Human TERT promoter variants, as well as kits, methods and uses thereof

There is a general need for the identification of polymorphisms and mutations occurring in familiar and sporadic cancer diseases, as such mutations and polymorphisms can serve as biomarkers, e.g. for prognostic purposes or for applying a personalized medicine.

The inventors have surprisingly identified that certain mutations in the human TERT promoter, namely one of the mutations: A>C mutation at position -57 bp from translation start of the TERT gene, and a C>T mutation at position -124 bp from translation start of the TERT gene, and a C>T mutation at position -146 bp from translation start of the TERT gene, a CC>TT mutation at positions -124/-125 from translation start of the TERT gene, and a CC>TT mutation at positions -138/- 139 bp from translation start of the TERT gene, are often found as germline mutations in cases of hereditary melanoma (see Example 1 ). Also, somatic mutations corresponding to the human TERT promoter mutations were found in sporadic melanoma cases (Example 1 ). Moreover, we surprisingly identified that in several of the studied cases, the human TERT promoter mutations occurred with the rs2853669 polymorphism of the TERT promoter. This polymorphism is well known to a skilled person and corresponds to the T>C mutation at position -245 bp from translation start of the TERT gene (or at position Chr 5: 1 ,295,349 hg19 coordinate). Also, it was surprisingly found that the TERT promoter mutations occurring with the rs2853669 polymorphism result in a modified promoter activity, as could be shown in Examples 1 and 2.

Moreover, it was surprisingly found that the presence of the rs2853669 polymorphism has a positive effect of survival rate and disease recurrence of cancer in patients carrying the above-described TERT promoter mutations. Therefore, it was surprisingly found that a human TERT promoter variant of the rs2853669 polymorphism having a mutation, in particular a point mutation at position at -57 bp, -124 bp, -146 bp, -124/-125 bp, and/or -138/-139 bp is in particular useful as a biomarker in the filed of diagnosis of cancer, in particular melanoma or bladder cancer. In particular, the variant is useful for determining survival rate and disease recurrence of cancer patients. This can typically be achieved by determining the respective nucleotide positions in genomic DNA of a human or patient suffering from cancer or suspected to suffer from cancer. The human wild type TERT promoter is also known to a skilled person and is illustrated below as SEQ ID No. 1 :

SEQ ID No. 1

GCCCGACGCCCCGCGTCCGGACCTGGAGGCAGCCCTGGGTCTCCGGATCA GGCCAGCGGCCAAAGGGTCGCCGCACGCACCTGTTCCCAGGGCCTCCACAT CATGGCCCCTCCCTCGGGTTACCCCACAGCCTAGGCCGATTCGACCTCTCTC CGCTGGGGCCCTCGCTGGCGTCCCTGCACCCTGGGAGCGCGAGCGGCGCG CGGGCGGGGAAGCGCGGCCCAGACCCCCGGGTCCGCCCGGAGCAGCTGC GCTGTCGGGGCCAGGCCGGGCTCCCAGTGGATTCGCGGGCACAGACGCCC AGGACCGCGCT7CCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTC CTGCCCCTTCACCTTCCAGCTCCGCCTCCTCCGCGCGGACCCCGCCCCGTC CCGACCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCC CTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCTCGCGGCGCGAGTTTCiAGG CAGCGCTGCGTCCTGCTGCGCACGTGGGAAGCCCTGGCCCCGGCCACCCC CGCGiATGCCGCGCGCTCCCCGCTGCCGAGCCGTGCGCTCCCTGCTGCGCA GCCACTACCGCGAGGTGCTGCCGCTGGCCACGTTCGT (SEQ ID No. 1 )

The core promoter sequence is shown underlined. The translation start ATG is indicated in bold. Also, nucleotides, which are identified to be mutated in cancer, in particular melanoma cells, are also indicated in bold. The corresponding identified mutations are shown in Figure 10.

Therefore, the present invention relates to a variant of the human wild type TERT promoter or the human TERT promoter with variant of the rs2853669 polymorphism, wherein the variant has at least one, preferably one of the following mutations a) to e):

a) a A>C mutation i) at position -57 bp from translation start of the TERT gene, or ii) position Chr 5: 1 ,295,161 hg19 coordinate,

b) a C>T mutation i) at position -124 bp from translation start of the TERT gene, or ii) position Chr 5: 1 ,295,228 hg19 coordinate, or

c) a C>T mutation i) at position -146 bp from translation start of the TERT gene, or ii) position Chr 5: 1 ,295,250 hg19 coordinate, or d) a CC>TT mutation i) at positions -124/-125 from translation start of the TERT gene, or ii) positions Chr 5: 1 ,295,228 and 1 ,295,229 hg19 coordinate,

e) a CC>TT mutation i) at positions -138/-139 bp from translation start of the TERT gene, or ii) positions Chr 5: 1 ,295,242 and 1 ,295,243 hg19 coordinate,

or a fragment thereof comprising i) at least 15, 20, 30, 50 or 100 continuous nucleotides thereof or ii) the core promoter region,

which fragment encompasses the respective mutation(s), in particular wherein the wild type TERT promoter has the sequence according to SEQ ID No. 1 , in particular as shown in Figure 10. hg 19 is understood as human reference genome hg19.

In a preferred embodiment, the variant of the invention has the one of the mutations of alternatives a) to e). For example, the variant has the mutation of alternative a), namely a A>C mutation at position -57 bp from translation start of the TERT gene, but not a mutation according to alternatives b) to e).

In another preferred embodiment, the variant of the invention has 2, 3, 4 or 5 of the mutations of alternatives a) to e).

Also, fragments of the variant of the human wild type TERT promoter or the human TERT promoter with variant of the rs2853669 polymorphism of the invention which fragments encompass at least one of the surprisingly identified mutations can be used. For example, such fragments may be used as primers or probes for determining the nucleotide sequence or part thereof of a human TERT promoter of a human, and/or as reference sequence or probe. For example, such fragments comprise the core promoter sequence as shown underlined in Figure 10.

Fragments of the invention encompassing at least one of these mutations comprise, preferably consist of at least 15, 20, 30, 50 or 100 continuous nucleotides, for example 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 continuous nucleotides. In a further preferred embodiment, the nucleotides have length of about at least 15, 20, 30, 50 or 100 continuous nucleotides.

In a further preferred embodiment, the length of the fragments is 300 nucleotides or less, preferably 200 nucleotides or less, more preferably 200 nucleotides or less, even more preferably 100 nucleotides or less, most preferably 50 nucleotides or less.

It was surprisingly found in Example 1 that the some of the mutations in the human TERT promoter result in the generation of additional binding motif for transcription factors, namely an Ets/TCF binding motif. Such binding motif created by the mutations is preferably GGA(A T) or CCGGAA. Therefore, the present invention also relate to variants of the wild type TERT promoter or the human TERT promoter with variant of the rs2853669 polymorphism, wherein the variant has a mutation resulting in an additional Ets/TCF binding motif. It could be shown in the Examples that the promoter activity is modulated by the generation of the binding motifs.

In a further embodiment, the present invention relates to a variant of the human wild type TERT promoter or the human TERT promoter with variant of the rs2853669 polymorphism, wherein the variant has a mutation resulting in an additional Ets/TCF binding motif,

in particular wherein the mutation is a point mutation or tandem point mutation,

or a fragment thereof comprising, in particular consisting of, i) at least 15, 20, 30, 50 or 100 continuous nucleotides thereof or ii) the core promoter region,

which fragment encompasses the respective mutation(s), preferably wherein the Ets/TCF binding motif is GGA(A/T) or CCGGAA.

Typically, a variant of the human TERT promoter of the present invention or fragment therefore may for example be cloned in a suitable vector for amplification or propagation. Based on the intended purpose, the vector is suitable for propagation in mammalian, in particular human cells, eukaryotic, e.g. insect cells, or yeast cells, or prokaryotic cells, like bacterial, e.g. E. coli cells, for example a Topo vector. In a further embodiment, the present invention relates to a vector comprising the variant or fragment of the present invention. Also, the cloned variant or fragment thereof may be ligated to further sequences. In one embodiment, an open reading frame or gene, like the luciferase gene, may be fused to the promoter variant of the invention, for expression of such in human cells open reading frame or gene. In a further embodiment, adaptor sequences, e.g. having a length of about 5 to 50 nucleotides, may be fused to variant promoter sequences or fragments thereof of the invention.

In a yet further embodiment, the present invention relates to a variant or a fragment thereof according to the present invention and at least one heterologous sequence. In one embodiment, the at least one heterologous sequence is the vector sequence and/or a coding sequence for a non-human gene, for example a reporter gene like luciferase.

In a yet further embodiment, the present invention relates to a primer or probe comprising, preferably consisting of, a fragment of a variant of the present invention, and optionally adaptor sequence(s) and/or detectable label(s).

Adaptor sequences are nucleic acid, in particular DNA sequences which are covalently attached to other nucleic acid sequences e.g. by ligation. Adaptor sequences have a length of 5 to 100, preferably 10 to 30 nucleotides. Such adaptor sequences may be useful to generate further binding sites e.g. to a solid support or primers or target sequences.

The primer or probes of the present invention may be labeled, in particular with a detectable label. A detectable label may be attached covalently or non-covalently, and may be a fluorescent, radioactive, chemiluminescent or magnetic label. For example, a probe may be labeled with a fluorescent label and a quencher moiety, in order to allow detection in real-time-PCR. The primer and probes of the present invention may be attached covalently or non-covalently to a solid support, like an array, or to beads, like magnetic beads. The primers and probes may be used to detect a polymorphism by hybridization to a target nucleic acid. Alternatively, the mutations may be detected by differences in restriction patterns due to the mutations. The target nucleic acid is preferably DNA, more preferably genomic DNA from a human.

It was surprisingly found that the presence of a mutation A>C at position -57 bp from translation start of the TERT gene is indicative for familial melanoma, i.e. a germline mutation. Therefore, the presence of the mutation in genomic DNA of human indicates that this human has a predisposition to develop melanoma.

In order to determine such mutation, a tissue probe is taken from a patient, for example blood or a tissue comprising or suspected to comprise cancer cells. In case of a germline mutation or a suspected germline mutation, any tissue comprising cells with nucleus is suitable. For example, a biopsy e.g. from skin may be used. From the cells in the tissue, genomic DNA can then be isolated by methods known in the art.

The presence of a given mutation can be determined by methods known in the art. In one preferred embodiment, the sequence of the human TERT promoter, in particular the core promoter and/or a sequence portion encompassing the nucleotide position(s) of interest can be determined by methods known to a skilled person. For example, the human TERT promoter, in particular the core promoter or relevant parts thereof may be amplified and/or cloned using primers and PCR, and the sequence may then be determined by sequencing methods known in the art. Such methods are described for example in Example 1 of the invention. Examples of suitable methods for determining a nucleotide at a given position are DNA sequencing, capillary electrophoresis, mass spectrometry, single-strand conformation polymorphism (SSCP), electrochemical analysis, denaturating HPLC and gel electrophoresis, restriction fragment length polymorphism, hybridization analysis and real-time PCR. These methods are known in the art. Therefore, in another embodiment, the present invention relates to an in vitro method of identifying a predisposition of a human to develop melanoma comprising determining the nucleotide i) at position -57 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,161 hg19 coordinate in genomic DNA from a tissue sample of said human,

wherein an A>C mutation at said position is indicative of a predisposition of said human to develop melanoma, in particular familial melanoma.

In a preferred embodiment, the tissue sample is blood or skin. In a further preferred embodiment, the nucleotide is determined by sequencing.

Further, it is important to stratify patients suffering from melanoma, in order to adapt the further treatment and/or to further determine their risk of disease recurrence, survival rate or susceptibility to treatments.

Therefore, in another embodiment, the present invention relates to an in vitro method of stratifying tumor cells of a patient suffering from melanoma or for diagnosing melanoma in a patient, comprising

determining in the genomic DNA of the tumor cells from said patient, or of skin cells suspected to develop a melanoma of said patient,

a) the nucleotide i) at position -124 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,228 hg19 coordinate, and/or b) the nucleotide i) at position -146 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,250 hg19 coordinate, and/or c) the nucleotides i) at positions -124/-125 from translation start of the TERT gene, or ii) at positions Chr 5: 1 ,295,228 and 1 ,295,229 hg19 coordinate, and/or

d) the nucleotides i) at positions -138/-139 bp from translation start of the

TERT gene, or ii) at positions Chr 5: 1 ,295,242 and 1 ,295,243 hg19 coordinate,

wherein a C>T mutation at said position of a) or b), or a CC>TT mutation at said position of c) or d) is indicative of melanoma, in particular sporadic melanoma.

In a preferred embodiment, the nucleotides of 1 , 2, 3 or 4 of alternatives a) to d) are determined, in particular the nucleotides of alternatives a) and b) are determined. In particular, it can be determined in case of the determination of one of the mutations a) to d) that the patient suffers from sporadic melanoma.

As explained above, various methods are available in the art for determining a nucleotide at the given positions of the human TERT promoter. In a preferred embodiment of the present invention, the nucleotides are determined by sequencing.

In order to further stratify a patient, further known biomarkers of a cancer, in particular melanoma, may be determined, in particular mutations in the BRAF and/or CDKN2 gene may be detected by methods known to a skilled person. In a preferred embodiment of the present invention, mutations in the BRAF and/or CDKN2 gene are detected in addition to the TERT promoter mutations, in particular using one or more of the primers of Table 7. Further, it was surprisingly found in Example 2 that a high proportion of bladder cancer patients carry mutations in the human TERT promoter at positions -57 bp, -124 bp, -146 bp, -129 bp, -124 bp, -125 bp, -138 bp, -139 bp from translation start of the TERT gene. These mutations were found in urothelial cells of bladder cancer patients. Therefore, the indicated variants of the human TERT promoter, in particular of the wild type TERT promoter and allelic variants thereof, in particular the rs2853669 polymorphism, can be used as biomarker for the diagnosis of cancer.

In another embodiment, the present invention relates to an in vitro method of diagnosing cancer, in particular bladder cancer in a human, comprising

determining in the genomic DNA of cells, preferably cancer cells, more preferably bladder or urothelial cells, from said human:

a) the nucleotide i) at position -57 bp from translation start of the TERT gene, or ii) position Chr 5: 1 ,295,161 hg19 coordinate, and/or b) the nucleotide i) at position -124 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,228 hg19 coordinate, and/or c) the nucleotide i) at position -146 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,250 hg19 coordinate, and/or d) the nucleotide at position -129 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,233 hg19 coordinate,

wherein the presence of one of the following mutations:

i) an A>C mutation at said position of a),

ii) a C>T or C>A mutation at said position of b),

iii) a C>T mutation at said position of c), and

iv) a deletion of the nucleotide C at said position of d),

is indicative of cancer, preferably bladder cancer.

The data in Example 2 surprisingly show that the common polymorphism rs2853669 in the TERT promoter acts as a modifier of the effect of the mutations on survival and tumor recurrence. The patients with the mutations showed poor survival in the absence (hazard ratio [HR] 2.19, 95%CI 1 .02-4.70) but not in the presence (HR 0.42, 95%CI 0.18-1 .01 ) of the variant allele of the polymorphism rs2853669. The mutations in the absence of the variant allele rs2853669 were highly associated with the disease recurrence in patients with Tis, Ta and T1 tumors (HR 1 .85, 95%CI 1 .1 1 -3.08). The TERT promoter mutations are the most common somatic lesions in bladder cancer with clinical implications. The association of the mutations with patient survival and the disease recurrence, subject to modification by a common polymorphism, has the effect that the TERT promoter variants of the invention are surprisingly biomarkers for cancer in particular with individualized prognostic potential.

Therefore, in a preferred embodiment, the method of the invention further comprises determining whether said TERT gene promoter has the rs2853669 polymorphism (T>C mutation at position -245 bp from translation start of the TERT gene, or at position Chr 5: 1 ,295,349 hg19 coordinate).

In another embodiment, the present invention relates to an in vitro method of determining survival rate and/or risk of disease recurrence of a patient suffering from cancer, preferably bladder cancer, comprising providing genomic DNA of cells, preferably cancer cells, more preferably bladder or urothelial cells from said patient and

a) determining in said genomic DNA whether the TERT gene promoter of said patient has the rs2853669 polymorphism, and

b) determining in said genomic DNA:

i) the nucleotide i) at position -57 bp from translation start of the TERT gene, or ii) position Chr 5: 1 ,295,161 hg19 coordinate, and/or

ii) the nucleotide i) at position -124 bp from translation start of the

TERT gene, or ii) at position Chr 5: 1 ,295,228 hg19 coordinate, and/or

iii) the nucleotide i) at position -146 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,250 hg19 coordinate, and/or

iv) the nucleotide at position -129 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,233 hg19 coordinate, wherein

the absence of the rs2853669 polymorphism and the concomitant presence of at least one of the following mutations: an A>C mutation at said position of i), a C>T or C>A mutation at said position of ii), a C>T mutation at said position of iii), and optionally a deletion of the nucleotide C at said position of iv), is indicative of a high risk of disease recurrence and low survival rate.

In one preferred embodiment 1 , 2, 3, or 4 of the nucleotides of alternatives i) to iv) are determined.

In another preferred embodiment, nucleotides of alternatives i) and ii) and iii) are determined. In another preferred embodiment, nucleotides of alternatives ii) and iii) are determined.

In a yet further preferred embodiment, 2, 3, or 4 of the nucleotides of alternatives i) to iv) are determined.

In a yet further preferred embodiment, 2, 3, or 4 of the nucleotides of alternatives i) to iv) are determined, and zero or one of the nucleotides of alternatives i) to iv) is mutated.

In another embodiment, the present invention relates to an in vitro method of determining survival rate or risk of disease recurrence of a patient suffering from cancer, preferably bladder cancer, comprising providing genomic DNA of cells, preferably cancer cells, more preferably bladder or urothelial cells from said patient and determining in said genomic DNA:

a) the nucleotide i) at position -57 bp from translation start of the TERT gene, or ii) position Chr 5: 1 ,295,161 hg19 coordinate, and/or b) the nucleotide i) at position -124 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,228 hg19 coordinate, and/or c) the nucleotide i) at position -146 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,250 hg19 coordinate, and/or d) the nucleotide at position -129 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,233 hg19 coordinate,

wherein the presence of one of the following mutations:

i) an A>C mutation at said position of a),

ii) a C>T or C>A mutation at said position of b),

iii) a C>T mutation at said position of c), and

iv) optionally a deletion of the nucleotide C at said position of d), is indicative of a low survival rate and high risk of disease recurrence of said patient.

In one preferred embodiment 1 , 2, 3, or 4 of the nucleotides of alternatives a) to d) are determined.

In another preferred embodiment, nucleotides of alternatives a) and b) and c) are determined. In another preferred embodiment, nucleotides of alternatives b) and c) are determined.

In a yet further preferred embodiment, 2, 3, or 4 of the nucleotides of alternatives a) to d) are determined.

In a yet further preferred embodiment, 2, 3, or 4 of the nucleotides of alternatives a) to d) are determined, and zero or one of the nucleotides of alternatives a) to d) is mutated according to alternatives i) to iv). Cancer is understood as malignant neoplasm, is encompassing a broad group of diseases involving unregulated cell growth. In cancer, cells divide and grow uncontrollably, forming malignant tumors, and invade nearby parts of the body. The cancer may also spread to more distant parts of the body through the lymphatic system or bloodstream. Examples of cancer include carcinoma, sarcoma, lymphoma and leukemia and blastoma. In a preferred embodiment, the cancer is a carcinoma, preferably selected from bladder cancer, breast cancer, prostate cancer, lung cancer, pancreas cancer, and colon cancer, or melanoma.

In a preferred embodiment, the bladder cancer is bladder carcinoma, in particular urothelial cell carcinoma of the bladder.

In a yet further preferred embodiment, the bladder cancer is a non-muscle invasive tumor, in particular of tumor stages Tis, Ta and T1 . For bladder tumors of these stages the mutations in the TERT promoter in the absence of the variant allele rs2853669 were highly associated with the disease recurrence in patients (HR 1 .85, 95%CI 1 .1 1 -3.08) as shown in Example 2. In another preferred embodiment, the bladder cancer is of tumor stage TaG1 or TaG2.

In the patients with the TaG1 +TaG2 stage diseases the presence of the mutations and the non-carrier status for the variant allele was associated with a 2.53 increased risk of the tumor recurrence.

The methods of the invention may be used for diagnosing patients which are untreated or which were treated for cancer. In the case of a bladder cancer patient, such patient may be a patient who is untreated for the bladder cancer, or who has undergone a bladder cancer treatment. In a preferred embodiment, the bladder cancer treatment is transurethral resection, either alone or in combination with BCG (Bacillus Calmette-Guerin), Radiotherapy, Chemotherapy, Chemotherapy + BCG, Cystectomy, Chemotherapy + Cystectomy, Chemotherapy + Radiotherapy and/or BCG + Cystectomy and/or immunotherapy.

Cystectomy may be radical or salvage cystectomy; Chemotherapy may be curative or neo adjuvant or palliative therapy or Mutamycin instillation; Radiation therapy may be curative or extravesical palliative or local palliative radiotherapy.

In a yet further preferred embodiment, patient has undergone transurethral resection and/or has been treated with radio- chemo- and/or immunotherapy.

The current strategy for follow-up treatment of bladder cancer patients is based on risk stratification, dependent on recurrence and progression scores. In clinical trial BCG in combination with interferon alpha-2B has been shown to be effective in reducing the recurrence and progression. The TERT mutations, particularly in the absence of the variant allele of the polymorphism, are therefore surprisingly useful in identifying patients for intravesical therapies.

Thus, in a yet further embodiment, the invention relates to a method of treatment of a bladder cancer patient, comprising

i) determining the risk of disease recurrence according to a method of claims 13 to 15, and

ii) administering to said patient a therapeutically effective amount of a medicament for intravesical therapy of bladder cancer, in particular administering a therapeutically effective amount of a combination of BCG and Interferon a intravesically, in case the patient was determined to have a high risk of disease recurrence.

In yet another embodiment, the present invention relates to a combination of BCG and Interferon a for use in the intravesical therapy of a patient suffering from bladder cancer, wherein said patient was identified to have a high risk of disease recurrence by performing a method of the invention above.

Preferably, Interferon a is Interferon a 2B.

In a further embodiment, the present invention relates to a kit comprising a variant or a fragment thereof of the invention, or a vector of the invention, or a nucleic acid of the invention, or a primer or probe of the invention. As explained above, the primer and/or probes may be used for determining whether the positions -57 bp, -124 bp, -146 bp, -129 bp, -124 bp, -125 bp, -138 bp, -139 bp from translation start of the TERT gene of the human TERT promoter are mutated, and therefore the primer and/or probes can be used for performing the methods of the invention.

The primer and/or probes are in one embodiment labeled with a detectable label, in particular fluorescent label.

In a further embodiment of the present invention, the primer and/or probes are not labeled with a detectable label, in particular not labeled with a fluorescent label.

In a preferred embodiment, the kit of the invention further comprises primers and/or reagents for amplifying and/or cloning the TERT promoter from genomic DNA, in particular by PCR.

Such kit is particularly useful for determining the nucleotides according to the method of the invention e.g. by cloning and subsequent sequencing.

Such primers useful for amplifying the human TERT promoter or a part thereof encompassing at least one position of interest are for example shown in Table 15. Further suitable reagents for amplification of such TERT promoter sequence or a part thereof are in particular a mix of dNTPs, a DNA polymerase, preferably processive DNA polymerase, and buffers. In a further preferred embodiment, the kit of the invention further comprises primers and/or reagents for determining one or more of the positions of the human TERT promoter: -57 bp, -124 bp, -146 bp, -129 bp, -124 bp, -125 bp, -138 bp, -139 bp and further optionally - 245 bp from translation start of the TERT gene, in particular by sequencing.

Suitable reagents for sequencing, in particular sequencing according to Sanger, are a mix of dNTPs, a DNA polymerase, preferably processive DNA polymerase, and buffer(s). Notably, various methods for sequencing are known in the art including e.g. sequencing by synthesis employing optionally modified dNTPs. The skilled person is aware of the reagents useful for performing a chosen sequencing method. In case of real-time PCR, the kit preferably comprises a primer pair suitable for amplifying the human TERT promoter or a part thereof encompassing at least one position of interest, and a probe which probe is labeled with a fluorescent label and a quencher moiety. In this preferred embodiment, the kit optionally further comprises a DNA polymerase, preferably a processive DNA polymerase and buffer(s).

Alternatively, the kit comprises at least one primer/probe, which is optionally bound to a solid support, which primer comprises at least one mutated nucleotide at position -57 bp, -124 bp, -146 bp, -129 bp, -124 bp, -125 bp, -138 bp, and/or -139 bp from translation start of the TERT gene, in particular wherein the nucleotide is mutated as described above, preferably the primer/probe is a primer/probe of the invention. Such primer may be used for hybridizing the primer/probe to a target DNA. The hybridization strength/efficacy can then be used for determining the nucleotide at said position of a target DNA.

In a preferred embodiment of the kits of the invention, also primers and/or probes are included to further determine whether the TERT promoter has the polymorphism rs2853669. Therefore, the nucleotide at position -245 bp from translation start of the TERT gene is in addition determined in a further embodiment. Suitable primers and probes for determining this polymorphism are described in the prior art and in Example 2. In another embodiment, the present invention relates to the use of a variant or a fragment thereof of the invention, or of a vector of the invention, or of a nucleic acid of the invention, or of a primer or probe of the invention, for

a) diagnosing cancer, in particular melanoma and/or bladder cancer, and/or

b) for identifying predisposition of a human to develop melanoma, and/or c) for determining survival rate or risk of disease recurrence of a patient suffering from cancer, preferably bladder cancer. It was further surprisingly found in 287 primary melanoma cases that TERT promoter mutations, besides causing an increased gene expression, associate with increased patient age, increased Breslow thickness and tumour ulceration and are most frequent in nodular melanomas, as shown in Example 3. The mutations are also more frequent at both intermittently and chronically sun- exposed sites than non-exposed sites and tend to co-occur with BRAF and CDKN2A mutations. These parameters are generally associated with poor outcome.

In addition to the TERT promoter variants described above, mutations were found at positions -46, -58, -144, -154, -156, -176, -187 and -242 of the human TERT promoter, as shown in Figure 17.

Therefore, the present invention relates in a further embodiment to a variant of the human wild type TERT promoter or the human TERT promoter with variant of the rs2853669 polymorphism, wherein the variant has at least one, preferably one of the following mutations a) to h):

a) a C>T mutation at position -46 bp from translation start of the TERT gene,

b) a C>T mutation at position -58 bp from translation start of the TERT gene, or

c) a C>T mutation at position -144 bp from translation start of the TERT gene, or

d) a C>T mutation at position -154 bp from translation start of the TERT gene, or

e) a C>T mutation at position -156 bp from translation start of the TERT gene, or

f) a C>T mutation at position -176 bp from translation start of the TERT gene, or g) a C>T mutation at position -187 bp from translation start of the TERT gene, or

h) a C>T mutation at position -242 bp from translation start of the TERT gene, or a fragment thereof comprising i) at least 15, 20, 30, 50 or 100 continuous nucleotides thereof or ii) the core promoter region,

which fragment encompasses the respective mutation(s), in particular wherein the wild type TERT promoter has the sequence according to SEQ ID No. 1 , in particular as shown in Figure 10.

In a further embodiment, the variant further has at least one, preferably one of the following mutations a) to e):

a) a A>C mutation i) at position -57 bp from translation start of the TERT gene, or ii) position Chr 5: 1 ,295,161 hg19 coordinate,

b) a C>T mutation i) at position -124 bp from translation start of the TERT gene, or ii) position Chr 5: 1 ,295,228 hg19 coordinate, or

c) a C>T mutation i) at position -146 bp from translation start of the TERT gene, or ii) position Chr 5: 1 ,295,250 hg19 coordinate, or

d) a CC>TT mutation i) at positions -124/-125 from translation start of the TERT gene, or ii) positions Chr 5: 1 ,295,228 and 1 ,295,229 hg19 coordinate,

e) a CC>TT mutation i) at positions -138/-139 bp from translation start of the TERT gene, or ii) positions Chr 5: 1 ,295,242 and 1 ,295,243 hg19 coordinate.

