HADIDA RUAH SARA SABINA (US)
NISHIMURA TAMIKI (JP)
NAKATSUKA MASASHI (JP)
SAMIZO FUMIO (JP)
KAMIKAWA YUMIKO (JP)
HOUTIGAI HITOSHI (JP)
SCARLATO GERARD ROBERT (US)
HADIDA RUAH SARA SABINA (US)
NISHIMURA TAMIKI (JP)
NAKATSUKA MASASHI (JP)
SAMIZO FUMIO (JP)
KAMIKAWA YUMIKO (JP)
HOUTIGAI HITOSHI (JP)
| WO1996020936A1 | 1996-07-11 | |||
| WO1996033176A1 | 1996-10-24 |
| DE19542189A1 | 1997-05-15 | |||
| EP0606046A1 | 1994-07-13 | |||
| FR2434150A1 | 1980-03-21 |
| 1. | A hydroxamic acid derivative represented by the formula [1] or a prodrug thereof, or a pharmaceutically acceptable salt thereof: wherein X is C1C2 alkylene which is substituted by optionally substituted alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl or optionally substituted heteroaryl ; optionally substituted orthoarylene; or optionally substituted orthoheteroarylene; yl isO,S,S (O)orS (0) 2; Y2 is 0, or S; One of R3is(CHR4)n(CR5R6)CONHOH;and The other of R1 and R3 is hydrogen, optionally substituted alkyl, or optionally substituted cycloalkyl; R2 is hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl; or R2 and R3 may be taken together to be optionally substituted ClClo alkylidene; R4, R and R6 are independently hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, optionally substituted alkylthio, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, or optionally substituted heteraryl; or R5 may be joined with R4 or R6 to form, with the carbon atom which they attach, optionally substituted cycloalkane or optionally substituted heterocycloalkane; n is an integer of 0 to 4; provided that when R2 and R3 are taken together to be optionally substituted ClClo alkylidene, X is not methylene substituted by a phenyl or a pyridyl wherein the phenyl and the pyridyl are optionally substituted by methyl or methoxy. |
| 2. | A hydroxamic acid derivative according to claim 1 or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein X is C1C2 alkylene substituted byZAr; optionally substituted orthoarylene; or optionally substituted orthoheteroarylene ; Z is single bond or alkylene; Ar is optionally substituted aryl or optionally substituted heteroaryl. |
| 3. | A hydroxamic acid derivative according to claim 1 or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein X is one of the groups represented by the formulae: Arl is optionally substituted aryl or optionally substituted heteroaryl; A1 is orthophenylene or monocyclic orthoheteroarylene; R8 and R9 are independently hydrogen or substituent. |
| 4. | A hydroxamic acid derivative according to any one of claim 13 or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein Y1 isS,S (O) or S (0) 2. |
| 5. | A hydroxamic acid derivative according to any one of claim 14 or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein n is 0,1 or 2. |
| 6. | A hydroxamic acid derivative according to any one of claim 15 or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein n is 0. |
| 7. | A hydroxamic acid derivative according to claim 1 represented by the formula [2] or a prodrug thereof, or a pharmaceutically acceptable salt thereof: wherein R5Y2,R4, and R6 are as defined in claim 1; Ar2 is optionally substituted phenyl; optionally substituted naphthyl; or optionally substituted mono or bicyclic heteroaryl; Y3 isS,S (O)orS (0) 2; R10 and R11 are independently hydrogen or optionally substituted alkyl; nl is an integer of 0,1 or 2. |
| 8. | A hydroxamic acid derivative according to claim 7 or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein nl is 0. |
| 9. | A hydroxamic acid derivative according to claim 1 represented by the formula [3] or a prodrug thereof, or a pharmaceutically acceptable salt thereof: wherein y2 R4, R and R are as defined in claim 1; A1, R8, and R9 are defined in claim 3; R12 and R13 are independently hydrogen or optionally substituted alkyl; Y3 isS, S(O)2;or n2 is an integer of 0,1 or 2. |
| 10. | A hydroxamic acid derivative according to claim 1 represented by the formula [3*] or a prodrug thereof, or a pharmaceutically acceptable salt thereof: wherein Y2, R4, R5 and R are as defined in claim 1; A1 is defined in claim 3 ; Y3, n2, R12 and R are defined in claim 9; R14 is hydrogen or substituent; R15 is substituent. |
| 11. | A hydroxamic acid derivative according to claim 9 10 or a prodrug thereof, or a pharmaceutically acceptable salt thereof ; wherein n2 is 0, and R12 and R13 are independently hydrogen or substituted alkyl. |
| 12. | A hydroxamic acid derivative according to any one of claim 111 or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein O.is. |
| 13. | A pharmaceutical composition containing a hydroxamic acid derivative according to any one of claims 112 or a prodrug thereof, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or diluent. |
| 14. | A method of inhibiting matrix metalloproteinases which comprises treating the matrix metalloproteinases with a hydroxamic acid derivative according to any one of claims 112 or a prodrug thereof, or a pharmaceutically acceptable salt thereof. |
| 15. | A method of inhibiting matrix metalloproteinases according to claim 14, wherein the matrix metallo proteinases are matrix metalloproteinase 3 and/or 13. |
| 16. | A method of treating a disease associated with excess or undesired matrix metalloproteinases which comprises administering an effective amount of a hydroxamic acid derivative according to any one of claims 112 or a prodrug thereof, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or diluent. |
| 17. | A method of treating a disease associated with excess or undesired matrix metalloproteinases according to claim 16, wherein the matrix metalloproteinases are matrix metalloproteinase 3 and/or 13. |
| 18. | Use of a hydroxamic acid derivative according to any one of claims 112 or a prodrug thereof, or a pharmaceutically acceptable salt thereof, in the preparation of a medicament for treating a disease associated with excess or undesired matrix metallo proteinases. |
HYDROXAMIC ACID DERIVATIVE Technical Field The present invention relates to hydroxamic acid derivatives useful as matrix metallo-proteinase inhibitors.
Background Art Extra cellular matrix, composition of connective tissue, is metabolized by a family of proteinases termed matrix metallo-proteinases. It is known that there exist 16 kinds of matrix metallo-proteinases such as collagenase (matrix metallo-proteinase-1: MMP-1), gelatinase A (matrix metallo- proteinase-2: MMP-2), stromelysin (metallo-proteinase-3: MMP-3), gelatinase B (matrix metallo-proteinase-9: MMP-9) and collagenase-3 (matrix metallo-proteinase-13: MMP-13).
Extra cellular matrix is under tight control by the expression and secretion of these matrix metallo- proteinases or endogenous inhibitors such as tissue inhibitor of matrix metallo-proteinases in normal. There are many reports about relationships between diseases characterized by excessive tissue disruption and elevated activities of matrix metallo-proteinases derived form the breakdown of these control.
Elevated levels of matrix metallo-proteinases,
particularly collagenase and stromelysin, have been detected in joints of osteoarthritic humans or that of rheumatoid arthritis (Arthr. Rheum., 33,388-97 (1990); S. M.
Krane et. al.,"Modulation of matrix synthesis and in The Control of degradation in joint inflammation, The Control of Tissue Damage", A. B. Glauert (ed.), Elsevier Sci. Publ., Amsterdam, 1988, Ch. 14, pp 179-95; Clin. Chim. Acta, 185, 73-80 (1989); Arthr. Rheum., 27,305-312 (1984) ; J. Clin. Invest., 84,678-685 (1989)).
Secreted proteinases such as stromelysin, collagenase and gelatinase play an important role in processes involved in the movement of cells during metastatic tumor invasion.
Indeed, there is also evidence that the matrix metallo- proteinases are overexpressed in certain metastatic tumor cell line. In this context, the enzyme functions to penetrate underlying basement membranes and allow the tumor cell to escape from the site of primary tumor formation and enter circulation (FEBS J., 5,2145-2154 (1991); Trends Genet., 6,121-125 (1990); Cancer Res., 46,1-7 (1986); Cell, 64,327-336 (1990); Cancer and Metastasis Rev., 9,305- 319 (1990)).
Both collagenase and stromelysin activities are observed in fibroblasts isolated from inflamed gingiva (J.
Periodontal Res., 16,417-424 (1981)). Enzyme levels have been correlated to the severity of gum disease (J.
Periodontal Res., 22,81-88 (1987)).
Collagenase-3 (matrix metalloproteinase-13: MMP-13) is
expressed in synovia of rheumatoid arthritis and chondrocyte of human osteoarthritis (J. Clin. Invest., 97, 2011-2019 (1996); J. Rheumatol., 23,509-595 (1996); J. Biol. Chem., 271,23577-23581 (1996); J. Clin. Invest., 97, 761-768 (1996)). MMP-13 has a strong enzyme activity against type II collagen and aggrecan. Thus, it is suggested that MMP-13 plays an important role in osteoarthritis and rheumatoid arthritis (J. Biol. Chem., 271,1544-1550 (1996) ; FEBS Lett., 380,17-20 (1996)). Therefore, inhibitors to matrix metallo-proteinase are useful as therapeutic agents or prophylactic drugs for joint diseases such as osteoarthritis, rheumatoid arthritis, metastasis of tumor cell and gingivitis.
Matrix metallo-proteinases are also concerned with conversion from the latent form of tumor necrosis factor-a to the mature form (Nature, 370,555-557 (1994)), degradation of a 1-antitrypsin (FEBS Lett., 279,191- 194 (1991)) and processing of other matrix metallo- proteinases (Biochemistry, 29,10261-10670 (1990); J. Biol. Chem., 267,21712-21719 (1992)). Therefore, inhibitors to matrix metalloproteinase are useful as anti- inflammatory agents.
WO 96/20936 disclose novel thiazolidin-4-one derivatives which inhibit platelet-activating factor and/or 5-lipoxygenase. But, it does not disclose the compounds can inhibit matrix metallo-proteinases.
Description of the invention The present invention is intended to provide novel compounds useful as matrix metallo-proteinase inhibitors.
The present inventors have earnestly examined and found that hydroxamic acid derivatives have excellent inhibition activity against matrix metallo-proteinases such as MMP-3, MMP-13 and the like. Thus, the present invention has been accomplished.
That is, the present invention is as follows: (1) A hydroxamic acid derivative represented by the formula [1] or a prodrug thereof, or a pharmaceutically acceptable salt thereof: wherein X is C1-C2 alkylene which is substituted by optionally substituted alkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl or optionally substituted heteroaryl; optionally substituted ortho-arylene; or optionally substituted ortho-heteroarylene; il is-O-,-S-,-S (O)-or-S (O) 2-; y2 is O, or S; One of R1 and R3 is- (CHR4) n- (CR5R6)-CO-NHOH;
The other of R1 and R3 is hydrogen, potionally substituted alkyl, or optionally substituted cycloalkyl; R2 is hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted cycloalkyl, or optionally substituted hetero-cycloalkyl; or R2 and R3 may be taken together to be optionally substituted Cl-Cl0 alkylidene; R4, R5 and R6 are independently hydrogen, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, optionally substituted alkylthio, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, or optionally substituted heteraryl; or R may be joined with R4 or R6 to form, with the carbon atom which they attach, optionally substituted cycloalkane or optionally substituted heterocycloalkane; n is an integer of 0 to 4; provided that when R2 and R3 are taken together to be optionally substituted Cl-Cl0 alkylidene, X is not methylene substituted by a phenyl or a pyridyl wherein the phenyl and the pyridyl are optionally substituted by methyl or methoxy.
(2) A hydroxamic acid derivative according to (1) or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein X is C1-C2 alkylene substituted by-Z-Ar; optionally
substituted ortho-arylene; or optionally substituted ortho-heteroarylene; Z is single bond or alkylene; Ar is optionally substituted aryl or optionally substituted heteroaryl.
(3) A hydroxamic acid derivative according to (1) or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein X is one of the groups represented by the formulae: Arl is optionally substituted aryl or optionally substituted heteroaryl; A1 is ortho-phenylene or monocyclic ortho-heteroarylene; R8 and R9 are independently hydrogen or substituent.
(4) A hydroxamic acid derivative according to any one of (1)- (3) or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein Y1 is-S-,-S (O)- or- S (0) 2-.
(5) A hydroxamic acid derivative according to any one of (1)- (4) or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein n is 0,1 or 2.
(6) A hydroxamic acid derivative according to any one of (1)- (5) or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein n is 0.
(7) A hydroxamic acid derivative according to (1) represented by the formula [2] or a prodrug thereof, or a pharmaceutically acceptable salt thereof: wherein y f R, R and R6 are as defined in (1) ; Ar2 is optionally substituted phenyl; optionally substituted naphthyl; or optionally substituted mono or bicyclic heteroaryl; Y3 is-S-,-S (O)-or-S (O) 2-; R10 and R11 are independently hydrogen or optionally substituted alkyl; nl is an integer of 0,1 or 2.
(8) A hydroxamic acid derivative according to (7) or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein nl is 0.
(9) A hydroxamic acid derivative according to (1) represented by the formula [3] or a prodrug thereof, or a pharmaceutically acceptable salt thereof: wherein y2, R4, R5 and R6 are as defined in (1); A1, R8, and R9 are defined in (3); R12 areindependentlyhydrogenoroptionallyR13 substituted alkyl; -S-,-S(O)-or-S(O)2-;Y3is n2 is an integer of 0,1 or 2.
(10) A hydroxamic acid derivative according to (1) represented by the formula [3'] or a prodrug thereof, or a pharmaceutically acceptable salt thereof:
wherein y R, R5 and R are as defined in (1); A1 is defined in (3) ; Y3, n2, R12 and R13 are defined in (9); hydrogenorsubstituent;R14is substituentR15is (11) A hydroxamic acid derivative according to (9)- (10) or a prodrug thereof, or a pharmaceutically acceptable salt thereof; wherein n2 is 0, and R12 and R13 are independently hydrogen or substituted alkyl group.
(12) A hydroxamic acid derivative according to any one of claim 1-11 or a prodrug thereof, or a pharmaceutically acceptable salt thereof, wherein Y is-0-.
(13) A pharmaceutical composition containing a hydroxamic acid derivative according to any one of (1)- (12) or a prodrug thereof, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or
diluent.
(14) A method of inhibiting matrix metallo-proteinases which comprises treating the matrix metallo-proteinases with a hydroxamic acid derivative according to any one of (1)- (12) or a prodrug thereof, or a pharmaceutically acceptable salt thereof.
(15) A method of inhibiting matrix metallo-proteinases according to (14), wherein the matrix metallo-proteinases are matrix metallo-proteinase 3 and/or 13.
(16) A method of treating a disease associated with excess or undesired matrix metallo-proteinases which comprises administering an effective amount of a hydroxamic acid derivative according to any one of (1)- (12) or a prodrug thereof, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or diluent.
(17) A method of treating a disease associated with excess or undesired matrix metallo-proteinases according to (16), wherein the matrix metallo-proteinases are matrix metallo-proteinase 3 and/or 13.
(18) Use of a hydroxamic acid derivative according to any one of (1)- (12) or a prodrug thereof, or a
pharmaceutically acceptable salt thereof, in the preparation of a medicament for treating a disease associated with excess or undesired matrix metallo- proteinases.
