoding SEQ ID NO: 10, 15, 24, or 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 9 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 10. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 9 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 15. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 19 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 15. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 23 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 24. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 28 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 24. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 36 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 42 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 46 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 50 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 54 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 58 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 62 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 66 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 70 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 74 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 78 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 82 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 86 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 90 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 74 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 10. In some embodiments, the composition comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 70 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 10. Nucleic acids of the present disclosure may be expressed in a host cell, for example, after the nucleic acids have been operably linked to an expression control sequence. Expression control sequences capable of expression of nucleic acids to which they are operably linked are well known in the art. An expression vector may include a sequence that encodes one or more signal peptides that facilitate secretion of the polypeptide(s) from a host cell. Expression vectors containing a nucleic acid of interest (e.g., a nucleic acid encoding a heavy chain or light chain of an antibody) may be transferred into a host cell by well-known methods, e.g., stable or transient transfection, transformation, transduction or infection. Additionally, expression vectors may contain one or more selection markers, e.g., tetracycline, neomycin, and dihydrofolate reductase, to aide in detection of host cells transformed with the desired nucleic acid sequences. In another aspect, provided herein are cells, e.g., host cells, comprising the nucleic acids, vectors, or nucleic acid compositions described herein. A host cell may be a cell stably or transiently transfected, transformed, transduced or infected with one or more expression vectors expressing all or a portion of an antibody described herein. In some embodiments, a host cell may be stably or transiently transfected, transformed, transduced, or infected with an expression vector expressing HC and LC polypeptides of an antibody of the present disclosure. In some embodiments, a host cell may be stably or transiently transfected, transformed, transduced, or infected with a first vector expressing HC polypeptides and a second vector expressing LC polypeptides of an antibody described herein. Such host cells, e.g., mammalian host cells, can express the antibodies that specifically bind human MCT1 as described herein. Mammalian host cells known to be capable of expressing antibodies include CHO cells, HEK293 cells, COS cells, and NS0 cells. In some embodiments, the cell, e.g., host cell, comprises a vector comprising a first nucleic acid sequence encoding SEQ ID NO: 9, 19, 23, 28, 36, 42, 46, 50, 54, 58, 62, 66, 70, 74, 78, 82, 86, or 90 and a second nucleic acid sequence encoding SEQ ID NO: 10, 15, 24, or 37. In some embodiments, the cell, e.g., host cell, comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 9, 19, 23, 28, 36, 42, 46, 50, 54, 58, 62, 66, 70, 74, 78, 82, 86, or 90 and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 10, 15, 24, or 37. In some embodiments, the cell comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 9, 70, or 74, and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 10. In some embodiments the cell comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 9 or 19, and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 15. In some embodiments, the cell comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 23 or 28, and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 24. In some embodiments, the cell comprises a first vector comprising a nucleic acid sequence encoding SEQ ID NO: 36, 42, 46, 50, 54, 58, 62, 66, 70, 74, 78, 82, 86, or 90, and a second vector comprising a nucleic acid sequence encoding SEQ ID NO: 37. The present disclosure further provides a process for producing an antibody or antigen binding fragments thereof that specifically binds human MCT1 described herein by culturing the host cell described above, e.g., a mammalian host cell, under conditions such that the antibody is expressed and recovering the expressed antibody from the culture medium. The culture medium, into which an antibody has been secreted, may be purified by conventional techniques. Various methods of protein purification may be employed, and such methods are known in the art and described, for example, in Deutscher, Methods in Enzymology 182: 83-89 (1990) and Scopes, Protein Purification: Principles and Practice, 3rd Edition, Springer, NY (1994). The present disclosure further provides antibodies or antigen binding fragments thereof produced by any of the processes described herein. In another aspect, provided herein are pharmaceutical compositions comprising an antibody, nucleic acid, or vector described herein. Such pharmaceutical compositions can also comprise one or more pharmaceutically acceptable excipient, diluent, or carrier. Pharmaceutical compositions can be prepared by methods well known in the art (e.g., Remington: The Science and Practice of Pharmacy, 22nd ed. (2012), A. Loyd et al., Pharmaceutical Press). In some embodiments, the anti-human MCT1 antibodies, nucleic acids, vectors, or pharmaceutical compositions described herein can be used to inhibit activated T cells and/or B cells and to treat conditions associated with overactive T cells and B cells, such as autoimmunity, allergy, or inflammatory conditions. In some embodiments, the anti-human MCT1 antibodies, nucleic acids, vectors, or pharmaceutical compositions described herein can be used to increase the activity or numbers of regulatory T cells and to treat conditions associated with overactive T cells and B cells, such as autoimmunity, allergy, or inflammatory conditions. Such autoimmune, inflammatory, and allergic conditions include, for example, rheumatoid arthritis (RA), psoriatic arthritis, psoriasis, scleroderma, multiple sclerosis, lupus, inflammatory bowel disease (IBD), immune thrombocytopenia (ITP), diabetes, graft versus host disease (GvHD), sarcoidosis, allergic asthma, and hepatitis-associated hepatotoxicity. These anti-human MCT1 antibodies may also be used for treating transplant or cell therapy recipient by inhibiting unwanted T cell immune responses against transplanted cells, tissues or organs, such as tissue grafts, CAR-T cell therapy or gene therapy constructs or cells containing the constructs. In some embodiment, the present disclosure provides methods of treating an autoimmune condition in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an anti-human MCT1 antibody, a nucleic acid encoding such an antibody, a vector comprising such a nucleic acid, or a pharmaceutical composition comprising such an antibody as provided herein. Examples of autoimmune conditions include systemic lupus erythematosus, inflammatory bowel disease, rheumatoid arthritis, psoriasis, or multiple sclerosis. In further embodiment, the present disclosure provides methods of treating an allergic condition, inflammatory