For these variants of the invention, the preferred embodiments of the variants of the invention described above apply.

In particular, fragments of the variant of the human wild type TERT promoter or the human TERT promoter with variant of the rs2853669 polymorphism of the invention which fragments encompass at least one of the surprisingly identified mutations can be used. For example, such fragments may be used as primers or probes for determining the nucleotide sequence or part thereof of a human TERT promoter of a human, and/or as reference sequence or probe. For example, such fragments comprise the core promoter sequence as shown underlined in Figure 10. Fragments of the invention encompassing at least one of these mutations comprise, preferably consist of at least 15, 20, 30, 50 or 100 continuous nucleotides, for example 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 continuous nucleotides.

Fragments of the invention encompassing at least one of these mutations comprise, preferably consist of at least 15, 20, 30, 50 or 100 continuous nucleotides, for example 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 continuous nucleotides.

In a further preferred embodiment, the nucleotides have length of about at least 15, 20, 30, 50 or 100 continuous nucleotides. In a further preferred embodiment, the length of the fragments is 300 nucleotides or less, preferably 200 nucleotides or less, more preferably 200 nucleotides or less, even more preferably 100 nucleotides or less, most preferably 50 nucleotides or less. It was surprisingly found in Example 3 that the some of the mutations in the human TERT promoter result in the generation of additional binding motif for transcription factors, namely an Ets/TCF binding motif, an additional BRCA1 binding motif, an additional PLAG1 binding motif, an additional E2F1 binding motif, or an additional SP1 binding motif. Such Ets/TCF binding motif created by the mutations is preferably GGA(A/T) or CCGGAA.

In a further embodiment, the present invention relates to such variant of the human wild type TERT promoter or the human TERT promoter with variant of the rs2853669 polymorphism, wherein the variant has a mutation resulting in an additional Ets/TCF binding motif, an additional BRCA1 binding motif, an additional PLAG1 binding motif, an additional E2F1 binding motif, or an additional SP1 binding motif, or wherein the mutation results in disruption of an ELK1 or AP binding site, in particular wherein the mutation is a point mutation or tandem point mutation,

or a fragment thereof comprising, in particular consisting of, i) at least 15, 20, 30, 50 or 100 continuous nucleotides thereof or ii) the core promoter region,

which fragment encompasses the respective mutation(s), preferably wherein the Ets/TCF binding motif is GGA(A/T) or CCGGAA.

In a further embodiment, the present invention relates to a vector comprising the variant or fragment of the present invention.

Also, the cloned variant or fragment thereof may be ligated to further sequences. In one embodiment, an open reading frame or gene, like the luciferase gene, may be fused to the promoter variant of the invention, for expression of such in human cells open reading frame or gene. In a further embodiment, adaptor sequences, e.g. having a length of about 5 to 50 nucleotides, may be fused to variant promoter sequences or fragments thereof of the invention.

In a yet further embodiment, the present invention relates to a variant or a fragment thereof according to the present invention and at least one heterologous sequence. In one embodiment, the at least one heterologous sequence is the vector sequence and/or a coding sequence for a non-human gene, for example a reporter gene like luciferase.

In a yet further embodiment, the present invention relates to a primer or probe comprising, preferably consisting of, a fragment of a variant of the present invention, and optionally adaptor sequence(s) and/or detectable label(s).

The primer or probes of the present invention may be labeled, in particular with a detectable label. A detectable label may be attached covalently or non-covalently, and may be a fluorescent, radioactive, chemiluminescent or magnetic label. For example, a probe may be labeled with a fluorescent label and a quencher moiety, in order to allow detection in real-time-PCR.

The primer and probes of the present invention may be attached covalently or non-covalently to a solid support, like an array, or to beads, like magnetic beads. The primers and probes may be used to detect a polymorphism by hybridization to a target nucleic acid.

Alternatively, the mutations may be detected by differences in restriction patterns due to the mutations.

The target nucleic acid is preferably DNA, more preferably genomic DNA from a human. Alternatively, the mutation can be determined on the RNA level, e.g. by using probes or sequencing. It was surprisingly found that the presence of one or more mutations in the TERT gene, in particular mutations 124C>T and 146C>T in the TERT promoter, correlate with increased patient age, increased Breslow thickness, and tumour ulceration. Such parameters are associated with poor outcome of the affected patients. Also, an association with intermittently and chronically sun-exposed sites, and co- occurrence with BRAF and CDKN2A mutations was found in primary melanoma patients. Therefore, the subject-matter related to the TERT promoter, in particular mutations in 124C>T and 146C>T, are surprisingly suitable as biomarkers for primary melanoma. In order to determine such mutation, a primary melanoma tissue probe is taken from a patient, e.g. by biopsy from skin. In case of metastatic cells, cells may be taken from the respective tissue affected, e.g. as a biopsy or removal of a bodily fluid such as blood. From the cells in the tissue or fluid, genomic DNA or RNA can then be isolated by methods known in the art.

The presence of a given mutation can be determined by methods known in the art. In one preferred embodiment, the sequence of the human TERT promoter, in particular the core promoter and/or a sequence portion encompassing the nucleotide position(s) of interest can be determined by methods known to a skilled person. For example, the human TERT promoter, in particular the core promoter or relevant parts thereof may be amplified and/or cloned using primers and PCR, and the sequence may then be determined by sequencing methods known in the art. Such methods are described for example in Example 1 and 3 of the invention. Examples of suitable methods for determining a nucleotide at a given position are DNA sequencing, capillary electrophoresis, mass spectrometry, single-strand conformation polymorphism (SSCP), electrochemical analysis, denaturating HPLC and gel electrophoresis, restriction fragment length polymorphism, hybridization analysis and real-time PCR. These methods are known in the art. Further, it is important to stratify patients suffering from primary melanoma, in order to adapt the further treatment and/or to further determine their risk of disease recurrence, survival rate or susceptibility to treatments.

Therefore, in another embodiment, the present invention relates to an in vitro method of stratifying tumor cells of a patient suffering from primary melanoma or for diagnosing primary melanoma in a patient, comprising

determining in the genomic DNA of the tumor cells from said patient, or of skin cells suspected to develop a primary melanoma of said patient,

a) the nucleotide i) at position -124 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,228 hg19 coordinate, and/or b) the nucleotide i) at position -146 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,250 hg19 coordinate, and/or c) the nucleotides i) at positions -124/-125 from translation start of the TERT gene, or ii) at positions Chr 5: 1 ,295,228 and 1 ,295,229 hg19 coordinate, and/or

d) the nucleotides i) at positions -138/-139 bp from translation start of the TERT gene, or ii) at positions Chr 5: 1 ,295,242 and 1 ,295,243 hg19 coordinate, and/or

e) the nucleotide i) at position -57 bp from translation start of the TERT gene, or ii) at position Chr 5: 1 ,295,161 hg19 coordinate,

wherein a C>T mutation at said position of a) or b), or a CC>TT mutation at said position of c) or d), or a A>C mutation at said position of a), or a A>C position at said position e) is indicative of primary melanoma.

Nodular melanomas tend to be diagnosed at later stages. Therefore, early diagnosis of nodular diagnosis is often not possible with prior art methods.

Therefore, in a particularly preferred embodiment, the primary melanoma is nodular melanoma.

The TERT promoter mutations may be homozygous or heterozygous.

Also, it is possible to determine the mutations in the RNA comprising mRNA of cells, as described in Example 3. Therefore, in another embodiment, the present invention relates to an in vitro method of stratifying tumor cells of a patient suffering from primary melanoma or for diagnosing primary melanoma in a patient, comprising

determining in the RNA of the tumor cells from said patient, or of skin cells suspected to develop a primary melanoma of said patient,

a) the nucleotide i) corresponding to position -124 bp from translation start of the TERT gene, or ii) corresponding to position Chr 5: 1 ,295,228 hg19 coordinate, and/or

b) the nucleotide i) corresponding to position -146 bp from translation start of the TERT gene, or ii) corresponding to position Chr 5: 1 ,295,250 hg19 coordinate, and/or

c) the nucleotides i) corresponding to positions -124/-125 from translation start of the TERT gene, or ii) corresponding to positions Chr 5: 1 ,295,228 and 1 ,295,229 hg19 coordinate, and/or

d) the nucleotides i) corresponding to positions -138/-139 bp from translation start of the TERT gene, or ii) corresponding to positions Chr 5: 1 ,295,242 and 1 ,295,243 hg19 coordinate, and/or

e) the nucleotide i) corresponding to position -57 bp from translation start of the TERT gene, or ii) corresponding to position Chr 5: 1 ,295,161 hg19 coordinate,

wherein a C>T mutation at said position of a) or b), or a CC>TT mutation at said position of c) or d), or a A>C mutation at said position of a), or a A>C position at said position e) is indicative of primary melanoma, in particular indicative of primary melanoma responsive to treatment with an agent which inhibits and/or suppresses TERT.

Further, in a further embodiment, the present invention relates to a method of treatment of a primary melanoma patient, comprising

i) determining whether the primary melanoma of said patient is responsive to treatment with an agent which inhibits and/or suppresses TERT according to the method of the invention above, and

ii) administering to said patient a therapeutically effective amount of an agent which inhibits and/or suppresses TERT, in case the primary melanoma was determined to be responsive to treatment with an agent which inhibits and/or suppresses TERT.

(iii) optionally further applying a standard therapy for primary melanoma, in particular surgery, to said patient. Step (ii) may be performed before, after or at the same time as step (iii).

Thus, in a yet further embodiment, the present invention relates to an agent which inhibits and/or suppresses TERT for use the treatment of primary melanoma in a patient, wherein said primary melanoma was determined to be responsive to treatment with an agent which inhibits and/or suppresses TERT by performing the above method of the invention.

In a preferred embodiment, the nucleotides of 1 , 2, 3, 4 or 5 of alternatives a) to e) are determined, in particular the nucleotides of alternatives a) and b) are determined. In particular, it can be determined in case of the determination of one of the mutations a) to e) that the patient suffers from primary melanoma.

In a preferred embodiment, the nucleotides of alternatives a) or b), or a) and b) are determined, in particular wherein a C>T mutation at said position of a) or b) or a) and b) is indicative of primary melanoma.

In an even more preferred embodiment, the primary melanoma is nodular melanoma.

In a further more preferred embodiment, the primary melanoma is ulcerated melanoma.

In a further more preferred embodiment, the primary melanoma is a melanoma in vertical growth phase.

In a further more preferred embodiment, the primary melanoma is a melanoma with solar lentigines at the site of primary melanoma. In a further more preferred embodiment, the primary melanoma patient is a patient with locoregional metastasis, distant metastasis, localized melanoma or in situ melanoma, even more preferably a patient with locoregional metastasis or distant metastasis, or the primary melanoma is in a patient with locoregional metastasis, distant metastasis, localized melanoma or in situ melanoma, even more preferably in a patient with locoregional metastasis or distant metastasis. In a preferred embodiment of the in vitro method of the invention, the primary melanoma is located at a sun-exposed part of the body, in particular an intermittently or chronically exposed site. In a further preferred embodiment, the method of the invention further comprises determining said nucleotide(s) in the genomic DNA of the metastatic cells from said patient, or of skin cells suspected to develop metastases of said primary melanoma patient. In a yet other, further preferred embodiment of the invention, the in vitro method of the invention further comprises determining the amount and/or concentration of human TERT mRNA in said tumor cells from said primary melanoma patient, or of skin cells suspected to develop a primary melanoma of said patient, and optionally the metastatic cells from said patient, or of skin cells suspected to develop metastases of said primary melanoma patient. Methods for isolating and/or quantification of mRNA are known to a skilled person. For example, RT-PCR methods, like the qRT-PCT as described in Example 3 may be used.

In a preferred embodiment, an elevated amount and/or concentration of human TERT mRNA in said tumor cells compared to control cells is indicative of a primary melanoma responsive to treatment with an agent which inhibits and/or suppresses TERT. Preferably, the amount and/or concentration of human TERT mRNA in said tumor cells compared to control cells is elevated by at least 10%, 50% or 100% compared to control cells. Such control cells are preferably healthy skin cells from the same patient or different person(s).

In a yet further preferred embodiment, the presence of the mutation(s) according to the in vitro methods of the inventions is indicative of primary melanoma with poor outcome, high risk of disease recurrence and/or low survival rate, in particular poor outcome.

Thus, in a further preferred embodiment, the present invention relates to an in vitro method of determining outcome, survival rate and/or risk of disease recurrence of a patient suffering from primary melanoma, comprising providing genomic DNA or RNA of cancer cells from said patient and determining in said genomic DNA or RNA: a) the nucleotide i) at, or, for RNA, corresponding to position -124 bp from translation start of the TERT gene, or ii) at, or for RNA, corresponding to position Chr 5: 1 ,295,228 hg19 coordinate, and/or

b) the nucleotide i) at, or, for RNA, corresponding to position -146 bp from translation start of the TERT gene, or ii) at, or, for RNA, corresponding to position Chr 5: 1 ,295,250 hg19 coordinate, and/or

c) the nucleotides i) at, or, for RNA, corresponding to positions -124/-125 from translation start of the TERT gene, or ii) at, or, for RNA, corresponding to positions Chr 5: 1 ,295,228 and 1 ,295,229 hg19 coordinate, and/or

d) the nucleotides i) at, or, for RNA, corresponding to positions -138/-139 bp from translation start of the TERT gene, or ii) at, or, for RNA, corresponding to positions Chr 5: 1 ,295,242 and 1 ,295,243 hg19 coordinate, and/or

e) the nucleotide i) at, or, for RNA, corresponding to position -57 bp from translation start of the TERT gene, or ii) at, or, for RNA, corresponding to position Chr 5: 1 ,295,161 hg19 coordinate,

wherein a C>T mutation at said position of a) or b), and/or or a CC>TT mutation at said position of c) or d), and/or a A>C mutation at said position of a), or a A>C position at said position e) is indicative of poor outcome, a low survival rate and/or high risk of disease recurrence of said primary melanoma patient, preferably indicative of poor outcome.

In this context, one or more further parameters associated with poor outcome may be determined.

Therefore, in another, further preferred embodiment of the invention, one or more of the following parameters are determined for said patient for the in vitro methods of the invention:

(i) Breslow thickness,

(ii) tumour ulceration,

(iii) patient age,

(iv) solar lentigines at the site of primary melanoma,

(v) BRAF mutation(s) in the primary melanoma cells or cells suspected to develop primary melanoma,

(vi) CDKN2A mutation(s) in the primary melanoma cells or cells suspected to develop primary melanoma,

(vii) hypermethylation of the p16 transcript (viii) histopathological classification, in particular as nodular melanoma,

(ix) exposure of the primary melanoma site to sun.

In particular,

(i) a Breslow thickness of more than 2 mm,

(ii) presence of tumour ulceration,

(iii) a patient age above 65 years,

(iv) the presence of solar lentigines at the site of primary melanoma,

(v) the presence of BRAF mutation(s) in the primary melanoma cells or cells suspected to develop primary melanoma,

(vi) the presence of CDKN2A mutation(s), such as a point mutation or deletion, in the primary melanoma cells or cells suspected to develop primary melanoma,

(vii) the presence of hypermethylation of the p16 transcript,

(viii) classification of the primary melanoma as nodular melanoma, and/or (ix) intermittent or chronic exposure of the primary melanoma site to sun, is/are indicative of poor outcome, a low survival rate and/or high risk of disease recurrence of the primary melanoma. Methods for determining such parameters are known to skilled persons are for example described in Example 3.

In more preferred embodiments, parameters (v), (vi) and/or (vii) are in addition determined.

In more preferred embodiments, parameters (i), (ii), (v), (vi) and/or (vii) are in addition determined.

In other more preferred embodiments, parameters (i) and (ii) are in addition determined.

"Poor outcome" is understood to mean poor survival and/or increased risk of death compared the average survival and/or risk of death of a patient diagnosed with this disease.

In a preferred embodiment, the nucleotides of 1 , 2, 3, 4 or 5 of alternatives a) to e) are determined, in particular the nucleotides of alternatives a) and b) are determined. In particular, it can be determined in case of the determination of one of the mutations a) to e) is indicative of poor outcome, a low survival rate and/or high risk of disease recurrence of said primary melanoma, preferably indicative of poor outcome. In a preferred embodiment, the nucleotides of alternatives a) or b), or a) and b) are determined, in particular wherein a C>T mutation at said position of a) or b) or a) and b) is indicative of is indicative of poor outcome, a low survival rate and/or high risk of disease recurrence of said primary melanoma, preferably indicative of poor outcome.

In an even more preferred embodiment, the primary melanoma is nodular melanoma.

In a further more preferred embodiment, the primary melanoma is ulcerated melanoma.

In a further more preferred embodiment, the primary melanoma is a melanoma in vertical growth phase. In a further more preferred embodiment, the primary melanoma is a melanoma with solar lentigines at the site of primary melanoma.

In a further more preferred embodiment, the primary melanoma patient is a patient with locoregional metastasis, distant metastasis, localized melanoma or in situ melanoma, even more preferably a patient with locoregional metastasis or distant metastasis, or the primary melanoma is in a patient with locoregional metastasis, distant metastasis, localized melanoma or in situ melanoma, even more preferably in a patient with locoregional metastasis or distant metastasis. In a preferred embodiment of the in vitro method of the invention, the primary melanoma is located at a sun-exposed part of the body, in particular an intermittently or chronically exposed site.

In a further preferred embodiment, the method of the invention further comprises determining said nucleotide(s) in the genomic DNA of the metastatic cells from said patient, or of skin cells suspected to develop metastases of said primary melanoma patient. In a yet other, further preferred embodiment of the invention, the in vitro method of the invention further comprises determining the amount and/or concentration of human TERT mRNA in said tumor cells from said primary melanoma patient, or of skin cells suspected to develop a primary melanoma of said patient, and optionally the metastatic cells from said patient, or of skin cells suspected to develop metastases of said primary melanoma patient. Methods for isolating and/or quantification of mRNA are known to a skilled person. For example, RT-PCR methods, like the qRT-PCT as described in Example 3 may be used. Preferably, such results on amount and/or concentration are normalized. Such methods are known to a skilled person.

It was also shown in the present studies that primary melanoma cells, which show TERT promoter mutations, exhibit higher TERT expression. As discussed in Example 3, this increased TERT expression may lead to stabilization of the tumour cells. The primary melanoma cells may therefore be treated by inhibiting and/or suppressing TERT in these cells.

Further, in a further embodiment, the present invention relates to a method of treatment of a primary melanoma patient, comprising

i) determining the outcome, survival rate and/or risk of disease recurrence of a patient suffering from primary melanoma according to a method of the invention above, and

ii) administering to said patient a therapeutically effective amount of an agent which inhibits and/or suppresses TERT, in case the patient was determined to have poor outcome, low survival rate and/or high risk of disease recurrence, and/or a standard therapy for primary melanoma.

An agent that inhibits and/or suppresses TERT may be an inhibitor of TERT telomerase enzymatic activity, such as a small molecule, or an inhibitory antibody or antibody fragment, or an agent, which lowers TERT mRNA or protein expression. Such agents are known to a skilled person, and are for example described in Ruden, M. and Puri, R. (Cancer Treat Rev., 2013;39(5):444-56). Known agents currently in clinical trials are small molecule inhibitors, antisense oligonucleotides, immunotherapies and gene therapies, targeting the hTERT or the ribonucleoprotein subunit hTER, as well as G-quadruplex stabilizers, tankyrase and HSP90 inhibitors targeting telomere and telomerase assembly, and T-oligo approach. Particularly preferred are the antisense oligonucleotide inhibitor GRN163L and immunotherapies that use dendritic cells (GRVAC1 ), hTERT peptide (GV1001 ) and cryptic peptides (Vx-001 ) described in the prior art, in particular as disclosed in Ruden, M. and Puri, R., supra. The agents disclosed therein which inhibit and/or suppress TERT are hereby incorporated by reference.

Therefore, in a preferred embodiment, the agents which inhibits and/or suppresses TERT is selected from the group consisting of small molecule inhibitors, antisense oligonucleotides, immunotherapies and gene therapies, targeting the hTERT or the ribonucleoprotein subunit hTER, as well as G-quadruplex stabilizers, tankyrase and HSP90 inhibitors targeting telomere and telomerase assembly, and T-oligo approach, even more preferably selected from the antisense oligonucleotide inhibitor GRN163L and immunotherapies that use dendritic cells (GRVAC1 ), hTERT peptide (GV1001 ) and cryptic peptides (Vx-001 ). A preferred standard therapy for primary melanoma is surgery.

Further standard therapies for primary melanoma are Elective lymph node dissection, SLNB/dissection, and adjuvant interferon (IFN) alfa-2b administration. Preferably, the patient undergoes surgery, and a therapeutically effective amount of an agent which inhibits and/or suppresses TERT is administered.

The invention further relates to an agent which inhibits and/or suppresses TERT for use the treatment of primary melanoma in a patient, wherein said patient was identified to have poor outcome, a low survival rate and/or high risk of disease recurrence by performing a method of the invention.

In a yet further embodiment, the present invention relates to the use of a variant or a fragment thereof, or of a vector, or of a nucleic acid, or of a primer or probe according to the present invention, for

a) diagnosing and/or stratifying primary melanoma, and/or

b) for determining poor outcome, a low survival rate and/or high risk of disease recurrence in a primary melanoma patient Figures

Figure 1 : Pedigree of melanoma-prone family. Four generations were affected by melanoma (solid symbols; circles represent females, and squares represent males). After linkage analysis carried out on 15 family members (L), HTS was performed on four affected and four unaffected individuals (boxed samples). A mutation in the TERT promoter was identified in all affected members and one unaffected individual (stars). Striketh rough symbols indicate deceased individuals. Two-digit numbers are age at onset of melanoma and age at death; Unk, unknown; Rs, rs2853669 observed in heterozygous form; threedigit numbers, DNA available; #, affected by other cancers; and index, index patient.

Figure 2: The TERT core promoter in melanoma. Mutations creating Ets/TCF binding motifs were found in affected family members (-57 bp) immediately next to the transcription start site and in sporadic metastatic melanoma (-124 to -149 bp; sequence details in Figure 4). Binding sites for c-Myc (E-Box), SP1 , and Ets transcription factors are known to exist in the wild-type TERT promoter. Ets2 binding was reported for Ets2 sites at -99 and -243 bp (stars) (4). The plus strand of DNA is shown. Figure 3: Luciferase reporter activity for TERT promoter constructs in melanoma cells (Ma-Mel-86a) and HEK293T cells. Reporter constructs without TERT promoter show Luciferase activity (pGL4.10). Introduction of wild type TERT promoter sequences and sequences with the rs2853669 polymorphism showed reduced Luciferase activity. In Ma-Mel-86a, the familial mutation (-57bp) increased activity compared to wild type and rs2853669 constructs. Combination of familial mutation with rs2853669 restored Luciferase activity to the levels of pGL4.10. HEK293T cells showed increased activity with the last construct (familial mutation and rs2853669) compared to wild type and rs2853669 constructs. pGL4.10: reporter construct without TERT promoter. -57bp K: familial mutation. Note the different scales and a discontinuous scale for HEK293T cells.

Figure 4: Mutations in the TERT core promoter in melanoma. Affected family members harbor a germ line heterozygous mutation at -57bp (T>G) immediately next to the transcription start site creating a new Ets/TCF binding motif. Sporadic metastatic melanoma showed frequent G>A mutations at -124bp to -149bp, that also create Ets/TCF binding motifs. Plus strand of DNA is shown. Ref: reference sequence. SM: sporadic melanoma.

Mutation frequencies in melanoma. (A) TERT is the most frequently mutated locus compared to BRAF, CDKN2A and NRAS in melanoma cell lines. (B) TERT mutations occur most often in conjunction with BRAF and CDKN2A mutations (left column: observed, right column: expected).

Proposed pathway of TERT activation in melanoma. UV stimulation leads to proliferation of melanocytes via the MAPK pathway and activates TCF (32, 33). UV light induced TCF binding sites in the TERT promoter mediate increased TERT expression. Telomerase (Tert) may then promote cell survival and proliferation. BRAF activating mutations further increase TCF and TERT activity.

LOD scores from linkage analysis across the genome. Chromosome 5-p shows the highest value at 2.45.

Coverage at genes for affected (a) and unaffected (u) individuals.

Coverage at genes in affected individuals given in percent of coverage in unaffected individuals. Data point 38 at around 130% represents ZDHHC1 1 position 839,557-843,816bp, a region, which is known for duplication of >1000 bases of non-repeat masked sequence (UCSC genome browser).

Figure 10: Sequence of the human wild type TERT promoter according to SEQ

ID No. 1 . The sequence of the core promoter is underlined. Mutations of the promoter which are subject of the present invention are indicated.

Figure 1 1 : Kaplan Meier analysis of differences in survival. (A) in all patients with and without the TERT promoter mutations; (B) in patients that were non-carriers of the variant allele rs2853669, with and without the mutations; (C) in patients that were carriers of the variant allele rs2853669, with and without the mutations. The numbers of patients at risk in each category are shown along the curves at years 5, 10, and 15.

Figure 12: Relative luciferase activity of different TERT promoter constructs.

Luciferase reporter constructs containing wild type TERT promoter sequence (WT), sequence with variant allele for the rs2853669 polymorphism (WT+rs), with -124T mutant (-124T), with -124T mutant and the variant allele (-124T+rs), with -146T mutant (-146T) and with -146 mutant and the variant allele (-146T+rs) were transfected into T24 and CLS-439, urothelial carcinoma cell lines.

Constructs with either of the two mutations (-124T and -146T) resulted in 2-4-fold increased activity compared to the construct with WT. Constructs with -124T+rs or -146T+rs showed reduced activity in comparison with constructs with corresponding mutations only.

Figure 13: Parts of the TERT promoter sequences showing different mutations in urothelial bladder tumors. The panel on the upper right shows a - 57T>G (A>C) mutation at 1 ,295, 161 (hg19 coordinate) in DNA from a tumor and wild type sequence in the corresponding DNA from blood tissue. The panel on the upper left shows a -146G>A (C>T) mutation at 1 ,295,250 in DNA from a tumor and wild type sequence in the corresponding DNA from blood tissue. The panel below left shows a -124G>A (C>T) mutation at 1 ,295,228 in DNA from a tumor and a wild type sequence in DNA from the corresponding blood tissue. The panel below right shows a -129 C del (-G del) at

1 ,295,233 in DNA from tumor and sequence after cloning of amplified DNA with the deletion, which shows that in addition to -129 C del the same allele also contains the -146G>A (C>T) mutation. Figure 14: A part of the TERT promoter which has been shown to carry somatic mutations. In the upper part of sequence different known transcription factor sites are marked. The sequences below show creations of Ets/TCF transcription factor bind motifs as a result of mutations at -57, -124 and -146 positions. -129C del in one of the tumors results in loss of a Sp1 site.

Figure 15: Kaplan Meier analysis of differences in tumor recurrence in patients with Tis, Ta and T1 tumors (A) in all patients with and without the TERT promoter mutations; (B) in patients that were non-carriers of the variant allele rs2853669, with and without the mutations; (C) in patients that were carriers of the variant allele rs2853669, with and without the mutations. The numbers of patients at risk in each category are shown along the curves at years 5, 10, and 15.

Figure 16: Kaplan Meier analysis of differences in tumor recurrence in patients with TaG1 +TaG2 disease categories (A) in all patients with and without the TERT promoter mutations; (B) in patients that were non- carriers of the variant allele rs2853669, with and without the mutations; (C) in patients that were carriers of the variant allele rs2853669, with and without the mutations. The numbers of patients at risk in each category are shown along the curves at years 5, 10, and 15.