"Ortho-arylene"includes C6-Clo ortAo-arylene. Typical examples are ortho-phenylene, 1,2-naphthalenediyl, 2,3- naphthalenediyl and the like. Preferable is ortho-phenylene.
"Ortho-heteroarylene"includes mono or bicyclic 5-or 6-membered ortho-heteroarylene containing 1 to 3 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms. Mono or bicyclic 5-membered ortho- heteroarylene includes, for example, monocyclic 5-membered ortho-heteroarylene containing 1 to 3 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms such as pyrrol-2,3-diyl, pyrrol-3,4-diyl, thiophen- 2, 3-diyl, thiophen-3,4-diyl, furan-2,3-diyl, imidazol-4,5- diyl, pyrazol-3,4-diyl, thiazol-2, 3-diyl, oxazole-2,3-diyl, isothiazol-3,4-diyl, isoxazol-3,4-diyl and the like; bicyclic 5-membered ortho-heteroarylene containing 1 or 2 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms such as indol-2,3-diyl, benzofuran- diyl, benzothiophendiyl and the like; and the like. Mono or bicyclic 6-membered ortho-heteroarylene includes, for example, monocyclic 6-membered ortho-heteroarylene containing 1 to 3 nitrogen atoms such as pyridin-2,3-diyl,
pyridin-3,4-diyl, pyrazin-2,3-diyl, pyrimidin-4,5-diyl, pyridazin-3,4-diyl and the like; bicyclic 6-membered ortho- heteroarylene containing 1 to 3 nitrogen atoms such as quinolin-2,3-diyl, isoquinolin-3,4-diyl, naphthyridin-3,4- diyl, quinoxalin-2,3-diyl and the like; and the like.
Preferable ortho-heteroarylene is monocyclic 5, or 6- membered ortho-heteroarylene.
"Aryl"includes C6-C10 aryl. Typical examples are phenyl, 1-naphthyl, 2-naphthyl and the like.
"Heteroaryl"includes, for example, mono or bicyclic 5- or 6-membered heteroaryl containing 1 to 5 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms, and the like. Mono or bicyclic 5-membered heteroaryl includes, for example, monocyclic 5-membered heteroaryl containing 1 to 5 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms such as pyrrolyl, thienyl, furyl, imidazolyl, pyrazolyl, isothiazolyl, isoxazolyl, furazanyl, oxazolyl, thiazolyl, triazolyl, tetrazolyl, and the like; bicyclic 5-membered heteroaryl containing 1 to 5 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms such as indolyl, isoindolyl, benzofuryl, benzothienyl, thieno [2,3- b] thienyl and the like; and the like. Mono or bicyclic 6- membered heteroaryl includes, for example, monocyclic 6- membered heteroaryl containing 1 to 5 nitrogen atoms such as pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, triazinyl and the like; bicyclic 6-membered heteroaryl containing 1
to 5 nitrogen atoms such as quinolyl, phthalazinyl, isoquinolyl, naphthyridinyl, quinoxalinyl and the like; and the like.
"Substituent"of the substituted aryl, the substituted heteroaryl, the substituted ortho-arylene and substituted ortho-heteroarylene, and"substituent"of R, R, and R includes, for example, the following groups: halogen; alkyl; alkenyl; alkynyl; halogenated alkyl;-Z1- Ar3;-Z1-N(Q2)Ar3;-Z1-N(Q2)Cy1;-Z1--Z1-N(Q2)Q1; -Z1-NQ4-NQ4-C(NQ3)N(Q2)Q1;-N1-NQ4-C(NQ3)N(Q2)Ar3; -Z1-NQ3-CON(Q2)Ar3;-Z1-C(NQ3)N(Q2)Cy1;-Z1-NQ3-CON(Q2)Q1; -Z1-NQ2-COOAr3;-Z1-NQ2-NQ3-CON(Q2)Cy1;-Z1-NQ2-COOQ1; -Z1-OCON(Q2)Ar3;-Z1-OCON(Q2)Cy1;-COOCy1;-Z1-OCON(Q1)Q2; -Z1-OCOONy1;-Z1-NQ2-COQ1;-Z1-NQ2-Z1-OCOOQ1;-Z1-OCOOAr3; -Z1-NQ2-SOQ1;-Z1-NQ2-SOAr3;-Z1-NQ2-COAr3;-Z1-NQ2-COCy1; -Z1-NQ2-SO2Ar3;-Z1-NQ2-SO2Cy1;-Z1-SOCy1;-Z1-NQ2-SO2Q1; -Z1-O-Cy1;-Z1-OCOQ1;-Z1-OCOAr3;-Z1-OQ1;-Z1-OAr3; OCOCy1;-Z1-COOQl;-Zl-COOAr3;-Z1-COOCyl ;-Z1-CON (Ql) Q2 ;- Z-CON (Q2) Ar3 ; -Z1-CON(Q2)Cy1; -Z1-CON(Q2)OQ1; -Z1- CON (Q2) OAr ; -Z1-CON(Q2)OCy1; -Z1-COQ1; -Z1-COAr3; -Z1-CO- -C(NQ3)N(Q2)Ar3;-Z1-Cy1;-Z1-C(NQ3)N(Q1)Q2; -Z1-SAr3;-Z1-S-Cy1;-Z1-SOQ1;-C(NQ3)N(Q2)Cy1;-Z1-SQ1; -Z1-SO2O1;-Z1-SO2Ar3;-Z1-SO2Cy1;-Z1-Z1-SOAr3;-Z1-SOCy1; SON(Q1)Q2;-Z1-SON(Q)2Ar3;-Z1-SON(Q2)Cy1;-Z1-SO2N(Q1)Q2; -Z1-SO3H;-Z1-OSO3H;-Z1--Z1-SO2N(O2)Ar3;-Z1-SO2N(O2)Cy1; -CHO;NO2;-Z1-CN;
wherein Z1 is single bond, alkylene, alkenylene or alkynylene ; Q1 Q Q3, Q4 are independently hydrogen, alkyl, alkenyl, alkynyl, wherein the alkyl, the alkenyl and the alkynyl are optionally substituted by one or more groups selected from the following groups: -Cy2;-N(R21)R22;-N(R22)Ar4;-halogen;-Ar4; -NR24-N(R22)Cy2;-NR24-C(NR23)N(R22)R21; -NR23-C(NR23)N(R22)Ar4;-NR24-C(NR23)N(R22)Cy2; -NR23-CON(R22)Cy2;-CON(R22)R21;-NR23-CON(R22)Ar4; -NR22-COOCy2;-NR22-COOR21;-NR22-COOAr4; -OCOOR21;OCON(R22)R21;-OCON(R22)Ar4;-OCON(R22)Cy2; -NR22-COR21;-NR22-COAr4;-NR22--OCOOAr4;-OCOOCy2; -NR22-SOAr4;-NR22-SOCy4;-NR22-COCy2;-NR22-SOR21; -NR22-SO2Cy2;-OR21;-OAr4;-SO2R21;-NR22-SO2Ar4; OCy ;-OCOR ;-OCOAr ;-OCOCy2 ;-COOR 1 ;-COOAr ;- -CON(R22)Ar4;-CON(R22)Cy2;;-COOCy2;-CON(R21)R22; CON (R) OR ;-CON (R) OAr;-CON (R22)OCy2; -COR21; - -SR21;-SAR4;-SCy2;-SOR21;-SOAr4;COAr4;-COCy2; <BR> <BR> <BR> -SOCy2 ;-S02R21 ;-S02Ar4 ;-S02Cy2;-SON (R22) R21 ;-<BR> <BR> <BR> <BR> <BR> <BR> <BR> SON (R22) Ar4 ;-SON (R22) Cy2;-S02N(R) R ; S02N(R22) Ar4 ;-S02N (R22) Cy2 ;-S03H ;-OSO3H ;-N02;- CN;-CHO; or Q may be jointed with Q2 or Q3 to form, with the carbon atom which they attach, optionally substituted heterocycloalkane.
R21 R22 R23 R24 R25 R26,27 28 independently hydrogen, alkyl, alkenyl, alkynyl, or R21 may be jointed with R22, R23 to form, with the carbon atom which they attach, heterocycloarlkane, or R25 may be jointed with R26, R27to form, with the carbon atom which they attach, heterocycloarlkane.
Ar3 and Ar4 are independently phenyl or heteroaryl, wherein the phenyl and the heteroaryl are optionally substituted by one or two groups selected from the following groups: halogen; alkyl; alkenyl; alkynyl; halogenated alkyl; -Z2-NR27--Z2-N(R25)R26;-Z2-NR28-C(NR27)N(R26)R25; -Z2-OCON(R26)R25;-Z2-CON(R26)R25;-Z2-NR26-COOR25; -Z2-NR26-SO2R25;-Z2-OR25;-NR26-COR25;-Z2-NR26-SOR25; -Z2-OCOOR25;-Z2-CON(R26)R25;-Z2-COOR25;-Z2-OCOR25; CON (R26)OR25; -Z2-COR25; -Z2-C(NR27) N (R) R ;-Z -Z2-SO2R25;-Z2-SON(R25)R26;-Z2-SR25;-Z2-SOR25; -N2-OSO3H;-Z2-NO2;-Z2-CN;-SO2N(R26)R25;-Z2-SO3H; -O-CH2-CH2-,-CH2-CH2-O-CHO-O-CH2-O-;-O-CH2-CH2-O-; CO-,-CH2-O-CO-: Z2 is single bond, alkylene, alkenylene or alkynylene; Cyl and Cy2 are independently cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl, wherein the cycloalkyl, the cycloalkenyl, the heterocycloalkyl,
and the heterocycloalkenyl are optionally substituted by one or two groups which are the same as the substituent of the substituted phenyl as used in Ar3 or Ar4.
"Substituents"of R8 and R9 may also selected from the following groups: <BR> <BR> <BR> <BR> <BR> -O-CH2-O-;-O-CH2-CH2-O-;-O-CH2-CH2-,-CH2-CH2-O-CO-,<BR> ; <BR> <BR> <BR> <BR> <BR> -CH2-O-CO- "Substituent"of R15 includes, for example, the following groups: -Z-Ar:-Z-Cy;-Z-N(Q)Q;-Z-N(Q)Ar;-Z- -Z1-NQ4-C(NQ3)N(Q2)Ar3;N(Q2)Cy1;-Z1-NQ4-C(NQ3)N(Q2)Q1; -Z1-NQ4-C(NQ3)N(Q2)Cy1;-Z1-NQ3-CON(Q2)Q1;-Z1-NQ3- CON (Q2) Ar3 ; -Z1-NQ3-CON(Q2)Cy1; -Z1-NQ2-COOQ1; -Z1-NQ2- COOAr3; -Z1-OCON(Q2)Ar3;-Z1-OCON(Q1)Q2; -Z1-NQ2-COAr3;-Z1-NQ2--Z1-OCON(Q2)Cy1;-Z1-NQ2-COQ1; COCy1; -Z1-NQ2-SOAr3;-Z1-NQ2-SOCy1;-Z1-NQ2-SOQ1; -Z1-NQ2-SO2Cy1;-Z1-OQ1;-Z1-NQ2-SO2Q1;-Z1-NQ2-SO2Ar3; OCOQ1; -Z1-OCOOQ1;-Z1-OCOOAr3;-Z1-OCOCy1; -Z1-COOAr3;-Z1-COOCy1;-Z1--Z1-OCOOCy1;-Z1-COOQ1; CON (Ql) Q2 ; -Z1-CON(Q2)Ar3; -Z1-CON(Q2)Cy1; -Z1- CON (Ql) OQ2; -Z1-CON(Q2)OAr3; -Z1-CON(Q2)OCy1; -Z1-COQ1 ; -Z1-C(NQ3)N(Q1)Q2;-Z1--Z1-COAr3;-Z1-CO-Cy1; N(Q2)Cy1;-Z1-SQ1';-Z1-SOQ1;C(NQ3)N(Q2)Ar3;-Z1-C(NQ3) -Z1-SO2Q1;-Z1-SO2Ar3;-Z1-SO1Cy1;-Z1-SOAr3;-Z1-SOCy1;
-Z1--Z1-SON(Q1)Q2;-Z1-SON(Q2)Ar3;-Z1-SON(Q2)Cy1; -Z1-SO2N(Q2)-Cy1;-CHO;SO2N(Q1)Q2;-Z1-SO2N(Q2)Ar3; wherein Q1,Q4,R21,R22,R23,R24,Z1,Ar3,Ar4,Cy1andQ3, Cy2 are defined above.
Q1 is hydrogen, alkyl, alkenyl, or alkynyl, wherein the alkyl, alkenyl, and alkynyl are substituted by one or more groups selected from the following groups: -N(R21)R22;-N(R22)Ar4;-N(R22)Cy2;--Ar4';-Cy2'; -NR24-NR24-C(NR23)N(R22)R21;-NR24-C(NR23)N(R22)Ar4; -NR23-C(NR23)N(R22)Cy2;-NR23-CON(R22)R21; -NR22-COOR21;-NR22-CON(R22)Ar4;-NR23-CON(R22)Cy2; COOAr4;-OCONAr4;-OCONCy2;-OCONR21; -NR22-COR21 ;-NR22-COAr4 ;-NR22-COCy2 ;-NR22-SOR21 ;- -NR22-SO2R21;-NR22-SO2Ar4;NR22-SOAr4;-NR22-SOCy2; -OCOAr4;-OCOCy2;-COOR21;--NR22-SO2Cy2;-OCOR21; -OCOOR21;-OCOOAr4;-OCOOCy2;-COOAr4;-COOCy2; -CON(R22)Cy2;-CON(R21)R22;-CON(R22)Ar4; CON(R22)OR21;CON(R22)OR21;-CON(R22)OAr4; --COR21; COAr4; -COCy2; -SOCy2;-SO2R21;--SOAr4; SO2Ar4;-SO2Cy2;-SON (R22) R21;-SON (R22) Ar4 ;- SON (R22) Cy2;-S02N (R22) R21;-S02N (R22) Ar4 ;- S02N (R22)Cy2; -CN ;-CHO;-OH;-SH Ar3 and Ar4 are heteroaryl, wherein the heteroaryl are optionally substituted by one or two groups which are the same as the substituent of the substituted phenyl
as used in Ar or Ar.
Cy and Cy2 are heterocycloalkyl or heterocycloalkenyl, wherein the heterocycloalkyl and the heterocycloalkenyl is optionally substituted by one or two groups which are the same as the substituent of the substituted phenyl as used in Ar3 or Ar4.
The number of"substituent"of the substituted aryl, the substituted heteroaryl, the substituted ortho-arylene and substituted ortho-heteroarylene, and the number of wsubstituent n of R, R, R, and R are one, two or three, preferably one or two.
"Alkyl"includes straight or branched C1-C6 alkyl. Typical examples are methyl, ethyl, propyl, 2-methylethyl, butyl, 2-methylpropyl, 1-methylpropyl, 1,1-dimethylethyl, 2,2- dimethylpropyl, pentyl, hexyl and the like.
"Halogenated alkyl"includes straight or branched C1-C6 alkyl substituted by one or more of halogens. Typical examples are trifluoromethyl, pentafluoroethyl, 2- chloroethyl, 3-bromopropyl, 5-fluoropentyl, 4-iodohexyl and the like.
"Alkoxy"includes straight or branched C1-C6 alkoxy.