condition, metabolic disorder, transplant or cell therapy recipient, MCT1-positive cancer, exercise-induced hyperinsulinism (EIHI) condition, or polycystic kidney disease (ADPKD) in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an antibody, a nucleic acid encoding such an antibody, a vector comprising such a nucleic acid, or a pharmaceutical composition comprising such an antibody as provided herein. The antibodies, nucleic acids, vectors, or pharmaceutical compositions described herein may be administered by parenteral routes (e.g., subcutaneous, and intravenous). In some embodiment, the present disclosure provides anti-human MCT1 antibodies, nucleic acids, vectors, or pharmaceutical compositions described herein for use in therapy. Furthermore, the present disclosure also provides anti-human MCT1 antibodies, nucleic acids, vectors, cells, or pharmaceutical compositions described herein for use in the treatment of an autoimmune condition, an allergic condition, inflammatory condition, metabolic disorder, transplant, or cell therapy recipient, MCT1 positive cancer, EIHI condition, or ADPKD. In some embodiments, provided herein are anti-human MCT1 antibodies, nucleic acids, vectors, cells, or pharmaceutical compositions described herein for use in the treatment of an autoimmune condition, e.g., systemic lupus erythematosus, inflammatory bowel disease, rheumatoid arthritis, psoriasis or multiple sclerosis. In some embodiments, the present disclosure provides the use of an anti-human MCT1 antibodies, nucleic acid, vector, cell, or pharmaceutical composition described herein for use in the manufacture of a medicament for the treatment of an autoimmune condition, an allergic condition, inflammatory condition, metabolic disorder, transplant, or cell therapy recipient, MCT1 positive cancer, EIHI condition, or ADPKD. One potential advantage of the methods and therapeutic uses disclosed herein is the possibility of producing marked and/or prolonged relief in a patient suffering from an autoimmune condition, allergic disease, inflammatory condition, metabolic disorder, transplant or cell therapy recipient, MCT1 positive cancer, EIHI condition, or ADPKD, with an acceptable developability and/ or safety profile including acceptable immunogenicity, tolerability, toxicities and/or adverse events, so that the patient benefits from the treatment method overall. The term “MCT1” as used herein, unless stated otherwise, refers to any native, mature MCT1 that results from processing of an MCT1 precursor protein in a cell. The term includes MCT1 from any vertebrate source, including mammals such as primates (e.g., humans and cynomolgus or rhesus monkeys) and rodents (e.g., mice and rats), unless otherwise indicated. The term also includes naturally occurring variants of MCT1, e.g., splice variants or allelic variants. The amino acid sequence of an example of human MCT1 is known in the art, e.g., NCBI reference sequence number NP_003042.3 (SEQ ID NO: 95). The amino acid sequence of an example of cynomolgus monkey MCT1 is also known in the art, e.g., UniProt accession number A0A2K5VB69 (SEQ ID NO: 96). The term “human MCT1” is used herein to refer collectively to all known human MCT1 isoforms and polymorphic forms. The term “antibody,” as used herein, refers to an immunoglobulin molecule that binds an antigen. Embodiments of an antibody include a monoclonal antibody, polyclonal antibody, human antibody, humanized antibody, chimeric antibody, bispecific or multispecific antibody, or conjugated antibody. The antibodies can be of any class (e.g., IgG, IgE, IgM, IgD, IgA), and any subclass (e.g., IgG1, IgG2, IgG3, IgG4). An exemplary antibody is an immunoglobulin G (IgG) type antibody comprised of four polypeptide chains: two heavy chains (HC) and two light chains (LC) that are cross-linked via inter-chain disulfide bonds. The amino-terminal portion of each of the four polypeptide chains includes a variable region of about 100-125 or more amino acids primarily responsible for antigen recognition. The carboxyl-terminal portion of each of the four polypeptide chains contains a constant region primarily responsible for effector function. Each heavy chain is comprised of a heavy chain variable region (VH) and a heavy chain constant region. The heavy chain constant region refers to a region of an antibody, which comprises the Fc region and CH1 domain of the antibody heavy chain. Each light chain is comprised of a light chain variable region (VL) and a light chain constant region. The IgG isotype may be further divided into subclasses (e.g., IgG1, IgG2, IgG3, and IgG4). The numbering of the amino acid residues in the constant region is based on the EU index as in Kabat. Kabat et al, Sequences of Proteins of Immunological Interest, 5th edition, Bethesda, MD: U.S. Dept. of Health and Human Services, Public Health Service, National Institutes of Health (1991). The term EU Index numbering or EU numbering is used interchangeably herein. The VH and VL regions can be further subdivided into regions of hyper-variability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FR). The CDRs are exposed on the surface of the protein and are important regions of the antibody for antigen binding specificity. Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxyl-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Herein, the three CDRs of the heavy chain are referred to as “HCDR1, HCDR2, and HCDR3” and the three CDRs of the light chain are referred to as “LCDR1, LCDR2 and LCDR3”. The CDRs contain most of the residues that form specific interactions with the antigen. Assignment of amino acid residues to the CDRs may be done according to the well-known schemes, including those described in Kabat (Kabat et al., “Sequences of Proteins of Immunological Interest,” National Institutes of Health, Bethesda, Md. (1991)), Chothia (Chothia et al., “Canonical structures for the hypervariable regions of immunoglobulins”, Journal of Molecular Biology, 196, 901-917 (1987); Al-Lazikani et al., “Standard conformations for the canonical structures of immunoglobulins”, Journal of Molecular Biology, 273, 927-948 (1997)), North (North et al., “A New Clustering of Antibody CDR Loop Conformations”, Journal of Molecular Biology, 406, 228-256 (2011)), or IMGT (the international ImMunoGeneTics database available on at www.imgt.org; see Lefranc et al., Nucleic Acids Res.1999; 27:209-212). The CDR regions of the anti-human MCT1 antibodies described herein, are defined by a combination of the definitions described above. Embodiments of the present disclosure also include antibody fragments or antigen binding fragments, which comprise at least a portion of an antibody retaining the ability to specifically interact with an antigen such as Fab, Fab’, F(ab’)2, Fv fragments, scFv, scFab, disulfide-linked Fvs (sdFv), a Fd fragment or linear antibodies, which may be for example, fused to an Fc region or an IgG heavy chain constant region. The term “Fc region” as used herein, refers to a region of an antibody, which comprises the CH2 and CH3 domains of the antibody heavy chain. Optionally, the Fc region may include a portion of the hinge region or the entire hinge region of the antibody heavy chain. Biological activities such as effector function are attributable to the Fc region, which vary with the antibody isotype. Examples of antibody effector functions include, Fc receptor binding, antibody- dependent cell mediated cytotoxicity (ADCC), antibody-dependent cell mediated phagocytosis (ADCP), C1q binding, complement dependent cytotoxicity (CDC), phagocytosis, down regulation of cell surface receptors (e.g. B cell receptor); and B cell activation. The term “Fc receptor” or “FcR” describes a receptor that binds to the Fc region of an antibody. In some embodiments, the FcR is a native sequence human FcR. An “Fc gamma receptor” or “FcγR” is an FcR that binds an IgG antibody and includes receptors of the FcγRI, FcγRII, and FcγRIII subclasses, including allelic variants and alternatively spliced forms of these receptors. FcγRII receptors include