Figure 17: Distribution of mutations in primary melanomas and representative sequences showing somatic mutations in the TERT promoter, (a) The distribution of mutations in the TERT promoter, BRAF and NRAS genes in 287 melanomas are indicated by different colours, (b) Representative sequences of the TERT promoter from different tumours with mutations;-146C>T mutation shown in the left most panel followed by the -138/-139 CC>TT tandem mutation, -124 C>T and -57 CA>C. The wild type and mutated sequences are shown on the top and the Ets/TCF consensus motifs created by the mutations are marked.

Figure 18: Relative TERT gene expressions in melanomas with and without

TERT promoter mutations. TERT messenger RNA (mRNA) expression measured by qRT-PCR in skin tissues from healthy individuals (n = 5), tumours without (n = 29) and tumours with the

TERT promoter mutations (n = 10). Expression of TERT gene was normalized to GUSB expression, used as an internal standard and quantification was done by AACT method with log2 transformation. Box plots represent mean ± standard error of the mean. P-values were determined by t-test.

Figure 19: Part of the sequences with TERT mutations from a primary tumour and two corresponding metastasis from the same patient. For one patient, a primary melanoma and two metastases were available; the primary tumour (upper panel) and metastasis 1 (middle panel) show a -124C>T and a -91 C>T mutations that are heterozygous. Metastasis 2 (lower panel) shows the same mutations in a homozygous form, indicating loss of the wild type allele.

Tables:

Table 1 Most-frequent TERT core promoter mutations in screened metastatic melanoma cell lines and paraffin embedded primary tumors. A total of 169 cell lines were screened. Amplification for the TERT promoter failed for one cell line. Of 168 cell lines examined, 125 carried recurrent mutations. Of 77 primary melanomas examined, 24 carried recurrent mutations, and one carried a rare mutation (Table 6). Seven rare mutations occurred at other sites in less than 2% of samples. Details of all mutations and polymorphisms are given in tables 5 and 6. Matched normal control DNA corresponding to 23 cell lines did not show mutations. For primary tumors, matched normal control DNA was not available. Table 2 Samples and coverage in high throughput sequencing (HTS).

Affected and unaffected individuals were analyzed in enrichment and HTS. The resulting coverage after mapping of reads is given in reads per position (mean) including non-tiled regions. MID: multiplex identifier. Index: index patient.

Table 3 Details on variants shared by the affected individuals. Exon and intron boundaries as defined in the UCSC genome browser. TF: transcription factor. ChIP: chromatin immunoprecipitation. Affected individuals were heterozygous for the variants.

Table 4 Variants in TERT and MC1 R detected in the melanoma prone family.

Hg19 coordinates, base changes and amino acid changes are given. HTS: High throughput sequencing. N: not in HTS. Y: in HTS. Table 5 Variants in TERT, BRAF, NRAS and CDKN2A detected in metastatic melanoma cell lines. Hg19 coordinates, base changes and amino acid changes are given. NA: For Ma-Mel-23 the TERT promoter was not evaluated. Variants in TERT detected in melanoma primary tumors. Hg19 coordinates and base changes are given.

Primer sequences and conditions for PCR, Sanger sequencing and cloning.

Affected and unaffected individuals in linkage analysis and percentage of SNP calls and signal detection.

TERT promoter mutations and rs2853669 variant: frequencies in tumors from bladder cancer patients. ^* Percentage of the TERT promoter mutations.†C>T or C>A mutation at chr5:1 ,295,228 (hg19 coordinate). †C>T mutation at chr5:1 ,295,250 (hg19 coordinate). 1|A>C mutation at chr5:1 ,295,161 (hg19 coordinate). §Percentage of carriers of the variant allele for the rs2853669 polymorphism. nPUNLMP: Papillary urothelial neoplasm of low malignant potential. ¥Alive or died due to causes than bladder cancer.

Cox regression analysis for the effect of the TERT promoter mutations and rs2853669 polymorphism on cause-specific survival in all bladder cancer patients and the effect on tumor recurrence in patients with non-invasive carcinomas. ^* Hazard ratio (HR) adjusted for sex, age at diagnosis, TNM status, tumor grade and treatment. †Hazard ratio (HR) adjusted for sex and age at diagnosis. Bold type HR: Statistically significant.

Cox regression analysis for the effect of the TERT promoter mutations and rs2853669 polymorphism on cause-specific survival in sub-categories of bladder cancer patients. ^* Hazard ratio (HR) adjusted for sex, age at diagnosis, TNM status, tumor grade and treatment. HR in bold font indicates statistically significant.

Variants in the TERT promoter detected in tumors from bladder carcinoma patients.

Cox regression analysis for the effect of the TERT promoter mutations and rs2853669 polymorphism on cause-specific survival in sub-categories of bladder cancer patients. ^* Hazard ratio (HR) adjusted for sex, age at diagnosis, TNM status, tumor grade and treatment. HR in bold font indicates statistically significant.

Different Treatments administered to the bladder carcinoma patients. TURB (Transurethral resection of bladder); BCG (Bacille Calmette- Guerin) instillation; Cystectomy (radical or salvage cystectomy); Chemotherapy (curative or neo adjuvant or palliative therapy or Mutamycin instillation); Radiation therapy (curative or extravesical palliative or local palliative radiotherapy).

Primer sequences and conditions for PCR for Sanger sequencing and cloning. Primer pair 1 was used for amplification of 2.5 kb of hTERT promoter sequence used in luciferase reporter assay. Primer pair 2 was used for amplification of a 343 bp fragment within hTERT core promoter sequence for mutation screening of the TERT promoter by Sanger sequencing in DNA from patients.

Characteristics of patients with primary melanomas according to presence or absence of TERT promoter mutations (n = 287). a Fitzpatrick phototyping scale, b V60L; D84E; V92M; R142H_R; R151 C_R; I155T; V156L; R160W_R; R163Q; D294H_R; T314T; rare variants, c comprising Basal Cell Carcinoma and Squamous Cell Carcinoma, d data are also included in estimation of category "sunexposure at melanoma site", e LMM, Lentigo Maligna Melanoma; SSM, Superficial Spreading Melanoma; NM, Nodular Melanoma; ALM, Acral Lentiginous Melanoma, bold font indicates statistical significance.

TERT promoter mutations in primary melanomas.

Multivariate analysis of TERT promoter mutations including various factors.

Alterations in TERT promoter, 9p21 locus, BRAF and NRAS in a subset of melanomas. Table 20: Information on melanoma patients and mutation status of primary melanoma tumours (n = 287).

Table 21 : PCR conditions and primer sequences.

Examples

Example 1 : TERT Promoter Mutations in Familial and Sporadic Melanoma

As general remark for Example 1 , it is noted that the mutations are annotated in this example using the upper DNA strand as reference. In contrast, the remaining part of this application refers to the lower DNA strand as reference. For example, a T>G mutation on one strand will be A>C mutation on the other strand. Consequently, the mutation at -57 bp T>G describes the change in the upper strand and it is automatically understood that the same mutation can be described as -57 bp A>C mutation in the lower strand.

A. Summary

Cutaneous melanoma occurs in both familial and sporadic forms. We investigated a melanoma-prone family through linkage analysis and high-throughput sequencing and identified a disease-segregating germline mutation in the promoter of the telomerase reverse transcriptase (TERT) gene, which encodes the catalytic subunit of telomerase. The mutation creates a new binding motif for Ets transcription factors and ternary complex factors (TCFs) near the transcription start and, in reporter gene assays, caused up to twofold increase in transcription. We then screened the TERT promoter in sporadic melanoma and observed recurrent ultraviolet signature somatic mutations in 125 of 168 (74%) of human cell lines derived from metastatic melanomas, 45 of 53 corresponding metastatic tumor tissues (85%), and 25 of 77 (33%) primary melanomas. The majority of those mutations occurred at two positions in the TERT promoter and also generated binding motifs for Ets/TCF transcription factors.

B. Introduction and general description of experiments

The identification of germline mutations that cosegregate with disease in cancerprone families often provides genetic and mechanistic insights into the more common, sporadically arising cancers. In a study of cutaneous melanoma, the most malignant skin cancer, we investigated a large pedigree with 14 related melanoma patients who were not carriers of germline mutations in CDKN2A or CDK4, two known melanoma genes (Fig. 1 ). Multipoint linkage analysis showed a possible 2.2-Mb linkage region on chromosome 5p with maximal logarithm of the odds ratio for linkage scores of 2.35 at rs1379917 and 2.45 at rs196801 1 . Target- enriched high-throughput sequencing (HTS) of the region was carried out on constitutional DNA from the four affected and four unaffected members of the family with an average coverage between 55- and 108-fold (Table 2) (1 ). The HTS data revealed a single promoter variant, three intronic variants, and three nongene variants previously unknown and unique to the DNA sequences of the affected individuals (Table 3). The disease segregating variants, seven in total, were validated by Sanger sequencing of DNA from the individuals sequenced by HTS and of DNA from additional unaffected members of the family. The new variants were also detected in an unaffected member (754, Table 4), who was 36 years old and carried multiple nevi. DNA from affected individuals other than those sequenced by HTS was not available for testing. Of the seven unique variants identified, one variant (T>G), was located in the promoter at -57 base pairs (bp) from ATG translation start site of the telomerase reverse transcriptase (TERT) gene. The TERT gene encodes the catalytic reverse transcriptase subunit of telomerase, the ribonucleoprotein complex that maintains telomere length. The nucleotide change in the sequence CCTGAA>CCGGAA creates a new binding motif for Ets transcription factors, with a general recognition motif GGA(A T). Beyond the general motif for Ets transcription factors, the familial mutation also generates a binding motif, CCGGAA, for the ternary complex factors (TCFs) Elk1 and Elk4 (2, 3). To exclude the possibility that the detected promoter mutation in TERT is a common germline variant, we screened germline DNA from 140 sporadic melanoma cases and 165 healthy controls, and none carried the variant. Screening of DNA from index cases from 34 Spanish melanoma families also did not show any mutations. No carriers were found in dbSNP and the 1000 Genomes databases (data available for 18 individuals were obtained from Ensembl). The familial mutation in the TERT promoter was in complete allelic linkage with a common polymorphism rs2853669 (G>A) at -246 bp upstream from the ATG start site (Table 4). In previous work, this polymorphism was reported to disrupt an Ets binding site, and it was associated with low telomerase activity in patients with non- small cell lung cancer (4). In luciferase reporter gene assays, we found that the activity of constructs containing the mutation at -57 bp of the TERT promoter was increased 1 .5-fold and 1 .2-fold over the wild-type construct in Ma-Mel-86a and human embryonic kidney (HEK) 293T cells, respectively. A construct with both the TERT mutation and the variant allele of the rs2853669 polymorphism showed a 2.2-fold increase in promoter activity in Ma-Mel-86a and and 1 .3-fold increase in HEK293 cells (mean from three measurements; details in supplementary text and Figure 3). The germline occurrence of the promoter mutation, creating an Ets/TCF motif, can result in modification of TERT expression in all tissues expressing Ets/TCF. Highest staining for the TCF Elk1 protein has been reported in female- specific tissues, such as ovary and placenta. The increased expression of TCF Elk1 protein in female-specific tissues may cause gender-related differences in cancer susceptibility among carriers of the TERT mutation (5) (supplementary text). Two affected members of the family developed several different types of cancer (marked with # in Fig. 1 ). One affected individual presented with ovarian cancer at age 27 and melanoma at age 30. Another individual was diagnosed with melanoma at age 20; later she developed ovarian cancer, renal cell carcinoma, bladder cancer, mammary carcinoma, and finally bronchial carcinoma, leading to her death at age 50. The mutation in the melanoma-prone family prompted us to screen melanoma cell lines derived from sporadic cases of metastatic melanoma. None of the cell lines carried the mutation detected in the family. However, we identified recurrent ultraviolet (UV)-signature mutations in the TERT core promoter in 74% (125 of 168) of the cell lines. The mutations were located within a 49-bp region starting from -100 bp upstream of the ATG start site (Table 1 , Fig. 2, Figure 4, and Table 5). There were two frequent mutations at -124 bp (G>A; C>T on opposite strand) and -146 bp (G>A); these mutations were mutually exclusive and occurred in 27 and 38% of cell lines, respectively. Two tandem GG>AA (CC>TT) mutations at positions -124/-125 bp and — 138/— 139 bp were observed at a frequency of 9%. The tandem mutation at positions— 138/— 139 bp could also be generated by a single-base mutation at -138 bp, because the base change at - 139 bp has been reported as a rare polymorphism (rs35550267). The two most frequent single-base mutations as well as the two tandem mutations also result in the creation of Ets/TCF binding motifs. Mutations were confirmed in 45 of 53 (85%) available metastasized tumors corresponding to the cell lines. The somatic nature of the mutations was shown by the absence of mutations in corresponding DNA from peripheral blood mononuclear cells available from 23 patients. Somatic mutations in the TERT promoter were more frequent than the BRAF mutations (53%, 90 of 169), CDKN2A alterations (50%, 84 of 169), and NRAS mutations (23%, 38 of 169; Figure 5). The occurrence of concomitant mutations in the TERT promoter and BRAF was more frequent (47%) than by random chance (40%) with an odds ratio (OR) of 3.2 [95% confidence interval (CI) 1 .3 to 8.2]. Concomitant mutations in TERT, BRAF, and CDKN2Awere observed in 30% of cell lines compared with the expected frequency of such occurrence of 9% (OR 5.6, 95% CI 2.4 to 13.8). The high recurrence and specificity of the TERT promoter mutations, together with the preliminary evidence from reporter assays that they have a functional effect on transcription, suggest that these mutations are driver rather than passenger events. Extensive functional studies will be required to validate this hypothesis. The TERT promoter mutations were also detected in 25 out of 77 (33%) paraffin embedded primary melanoma tumors (Table 1 and Table 6) at - 124 bp (7/77; 9%) and -146 bp (5/77; 7%). Four primary tumors carried the GG>AA tandem mutations at -124/-125 bp, and eight primary tumors carried the GG>AA tandem mutations at — 138/— 139 bp. Reduced sensitivity to detect mutations in paraffin-embedded primary tumors because of contaminating normal cells cannot be ruled out. Primary tumors harbored five additional mutations in the TERT promoter, which were not present in metastases, and those did not generate Ets/TCF binding motifs. We also screened DNA extracted from 25 melanocytic nevi and only one carried a mutation at -101 bp, which did not create an Ets/TCF motif. For both primary tumors and melanocytic nevi, matched normal control DNA was not available for testing. The TERT coding region has been reported to be somatically mutated in 1 % of cancers (14 cancer types, 1271 unique samples) (6). Mutations creating Ets/TCF binding motifs in the TERT promoter in melanoma have not been described in earlier sequencing projects. TCFs are a subfamily of Ets transcription factors; two members of this subfamily, Elk1 and Elk4, are downstream targets of BRAF and regulate the expression of many genes (7-1 1 ). Conceivably, TCF may represent a link between telomerase activity and the frequent BRAF activating mutations in melanoma (Figure 6) (12, 13). Lastly, whether TERT promoter mutations occur in other cancer types remains to be determined. We did not detect these mutations in a screen of 22 esophageal squamous cell carcinomas, but further analyses are warranted. C. Supplementary Text

Luciferase assays

In Luciferase assays the TERT promoter had a repressive effect on the reporter gene activity. Both cell lines transfected with a construct containing the wild type TERT promoter showed decreased reporter activity compared to the empty reporter vector (pGL4.10, Figure 3). This is in line with a tight regulation of the TERT promoter by cellular mechanisms (4). Comparing different TERT promoter sequences, the wild type and the construct containing the polymorphism rs2853669 showed similar activity. In Ma-Mel-86a, the familial mutation (-57bp) increased activity and in combination with rs2853669, abolished the repression of gene activity. In HEK293T cells an increased activity was seen as well with the construct containing the familial mutation and rs2853669. Female tissues in carriers of TERT promoter mutations Staining for the TCF proteins Elk1 and Elk4 have been reported for various tissues in a previous study (5). Out of 65 cell types 22 stained for Elk1 , strong staining was observed in ovarian stroma cells, follicle cells, throphoblastic cells of the placenta and cerebellar cells of the granular layer, staining in 61 other cell types was negative to moderate. Elevated expression of ELK1 in female tissue is in line with its location on the X-chromosome (26-28). Due to X-chromosome inactivation somatic tissues would be assumed to express Elk1 from a single locus. However, X-chromosome reactivation has been described for germ cells (29, 30) and breast cancer cells (31). The resulting increased risk in women may have led to the ovarian cancer in two family members. It may also possibly be reason for an earlier onset of melanoma in female family members at median age 28 compared to males at median age 40.5 (p-value=0.053, wilcoxon rank test W=5). Even though Elk1 is pronounced in certain female tissues, it showed weak staining in 10 melanoma tissues and negative to moderate in 19 additional cancer tissues (5). However, it is possible that levels of Elk1 expressions may have less influence on transcriptional activity of target genes than Elk1 phosphorylation in the MAPK pathway. Elk4 showed strong staining in squamous epithelial cells of the esophagus and testis leydig cells, and negative to moderate in the remaining 63 cell types. Since the gene encoding Elk4 is located on chromosome 1 , no female-specific risk is obvious. Elk4, however, showed strong staining in Thyroid cancer cells while negative to moderate in the remaining 19 cancer types (5).

MC1R variant carriers in the melanoma family

We sequenced DNA from the family members to genotype MC1R variants (Table 4). Different family members carried Val60Leu, Val92Met, Arg151 Cys, Arg160Trp, Gln233Gln variants. None of the family members carried any high-risk RHC variant.

Polymorphism rs2853669 in metastatic melanoma cell lines

As in the melanoma family, the polymorphism rs2853669 was observed in somatic melanoma cell lines and may affect TERT expression (frequency of 42%; 37.5% in CEU population, n=120). However, it was not over- or underrepresented in any of the mutational categories with respect to TERT, BRAF, CDKN2A and NRAS. However, for most of those categories sample size was less than 10; too small to draw any conclusions.

D. Materials & Methods

Patient samples and DNA extraction Peripheral blood samples from the members of a melanoma pedigree were drawn at the Skin Cancer Unit, German Cancer Research Center Heidelberg, at the University Hospital Mannheim. A written consent was obtained from all individuals. Sporadic melanoma cases were recruited at the Skin Cancer Unit, at the University Hospital Mannheim. Blood samples were collected between 2000 and 2007 and diagnoses were confirmed by histopathology. Ethical approval for the study from the local ethics committee and written informed consent from all study participants were obtained. Ethnically matched healthy control subjects were anonymously recruited at the Institute of Transfusion Medicine and Immunology Mannheim (Germany). Informed consent was obtained from the guardians of the patients and the appropriate ethical institutional review board approved the study. Melanoma cell lines were established from melanoma metastases (14). Genomic DNA was extracted from the cell lines and from peripheral blood lymphocytes using the Qiagen DNeasy kit.

PCR, Sanger sequencing and TA-cloning

Coding regions of CDKN2A, CDK4 and MC1R were screened for mutations in DNA from the family members using PCR and Sanger sequencing. Primer sequences are given in Table 7 and a previous study (15). Unknown variants indicated by HTS were validated by PCR and Sanger sequencing (primers in Table 7). Analysis of electropherograms and sequences was performed in SeqMan (Lasergene), BioEdit (16) and Geneious (17). The TERT promoter was screened in DNA from cell lines, metastatic tumor tissues and melanocytic nevi using PCR and Sanger sequencing. DNA from paraffin-embedded primaries tumors was screened using single strand conformation polymorphism (SSCP) and Sanger sequencing, independently. Amplified TERT promoter containing variants in the melanoma family members and in the cell lines were cloned into pcr2.1 Topo-TA vectors and analyzed by colony PCR and Sanger sequencing. BRAF and NRAS mutations in cell lines were screened using PCR and Sanger sequencing as described previously (14). Screening of CDKN2A in cell lines was performed using primers given in Table 7.

Linkage analysis

Genotypes for linkage analysis were obtained using 250ng of genomic DNA from 15 family members on the Mapping10K_Xba142 array (Affymetrix) containing probes for 10,204 SNPs. CEL files were analyzed in GeneChip and yielded call rates between 97.16% and 99.34% and signal detection rates of >99.6% in all samples (Table 8). Data management and quality checks were performed with Alohomora (18). Linkage analysis of the genotypes was performed assuming a rare monogenetic autosomal dominant mode of inheritance, a disease allele frequency of 0.001 , 0.05 phenocopies and a reduced penetrance of 0.95. In the last generation only affected individuals were taken into account (therefore 754 from the family was excluded). Multipoint LOD-scores were calculated with the software program Merlin (19, 20) (Figure 7).

High throughput sequencing (HTS)

Genomic DNA was transformed to paired-end sequencing libraries in the standard lllumina protocol. For simultaneous enrichment and sequencing of the 8 samples multiplex identifiers (MID) were utilized. NimbleGen capture array probes spanning the target region were designed as described previously, omitting repetitive regions (21). The genomic sequencing libraries were enriched for the target region by hybridization to the array, followed by washing, elution and amplification at MWG Operon Eurofins. Enriched libraries were sequenced on one lane illumina HiSeq with a paired end read length of 100bp. Between 9 and 20 million reads, i.e. 2.4-4Gb of sequence per individual were retrieved.

Read mapping and variant analysis

Reads were mapped to the human reference genome (hg19) using bwa v.0.5.5 (22) and analysed using samtools v.0.1 .7a (23). We required a minimum read quality of 20 for mapping, subsequently a mapping quality of 20, and assumed an insert size of 350bp as determined by gel electrophoresis and gel cuts of the libraries. Duplicates were removed and coverage was normalized to read counts. We tested for a difference in gene coverage between affected and unaffected individuals using a Wilcoxon rank sum test in R. We analyzed the coverage of genes and transcript variants defined by transcription start and end coordinates in the UCSC genome browser. Genes had a largely similar coverage in affected and unaffected individuals (Figure 8). If coverage varied significantly between both groups (Wilcoxon test, p-value below 0.05), the coverage in affected deviated from those of the unaffected by up to around 10% in most genes (Figures 8, 9), did not warrant a call for a copy number variation. For one region in ZDHHC11 affected individuals showed around 30% more coverage than unaffected. However, coverage varied substantially in this region, which is known to be duplicated (UCSC genome browser). Since the region was also affected by a discontinuous tiling of the capture probes; therefore, we did not call a copy number difference from the data. We further explored the paired end information of sequence reads to identify rearrangements using Samtools and R. Between 0.68 and 1 .31 percent of the sequence reads per sample were improperly paired. We identified improper read pairs shared by the affected individuals by their overlapping start coordinates. From the resulting list we removed those read pairs that were also present in unaffected individuals to obtain 19 improper read pairs unique to the affected family members. We analyzed genomic location and insert size for these read pairs to identify the potential cause of improper pairing. We found 3 read pairs spanning a LINE, 2 were explained by simple repeats, 14 indicated a short library insert size below 100bp, presumably resulting from variation in the library gel cut, which was originally targeting 350bp library molecules. Thus, we found no indication for a novel rearrangement in the affected family members. Variant calling was performed using Samtools mpileup and Bcftools. We analysed variants to be located outside repetitive regions (according to Repeat masker at UCSC genome browser and tiled by capture probes) and to be shared by the affected individuals. Genes and transcript variants were defined as by transcription start and end coordinates in the UCSC genome browser (24). For new variants shared by the affected individuals we ran UCSC requests for TF binding from ChIP, CpG islands and miRNA sites. We screened for splice sites (Human Splicing Finder v.2.4.1 (25)) and TF binding sites were further analyzed by TFsearch v.1 .3 (http://www.cbrc.jp/research/db/TFSEARCH.html).

Cell culture and Luciferase assay

Melanoma cell line Ma-Mel-86a was established from a tumor metastasis. The tumor sample was collected after patient had given informed consent. HEK293T is a widely used human embryonic kidney cell line. Both cell lines were cultured in RPMI 1640 supplemented with 10% fetal calf serum. HEK293T cells and Ma-Mel- 86a cells were seeded into 6 well plates and transfected with 1 g of the reporter gene constructs (pGL4.10, pTERT-WT, pTERT-SNP, pTERT-mut, pTERT- SNP/mut). Cloned inserts were 2.5kbp long and covered 2209bp of promoter, followed by 219bp of exon 1 and 60bp of intron region (primers in Table 7). After 48h incubation cells were lysed and analyzed for Renilla and Firefly luciferase activity by using the Dual-Glo luciferase assay system (Promega). The reporter assay was performed according to Promega's instructions. Each transfectant was assayed in triplicates.The activity of Firefly luciferase was normalized to Renilla luciferase to obtain final reporter activity.

Odds ratios

We used odds ratio (OR) to calculate the probability of occurrence of mutations in the TERT promoter and BRAF gene together (29 cell lines) compared to mutations only in TERT (9 cell lines) promoter. OR were also calculated for occurrence mutations in TERT, BRAF and CDKN2A together (50 cell lines) compared to mutations only in TERT (9 cell lines). References

2. Y. Akiyama, TFSearch, www.cbrc.jp/htbin/nph-tfsearch (1995).

3. P. Shore, A. D. Sharrocks, Nucleic Acids Res. 23, 4698 (1995).

4. D. Xu, J. Dwyer, H. Li, W. Duan, J.-P. Liu, J. Biol. Chem. 283, 23567 (2008).

5. M. Uhlen et al., Nat. Biotechnol. 28, 1248 (2010).

6. S. A. Forbes et al., Nucleic Acids Res. 39, D945 (201 1 ).

7. V. N. Rao, E. S. Reddy, Oncogene 9, 1855 (1994).

8. A. J. Whitmarsh, P. Shore, A. D. Sharrocks, R. J. Davis, Science 269, 403 (1995).

9. W. Lee, E. B. Keller, J. Mol. Biol. 220, 599 (1991 ).

10. G. C. Kujoth, D. F. Robinson, W. E. Fahl, Cell Growth Differ. 9, 523 (1998).

1 1 . R. Janknecht, W. H. Ernst, A. Nordheim, Oncogene 10, 1209 (1995).