Typical examples are methoxy, ethoxy, propoxy, 2- methylethoxy, butoxy, 2-methylpropoxy, 1-methylpropoxy, 1,1-dimethylethoxy, 2,2-dimethylpropoxy, pentyloxy,
hexyloxy, and the like.
"Alkylthio"includes straight or branched C1-C6 alkylthio. Typical examples are methylthio, ethylthio, propylthio, 2-methylethylthio, butylthio, 2- methylpropylthio, 1-methylpropylthio, 1,1-dimethylethlthio, 2,2-dimethylpropylthio, pentylthio, hexylthio, and the like.
"Alkenyl"includes straight or branched C2-C6 alkenyl.
Typical examples are vinyl, allyl, 1-propenyl, 2-butenyl and the like.
"Alkynyl"includes straight or branched C2-C6 alkynyl.
Typical examples are ethynyl, propargyl, 1-propynyl, 2- butynyl, pentynyl and the like.
"Alkylene"includes straight or branched C1-C6 alkylene.
Typical examples are methylene, ethylene, trimethylene, 2- methyltrimethylene, tetramethylene, pentamethylene, hexamethylene and the like.
"Alkenylene"includes straight or branched C2-C6 alkenylene. Typical examples are vinylene, propenylene, 2- butenylene, 2-methyl-2-butenylene, 3-pentenylene, 3- hexenylene and the like.
"Alkynylene"includes straight or branched C2-C6 alkynylene. Typical examples are ethynylene, propynylene, 2-butynylene, 3-pentynylene, 2-methyl-3-pentynylene, 3- hexynylene and the like.
"C1-C2 alkylene"is methylene or ethylene.
"Cl-Clo alkylidene"includes straight or branched Cl-Cl0 alkylidene, preferably straight or branched C1-C6 alkylidene.
Typical examples are methylidene, ethylidene, propylidene, butylidene, 2-methylbutylidene, hexylidene, octylidene, nonylidene, decylidene and the like. Preferable is methylidene.
"Cycloalkane"includes C3-C8 cycloalkane, which can be containing 0-2 carbonyl group. Typical examples are cyclopropane, cyclobutane, cyclopentane, cyclohexane, cycloheptane, cyclooctane, cyclohexanone and the like.
"Heterocycloalkane"includes, for example, 5-or 6- membered heterocycloalkane containing 1 to 3 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms, and the like. The sulfur atoms of"Heterocycloalkane" may be oxidized to form sulfoxide, or sulfone.
"Heterocycloalkanen may also be containing 0-2 carbonyl groups. Typical examples of 5-membered heterocycloalkane containing 1 to 3 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms, are pyrrolidine, imidazolidine, pyrazolidine, tetrahydrofuran, tetrahydrothiophene, dioxolane, pyrrolidinone, and the like.
Typical examples are 6-membered heterocycloalkane containing 1 to 3 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms, are piperidine, piperazine, morpholine, tetrahydropyrane, dioxane, thiomorpholine, 4-piperidone and the like.
"Cycloalkyl"includes C3-C8 cycloalkyl, which may
contain 0-2 carbonyl group. Typical examples are cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclohexanone-4-yl and the like.
"Cycloalkenyl"includes C3-C8 cycloalkenyl, which may contain 0-2 carbonyl group. Typical examples are cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, cyclopenten-3-one-yl and the like.
", Heterocycloalkyl" includes, for example, 5-or 6- membered heterocycloalkyl containing 1 to 5 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms, and the like. The sulfur atoms of"Heterocycloalkyl" may be oxidized to form sulfoxide or sulfone.
"Heterocycloalkyl"may also be containing 0-2 carbonyl groups. Typical examples are 5-membered heterocycloalkyl containing 1 to 3 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms, are pyrrolidinyl, 2-pyrrolidinone-1-yl, imidazolidinyl, pyrazolidinyl, tetrahydrofuryl, tetrahydrothienyl, dioxolanyl and the like. Typical examples are 6-membered heterocycloalkyl containing 1 or 3 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms, are piperidyl, piperazinyl, morpholinyl, tetrahydropyranyl, dioxanyl, thiomorpholinyl, 4-piperidone- 1-yl and the like.
"Heterocycloalkenyln includes, for example, 5-or 6-
membered heterocycloalkenyl containing 1 to 5 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms, and the like. The sulfur atoms of"Heterocycloalkenyl"may be oxidized to form sulfoxide or sulfone."Heterocycloalkenyl"may also be containing 0-2 carbonyl groups. Typical examples are 5-membered heterocycloalkenyl containing 1 to 3 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms, are pyrrolinyl, imidazolinyl, pyrazolinyl, dihydrofuryl, 5-pyrazolone-4-yl and the like. Typical examples are 6-membered heterocycloalkyl containing 1 to 3 atoms selected independently from nitrogen atoms, sulfur atoms and oxygen atoms, are 2,3-dihydropyridyl-, 4- pyridone-1-yl and the like.
"Substltuent"of the substituted alkyl, the substituted alkenyl, the substituted alkynyl, the substituted alkoxy, the substituted alkylthio, the substituted cycloalkyl, the substituted heterocycloalkyl, the cycloalkenyl, the substituted heterocycloalkenyl, the substituted cycloalkane, the substituted heterocycloalkane and the substituted Cl-Clo alkylidene includes, for example, the following groups: halogen; -N(Q5)Q6;-N(Q6)Ar5;-N(Q6)Cy3;-NQ8--Cy3; C (NQ) N (Q6) Q -NQ-C (NQ7) N (Q6) Ar5; -NQ8-C(NQ7)N(Q6)Cy3; - -NQ7-CON(Q6)Cy3;-NQ7-NQ7-CON(Q6)Q5;-NQ6-CON(Q5)Ar5; COOQ6;-NQ7-COOCy3;-OCON(Q6)Q5;-OCON(Q6)Ar5;COOAr5; -OCON(Q6) CY3 ;-NQ6-COQ5 ;-NQ6-COAr5 ;-NQ6-COCIT ;-NQ6-SOQ5 ;
-NQ6-SO2Q5;-NQ5-SO2Ar5;-NQ6--NQ6-SOAr5;-NQ6-SOCy3; -OAr5;-OCy3;-OCOQ5;-OCOAr5;-OCOCy3;-SO2Cy3;-OQ5; COOQ5;-OCOOQ5;-OCOOAr5;-OCOOCy3;--COOCy3; -CON(Q6)Cy3;-CON(Q6)OQ5;-CON(Q6)Q5;-CON(Q6)Ar5; CON (Q6) OAr5; ; -CON (Q6) ocy3 ; -COQ5; -COAr5; -COCy3; -SQ5; -SAr5 ;-SCy3 ;-SOQS-SOAr5 ;-SOCy3 ;-S02Q5 ;-S02AT5;- -SON(Q6)Ar5;-SON(Q6)Cy3;-SQ2N(Q6)Q5;SO2Cy3;-SON(Q6)Q5; -SO2N (Q6)Ar5; -SO2N(Q6)Cy3; -SO3H; -NO2 ;-CN; wherein R29, R, R and R32 are independently hydrogen, alkyl, alkenyl, alkynyl; Q5, Q6, QF and Q8 are independently hydrogen, alkyl, alkenyl and alkynyl wherein the alkyl, the alkenyl and the alkynyl are optionally substituted by one or more groups selected from the following group: -Cy4;-N(R29)R30;-N(R30)Ar6;-halogen;-Ar6; -NR32-N(R30)Cy4;-NR32-C(NR31)N(R30)R29; -NR31-C(NR31)N(R30)Ar6;-NR32-C(NR31)N(R30)Cy4; -NR31-CON(R30)Cy4;-CON(R30)R29;-NR31-CON(R30)Ar6; -NR30-COOCy4;-OCON(R30)NR3-COOR29;-NR30-COOAr6; -OCON(R30)Cy4;-NR30-COR29;-NR30-R29;-OCON(R30)Ar6; -NR30-SOR29;-NR30-SOAr6;-NR30-COAr6;-NR30-COCy4; -SO2R29;-NR30-SO2Ar6;-NR30-SO2Cy4;-SOCy4;-NR30 OR29 ;-OAr6 ;-OCy4 ;-COOR29 ;-COOAr6 ;-COOCy4 ; _ -OCOCy3;-OCOOR29;-OCOOAr6;-Z1-OCOR29;-COAr5; -CON(R30)Ar6;-CON(R30)Cy4;-OCOOCy4;-CON(R30)R29; -CON(R30)OCy4;-COR29;-CON(R30)OR29;-CON(R30)OAr6;
-SR29;-SAr6;-SCy4;-SOR29;-SOAr6;-COAr6;-COCy4; SOCy4 ;-S02R29 ;-S02Ar6 ;-S02Cy4;-SON (R R29 ;- -SO2N(R30)R29;-SON(R30)Ar6;-SON(R30)Cy4; -SO3H;-NO2;-CN;SO2N(R30)Ar6;-SO2N(R30)Cy40; or Q5 may be jointed with Q6 or Q to form, with the carbon atom which they attach, optionally substituted heterocycloalkane.
Ar5 and Ar6 are independently aryl or heteroaryl, wherein the aryl and the heteroaryl are optionally substituted by one or two groups which are the same as the "substituent" of the substituted aryl, the substituted heteroaryl, the substituted ortho-arylene and substituted ortho-heteroarylene, and"substituent" of R, R, and R Cy3 and Cy4 are independently cycloalkyl, cycloalkenyl, heterocycloalkyl, or heterocycloalkenyl, wherein the cycloalkyl, the cycloalkenyl, the heterocycloalkyl, and the heterocycloalkenyl are optionally substituted by one or two groups which are the same as the substituent of the substituted phenyl as usea in Ar3 or Ar4.
The number of "substituent" of substituted alkyl is one to five, preferably one, two, or three.
When R1 is- (CHR4) n- (CR5R6)-CO-NHOH in formula 1,- (CHR4) nl- (CR5R)-CONHOH in formula 2,- (CHR4) n2- (CR5R6)-CO- NHOH in formula 3 and 3', and R5 or R6 are 1-substituted
alkyl in formula 1,2,3, and 3', the subsitituents of R5 or R6 do not include the following groups: -CON (Q6) Q5 ;-CON (Q6) AT5 ;-CON (Q6) Cy3-CON (Q6) OQ5 ; CON (Q6) 0Ar5;-CON (Q6) OCy3 ;-CO-Q5 wherein Ar5,andCy3aredescribedabove.Q5,Q6, "Halogen"includes fluorine, chlorine, bromine and iodine. Typical examples are chlorine and fluorine.
The preferable examples of- (CHR4) n- (CR5R6)-CO-NHOH as used in one of R and R3 in formula 1 ; - (CHR4)nl-(CR5R6)-CO- NHOH as used in formula 2; or- (CHR4) n2- (CR5R6)-CO-NHOH as used in formula 3 are wherein R5 is hydrogen, optionally substituted alkyl, optionally substituted cycloalkyl, and optionally substituted heterocycloalkyl, and more preferably hydrogen or optionally substituted alkyl;
n3 is an integer of 0 to 3; n4 is an integer of 0 to 2, and more preferable n3 and n4 is 0; A3 is cyclopentane or cyclohexane; and A4 is cyclopentane, cyclohexane, tetrahydropyrane, piperazine and the like.
The preferable R6 in formula 1,2,3, and 3'is hydrogen or C1-C3 alkyl such as methyl, ethyl.
The more preferable example of R5 in formula 2 is the optionally substituted alkyl. The functional groups of the "substituents"of substituted alkyl, such as hydroxy, carboxyl, amino, or thiol, may be protected with typical protective groups described in"protective groups in organic synthesis 2nd edition by W. Greene (John Wiley & Sons,INC.)".
The more preferable R5 in formula 3 and 3'is hydrogen or alkyl such as methyl, ethyl, propyl, and isopropyl.
The preferable examples of the hydroxamic acid derivative represented by formula 1 are (1) the derivatives wherein R1 is- (CHR4) n- (CR5R6)-CONHOH ; and R3 is hydrogen, or optionally substituted alkyl ; and (2) the derivatives wherein R1 is alkyl substituted by a) halogen, b) optionally substituted cycloalkyl, c) optionally substituted aryl, d) optionally substituted hetero-cycloalkyl or e) optionally substituted heteroaryl; and R is- (CHR4) n- (CR5R6)-CONHOH ;
Wherein n, R4, R5, and asdifinedabove.are The preferable example of R2 in formula l; R10 in formula 2; and formula3and3'arehydrogenoralkylin such as methyl and ethyl.
The preferable examples of the hydroxamic acid derivative represented by formula 2 are the derivatives wherein R is hydrogen or optionally substituted alkyl, such as methyl, ethyl, propyl or butyl in which the "substituents"are selected from the following group; -NQ6-COOCy3;-NQ6-COQ5;-NQ6--NQ6-COOQ5;-NQ6-COOAr5; COAr5;-NQ6-COCy3 ;-NQ6-SOQ5 ;-NQ6-SOAr5 ;-NQ6-SOCy3 ;- -NQ6-SO2Cy3;-COOQ5-;-COOAr5-;NQ6-SQ2Q5-;-NQ6-SO2Ar5; -COOCy3- ;-CON (Q6) Q5 :-CON (Q6) Ar5 ;-CON (Q6) CY ;- -CON(Q6)OCy3;-COQ5;-COAr5;-CON(Q6)OQ5;-CON(Q6)OAr5; COCy3 ;-SO-Q5 ;-SO-Ar5 ;-SO-Cy3 ;-S02-Q5 ;-S02-Ar5 ;-S02- SON(Q6)-Ar5;SON(Q6)-Cy3;-SO2N(Q6)-Q5;Cy3;-SON(Q6)-Q5; -S02N (Q6)-Ar5 ; -SO2N (Q6)-Cy3 wherein Ar5, Cy3 Q5 and Q are described above.
The more preferable"substituents"are selected from the following group; -COOQ5 ;-COOAr5 ;-COOCy3 ;-CON (Q6) Q5 ;-CON (Q6) Ar5 ;- CON(Q6)Cy3;-CON(Q6)OCy3;-CO--CON(Q6)OAr5; -CO-Cy3;-COO-Q5;-COO-Ar5;-COO-Cy3;Q5;-CO-Ar5; wherein Ar, Cy, Q and Q6 are described above.
The preferable example of the hydroxamic acid derivative represented by formula 3 and 3'are the derivatives wherein R13 is optionally substituted alkyl, such as methyl, ethyl, or propyl. The"substituents"are selected from the following groups; -Ar5-Cy3 ;-O-Q9 ;-OAr5 ;-N (Q5) Ar5 ;-S-Q9 ;-SAr5 ; wherein Ar5, Cy3, and Q5 are described above; Q9 is alkyl, alkenyl or alkynyl wherein the alkyl, the alkenyl and the alkynyl are substituted by one or more groups selected from the following group: -Ar; Cy;-OAr6;-SAr6 ; wherein Ar6, and Cy4 are described above ; The preferable Ar5 and Ar6 in R13 in formula 3 and 3' are optionally substituted phenyl or optionally substituted monocyclic heteroaryl such as pyridyl, thienyl, furyl and pyrrolyl. The preferable"substituents"are selected from the following groups; halogen; halogenated alkyl -OQ1; or-SAr3-SQ1; wherein Q1 and Ar3 are as defined above.