FcγRIIA (an “activating receptor”) and FcγRIIB (an “inhibiting receptor”), which have amino acid sequences that differ primarily in the cytoplasmic domains thereof. FcRs are reviewed in Ravetch and Kinet, Ann. Rev. Immunol., 9:457-92 (1991); Capel et al., Immunomethods, 4:25-34 (1994); and de Haas et al, J. Lab. Clin. Med., 126:330-41 (1995). The terms “bind” and “binds” as used herein, are intended to mean, unless indicated otherwise, the ability of a protein or molecule to form a chemical bond or attractive interaction with another protein or molecule, which results in proximity of the two proteins or molecules as determined by common methods known in the art. The terms “nucleic acid” as used herein, refer to polymers of nucleotides, including single-stranded and / or double-stranded nucleotide-containing molecules, such as DNA, cDNA, and RNA molecules, incorporating native, modified, and / or analogs of, nucleotides. Polynucleotides of the present disclosure may also include substrates incorporated therein, for example, by DNA or RNA polymerase or a synthetic reaction. The term “subject” as used herein, refers to a mammal, including, but are not limited to, a human, chimpanzee, ape, monkey, cattle, horse, sheep, goat, swine, rabbit, dog, cat, rat, mouse, guinea pig, and the like. Preferably, the subject is a human. The term “therapeutically effective amount”, as used herein, refers to an amount of a protein or nucleic acid or vector or composition that will elicit the biological or medical response of a subject, for example, reduction or inhibition of an enzyme or a protein activity, or ameliorate symptoms, alleviate conditions, slow or delay disease progression, or prevent a disease, etc. In a non-limiting embodiment, the term “a therapeutically effective amount” refers to the amount necessary (at dosages and for periods of time and for the means of administration) of a protein or nucleic acid or vector or composition that, when administered to a subject, is effective to at least partially alleviate, inhibit, prevent and/or ameliorate a condition, or a disorder or a disease to achieve the desired therapeutic result. A therapeutically effective amount of the protein or nucleic acid or vector or composition may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the protein or nucleic acid or vector or composition to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the protein or nucleic acid or vector or composition of the present invention are outweighed by the therapeutically beneficial effects. The term “inhibits” as used herein, refers to for example, a reduction, lowering, slowing, decreasing, stopping, disrupting, abrogating, antagonizing, or blocking of a biological response or activity, but does not necessarily indicate a total elimination of a biological response. The term “treatment” or “treating” as used herein, refers to all processes wherein there may be a slowing, controlling, delaying, or stopping of the progression of the disorders or disease disclosed herein, or ameliorating disorder or disease symptoms, but does not necessarily indicate a total elimination of all disorder or disease symptoms. Treatment includes administration of a protein or nucleic acid or vector or composition for treatment of a disease or condition in a patient, particularly in a human. The term "about" as used herein, means within 5%. As used herein, the term “a”, “an”, “the”, and similar terms used in the context of the present disclosure (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context. BRIEF DESCRIPTION OF THE DRAWINGS FIGs.1 shows anti-human MCT1 antibody Ab1 binds human MCT1 and increases regulatory T cell differentiation in a concentration dependent manner. FIGs.2A, 2B, and 2C shows anti-human MCT1 antibody Ab6 does not significantly elicit ADCC (3A) or ADCP (3B) Fc-mediated effector function activity, or CDC (3C) activity. FIGs.3A and 3B show the preparative size exclusion chromatography (SEC) chromatograms of anti-human MCT1 antibody Ab1 (1A) and INX444 antibodies (1B) after cell culture and affinity capture. FIG.4 shows an overlay of analytical SEC chromatograms comparing the retention times of anti-human MCT1 antibody Ab1 and INX444 IgG1EN. FIG.5 shows anti-human MCT1 antibody Ab1 treated mice exhibit protection from weight loss in a GvHD mouse model. FIG.6. shows anti-human MCT1 antibody Ab6 treated mice exhibit protection from weight loss in a GvHD mouse model. EXAMPLES The following examples are offered to illustrate, but not to limit, the claimed invention. Example 1: Antibody generation and engineering of humanized MCT1 Antibodies (anti- human MCT1 antibodies). Antibody engineering and generation: Humanized MCT1 antibodies were generated by engineering and empirical testing of anti-MCT1 parental rat monoclonal antibody M1056 (described in WO19136300) through humanization and CDR engineering. Previously described monoclonal antibody INX444 [described in WO19136300] was derived from parent rat antibody M1056 through humanization, CDR engineering, and light chain shuffling. However, analysis of INX444 identified several developability challenges and risk factors. Significant oxidation and clipping were observed in cell culture, instability due to oxidation, were observed for INX444 non-specific interactions with column resin and serum proteins, creating challenges in downstream analytical and manufacturing processes, which impact potential clinical development and or commercial potential of this antibody. Further, rapid clearance and high immunogenicity risk of INX444 were observed. The VH and VL sequences of INX444 each contain at least five non-human framework residues, as well as CDR mutations introduced into the VH parent rat antibody sequence and non-parental VL CDR segments introduced by light chain shuffling. To overcome the developability challenges and immunogenicity disadvantages of INX444, an extensive humanization, and engineering approach was taken to de novo humanize and engineer the parental rat M1056 antibody. Following framework replacement, the newly humanized antibodies (anti-human MCT1 antibodies) were engineered in their CDRs, and IgG constant regions to further improve desired properties. The anti-human MCT1 antibodies described herein can be synthesized and purified by well-known methods. An appropriate host cell, such as Chinese hamster ovarian cells (CHO), can be either transiently or stably transfected with an expression system for secreting antibodies using a predetermined HC:LC vector ratio if two vectors are used, or a single vector system encoding both heavy chain and light chain. Clarified media, into which the antibody has been secreted, can be purified using the commonly used techniques. Antibody Framework engineering: To overcome framework and CDR amino acid residues impacting the immunogenicity properties that were observed in the INX444, a different humanization and engineering approach was selected. Briefly, the parental rat antibody M1056 was humanized using a framework library approach. For the framework library, twelve human VH framework germline genes (1-24, 1-46, 1-69, 2-5, 3-15, 3-23, 3-53, 3-72, 4-04, 4-39, 5-51, and 6-01) and eight human VL framework genes (A-19, A-26, A-27, B-2, B-3, L-2, L-12, and O- 2) containing M1056’s CDRs following two different CDR definitions (generating two 96 HC/LC combination libraries) were synthesized and cloned into heavy and light chain human IgG1 expression vectors. All 192 combinations were generated, and transiently transfected into Chinese Hamster Ovary (CHO) cells. Supernatants from the transfected CHO cells were assessed for functional activity, such as inhibition of MCT1 transporter activity, and in some cases, for MCT1 cell binding, T cell inhibition, stability, and immunogenicity. Screening of the human framework libraries revealed 21 of the 192 fully human framework antibodies displaying the CDRs derived from the parent rat antibody (M1056) exhibited appreciable functional activity as determined by the bromopyruvate transport assay. The remaining antibodies did not