12. H. Davies et al., Nature 417, 949 (2002).

13. R. Kumar et al., Clin. Cancer Res. 9, 3362 (2003).

14. S. Ugurel et al., B-RAF and N-RAS mutations are preserved during short time in vitro propagation and differentially impact prognosis. PLoS ONE 2, e236 (2007). doi:10.1371/journal.pone.0000236 Medline

15. D. Scherer et al., Melanocortin receptor 1 variants and melanoma risk: a study of 2 European populations. Int. J. Cancer 125, 1868 (2009). doi:10.1002/ijc.24548 Medline

16. T. A. Hall, Nucleic Acids Symp. Ser. 41 , 95 (1999).

17. A. Drummond et al., Geneious v5.3.4. Available: http://www.geneious.com, (2010).

18. F. Ruschendorf, P. Nurnberg, ALOHOMORA: a tool for linkage analysis using 10K SNP array data. Bioinformatics 21 , 2123 (2005). doi:10.1093/bioinformatics/bti264 Medline

19. G. R. Abecasis, S. S. Cherny, W. O. Cookson, L. R. Cardon, Merlin— rapid analysis of dense genetic maps using sparse gene flow trees. Nat. Genet. 30, 97 (2002). doi:10.1038/ng786 Medline 20. G. R. Abecasis, J. E. Wigginton, Handling marker-marker linkage disequilibrium: pedigree analysis with clustered markers. Am. J. Hum. Genet. 77, 754 (2005). doi:10.1086/497345 Medline

21 . E. Hodges et al., Hybrid selection of discrete genomic intervals on custom- designed microarrays for massively parallel sequencing. Nat. Protoc. 4, 960 (2009). doi:10.1038/nprot.2009.68 Medline 22. H. Li, R. Durbin, Fast and accurate short read alignnnent with Burrows-Wheeler transform. Bioinformatics 25, 1754 (2009). doi:10.1093/bioinformatics/btp324 Medline

23. H. Li et al.; 1000 Genome Project Data Processing Subgroup, The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078 (2009). doi:10.1093/bioinformatics/btp352 Medline

24. F. Hsu et al., The UCSC Known Genes. Bioinformatics 22, 1036 (2006). doi:10.1093/bioinformatics/btl048 Medline

25. F.-O. Desmet et al., Human Splicing Finder: an online bioinformatics tool to predict splicing signals. Nucleic Acids Res. 37, e67 (2009). doi:10.1093/nar/gkp215 Medline

26. M. Janz et al., Refined mapping of the human Ets-related gene Elk-1 to Xp1 1 .2- p1 1 .4, distal to the OATL1 region. Hum. Genet. 94, 442 (1994). doi:10.1007/BF00201610 Medline

27. N. Harindranath, F. C. Mills, M. Mitchell, A. Meindl, E. E. Max, The human elk- 1 gene family: the functional gene and two processed pseudogenes embedded in the IgH locus. Gene 221 , 215 (1998). doi:10.1016/S0378-1 1 19(98)00448-X Medline

28. V. N. Rao et al., elk, tissue-specific ets-related genes on chromosomes X and 14 near translocation breakpoints. Science 244, 66 (1989). doi:10.1 126/science.2539641 Medline

29. D. J. Driscoll, B. R. Migeon, Sex difference in methylation of single-copy genes in human meiotic germ cells: implications for X chromosome inactivation, parental imprinting, and origin of CpG mutations. Somat. Cell Mol. Genet. 16, 267 (1990). doi:10.1007/BF01233363 Medline

30. E. Hysolli, Y. W. Jung, Y. Tanaka, K.-Y. Kim, l.-H. Park, The lesser known story of X chromosome reactivation: a closer look into the reprogramming of the inactive X chromosome. Cell Cycle 1 1 , 229 (2012). doi:10.4161/cc.1 1 .2.18998 Medline

31 . S. Ganesan et al., BRCA1 supports XIST RNA concentration on the inactive X chromosome. Cell 1 1 1 , 393 (2002). doi:10.1016/S0092-8674(02)01052-8 Medline 32. M. A. Price, F. H. Cruzalegui, R. Treisman, The p38 and ERK MAP kinase pathways cooperate to activate Ternary Complex Factors and c-fos transcription in response to UV light. EMBO J. 15, 6552 (1996). Medline

33. W. Zuidervaart et al., Activation of the MAPK pathway is a common event in uveal melanomas although it rarely occurs through mutation of BRAF or RAS. Br. J. Cancer 92, 2032 (2005). doi:10.1038/sj.bjc.6602598 Medline Table 1 :

Distance to

Position (hgl9) and variant Cell lines % Primaries %

start (bp)

1,295,228 G>A -124 46 27.4 7 9.1

1,295,228 and 1,295,229 GG>AA -124, -125 7 42 4 52

1,295,242 and 1,295,243 irs3555Q26?> GG>AA -138, -139 8 4.8 8 10.4

1,295,250 G>A -146 64 38.1 5 6.5

Table 2:

Individual Status MID Read count Coveraqe

Index Affected ATCACG 2772490 108

766 Affected CGATGT 1761226 71

812 Affected CAGATC 2003514 80

852 Affected ACTTGA 1974298 79

772 Unaffected TGACCA 2649047 104

773 Unaffected ACAGTG 1601666 64

767 Unaffected TTAGGC 2267936 91

778 Unaffected GCCAAT 1364903 55

Table 3:

Position hg19 UCSC exon Intron Min. distance to

anl no. Location Gene Reference Variant bp in exon / intron Nearby gene

(bp) no. no. next exon (bp)

1 Promoter TERT 1 ,295,161 T G 1 2 0 -

2 Intron SLC9A3 501 ,288 c T 1 22,938 9,102 -

3 Intron NKD2 1 ,036,775 c G 9 859 276 -

4 Intron SLC12A7 1 ,073,496 c T 17 251 251 -

5 Non-gene - 1 ,140,303 c T - 28,131 SLC12A7 (uc003jbu 3)

6 Non-gene - 1 ,140,764 c T - 28,592 SLC12A7 (uc003jbu 3)

7 Non-gene - 1,557,614 c T - 9,983 CR749689 (uc003jcn.3

Table 3 (continued):

Positioo g19 Cp6 island Natural splice mi NA sit

Variant no. Location Gene UCSC No. TF ChlP (95 experiments) UCSC TF ChlP (95 experiments)

UCSC site found UCSC

Pol2, TAP! , Eqr-1, c-Myc, E2F6JH-50). Max,

1 Promoter TERT 1,295,161 yes

Sin3Ak-20, GABP

2 Irttron SLC9A3 501.28?

3 Irrtron N D2 1,036,775

4 Irrtrori SLC12A7 1,073.496

5 Non-gene - 1,140,303

6 Non-gene - 1,140,764 ZNF263, CTCF, FOXA1 JC-20)

7 N r -gene - 1,557,614

Table 4: individual HTS Melanoma TERT MC1R

753 n unaffected

754 n unaffected 1 ,295,161 (T>G); 1 ,295,349 (A>G>; Γ52853669 VaieOLeu

755 n unaffected Vat92 et

756 n unaffected

757 n unaffected Vaf92 et

758 rt unaffected 1 ,295,349 (A>G); rs2B53669 Va»92Met

759 n unaffected 1 ,295,349 (A>G); rs2853669

760 n unaffected 1 ,295,349 (A>G); rs2853669 Vat92Met

761 n unaffected 1 ,295,349 (A>G); rs2853669 ValSOLeu

762 n unaffected Val92Met

763 n unaffected

764 n unaffected

765 n unaffected Arg151Cys

768 n unaffected VaieOLeu

769 n unaffected VaI92 et Arg160Trp

770 n unaffected Valffifctet

774 n unaffected 1 ,295,349 (A>G); rs2853669

775 n unaffected 1 ,295,349 (A>G); Γ52853669 Arg151Cys

776 n unaffected

777 n unaffected 1 ,295,343 (A>G); rs2853669

779 n unaffected 1 ,295,349 (A>G); rs2853669 Vat92Met

730 n unaffected

781 n unaffected Vat92htet

782 n unaffected Arg160Trp

801 n unaffected VaffiOLeu

802 n unaffected 1 ,295,349 (A G); re2853669

803 n unaffected Vat60Leu

804 n unaffected VaieOLeu

767 y unaffected Val92 et

772 y unaffected Val60Leu

773 y unaffected Val60Leu

778 y unaffected

Index y affected 1 ,295,161 (T>G); 1 ,295,349 (A>G); rs2853669 VaieOLeu; Gtn233Gln

766 y affected 1 ,295, 161 (T>G); 1 ,295,349 (A G); FS2853669 ValBOLeu; Val92Met

812 y affected 1 ,295,161 (T>G); 1 ,295,343 (A>G); rs2853669 ValSOLeu

852 y affected 1 ,295,161 (T>G); 1 ,295,349 (A>G); rs2853669 ValSOLeu

Table 5:

Table 5 (continued):

Table 5 (continued):

Table 5 (continued):

Table 5 (continued):

Table 5 (continued):

Table 5 (continued): Table 5 (continued):

Table 6:

No. Tumor !D TERT

1 H/9639232

2 H02,'15775

3 H/02C1448 1,295.253 G>A

4 Η/Ό 1/17496

5 HS5/12527 1.295,242 G A; 1.295,243 G>A, rs35550267

6 ΗΛ33ΛΒ8 1 1.295.242 G>A; 1 ,295,243 G>A, IS35550267

7 H03I13461

8 H/02/6073 1.295,228 G A; 1,295,229 G>A

9 1 ,295.228 G>A; 1,295,229 G>A

10 Himmzm 1.295.223 G A; 1,295,264 G A

11 H/96 4869 1,295,228 G>A; 1,295,22.9 G>A

12 H/96/26775

13 H/01J4782

14 H/97/22176

15 H/G3B1173 1.295.228 G>A

16 HSTO3923 1,295,228 G>A; 1,295,250 G>A;

17 BJD2/3152

18 HTO2/41006 1.295,242 G>A; 1,295,243 G ^» A. rs35550267

19 H02Q9564

2D H/99/20376 1,295,228 G A

21 HJ02/38933

22 Hi /27923

23 ΒΛ0/38779 1,295.242 G>A; 1,295,243 G A, rs35550267

24 msmmi

25 H/95/1 218 1,295,250 G>A

26 HS9/23101 1,295.228 G A

27 B/99/35955

28 BJD3J23203

29 H/02J28231

30 Η/95/21Θ74 1.295,250 G>A

31 IQ 3435

32 ΗΛ /1 359

33 H02/ 3571

34 ΗΛ2/ 8473

35 ΗΛ /30657 1,295,228 G>A; 1,295,229 G>A; 1,29:5.258 G>A

36 HD1l40fi1S

37 HS9/ 5201 1,295,228 G> A

38 H/Q3I23265 1.295,228 G= ^> A

39 W02/39423

40 H/02/42433

41 HI98/5210 Table 6 (continued):

No. Tumor ID TERT

42 1765/05 1 ,295.242 G A; 1,295,243 G>A, rs35550267

43 15172/02

44 12528/02

45 7724Λ2

46 1764/05 1.295.242 G>A; 1 ,295,243 G A, rs35550267

47 8428ffl5

48 10044111a

49 3699/03

50 8464/05a

51 3S779 M

52 14534/02 1.295.242 G A; 1,295,243 G>A, Γ535550267

53 10436/04

54 6012Λ4

55 5130/02

56 1 661 *02 1.295.228 G>A; 1,295,242 G>A; 1 ,295,243 G A, rs35550267

57 9506/03

58 7484/04

59 2798/03

60 14505135

SI 2970/03

62 12925/96 iVa 1.295,250 G>A

63 5812/95 I

64 25069/96

65 42632/98

66 14873/99 II

67 23571/99 1.295,241 G*A

66 17455/00

69 191816/00 a 1 ,295,250 G>A

70 41350/01 I

71 12036/01 lb

72 23543/02

73 10295/02

74 1129/00

75 5842 00

76 25550/03 lb

77 12232/01 b Table 7:

Pair PGR

Gene Primer name Sequence 5' -3' Annealing

No. additives

TERT hTERT_F ACGAACGTGGCCAGCGGCAG 62°C 5% DMSO,

TERT hTERT R CTGGCGTCCCTGCACCCTGG 5% glycerol

TERT iiTERT_short_F CAGCGCTG CCTG AAACTC 55°C 5% DMSO,

TERT liTERT_short_R GTCCTGCCCCTTCACCTT 5% glycerol

TERT TERT_cloning_F CTGGTACTGAATCCACTGTTTCATTTG 58°C 5% DMSO

TERT TERT_clonirxj_R CTCTCCGCATGTCGCTGGTT

SLC9A3 501288_F C AGCTAATTAAG C AC AC AATG G 60°C

SLC9A3 501288_R ACCTTG AAAG GTC CTTGGAG

NKD2 1036775_F T C CTTCC AC AG CTACCTGTTG 58°C

NKD2 1036775_R CATCCACACTACTGGACGAC

SLC12A7 1073496_F CCC C AGTG AG C CTG.AAC 58°C

SLC12A7 1073 96_R GGCGGTGGCTTTGAGCTC

Non-gene 1 140303_F GCATCAAACGCTCCGAGGTC 63°C

Non-gene 1 140303_R G GATC AC ATGCCTC ATCG CCTG

Non-gene 1140764_F GGAGGCGTCATTCTGTAAACAGG 63°C

Non-gene 1 140764_R AATGGCCCTCCTGGGTGAATC

Non-gene 1557614_F CCTGTCAGCTCAGGTCATGTGTT 63°C

Non-gene 1557614_R TCTCTCATCCACAGCTGGACG

10 CDKN2A Exon_l_F CGGCTGCGGAGAGGGGGAGAG 67 ^C C 10% DMSO

CDKN2A Exon_1_R CTCCAGAGTCGCCCGCCATCC

11 CDKN2A Exon_1B_F GGAGGCGGCGAGAACAT 63 °C 5% DMSO

CDKN2A Exon_lB_R GGGCCTTTCCTACCTGGTCTT

12 CDKN2A Exon_2_F GG GCTCTAC AC A AGCTTC CTT 63°C 5% DMSO

CDKN2A Exon_2_R TTTGGAA GCTCTC AGGG TAC A

13 CDKN2A Exon_3_F GCCTGTTTTCTTTCTGCCCTCTG 57°C

CDKN2A Exon 3 R CGAAAGCGGGGTGGGTTGT

Table 8:

No. Individual Status SNP calls (%) Signal detection {%)

1 753 Unaffected 9S.77 99.99

2 754 Unaffected 99.16 99.95

3 766 Affected 97.16 99.49

4 767 Unaffected 99.01 100

5 772 Unaffected 99.34 100

6 773 Unaffected 97.89 99.64

7 778 Unaffected 98.59 99.9

8 780 Unaffected 98,26 99.8

9 781 Unaffected 98.53 99.96

10 801 Unaffected 98.57 99.98

11 802 Unaffected 99.03 99.913

12 804 Unaffected 99.16 99.99

13 812 Affected 98.96 99.97

14 852 Affected 98.67 99.98

15 Index Affected 98.83 99.87 Example 2: The TERT promoter mutations in bladder cancer: effect on survival and disease recurrence and its modification by a common polymorphism

Summary

The telomerase reverse transcriptase (TERT) promoter, an important element of telomerase expression, has emerged as a target of cancer specific mutations. Originally described in melanoma, the mutations in TERT promoter have been shown to be common in certain other tumor type that included glioblastoma, hepatocellular carcinoma and bladder cancer. To fully define the occurrence and effect of the TERT promoter mutations, we investigated tumors from a well characterized series of 327 patients with urothelial cell carcinoma of bladder. The somatic mutations, mainly at positions -124 and -146 bp from ATG start site that create binding motifs for Ets/TCF, affected 65.4% of the tumors, with even distribution across different stages and grades. Our data showed that a common polymorphism rs2853669, within a pre-existing Ets2 binding site in the TERT promoter, acts as a modifier of the effect of the mutations on survival and tumor recurrence. The patients with the mutations showed poor survival in the absence (hazard ratio [HR] 2.19, 95%CI 1 .02-4.70) but not in the presence (HR 0.42, 95%CI 0.18- 1 .01 ) of the variant allele of the polymorphism. The mutations in the absence of the variant allele were highly associated with the disease recurrence in patients with Tis, Ta and T1 tumors (HR 1 .85, 95%CI 1 .1 1 -3.08). The TERT promoter mutations are the most common somatic lesions in bladder cancer with clinical implications. The association of the mutations with patient survival and the disease recurrence, subject to modification by a common polymorphism, can be a new putative marker with individualized prognostic potential.

Introduction

The human TERT gene encodes the catalytic reverse transcriptase subunit of telomerase that maintains telomere length (1 ). Increased telomerase activity is perceived to be one of the hallmarks of human cancers and the transcriptional regulation of the TERT gene is the major cause of its cancer specific activation (2, 3). The TERT promoter has been shown to be the most important element of telomerase expression as it harbors binding sites for numerous cellular transcriptional activators as well as repressors that directly or indirectly regulate the gene expression (4). In addition, the high GC content around the transcription start site of the TERT promoter confers epigenetic regulation through methylation and chromatin remodeling (5, 6). We previously described a high-penetrant disease segregating single nucleotide germline mutation in the TERT promoter in a large melanoma family (7). The A>C (T>G) mutation at position -57 bp (from the ATG start site; Chr 5:1 ,295,161 hg19 coordinate) resulted in creation of a new binding motif GGAA/T for Ets transcription factors and a general binding CCGGAA T motif for ternary complex factors (TCF) (8). Simultaneous screening of the TERT promoter for somatic mutations in melanoma tumors by us and others resulted in detection of highly recurrent and mutually exclusive somatic mutations mainly at two residues at -124 (1 ,295,228) and -146 (1 ,295,250) from the ATG start site in the TERT promoter (7, 9). The C>T (G>A) transition at both sites also resulted in creation of the Ets/TCF binding motifs. A concurrent study on cancer cell lines indicated the possibility of mutations being present in cancers other than melanoma (10). The occurrence of the TERT promoter mutations in a range of tumors in certain cancer types has now been confirmed (1 1 ). In this experiment, we investigated a large series of 327 patients with well characterized tumors from urothelial cell carcinoma of bladder for mutations in the TERT promoter. We observed that the common TERT promoter mutations affected two-thirds of the tumors and were spread across all stages and grades suggesting that the mutations are early events in bladder carcinogenesis. We also assessed the association of those recurrent TERT promoter mutations with patient survival and disease recurrence.

Results

We observed that two nucleotide positions at -124 bp and -146 bp from ATG start site accounted for over 99% of all the detected mutations in TERT promoter. The - 124C>T (G>A) mutation (Fig. 13) was the most frequent alteration that was detected in 175 (53.5%) tumors. In three tumors the nucleotide change involved a C>A (G>T) tranversion at the -124 position. Additional 38 (1 1 .6%) tumors carried the -146C>T (G>A) mutation (Fig. 13). One bladder tumor carried a -57A>C (T>G) mutation (Fig. 13), previously detected as a causal mutation in a melanoma pedigree (7). The mutations at -57, -124 and -146 bp were mutually exclusive and resulted in creation of a general CCGGAA/T binding motif for Ets/TCF transcription factors (Fig. 1 ). Four tumors, in addition to two recurrent mutations, also carried other changes within the amplified region of the TERT promoter (Table 13). One tumor (D:078) in addition to the -146C>T (G>A) mutation had on the same allele a single nucleotide (G/C) deletion at -129 bp (1 ,295,233; Table 12 and Fig. 13). The deletion resulted in depletion of a Sp1 transcription factor binding site. Sequencing of the DNA from corresponding germline DNA confirmed that mutations in tumors were somatic (More details are provided in Supporting Information Results). Of 327 tumors, 214 (65.4%) carried a defined mutation in the investigated core TERT promoter region (Table 9). The distribution of mutations in the TERT promoter was even in bladder tumors from stages Tis through T2+, ranging from 60 to 71 % (Table 9). Low grade tumors (papillary urothelial tumors of low malignant potential [PUNLMP]+G1 ) carried mutations in 87 of 1 18 (73.7%, 95%CI 65.8-81 .7%) and 1 14 of 180 (63.3%; 95%CI 56.3-70.4%) high grade tumors (G2+G3). 13 of 29 (44.8%, 95%CI 26.7-62.9%) tumors with undetermined grade Gx also carried mutations. The distribution of the mutations in different disease categories was similar to those in different tumor stages (Table 9).

The DNA sequence amplified for the detection of mutations in TERT promoter also carried a T>C (A>G) single nucleotide polymorphism (SNP) at position -245 bp (1 ,295,349) represented by rs2853669 with a carrier frequency of 47.1 % (Table 9). The distribution of somatic mutations in the TERT promoter was not associated with the carrier status of the variant allele of the polymorphism (odds ratio [OR] 1 .22, 95%CI 0.79 to 1 .90). The OR for the distribution of carriers of variant allele according to mutational status was 1 .19 (95%CI 0.75-1 .88). Of the 327 tumors sequenced for the TERT promoter mutation, data for p53 mutations were available for 174 tumors. Of the 24 tumors with mutations in p53, 17 (71 %; 95%CI 53-89%) carried the TERT promoter mutations compared to 94 (63%, 95%CI 55-70%) of 150 that were wild-type for p53. The statistical analysis showed an independent association of survival with sex, age at diagnosis, tumor grade, stage, disease categories, presence of node and metastasis (data not shown). A Cox proportional model, that included age at diagnosis, TNM status, tumor grade, and treatment, showed a hazard ratio (HR) of 1 .34 (95%CI 0.81 -2.23) for an overall effect of the mutations on patient survival. The corresponding HR for the survival in patients that were noncarriers of the variant allele of the rs2853669 polymorphism was 2.19 (95%CI 1 .02-4.70) and in the carriers HR was 0.42 (95%CI 0.18-1 .01 ; Table 10). The interaction between the mutations and polymorphism was statistically significant (P=0.05). The effect of the TERT promoter mutations on survival and its modification by the polymorphism was confirmed in Kaplan Meier models (Fig 12). In all sub-categories a similar trend of the effect of mutations on patients that did not carry the variant allele was observed (Table 1 1 ). The analysis of Tis, Ta and T1 tumors showed that the TERT promoter mutations in the absence of the variant allele of the polymorphism were associated with statistically significant risk of the disease recurrence (Fig. 14) with a HR of 1 .85 (95%CI 1 .1 1 -3.08); the association was not statistically significant in the presence of the variant allele (HR 1 .14, 95%CI 0.62-1 .99). For the patients with TaG1 +TaG2 disease categories, the HR for the risk of the recurrence due to the mutations was 2.53 (95%CI 1 .20-5.33) in patients that did not carry the variant allele; the association was not statistically significant in presence of the variant allele (HR 0.80, 95%CI 0.36-1 .78; Table 10, Fig. 15). Luciferase reporter assays were carried out in two urothelial cell carcinoma cell lines, T24 and CLS-439, to determine the effect of the TERT promoter mutations and modulation of the effect by the variant allele of the rs2853669 polymorphism. The result showed a statistically significant decrease (T- test; P =0.02) in promoter activity in both cell lines transfected with the TERT promoter construct that carried the variant allele for the rs2853669 polymorphism compared to cell lines transfected with a wild type promoter construct. Promoter constructs with either -124C>T (G>A) or -146C>T (G>A) mutations and without the variant allele of the polymorphism showed 2-4-fold increased activity. Introduction of the variant allele of the rs2853669 polymorphism over the background of either - 124C>T (G>A) or -146C>T (G>A), in both cell lines, resulted in a reduction of the promoter activity compared to constructs with either of the two mutations. The reduction in the activity due to the variant was only statistically significant in the construct with -124T(A) mutant (T-test; P = 0.03 and 0.05). The reduction in the promoter activity due to variant allele in the construct with -146T(A) mutant was not statistically significant in either of the two cell lines.

Discussion

Bladder carcinoma represents the one of the most frequent cancers in world-wide (12, 13). The most common bladder carcinomas are derived from urothelium and are perceived to arise by at least two separate mechanisms. The non-muscle invasive bladder tumors (Tis, Ta and T1 ) account for most of the urothelial carcinomas that are confined to mucosa or submucosa (14). Remaining urothelial carcinomas are invasive that arise either de novo or from high grade carcinoma in situ (15, 16). Low grade tumors are characterized by frequent mutations in the HRAS and fibroblast growth factor receptor 3 (FGFR3) genes. A majority of high grade tumors that show propensity to progression to local and distant metastasis contain defects in p53 and/or retinoblastoma tumor suppressors. The altered pathways in the both variants of bladder cancer have been a subject of research for targeted therapy (17, 18). In this experiment, we investigated the newly discovered non-coding mutations within the core promoter region of the TERT gene. Two major findings of this study include (A) a high recurrence of the TERT promoter mutations in bladder cancer and (B) association of the detected mutations with the disease recurrence and patient survival, through an interaction with a common polymorphism.

The frequency of the TERT promoter mutations detected was higher than any earlier reported lesions in any gene in bladder cancer (19). A role for the mutations in early bladder carcinogenesis can be deduced from the occurrence in almost two-thirds of bladder tumors across all stages and grades. The specificity of all mutations detected in the TERT promoter in creation of Ets/TCF binding motif alludes to involvement of a strong selection, as telomerase expression is crucial in maintenance of cancer cells in an immortalized state (20). The somatic mutations specifically create CCGGAA/T binding motifs for Ets/TCF, which are distinct from the pre-existing GGAA sites in the TERT promoter. The specific mutations detected have been shown to cause two to four-fold increased promoter activity in reporter assays (7, 10). While in melanoma the -146C>T (G>A) was more frequent than the -124C>T (G>A) mutation, in bladder tumors the latter mutation was predominant (7). Unlike melanoma, CC>TT tandem mutations were absent in bladder cancer, reflecting etiological differences between the cancer types (21 ).

Our data showed an overall tendency of poor survival in the patients that carried the mutations in tumors. Previously, the TERT promoter mutations, with prevalence over 80% in glioblastoma, were associated with poor survival (1 1 ). A stratification of the data in the present study showed that the effect of the mutations on survival in bladder cancer patients was modified by a common polymorphism rs2853669 located within 120-140 bp of the mutational sites. The mutations did not affect survival in the patients that were carriers of the variant allele of the polymorphism. A Cox regression model, which included all factors associated independently with survival including treatment, showed over two-fold increased hazard ratio for reduced survival of patients that had the somatic TERT promoter mutations in tumors and were noncarriers of the variant allele. All patients included in the analysis had undergone transurethral resection of bladder tumors; some of them in addition to the resection, had been treated with combinations of radio-, chemo- and immune-therapies. With prevalence of the TERT promoter mutations in two-thirds of bladder cancer, almost one third of the patients would be vulnerable to an adverse effect on survival according to our data. The non-muscle invasive lesions, with a propensity to recurrence, are generally not associated with mortality (22). All four patients in the TaG1 disease category, who had died due to the bladder cancer had the TERT mutations in their tumors and were non-carriers of the variant allele. The data showed that the mutations were also associated with the disease recurrence in patients with Tis, Ta and T1 tumors. The effect was more pronounced in the absence of the variant allele than in its presence. In the patients with the TaG1 +TaG2 diseases the presence of the mutations and the non-carrier status for the variant allele was associated with a 2.53 increased risk of the tumor recurrence. The current strategy for follow-up treatment is based on risk stratification, dependent on recurrence and progression scores (14). In clinical trial BCG in combination with interferon alpha- 2B has been shown to be effective in reducing the recurrence and progression (23). Genetic markers can be of utmost use in stratification of at risk patients. The TERT mutations, particularly in the absence of the variant allele of the polymorphism, can potentially be helpful in identifying patients for intravesical therapies, which are critical for management of non-muscle invasive bladder cancer (24). Mechanistically, the modifying effect of the polymorphism was in the expected direction. While the somatic mutations resulted in the creation the Ets/TCF binding sites, the variant allele of the polymorphism disrupts a preexisting non-canonical Ets2 binding site in the proximal region of the TERT promoter, immediate adjacent to an E-box. Interaction of Ets2 with the binding site on TERT promoter has been shown to involve binding of c-Myc to the E-box in breast cancer cell lines (25). Mutation of the Ets2 binding site has been shown to inhibit E-box binding of c-Myc. The variant allele of the single nucleotide polymorphism has previously been shown to be associated with low telomerase and telomere activity in non-small cell lung carcinoma (26). The reported association of the polymorphisms with risk of inherited susceptibility to breast cancer has been inconsistence; however, the tissue and cellular context could be important for functionality as observed in reporter assays (27-30). Based on the information from 1000 genome database, the rs2853669 polymorphism is in linkage disequilibrium with four other variants that included a synonymous variant (rs2736098) within exon 2 of the TERT gene and three variants located 1 .6 to 2.7 kb upstream of ATG start site (31 ). A recent study on breast and ovarian cancers showed that a haplotype comprised of the alleles of the three polymorphisms, rs2736107, rs2736108 and rs2736109, virtually abolished promoter activity in reporter assays. Paradoxically the alleles in the haplotype that abolished promoter activity were associated with increased telomere length (32). Though, it is possible that the observed modulation of the effect the TERT promoter mutations on survival and recurrence by the variant allele of the rs2853669 polymorphism could be a proxy for the variants in linkage disequilibrium. However, the reduction in promoter activity observed in this study due to introduction of the variant allele compared to the promoter construct with either wild type sequence or constructs with either of the two mutations, in particular with the most frequent -124 C>T (G>A) mutation, suggested the functionality of the rs2853669 polymorphism.