The preferable positions of the substituents of the substituted phenyl and the substituted monocyclic heteroaryl in R13 in formula 3 and 3'are m-position or p- position, especially p-position.
The preferable Ar in formula 2 are optionally substituted phenyl, optionally substituted naphthyl, optionally substituted monocyclic heteroaryl, or optionally substituted bicyclic heteroaryl, wherein the"substituents" are selected from the following groups: halogen, alkyl, halogenated alkyi,-OQ\-OAr,-SQ,- -SOAr3,-SO2Q1,-SO2Ar3;SAr3,-SOQ1, wherein Ar3 and Q1 are defined above.
The preferable positions of the substituent of the substituted phenyl and the substituted monocyclic heteroaryl as used in Ar2 in formula 2 are m-position or p- position, especially p-position. More preferable Ar2 in formula 2 are phenyl or monocyclic heteroaryl.
The preferable A1 in formula 3 and 3'are phenylene or monocyclic hteroarylene, such as pyrazole-3,4-diyl, imidazole-4,5-diyl, and thiophene-2,3-diyl.
When the A1 in formula 3 and 3'is phenylene, the preferable positions of R8 or R9 in formula 3, and R14 or R15 in formula 3'are 6th and/or 7th positions.
The hydroxamic acid derivatives can be prepared through three processes: [A] cyclization process; [B] substitution process ; [C] process of forming hydroxamic acid group.
The order of three processes may be the same as or different from the order [A], [B] and [C] as long as the hydroxamic acid derivatives can be prepared. And protective groups may be used through these processes to protect functional groups in the hydroxamic acid derivative.
Protective groups include well known groups described in "Protective Groups in Organic Syntheses"2nd ed. T. W. Greene and P. G. M. Wuts, John Wiley & Sons, Inc. 1991.
[A] Cyclization process (1) 5-Membered ring wherein RA, RB and RL are independently hydrogen atom or substituent; and Y2 is-O-or-S-.
5-Membered ring can be formed for example by cyclization reaction of imine with mercapto-or hydroxy- carboxylic acid by the same method as ones described in Chem. Rev., Vol. 81,175 (1981). One to 5 equivalents of mercapto-or hydroxy-carboxylic acid per equivalent of the
imine is preferably used. In this reaction, dehydration agent such as molecular sieves 3A (MS 3A) or triethyl orthoformate may be added. Reaction solvent includes for example ether such as THF; halogenated hydrocarbon such as chloroform, dichloromethane; amide such as DMF, N-methyl- pyrrolidone; sulfone or sulfoxide such as tetramethylene solfone, DMSO; hydrocarbon such as benzene, toluene, xylene, heptane, hexane; or mixture thereof. Reaction temperature is usually 50 °C to boiling point of the solvent. The imine can be prepared by a conventional method.
(2) 6-Membered ring 6-Membered ring can be formed for example by the same methods as ones described in EP 162776 A; Chem. Pharm.
Bull., 39,2888 (1991) ; ibid., 42,1264 (1994) çbSd., 44, 2055 (1996). Method 1 R Ro Rc Rp Rnn 1 + H02C-CH-X-- HN OH-- HN O H2N OH (' 1 I"m Rnn R Wherein RC, RD and RM are independently hydrogen atom or substituent, or RC-C-C-RD is optionally substituted ortho- arylene or optionally substituted ortho-heteroarylene; and X1 is chlorine, bromine or iodine.
6-Membered ring can be formed by amidation reaction of hydroxy-amine with halo-carboxylic acid or halo-ester,
followed by ether formation reaction. Amidation reaction can be performed by a conventional method such as dehydration method, mixed anhydride method, activated ester method and the like ("The Peptides Analysis, Synthesis, Biology", Vol. 1,2,3,5, ed. by E. Gross, J. Meinhofer Academic Press (1979)). Dehydration agent used in the dehydration method includes dicyclohexylcarbodiimide, N, N- dimethylaminopropyl-N'-ethylcarbodiimide, 2-ethoxy-1- ethoxycarbonyl-1,2-dihydroquinoline, 0-(7-azabenzotriazol- 1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate.
Acylation agent used in mixed anhydride method includes isobutyl chloroformate, pivaloyl chloride and the like.
Ether formation reaction can be carried out by a conventional method. Method 2 D IRC RD Rc RD Ru ruz 9 + RE02C-CH-Xi HN S H2N SH RM RM ° RM Rm R 0 R wherein R, RD, Ru and X1 are as defined above; and R is hydrogen or alkyl.
6-Membered ring can be formed by thioether formation reaction of mercaptoamine and halide, followed by amidation reaction. Thioether formation reaction may be performed in the presence of base such as K2CO3, NaOH and triethylamine.
2-Mercapto-anilines may be commercially available or can be
prepared from 2-aminothiazoles, 2-methylthiazoles, or dithiazolium chloride by the same method as one described in Chem. Pharm. Bull., 39,2888 (1991); ibid, 42,1264 (1994); ibid, 44,2055 (1996); J. Chem. Soc., 1948,870.
The amidation reaction can be carried out by heating in the presence of acid such as HC1, HBr, H2SO4, acetic acid and methanesulfonic acid, or by a conventional method described above. Method 3 Re Re Ry y E 2'_ 2 2 + R _ CH-y2H 0-02N y 2 o. HN y 02N X1 R 02C 4 M ° RM R 0 R wherein RC, RD, Y2, RE, X1and are as defined above.
6-Membered ring can be formed by ether or thioether formation reaction of nitrohalide and thiol or alcohol, followed by reduction and amidation reaction. Ether or thioether formation reaction may be performed in the presence of base such as K2COg, NaOH and triethylamine.
Reduction may be carried out by a conventional method.
Amidation reaction may be carried out by heating in the presence of acid or by a conventional method described above. Method 4 RM C D C R R CH-X F _-2 ' + H N' X2 Y2-- R N Y X2 Y2 H rt
wherein RC, RD, RM,Y2 andX1 are as defined above; and X2 is chlorine, bromine or iodine; and RF is hydrogen or substituent.
6-Membered ring can be formed by ether or thioether formation reaction of alcohol or thiol and halide, followed by cyclization reaction. Ether or thioether formation reaction can be carried out by the method described above.
Cyclization reaction can be performed in the presence of Pd catalyst by the same method as one described in J. Am. Chem.
Soc., 119,8451-8458 (1997). Base such as Cs2CO3 may be added in this reaction.
[B] Substitution process (1) Substitution at the position of R1 in the formula [1] Introducing a substituent at the position of R1 in the formula [1] can be performed for example by alkylation.
Alkylation may be performed by reacting with corresponding alkyl halide, preferably alkyl iodide or bromide, in the presence of base such as NaH, NaOMe, potassium t-butoxide and Na2CO3. Reaction solvent is for example ether such as THF; amide such as DMF; sulfoxide such as DMSO or mixture
thereof, preferably THF and DMF. Reaction temperature is usually 0 °C to 160 °C.
(2) Substitution at the position of R2 and R3 in the formula [1] Introducing substituent (s) at the position of R2 and R3 in the formula [1] can be performed for example by aldol reaction, Wittig reaction, alkylation, Michael reaction and the like. wherein R, X and Y are as defined above; and R is hydrogen or substituent.
Aldol reaction may be performed by reacting with the corresponding aldehyde in the presence of base or acid (J.
Med. Chem., 20,729 (1977), EP 657444 (A), JP 7-233155 (A)). wherein R1, X, Y and RG are as defined above.
Wittig reaction may be performed by reacting with the corresponding aldehyde (J. Org. Chem., 40,1731 (1975), US 3873535, US 3923709).
(2) Introduction of sulfoxide and sulfone
Introduction of sulfoxide can be carried out by oxidizing thioether group with mild oxidizing agent such as hydrogen peroxide, sodium periodate and the like.
Introduction of sulfone can be carried out by oxidizing thioether or sulfoxide with oxidizing agent such as m- chloroperbenzoic acid (m-CPBA) and potassium peroxymonosulfate.
[C] Process of forming hydroxamic acid group Hydroxamic acid group can be formed for example by (1) amidation of ester group with hydroxylamine (J. Med. Chem., 40,2525 (1997)) or (2) condensation of carboxylic acid group with protected hydroxylamine followed by deprotection (J. Med. Chem., 41,1209 (1998); Ibíd,, 41,1745 (1998); Ibid., 38,2570 (1995)).
(1) Amidation of ester group with hydroxylamine wherein RH is optionally substituted alkyl such as methyl, ethyl and benzyl.
Preferred RH is methyl or ethyl. Two to 50 equivalents of hydroxylamine per equivalent of the ester group is preferably used. Reaction solvent is for example alcohol such as methanol, ethanol; amide such as DMF; sulfoxide such as DMSO; ketone such as acetone; water or mixture thereof, especially alcohol. Reaction temperature is usually 0 °C to 80 °C.
(2) Condensation of carboxylic acid group with protected hydroxylamine followed by deprotection wherein R is a protective group of hydroxylamine such as t-butyldimethylsilyl, trimethylsilyl, t-butyl, benzyl, 4- methoxybenzyl and tetrahydropyranyl.
Condensation of carboxylic acid group with protected hydroxylamine can be performed by a conventional method as described above. The protective group of the protected hydroxamic acid group can be removed by a conventional method ("Protective Groups in Organic Syntheses"2nd ed.
T. W. Greene and P. G. M. Wuts, John Wiley & Sons, Inc. 1991).
The prodrug of the hydroxamic acid derivative includes the prodrugs described in Chemistry and Industry, 1980, 435; Advanced Drug Discovery Reviews 3,39 (1989). The typical examples are biohydrolyzable esters such as acyloxymethyl esters, glycolates, lactates and morpholinoethyl ester of carboxyl group; hemiglutarates of phenolic hydroxyl group; N-morpholinomethyl amides; N- acyloxymethyl amines; N-ayloxyalkoxycarbonylamines.
The present invention includes every isomers such as diastereomers, enantiomers, and geometrical isomers, if the
hydroxamic acid derivative has such isomers.
Method of optical resolution of a present invention compound or an intermediate thereof which has acidic group comprises steps of (1) a step of forming a salt of a compound of present invention or intermediate thereof and an optically active base; (2) a step of recrystallization.
Examples of the solvent forming a salt are an alcohol solvent (such as methanol, ethanol 2-propanol and the like), an ether solvent (such as diethyl ether and the like), an aromatic hydrocarbon solvent (such as toluene and the like), an aprotic solvent (such as acetonitrile), and a mixture of the solvent described before. Examples of the optical active base are an organic amine (such as a-phenetylamine, quinine, quinidine, cinchonidine, cinchonine, strychnine, and the like), and the like.
Method of optical resolution of a present invention compound or an intermediate thereof which has basic group comprises steps of (1) a step of forming a salt of a compound of present invention or intermediate thereof and an optically active acid; (2) a step of recrystallization.
Examples of the solvent forming a salt are an alcohol solvent (such as methanol, ethanol 2-propanol and the like), an ether solvent (such as diethyl ether and the like), an
aromatic hydrocarbon solvent (such as toluene and the like), an aprotic solvent (such as acetonitrile), and a mixture of the solvent described before. Examples of the optical active acid are a monocarboxylic acid (such as mandelic acid, N-benzyl alanine, lactic acid and the like), a dicarboxylic acid (such as tartaric acid, O- diisopropylidene tartaric acid, malic acid and the like), a sulfonic acid (such as camphor sulfonic acid, bromocamphor sulfonic acid and the like), and the like.
Temperature of forming the salt is selected from the range from about room temperature to about boiling point of the solvent. To increase the purity of optical isomer, it is preferable to heat the solution of salts to around the boiling point of solvent. A molar rate of optically active acid and the compound or the intermediate is selected from the range of about 0.5 to about 2.0, preferably around 1.0.
If it is necessary to improve the optical purity, it is possible to repeat recrystallization in the solvent described before.
The present invention also includes solvates such as the hydrate and the like, of the hydroxamic acid derivative or the prodrug thereof, or the pharmaceutically acceptable salt thereof.
The pharmaceutically acceptable salts of the hydroxamic acid derivative or the prodrug thereof include, for example, salts with inorganic acids such as the hydrochloride,
hydrobromide, sulfate, phosphate and the like; salts with organic acids such as the acetate, oxalate, citrate, lactate, tartrate, malonate, fumarate, maleate, mathanesulfonate and the like; salts with inorganic metals such as the lithium salt, sodium salt, potassium salt, magnesium salt, aluminum salt, barium salt and the like; salts with organic bases such as the ammonium salt, triethylammonium salt, tetrabutylammonium salt, pyridinium salt, pyrrolidinium salt, piperidinium salt and the like.
The hydroxamic acid derivatives or the prodrug thereof, or the pharmaceutically acceptable salt thereof of the present invention are useful as matrix metallo-proteinase inhibitors. Therefore, they may be used to treat or prevent a disease associated with excess or undesired matrix metallo-proteinases.
The diseases associated with excess or undesired matrix metallo-proteinases include, for example, the following diseases: Abnormal wound healing, acne, acute coronary syndrome, acute infection, AIDS, alcoholism, allergic conjunctivitis, allergic reactions, allergic rhinitis, ALS, Alzheimer's diseases, anaphylaxis, aneurysmal aortic disease, angina, angiofibromas, anorexia, aortic aneurysm, ARDS, aspirin-independent anti-thrombosis, asthma, atherosclerosis, atherosclerotic plaque rupture, atopic dermatitis, benign hyperplasia, bleeding, bone
fractures, bronchitis, burns, cachexia, cancer, cardiac infarction, cardiac insufficiency, cardiomyopathy, cerebral hemorrhaging, cerebral ischemia, cerebral vascular dementia, CHF, chronic bronchitis, chronic dermal wounds, chronic obstructive pulmonary disease, cirrhosis, congestive heart failure, corneal injury, coronary thrombosis, Crohn's disease, cystic fibrosis, decubitis ulcer, diabetic peripheral neuropathy, diabetic retinopathy, diabetic ulcers, Duchenne's muscular dystrophy, emphysema, endometriosis, endosclerosis, epidermolysis bullosa, eye disorders, fibrosis, gastritis, gingivitis, glomerular diseases, glomerulonephritis, gout, graft rejection, gum disease, GVHD, Hashimoto's thyroiditis, head trauma, headaches, heart attacks, heart failure, hemangiomas, hemorrhage, hepatitis, hirsutism, Huntington's disease, hypertension, insulin resistance, interstitial nephritis, ischemia, ischemic heart disease, Kapos's sarcoma, keratinization, keratitis, kidney failure, leishmaniasis, leprosy, leukemia, leukocyte infiltration, liver cirrhosis, loss of appetite, macular degeneration, malaria, mandibular joint disease, memory impairment, meningitis, migraine, miscarriage, multi-infarct dementia, multiple sclerosis, muscular dystrophy, myalgia, myasthenia gravis, myelinic degradation, myocardial infarction, myopia, neovascular glaucoma, neuroinfalmmation, ocular tumors, optic neuritis, osteoarthritis, osteopenia, Paget's disease,
pain, pancreatitis, Parkinson's disease, periodontitis, peripheral vascular disease, polyarteritis nodositas, polychondritis, premature childbirth, premature rupture of fetal membranes, prion disease, proliferative retinopathies, proteinurea, pseudogout, psoriasis, pterygium, pulmonary emphysema, radiation damage, rattle snake bite, Reiter's syndrome, renal fibrosis, reocclusion, reperfusion injury, restenosis, scleritis, scleroderma, senile dementia, senility, sepsis, septic shock, Sharp syndrome, Sjoegren's syndrome, SLE, spondylosis, stenosis, sterility, stroke, system sclerosis, thrombosis, toxic effects of chemotherapy, toxic shock, tuberculosis, ulcerations (corneal, epidermal, gastric), ulcertive colitis, uremia, vasculitis, ventricular dilation, vesicular epidermolysis,.