show significant activities. After preliminary assessment for stability and immunogenicity risks, 12 framework antibody combinations were further characterized experimentally to evaluate properties such as cell-based MCT1 binding, functional activity by inhibition of T cell proliferation, biophysical properties, and human serum binding. These analyses led to the selection of five antibodies (namely: Ab1, Ab2, Ab3, Ab4, and Ab5) as shown in Tables 1 and 2, for further in-depth characterization, particularly focusing on immunogenicity assessments. These five framework antibodies showed significant improvements in developability, standard platform purification fitness, and critical readouts evaluating clinical immunogenicity risks. All five framework antibodies were confirmed to specifically and selectively bind MCT1. The described framework engineering (i.e. humanization) process through interrogation of a comprehensive combinatorial library of a representative subset of fully human VH and VL germline sequences having/displaying the parent rodent antibody CDRs to identify productive solutions (or framework replacements) was a critical step in improving the developability of the antibody. All final five selected framework antibodies, each having specific VH/VL combinations of fully human germline frameworks displaying the M1056-derived CDRs, showed significantly improved properties relevant to clinical development, such as process development and immunogenicity In addition, a Tryptophan mutation introduced into HCDR3 of INX444 was removed in the humanization process of reverting all 6 CDRs back to the parent CDR sequences, providing significant improvement in oxidation. Antibody CDR engineering: Humanized Framework antibody Ab1 was selected for further engineering. A site-saturated mutagenesis approach was used to generate a comprehensive library containing all possible natural amino acid substitutions (excluding Cysteine) at every VH and VL CDR amino acid residue of the humanized Framework antibody Ab1. 1444 resulting CDR antibody variants of Ab1 were screened for MCT1 cell binding using a high throughput flow cytometry assay and putative hits were scaled up and confirmed for binding and functional activity. This initial mutagenesis effort revealed, in some cases, a discrepancy in binding and functional activity readouts (for example, certain mutations causing apparent improvements in binding did not translate into improved inhibitory activity, or, in certain cases, even reduced functional activity) suggesting a disconnect in the mechanistic structure-activity requirements for transporter binding and functional transport inhibition of the antibody. Improvements in binding and potency for selected mutations were moderate and a second round of site-saturated mutagenesis was conducted. A critical amino acid change discovered in the initial CDR library screen (HC CDR1 F27R) was determined to improve binding affinity and functional activity (e.g., inhibition of metabolite transport and CD4/CD8 T cell proliferation), was embedded in a new saturated mutagenesis library and, to address the observed differences in structural requirements for binding and inhibition, the screening strategy was modified to integrate parallel high throughput analysis of all new 1444 antibody variants for cell-based binding as well as MCT mediated transport inhibition using a high throughput Bromopyruvate (BP) in vitro transport assay. CDR mutations that significantly improved binding and/or functional activity such as in BP transport and T cell inhibition assays were identified (some as shown in Table 3). The best single amino acid changes were combined in rationally designed combinatorial libraries and the resulting antibodies were screened for functional activity (BP transport and T cell inhibition). A panel of 16 hits (as shown in Tables 1, 2 and 3) referred to as Ab6 to Ab21, from the combinatorial library demonstrating most improved potencies were assessed for developability and immunogenicity to determine high potency therapeutic antibodies with developability and immunogenicity properties enabling clinical development. Antibody constant region engineering: The human IgG1 effector null backbone with amino acid substitutions at L234A, L235E, G237A, A330S, and P331S show reduced binding to FcγR and C1q receptors (all amino acid residues are numbered according to the EU Index numbering), referred to as IgG1EN was selected for the exemplified anti-human MCT1 antibodies. The INX444 as described in WO19136300, has an Fc region having an alanine at residue 234, an alanine at residue 235, an arginine at residue 269, and an alanine at residue 322, herein referred to as INX444 LALA, was converted to an IgG1EN backbone (referred to as INX444 IgG1EN). No significant differences in effector function activity, developability profiles, or immunogenicity profile were observed with the 2 different backbones on the INX444 i.e., INX444 LALA and INX444 IgG1EN. Table 1: CDR amino acid sequences of exemplified anti-human MCT1 antibodies

Table 2: Amino Acid sequences of exemplified anti-human MCT1 antibodies

Table 3: Exemplified anti-human MCT1 antibodies generated from combinatorial engineering of Ab1 (showing CDR differences compared to Ab1)

Example 2: Binding affinity of the anti-human MCT1 antibodies Binding affinity for antibody screening at 25 ºC: The exemplified anti-human MCT1 antibodies were screened for binding to human MCT1 using a competition Meso Scale Discovery (MSD) binding assay. Briefly, four constant concentrations of each antibody were mixed with a 2 or 3- fold dilution series of HEK WT cells (verified to express MCT11.09 × 10 ⁶ receptors/cell) to give a final concentration of: 250, 125, 62.5 and 31.25 pM (n=1) for each antibody and a cell gradient from 60 to .0585 million cells per mL. The mix was incubated at 37 ºC for 1-2 days. After incubation, the incubated samples were spun down for 5 min at 500xg to remove cells. A 96-well multi-array plate (Meso Scale Diagnostics, Cat. # L15XA-3) was coated at 4 °C overnight with 1 μg/mL of goat anti human FC in phosphate buffered saline (PBS). Following coating, plates were washed 3 times with 150 μL PBST (PBS with 0.05% Tween ^® 20) and blocked with 150 μL/well of PBS 3% blocker A buffer (Cat# R93BA-1) at 25 °C for 1 hr. Plates were then washed 3 times with PBST. 50 μL of the preincubated antibody: cell dilution series was transferred to the wells and incubated at 25 °C with 700 rpm shaking for 1hr. Plates were washed 3 times with PBST. Then 100 μL of 1 μg/mL anti-human kappa-biotin antibody (Cat. #2060-08) was added, and plates were incubated at 25 ºC with 700 rpm shaking for 1hr. Plates were washed 3 times with PBST, followed by addition of 100 μL of 1 μg/mL MSD Sulfo-tag streptavidin antibody (Meso Scale Diagnostics Cat. #R32 AD1), and plates were incubated at 25 ºC with 700 rpm shaking for 1 hr. Plates were washed 3 times with PBST, 150 μL/well of 1X Read Buffer T was added to the wells and analyzed on a SECTOR ^® Imager 6000 (Meso Scale Diagnostics) 15 min after buffer addition. The apparent KD is determined by fitting a sigmoidal curve to the electrochemiluminescence (ECL) response vs. log (MCT1 receptor concentration) using assay development tool kit graphed with normalized ECL values. The representative results as demonstrated in Table 4a show the anti-human MCT1 antibodies had desirable binding affinities to human MCT1. Binding affinity of Ab1 and Ab6 at 37 ºC: The binding affinity of the exemplified anti-human MCT1 antibodies Ab1 and Ab6 to human MCT1 was measured using a competition Meso Scale Discovery (MSD) binding assay. Briefly, two constant concentrations of each antibody was mixed with a dilution series of HEK WT cells (verified to express MCT11.09 × 10 ⁶ receptors/cell) to give a final concentration of: 50 pM and 5 pM in triplicate for each antibody and a 3 fold cell gradient from 29 to .0044 million cells per mL. The mix was incubated at 37 ºC for 36-48 hr with shaking at 300 rpm. After incubation, the incubated samples were spun down