The constructs used in the assays did not contain variant alleles for any other polymorphisms in linkage disequilibrium with the rs2853669 polymorphism. The detection of the -57A>C (T>G; 1 ,295,161 ) as a somatic mutation in a bladder tumor, which we earlier reported as a high penetrant causal mutation in a large melanoma pedigree, reinforces the status of the nucleotide changes in the TERT promoter as bonafide driver mutations. p53 has been shown to repress TERT transcription in a Sp1 -dependent manner. One of the tumors with a single nucleotide deletion together with the -146C>T mutation represented a unique case where the targeted mutations resulted in an ablation of a Sp1 repressor element and creation of a new site for Ets/TCF (4, 33). The resulting increased expression of telomerase as a consequence of the TERT promoter mutations can provide target for therapy. Several strategies of therapeutic telomerase inhibition, including small molecular inhibitors, immunotherapy, gene therapy, telomere and telomerase associated proteins, in different cancers have entered clinical trials (34). The telomerase protein is also associated with other biological activities that include enhanced cell proliferation, inhibition of apoptosis, and regulation of DNA damage response and cellular proliferative life span that could be affected by the promoter mutations (35). At a wider level, the promoter mutations represent a paradigm shift in the trail of missing mutations that could not be accounted through the search confined to coding sequences (36). In the context of bladder cancer, we show that the mutations effect the survival in a manner that is modified by a common genetic polymorphism located within the same locus. The mutations and the polymorphism in conjunction can potentially be used as clinical biomarkers to predict the patient survival and the disease recurrence.

Material and Methods

Patients

A total of 538 patients were registered in the Stockholm region with newly diagnosed bladder neoplasms (urothelial cell carcinomas) in 1995-1996 with 15 years clinical follow-up. All hospitals and urology units in the region participated in the study. Treatment and follow-up were performed according to a standard-of- care program. Tumors were removed prior to any treatment from patients with transurethral resection, snap frozen in liquid nitrogen and cut in approximate 5 μιτι- thick sections. The first and last sections were stained and examined for tumor content. Only biopsies with more than 70% tumor were included in the study. Tumor stage was assessed according to modified tumor, node, metastasis (TNM) system suggested by Hall and Prout (37). The World Health Organization 1999 malignancy grading system was used for tumor grade (38). Informed consent was obtained from all patients included in the study. The study was approved by the appropriate ethical committee. In this study 327 patients were included, from whom tumor DNA was either available or amplified successfully in PCR. The treatment data were available for 284 patients. 143 patients were treated with transurethral resection of bladder tumor (TURB) only, whereas other patients received different treatment combinations (Table S2).

Mutation detection

DNA was extracted from tumors and corresponding blood tissues using standard procedures. The core TERT promoter region 343 bp (from the position -278 to +65 from ATG start site) was screened for mutations using PCR and Sanger sequencing (Table 14) as described (7). More details are provided in Supporting Information. Mutations in the p53 gene (exon 5-8) in a subset of the bladder tumors included in this study were determined and described previously (39, 40).

Statistical analysis

The associations between the age, sex, p53 mutational status, stage, grade, node, metastasis, TERT promoter mutations and cause-specific survival were determined separately using Kaplan Meier method. The cumulative curves for the survival outcome in patients with and without the TERT promoter mutations, before and after stratification into the carriers and non-carriers of the variant allele of the rs2853669 polymorphism were drawn. The differences between the curves were analyzed with log-rank test. A Cox proportional hazard regression model was used to determine the association between the TERT promoter mutations, before and after stratification for the carriers and non-carriers of the variant alleles of the rs2853669 polymorphism, and cause-specific patient survival. The model was adjusted for sex, age at diagnosis, tumor stage, grade, node, metastasis and treatment. Five patients with Tis were excluded from survival analysis. A Cox model was also used to determine the association between the TERT promoter mutations and the disease recurrence in patients with noninvasive tumors, both before and after stratification for the variant allele of the polymorphism.

Luciferase reporter assays

Urothelial cell line T24 was a kind gift from Prof. Karin Hoppe-Seyler of German Cancer Research Center (41 ). The cell line CLS-439, also a bladder carcinoma cell line was purchased from CLS cell line services, Heidelberg. The cell lines T24 and CLS-439 were cultured in DMEM and RPMI-1640 media (Gibco) respectively, supplemented with 10%FBS (Gibco). Cells were incubated at 37°C in a humidified atmosphere with 5% CO2. The cell lines were authenticated by short tandem repeat profiling or multiplex cell authentication (42). The DNA extracted from the cell lines was also sequenced to screen for the TERT promoter mutations. For reporter assay, cells were seeded in 6-well plates and cotransfected with Lipofectamine 2000 (Invitrogen), 1 g of reporter construct and 50 ng of pRL-SV40 expression plasmid for Renilla luciferase (Promega) in triplicate. pGL3-control plasmid was used for determining transfection efficiency and pRL-SV40 as an internal control for normalization of luminescence values. pGL3-control and pRL- SV40 express firefly luciferase and Renilla luciferase genes under the thymidine kinase and SV40 promoters, respectively. A total of six reporter constructs, with wild-type (WT) sequence, with WT + variant allele for the rs2853669 polymorphism, with -124T(A) mutant, with -124T(A) mutant + variant allele for the rs2853669 polymorphism, with - 146T(A) mutant and with -146T(A) mutant + variant allele for the rs2853669 polymorphism were prepared. Promoter-less vector (pGL4.10[luc2]), and non-transfected cells were used as negative controls. Cells were harvested for 64 hours post transfection using 1x passive lysis buffer (Promega) and reporter expression was analyzed using the Dual-Luciferase assay system (Promega). The relative ratio of firefly luminescence to renilla luminescence was calculated to normalize the variations across samples. More details about the cell lines, cloning and reporter assays are provided in the Supporting Information.

References

1 . Dwyer J, Li H, Xu D, & Liu JP (2007) Transcriptional regulation of telomerase activity: roles of the Ets transcription factor family. Ann N Y Acad Sci 1 1 14:36-47.

2. Daniel M, Peek GW, & Tollefsbol TO (2012) Regulation of the human catalytic subunit of telomerase (hTERT). Gene 498(2):135-146.

3. Hanahan D & Weinberg RA (201 1 ) Hallmarks of cancer: the next generation. Cell 144(5):646-674.

4. Kyo S, Takakura M, Fujiwara T, & Inoue M (2008) Understanding and exploiting hTERT promoter regulation for diagnosis and treatment of human cancers. Cancer Sci 99(8):1528-1538. 5. Stein GS, Montecino M, van Wijnen AJ, Stein JL, & Lian JB (2000) Nuclear structure-gene expression interrelationships: implications for aberrant gene expression in cancer. Cancer Res 60(8):2067-2076.

6. Renaud S, et al. (2007) Dual role of DNA methylation inside and outside of CTCF-binding regions in the transcriptional regulation of the telomerase hTERT gene. Nucleic Acids Res 35(4):1245-1256.

7. Horn S, et al. (2013) TERT promoter mutations in familial and sporadic melanoma. Science 339(6122):959-961 .

8. Wei GH, et al. (2010) Genome-wide analysis of ETS-family DNA-binding in vitro and in vivo. Embo J 29(13):2147-2160.

9. Patton EE & Harrington L (2013) Cancer: Trouble upstream. Nature 495(7441 ):320-321 .

10. Huang FW, et al. (2013) Highly recurrent TERT promoter mutations in human melanoma. Science 339(6122):957-959.

1 1 . Killela PJ, et al. (2013) TERT promoter mutations occur frequently in gliomas and a subset of tumors derived from cells with low rates of self-renewal. Proc Natl Acad Sci U S A.

12. Burger M, et al. (2013) Epidemiology and risk factors of urothelial bladder cancer. Eur Urol 63(2):234-241 .

13. Cohen SM, Shirai T, & Steineck G (2000) Epidemiology and etiology of premalignant and malignant urothelial changes. Scand J Urol Nephrol Suppl (205):105-1 15.

14. Anastasiadis A, et al. (2012) Follow-up procedures for non-muscle-invasive bladder cancer: an update. Expert Rev Anticancer Ther 12(9):1229-1241 .

15. Wu XR (2005) Urothelial tumorigenesis: a tale of divergent pathways. Nat Rev Cancer 5(9):713-725.

16. Cheng L, et al. (201 1 ) Bladder cancer: translating molecular genetic insights into clinical practice. Hum Pathol 42(4):455-481 .

17. Gschwind A, Fischer OM, & Ullrich A (2004) The discovery of receptor tyrosine kinases: targets for cancer therapy. Nat Rev Cancer 4(5):361 -370.

18. Kuball J, et al. (2002) Successful adenovirus-mediated wild-type p53 gene transfer in patients with bladder cancer by intravesical vector instillation. J Clin Oncol 20(4):957-965.

19. Dulak AM, et al. (2013) Exome and whole-genome sequencing of esophageal adenocarcinoma identifies recurrent driver events and mutational complexity. Nat Genet.

20. Hahn WC, et al. (1999) Creation of human tumour cells with defined genetic elements. Nature 400(6743):464-468. 21 . Thilly WG (2003) Have environmental mutagens caused oncomutations in people? Nat Genet 34(3):255-259.

22. Prasad SM, Decastro GJ, & Steinberg GD (201 1 ) Urothelial carcinoma of the bladder: definition, treatment and future efforts. Nature reviews. Urology 8(1 1 ):631 -642.

23. Joudi FN, Smith BJ, & O'Donnell MA (2006) Final results from a national multicenter phase II trial of combination bacillus Calmette-Guerin plus interferon alpha-2B for reducing recurrence of superficial bladder cancer. Urol Oncol 24(4):344-348.

24. Logan C, Brown M, & Hayne D (2012) Intravesical therapies for bladder cancer - indications and limitations. BJU Int 1 10 Suppl 4:12-21 .

25. Xu D, Dwyer J, Li H, Duan W, & Liu JP (2008) Ets2 maintains hTERT gene expression and breast cancer cell proliferation by interacting with c-Myc. J Biol Chem 283(35):23567-23580.

26. Hsu CP, Hsu NY, Lee LW, & Ko JL (2006) Ets2 binding site single nucleotide polymorphism at the hTERT gene promoter-effect on telomerase expression and telomere length maintenance in non-small cell lung cancer. Eur J Cancer 42(10):1466-1474.

27. Savage SA, et al. (2007) Genetic variation in five genes important in telomere biology and risk for breast cancer. Br J Cancer 97(6):832-836.

28. Varadi V, et al. (2009) A functional promoter polymorphism in the TERT gene does not affect inherited susceptibility to breast cancer. Cancer Genet Cytogenet 190(2):71 -74.

29. Beesley J, et al. (201 1 ) Functional polymorphisms in the TERT promoter are associated with risk of serous epithelial ovarian and breast cancers. PLoS

ONE 6(9):e24987.

30. Kote-Jarai Z, et al. (2013) Fine-mapping identifies multiple prostate cancer risk loci at 5p15, one of which associates with TERT expression. Hum Mol Genet 22(12):2520-2528.

31 . Abecasis GR, et al. (2012) An integrated map of genetic variation from 1 ,092 human genomes. Nature 491 (7422):56-65.

32. Bojesen SE, et al. (2013) Multiple independent variants at the TERT locus are associated with telomere length and risks of breast and ovarian cancer. Nat Genet 45(4):371 -384, 384e371 -372.

33. Xu D, et al. (2000) Downregulation of telomerase reverse transcriptase mRNA expression by wild type p53 in human tumor cells. Oncogene 19(45):5123- 5133. 34. Ruden M & Puri N (2012) Novel anticancer therapeutics targeting telomerase. Cancer Treat Rev.

35. Mukherjee S, Firpo EJ, Wang Y, & Roberts JM (201 1 ) Separation of telomerase functions by reverse genetics. Proc Natl Acad Sci U S A 108(50):E1363-1371 .

36. Vogelstein B, et al. (2013) Cancer genome landscapes. Science 339(6127):1546-1558.

37. Hall RR & Prout GR (1990) Staging of bladder cancer: is the tumor, node, metastasis system adequate? Semin Oncol 17(5):517-523.

38. Reuter VE, Epstein Jl, Amin MB, & Mostofi FK (1999) The "WHO/ISUP Consensus Classification of Urothelial (Transitional Cell) Neoplasms": continued discussion. Hum Pathol 30(7):879-880.

39. Ryk C, et al. (2005) Influence of GSTM1 , GSTT1 , GSTP1 and NAT2 genotypes on the p53 mutational spectrum in bladder tumours. Int J Cancer 1 13(5):761 -768.

40. Berggren P, et al. (2001 ) p53 mutations in urinary bladder cancer. Br J Cancer 84(1 1 ):1505-151 1 .

C. Supporting Information

Material and Methods

PCR and DNA sequencing

DNA was extracted from tumors and corresponding blood tissues using standard procedures. The core TERT promoter region (from the position +65 to -278 bp) was screened for mutations using PCR and Sanger sequencing. DNA samples from tissues were used as template for amplification of a 343 bp fragment. Each PCR was carried out with 10 ng DNA as template in a 10 μΙ volume containing 50 mM KCI, 0.1 1 μΜ each primer (Table 12), 2.0 MgCI2 and 10% glycerol. The sequencing reactions were performed, after purification of amplified DNA fragments with ExoSapIT (Amersham Biosciences, Uppsala, Sweden) to remove unused primers, using dideoxy terminator kit (Big Dye, Applied Biosystems). Each sequencing reaction was carried out in a 10 μΙ volume using forward and reverse primers separately. The electrophoresis of sequencing reaction products was carried out on an ABI prism 3130XL Genetic Analyzer (Applied Biosystem). The sequences generated were analyzed in Genious (www.geneious.com). Amplified DNA from a tumor containing a single base C (G) deletion at position -129 bp, another three DNA samples with more than one mutation were cloned into pcr2.1 Topo-TA vectors and analyzed by Sanger sequencing. The transcription factor binding sites in the TERT promoter were assessed by position weight matrix and relative score method using JASPAR (1 ).

Luciferase reporter assays

For reporter constructs a 2.5kbp region of TERT locus (chr5:1 ,294,815-1 ,297,313) was amplified using genomic DNA. The amplified region included 2209bp of promoter, followed by 219bp of exon 1 and 60bp of intron 1 . The amplicon was cloned into a T-overhang vector (TOPO PCR2.1 , Invitrogen). The mutations at - 124 and -146 positions and the variant allele at -245 positions were generated using Quik-change site-directed mutagenesis kit (Invitrogen). A total of six reporter constructs, with wild-type (WT) sequence, with WT + variant allele for the rs2853669 polymorphism, with -124T(A) mutant, with -124T(A) mutant + variant allele for the rs2853669 polymorphism, with -146T(A) mutant and with -146T(A) mutant + variant allele for the rs2853669 polymorphism were generated. All the plasmid constructs were sequenced by Sanger sequencing to confirm the respective mutations and the variant allele. The TERT insert was restriction digested at BamHI and Xhol sites and subcloned into pGL4.10 promoter-less vector (Promega) between Xhol and Bglll sites. Urothelial carcinoma cell lines T24 and CLS-439 used for the assays are derived from Caucasian patients 81 years old female and 61 year old male patients, respectively. Sequencing results showed that both cell lines endogenously carried -124C>T (G>A) mutation in the TERT promoter. T24 cell line was a kind gift from Prof. Karin Hoppe-Seyler of German Cancer Research Center (2). The cell line CLS-439, also a bladder carcinoma cell line was purchased from CLS cell line services, Heidelberg, Germany. The cell lines T24 and CLS-439 were cultured in DMEM and RPMI-1640 media (Gibco) respectively, supplemented with 10%FBS (Gibco). Cells were incubated at 37°C in a humidified atmosphere with 5% CO2. The cell lines were authenticated by short tandem repeat profiling or multiplex cell authentication (3). The DNA extracted from the cell lines was also sequenced to screen for the TERT promoter mutations.

Cells were seeded in 6-well plates and cotransfected with Lipofectamine 2000 (Invitrogen), 1 g of each reporter construct and 50 ng of pRL-SV40 expression plasmid for Renilla luciferase (Promega). pGL3-control plasmid was used for determining transfection efficiency and pRL-SV40 as an internal control for normalization of luminescence values. pGL3-control and pRL-SV40 express firefly luciferase and Renilla luciferase genes under the thymidine kinase and SV40 promoters, respectively. Promoter-less vector (pGL4.10[luc2]), and non- transfected cells were used as negative controls. Cells were harvested for 64 hours post transfection and lysed using 1x passive lysis buffer (Promega) and reporter expression was analyzed using the Dual-Luciferase Reporter assay system (Promega) in 96-well format. Assays were performed in triplicate wells.

Results

Four tumors, in addition to two recurrent mutations, also carried other nucleotide changes within the amplified region of the TERT promoter (Table 12). DNA from one tumor (D:078) had a single nucleotide (G/C) deletion at -129 bp (1 ,295,233; Table 12). Cloning of the amplified product into a T-overhang vector showed that the allele with the deletion also carried the -146C>T (G>A; 1 ,295,250; Fig. 13). The deletion resulted in depletion of a Sp1 transcription factor binding site (Fig. 14). One tumor (H:036), in addition to the -124C>T (G>A; 1 ,295,228) mutation, also carried a -101 C>T (G>A; 1 ,295,205) nucleotide change. The two nucleotides changes were in two different alleles. Another tumor (K:085), in addition to the - 124C>T (G>A) mutation, also showed a -58C>T (G>A; 1 ,295, 162) base change and both mutations were on the same allele. One more tumor (S:048) that had the -146C>T (G>A; 1 ,295,250) mutation carried two additional nucleotide changes - 67C>T (G>A; 1 ,295,171 ) and -69G>A (C>T; 1 ,295, 173) and all the changes were located on the same allele. None of the additional base changes in H:036, K:085 and S:041 tumors affected or created any known transcriptional binding motifs.

In Kaplan Meier model, the effect of the mutations on overall patient survival was not statistically significant (log rank P = 0.33). However, in the patients without variant allele of the rs2853669 polymorphism, the mutations were associated with a statistically significant poor survival (log rank P = 0.05) but not in patients that carried the variant allele (log rank P = 0.37; Fig. 1 1 ). The effect of the mutations on patient survival in the absence of the variant allele of the polymorphisms was also observed in all sub-categories of the bladder cancer patients (Table 1 1 and Table 13). In patients aged 70 years or more at diagnosis, the HR for the effect of the mutations in the non-carriers was 4.19 (95%CI 1 .46-12.06) compared to 0.35 (95%CI 0.1 1 -1 .12) in the corresponding carriers (Table 1 1 ). In all other categories a similar trend of the effect of mutations on patients that did not carry the variant allele was observed. In Kaplan-Meier models for the disease recurrence as outcome, the mutations were associated with statistically significant risk in patients with Tis, Ta and T1 tumors (log rank P = 0.04). The effect of the mutations on the disease recurrence was enhanced in patients that were non-carriers of the variant allele of the polymorphism (log rank P = 0.02; Fig. 15). However, in the carriers of the variant allele the effect on the recurrence was not statistically significant (log ran P = 0.86). Similarly, the Kaplan-Meier analysis for patients with the TaG1 +TaG2 disease categories showed statistically significant effect of mutations on the disease recurrence in patients that were non-carriers of the variant allele (log rank P = 0.01 ) and not in the patients that were carriers (log rank P = 0.77; Fig. 16).

The 1000 genome database showed that the variant is in linkage disequilibrium (r2 = 0.5 or more) with four other variants, which include rs2736098 (r2 = 0.85), a synonymous variant at codon 305 (GCG>GCA; ala>ala) within exon 2 of TERT; rs2736109 (located -1 .655 kb upstream of ATG; r2 = 0.66), rs2736108 (located - 2.384 kb upstream of ATG; r2 = 0.94) and rs2736107 (located -2.750 kb upstream of ATG; r2 = 0.87).

References

1 . Bryne JC, et al. (2008) JASPAR, the open access database of transcription factor-binding profiles: new content and tools in the 2008 update. Nucleic Acids Res 36(Database issue):D102-106.

2. Wagener N, et al. (2013) Endogenous BTG2 expression stimulates migration of bladder cancer cells and correlates with poor clinical prognosis for bladder cancer patients. Br J Cancer 108(4):973-982.

3. Castro F, et al. (2013) High-throughput SNP-based authentication of human cell lines. Int J Cancer 132(2):308-314.

Example 3: Telomerase reverse transcriptase (TERT) promoter mutations in primary melanoma

Summary

In this study based on 287 primary melanomas we show that the TERT promoter mutations, besides causing an increased gene expression, associate with increased patient age, increased Breslow thickness and tumour ulceration and are most frequent in nodular melanomas. The mutations are also more frequent at both intermittently and chronically sun-exposed sites than non-exposed sites and tend to co-occur with BRAF and CDKN2A mutations. The association with parameters generally associated with poor outcome raises the possibility of the use of the TERT promoter mutations as disease biomarkers.

We previously reported a disease segregating causal germline mutation in a melanoma family and recurrent somatic mutations in metastasized tumours from unrelated patients in the core promoter region of the telomerase reverse transcriptase (TERT) gene. In this study based on 287 primary melanomas we show that the TERT promoter mutations, besides causing an increased gene expression, associate with increased patient age, increased Breslow thickness and tumour ulceration and are most frequent in nodular melanomas. The mutations are also more frequent at both intermittently and chronically sun- exposed sites than non-exposed sites and tend to co-occur with BRAF and CDKN2A mutations. The association with parameters generally associated with poor outcome raises the possibility of the use of the TERT promoter mutations as disease biomarkers.

Introduction

Cutaneous melanoma, one of the most aggressive form of a skin cancer owing to its high propensity to metastasize and intrinsic drug resistance, accounts for the majority of skin-cancer related deaths ¹ . Sun exposure coupled with characteristic phenotypes define the most important risk factors for developing melanoma ² . Sequencing data have shown that of all cancer types, melanoma genomes are marked by (a) the highest prevalence of somatic mutations and (b) mutational pattern that depict a characteristic 'UV-signature', indicated by a high rate of transitions at dipyrimidinic sites ^3,4,5 . Frequently mutated genes are involved in various signalling cascades and cell cycle regulation. Besides the recurrent alterations in BRAF/NRAS, CDKN2A, PTEN and others, various sequencing projects have also identified mutations in a number of additional genes including GRIN2A, RAC1, BCL2L12, PPP6C and STK19 ^4,6,7,8 .

We previously described a highly penetrant, disease segregating causal germline mutation in a melanoma family and recurrent somatic mutations from unrelated patients in the core promoter region of the telomerase reverse transcriptase (TERT) ⁹ . The somatic mutations in the TERT promoter simultaneously discovered in another study have been shown to be frequent in a wide range of cancer types ^{10,1 1 , 12, 13,14} . The familial germline A>C mutation at -57 bp (from ATG start site; Chr 5:1 ,295,161 hg19 co-ordinate) and the recurrent mutually exclusive C>T somatic mutations at -124 (1 ,295,228) bp and -146 (1 ,295,250) bp resulted in creation of E-twenty six/ternary complex factor (Ets/TCF) binding motifs with consequent tumour specific increased TERT expression as shown by gene reporter assays ^9,10 . The frequency of the alterations in the TERT promoter exceeded that of any known gene mutation in melanoma.

The widespread occurrence of the TERT promoter mutations in many cancers has now been confirmed. The mutations have been associated with an increased gene expression, increased telomere length and adverse forms of the disease and poor outcome ^{1 1 , 15, 16,17, 18, 19,20} . In order to validate the presence of mutations in primary melanoma and to find association, if any, with different parameters, we screened 287 primary melanomas. The data were analyzed for association with different phenotypic, epidemiologic and clinical features.

Results Melanoma patients included in this study were recruited at the Department of Dermatology, Instituto Valenciano de Oncologia. In this study we screened primary tumours from 287 melanoma patients. Of 287 tumours, 227 were formalin fixed paraffin embedded (FFPE) tumour tissues, for which corresponding mutational data for the BRAF and NRAS genes were available. Additional 60 tumours were available as fresh frozen tissues, which were, besides TERT promoter mutations, also sequenced for BRAF and NRAS. Additionally in those tumours alterations at the CDKN2A locus were determined using methylation sensitive-multiplex ligation- dependent probe amplification (MS-MLPA). Detailed epidemiological data, phenotype information about the patients and the available tumour characteristics are given in Table 16 and Table 20.

Mutations in the TERT promoter Mutations in the TERT promoter region were detected in 109 of 287 (37.9%) melanomas (Table 16). The two mutually exclusive somatic changes -124C>T and -146C>T accounted for 91 of 109 (83.5%) mutations with the most common being the -146C>T (51 of 109; 46.8%). The position at -124 bp was altered in 36.7% (40/109) tumours by the C>T transitions and one tumour carried a C>A transversion. Four tumours (3.7%) carried CC>TT tandem mutation at -124/-125 bp and 7 tumours (6.4%) had a similar tandem mutation at the positions -138/-139 bp. A previously described causal A>C alteration at -57 bp in a melanoma family was present as a somatic mutation in three of 109 (2.8%) tumours with mutations. In addition, three tumours with the -146C>T mutation also carried a C>T base change at -149 bp position. One tumour with the -124C>T and another with the - 138/-139CC>TT mutations also carried the -101 C>T alteration. In addition eight melanomas carried exclusive mutations at various other positions within the core TERT promoter, which included -460T, -580T, -144C>T, -154CT, -1560T, - 176C>T, -187C>T and -242C>T. The observed alteration lead to putative changes in transcription binding sites including creation of a Ets/TCF binding motif by -156 C>T (Table 17) ²¹ . From six patients, besides primary tumours, additionally metastases were also available. Out of those, five metastases were from five patients whereas from one patient two metastases were available. Sequencing showed that primary and corresponding tumours from five patients did not carry mutations in the TERT promoter. In contrast, all three tumours from one patient, one primary and two metastases, showed the -124 C>T and additional -91 C>T mutations. Within the primary tumour and one metastasis, the TERT promoter mutations were heterozygous, in the second metastasis both mutations were in the homozygous state indicating loss of the wild type allele (Figure 19).

Association of TERT promoter mutations with patient and tumour characteristics Data analysis (Table 16) showed that the TERT promoter mutations were more frequent in tumours from melanoma patients aged above 65 years than from patients with age 65 years or below [odds ratio (OR) 2.10, 95% confidence interval (CI) 1 .10 - 3.98, P = 0.02]. Similarly TERT promoter mutations were more frequent in melanomas located at sun-exposed parts of the body. The association was statistically significant for chronically exposed sites (OR 2.74; 95% CI 1 .30 - 5.78; P = 0.008) as well as for intermittently exposed sites (OR 4.44; 95% CI 1 .70 - 1 1 .5; P = 0.002). Presence of solar lentigines at the site of melanoma also increased the odds of TERT promoter mutations within the lesion (OR 1 .84; 95% CI 1 .12 - 3.01 ; P = 0.02), although, the mutations were not associated with presence of solar lentigines in general. Other factors, such as a personal history of sunburns, sunburns at the site of melanoma or outdoor work did not influence the presence of TERT promoter mutations. Similarly, the mutations did not show any association with any characteristic patient phenotype like hair, skin or eye colour or status of the MCiR gene. We found that acral lentiginous melanoma (ALM) had the lowest frequency of the TERT promoter mutations (1/24, 4.2%). Nodular melanoma (NM), in contrast, had the highest frequency (42/76, 55.3%) of the mutations with an OR of 2.80 (95% CI 1 .63 - 4.92, P = 0.0002) for comparison with all other tumour types. Three of 13 (23%) lentigo maligna melanoma (LMM) tumours carried TERT promoter mutations. Frequencies of TERT promoter mutations were higher in vertical growth phase tumours than those in radial growth phase (OR 3.97, 95% CI 1 .60 - 9.94, p = 0.003). Similarly the mutations occurred at a higher frequency in tumours thicker than 2 mm compared to lesions thinner than 2 mm (OR 2.4, 95% CI 1 .44 - 3.93, P = 0.0007). Ulcerated tumours were also found more likely to carry TERT alterations than non-ulcerated tumours (OR 2.2, 95% CI 1 .30 - 3.67, P = 0.003). The lesions with locoregional or distant metastasis carried more TERT promoter mutations than in situ or localized melanomas (OR 1 .90, 95% CI 1 .17 - 3.38, P = 0.01 ). A family history of melanoma or a past personal history of non-melanoma skin cancer or any other non-cutaneous neoplasia did not affect the odds of carrying a TERT promoter mutation. In a multivariate model we observed that the associations between TERT promoter mutations and histological sub-types, tumour stage and presence of solar lentigines were no longer statistically significant (Table 18). TERT promoter mutations and alterations in BRAF, NRAS and CDKN2A

The BRAF mutations at codon 600 were present in 104 of 287 (36.2%) tumours and NRAS mutations were present in 20 of 275 (7.3%) melanomas. In 18 melanomas, mutations in NRAS affected codon 61 , one melanoma carried a mutation in codon 13 and one melanoma carried a T58I mutation. The tumour affected by the latter mutation also harboured the V600E mutation in BRAF. Aberrations at the CDKN2A locus were detected in 14 of the 63 (22.2%) tumours. Four tumours carried mutations, seven had large deletions and the promoter specific for the p16 transcript was hypermethylated in two tumours (Table 19).