The hydroxamic acid derivative or the prodrug thereof, or the pharmaceutically acceptable salt thereof may be administered orally or parenterally. Pharmaceutical forms for oral administration include for example tablets, pills, capsules, powders, granules, suspensions, emulsions, syrups and the like. Pharmaceutical forms for parenteral administration include for example intravenous injections such as drops, intramuscular injections, subcutaneous injections, intranasal preparations, eye drops, suppository, percutaneous preparations such as ointments, creams,
lotions, and the like.
The solid compositions such as tablets can be prepared by mixing the active compound with pharmaceutically acceptable conventional carriers or excipients such as lactose, sucrose, corn starch or the like; binders such as hydroxypropylcellulose, polyvinylpyrrolidone, hydroxypropylmethylcellulose or the like; disintegrating agents such as sodium carboxymethylcellulose, sodium starch glycolate or the like; lubricants such as stearic acid, magnesium stearate or the like; or preservatives or the like.
For parenteral administration, the active compound can be dissolved or suspended in a physiologically acceptable carrier such as water, saline, oil, dextrose solution or the like, which may contain auxiliary agents such as emulsifiers, stabilizers, salts for influencing osmotic pressure or buffers, if desired.
The dose for administration varies widely depending on the grade of the symptoms, the patient's age, body weight, sex, administration route, and the like. But the hydroxamic acid derivative is usually administered to an adult (ca.
60kg) in a dose of approximately 1-1,000 mg, preferably 5 -300 mg once or several times per day, by the oral route.
By the parenteral route, the hydroxamic acid derivative is usually administered to an adult (ca. 60kg) in a dose of approximately 0.1-200 mg, preferably 0.3-100 mg once or several times per day.
Examples The present invention is explained below precisely with examples but is, of course, not limited by them. The mass and purity of the samples were determined by LC/MS using a column of 4.6 x 50 mm from YMC (ODS-A column). The flow rate through the column was 3.5 ml/minute. About 100 gl/mln were split into the mass-spectrometer. The mass scan ranged from 200 to 700 amu. The determination of the purity of the samples was assigned through an W detector (wavelengths: 220 and 254 nm). The gradient employed was from 10 to 99% of mobile phase B (0.035% of TFA in acetonitrile) during a period of 5 minutes (see table below). Duration (min) Mobile Phase A Mobile Phase B 0.1 90 10 0.5 90 10 3.7 1 99 0.2 1 99 1 90 10 1 90 10 Solvent system: Mobile phase A: 0.05% TFA in water Mobile phase B: 0.035% TFA in acetonitrile Example 1 0 0 <\/ XOH °Y- (NHOH X HOOCt Nt Step 2/NF CHO SH cr c'D, SU F HPLC F
Stepl: 2- [2- (2-Fluorophenyl)-3- (2-phenylethyl)-4-oxo- thiazolidin-5-yl]-acetic acid A solution of phenylethylamine (85 gel), 2- fluorobenzaldehyde (143 1) and mercaptosuccinic acid (306 mg) and trimethyl orthoformate (0.5 mL) in THF (3 mL) was heated at 80 °C for 4 hrs. The reaction mixture was cooled, diluted with EtOAc (2 mL) and washed twice with 2 ml of 1N HC1. The organic layer was concentrated to give a residue that was used in the next step without further purification.
Step 2: 2- [2- (2-Fluorophenyl)-3- (2-phenylethyl)-4-oxo- thiazolidin-5-yl]-acetic acid N-hydroxyamide The residue from the previous step was dissolved in dry CH2C12 (1.5 mL) and pyridine (0.5 mL). Pentafluorophenyl trifluoroacetate (175 p1) was added and the mixture was stirred at room temperature for 1 hour. 0-TBS-hydroxylamine (200 mg) was added and the agitation was continued at room temperature for 12 hours. The reaction was diluted with CH2C12 (3 mL) and quenched by adding 6N HC1 (1.5 mL). The organic layer was washed with 2N HC1 (2 mL). The crude reaction mixture was purified by HPLC. The following compounds listed in the Table 1 were prepared in a similar manner. Table 1 NHOH 0 0 Ru 1 N RR 2 Example RR1 RR2 mol. Mass HPLC rt No. weight (m/e) (min) _-(CH2) 2-Ph-C6H4-2-F 374.(CH2) 2-Ph-C6H4-2-F 374. 44 375.2,342.2 3.05 2-CH (benzyl) C02Me-C6H2-5-Br-2,4- (OMe) 2 553.43 555.2 3.25 3- (CH2) 2-Ph-4-Py 357.43358.0,325.2 1.77 _-Benzvl-2-Thiazolvl 349.43 350.2,317.0 2.73 5-Benzyl-C6H4-4-CO2Me 400. 46 401.4,368.2 3.13 6-Benzyl-2-Furyl-5-Br 411.28 413.0,380.0,265.2 3.19 7-Benzyl H C/3 452.54 453.0,420.4 2. 83 _ O N o 8-(CH2) 2-Ph-3-lndolyl-5-OMe 425. 51-426. 2,(CH2) 2-Ph-3-lndolyl-5-OMe 425. 51-426. 2, 279.0 2.87 9-CH2-C6H3-2-F 4-Br-C6H4-4-OMe 469.33 0 3.15 10-CH2CHCI (CH2) 3CI-C6H3-2-NO2,3-OMe 466.34 466.2,433.2 3.35 11- (CH2) 511.2,448.0 3.66 12 (CH2) 4-Ph HaC CH, 474. 67 474. 2,441.4 3.02 s s 13- (CH2) 3-Ph-C6H4-4-OMe 400.50401.2,368.0 3.32 14- (CH2) 3-Ph 1-Naphthyl-4-NMe2 463.60 0,250.0 2.23 15-(CH2)(CH2) 3N (nBu) 2-2-Furyl-5- (C6H4-4-Br) 566.56 08 16-CH2CH (Me) Ph-C6H4-4-O-nBu 442.58 443.0,249.8 3.17 17-CH2C (Me) 2CH2NMe2-2-Furyl-5- (C6H4-4-CI 466.00 466.2 2.84 18-CH2 2-C6H4-4-OH-3-P rrol I-4-C02Et 2 5-Me2 1-Ph 537.64 2 3.36 19- (CH2) 2-C6H4-4-OH-C6H3-2,3- (OMe) 2 432.50 2 2.85 20 (CH2) 2-C6H3-3,4- (OMe) 2-2-Furyl-5-(C6H44-Br) 561.46 2 3.71 Example 21 O CHO O S OS N N Me0 NHz I \ Step 1, MeO Step 2 HOHN +-- HO COOH OMe OMe OMe
Step 1: 2-(4-Methoxyphenyl)-3-[(lS)-methoxycarbonyl-3- methylbutyl]-1,3-thiazolidine-4-one A solution of amino acid methyl ester (0.68 mmol) in 1 mL of THF was poured into a sealed tube containing molecular sieves 3A and a solution of the aldehyde (1.5 mmol) in dioxane (1 mL). The mixture was heated at 80 °C for 4 hours. Mercaptoacetic acid (17 Rl, 2.5 mmol, 3.7 equiv.) was added to the mixture and the heating was continued for additional 12 hours. The reaction mixture was cooled down, diluted with EtOAc (2 mL) and filtered to remove the molecular sieves. The filtrate was washed twice with 2 mL of aq Na2CO3 and evaporated to give an oil that was used in the next step without further purification.
Step 2: 3-l (lS)-(N-Hydroxyaminocarbonyl)-3-methylbutyl]- 2- (4-methoxyphenyl)-1,3-thiazolidine-4-one ROH (435 mg) and hydroxylamineHCl (340.2 mg) were dissolved in MeOH (2.14 mL and 3.4 mL respectively) at room temperature. Once a solution was obtained the KOH solution was poured into the hydroxylamine solution at 0 °C and the mixture was maintained at this temperature for
1 hour. The precipitate (KC1) was filtered off, and the filtrate was poured into the solution of the methyl ester (0.68 mmol) in MeOH (2 mL) and stirring was continued for additional 3 hours. Acetic acid (0.5 mL) was added to the mixture and the volume of the reaction was reduced to one third. The resulting viscous solution was diluted with water (2 mL) and EtOAc (5 mL). The organic layer was separated, evaporated and purified by HPLC.
The following compounds listed in the Tables 2,2'and 2''and Table 3 were prepared in a similar manner.
Table 2 Example RR1 RR2 RR3 moi. Mass HPLC rt No. weight m e min 21-iBu-C6H4-4-OMe-H 338.43 2,278.4 2.93 22-Benzyl-C6H4-2-Br-H 421.32 423. 0,390.0,362.0 3.28 23-Benzyl-C6H4-4-CF3-H 410.42 2,350.0 3.42 24-Benzyl-C6H3-3,4-methylenedioxy-Me 400.46 2 3.27 25-Benzyl 2-Furyl-5-(C6H4-4-NO2) H 453.(C6H4-4-NO2) H 453. 48 453.8,421.2,393.2 3.44 26-Benzyl F F-H 496.53 0,436.2 3.63 s-F zizi N-N H3C 27-Benzyl-C6H4-4-n-pentyl-H 412.56 413. 2,380.2,352.0 4.08 28-Benzyl-C6H3-3-N02,4-CI-H 421.86 2,361.4 3.49 29-Benzyl-C6H4-4-CO2Me-H 400.46 401.0, 368. 0,340.0 3.16 30-Benzy)-C6H4-4-CH20- (Ph-4-N02)-H 493.54 2 3.47 31-Benzyi-4-lmidazolyl-5-Me-H 346. 41 348. 2 2.20 32-Benzyl-C6H3-3-NO2,4-S (C6H4-4-Br)-H 574.48 575.4 3.36 33-iBu-2-Pyridyl-6-Me-H 323.42324.2,149.2 2.00 34-iBu-C6H4-4-N CH2CH2CN) 2-H 429.55430.0,369.0 2.86 35-CH2-C6H4-4-OH-3-Furyl-H 348.38 15 36-CH2-C6H4-4-OH-2-Thienyl-5-Me-H 378. 47 379.2,346.0,282.42.49 37-iPr-CH (CN)-C6H4-4-CI-H 367.86 2. 2.47 38-CH2-3-indolyl CH3-H 461.59 401 3.32 - 39-CH2-3-indolyl-H 487.60488.0,455.2 3. 30 S = 40-CH2-3-indolyl-2-Furyl-5-(C6H4-4-CI)-H 481. 96 482. 2,(C6H4-4-CI)-H 481. 96 482. 2, 449.0 3.19 41-CH2-3-indolyl-2-Furyl-5- (C6H4-4-Br)-H 526. 41 528. 0,495,467 3.21 42-iBu CH3-H 388.53 328.2 3.62,3.68 43-iBu-H 414.55415.2,382,354.2 3. 52 Y 44-Bu CH3--H 37S. 52 0 3. 25 six s- 45-iBu-2-Furyl-5-C6H4-3-CF3-H 442. 46 443. 2,410.2,382 3. 41 46-iBu-2-Furyl-5- (C6H4-4-CI)-H 408.91 348.2 3. 40 47-iBu-2-Furyl-5- (C6H4-4-Br)-H 453.36 394 3.44 48-iBu-3-Py-H 309.39310.2,277,249.2 1. 37 49-Bu-4-Py H 309. 39 2 0.94 50-iBu-2-Naphthyl-6-OMe-H 388.49 328.2 3.14 51-iBu-C6H4-4-OH-H 324.40 264.0 2.71 52-Benzyl-H 384.46 3.14,3.20 i 0 53-Benzyl CH3-H 422.55423.2,390,362.2 4. 06 v 54-Benzyl-H 448.57 2,388 3. 97 - 55-Benzyl-2-Furyl-5-(C6H4-4-CI)-H(C6H4-4-CI)-H 442.92 443. 2 3.78 56-Benzyl-2-Furyl-5- (C6H4-4-Br)-H 487.38 84 57-Benzyl-C6H4-4-OH-H 358.42 2 2.79 58-iBu-C6H3-3-F, 4-OMe-H 356.42 2,296.2 2.89 59-H-C6H2-2,4,5- (OMe) 3-H 342.37 0,251. 0 2.22 60-H F F-H 406.41 407.2,374.0 2.89 S'- F N-N HIC 61-(CH2) 2-Ph-C6H4-4-OMe-H 386.(CH2) 2-Ph-C6H4-4-OMe-H 386. 47 387.2,354.3. 31 62-CH2-C6H4-4-Ph-C6H4-4-OMe-H 448.55 2,388.2 3.74 63-CH2-2-Naphthyl-C6H4-4-OMe-H 422.51 423.2,390.2,316.2 3. 55 64-Benzyl-C6H4-4-OCHF2-H 408.43 2,247.2 3.14 65-Benzyl-C6H4-4-SO2Me-H 420.51 2,286.2 2.63 66-iBu-C6H4-4-Br-H 387. 30 0 3. 30 67-Me-2-Pyrrolyl-1-S02- (C6H4-4-Me)-H 409.49 2 2. 85 68-CH2-3-indolyl-C6H4-4-OMe-H 411.48 2,351 3. 12 69-CH2-3-indolyl-C6H4-4-O-nBu-H 453.56 3.67 70- (CH2) 2SCH3-C6H4-4-OMe-H 356.47 2 2.93 71- (CH2) 2SCH3-C6H3-3-F, 4-OMe-H 374.46 2 2.90 72-CH2-cyclohexyl-C6H4-4-OMe-H 378. 49 379.2,346,318.0 3. 