for 8 min at 500xg to remove cells. A 96-well multi-array plate (Meso Scale Diagnostics, Cat. # L15XA-3) was coated at 4 °C overnight with 3 μg/mL of goat anti human FC in phosphate buffered saline (PBS). Following coating, plates were washed 3 times with 150 μL PBST (PBS with 0.05% Tween ^® 20) and blocked with 150 μL/well of PBS 3% blocker A buffer (Meso Scale Diagnostics, Cat. # R93BA-1) at 37 °C for 30 min. Plates were then washed 3 times with PBST. 50 μL of the preincubated antibody: cell dilution series was transferred to the wells and incubated at 37 °C with 1000 rpm shaking for 1 hr. Plates were washed 3 times with PBST. Then 100 μL of 1 μg/mL anti-human kappa-biotin antibody (Southern Biotech, Cat. #2060-08) was added, and plates were incubated at 37 ºC with 1000 rpm shaking for 30 min. Plates were washed 3 times with PBST, followed by addition of 100 μL of 1 μg/mL MSD Sulfo-tag streptavidin antibody (Meso Scale Diagnostics Cat. #R32AD-1), and plates were incubated at 37 ºC with 1000 rpm shaking for 15 min. Plates were washed 3 times with PBST, 150 μL/well of 1X Read Buffer T (Meso Scale Diagnostics Cat. #R92TC-1) was added to the wells and analyzed on a SECTOR ^® Imager 6000 (Meso Scale Diagnostics) 15 min after buffer addition. The apparent KD is determined by fitting a sigmoidal curve to the electrochemiluminescence (ECL) response vs. log (MCT1 receptor concentration) using Assay development tool kit graphed with normalized ECL values. Each experiment was performed in triplicate as separate independent dilution series and plates. The data reported was the average K _D . The results as demonstrated in Table 4b, show the anti-human MCT1 Ab1 and Ab6 had desirable binding affinities to human MCT1. Table 4a. Binding affinity screening of exemplified anti-human MCT1 antibodies to MCT1 at 25 ºC

Table 4b. Binding affinity of exemplified anti-human MCT1 antibodies Ab1 and Ab6 to human MCT1 at 37 ºC Example 3: Functional characterization of the anti-human MCT1 antibodies Inhibition of MCT1 mediated transport: An in vitro bromopyruvate functional transport assay was used to assess ability of the exemplified anti-human MCT1 antibodies to inhibit MCT1 mediated transport activity. HEK293T cells expressing MCT1 were pre-treated with exemplified anti-human MCT1 antibodies or a small molecule MCT1 inhibitor at 37 °C for 1 h. Cells were then incubated with a cytotoxic reagent 3-bromopyruvate (3-BrPy) at concentrations ranging from 25 to 500 mM for 2 to 6 h. ATP from dying cells was quantified using a commercial viability kit (ATPlite, PerkinElmer) in a 96-well plate and viability measured using luminescence. Reduction of ATP production indicated functional activity of the antibody. The mouse or chimeric antibody before humanization was used as a positive control antibody. MCT1/CD147 double knockout 293T cells were used as a negative control cell line. The results as demonstrated in Table 5, show that the exemplified anti-human MCT1 antibodies inhibit MCT1 receptor mediated transport in the bromopyruvate assay, and can thus also be identified as antagonistic anti-human MCT1 antibodies. Table 5: Inhibition of MCT1 mediated transport by exemplified anti-human MCT1 antibodies. Inhibition of CD4/CD8 T-cell Proliferation: Inhibition of T cell proliferation by the exemplified anti-human MCT1 antibodies was assessed in primary T cells isolated from human PBMCs. Human PBMCs were isolated from human blood samples by standard Ficoll-Paque ^TM plus (GE HEALTHCARE) density gradient centrifugation methods, and primary T cells were isolated from the PBMC suspension by negative selection with EasySep ^TM Human T cell Enrichment kit according to the manufacturer’s protocol (STEMCELL™ Technologies). Isolated human primary T cells were labeled with Cell Trace Violet dye (Thermo Fisher) and resuspended at 1 × 10 ⁶ cells/mL and plated in polystyrene 96-well, u-bottom plates in complete medium (RPMI- 1640 containing 10% Fetal bovine serum, 1X MEM-nonessential amino acids, 1mM sodium pyruvate, 1X penicillin-streptomycin solution (all from Corning ^® ) and 1X GlutaMAX ^TM (Gibco ^TM ), 0.1% β-mercaptoethanol (LIFE TECHNOLOGIES). Anti-human MCT1 antibodies or isotype control antibodies were added at 300 µg/mL diluted 4-fold and 11-point titration. Cells were stimulated with Human CD3/CD28 dynabeads (GIBCO) for 3 days at 37 °C and 5% CO2. T cell proliferation was analyzed by FACS as a dilution of cell trace violet dye. The results showed that the exemplified anti-human MCT1 antibodies inhibited CD4 and CD8 T cell proliferation in a dose dependent manner. Table 6 shows the IC ₅₀ values of the CD4 and CD8 T cell proliferation inhibition by the exemplified anti-human MCT1 antibodies. Table 6. Inhibition of T cell proliferation by exemplified anti-human MCT1 antibodies In vitro T regulatory cell differentiation: Enhancement of the expansion of induced Regulatory T (Treg) cells by exemplified anti-human MCT1 antibodies was assessed in primary naïve CD4 T cells isolated from PBMCs. Human PBMCs were isolated from human blood samples by standard Ficoll-Paque ^TM plus (GE HEALTHCARE) density gradient centrifugation methods, and primary naïve CD4 T cells were isolated from the PBMC suspension by negative selection according to the manufacturer’s protocol (StemCell). Isolated human primary naive CD4 T cells were resuspended at 1 × 10 ⁶ cells/mL and plated in polystyrene 96-well, u-bottom plates in complete medium (RPMI-1640 containing 10% Fetal bovine serum, 1X MEM-nonessential amino acids, 1 mM sodium pyruvate, 1X penicillin-streptomycin solution (all from Corning ^® ) and 1X GlutaMAX ^TM (Gibco ^TM ), 0.1% β-mercaptoethanol (LIFE TECHNOLOGIES). Exemplified anti-human MCT1 antibodies or isotype control antibodies were added at different concentrations. Cells were stimulated with anti-CD3/CD28 dymane beads (Gibco) and hrTGFb (R&D) and hrIL-2 (R&D) for 3 days at 37 °C and 5% CO2. Treg differentiation is analyzed by FACS as % of FoxP3+/CD25+ cells. The results as demonstrated in Figure 1 and Tables 7 and 8 show that the anti-human MCT1 antibodies Ab1 and Ab6 increased regulatory T cell differentiation in a concentration dependent manner as compared to the isotype control. These results showed an unexpected benefit of the anti-human MCT1 antibodies, suggesting that treatment with Ab1 or Ab6 may enhance differentiation of regulatory T cells which subsequently inhibit autoimmune responses. Table 7. Percent increase in regulatory T cell differentiation upon treatment upon treatment with anti-human MCT1 antibody Ab1 over isotype control Table 8. Percent increase in regulatory T cell differentiation upon treatment with anti- human MCT1 antibody Ab6 or isotype control B cell proliferation: Inhibition of B cell proliferation by the exemplified anti-human MCT1 antibodies was assessed in primary B cells isolated from human PBMCs. Human PBMCs were isolated from human blood samples by standard Ficoll-Paque ^TM plus (GE HEALTHCARE) density gradient centrifugation methods, and primary B cells were isolated from the PBMC suspension by positive selection with CD19 microbeads according to the manufacturer’s protocol (Miltenyi Biotec). Isolated human primary B cells were labeled with Cell Trace Violet dye (Thermo Fisher) and resuspended at 1 × 10 ⁶ cells/mL and plated in polystyrene 96-well, u- bottom plates in complete medium (RPMI-1640 containing 10% Fetal bovine serum, 1X MEM- nonessential amino acids, 1mM sodium pyruvate, 1X penicillin-streptomycin solution (all from Corning ^® ) and 1X GlutaMAX ^TM (Gibco ^TM ), 0.1% β-mercaptoethanol (LIFE TECHNOLOGIES). Exemplified anti-human MCT1 antibodies or isotype control antibodies were added at 300 µg/mL diluted 4-fold and 11-point titration. Cells were stimulated with Human MEGACD40L protein (ENZO) and rhIL-4 (R&D) for 5 days at 37 °C and 5% CO ₂ . B cell proliferation is analyzed by FACS as a dilution of cell trace violet dye. The results showed that the exemplified anti-human MCT1 antibody Ab6 inhibited B cell proliferation in a dose dependent manner, with an average IC50 of 2.95 nM