Mutations in the TERT promoter were more frequent in tumours with BRAF mutations, (OR 2.50, 95% CI, 1 .53 - 4.14, P = 0.0003). A similar association between the TERT promoter mutations and NRAS mutations was observed (OR 2.6, 95% CI 1 .03 - 6.62, P = 0.04); however, it may be pointed out data for NRAS mutations were available only for 274 tumours. In a subset of 60 melanomas, 12 tumours had CDKN2A aberrations, and 8 of those also harboured TERT promoter mutations (OR 4.8, 95% CI 1 .25 - 18.38, P = 0.02; Table 19).

TERT mRNA expression levels

RNA was available from 39 primary melanomas to study relationship between the TERT promoter mutations and gene expression. Of 39 melanomas, 10 carried and 29 did not have the mutations. Of the 10 tumours with the TERT promoter mutations, two harboured -124C>T, one -124/-125 CC>TT, two -139/-139 CC>TT and five had -146C>T mutations. In addition, RNA was available from five skin tissues from healthy individuals. Analysis of qRT-PCR data showed statistically significant higher levels of mRNA expression in melanomas with TERT promoter than in melanoma without mutations and skin tissues (P = 0.02; Figure 18).

Discussion Infinite capability of cancer cells to divide through maintenance of telomeres has been attributed mainly to the sustained expression of telomerase ^22,23 . Though telomerase is up regulated in over 90 percent of human cancers, a definite mechanism for its cancer-specific activation had remained unclear ^24,25 . The detection of the activating somatic mutations in the promoter of the TERT gene has provided an insight into the possible cause of telomerase regeneration ¹⁴ . The mutations first detected in melanoma seem to be recurrent in many cancer types ^9,12 . In this study we investigated and validated the TERT promoter mutations in a large series of primary melanomas. The major findings of the study include the association of the TERT promoter mutations with adverse markers of melanoma prognosis like increased patient age, increased tumour thickness and tumour ulceration. These findings coupled with mechanistic relevance of the mutations provide for probable use of the lesions within the TERT promoter as disease biomarkers.

Earlier in cell lines from metastasized melanoma, we reported a 74% frequency of the somatic TERT promoter mutations and in the same study one-third of primary melanomas were shown to carry those mutations ⁹ . In this study carried out on 287 primary tumours, we found frequencies of the TERT promoter mutations to be similar to the oncogenic alterations in BRAF. The most frequent TERT promoter mutation in melanoma as described earlier was -146 C>T followed by -124 C>T ⁹ . In many other cancer types the latter is more frequent than any other TERT promoter mutation ^{11 ,12,26} . Similar to bladder cancer three melanomas carried the - 57 A>C as a somatic mutation described initially as a familial melanoma mutation ¹¹ . The underlying discernible selection force behind occurrence of the major TERT promoter mutations is an apparent de novo creation of CCGGAA/T binding motif for Ets/TCF transcription factors that leads to an increased gene expression ¹⁴ .

Abundance of C>T mutations in human cancers in general can be attributed to APOBEC cytidine deaminase expression in cancer development ²⁷ . However, the C>T alterations at the two most recurrent mutational sites in the TERT promoter along with CC>TT tandem mutations at the positions -124/-125 and -138/-139 bp in about 10 percent of melanomas in this and earlier studies suggested a causal role for UV exposure in genesis of the lesions. Until now, a CC>TT tandem mutation at the -138/-139 bp positions has been reported in 4 of 1231 screened bladder cancers compared to 15 of 420 melanomas ^28,29 . The base change at -139 bp has been reported to be a rare polymorphism represented by rs35550267, the tandem mutation at the position could be caused by a C>T base change at -138 that in conjunction with the polymorphism results in creation of an Ets/TCF binding motif ^9,30 . Further support for the association between UV exposure and TERT promoter mutations was apparent from an increased frequency of the mutations in tumours arising at the sites that are either intermittently or chronically exposed to sunlight compared to rarely exposed parts of the body ³¹ . Other features that supported the same proposition included association of the mutations in melanomas arising at the site of solar lentigines, the hyper pigmented lesions that are mostly seen in sun-damaged areas of skin ³² . BRAF mutations, in contrast, have been shown to be more prevalent on non-chronically exposed sites than the chronically exposed sites ^{31 ,33} . Mutations in melanoma from patients with increased age are considered to be consequences of cumulative exposure to sun. The TERT promoter mutations in contrast to BRAF mutations were more frequent in melanoma from patients with increased age at the diagnosis ³¹ .

Tumour thickness and ulceration in melanoma have persistently been shown to be markers of poor survival and increased risk of death; we found that TERT promoter mutations were associated with both, increased Breslow thickness and the presence of tumour ulceration ^34,35 . The mutations were also associated with vertical growth phase and with the presence of regional and distant metastasis. Histopathological sub-types are now usually considered as biologically distinct entities with the majority being either superficial spreading or nodular melanomas ³⁶ . We found that more than half of all nodular melanomas compared to one-third of superficial spreading melanomas carried the TERT promoter mutations; tumours with acral lentigous melanoma and lentigo maligna melanoma had fewer mutations. While acral melanomas are characterized by the presence of KIT mutations, BRAF mutations are more frequent in superficial spreading melanoma than nodular melanoma ^33,36 . Another distinct feature of nodular melanoma is the lack of radial growth phase and exclusive progression in vertical manner, which was found to be associated with the presence of the TERT promoter mutations. However, nodular melanomas tend to be diagnosed at later stages bearing an increased Breslow thickness, which was reflected in a multivariate model ³⁷ . Beyond the possibility that TERT promoter mutations could be the markers of adverse outcome in melanoma, increased TERT expression as a consequence of the mutations may play a role in tumour growth. Any reduction in the levels of the telomerase across the organisms results in erosion of telomeres. Telomerase reactivation in tumours with telomere dysfunction reportedly leads to malignant progression of prostate cancer in a mouse model ³⁸ . Conversely suppression of telomerase activity has been shown to significantly reduce tumour invasion and metastatic potential in a melanoma mouse model ³⁹ . The observed effects like induction of dendritic morphology, increased melanin content and tyrosinase expression were reportedly mediated through down-regulation of several gylcolytic pathway genes ³⁹ . In a sub-set of tumours where we could measure gene expression, melanomas with the mutations did show an increased TERT transcription levels compared to melanoma without mutations. A study on glioma has shown that the TERT promoter mutations rather than hypermethylation are the main mechanism that upregulate the gene expression ¹⁴ .

Previously, we showed that the TERT promoter mutations tend to be more frequent in tumours with BRAF mutations and in this study we confirmed that association ⁹ . In a sub-set of tumours we also observed co-occurrence of the alterations in TERT promoter and CDKN2A that was higher than what would be expected per chance. Most melanocytic nevi carry BRAF mutations, whereas TERT promoter mutations and CDKN2A alterations are detected in later stages ^9,40 . The loss of CDKN2A has been suggested to be a key step in escape of melanocytes from BRAF induced senescence; the acquisition of the TERT promoter mutations can be hypothesized to facilitate stabilization of the transformed genome through reversal of telomeric loss as consequence of increase telomerase activity ⁴¹ .

The TERT promoter mutations represent novel genetic alterations with a role in cancer development through alteration in gene expression. In this study based on a relatively large series of primary melanoma, we showed association of the TERT promoter mutations with factors that are generally considered as markers of poor prognosis. Strategies based on therapeutic inhibition of telomerase that include small molecular inhibitors, immunotherapy, gene therapy, telomere and telomerase proteins are already part of clinical trials ⁴² . Further research will determine usefulness of the TERT promoter mutations in the context of melanoma treatment where strategies based on BRAF inhibitors have shown a vast potential despite persistent issue of resistance ⁴³ .

Material and Methods

Patients and tumour samples

In this study primary melanoma tumours from 287 melanoma patients were retrieved from the biobank of the Instituto Valenciano de Oncologia in Valencia, Spain. Sixty tumours were fresh-frozen and 227 were available as formalin-fixed paraffin-embedded (FFPE) tissue. From six patients corresponding metastases were also available as FFPE. All patient data were obtained from the melanoma database of the institution. The database, initiated in January 2000, contains systematically and prospectively collected information from patients treated at the institution ⁴⁴ . Ethical approval for the study from local ethics committee and written informed consent from all study patients were obtained.

Phenotypic characteristics and sun exposure history

Details on collection of clinical, epidemiological and histological data were described previously ⁴⁴ . Briefly, patients underwent clinical examination by expert dermatologists in which congenital, atypical and common melanocytic nevi (>2 mm in diameter) were counted. The presence or absence of actinic keratoses and solar lentigines was also recorded. The density of freckling in childhood on the face, arm, and back was scored according to the Vancouver charts ⁴⁵ . Patients were also asked to report their sun exposure history recording the total number of severe and light sunburns. Hair and eye colour was also recorded, as well as the skin type using the Fitzpatrick classification. Family and personal histories of other neoplasia were systematically collected. The pattern of sun-exposure was inferred from medical histories, physical examinations, patient reported data and the location of the primary tumour and assigned into three categories: rarely exposed, usually exposed and infrequently exposed.

DNA and RNA extraction

From fresh frozen melanoma samples DNA and RNA were extracted using the QIAGEN AllPrep DNA RNA MiniKit. Tissues were homogenized in a Tissuelyser LT (Qiagen, Hilden, Germany) with 5 mm stainless steel beads in 600μΙ RLT buffer and further processed. Concentrations of total DNA and RNA were measured using an UV-VIS- Spectrophotometer (NanoDrop Technologies, Wilmington, USA) and absorption ratio at 260/280 nm was determined. RNA consistency was examined on a Bioanalyzer 2100 System (Agilent Technologies, Palo Alto, CA) using the corresponding RNA nano chips.

Extraction of DNA from formalin-fixed paraffin-embedded melanoma tissue was performed as described previously ⁴⁶ . Briefly, hematoxylin- and eosin-stained sections from each melanoma were assessed for areas of normal and tumour tissue. Formalin-fixed paraffin-embedded tissue sections were dissected to select areas with maximum melanoma cells. DNA was isolated using Qiagen DNeasy Tissue Kit (QIAGEN, Hilden, Germany) with additional proteinase K digestion at 55 °C for 48 hours.

Mutation detection in the TERT promoter and in BRAF, NRAS, CDKN2A

Mutational status of the TERT core promoter region (from position -27 to -286 from ATG start site) was determined by PCR and Sanger sequencing. PCR was carried out in a 10 μΙ volume containing 10 ng DNA, 50 mM KCI, 0.1 1 mM dNTP, and 0.1 1 μΜ of each primer. Concentrations of MgC^ and other additives and temperature conditions were adjusted according to the primer sequences (y Table 21 ). Amplified products were purified with Exosap (GE Healthcare, Buckinghamshire, UK) to remove unused primer and were subjected to 35 cycles of sequencing reaction with a dideoxy terminator kit and forward and reverse primers in separate reactions (BigDye ^® Terminator v3.1 Cycle Sequencing Kit, Applied Biosystems, Austin TX, USA). Sequencing reaction products were precipitated with ethanol and analyzed on a capillary sequencer (AbiPrism 3130x1 Genetic Analyzer). Mutations at codon 600 of BRAF p.V600 and codon 61 of NRAS p.Q61 in DNA from FFPE samples were detected with single base extension or allele-specific assays using the iPLEX genotyping format (Sequenom) as described previously. For DNA from fresh-frozen tumour tissues PCR and Sanger sequencing as described were used to detect mutations in the TERT promoter, BRAF, NRAS and additionally in CDKN2A. Thirteen FFPE samples with known BRAF status were re- sequenced with Sanger sequencing for random confirmation of the results. The sequencing data were analyzed using Geneious Pro 5.6.5 software with reference to the sequences from the NCBI gene database, TERT (chr5: 1 ,295,071 - 1 ,295,521 ), BRAF (NG_007873.2), NRAS (NG_007572.1 ) and CDKN2A (NC_000009.1 1 ; NM_000077.4).

Methylation sensitive-multiplex ligation-dependent probe amplification (MS- MLPA)

To detect deletions and methylation at the CDKN2A locus we used the MS-MLPA method with specific probes (SALSA MLPA ME024 9p21 CDKN2A/2B; MRC Holland, Amsterdam, The Netherlands). 50 ng of DNA per sample were subjected to 16 hours of incubation with the probe mix and afterwards divided into two reactions. One was processed in a ligation reaction, followed by a multiplex PCR. The second part was processed in a ligation step followed by Hhal digestion and then amplified in a multiplex PCR. Fragment analysis was performed on a capillary sequencer (AbiPrism 3130x1 Genetic Analyzer). The results were evaluated using Coffalyser software (MRC Holland); threshold to define deletions was set at the delta value of 0.3 and if methylation of a probe exceeded 30% the status was considered positive.

Measurement of the TERT gene expression For measurement of the TERT expression reverse transcription reaction was performed using between 0.75 - 1 .0 g RNA and random hexamer primers using a cDNA synthesis kit (ThermoScientific, Waltham, USA). TERT expression levels then were determined by quantitative real-time PCR (qRT-PCR) using a syber green kit (QIAGEN, Hilden, Germany). The real time PCR was carried out in triplicates on a 384 well layout using forward (5 GGAAGAGTGTCTGGAGCAA3'; biding site in exon 3 of TERT; SEQ ID No. 32) and reverse (5OGATGAAGCGGAGTCTGGA3'; binding site in exon 4 of TERT; SEQ ID No. 33) primers specific for TERT and primers for the GUSB gene (QIAGEN, Hilden, Germany), a housekeeping gene used as an internal standard. TERT expression levels were calculated using GUSB expression as a reference and relative quantification was performed using the ΔΔΟ method and log2-transformation.

Statistical analysis

The associations between the TERT promoter mutations and other parameters were determined by using chi-square test. A difference was considered statistically significant if P-value was < 0.05. Odds ratios were calculated to assess the size of the effect of different parameters on the occurrence of the TERT promoter mutations. Multivariate logistic regression was also carried out that included age at diagnosis, histological type, presence of solar lentigines, and pattern of sun- exposure at melanoma site, ulceration, stage and Breslow thickness that were associated with the mutations in the univariate analyses.

References 1 . Eggermont AM, Spatz A, Robert C. Cutaneous melanoma. Lancet 2013.

2. Braeuer RR, Watson IR, Wu CJ, Mobley AK, Kamiya T, Shoshan E, et al. Why is melanoma so metastatic? Pigment Cell Melanoma Res 2013.

3. Alexandrov LB, Nik-Zainal S, Wedge DC, Aparicio SA, Behjati S, Biankin AV, et al. Signatures of mutational processes in human cancer. Nature 2013,

500(7463): 415-421 . 4. Hodis E, Watson IR, Kryukov GV, Arold ST, Imielinski M, Theurillat JP, et al. A landscape of driver mutations in melanoma. Cell 2012, 150(2): 251 -263.

5. Mar VJ, Wong SQ, Li J, Scolyer RA, McLean C, Papenfuss AT, et al.

BRAF/NRAS wild-type melanomas have a high mutation load correlating with histologic and molecular signatures of UV damage. Clin Cancer Res 2013, 19(17): 4589-4598.

6. Krauthammer M, Kong Y, Ha BH, Evans P, Bacchiocchi A, McCusker JP, et al. Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma. Nat Genet 2012, 44(9): 1006-1014. 7. Wei X, Walia V, Lin JC, Teer JK, Prickett TD, Gartner J, et al. Exome sequencing identifies GRIN2A as frequently mutated in melanoma. Nat Genet 201 1 , 43(5): 442-446.

8. Gartner JJ, Parker SC, Prickett TD, Dutton-Regester K, Stitzel ML, Lin JC, et al. Whole-genome sequencing identifies a recurrent functional synonymous mutation in melanoma. Proc Natl Acad Sci U S / 2013, 110(33): 13481 -13486.

9. Horn S, Figl A, Rachakonda PS, Fischer C, Sucker A, Gast A, et al. TERT promoter mutations in familial and sporadic melanoma. Science 2013, 339(6122): 959-961 .

10. Huang FW, Hodis E, Xu MJ, Kryukov GV, Chin L, Garraway LA. Highly recurrent TERT promoter mutations in human melanoma. Science 2013,

339(6122): 957-959.

1 1 . Rachakonda PS, Hosen I, de Verdier PJ, Fallah M, Heidenreich B, Ryk C, et al. TERT promoter mutations in bladder cancer affect patient survival and disease recurrence through modification by a common polymorphism. Proc Natl Acad Sci U S A 2013.

12. Killela PJ, Reitman ZJ, Jiao Y, Bettegowda C, Agrawal N, Diaz LA, Jr., et al. TERT promoter mutations occur frequently in gliomas and a subset of tumors derived from cells with low rates of self-renewal. Proc Natl Acad Sci U S A 2013, 110(15): 6021 -6026. 13. Vinagre J, Almeida A, Populo H, Batista R, Lyra J, Pinto V, et al. Frequency of TERT promoter mutations in human cancers. Nature communications 2013, 4: 2185.

14. Arita H, Narita Y, Takami H, Fukushima S, Matsushita Y, Yoshida A, et al. TERT promoter mutations rather than methylation are the main mechanism for

TERT upregulation in adult gliomas. Acta Neuropathol

15. Nault JC, Mallet M, Pilati C, Calderaro J, Bioulac-Sage P, Laurent C, et al. High frequency of telomerase reverse-transcriptase promoter somatic mutations in hepatocellular carcinoma and preneoplastic lesions. Nature communications 2013, 4: 2218.

16. Tallet A, Nault JC, Renier A, Hysi I, Galateau-Salle F, Cazes A, et al.

Overexpression and promoter mutation of the TERT gene in malignant pleural mesothelioma. Oncogene 2013.

17. Arita H, Narita Y, Fukushima S, Tateishi K, Matsushita Y, Yoshida A, et al. Upregulating mutations in the TERT promoter commonly occur in adult malignant gliomas and are strongly associated with total 1 p19q loss. Acta Neuropathol

126(2): 267-276.

18. Papadopoulos N, Kinde I, Munari E, Faraj SF, Hruban RH, Schoenberg MP, et al. TERT Promoter Mutations Occur Early in Urothelial Neoplasia and are Biomarkers of Early Disease and Disease Recurrence in Urine. Cancer Res 2013.

19. Landa I, Ganly I, Chan TA, Mitsutake N, Matsuse M, Ibrahimpasic T, et al. Frequent Somatic TERT Promoter Mutations in Thyroid Cancer: Higher

Prevalence in Advanced Forms of the Disease. J Clin Endocrinol Metab 2013.

20. Liu T, Wang N, Cao J, Sofiadis A, Dinets A, Zedenius J, et al. The age- and shorter telomere-dependent TERT promoter mutation in follicular thyroid cell- derived carcinomas. Oncogene 2013.

21 . Bryne JC, Valen E, Tang MH, Marstrand T, Winther O, da Piedade I, et al. JASPAR, the open access database of transcription factor-binding profiles: new content and tools in the 2008 update. Nucleic Acids Res 2008, 36(Database issue): D102-106. 22. Masutomi K, Yu EY, Khurts S, Ben-Porath I, Currier JL, Metz GB, et al. Telomerase maintains telomere structure in normal human cells. Ce// 2003,

114(2): 241 -253.

23. Marion RM, Blasco MA. Telomere rejuvenation during nuclear

reprogramming. Curr Opin Genet Dev 2010, 20(2): 190-196.

24. Low KC, Tergaonkar V. Telomerase: central regulator of all of the hallmarks of cancer. Trends in biochemical sciences 2013.

25. Shay JW, Zou Y, Hiyama E, Wright WE. Telomerase and cancer. Hum Mol Genet 2001 , 10(7): 677-685. 26. Koelsche C, Sahm F, Capper D, Reuss D, Sturm D, Jones DT, et al.

Distribution of TERT promoter mutations in pediatric and adult tumors of the nervous system. Acta Neuropathol 2013.

27. Roberts SA, Lawrence MS, Klimczak LJ, Grimm SA, Fargo D, Stojanov P, et al. An APOBEC cytidine deaminase mutagenesis pattern is widespread in human cancers. Nat Genet 2013, 45(9): 970-976.

28. Allory Y, Beukers W, Sagrera A, Flandez M, Marques M, Marquez M, et al. Telomerase Reverse Transcriptase Promoter Mutations in Bladder Cancer: High Frequency Across Stages, Detection in Urine, and Lack of Association with Outcome. Eur Urol 2013. 29. Hurst CD, Piatt FM, Knowles MA. Comprehensive Mutation Analysis of the TERT Promoter in Bladder Cancer and Detection of Mutations in Voided Urine. Eur Urol 2013.

30. Maldonado JL, Fridlyand J, Patel H, Jain AN, Busam K, Kageshita T, et al. Determinants of BRAF mutations in primary melanomas. J Natl Cancer Inst 2003, 95(24): 1878-1890.

31 . Bauer J, Buttner P, Murali R, Okamoto I, Kolaitis NA, Landi MT, et al. BRAF mutations in cutaneous melanoma are independently associated with age, anatomic site of the primary tumor, and the degree of solar elastosis at the primary tumor site. Pigment Cell Melanoma Res 201 1 , 24(2): 345-351 . 32. Watanabe T, Tahira M, Morino S, Horie T, Adachi K, Tsutsumi R, et al. Novel morphological study of solar lentigines by immunohistochemical and electron microscopic evaluation. J Dermatol 2013, 40(7): 528-532.

33. Lee JH, Choi JW, Kim YS. Frequencies of BRAF and NRAS mutations are different in histological types and sites of origin of cutaneous melanoma: a metaanalysis. Br J Dermatol 201 1 , 164(4): 776-784.

34. In 't Hout FE, Haydu LE, Murali R, Bonenkamp JJ, Thompson JF, Scolyer RA. Prognostic importance of the extent of ulceration in patients with clinically localized cutaneous melanoma. Ann Surg 2012, 255(6): 1 165-1 170. 35. Egger ME, Stepp LO, Callender GG, Quillo AR, Martin RC, 2nd, Scoggins CR, et al. Outcomes and prognostic factors in superficial spreading melanoma. Am J Surg 2013.

36. Greenwald HS, Friedman EB, Osman I. Superficial spreading and nodular melanoma are distinct biological entities: a challenge to the linear progression model. Melanoma Res 2012, 22(1 ): 1 -8.

37. Warycha MA, Christos PJ, Mazumdar M, Darvishian F, Shapiro RL, Berman RS, et al. Changes in the presentation of nodular and superficial spreading melanomas over 35 years. Cancer 2008, 113(12): 3341 -3348.

38. Ding Z, Wu CJ, Jaskelioff M, Ivanova E, Kost-Alimova M, Protopopov A, et al. Telomerase reactivation following telomere dysfunction yields murine prostate tumors with bone metastases. Ce// 2012, 148(5): 896-907.

39. Bagheri S, Nosrati M, Li S, Fong S, Torabian S, Rangel J, et al. Genes and pathways downstream of telomerase in melanoma metastasis. Proc Natl Acad Sci U S A 2006, 103(30): 1 1306-1 131 1 . 40. Kumar R, Angelini S, Snellman E, Hemminki K. BRAF mutations are common somatic events in melanocytic nevi. Journal of Investigative Dermatology 2004, 122(2): 342-348.

41 . Michaloglou C, Vredeveld LC, Mooi WJ, Peeper DS. BRAF(E600) in benign and malignant human tumours. Oncogene 2008, 27(7): 877-895. 42. Ruden M, Puri N. Novel anticancer therapeutics targeting telomerase.

Cancer Treat Rev 2013, 39(5): 444-456.

43. Sullivan RJ, Flaherty KT. Resistance to BRAF-targeted therapy in melanoma. Eur J Cancer 2013, 49(6): 1297-1304. 44. Nagore E, Botella-Estrada R, Requena C, Serra-Guillen C, Martorell A, Hueso L, et al. [Clinical and epidemiologic profile of melanoma patients according to sun exposure of the tumor site]. Actas Dermosifiliogr 2009, 100(3): 205-21 1 .

45. Gallagher RP, McLean Dl, Yang CP, Coldman AJ, Silver HK, Spinelli JJ, et al. Suntan, sunburn, and pigmentation factors and the frequency of acquired melanocytic nevi in children. Similarities to melanoma: the Vancouver Mole Study. Arch Dermatol 1990, 126(6): 770-776.

46. Hacker E, Nagore E, Cerroni L, Woods SL, Hayward NK, Chapman B, et al. NRAS and BRAF mutations in cutaneous melanoma and the association with MC1 R genotype: findings from Spanish and Austrian populations. J Invest

Dermatol 2013, 133(4): 1027-1033.