41 73-CH2-cyclohexyl-C6H4-4-O-nBu-H 420.58 360.2 4.05 74-CH2-cyclohexyl-C6H3-3-F, 4-OMe-H 396.48 336.2 3.42 75-CH2S-benzyl-C6H4-4-OMe-H 418.54 2,358 3.36 76-CH2S-benzyl-C6H3-3-F, 4-OMe-H 436.53 2,376 3.39 77-CH2-C6H4-4-OH-C6H4-4-OMe-H 388.45 328.2 83 78-CH2-C6H4-4-OH-C6H4-4-O-nBu-H 430.53 370.2 3.49 79-CH20-tBu-C6H4-4-OMe-H 368.46 252.0 3.29 80-CH20-tBu-C6H3-3-F, 4-OMe-H 386. 45 387. 0,331.2,298,270.2 3.33 81-nBu-C6H4-4-OMe-H 338.43 339. 2,306,278.0 3.18 82-nBu-C6H4-4-Me-H 322.43 323. 2,290,262.2 3.40 83-nBu-C6H3-3-F, 4-OMe-H 356.42357.2,324,296.2 3. 21 84-CH2-C6H4-4-OH-2-Furyl-5- (C6H4-3-N02)-H 469.48 470.2,437,409.2 3.04 85-Ph-C6H4-4-SMe-H 374.48 4 3. 09 86-CH2-C6H4-4-OH-C6H4-4-CI-H 392.86 90 87-iBu-C6H4-4-CI-H 342.85 343. 2, 310,282.2 3.10,3.22 88-iBu F. F-H 462.52 463.0,430,402.2 3.43 -P HAN HC 89-iBu-C6H4-4-0 (CH2) 3NMe2-H 409.55 2 2. 32,2.45 90-iPr-C6H4-4-OMe-H 324.40 2,264 3.11 91-iBu-C6H3-3, 4-methylenedioxy-H 352. 41 353.2,320.2,292.2 3.15 92-iBu-C6H4-4-OMe-H 338. 43 339.2,306.2,278.2 3.18 93-Me-C6H4-4-Br-H 345.22 0 3.05 94-CH (OH) CH3-C6H4-4-CI-H 330.79 0,270.0 2.66 95-nBu-C6H4-4-SMe-H 354.49 2,394.2 3.27 96-CH20-tBu-C6H4-4-O-nBu-H 410.54 2,294.0 3.93 97-CH2-cyclohexyl-C6H4-i-OPh H 440. 57 2,380.2 3.66 98 -CH2-cyclohexyl -C6H4-4-Ph -H 424.57 425.0, 392.0, 364.0 3.64 99 -CH2-cyclohexyl -Ph -H 348.47 349.2, 316.2, 288.2 3.21 100 -Me -C6H4-4-OPh -H 358.42 359.0, 326.0, 298.2 3.00 101 -nBu -C6H4-4-OPh -H 400.50 401.2 368.2, 340.2 3.38 102 -nBu -C6H4-4-OPh -H 384.50 385.2, 352.2, 324.2 3.39 103 -CH2-3-indolyl -C6H4-4-OMe -H 411.48 412.2, 379.2, 351.2 2.90 104 -Ph -C6H4-4-OMe -H 358.42 359.0, 326.0, 298.2 2.80 105 -CH2O-tBu -C6H4-4-OMe -H 368.46 369.2, 313.2, 280.2, 252.0 2.96 106 -nPr -C6H4-4-OMe -H 324.40 325.2, 292.2, 264.0 2.71 107 -CH2-(1-benzylimidazol-4-yl) -C6H4-4-OMe -H 452.54 453.2, 420.2, 392.0 2.53 108 -Me -C6H4-4-OMe -H 296.35 297.2, 264.2, 236.2 2.41 109 -CH2-C6H4-4-O-TBu -C6H4-4-OMe -H 444.55 45.2, 412.2 384.0, 328.2 3.26 110 -uBu -C6H4-4-OMe -H 338.43 339.2, 306.2, 278.2 2.88 111 -CH2-3-indolyl -C6H3-3-F,4-OMe -H 429.47 430.2, 397.2, 369.2 2.90 112 -nBu -C6H4-4-Cl -H 342.85 343.2, 310.2, 282.2 3.11 113 -(CH2)2SCH3 -C6H4-4-OPh -H 418.54 419.0, 386.0, 358.0 3.06 114 -CH2S-benzyl -C6H4-3-Me -H 402.54 403.2, 370,0, 342.2 3.07 115 -CH2S-benzyl -C6H4-4-SMe -H 434.60 435.2, 402.2, 374.2 3.09 116 -CH2S-benzyl -C6H4-3-Cl -H 422.96 423.0, 390.0, 362.0 3.11 117 -CH2S-benzyl -C6H4-4-Cl -H 422.96 423.0, 390.0, 362.0 3.14 118 -CH2S-benzyl -C6H4-4-OPh -H 480.61 481.4, 448.2, 420.4 3.32 119 -CH2O-tBu -C6H4-4-SMe -H 384.52 385.2, 329.2, 296.2, 268.2 3.35 120 -CH2-3-indolyl -C6H4-4-F -H 399.45 400.2, 367.0, 399.2 3.74 121 -CH2-3-indolyl -C6H4-4-Cl -H 415.90 416.2, 383.0 3.95 122 -CH2-C6H4-4-OH -C6H4-4-SMe -H 404.51 405.2, 372.2, 344.0 3.59 123 -CH2-C6H4-4-OH -C6H4-4-SMe -H 404.51 405.2, 372.2, 344.0 2.91 124 -CH2-C6H4-4-OH -C6H4-4-OCF3 -H 442.42 443.2, 410.2, 382.2 3.12 125 -CH2-3-indolyl -C6H4-4-SMe -H 427.55 428.2, 395.2, 367.2 3.30 126 -CH2-3-indolyl -C6H4-4-F -H 399.45 400.2, 367.2, 399.2 3.20 127 -Me -C6H4-4-OPh -H 358.42 359.2, 326.2, 298.2 3.23 128 -CH2-C6H4-4-OH -C6H4-4-OPH -H 450.52 451.0, 418.0. 390.0 3.29 129 -iBu -C6H4-4-SMe -H 354.49 355.2, 322.2, 294.2 2.91 130 -iBu -C6H4-4-Cl -H 342.85 343.2, 310.2, 282.2 2.89 131 -iBu -C6H3-3-F. 4-OMe -H 356.42 357.0, 324.0, 296.2 2.90 132 -iBu -C6H4-4-Cl -H 342.85 343.2, 310.2, 328.2 3.03 133 -iBu -C6H4-4-Br -H 387.80 389.2, 356.2, 328.2 3.04 134 -Benzyl -C6H4-4-SMe -H 388.51 389.2, 356, 328.2 3.33, 3.37 135 -iPr -C6H4-4-nBu -H 350.48 351.2, 318, 290.0 3.42 136 -(CH2)2SCH3 -C6H4-4-SMe -H 372.53 373.0, 340, 312.0 2.98 137 -(CH2)2SCH3 -C6H4-4-Cl -H 360.88 361.0, 328, 300.0 3.01 138 -(CH2)2SCH3 -C6H4-4-Br -H 405.34 407,374, 346.0, 298.2 3.04,3.11 139 -(CH2)2CH3 -C6H4-4-OPh -H 418.54 419.0, 386, 358.0, 310.2 3.30 140 -nPr -C6H4-4-SMe -H 340.47 341.2, 308, 280.0 2.97 141 -nPr -C6H4-4-Cl -H 328.82 329.2, 396, 268.0 2.94, 3.01 142 -nPr -C6H4-4-Br -H 373.27 375.0, 342, 314 2.98, 3.07 143 -nPr -C6H4-4-OPh -H 386.47 387.0 354, 326.2 3.30 144 -CH2-cyclohexyl -C6H4-4-SMe -H 394.56 395.2, 362, 334.4 3.40 145 -CH2-cyclohexyl -C6H3-3-F,4-OMe -H 396.48 387.2, 364,4 336.2 3.26 146 -CH2-cyclohexyl -C6H4-4-F -H 366.46 467.0, 334, 306.2 3.29 177 -CH2-cyclohexyl -C6H4-4-Cl -H 382.91 383.0, 350, 322.2 3.44 148 -CH2-cyclohexyl -C6H4-4-Br -H 427.36 429.2, 396, 368.0 3.49 149 -CH2-cyclohexyl -C6H4-4-OPh -H 440.57 441.2, 308, 380.2 3.69 150 -nBu -C6H4-4-SMe -H 354.49 355.2, 322, 294.0 3.14 151 -nBu -C6H3-3-F, 4-OMe -H 356.42 357.0, 324, 296.2 2.96 152 -nBu -C6H4-4-F -H 326.39 327.2, 294, 266.0 3.00 153 -nBu -C6H4-4-Cl -H 342.85 343.0, 310, 282.0 3.15 154 -nBu -C6H4-4-Br -H 387.30 389.0, 356, 328.2 3.21 155 -nBu -C6H4-4-OPh -H 400.50 401.2, 368, 340.2 3.48 156 -nBu -C6H4-3-OCF3 -H 392.40 393.0, 360, 332.2 3.29 157 -CH2-(1-benzylimidazol-4-yl) -C6H4-4-F -H 440.50 441.4, 408.2 2.63 158 -CH2-(1-benzylimidazol-4-yl) -C6H4-4-Br -H 501.41 503.2 2.74,2.80 159 -CH2-C6H4-4-O-tBu -C6H4-4-SMe -H 460.62 461.2, 428, 400.2 3.49 160 -CH2-C6H4-4-O-tBu -C6H3-3-F, 4-OMe -H 462.54 463.2, 430, 402.2, 346.0 3.35 161 -CH2-C6H4-4-O-tBu -C6H4-4-F -H 432.52 433.2, 400.2, 372, 316.2 3.35 162 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H 448.97 449.0, 416.2, 388, 332.0 3.51 163 -CH2-C6H4-4-O-tBu -C6H4-4-Br -H 493.42 495.2, 462, 434.0, 378.0 3.34 164 -CH2-C6H4-4-O-tBu -C6H4-4-OPh -H 506.63 507.2, 474, 446.2, 390.0 3.75 165 -Benzyl -C6H4-4-SMe -H 388.51 389.0, 356, 328.2 3.20 166 -Benzyl -C6H4-4-Cl -H 376.86 377.0, 344, 316.2 3.22 167 -Benzyl -C6H4-4-Br -H 421.32 423.0, 390, 362.0 3.28 168 -Benzyl -C6H4-4-OPh -H 434.52 435.2, 402, 374.0 3.49 169 -(CH2)4NHCO2-tBu -C6H4-4-OMe -H 453.56 454.2, 398.2, 354.2 3.12 170 -CH2CH2CO2-tBu -C6H4-4-OMe -H 410.59 411.2, 355.2, 322.2 3.14 171 -CH2-4-imidazolyl -C6H4-4-OMe -H 362.41 363.2, 302.2 2.02, 2.10 172 -iPr -C6H4-4-SMe -H 340.47 341.0, 308, 280.2 2.86 173 -secBu -C6H4-4-Cl -H 342.85 343.0, 310, 282.0 3.02 174 -secBu -C6H4-4-F -H 326.39 327.0, 294, 266.2 2.85 175 -secBu -C6H3-3-F,4-OMe -H 356.42 357.2, 324, 296.2 2.89 176 -secBu -C6H4-4-SMe -H 354.49 355.2, 322.2, 294 3.32 177 -(CH2)4NH2 -C6H4-4-OMe -H 353.44 354.2, 321.2 2.16 178 -(CH2)2CO2H -C6H4-4-OMe -H 354.38 354.8, 337.2 2.62, 2.69 179 -ipr -C6H4-4-OPh -H 386.47 387.0, 354, 326.2 3.27 180-iPr-C6H4-4-O-ben I-H 400. 50 401. 2.268,340.0 3.31 .. zy s316.2 3.22181-Benzyl-C6H4-4-CI-H 376. 86 377. 2, 344, 182-Benzyl-C6H4-4-Br-H 421. 32 423. 0, 390,362.0 3.27 183-Benzyl-C6H4-4-OPh-H 434. 52 435. 2, 402,374.0 3.49 184-CH20-tBu-C6H4-4-CI-H 372.87 373.0,317.0,284.0,256 3.32 185-CH20-tBu-C6H4-4-Br-H 417. 32 419.0,363.0,330,302 3.38 186-CH2- (1-benzylimidazol-4-yl)-C6H4-4-SMe-H 468. 60 469. 2 2.77 187-CH2-1-benzylimidazol-4-I-C6H4-4-CI-H 456. 95 457. 2 2.76 188-CH2- (1-benzylimidazol-4-yl)-C6H4-4-OCF3-H 506. 51 507. 2,474.2 2.95 189-CH2-C6H4-4-OH-C6H3-3-F, 4-CI-H 410.85 410.8,350.2 2.79 190-CH2-C6H4-4-OH-2-Thienyl-5-SMe-H 410. 54 411. 4,349.8 2.83 191-CH2-C6H4-4-OH-C6H3-2-F,4-OMe-H 406. 44 407. 2, 374,346.0 2.90 192-iBu-C6H4-4-O-allyl-H 364. 47 365. 2,332,304.2 3.40 193-nBu-2-Thienyl-5-CI-H348.87 349.0,316,288.0 3. 41 194-nBu-H 366. 44 367. 2,334.2,306 2. 95 rr 0 195-nBu 2-Benzofuranyl-H 348. 42 349. 2,316,288.23.31 196-CH2-C6H4-4-OH-C6H4-4-Br-H 437. 32 436. 8,404,376.2 2.79 197-Benzyl-C6H3-2-F, 5-OMe-H 390. 44 391.0,358.2,330 2.92 198-Benzyl-2-Furyl-5-(C6H4-2-CI)-H 442. 92 443.(C6H4-2-CI)-H 442. 92 443. 2,410.2,382 3.33 199-Benzyl-C6H3-2-F,4-OMe-H 390. 44 391. 0,358.2,330 2. 91 200-iBu-C6H3-2-F,4-OMe-H 356. 42 357. 2,324.4,296 2.80 201-CH2-C6H4-4-OH-2-Thienyl-4-Br-H 443. 34 445. 0,383.8 2.70 202-CH2-C6H4-4-OH-2-Thienyl-5-Br-H 443. 34 444.8,384 2.72 203-CH2-C6H4-4-OH-2-Thienyl-5-CI-H 398. 89 399. 0,338.02.67 204-CH2-C6H4-4-OH-C6H3-2-F, 4-Br-H 455. 31 457. 2, 396 2.91 Table2' Example RR1 RR2 mol. Mass HPLC rl NO. weitht (m/e) (min 447 -Cyclohexyl -OMe 364.5 365.2, 332.2, 304 3.48 448 -Cyclohexyl -OMe 364.5 365.2, 332.2, 304 3.58 449 -iBu -Cl 342.8 343.0, 310, 282.2 3.09 450 -iBu -Cl 342.8 343.0, 310, 282.2 3.13 451 -iBu -O-C6H4-4-F 418.5 419.2, 386, 358.2 3.45 452 -iBu -O-C6H4-4-Cl 434.9 435.2, 374.2 3.74 453 -iBu -Cl 342.8 343.0, 310, 282.2 3.09 454 -CH2-2-imidazolyl -Cl 366.8 367.0, 334, 306 1.85 455 -(CH2)3NHC(NH)NH2 -Cl 385.9 386.2, 353.0 2.26 456 -(CH2)2CO-piperidino -Cl 425.9 426.2, 393, 365.0 2.82 457 -(CH2)3NHCOOCH2Ph -Cl 478.0 478.2 3.16 458 -(CH2)2CONM32 -Cl 385.9 386.2, 353, 325.0 2.58 459 -(CH2)3NHOO-tBu -Cl 444.0 444.2, 388.2 3.29 460 -iBu -NEt2 379.5 380.2 3.49 Table2" Example RR1 RR2 mol. Mass HPLC rl NO. weitht (m/e) (min 461 -iBu -2-Thienyl 314.4 315.0, 3.29 462 -iBu -2-Thienyl-5-Br 393.3 393.0, 360, 3.59 463 -iBu -2-Thienyl-5-Br 393.3 393.0, 360, 3.58 464 -iBu -2-Thiazolyl 315.4 316.0 2.89 465 -Benyl -2-Thienyl 348.4 349.0, 316, 3.34 466 -Benyl -2-Thienyl-5-Br 427.3 429.0, 427, 3.59 I _ Table3 °YA- RR1 nus RR 2 Example RR1 RR2 welght Mass HPLC rt No. weight (m/e) (m n) 205- (CH2) 3CONHOH-C6H4-4-Br 359.2 361.0,328, 300 2.79 206- (CH2) 3CONHOH-C6H3-3, 4-methylenedioxy 324.4 325.2,292,264.2 2.46 207-(CH2) 2CONHOH-C6H4-4-OMe 296.(CH2) 2CONHOH-C6H4-4-OMe 296. 3 297.0,264.0 2.30 208-CH (C02Me) CH2CONHOH-C6H4-4-Br 403.3 405.0,371.8,344.0 3.07
Example 209 0 0 OH 0 0 CHO N s N NH2 Me0 Step 2 Me0 Step 1_- /SH COOH, OMe OMe OYE , 0 0 O O S (S Step 3/S/N (S MET HO I I OMe OMe Step 1: 2-(4-Methoxyphenyl)-3-1 (lS)-methoxycarbonyl-2- phenylethyl]-4-oxo-thiazolidin-5-yl)-acetic acid A suspension of (L)-phenylalanine methyl ester (147 mg) and triethylamine (95 » 1) in 1 mL of THF was stirred at room temperature for 5 minutes. The solution was filtrated and then poured into a sealed tube containing 3A molecular sieves and a solution of p-methoxybenzaldehyde (183 » 1) in dioxane (1 mL). The mixture was heated at 80 °C for 4 hours.