from 3 donors as shown in Table 9. Table 9. Inhibition of B cell proliferation by exemplified anti-human MCT1 antibody Ab6 Example 4: Fcy receptor binding and effector function activity of the anti-human MCT1 antibodies In vitro Human Fcy receptor (FcyR) binding and effector function activity was conducted to confirm that the anti-human MCT1 antibodies lack detectable FcyR binding, complement- dependent cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC), and antibody- dependent cellular phagocytosis (ADCP) activity. Human Fcγ receptor binding. Biacore T100 (Cytiva), Biacore reagents, and Scrubber2 Biacore Evaluation Software (Biologics 2008) were used for the SPR binding analysis of the MCT1 antibodies. Further, the IgGEN and LALA IgG backbones were also compared for binding to Fcγ Receptors. A series S CM5 chip (Cytiva P/N BR100530) was prepared using the manufacturer’s EDC/NHS amine coupling method (Cytiva P/N BR100050). Briefly, the surfaces of all 4 flow cells (FC) were activated by injecting a 1:1 mixture of EDC/NHS for 7 minutes at 10 μL/minute. Protein A (Calbiochem P/N 539202) was diluted to 100 μg/mL in 10 mM acetate, pH 4.5 buffer, and immobilized for approximately 4000 RU onto all 4 FCs by 7 minute injection at a flow rate of 10 μL/minute. Unreacted sites were blocked with a 7 minute injection of ethanolamine at 10 μL/minute. Injections of 2 × 10 μL of glycine, pH 1.5, were used to remove any noncovalently associated protein. Running buffer was 1x HBS-EP+ (TEKNOVA, P/N H8022). The FcγR extracellular domains (ECDs) -FcγRI (CD64), FcγRIIA_131R, and FcγRIIA_131H (CD32a), FcγRIIIA_158V, FcγRIIIA_158F (CD16a), and FcγRIIb (CD32b) were produced from stable CHO cell expression. All FcγR ECDs were purified using IgG Sepharose and size exclusion chromatography (SEC). For FcγRI binding, antibodies were diluted to 2.5 μg/mL in running buffer, and approximately 150 RU of each antibody was captured in FCs 2 through 4 (RU captured). FC1 was the reference FC, therefore no antibody was captured in FC1. FcγRI ECD was diluted to 200 nM in running buffer and then two-fold serially diluted in running buffer to 0.78 nM. At least duplicate injections of each concentration were injected over all FCs at 40 μL/minute for 120 seconds followed by a 1200 second dissociation phase. Regeneration was performed by injecting 15 μL of 10 mM glycine, pH 1.5, at 30 μL/minute over all FCs. Reference-subtracted data was collected as FC2FC1, FC3-FC1, and FC4-FC1. The measurements were obtained at 25 °C. The affinity (K _D ) was calculated using either steady state equilibrium analysis with the Scrubber 2 Biacore Evaluation Software or a “1:1 (Langmuir) binding” model in BIA Evaluation. For FcγRIIa, FcγRIIb, and FcγRIIIa binding, antibodies were diluted to 5 μg/mL in running buffer, and approximately 500 RU of each antibody was captured in FCs 2 through 4 (RUcaptured). FC1 was again the reference FC. Fcγ receptor ECDs were diluted to 10 μM in running buffer and then 2-fold serially diluted in running buffer to 39 nM. Duplicate injections of each concentration were injected over all FCs at 40 μL/minute for 60 seconds followed by a 120 second dissociation phase. Regeneration was performed by injecting 15 μL of 10 mM glycine, pH 1.5, at 30 μL/minutes over all FCs. Reference-subtracted data was collected as FC2-FC1, FC3-FC1, and FC4-FC1. The measurements were obtained at 25˚C. The affinity (K _D ) was calculated using the steady state equilibrium analysis with the Scrubber 2 Biacore Evaluation Software. The results as demonstrated in Table 10, show that the IgG1EN Fc and LALA Fc backbones do not bind the Fcγ receptors. Table 10. Binding affinities of anti-human MCT1 antibodies to Human Fcγ Receptors C1q binding. A 96-well microplate was coated with 100 μL/well of each antibody diluted in DPBS (Dulbecco’s HyClone) with a concentration range of 10 μg/mL to 0.19 μg/mL. Testing was performed in duplicate wells. The plate was sealed and incubated overnight at 4 °C. The coating reagent was removed, and 200 μL/well of casein blocking reagent (Thermo) was added. The plate was sealed and incubated for 2 hours at room temperature (RT). Plate was washed 3 times with wash buffer (1 x TBE with 0.05% Tween 20) and 100 µL/well of Human C1q (MS Biomedical) at 10 μg/mL diluted in casein blocking reagent was added and incubated for 3 hours at RT. The plate was then washed three times with wash buffer and 100 μL/well of a 1:800 times dilution of Sheep anti-human C1q-HRP (Abcam #ab46191) in casein blocker was added and incubated for 1 hour at RT. The plate was washed 6 times with wash buffer, and 100 μL/well of TMB Substrate (Pierce) was added to each well and incubated for 7 minutes. 100 µL of 1 N HCl was added to each well to stop the reaction. Optical density was immediately measured using a colorimetric microplate reader set to 450 nm. The data was analyzed using SoftMax Pro 7.1 Data Acquisition and Analysis Software. The results (not shown) showed that the exemplified anti-human MCT1 antibody Ab6 and IgG1EN control did not bind the complement component C1q when compared to the human IgG1 positive control antibody which bound in a dose dependent manner. In vitro ADCC, ADCP, and CDC activity. Raji cells expressing MCT1 and CD20 were used as target cells for the 3 assays. For the ADCC assay, Jurkat FcγRIIIa (V158)-NFAT-Luc cell line stably co-expressing human FcγRIIIa (V158), human FcεRγ-chain and NFAT luciferase reporter gene (Eli Lilly and Company) was used as the effector cell line. For the ADCP assay, Jurkat FcγRIIa-NFAT-Luc cell line stably co-expressing human FcγRIIa (H131) and NFAT luciferase reporter gene (G988A, Promega) was used as the effector cell line. Briefly, test samples were serially diluted 4-fold in duplicates and 50 μL/well of the diluted test compound or assay buffer was added to 96-well plates (Costar 3917). Raji cells were diluted in assay medium to a final cell density of 1.0 x 10 ⁶ cells/mL and a volume of 50 μL cells/well was added to the ADCC, ADCP and CDC assay plates which have 50 μL/well of the serially diluted test samples. ADCC, ADCP and CDC assay plates were gently agitation on a plate shaker for 30 seconds at 200 rpm, then incubated for 1 h at 37 °C. The stably transfected Jurkat V158 cells or Jurkat H131 cells were diluted to a concentration of 3 × 10 ⁶ cells/mL and 50 μL/well was added to the respective ADCC and ADCP assay plates containing the serially diluted test samples and Raji cells, and the plate was mixed by gentle agitation on a plate shaker for 30 seconds at 200 rpm, then incubated for 4 hrs at 37 °C. Pre-diluted complement from human serum (Quidel A113) was added to the CDC plate (50 μL/well) containing the serially diluted test samples and Raji cells, and the plate was mixed by gentle agitation on a plate shaker for 30 seconds at 200 rpm, then incubated for 2 h at 37 °C. After incubation, the ADCC, ADCP, and CDC plates were brought to room temperature for 10 minutes followed by addition of 100 μL of One-glo Ex (E8130, Promega) to the ADCC and ADCP assay plates and the Cell‑Titer Glo (G7571, Promega) to the CDC assay plates. The luminescence was read using an Envision 11 multi-mode plate reader using 0.2 cps integration. The results were analyzed using Prism v8.2 (Graph pad). In vitro neutrophil activation. Heparin-treated human whole blood obtained from three independent healthy donors was used. Blood was diluted at 1:1 with assay media and plated at 100 μL/well in 96-well plates. Test antibodies were titrated into the diluted whole blood starting at 300 μg/mL, following by 1:5 serial dilutions. R848 (TLR7 agonist) was used as a positive control, at a final concentration of 1 μg/mL. All conditions were performed in triplicate. Samples were incubated for 1 h or overnight, after that red blood cells were lysed using ACK buffer, cells were washed and stained with the cocktail of following antibodies: anti-CD3-BV785 (Cat# 317330, Biolegend), anti-CD45-BV421 (Cat# 563879, BD Bioscience), CD66b-FITC (Cat#555724, BD Bioscience), CD11b-PE-Cy7 (Cat# 552850 BD Bioscience). Cells