Table 9

M Col. -124 -146 Others Carriers Number _0/ All % ^* TT , /o

/o C>T ^† C>T* ¹ (TC+CC

All 327 214 65.4 175 38 1 173 154 47.1

Sex

Men 221 67.6 146 66.1 120 25 1 1 19 102 46.2

Women 106 32.4 68 64.2 55 13 0 54 52 49.1

Age [Median (Q1 -Q3)= 72.8y (64.5-

79.4)]

<70y 109 33.3 75 68.8 60 15 0 58 51 46.8

>70y 189 57.8 124 65.6 101 22 1 102 87 46.0

Missing 29 8.9 15 51 .7 14 1 0 13 16 55.2

Tumor grade

Low grade:

14 4.3 4 28.6 3 1 0 10 4 28.6 PUNLMP ⁿ

G1 104 31 .8 83 79.8 68 14 1 51 53 51 .0

High grade:

63 19.3 37 58.7 28 9 0 34 29 46.0 G2 G3 1 17 35.8 77 65.8 65 12 0 64 53 45.3

Gx 29 8.9 13 44.8 1 1 2 0 14 15 51 .7 Tumor stage (T)

Non-invasive: _c

1 .5 3 60.0 3 0 0 2 3 60.0 Tis 5

Ta 158 48.3 105 66.5 86 18 1 85 73 46.2

Invasive: _cc

17.1 40 71 .4 32 8 0 30 26 46.4

T1 ⁵⁶

T2 80 24.5 53 66.3 43 10 0 43 37 46.3

Missing 28 8.6 13 46.4 1 1 2 0 13 15 53.6 Lymph node (N)

NO 30 9.2 20 66.7 16 4 0 18 12 40.0

N+ 14 4.3 6 42.9 6 0 0 5 9 64.3

Nx 246 75.2 167 67.9 135 31 1 131 1 15 46.7

Missing 37 1 1 .3 21 56.8 18 3 0 19 18 48.6 Metastasis (M)

M0 250 76.5 165 66.0 135 29 1 137 1 13 45.2

M+ 10 3.1 6 60.0 5 1 0 4 6 60.0

Mx 32 9.8 24 75.0 18 6 0 15 17 53.1

Missing 35 10.7 19 54.3 17 2 0 17 18 51 .4 Disease

Tis 5 1 .5 3 60.0 3 0 0 2 3 60.0

TaG1 101 30.9 80 79.2 65 14 1 50 51 50.5

TaG2 30 9.2 15 50.0 12 3 0 17 13 43.3

TaG3+T 69 21 .1 46 66.7 38 8 0 38 31 44.9

T2+ 80 24.5 53 66.3 43 10 0 43 37 46.3

Missing 42 12.8 17 40.5 14 3 0 23 19 45.2

Death

Dead 88 26.9 63 71 .6 51 12 0 50 38 43.2

^{Al ive,/} _ri5 196 59.9 126 64.3 102 23 1 102 94 48.0 censored

Missing 43 13.1 25 58.1 22 3 0 21 22 51 .2

P53 mutations

Mutation 24 7.3 17 70.8 15 2 0 7 17 70.8 Wild type 150 45.9 94 62.7 76 18 0 83 67 44.7 Missing 153 46.8 103 67.3 84 18 1 83 70 45.8 Table 10

All SNP non-carriers SNP carriers

Dea Dea Dea

HR (95% CI) N HR (95% CI) HR (95% CI) d d

Survival

Without

93 25 1.00 Reference 56 13 1.00 Reference 37 12 1.00 Reference mutation

With (0.81- (1.02- (0.18-

94 37 2.19 92 26 0.42 mutation 2.23) 4.70) 1.01) Tumor

recurrence ⁺

Tumor stage

(Tis, Ta, Tl)

Without

69 38 1.00 Reference 45 22 1.00 Reference 24 16 1.00 Reference mutation

With

138 96 1.51 1.03-2.20) 65 48 1.85 1.11-3.08) 73 48 1.14 (0.62-1.99) mutation

Disease

category

(TaGl+TaG2)

Without

34 18 1.00 Reference 20 9 1.00 Reference 14 9 1.00 Reference mutation

With

89 63 1.59 0.94-2.69) 43 33 2.53 1.20-5.33) 46 30 0.80 (0.36-1.78) mutation

Table 1 1

All Non-carriers Carriers

N N

Patients No. deadHR ^* 95% CI o ^~ * 95%CI o ^®a HR ^* 95% CI d d

Without mutation 60 11 ¹ -° ^Referenc 35 5 1-0 eferen _{25 6 1 QQ Reference}

0 e 0 ce

With mutation 127 40 ¹ ^ 0.62-2.96 6521 ¹ „ ⁸ ° ^48" 62 19 0.32 0.06-1.87

6 1 6.81

Women

. 1.0 Referenc _{H 0} LOReferen _H „ . _nn ._, ,

Without mutation 33 14 „ 21 8 „ 12 6 1.00 Reference

0 e 0 ce

With mutation 59 23 ¹ f 0.69-3.57 29 16 ² I ° _n ⁸ ^ ^~ 30 7 1.10 0.19-6.48

8.61

Age at diagnosis >70y

, . .. _rr , .~ 1.0 Referenc „„ _r . LOReferen „„ _n , _nn ._, ,

Without mutation 59 19 _n 3610 „ 23 9 1.00 Reference

0 e 0 ce

With mutation 114 47 ¹ ^ 0.85-2.86 5927 ^4"1 * ^6~ 55 20 0.35 0.11-1.12

6 9 12.06

Age at diagnosis

<70y

...... , . .. ₁ „ 1.0 Referenc _r . „ LOReferen „ ._, ,

Without mutation 34 6 „ 20 3 „ 14 3 1.00 Reference

0 e 0 ce

With mutation 72 16 ° 0.18-2.49 3510 °„ ⁰ „° _o 37 6 -

0 y .o

Table 12

Table 12. Variants in the TERT promoter detected in tumors from bladder carcinoma patients

ID Age at Sex Tumor Tumor TumN TumM Death Death from cancer p53 mutation TERT mutation rs2853669 Treatm diagnoStage Grade A>G grou sis

D:057 71.6 M Tis G3 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG BCG

D:001 82.9 M Tis G3 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA BCG

D:053 82.1 F Tis G3 NX MX Dead Not dead/Dead-Other cause None None AG Chem therap

D:073 75.0 M Tis G3 NX MO Dead Not dead/Dead-Other cause None None AA BCG

D:079 80.3 F Tis G3 NX MX Dead Not dead/Dead-Other cause G- >C; exon 1 ,295,228 G>A AG BCG

8; R280T

D:013 56.3 M Ta G1 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG BCG

D:017 77.7 M Ta G1 NX MO Dead Not dead/Dead-Other cause not done None AG TURB

D:021 61.2 M Ta G1 NX MX Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG TURB

D:022 73.5 F Ta G1 NX MX Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG TURB

D:025 81.5 F Ta G1 NX MO Dead Not dead/Dead-Other cause not done None AA TURB

D:037 83.2 F Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG TURB

D:049 69.1 M Ta G1 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

D:051 73.5 F Ta G1 NX MO Dead Not dead/Dead-Other cause not done None AA TURB

D:065 58.4 M Ta G1 NX MO Not dead Not dead/Dead-Other cause None None AA TURB

D:070 73.4 F Ta G1 NX MO Not dead Not dead/Dead-Other cause None None AA TURB

D:072 75.5 M Ta G1 NX MO Dead Not dead/Dead-Other cause None None AA TURB

D:076 61.6 F Ta G1 NX MO Not dead Not dead/Dead-Other cause None None AA Chem therap

D:077 73.6 F Ta G1 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,250 G>A AG TURB

D:078 76.1 F Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,250 G>A; AA TURB

1 ,295,233del C

D:081 88.5 M Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

D:087 56.1 F Ta G1 NX MO Dead Dead-Cancer None 1 ,295,228 G>A AA Chem therap

D:089 79.4 M Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

D:093 75.8 M Ta G1 NX MX Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG TURB

D:095 73.9 F Ta G1 NX MX Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG TURB

D:099 55.7 M Ta G1 NX MX Not dead Not dead/Dead-Other cause None None AG TURB

D: 101 68.3 M Ta G1 NX MO Not dead Not dead/Dead-Other cause C- >G; int; 1 ,295,250 G>A AA TURB

Base 14133

H:003 50.2 M Ta G1 NX MO Not dead Not dead/Dead-Other cause not done None AA TURB

1-1:01 1 85.5 F Ta G1 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AA TURB

1-1:014 72.1 F Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG TURB

H:029 53.6 M Ta G1 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG BCG

H:036 65.8 F Ta G1 NX MO Dead Dead-Cancer not done 1 ,295,205G>A; AA TURB

1 ,295,228 G>A

H:037 74.6 M Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

H:040 71.7 M Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA BCG

H:067 77.5 F Ta G1 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG TURB

H:069 64.5 F Ta G1 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG TURB

H:070 71.8 M Ta G1 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA Chem therap

H:091 76.5 M Ta G1 NX MX Dead Not dead/Dead-Other cause not done 1 ,295,250 G>A GG TURB

1-1: 102 68.6 F Ta G1 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA TURB

1-1: 1 15 62.8 F Ta G1 NX MX Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA TURB

1-1: 1 19 50.8 M Ta G1 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA Chem therap Cystecto

1-1: 124 89.2 M Ta G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG TURB

1-1: 127 53.6 Μ Ta G1 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA TURB

1-1: 128 69.0 F Ta G1 NX MX Not dead Not dead/Dead-Other cause not done 1 ,295,250 G>A AG TURB

1-1: 129 76.8 Μ Ta G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,250 G>A AG TURB

1-1: 132 67.0 Μ Ta G1 NX MX Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA TURB

K:007 76.7 F Ta G1 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG Chem therap

Κ:009 81.8 F Ta G1 NX MO Dead Not dead/Dead-Other cause None None GG TURB

Κ:021 58.9 Μ Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

Κ:029 80.0 F Ta G1 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

Κ:033 57.6 Μ Ta G1 NX MO Dead Not dead/Dead-Other cause None None AA TURB

Κ:043 73.8 Μ Ta G1 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,250 G>A AG Chem therap

Κ:052 74.7 Μ Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

Κ:067 64.8 Μ Ta G1 NX MO Not dead Not dead/Dead-Other cause None None AA TURB

Κ:071 66.5 F Ta G1 NX MO Dead Not dead/Dead-Other cause A- >G; exon 1 ,295,228 G>A AG TURB

5; Y163C

Κ:072 53.2 Μ Ta G1 NX MO Not dead Not dead/Dead-Other cause None None GG TURB

Κ:079 71.2 Μ Ta G1 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG TURB

Κ:082 61.1 F Ta G1 NX MX Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG TURB

Κ:083 85.8 Μ Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG TURB

Κ:085 79.1 Μ Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,162 G>A; AA TURB

1 ,295,228 G>A

Κ:086 53.8 Μ Ta G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG TURB

Κ:089 59.6 Μ Ta G1 NX MO Not dead Not dead/Dead-Other cause None None AG TURB

Κ:101 58.2 Μ Ta G1 NX MX Not dead Not dead/Dead-Other cause None None AA TURB

Κ:1 15 83.9 Μ Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,250 G>A GG TURB

Κ:131 60.5 Μ Ta G1 NX MO Not dead Not dead/Dead-Other cause A- >G; exon 1 ,295,228 G>A AG TURB

5; Y163C

Κ:132 56.5 Μ Ta G1 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

Κ:135 79.2 Μ Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A GG BCG

Κ:136 44.9 F Ta G1 NX MO Not dead Not dead/Dead-Other cause None None AA TURB

κ 155 73.2 M Ta G1 NX MO Not dead Not dead/Dead-Other cause None None AG TURB κ 165 51.2 M Ta G1 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA BCG κ 167 77.5 M Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>T AG TURB κ 174 88.2 M Ta G1 NX MX Dead Not dead/Dead-Other cause None 1 ,295,250 G>A AA TURB κ 175 49.2 F Ta G1 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,250 G>A AA TURB κ 185 69.2 M Ta G1 NX MO Dead Not dead/Dead-Other cause None None AG TURB κ 186 86.1 M Ta G1 NX MO Dead Dead-Cancer None 1 ,295,228 G>A AA TURB κ 188 78.6 F Ta G1 NX MO Dead Not dead/Dead-Other cause G- >A; exon 1 ,295,228 G>A AG TURB

8; G279G

Κ:197 80.1 M Ta G1 NX MO Dead Not dead/Dead-Other cause None None AG TURB

Κ:198 91.2 M Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A GG TURB

Ι_:007 82.8 M Ta G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA TURB

Ι_:009 79.0 M Ta G1 NX MX Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA TURB

SS:00 70.0 M Ta G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA TURB

0

SS:01 66.6 M Ta G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,250 G>A AA TURB

9

S:013 72.1 M Ta G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG TURB

S:015 74.9 F Ta G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,250 G>A AG TURB

S:036 74.1 M Ta G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295, 161 T>G AG TURB

S:048 79.6 M Ta G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,171 G>A; AA TURB

1 ,295, 173 OT;

1 ,295,250 G>A

S:053 59.7 M Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

S:056 84.9 M Ta G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG BCG

S:058 63.7 F Ta G1 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG BCG

S:066 67.8 F Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

S:075 85.7 F Ta G1 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG TURB

S:076 53.0 F Ta G1 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG Chem therap

S:078 71.4 M Ta G1 NX MX Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

S:080 63.2 M Ta G1 NX MX Dead Not dead/Dead-Other cause not done None AA TURB

S:134 76.4 M Ta G1 NX MX Dead Not dead/Dead-Other cause None 1 ,295,228 G>A GG TURB

S:148 86.7 F Ta G1 NX MX Dead Not dead/Dead-Other cause None 1 ,295,250 G>A AA TURB

S:164 65.5 F Ta G1 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG TURB

S:168 71.6 M Ta G1 NX MX Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG TURB

S:171 81.2 M Ta G1 NX MX Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA TURB

S:173 60.9 M Ta G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG TURB

S:185 70.0 F Ta G1 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA TURB

K:204 M Ta G2 None None AA

K:207 M Ta G2 None 1 ,295,228 G>A AA

D:014 73.4 M Ta G2 NX MX Dead Not dead/Dead-Other cause not done None AA Chem therap

D:019 78.4 M Ta G2 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,250 G>A AA TURB

D:063 66.9 M Ta G2 NX MX Dead Not dead/Dead-Other cause G- >T; exon None GG TURB

5; C135F

D:071 70.6 F Ta G2 NX MO Dead Not dead/Dead-Other cause None None AA TURB

D:098 52.7 M Ta G2 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,250 G>A GG TURB

H:010 41.3 M Ta G2 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG TURB

H: 108 79.5 M Ta G2 NX MO Dead Not dead/Dead-Other cause not done None AG BCG

K:017 47.9 M Ta G2 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,250 G>A AA TURB

K:030 73.3 M Ta G2 NX MO Dead Not dead/Dead-Other cause None None AA TURB

K:066 75.0 F Ta G2 NX MO Dead Not dead/Dead-Other cause not done None AG TURB

K:1 14 47.4 M Ta G2 NX MO Not dead Not dead/Dead-Other cause None None AG BCG

K:120 70.2 M Ta G2 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A GG TURB

K:156 61.7 M Ta G2 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

K:168 72.4 M Ta G2 NX MO Not dead Not dead/Dead-Other cause None None AG BCG

K:180 64.4 M Ta G2 NX MX Dead Not dead/Dead-Other cause None 1 ,295,228 G>A GG TURB

K:183 62.9 M Ta G2 NX MO Dead Not dead/Dead-Other cause None None AA TURB

K:190 67.6 M Ta G2 NX MO Dead Dead-Cancer None 1 ,295,228 G>A AA Radio

therap

SH:00 50.6 F Ta G2 NX MO Dead Not dead/Dead-Other cause not done None AG Chem

2 therap

SS:01 77.6 F Ta G2 NX MO Dead Not dead/Dead-Other cause C- >T; exon 5; 1 ,295,228 G>A AG TURB

1 P153P

S:019 82.5 M Ta G2 NX MO Dead Not dead/Dead-Other cause None None AA Chem therap

S:035 73.7 F Ta G2 NX MO Dead Not dead/Dead-Other cause not done None AA BCG

S:049 56.9 M Ta G2 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA BCG

S: 154 88.9 M Ta G2 NX MX Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG TURB

S: 160 67.9 M Ta G2 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A GG Chem therap

S: 166 83.4 M Ta G2 NX MX Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

S: 177 76.9 M Ta G2 NX MO Dead Not dead/Dead-Other cause not done None AA TURB

S: 188 64.0 M Ta G2 NX MO Dead Not dead/Dead-Other cause not done None AA BCG

S: 189 75.7 M Ta G2 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

SS:00 61 .8 F Ta G3 NX MO None 1 ,295,228 G>A AA

Q y

D:036 71 .0 M Ta G3 NO MO Dead Dead-Cancer C- >T; exon 6; None GG Cystecto

Q192*

D:055 70.7 M Ta G3 NX MO Dead Dead-Cancer None 1 ,295,228 G>A AG Chem therap

Cystecto

D:083 61 .1 M Ta G3 NX MO Dead Not dead/Dead-Other cause not done None AA TURB

H:013 80.6 F Ta G3 NX MO Dead Not dead/Dead-Other cause not done None GG BCG

H:033 79.8 M Ta G3 NX MO Dead Not dead/Dead-Other cause G- >C; exon 1 ,295,228 G>A AA BCG

8; D281 H

H:057 78.0 M Ta G3 NX MO Dead Not dead/Dead-Other cause None None AA BCG

H:065 87.3 M Ta G3 NX MO Dead Not dead/Dead-Other cause not done None AG TURB

1-1: 120 72.3 M Ta G3 NX MO Dead Not dead/Dead-Other cause not done None AA BCG

1-1: 134 81 .5 M Ta G3 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA BCG

K:080 69.5 M Ta G3 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG BCG

K:164 75.5 M Ta G3 NX MO Dead Not dead/Dead-Other cause None None AA Chem therap

S:041 76.8 M Ta G3 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA BCG

D:040 71.5 M Ta PUNLM NX MO Not dead Not dead/Dead-Other cause None None AG TURB r

D:094 49.5 M Ta PUNLM NX MO Dead Not dead/Dead-Other cause None None AA TURB

D:096 74.1 F Ta PUNLM NX MO Dead Not dead/Dead-Other cause G- >A; exon 1 ,295,228 G>A AA TURB

P 8; E271 K

H:060 73.2 M Ta PUNLM NX MO Not dead Not dead/Dead-Other cause not done None GG TURB r

H:081 47.4 M Ta PUNLM NX MO Not dead Not dead/Dead-Other cause None None AA TURB r

K:026 78.9 M Ta PUNLM NX MO Dead Not dead/Dead-Other cause None None AA TURB r

K:035 69.0 F Ta PUNLM NX MO Dead Not dead/Dead-Other cause None 1 ,295,250 G>A AG TURB r

K:091 41.3 M Ta PUNLM NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB r

SS:00 65.1 M Ta PUNLM NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA TURB

1 r

S:018 38.8 M Ta PUNLM NX MO Not dead Not dead/Dead-Other cause not done None AG TURB r

S:061 80.7 F Ta PUNLM NX MO Not dead Not dead/Dead-Other cause not done None AA TURB r

S:072 76.3 M Ta PUNLM NX MO Not dead Not dead/Dead-Other cause None None AA TURB r

S:098 54.6 M Ta PUNLM NX MO Not dead Not dead/Dead-Other cause None None AA TURB r

S:175 63.0 M Ta PUNLM NX MX Not dead Not dead/Dead-Other cause not done None AA TURB r

K:061 73.2 F T1 G1 N+ MO None 1 ,295,228 G>A AG

H: 104 72.2 M T1 G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG TURB

S:057 64.6 M T1 G1 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA Chem therap

H:001 77.0 M T1 G2 None 1 ,295,228 G>A AA

D:003 74.0 F T1 G2 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AA Radio therap

D:010 80.4 F T1 G2 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AA Radio therap

H:016 72.6 F T1 G2 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,250 G>A AA TURB

H:068 81.9 F T1 G2 NX MO Dead Dead-Cancer None None AA TURB

H:089 83.5 M T1 G2 NX MO Dead Not dead/Dead-Other cause not done None AA TURB

H: 1 16 81.4 F T1 G2 NX MO Dead Dead-Cancer not done None GG Chemo radiother

K:024 62.7 F T1 G2 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA BCG

K:036 46.1 M T1 G2 NX MO Dead Dead-Cancer not done None AA TURB

K:104 71.4 F T1 G2 NX MO Dead Dead-Cancer None None AA Radio therap

K 166 62.3 M T1 G2 NO MO Not dead Not dead/Dead-Other cause None None AG Cystecto

K 172 71.8 M T1 G2 NX MO Dead Dead-Cancer None 1 ,295,228 G>A GG BCG

K 176 64.3 M T1 G2 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG Cystecto

K 179 61.5 M T1 G2 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA TURB

K 192 56.6 M T1 G2 NX MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A GG BCG

K 199 69.9 M T1 G2 NX MO Dead Dead-Cancer None 1 ,295,250 G>A AG Chem therap

K:203 62.9 M T1 G2 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AG Chem therap

L:006 72.3 M T1 G2 NX MO Not dead Not dead/Dead-Other cause None None AA TURB

SS:00 78.1 M T1 G2 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG BCG

4

S:006 74.4 M T1 G2 NO MO Dead Dead-Cancer not done 1 ,295,228 G>A AA BCG-

Cystecto

S:017 82.1 M T1 G2 NX MX Dead Not dead/Dead-Other cause None None AA Chem therap

S:020 66.3 M T1 G2 NX MO Dead Dead-Cancer None 1 ,295,250 G>A AA Chem therap

S:062 71.7 F T1 G2 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A GG TURB

S:143 90.3 F T1 G2 NX MO Dead Dead-Cancer None 1 ,295,228 G>A AG TURB

S:146 74.9 M T1 G2 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,250 G>A AG TURB

S:150 80.5 M T1 G2 NX MO Dead Dead-Cancer None 1 ,295,228 G>T AG TURB

S:190 82.3 F T1 G2 NX MO Dead Not dead/Dead-Other cause C- >T; exon 7; None GG TURB

R248W

H:002 79.6 M T1 G3 MO not done 1 ,295,250 G>A AA

D:006 71.9 M T1 G3 NX MO Dead Not dead/Dead-Other cause not done None AA BCG

D:015 71.5 M T1 G3 NO MO Dead Dead-Cancer not done 1 ,295,228 G>A AG BCG- Cystecto

D:042 74.6 M T1 G3 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AA BCG- Cystecto

D:084 69.3 F T1 G3 NX MO Dead Not dead/Dead-Other cause G- >T; exon 1 ,295,228 G>A AG BCG

5; C176F

H:028 66.9 M T1 G3 NX MO Dead Dead-Cancer not done None AA Cystecto

H:035 46.4 F T1 G3 NX MO Not dead Not dead/Dead-Other cause not done None AA BCG

H:043 83.2 F T1 G3 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AA Radio therap

H:055 74.9 M T1 G3 NX MO Not dead Not dead/Dead-Other cause None None AA BCG

1-1: 1 18 87.5 F T1 G3 NX MO Dead Not dead/Dead-Other cause not done None AA TURB

1-1: 123 51.4 M T1 G3 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG BCG

K:023 71.5 M T1 G3 NO MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA Cystecto

K:051 67.8 M T1 G3 NO MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG Chem therap

K:064 70.6 M T1 G3 NX MX Dead Dead-Cancer not done 1 ,295,250 G>A GG TURB

K:073 72.8 M T1 G3 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A GG Radio therap

K:1 1 1 65.0 M T1 G3 NX MO Dead Dead-Cancer C- >T; exon 7; 1 ,295,228 G>A AG Radio

R248W therap

L:004 61.9 M T1 G3 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG BCG- Cystecto

S:010 83.8 F T1 G3 NX MO Dead Dead-Cancer not done None AA Radio

therap

S:01 1 52.3 M T1 G3 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG BCG

S:065 59.8 M T1 G3 NO MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A GG Cystecto

S:069 68.6 M T1 G3 NO MO Dead Dead-Cancer None 1 ,295,250 G>A AA Chem therap Cystecto

S:139 93.1 M T1 G3 NX MX Dead Dead-Cancer C- >T; exon 6; 1 ,295,250 G>A AG TURB

Q192*

S:142 83.8 M T1 G3 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA BCG

S:149 73.6 M T1 G3 NX MO Dead Dead-Cancer None 1 ,295,228 G>A AA BCG

S:162 61.4 M T1 G3 NX MO Not dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA BCG

S:181 60.4 M T1 G3 NX MO Not dead Not dead/Dead-Other cause not done None AA BCG

D:058 70.5 F T2 G2 NO MO None None AG

D:045 78.5 M T2 G2 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA Radio therap

H:022 76.8 M T2 G2 NX MO Dead Dead-Cancer not done 1 ,295,250 G>A AG Radio therap

K:1 19 61.6 M T2 G2 NX MO Not dead Not dead/Dead-Other cause G- >C; exon None GG TURB

5; E171 Q

K:145 69.7 M T2 G2 NX MO Dead Dead-Cancer None 1 ,295,250 G>A AA Chem therap

S:079 82.8 M T2 G2 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AA TURB

K:208 66.4 M T2 G3 None 1 ,295,228 G>A AA

K:209 M T2 G3 None 1 ,295,228 G>A AG

D:012 82.7 M T2 G3 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AG Chem therap

D:018 68.9 F T2 G3 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AG BCG- Cystecto

D:029 79.1 F T2 G3 NX MO Dead Dead-Cancer not done 1 ,295,250 G>A AA Radio therap

D:031 73.0 M T2 G3 NO MO Dead Dead-Cancer None 1 ,295,228 G>A AA Chem therap

D:068 69.8 F T2 G3 N+ M+ Dead Dead-Cancer None None AA TURB

D:074 80.1 M T2 G3 NO MO Dead Dead-Cancer None None AA Cystecto

D:080 74.8 F T2 G3 N+ M+ Dead Dead-Cancer None None GG Radio therap

D:082 64.1 F T2 G3 NO MO Dead Not dead/Dead-Other cause None 1 ,295,250 G>A AA Cystecto

D:086 70.4 M T2 G3 NO MO Dead Not dead/Dead-Other cause None 1 ,295,228 G>A AA Chem therap

H:018 63.2 F T2 G3 NO MO Dead Dead-Cancer None 1 ,295,250 G>A AA Cystecto

1-1:019 85.2 F T2 G3 NO MO Dead Dead-Cancer not done None AG Chem therap

H:025 81.5 F T2 G3 NO MO Dead Not dead/Dead-Other cause None None AA Cystecto

H:026 68.1 M T2 G3 NX M+ Dead Dead-Cancer not done 1 ,295,250 G>A AG Chemo radiother

H:048 83.7 F T2 G3 NX MO Dead Not dead/Dead-Other cause G- >A; exon 1 ,295,228 G>A AA BCG

6; V197M

H:052 74.9 M T2 G3 NO MO Dead Dead-Cancer not done 1 ,295,228 G>A AG Chem therap Cystecto

1-1:061 75.1 M T2 G3 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AA Radio therap

H:064 83.6 F T2 G3 N+ M+ Dead Dead-Cancer not done None AA TURB

H:098 73.0 M T2 G3 NO MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A AA Cystecto

H: 107 51.4 F T2 G3 N+ MO Dead Dead-Cancer not done 1 ,295,228 G>A AA Chem therap

H: 122 48.1 F T2 G3 N+ MO Dead Dead-Cancer not done None GG Chem therap

1-1: 125 76.4 M T2 G3 N+ M+ Dead Dead-Cancer not done 1 ,295,228 G>A AA Radio therap

1-1: 133 80.0 F T2 G3 NX MO Dead Dead-Cancer not done None AG TURB

1-1: 135 83.1 F T2 G3 NX MO Dead Dead-Cancer not done None AA Radio therap

K:010 59.8 M T2 G3 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AA Chemo radiother

K:022 76.2 F T2 G3 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AA Radio therap

Κ:031 91.3 F Τ2 G3 NX M+ Dead Dead-Cancer not done 1 ,295,228 G>A AA TURB

Κ:032 65.3 F Τ2 G3 Ν+ MO Dead Dead-Cancer not done None AG Chem therap

Κ:044 70.8 Μ Τ2 G3 Ν+ MO Dead Dead-Cancer not done None AG Radio therap

Κ:048 70.7 Μ Τ2 G3 NO MO Dead Dead-Cancer C- >T; exon 5; None AA Chem

H179Y therap

Cystecto

Κ:087 52.6 Μ Τ2 G3 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AA Chemo radiother

Κ:090 88.4 Μ Τ2 G3 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AA TURB

Κ:098 81.7 Μ Τ2 G3 NX MO Dead Dead-Cancer None None AA TURB

Κ:100 74.1 F Τ2 G3 NX MO Dead Not dead/Dead-Other cause None None AG Radio therap

Κ:105 44.3 Μ Τ2 G3 NX MO Not dead Not dead/Dead-Other cause A- >G; exon None AG Cystecto

7; N247G

Κ:109 65.8 Μ Τ2 G3 N+ MO Dead Dead-Cancer None 1 ,295,228 G>A AG Chemo radiother

Κ:1 16 67.6 Μ Τ2 G3 NO MO Dead Dead-Cancer C- >T; exon 5; None GG Cystecto

P151 S

Κ:140 66.7 Μ Τ2 G3 NO MO Not dead Not dead/Dead-Other cause A- >G; exon 1 ,295,228 G>A AG Cystecto