Mercaptosuccinic acid (375 mg) was added to the mixture and the heating was continued for an additional 12 hours. The reaction was cooled, diluted with EtOAc (2 mL) and filtered to remove the molecular sieves. The filtrate was washed twice with 2 ml of 1N HC1 and evaporated to give a solid residue that was used in the next step without further purification.
Step 2: (2-(4-Methoxyphenyl)-3-[(lS)-methoxycarbonyl-2- phenylethyl]-4-oxo-thiazolidin-5-yl)-acetic acid N- methylamide The crude carboxylic acid from step 1, diisopropylethylamine (178 » 1), HOBT (138 mg) and EDC. HC1 (196 mg) were dissolved in CH2C12 (2 mL) and the reaction mixture was stirred at room temperature for 1 hour.
Methylamine (254 gel, 8.03 M in ethanol) was added to the mixture and stirring was continued for an additional 12 hours. The reaction was diluted with CH2C12 (5 mL) and washed with 1N HC1 (2 x 1.5 mL), water (1.5 mL) and brine (1.5 mL). The organic layer was concentrated In vaouo and the crude product was used in the next step.
Step 3: 2-t3-t (lS)-(N-Hydroxycarbamoyl)-2-phenylethyl]-2- (4-methoxyphenyl)-4-oxo-thiazolidin-5-yl]]-N- methylacetamide KOH (435 mg) and hydroxylamineHCl (340 mg) were dissolved in MeOH (2.14 mL and 3.4 mL respectively) at room temperature. Once a solution was obtained, the KOH solution was poured into the hydroxylamine solution at 0 °C and the mixture was maintained at this temperature for 1 hour. The precipitate (RC1) was filtered off. The filtrate was added into the solution of the methyl ester (obtained in step 2) in MeOH (2 mL) and stirring was continued for an additional 3 hours. Acetic acid (0.5 mL) was added to the mixture and the volume of the reaction was reduced to one third. The
resulting viscous solution was diluted with water (2 mL) and EtOAc (5 mL). The organic layer was separated, evaporated and purified by HPLC.
The following compounds listed in the Tables 4,4'and 4''were prepared in a similar manner.
Table 4 Example mol. Mass RR1 RR2 RR3 RR4 No. weight (m/e) 209 -Benzyl -C6H4-4-OMe -H -Me 443.53 444.2, 411, 383.2 210 -Benzyl -C6H4-4-OMe -H -OH 445.50 447.2, 413.2, 386.2 211 -Benzyl -C6H4-4-OMe -H -CH2-3-Py 520.61 521.4 460.2 212 -iBu -C6H4-4-OMe -H -CH2-C6H4-4-Me 499.63 500.2, 467.4, 439 213 -iBu -C6H4-4-OMe -H -CH2-C6H4-4-Me 499.63 500.2, 467.4, 439 214 -iBu -C6H4-4-OMe -H -CH2-3-furyl 475.57 476.2, 443.2, 415 215 -iBu -C6H4-4-OMe -H -CH2-3-furyl 475.57 476.2, 443.2, 415 216 -iBu -C6H4-4-OMe -H -Benzyl 485.61 486.2, 453.2, 425 217 -iBu -C6H4-4-Cl -H -CH2-2-furyl 479.99 480.2, 447.0 419 218 -iBu -C6H4-4-Cl -H -CH2-2-furyl 479.99 480.2, 447.0 419 219 -iBu -C6H4-4-Cl -H -CH2-2-furyl 479.99 480.2, 447.0 419 220 -iBu -C6H4-4-Cl -H -Benzyl 490.03 490.2, 457.2, 429 221 -iBu -C6H4-4-Cl -H -Benzyl 490.03 490.2, 457.2, 429 222 -iBu -C6H4-4-Cl -H -Benzyl 490.03 490.2, 457.2, 429 223 -iBu -C6H4-4-Cl -H -Cyclopentyl 468.02 468.4, 435.2, 407 224 -iBu -C6H4-4-Cl -H -Cyclopentyl 468.02 468.4, 435.2, 407 225 -iBu -C6H4-4-Cl -H -Cyclopentyl 468.02 468.4, 435.2, 407 226 -iBu -C6H4-4-Cl -H -(CH2)2OMe 457.98 458.2, 425.2, 397 227 -iBu -C6H4-4-Cl -H -(CH2)2OMe 457.98 458.2, 425, 397 228 -iBu -C6H4-4-Cl -H -(CH2)2OMe 457.98 458.2, 425, 397 229 -iBu -C6H4-4-OMe -H -iPentyl 465.62 466.4, 433.2, 405 230 -iBu -C6H4-4-OMe -H -3-isooxazolyl-5-me 476.56 477.2, 444.2 231 -iBu -C6H4-4-OMe -H -CH(Me)CH2OMe 467.59 468.l4, 435.2, 407 232 -iBu -C6H4-4-OMe -H -Cyclopentyl 463.60 464.4, 431.2. 403 233 -iBu -C6H4-4-OMe -H -Cyclopentyl 463.60 464.4, 431.2. 403 234 -iBu -C6H4-4-OMe -H -Et 423.54 424.2, 391, 363.2 235 -iBu -C6H4-4-OMe -H -Et 423.54 424.2, 391, 363.2 236 -iBu -C6H4-4-OMe -H -Allyl 435.55 436.2, 403, 375.2 237 -iBu -C6H4-4-OMe -H -Allyl 435.55 436.2, 403, 375.2 238 -iBu -C6H4-4-OMe -H -iBu 451.59 452.2, 419.2, 391 239 -iBu -C6H4-4-OMe -H -Cyclohexyl 477.63 478.2, 455.2, 417 240 -iBu -C6H4-4-OMe -H -iPr 437.56 438.2, 405.2, 377 241 -iBu -C6H4-4-OMe -H -iPr 437.56 438.2, 405.2, 377 242 -iBu -C6H4-4-OMe -H -iPr 437.56 438.2, 405.2, 377 243 -iBu -C6H4-4-OMe -H -Ph 471.58 472.2, 437.2, 411 244 -iBu -C6H4-4-OMe -H -Ph 471.58 472.2, 437.2, 411 245 -iBu -C6H4-4-OMe -H -2-Py 472.57 473.2, 412.2 246 -iBu -C6H4-4-OMe -H -(CH2)3OMe 467.59 468.4, 435.2, 407 247 -iBu -C6H4-4-OMe -H -(CH2)3-1-(2-Me-piperidyl) 534.72 450.2, 417.2, 389 248 -iBu -C6H4-4-OMe -H -(CH2)2OMe 453.56 454.2, 421.2, 393 249 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -CH2-C6H4-4-OMe 626.18 626.4 250 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -CH2-C6H4-4-OMe 626.18 626.4 593.4 251 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -CH2-C6H4-4-OMe 626.18 626.4 593.2, 565 252 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -CH2-C6H4-4-Me 610.18 610.2, 577, 549.4 253 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -CH2-3-Py 597.14 597.2 254 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -3-lsooxazolyl-5-Me 587.10 587.2, 531.0, 470.2 255 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -3-lsooxazolyl-5-Me 587.10 587.2, 531, 470.2 256 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -C(Me)2OMe 578.13 578.2. 517.2 257 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -C(Me)2OMe 578.13 578.2. 545, 517.2 258 -iBu -C6H4-4-Cl -H -Ph 476.00 476.0, 443.2, 415 259 -iBu -C6H4-4-Cl -H -iPr 441.98 442.4, 409.2, 381 260 -iBu -C6H4-4-Cl -H -nPr 441.98 442.4, 409, 381.2 261 -iBu -C6H4-4-Cl -H -iBu 456.01 456.2, 423.2, 395 262 -iBu -C6H4-4-Cl -H -Allyl 439.96 440.2, 407, 379.2 263 -iBu -C6H4-4-Cl -H -Et 427.95 428.2, 395, 367.0 264 -iBu -C6H4-4-Cl -H -CH2-cyclopropyl 453.99 454.2, 421.2, 393 265 -iBu -C6H4-4-Cl -H -CH2-C6H4-4-OMe 520.05 520.4, 487.2, 459 266 -iBu -C6H4-4-Cl -H -CH2-C6H4-4-Me 504.05 504,0, 471.2, 443 267 -iBu -C6H4-4-Cl -H -2-Py 476.99 477.2, 416.2 268 -iBu -C6H4-4-Cl -H -(CH2)3-1-(2-Me-piperidyl) 539.14 539.4 269 -iBu -C6H4-4-Cl -H -iPentyl 470.04 470.2, 437.2, 409 270 -iBu -C6H4-4-Cl -H -(CH2)3OMe 472.01 472.2, 439.2, 411 271 -iBu -C6H4-4-Cl -H -C(Me)2OMe 472.01 472.2, 439.2, 411 272 -iBu -C6H4-4-Cl -H -(CH2)2-2-Py 505.04 505.2, 472.2 273 -iBu -C6H4-4-Cl -H -CH2-Py 491.01 491.2, 430.2 274 -iBu -C6H4-4-Cl -H -3-lsooxazolyl-5-Me 480.97 481.2, 448.0, 420 275 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -Et 534.08 534.2, 473.2 276 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -Et 534.08 534.2, 501, 473.2 277 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -Et 534.08 534,2, 501, 473.2 278 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -Allyl 546.09 546.2, 485.2 279 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -Allyl 546.09 546.2, 513, 485.2 280 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -Cyclohexyl 588.17 588.2, 527.4 281 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -iPr 548.11 548.4, 487.2 282 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -iPr 548.11 548.4, 515, 487.2 283 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -nPr 548.11 548.4, 515, 487.2 284 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -nPr 548.11 545.4, 487.2 285 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -2-Py 583.11 583.2, 522.4 286 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -2-Py 583.11 583.2, 522.4 287 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -2-Py 583.11 583.2, 522.4 288 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -Ph 582.12 582.2, 549, 521.4 289 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -CH2-cyclopropyl 560.12 560.2, 527, 499.2 290 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -CH2-cyclopropyl 560.12 560.2, 499.2 291 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -nPr -nPr 590.19 590.4, 529.2 292 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -4-Py 582.11 583.2 293 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -4-Py 583.11 583.2, 527.2 294 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -Benzyl 596.15 596.2, 563, 535.2 295 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -Cyclopentyl 574.14 574.4, 513.4 296 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -iPentyl 576.16 576.4, 543, 515.2 297 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -(CH2)3OMe 578.13 578.2, 517.2 298 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -(CH2)3OM3 578.13 578.2, 517.2 299 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -(CH2)3-1-(2-Me-piperidyl) 645.27 645.4 300 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -(CH2)2-2-Py 611.17 611.2 301 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -(CH2)2-2-Py 611.17 611.2 302 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -CH2-2-furyl 586.11 586.2, 525.2 303 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -CH2-2-furyl 586.11 586.2, 553, 525.2 304 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -CH2-2-furyl 586.11 586.2, 525.2 305 -iBu -C6H4-4-Cl -nPr -nPr 484.06 484.2, 451, 423 306 -iBu -C6H4-4-Cl -nPr -nPr 484.06 484.2, 451.0 307 -Benzyl -C6H4-4-OMe -H -Me 443.53 444.2, 411, 383.2 308 -Benzyl -C6H4-4-OMe -H -CH2-C6H$-4-OMe 549.65 550.4, 489.2 309 -Benzyl -C6H4-4-OMe -H -CH2-C6H4-4-OMe 549.65 550.4, 517.4, 489 310 -iBu -C6H4-4-OMe -H -CH2-cyclopropyl 449.57 450.2, 417.2, 389 311 -iBu -C6H4-4-OMe -H -CH2-cyclopropyl 449.57 450.2, 417.2, 389 312 -iBu -C6H4-4-OMe -H -CH2-C6H4-4-OMe 515.63 516.2, 483.2, 455 313 -iBu -C6H4-4-OMe -H -CH2-C6H$-4-OMe 515.63 516.2, 483.2, 455 314 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -iBu 562.13 562.4, 501.2 315 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -(CH2)2OMe 564.11 564.2, 503.2 316 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -(CH2)2OMe 564.11 564.2, 503.2 317 -iBu -C6H4-4-Cl -H -(CH2)3SMe 488.07 488.2, 455.2, 427 318 -iBu -C6H4-4-Cl -H -(CH2)3SMe 488.07 488.2, 455.2, 427 319 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -(CH2)3SMe 594.20 594.2, 533.2 320 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -nBu 562.13 562.2, 501.2 321 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -nBu 562.13 562.2, 529, 501.2 322 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -nBu 562.13 562.2, 501.2 323 -iBu -C6H4-4-Cl -H -Cyclohexyl 482.05 482.2, 449.2, 421 324 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -Me 515.63 516, 483, 455 325 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -Me 520.05 520.4, 459.2 326 -CH2-C6H4-4-O-tBu -C6H4-4-Cl -H -Me 520.05 520.4, 487, 459.2 327 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -iPentyl 571.74 572.4, 539, 511.4 328 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -(CH2)3OMe 573.71 574.4, 513.4 329 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -(CH2)3OMe 