were stained for 30 min at RT, washed and acquired using Fortessa X-20, data was analyzed using FlowJo and plotted in Prism GraphPad. Neutrophils were identified based on their size and granularity and expression of following makers: CD45+/CD3-/CD66b+/CD11b+. Expression of CD66b and CD11b was analyzed as gMFI (geometric mean fluorescent intensity) of CD45+/CD3-/CD66b+/CD11b+ cells. The results in Figure 2A showed that the exemplified anti-human MCT1 antibody Ab6 did not elicit ADCC activity at all concentrations tested when compared to the positive control wild type IgG1 anti-human MCT1 antibody and a CD20 antibody which elicited ADCC activity in a dose dependent manner. The results in Figure 2B showed that the exemplified anti-human MCT1 antibody Ab6 did not significantly elicit ADCP activity at all concentrations tested when compared to the positive control wild type IgG1 anti-human MCT1 antibody and a CD20 antibody which elicited ADCP activity in a dose dependent manner. The results for the neutrophil activation assay (not shown) confirmed a lack of FcγRIIa activation by the anti- human MCT1 antibody Ab6 at all timepoints and concentrations tested. These results cumulatively showed that Ab6 is unlikely to elicit Fc-mediated effector function activity in vivo. The results in Figure 2C showed that neither the exemplified anti-human MCT1 antibody Ab6 or the wild-type IgG1 control antibody elicited CDC activity, when compared to an anti-CD20 positive control which elicited CDC activity in a dose dependent manner. Example 5: Developability properties of anti-human MCT1 antibodies Biophysical and chemical properties of the anti-human MCT1 antibodies were evaluated to determine the developability profile of the antibodies. In culture oxidation and degradation: In-culture oxidation and degradation of the exemplified anti-human MCT1 antibodies was assessed. The exemplified anti-human MCT1 antibodies were expressed in CHO cells and subjected to the Protein A capture method which follows. The capture column (MabSelect™ SuRe™ Protein A) was neutralized by washing with 2 column volumes of 50 mM Tris pH 8.0, then equilibrated with 20 mM Tris pH 7.0. Cell-free bioreactor harvest containing the antibody was then loaded onto the column. Following sample load, the column was washed with 20 mM Tris pH 7.0, then two column volumes of 20 mM Tris pH 7.0 + 1M NaCl, then 20 mM Tris pH 7.0. MCT1 antibody was then eluted from the column using 20 mM acetatic acid + 5 mM citric acid buffer (pH 2.9). Eluate fractions were collected by UV absorbance (>200mAu) and pooled together. This pool was then adjusted to pH 5 with 1M Tris pH 8.0 and allowed to incubate at room temperature while stirring for 15 min. The elution then sat at room temp for a total of 1 hr. The sample pool was spun down at 20 °C, 3000xg, for 5 minutes to remove host cell protein (HCP) precipitate. The sample supernatant was then filtered with a 0.22 micron steri-flip PDVF filter (Millipore) and then subjected to preparative SEC (see Figures 3A and 3B). The results as demonstrated in Figures 3A and 3B, indicate that the exemplified anti- human MCT1 antibodies had desirable developability oxidation and degradation profile. Specifically, the SEC profile for Ab1 (Figure 3A) showed a narrow single peak without any shoulder peaks, indicating reduced degradation (e.g., in-culture clipping), or oxidation of the antibody compared to INX444, providing desirable developability properties and reducing potentially complex and costly changes in downstream analytical and manufacturing processes (such as allowing for collection of high purity material by standard purification procedures). The SEC profile for INX444 antibodies (Figure 3B) showed a front shoulder peak in the elution profile. Further analysis of the INX444 antibodies by LC/MS/MS identified the front shoulder peak as attributable to in-culture antibody clipping (CH1 multiple clipping sites) and oxidation (majority observed at amino acid residue W105). Application of standard platform purification procedures were not suitable for removing these impurities from the INX444 antibodies, and thus provided challenges to downstream purification processes and developability. Interaction with analytical size exclusion column: 3 µg of the exemplified anti-human MCT1 antibodies (greater than 96 % purity) were injected onto an analytical size exclusion column (TOSOH TSKgel-UP-SW3000, Fisher scientific, Cat.50-104-9800) on an Agilent HPLC system with a mobile phase flow rate of 0.35 mL/min. The UV signals were detected at 214 nm. The results as demonstrated in Table 11 and Figure 4, show that the retention time of exemplified anti-human MCT1 antibodies on an analytical size exclusion column was significantly reduced (ranged from 3.78 to 4.04 minutes), when compared to INX444 (5.18 minutes). Specifically, these results indicated that there was reduced interaction between the column resins and the exemplified anti-human MCT1 antibodies, when compared to the INX444 antibody (this is also demonstrated by the peak widths of the Ab1 and INX444 in Figure 4). Strong interactions of an antibody with column resins poses challenges in analytical method development to detect soluble high molecular weight species and requires modifications in downstream analytical processes. Table 11. Size exclusion column retention times of exemplified anti-human MCT1 antibodies

Hydrophobic interaction chromatography (HIC): 20 μg of IgG samples (1 mg/mL) were diluted 1:1 with 2x Buffer A concentrate (2 M ammonium sulfate, 0.1 M sodium phosphate at pH 6.8) to achieve a final ammonium sulfate concentration of 1 M prior to analysis. A TSKgel butyl-NPR (4.6mm ID x 10cm, 2.5um, Tosoh # 42168) column was used, with a 2-minute hold in mobile phase A (1M ammonium sulfate, 50mM sodium phosphate, pH 6.8), followed by a linear gradient (0-100% B) of mobile phase A and mobile phase B (50 mM sodium phosphate, pH 6.8) over 23 minutes at a flow rate of 1 mL/minute. A final hold of 5 minutes in 100 % mobile phase B was used to remove any remaining protein, with UV absorbance monitoring at 280 nm and 215nm. The results as demonstrated in Table 12, show that the exemplified anti-human MCT1 antibodies Ab6 to Ab21 had a lower retention times on a hydrophobic interaction column (ranged from 6.53 min to 8.46 min) indicating low hydrophobicity, when compared to INX444 which had a retention time of 12 min. Antibody hydrophobicity can create downstream manufacturing concerns such as poor expression and protein aggregation. Table 12: Hydrophobic interaction chromatography data on exemplified anti-human MCT1 antibodies

Cross-interaction chromatography: The cross-interaction chromatography (CIC) IgG column was prepared by coupling ∼30 mg of human serum polyclonal antibodies (I4506; Sigma) to a 1- mL HiTrap NHS-activated column (17-0716-01; GE Healthcare), followed by quenching with ethanolamine and Tris. The blank column (control column without the IgG) was prepared by deactivating with ethanolamine and Tris. 20 µg of each antibody was injected onto each column (IgG and Blank) with a constant flow rate of 0.2 mL/min using 10 mM sodium phosphate, 10 mM NaCl, pH 6.5 as the mobile phase on an Agilent 1260 series HPLC system. Retention times (RT) obtained by both IgG and blank columns were used to calculate K’ (ratio of the retention time, calculated as IgG K’ = [IgG column RT – blank column RT] / blank column RT). In addition, due to peak tailing in some samples, peak width at 50% height is also obtained to monitor “stickiness” of test antibodies. The results as demonstrated in Table 13, show that the exemplified anti-human MCT1 antibodies did not exhibit significant nonspecific binding to serum IgG or the blank column as shown by the IgG column retention time (ranged from 5.07 to 5.41 min) and the blank peak width (ranged from 4.81 to 5.01 min) when compared to INX444 (IgG RT of 11 min, blank peak width of 6.81 min). Furthermore, the exemplified antibodies IgG peak width ranged from 1.36 to 1.94 min and the blank peak width ranged from 0.88 to 1.2 min, indicating low IgG and column resin interaction when compared to INX444 (IgG peak width of 8 min, blank peak width of 2 min). Low IgG retention times on a CIC column indicate potentially improved solubility of an antibody. Table 13: CIC analysis of exemplified anti-human MCT1 antibodies