5; H179R

Κ:146 71.8 Μ Τ2 G3 NO MO Dead Dead-Cancer None 1 ,295,228 G>A AA Cystecto

Κ:149 84.2 Μ Τ2 G3 NX MO Dead Dead-Cancer None 1 ,295,250 G>A AA TURB

Κ:160 70.4 Μ Τ2 G3 NO MO Dead Not dead/Dead-Other cause None None AA Chem therap Cystecto

Κ:163 80.6 Μ Τ2 G3 NX M+ Dead Dead-Cancer None None AG TURB

Κ:178 75.1 Μ Τ2 G3 NX MO Dead Dead-Cancer G- >A; exon 1 ,295,228 G>A GG Chemo

7; G245S radiother

Κ:182 73.1 F Τ2 G3 NX MO Dead Dead-Cancer None 1 ,295,228 G>A AA TURB

Κ:191 79.6 F Τ2 G3 NO MO Dead Dead-Cancer None 1 ,295,228 G>A AA Cystecto

K:195 74.3 F T2 G3 N+ M+ Dead Dead-Cancer None 1 ,295,228 G>A AG Radio therap

Κ:196 43.7 M T2 G3 NX MO Not dead Not dead/Dead-Other cause None 1 ,295,250 G>A AG Cystecto

Κ:201 64.6 F T2 G3 NO MO Not dead Not dead/Dead-Other cause None 1 ,295,250 G>A AG Cystecto

Κ:202 79.7 M T2 G3 NX MO Dead Dead-Cancer None 1 ,295,228 G>A GG Radio therap

SS:00 80.1 F T2 G3 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AG Radio

8 therap

S:003 94.2 F T2 G3 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AG Radio therap

S:016 73.2 F T2 G3 NX MO Dead Not dead/Dead-Other cause not done 1 ,295,228 G>A GG Radio therap

S:040 79.0 F T2 G3 NX MO Dead Not dead/Dead-Other cause not done None AA Radio therap

S:055 49.9 F T2 G3 NO MO Dead Dead-Cancer not done None AA Chem therap

S:068 79.8 M T2 G3 NX MO Dead Not dead/Dead-Other cause not done None GG TURB

S:081 62.2 M T2 G3 NO MO Dead Dead-Cancer not done 1 ,295,228 G>A AA Radio therap

S:128 81.5 F T2 G3 NX MO Dead Dead-Cancer None 1 ,295,228 G>A AA Radio therap

S:136 87.2 M T2 G3 NX MO Dead Dead-Cancer None None AG Radio therap

S:138 76.4 M T2 G3 NX MO Dead Dead-Cancer None 1 ,295,228 G>A AG Radio therap

S:152 70.7 M T2 G3 NO MO Dead Dead-Cancer None 1 ,295,228 G>A AA Chem therap

S:153 73.0 F T2 G3 NX MO Dead Dead-Cancer None 1 ,295,250 G>A AA Radio therap

S:158 81.4 F T2 G3 NX MX Dead Dead-Cancer None 1 ,295,228 G>A AA Radio therap

S:159 69.5 M T2 G3 NO MO Not dead Not dead/Dead-Other cause A- >G; exon 1 ,295,228 G>A AA Cystecto

7; N239D

S:161 71.9 M T2 G3 N+ MO Dead Dead-Cancer not done None GG Chem therap

S:163 87.1 M T2 G3 NX MO Dead Dead-Cancer None 1 ,295,228 G>A GG Radio

therap

S:167 60.9 F T2 G3 NO MO Dead Dead-Cancer None 1 ,295,228 G>A AG Chem therap Cystecto

S:174 83.8 M T2 G3 NX MO Dead Dead-Cancer G- >A; exon 1 ,295,228 G>A AA Radio

8; R273H therap

S:176 84.0 F T2 G3 NX M+ Dead Dead-Cancer not done 1 ,295,228 G>A AG Radio therap

S:179 96.0 F T2 G3 NX MO Dead Dead-Cancer None None AA TURB

S:182 85.0 M T2 G3 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AA Radio therap

S:184 79.4 M T2 G3 NX MO Dead Dead-Cancer not done 1 ,295,228 G>A AG Radio therap

S:187 60.0 M T2 G3 N+ M+ Dead Dead-Cancer not done 1 ,295,228 G>A GG TURB

S:140 71.5 F T2 GX N+ MO Not dead Not dead/Dead-Other cause None None AA Radio therap

D 100 81.0 M Ta G1 MX None 1 ,295,228 G>A AA Cystecto

H 008 74.8 M Ta G1 NX MO not done None AG TURB

K 102 81.9 M Ta G1 NX MO not done 1 ,295,228 G>A AA

K 194 73.9 M Ta G1 NX MO None 1 ,295,228 G>A GG TURB

K 205 M Ta G1 G- >A; exon 1 ,295,228 G>A AG

8; G266R

K:206 M Ta G1 None 1 ,295,228 G>A AG

D:062 75.3 F GX None None GG TURB D:067 F GX None 1 ,295,228 G>A AA

D:075 M GX None None AA

D:097 M GX None None AG

H:024 M GX not done None AG

H:027 M GX not done None GG

H:045 F GX not done None AG

H:059 M GX not done None AA

Table 13

All Non-carriers Carriers

N

95%

Patients No. dead HR ^* 95% CI No. dead HR ^* 95% CI o dead HR

CI

Men with age at

diagnosis >70y

Refere _{1 00} Referen Referen Without mutation 33 8 1.00 19 3 14 5 1.00

nee ce ce

0.74- 0.04-

With mutation 77 30 1.89 40 15 1 R7 °- ^32" 37 15 0.72

4.84 ⁸⁷ 1 1.06 1 1.58

Women with age at

diagnosis >70y

Refere _{1 00} Referen Referen Without mutation 26 11 1.00 17 7 9 4 1.00

nee ce ce

0.61- 0.22-

With mutation 37 17 1.47 19 12 3 54 ° ₁ - ₄ ⁸⁵ ₇ ^" ₁ 18 5 1.22

3.56 6.85

Men with age at

diagnosis <70y

Refere _{1 00} Referen Referen Without mutation 27 3 1.00 16 2 1 1 1 1.00

nee ce ce

0.02-

With mutation 50 10 0.23 25 6 - 25 4 - - 2.50

Women with age at

diagnosis <70y

Refere _{1 00} Referen Referen Without mutation 7 3 1.00 4 1 3 2 1.00

nee ce ce

With mutation 22 6 - - 10 4 - 12 2 1.00 -

Table 14

Patients Dead Alive/Censored

Treatment combination N N %

TURB 143 21 85.3

TURB+BCG 39 2 95.0

TURB+ Radiotherapy 36 31 13.9

TURB+Chemotherapy (±BCG) 29 12 58.6

TURB+Cystectomy 19 7 63.2

TURB+Chemotherapy+Cystectomy 7 5 28.6

TURB+Chemotherapy+Radiotherapy 6 6 0.0

TURB+BCG+Cystectomy 5 4 20.0

5 Table 15:

Chromos PCR

omal prod

Anneali PCR

? ^lr Primer name position Sequence 5"-3' uct

No. additives lengt ng

h

1,297,287- CTGGTACTGAATCCACTGTT 2499 5%

1 hTERT-Prom-F 58°C

1,297,313 TCATTTG bp DMSO

1,294,815- hTERT-Prom-R CTCTCCGCATGTCGCTGGTT

1,294,834

1,295,040 - 343 10%

2 hTert+65-F AGCACCTCGCGGTAGTGG 58°C

1,295,057 bp glycerol

1,295,365- hTert -278-R GGATTCGCGGGCACAGAC

1,295,382

Table 16

Table Ml Characteristics of patients with primary melanomas according to presence or absence of TEKT promoter mutations (n = 287}.

Characteristic «I TEMT TEST Odds ratio 95» Ci P-value patients promoter promoter

rihhype iniu.tat.ei

Toted 287 178 109

Gender

Male 141 81 60 1.00 fief

Female 146 37 49 o.&s 0.42 - 1.10 0.11

Age at diagnosis, years

< 45 70 48 22 1.00 fief

46 - 65 1.19 SO 39 1.06 0.56 - 2.00 0.S5

> 6.5 38 sa «S 2 10 1,10· - 3.98 0.02

Phototype"

5 - _Ί 3.

I S3 120 77 1 00 Ref.

3 J 111

I 75

J 53 31 0.91 0.54 - 1.54 0.73

3

Not stated 6 5 1

£vt colour

Dart 171 ioe 65 1.00 Ref.

Fair 110 67 4.3 1.0.5 0.64' -' 1.71 0.S6

Nat stated 6 5 1

Hair colour

Dart (black/brown) 22,5 141 84 1,00 fie

Red/blond 56 32 24 1.26 0.69 - 2.2.S 0 45

Not stated 6 5 1

Freckling (at chu naodj

Be 169 loo- 69 1.00 Ref.

Yes 06 56 30 0.78 0.4.5 - 1.3.3 0.36

Not stated 32 22 10

Cam-genital meiaao fUc nrvi

Bone present 235 144 91 J. CO Ref.

Present as 17 11 1.02 0.#S - 2..2S 0.95 fiat stated 17 7

Coamum mtkmxvtic nevus count

< BO 2,42 147 95 J.00 Ref.

> 50- 34 2.* 10 0 64 0.30' - .41 0.27

Not stated 11 7 4

Oiaicalif atypical metonocytic nev us

Bone present 23.2 141 91 l.OD Kef.

Present IS 14 4 0.44 0.14 - 1.39 0.15

Not stated 37 23 14

Presence of actmic keratosis

No 247 156 90 J.00 Ref.

Yes 14 16 138 0.92 - 4.2.5 0.08

Mot stated 10 8 .2

Presence of solar terttkjmes

Ho 34 24 10 1.00

Yes 233 143 96 1.61 0.74 - 1.5-2 0.23 fiat stattd 14 11 3

Presence- of spferr tentigittes of melanoma site

No 159 109 50 !.£» Ref.

Yes IIS 64 54 1.14 1.12 - 3.01 0.02 not stated IS 5 5

-Presence af MClM variant*

No 91 62 29 LCD P.ef. Yes 167 98 69 1.50 0.88 - 2.58 0.14

Not stated 29 IS 11

Past personal history of sunburns

Ho 136 S3 53 J. DO «'/

Yes 133 &6 53 0 98 0.60· - 1.5€ 0.92

Mat stated 12 3 9

St rtbarn at melanoma site

Ma 120 71 42 1.00

Yes 147 87 60 1.20 0.78 - 2.11 0.33

Not stated 20 13 7

Pattern of sun exposure at mekmc m m site

Rarely exposes! 52 42 10 J.00 «ef.

Infrequently exposed 155 118 77 2.74 1.3» - 5.7S 0.008

Usually exposed 35 17 IS 4 44 1.70 - 11.5 0.002

Mat stated 5 1 4

Outdoor mar

Bo 202 125 77 1.00 Ref.

Yes SO 48 32 1.08 0.64· - .84 0.77

Hat stated .5 5 0

Family hatory of melanoma

Ho 273 169 104 1.00 Ref

Yes 10 8 2 0 41 0.08 - 1.95 0.24

Not stated 4 1

Personal Mstetf of non-melanoma skin cant «·

Be 238 153 85 1.00 Ref.

Yes 43 25 24 1.73 0.93 - 3 21 o.os

P rsonal history mf other non- uta neov meo jsntaios

Ffc 253 158 1» 1.00 «*

Yes 28 19 9 0.75 0.33 - 1.72 0.49

Mot stated I .1 0

Location of primary mekmama

Acra l 42 38 4 1.00 fief

Trunk 121 72 49 6,47 2.17 - 19.17 o.oooe

H ead/neck 26 12 14 11.1 3.06 - 40.14 0.OOD2

Upper extremities ^~ 1 32 18 14

6.89 2.26 - 21.0 0.0007

Lower extremities J 56 33 23

Mucosa! 6 5 1

Primary unknown 3 0 3

Not stated I 0 1

Histological type'

ssfci ^" Ί 158 103 55 i.oo Ref.

mm J 76 34 42 2.31 1.3 - 4,0 0.O3

AIM 24 23 1

LMM IS 10 3

Other/unspecified Iff 8 8

Growth phase

Radial 39 33 6 J 00

Vertical 186 ioa 78 3.97 1.60 - 9.94 0.003

Not stated 62 37 25

Bresfow thickness, mm

< 2 00 160 112 48 1,00 Ref.

> 2 00 111 55 56 2.38 1.44 - 3.9Ϊ 0.0007

Not stated 16 1.1 5

Presence of ulceration

Bo 194 133 61 J.00 He/:

Yes 86 43 43 2.18 1.30 - 3.67 0.003

Not stated 7 2 J

T-ce i infiltration

Mo 115 73 -: ^.05 ¾ Non-brisk ^" [ 75 50 1.14

0.68 - 1.32 0 61 Brisk J s € 2

Not stated 41 26 15

Regression

No 227 146 Si 1.00 Re/.

Yes _* 21 13 1.63 0.83 - 3.21 0.15

Not stated 20 11 9

ComtigmoMS mewat remnants

No 215 136 79 1.00 Ref.

Yes 53 34 24 1.22 0.67 - 2.19 0.51

Hot stated 14 6

Presence of efatstmsis

No 162 107 55 1.00 «*

Yes 54 28 26 3..3S 0.57 - 3 38 0..S6.2

Not stated 71 4J 28

Stage

In situ ~Ί 12 11 1

1.09 ¾#:

Localized J 191 124 67

LDOoregiomal disease ~ ^* | 74 38 36

1.90 1.17 - 338 0.01 Distant metistasis J 4 1 3

Not stated 6 4 2

BMAf

WMd-type 183 128 55 1.00 Be/

Mutated 104 50 54 2.50 1.53 - 4.14 0.0003

NRAS

Wild-type 255 162 8 J. DC? Ref

Mutated 20 93 12 2.60 1.03 - 6.62

Not stated 11 4

Fitzpstri k. h ot oty i g; scsic

b Vmi; DSflf; ¥<32M; I142H R1SJCJI; 115 ST;: VIM; R1E0W_R; RlGHfc KMKJ rare v

c comprising <M CachNn and Saa »mou Carcinoma

-xposure

e Superficial Sprsading Mrhnc una; No Mei*f*om Mctnsnw bold font indicates sig n. tfica nee

Table 17

Table 18

Tablets f Multivariate analysis of TERT promoter mutations including various factors.

OR 95% CI Global

P-value

Age, years

£ 65 1.» ft?/.

> 65 1.57 1 03 - 3.79 0.04

Presence of safar fentigines at melanoma site

Mo 1.00 Rcf.

Yes 1.5B 0.81 - 3.06 0.2

SUM exposure

Rarely 1.00 Ref.

Infrequently exposed 3.01 1.07 - 8.46

0.05

Usually exposed 4.54 _ ? - - _i 2

Histological type'

S5M 1.00 ft?/.

LWtfct 0.38 3.08 - _ S

MM O.Sfi 0.38 - 1.96 0.04

AL 0.04 0.004 - 0.42

Bresla w z^. z 'i ess, mm

< 2.00 1.00 Ref.

> 2.00 233 1.24 - 6.43 0.01

Presence of ulceration

No 1.00 *«/

Yes 2.34 1.04 - 5.26 0.04

Stage

In situ + localized 1.00 ft?/.

Locoregional disease +

Q 0.42 - _ it 0.8 distant metastasis

BRAF

WHdtype 1.00 ft?/.

Mutation 2.35 1.27 - 4.33 O.0DS

• IMM, le-ifitig-o lMaligifiai Meliinania; S5M, Superficial Spreading Melan o "" : ' \ ^' ,' '.odular

Mrianatna -oral leintigiwus Melanema

able 20

33 mitt 68 FFPE wt wt wt -

34 male 56 FFPE wt wt wt -

35 male 43 fresh frozen tissue wt: wt wt Dei CDKN2A e;x»n3 - CDKN2B «xon2

3€ female 53 FFPE wt ^• mi - -

37 male 67 FFPE -1460T wt wt -

38 ale 50 FFPE -1560T t wt -

39 ale 54 fresh frozen tissye; wt V6QOE wt wt

W female 74 fresh frozen tissue wt wt wt wt

♦1 female 78 FFPE t w wt -

42 female 40 FFPE t t wt -

43 female 59 FFPE wt: V600E wt -

44 female 51 FFPE wt V600-E art

45 ale 56 fresh frozen tissue -1460T wt Q61K Del CDKN2A eienS - CDKN2A l6*"* promoter

46 ale 31 fresh frozen tissye wt wt wt c.30iT>e; JJ..S101W

47 female 56 fresh frozen tissue -i3S_133CCrr ¥600 E wt e.2056 T; p..E§3*

48 female 65 fresh frozen tissue wt wt wt wt

49 female 67 FFPE wt wt Q61R -

50 male 55 FFPE -I460T; -I560T V60CE wt -

51 male 50 FFPE wt wt wt -

52 male 63 FFPE wt wt wt -

53 male 45 FFPE wt t wt -

54 m ate 54 fresh frozen tissue wt t wt t

55 ale 75 fresh frozen tissye wt wt wt wt

56 maie 57 fresh frozen tissue -1460T wt Q6 U Metication pis""* promoter:237nt 44W; 171nt 42*

57 female 45 FFPE wt V6TJOE wt -

58 female 51 fresh frozen tissue -1240T V6C»E wt wt

59 female 67 fresh frozen tissue -1240T V600E wt wt

60 male 55 fresh frozen tissue wt t wt t

61 female 59 FFPE wt wt wt -

62 m ale 72 FFPE wt t - -

63 female 76 FFPE wt wt wt -

64 female 76 FFPE t wt wt -

Del CDKN2Ae«m2/

65 ft mil* 52 fresh frozen tissye -124&T pie""** promoter - downstream

V600E (TG>AA) wt

CDKN2B {23*1 fit)

6€ male 44 fresh frozen tissue -1460T V600K (homo) t wt

67 male 39 fresh frozen tissue wt t wt wt

63 female 67 FFPE wt wt wt -

63 female 42 fresh frozen tissue wt V600E wt wt

70 female 66 fresh frozen tissye wt V6CBE wt wt

Met vlatkm plGlNK4A promoter: 237nt 33», 171nt 3SW

71 female 82 fresh frozen tissye -1460T; -89_90GOTT wt wt

and c.24S_249AOCT

72 female 52 fresh frozen tissye wt t wt wt

73 female 53 FFPE -I4&OT; -1560T t Qfiii -

74 female 80 FFPE -1240T wt Q61R -

75 male 72 fresh frozen tissue -1240T; -1260T wt wt c2626>T; p.E8S*

76 male 64 FFPE wt wt wt -

77 female 31 FFPE wt wt - -

78 female 73 FFPE wt wt wt -

79 female 60 fresh frozen tissue -1240T V600E t wt

SO female 54 fresh frozen tissye -1460T V600E wt wt

81 female 66 FFPE -1870T wt G12.D -

82 female 31 FFPE -1460T wt wt -

SB female 35 FFPE t mrt wt -

84 male 52 FFPE -14SOT wt wt -

SS ale 32 FFPE t wt wt -

86 fema le 67 FFPE wt w wt -

87 mafe 67 fresh frozen tiss e -1460T V6Q0E wt wt

SS fema le 55 FFPE wt wt - -

89 female 70 fresh frozen tissue -1460T wt Q61R t

90 fema le 70 fresh frozen tissue wt V6O0E wt wt:

91 male 66 fresh frozen tissye -1460T V600-E wt wt

92 ate 46 FFP ^' E wt ¥600 E wt -

93 female 78 fresh frozen tissue -2420T wt wt wt

94 f ma le 51 FFPE wt wt wt -

95 male 59 FFPE wt wt wt -

96 ale 66 fresh frozen tissue wt wt wt wt

97 male 85 fresh frozen tissue -1240T V600E wt wt

98 ale 62 fresh frozen tissye wt VG00E wt wt

99 female 44 FFPE wt wt Q61R -

100 ale 68 fresh frozen tissue wt wt wt wt

101 female 73 FFPE -1440T wt wt -

102 male 72 fresh frozen tissye -1460T _ V6O0IC{GT>AA) wt wt

103 malt 59 FFPE wt ¥600 E wt

104 f ema le Si fresh frozen tissue wt wt wt wt:

105 female 45 fresh frozen tissue wt V600E wt

ioe ftmi le 39 FFPE -1460T V60UE wt

107 male 56 FFPE wt wt wt

MB female 64 FFPE wt wt wt

109 female 60 FFPE wt wt ml

110 female 41 FFPE wt V600E wt

Del CDKN2A exraii - CDKN2B exonl/plB promoter

111 female 52 fresh frozen tissue -1460T wt wt

[methylation pl6*"** promoter; 237nt 25%]

112 'male as fresh frozen tissue wt wt Q61R Del CDKH2A ex:en3 - CDKN2B exoril/pl5 promoter

113 male 64 FFPE -1 60T veooE wt

114 female 48 FFPE wt wt Q61R

US ■m ale 28 fresh frozen ttssue wt wt wt

116 male 42 FFPE -1240-T; -l05_i06COTT wt t

117 f etna le 48 FFPE -1460T wt Q61R

118 ^■ male 76 fresh frozen tissue wt wt wt

119 female 90 FFPE -1460T wt Q61K

120· fwna e S3 fresh frozen tissue t wt wt wt

12 i male 49 FFPE wt wt wt

122 female 79 FFPE wt wt

123 male 73 FFPE wt wt wt

124 female 45 fresh frozen tissue wt V60QE wt

125 male 49 FFPE wt wt wt

126 ^■ m ale 63 fresh frozen tissue wt V60OE wt t

127 m ale 72 fresh frozen tissue wt wt wt wt

128 f ema le 80 fresh frozen tissue wt V60DE wt Del MTAP exon6 - GDKW2E! exonl/pl5 promoter

129 male 50 fresh frozen tissue -13S_t39CC>TT V60OE wt wt

130 female 76 fresh frozen tissue wt wt wt

131 f ema le 65 fresh frozen tissue wt V600E wt wt

132 ale S3 FFPE wt ViODK wt

133 female 89 FFPE wt t wt

134 female 87 fresh frozen tissue wt ¥§£»E wt wt

135 f ema le 67 fresh frozen tissue -1460T wt t wt

136 female 72 FFPE -1240T wt wt

137 im ale 55 FFPE wt wt wt

138 female 72 fresh frozen tissue wt wt wt

133 maie 48 FFPE wt wt t

140 mate 75 FFPE -1240T t wt

141 maie 49 fresh frozen tissue -1460T V6O0E mt DeS CDKN2A exon3 - CDKN2B eiconl/piS promoter

142 fema le 69 FFPE wt V600E wt

143 maie 47 FFPE wt V600E wt

144 female 59 FFPE wt ¥600 E

145 maie 69 FF E wt wt

146 female 32 FFPE -1460T ¥600 E

147 female 64 fresh frozen tissye wt wt

MS female 57 FFPE t wt t

149 male 64 FFPE -I24_125CC>TT; -1260T t wt

150 male- 43 FFPE wt wt wt

151 female 69 FFPE -1460T V600E wt

152 female S5 FF E wt wt wt

153 female 34 FFPE wt wt Q61R

154 maie 39 FFPE -138_139CC>TT wt wt

155 male 53 FFFE wt V600E wt

156 maie 7S FFPE -1460T t wt

157 female 68 FFPE wt t wt

158 male 40 FFFE t V6O0E wt

159 female 38 FFPE wt wt wt

ISO male 38 F PE wt wt wt

161 female 79 FFPE -1240T wt t

162 maie 46 FFPE -1240T; -910T wt wt

163 maie 66 FFPE wt t wt

164 male 62 FFPE wt ¥6£»E wt

165 female 76 FFPE -57A>£ wt

166 male 48 FFPE -1460T wt wt

167 ale- 64 FFPE -57A>C; -1250T wt wt

168 female 44 F PE -46C>T wt wt

169 female 50 FFPE -1460T; -1490T ¥600 E wt

170 f em a le 70 FFPE wt t

171 male 65 FFPE wt V600E wt

172 female 67 FFPE wt VG0OE t

173 male 29 FFFE wt wt

ϊ ϊ ϊ ϊ ϊ ϊ ϊ ϊ ί ϊ ϊ ϊ ΐ ϊ ί ΐ ϊ ϊ ϊ ϊ ϊ ί ϊ ί ϊ ϊ ϊ ϊ ϊ ϊ ΐ ϊ ϊ ϊ ϊ ϊ

x

111 : : 1 : ιι ii | 1 f : \ : | : : : : : : : | n\ 210 female 52 FFPE wt t wt

211 mate 60 FFPE wt wt wt -

212 mile 58 FFPE t wt wt -

213 male 57 FFPE -1240T V60OE t -

214 male S4 FFPE -1460T wt wt -

215 female S3 fresh frozen tissue wt V60OE mt t

216 female 56 FFPE wt wt Wit -

217 male SO FFPE wt wt t -

21S male 7S FFPE -1460T; -1490T V&QOK wt -

219 male 66 FFPE -1240T V600E wt -

220 female 31 FFPE wt wt wt -

221 ale to FFPE -1460T V60OE wt -

2.22 female 23 FFPE wt V60OE wt -

223 female 77 FFPE wt. wt wt -

224 ale S3 FFPE -1240T wt mt -

225 female 7.3 FFPE -1460T; -1430T V6G0E wt -

226 male 27 FFPE t wt wt -

227 male 81 FF E -1240T wt wt -

228 ale 77 FFPE -1460T wt Q61R -

229 female 53 FFPE wt wt wt -

230 ale §5 FFPE wt wt wt

23 i female 41 FFPE wt mt wt -

232 female 73 FFPE wt ¥600 E wt -

233 female 31 FFPE wt V600E t -

234 male 29 FFPE t wt t -

235 ale 10 FFPE wt V600E wt -

236 male 41 FFPE -1240T V600E wt -

237 female 42 FFPE wt V6O0E wt -

238 female 55 FFPE -1460T ¥600 E wt -

239 female 48 FFPE wt ¥600 E wt -

240 female 41 FFPE wt wt wt -

241 male IS FFPE -1240T t wt -

242 male 71 FFPE -1240T wt wt -

243 female 51 FFPE -1460T V6O0K wt -

2.44 female 52 FFPE wt w wt -

245 male 46 FFPE wt wt 0.61R -

Table 21

Table 21 PCB conditions and primer sequences.

Mgf¾ cancentration Siie

Seine Prieier sequence

and additives temperature

BRAF: exaa 15

forward 5 'CCTAAACTCTTC ATA ATGCTT3 '

2..S m MfCli 209 B2*C; 40* reverse 5'ATAQCCrCAATTCTTACCAT3 ^r

CDKN2A: exonl

forward 2mM MgCl _j ; 5"CGGCTGCGGAGAGGGGGAGAG3' 57*C, 3x;

246

reverse 5»D SO 5'CGATGGC6GGC6ACTCTGGAG3' 56'C, 27x

CDKN2A: emn.2

forward B TTGSAAGCTCTCAGeGTACAE'

2m MECIJ 425 52*C, 35s: rewerse^ .5 'GGGCTCTACACAAGCTTCCTT3 '

CDKN2A: exon2

forward 2mM MgC½ 5 'ATGCC6GTAGGGAC6GCAA63 '

208 5S*C, 5x reverse 7 Glycerol 5*AAAGCGGGGTGGGTTGTGGC3'

NBAS: exon 2

forward S'CGCCAATTAACCCTGATTACT 56*C, 3κ;

2mM ECI. 174

reverse 5'CACT6SGOCT€ACCTCTA3' S5'C, 32K

NMAS: exon3

forward 5"CCCCTTACCCTCCACAC3' 55 'C, 3K;

2m MeCli 196

reverse S'A6GTTAATATCCGCAAATGAC3' 54 ^* C, 3Zx

TERT promoter:

-27 til -286

forward 5tCCACGTGCGCAGCAGGAC3 '

260 60'C * reverse 5» Slfcerol 5'CT1CCCASTGGATTCGCGGGC3'

B 35» if DMA from if tissue; 45x if FFPE