Solubility: Solubility was assessed by concentrating 100mg of the exemplified anti-human MCT1 antibodies with a 30 kDa molecular weight cut-off centrifugal filter (for example, Amicon U.C. filters, Millipore, catalog # UFC903024) to a volume of approximately 0.5 mL. The final concentration of the sample was measured by using a Solo VPE spectrophotometer (C Technologies, Inc). The results showed that the exemplified anti-human MCT1 antibodies had high solubility. Thermal Stability: Differential Scanning Calorimetry (DSC) was used to evaluate the stability of exemplified anti-human MCT1 antibodies against thermal denaturation. DSC was run using a Malvern MircoCal VP-DSC instrument. Samples were heated from 20 °C to 110 °C at a constant rate of 60 °C/hour. Analysis methods were performed using the MicroCal VP-Capillary DSC Automated Analysis program. Baseline corrections were performed, and T onset and TMs were determined. The results showed that the exemplified anti-human MCT1 antibodies had comparable Tm and acceptable thermal stability for development. Chemical Stability: Stability of the exemplified MCT1 antibodies is assessed at a high concentration (approximately 100 mg/mL) in an acceptable buffer. Concentrated samples are incubated for a period of 4 weeks at 5 °C and 35 °C. Following incubation, samples are analyzed for the percentage of main peak loss (Δ% MainPeak) with size exclusion chromatography (SEC), for fragmentation by capillary electrophoresis (CE-SDS), and for chemical modification (for example deamidation, isomerization, or oxidation) by LCMS peptide mapping. Freeze/thaw stability: Freeze/thaw stability is evaluated at a high concentration (approximately 100 mg/mL), using a slow 3 repeat, controlled temperature cycle which mimics the freeze/thaw conditions of large volumes of bulk drug substance placed at -70°C. Example 6: Immunogenicity risk profiling of the exemplified anti-human MCT1 antibodies Immunogenicity T-cell proliferation assay: The ability of the exemplified anti-human MCT1 antibodies or test candidate MAPPS peptides to activate CD4+ T cells by inducing cellular proliferation was assessed. CD8+ T cell depleted PBMC’s were prepared and labeled with Carboxyfluorescein Diacetate Succinimidyl Ester (CFSE). Each sample was tested with media control, keyhole limpet haemocyanin (KLH; positive control), the respective therapeutic control (positive clinical benchmark antibody or peptide immunogenic control), exemplified antibodies, or test candidate MAPPS peptides. Cells were cultured and incubated for 7 days. On day 7, samples were analyzed by flow cytometry for a CD4+ T cell proliferative response. A median cellular division index (CDI) was calculated. 9 donors were assessed. Donors that produced a CDI > 2.5 were considered as positive responders. A percent donor frequency across all donors was evaluated. The results as demonstrated in Table 14, show that the exemplified anti-human MCT1 antibodies tested, had significantly reduced T cell proliferation (ranging from 0% to 22% positive donor response) from the 9 donors tested, indicating low immunogenicity risk when compared to the positive control anti-CXCR4 antibody which demonstrated a 78% positive donor response. These results indicate a low immunogenicity risk profile for the exemplified anti-human MCT1 antibodies. The INX444 showed 89% positive donor response in the T cell proliferation assay, indicating a high immunogenicity risk profile. Table 14: T cell proliferation assay to assess immunogenicity risk for the exemplified anti- human MCT1 antibodies Serum protein binding: To further assess immunogenicity risk profile of the exemplified anti- human MCT1 antibodies serum protein binding was determined using mass spectrometry (MS). Antibodies diluted in PBS were coated at 4 °C overnight on Nunc MaxiSorp (or Immulon 4 HBX) microplates at 3 ^g/well. Next day plates were washed 3x with 200 µL of cold PBS, and blocked with 100 µL of PBS /1% BSA at RT for 3 hrs. Blocking solution was removed, and plates were washed 3x again.100 ^L of human serum sample (pooled serum from eight donors, diluted 1:1 with PBS/protease inhibitors) was added to the wells, and plates were incubated at 4 °C overnight. Next day samples were removed, and plates were washed ten times with 200 µL cold PBS. Bound proteins were eluted with 1% acidic acid, reduced, alkylated, and digested with trypsin. Tryptic peptides were analyzed by nano LC/MS using a Thermo QE-HFX (or LUMOS) mass spectrometer. Peptide and protein identifications were generated by an internal proteomics pipeline using search algorithms with tryptic enzyme and a human database with test antibody sequences appended. Ions were quantified by internal proteomics tools (Chrom- Alignment, Meta-consense and Quant) and analyzed in JMP using Oneway analysis/Each Pair, Student’s t test (or All pairs, Tukey HSD) platform. Ions with p<0.05 and difference >1 were considered as enriched. The results of the MS analysis showed that the exemplified anti-human MCT1 antibodies did not have detectable binding to serum proteins. This lack of binding indicates a reduced immunogenicity risk and a reduced risk of faster clearance, thus providing a potentially desirable safety immunogenicity risk and PK profile for the exemplified anti-human MCT1 antibodies. The results further showed that INX444 bound to multiple apolipoproteins in the serum, indicating a higher immunogenicity risk and potentially faster clearance. Example 7: In vivo characterization of the anti-human MCT1 Abs Graft versus Host Disease (GvHD) assay: Female NSG™ mice (NOD.Cg-Prkdc ^scid Il2rg ^tm1Wjl /SzJ, JAX Labs, Stock # 05557) were housed 3/cage at 72 °C under a 12 h light:dark cycle and allowed food and water ad libitum (n=33). Human PBMC’s were isolated from LRS tubes obtained from the San Diego Blood Bank (San Diego CA) using SepMate 50 Ficol preparation tubes according to manufacturer’s instructions (StemCell Technologies, Vancouver, BC). Freshly isolated PBMC’s were suspended in PBS at 1.2 x 10 ⁸ cells/mL and mice were engrafted with 100 µL PBMC’s suspension intravenously on day 0 (1.2 x 10 ⁷ /cells/mouse, n=29); 4 mice were not engrafted with PBMC’s as non-engrafted controls. On day 1, mice were divided into weight matched groups and dosed subcutaneously with a human IgG1EN isotype control antibody, or Ab1 or Ab6. Dosing continued once weekly for the remainder of the experiment. Health checks and body weight measurements were performed routinely. Spleen cells at the end of the study for the Ab6 treated mice were further evaluated for T regulatory cells expansion. The results as demonstrated in Figures 5 and 6 showed that treatment with Ab1 or Ab6 respectively could achieve full protection from weight loss, similar to the non-engrafted control group at specific doses. Surprisingly, as shown in Table 15, treatment with the anti-human MCT1 antibody Ab6 showed an expansion of FoxP3 ⁺ regulatory T cells in the spleen cells at the end of the study when compared to the control. These results suggest that expansion of regulatory T cells induced by Ab6 may also contribute to the protection from weight loss. Table 15. Increase in number of FoxP3+ regulatory T cells upon treatment with anti- human MCT1 antibody Ab6

SEQUENCES KGSQNINNYLA T L Ab19 TCAACCGTGTACATGGAGCTTAGCAGCCTGCGCTCTGAGGACACTGCCGTGTACTAC L

L Wherein Xaa ₂ is Valine or Arginine, Xaa ₇ is Leucine or Arginine, Xaa ₉ is Asparagine or Glycine, Xaa ₁₀ is Tyrosine or Isoleucine, Xaa ₁₂ is Leucine or Isoleucine, and Xaa ₁₃ is Glutamine, Valine, or Glycine Wherein Xaa4 is Arginine or Serine, Xaa9 is Isoleucine or Glutamic Acid, and Xaa13 is Glutamic Acid or Arginine Wherein Xaa4 is Arginine or Leucine, and Xaa6 is Histidine or Arginine or Tyrosine, and Xaa20 is Proline or Alanine