573.71 574.4, 541, 513.4 330 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -(CH2)3-1-(2-Me-piperidyl) 640.85 641.4 331 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -(CH2)2-2-Py 606.75 607.2, 574.2 332 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -(CH2)2-2-Py 606.75 607.2 333 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -CH2-2-furyl 581.69 582.2, 549, 521.4 334 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -Benzyl 591.73 592.4, 559, 531.2 335 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -4-Py 578.69 679.2, 518.2 336 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -Cyclopentyl 569.73 570.4, 537, 509.4 337 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -Cyclopentyl 569.73 570.4, 537, 509.4 338 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -(CH2)2OMe 559.69 560.2, 527.2, 499 339 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -(CH2)3SMe 589.78 590.2, 557.2, 529 340 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -nBu 557.71 558.2, 525, 497.4 341 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -nBu 557.71 558.2, 525, 497.4 342 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -(CH2)3SMe 589.78 590.2, 557, 529.2 343 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -C(Me)2OMe 573.71 574.4, 541, 513.4 344 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -3-Isooxazolyl-5-Me 582.68 583.2, 522 345 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -C(Me)2OMe 573.71 574.4, 541, 513.4 346 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -3-iSOOXAZOLYL-5-mE 582.68 583.2, 550, 522.2 347 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -CH2-4-Py 592.72 593.4 348 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -Et 529.66 530.2, 497, 469.4 349 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -Et 529.66 530.2, 497, 469.4 350 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -Allyl 541.67 542.4, 509, 481.4 351 -CH2-C6H4-4-O-tBu-C6H4-4-OMe -H -Allyl 541.67 542.4, 509, 481.2 352 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -iBu 557.71 558.2, 525, 474.4 353 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -iBu 557.71 558.2, 525, 497.4 354 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -Cyclohexyl 583.75 584.2, 551, 523 355 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -iPr 543.69 544.4, 511, 483.4 356 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -iPr 543.69 544.4, 511, 483.4 357 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -nPr 543.69 544.4, 511, 483.4 358 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -nPr 543.69 544.4, 511, 483.4 359 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -Ph 577.71 578.2, 545.2, 517 360 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -2-Py 578.69 579.2, 518.2 361 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -2-Py 578.69 579.2, 518.2 362 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -CH2-cyclopropyl 555.70 556.2, 523, 495.4 363 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -CH2-cyclopropyl 555.70 556.2, 523, 495.4 364 -CH2-C6H4-4-O-tBu -C6H4-4-OMe -H -CH2-C6H$-4-OMe 621.76 622.4, 589, 561 Table4' Example RR1 RR2 RR3 Rr4 mol. Mass No. weitht (m/e) 467 -Benzyl -Cl -H -Benzyl 524.0 524.2 491.2, 463 468 -Benzyl -Cl -H -Benzyl 524.0 524.2, 491, 463.2 469 -Benzyl -Cl -H -Bznzyl 524.0 524.2, 491, 463.2 470 -Benzyl -Cl -H -Benzyl 524.0 524.2, 491, 463.2 471 -Benzyl -OMe -nPr -nPr 513.7 514.4, 481.2, 453 472 -Benzyl -OMe -nPr -nPr 413.7 514.2, 481, 453 473 -Benzyl -OMe -H -iBu 485.6 486.2, 453, 425.2 474 -Benzyl -OMe -H -iBu 485.6 486.2, 453.2, 425 475 -Benzyl -OMe -H -(CH2)3OMe 401.6 502,2, 469, 441.4 476 -Benzyl -OMe -H -(CH2)3OMe 501.6 502,2, 469, 441.4 477 -Benzyl -OMe -H -(CH2)3OMe 501.6 502.2, 469, 441.4 478 -Benzyl -Cl -H -3-Isooxazolyl-5-Me 515.0 515.2, 482, 454.2 479 -Benzyl -OMe -H -iPr 471.6 472.2, 439, 411.2 480 -Benzyl -OMe -H -iPr 471.6 472.2, 439.4, 411 481 -Benzyl -OMe -H -iPr 471.6 472.2, 439.2, 411 482 -Benzyl -Cl -H -iPentyl 504.1 504.2, 471, 443.2 483 -Benzyl -Cl -H -iPentyl 504.1 504.2, 471.2, 443 484 -Benzyl -OMe -H -C(Me)2OMe 501.6 502.2, 469, 441.4 485 -Benzyl -OMe -H -C(Me)2OMe 501.6 502.4, 469, 441.4 486 -Benzyl -OMe -H -C(Me)2OMe 501.6 502.4, 469, 441.4 487 -Benzyl -Cl -H -3-Isooxazolyl-5-Me 515.0 515.2, 472, 454.2 488 -Benzyl -Cl -H -3-Isooxazolyl-5-Me 515.0 515.2, 482, 454.2 489 -Benzyl -OMe -H -CH2-cyclopropyl 483.6 484.2, 451.2, 423 490 -Benzyl -OMe -H -CH2-cyclopropyl 483.6 484.2, 451.2, 423 491 -Benzyl -OMe -H -CH2-cyclopropyl 483.6 484.2, 451.2, 423 492 -Benzyl -OMe -H -Ph 505.6 506.2, 473, 445.2 493 -Benzyl -OMe -H -Ph 505.6 506.2, 473, 445.2 494 -Benzyl -OMe -H -Allyl 496.6 470.2, 437, 409.2 495 -CH2-cyclohexyl -Cl -H -Et 468.0 468.4, 435.2, 407 496 -CH2-cyclohexyl -Cl -H -iPr 482.0 482.2, 449,2, 421 497 -CH2-cyclohexyl -Cl -H -iPr 482.0 482.2, 449,2, 421 498 -CH2-cyclohexyl -Cl -H -nPr 482.0 482.2, 449,2, 421 499 -CH2-cyclohexyl -Cl -H -nPr 482.0 482.2, 449,2, 421 500 -CH2-cyclohexyl -Cl -H -Ph 516.1 516.2, 483, 455.2 501 -CH2-cyclohexyl -Cl -H -Ch2-C6H4-4-OMe 560.1 560.2, 527.2, 499 502 -CH2-cyclohexyl -Cl -H -CH2-C6H$-4-OMe 560.1 560.2, 527.4, 499 503 -CH2-cyclohexyl -Cl -H -CH2-cyclopropyl 494.1 494.4, 461, 433.2 504 -CH2-cyclohexyl -Cl -H -2-Py 517.1 517.4, 456.2 505 -CH2-cyclohexyl -Cl -H -2-Py 517.1 517.2, 456.2 506 -CH2-cyclohexyl -Cl -H -CH2-C6H4-4-Me 544.1 544.2, 511, 483.4 507 -CH2-cyclohexyl -Cl -H -(CH2)3OMe 512.1 512.2, 479, 451.2 508 -CH2-cyclohexyl -Cl -H -3-Isooxazolyl-5-Me 521.0 521.2, 488, 460.2 509 -CH2-cyclohexyl -Cl -H -3-Isooxazolyl-5-Me 521.0, 521.4, 488, 460.2 510 -CH2-cyclohexyl -Cl -H -CH2-3-Py 531.1 531.2, 470.2 511 -CH2-cyclohexyl -Cl -H -CH2-3-Py 531.1 531.2, 470.2 512 -CH2-cyclohexyl -Cl -H -(CH2)3OMe 512.1 512.2, 479, 451.2 513 -Benzyl -OMe -Me -(CH2)2NMe2 514.6 515.2 514 -CH2-cyclohexyl -Cl -H -(CH2)2-2-Py 545.1 545.2, 484.4 515 -CH2-cyclohexyl -Cl -H -(CH2)2-2-Py 545.1 545.2, 484.2 516 -CH2-cyclohexyl -Cl -H -CH2-2-furyl 520.1 520.4, 487, 459.2 517 -CH2-cyclohexyl -Cl -H -CH2-2-furyl 520.1 520,4, 487, 459.2 518 -CH2-cyclohexyl -Cl -H -Benzyl 530.1 530.2, 497, 469.4 519 -CH2-cyclohexyl -Cl -H -Me 454.0 454.2, 421, 393.2 520 -CH2-cyclohexyl -Cl -H -nBu 496.1 496.4, 463, 435.2 521 -CH2-cyclohexyl -Cl -H -(CH2)3SMe 528.1 528.2, 495, 467.2 522 -CH2-cyclohexyl -Cl -H -(CH2)2OMe 498.0 498.2, 464, 437.2 523 -CH2-cyclohexyl -OMe -H -3-Isooxazolyl-5-Me 516.6 517.4, 484, 456.2 524 -CH2-cyclohexyl -OMe -H -3-Isooxazolyl-5-Me 516.6 517.2, 484, 456.2 525 -CH2-cyclohexyl -OMe -H -CH2-2-furyl 515.6 516.2, 483, 455.2 526 -CH2-cyclohexyl -OMe -H -(CH2)2-2-Py 540.7 541.2, 508.4 527 -CH2-cyclohexyl -OMe -H -(CH2)3-1-(2-Me-piperidyl) 574.8 575.6 528 -CH2-cyclohexyl -OMe -H -(CH2)3OMe 507.7 508.4, 475, 447.2 529 -CH2-cyclohexyl -OMe -H -(CH2)3OMe 507.7 508.4, 475.2, 447 530 -CH2-cyclohexyl -OMe -H -Benzyl 525.7 526.2, 493, 465.2 531 -CH2-cyclohexyl -OMe -H -Benzyl 525.7 526.2, 493.4, 465 532 -CH2-cyclohexyl -OMe -nPr -nPr 519.7 520.4 487, 459 4.83 533 -CH2-cyclohexyl -OMe -H -CH2-2-furyl 515.6 516.2, 483, 455.2 4.48 534 -Benzyl -Cl -H -iPentyl 504.1 504.0, 471, 443.2 4.33 535 -Benzyl -Cl -H -iPentyl 504.1 504.2, 471, 443.2 4.40 536 -CH2-cyclohexyl -OMe -H -Cyclopentyl 503.7 504.2, 471.2, 443 4.51 537 -CH2-cyclohexyl -OMe -H -4-Py 512.6 513.4, 452.2 4.04 538 -CH2-cyclohexyl -OMe -H -4-Py 512.6 513.4, 452.2 4.01 539 -CH2-cyclohexyl -OMe -H -(CH2)3SMe 523.7 524.4 491.2, 463 4.49 540 -CH2-cyclohexyl -OMe -H -(CH2)2OMe 493.6 494.4, 461.2, 433 4.34 541 -CH2-cyclohexyl -OMe -H -(CH2)2OMe 493.6 494.4, 461.2, 443 4.27 542 -CH2-cyclohexyl -OMe -H -Cyclopentyl 403.7 504.2, 471.2, 443 4.56 543 -CH2-cyclohexyl -OMe -H -nBu 491.7 492.4, 459.4, 431 4.54 544 -CH2-cyclohexyl -OMe -H -Me 449.6 450.2, 417, 389.4 3.88 545 -CH2-cyclohexyl -OMe -H -Et 463.6 464.2, 431.2, 403 4.32 546 -CH2-cyclohexyl -OMe -H -Et 463.6 464.2, 431.2, 403 4.36 547 -CH2-cyclohexyl -OMe -H -Allyl 475.6 476.2, 443.2, 415 4.41 548 -CH2-cyclohexyl -OMe -H -iBu 491.7 492.4, 459.4, 431 4.47 549 -CH2-cyclohexyl -OMe -H -iBu 491.7 492.4, 459.2, 431 4.51 550 -CH2-cyclohexyl -OMe -H -iBu 491.7 492.4, 459.4, 431 4.56 551 -CH2-cyclohexyl -OMe -H -Cyclohexyl 517.7 518.4, 485.2, 457 4.62 552 -CH2-cyclohexyl -OMe -H -Cyclohexyl 517.7 518.4, 485.2, 457 4.69 553 -CH2-cyclohexyl -OMe -H -iPr 4776. 478.2, 445.2, 417 4.40 554 -CH2-cyclohexyl -OMe -H -iPr 477.6 478.2, 445.2, 417 4.45 555 -CH2-cyclohexyl -OMe -H -nPr 477.6 478.2, 445.2, 417 4.41 556 -CH2-cyclohexyl -OMe -H -nPr 477.6 478.2, 445.2, 417 4.46 557 -CH2-cyclohexyl -OMe -H -Ph 511.6 512.4, 479, 451.2 4.61 558 -CH2-cyclohexyl -OMe -H -2-Py 512.6 513.4, 452.2 4.13 559 -CH2-cyclohexyl -OMe -H -2-Py 512.6 513.4, 452.2 4.18 560 -CH2-cyclohexyl -OMe -H -CH2-cyclopropyl 489.6 490,4, 457.2, 429 4.46 561 -CH2-cyclohexyl -OMe -H -CH2-cyclopropyl 489.6 490.4, 457.2, 429 4.50 562 -CH2-cyclohexyl -OMe -H -CH2-C6H4-4-OMe 555.7 556.2, 523, 495.4 4.52 563 -CH2-cyclohexyl -OMe -H -CH2-C6H4-4-OMe 555.7 556.2, 523, 495.4 4.56 564 -CH2-cyclohexyl -OMe -H -CH2-C6H4-4-OMe 555.7 556.2, 523, 495.4 4.57 565 -CH2-cyclohexyl -OMe -H -CH2-C6H4-4-Me 539.7 540.4, 507, 479.2 4.62 566 -CH2-cyclohexyl -OMe -H -CH2-C6H4-4-Me 539.7 540.4, 507.4, 479 4.65 567 -CH2-cyclohexyl -OMe -H -CH2-C6H4-4-Me 539.7 540.4, 507.4, 479 4.68 568 -CH2-cyclohexyl -OMe -H -CH2-3-Py 526.7 527.2, 466.2 4.00 569 -Benzyl -Cl -Me -(CH2)2NMe2 519.1 519.4 3.95 570 -Benzyl -Cl -H -iPr 476.0 476.2, 443, 415.4 4.34 571 -Benzyl -Cl -H -iPr 476.0 476.0, 443, 415.2 4.42 572 -Benzyl -Cl -H -iPr 476.0 476.2, 443.2, 415 4.48 573 -Benzyl -Cl -nPr -nPr 518.1 518.2, 485.2, 457 4.65 574 -Benzyl -Cl -nPr -nPr 518.1 518.2, 485, 457.2 4.81 574 -Benzyl -OMe -H -CH2-C6H4-4-Me 533.7 534.2, 501, 473.2 4.58 576 -Benzyl -Cl -H -nBu 490.0 490.2, 457 429.2 4.57 577 -Benzyl -Cl -H -nBu 490.0 490.2, 457, 429.2 4.64 578 -Benzyl -OMe -H -nPr 471.6 472.2, 439.2, 411 4.32 579 -Benzyl -OMe -H -nPr 471.6 472.2, 439, 411.2 4.37 580 -Benzyl -OMe -H -nPr 471.6 472.2, 439, 411.2 4.38 581 -Benzyl -OMe -H -(CH2)3-1-(2-Me-piperidyl) 568.7 569.4 3.98 582 -Benzyl -OMe -H -Benzyl 419.6 520.4, 487, 459.2 4.37 583 -Benzyl -Cl -H -Cyclohexyl 416.1 516.2, 483, 455.2 4.67 584 -Benzyl -OMe -H -nBu 485.6 486.2, 453, 425.2 4.30 585 -Benzyl -Cl -H -CH2-2-furyl 514.0 514.2, 481, 453.2 4.51 586 -Benzyl -OMe -H -Cyclohexyl 511.6 512.4, 479, 451.2 4.54 587 -Benzyl -OMe -H -CH2-2-furyl 509.6 510.2, 477, 449.2 4.39 588 -Benzyl -Cl -H -CH2-cyclopropyl 488.0 488.2, 455, 427.2 4.49 589 -Benzyl -Cl -H -CH2-cyclopropyl 488.0 488.2, 455.2, 427 4.56 590 -Benzyl -Cl -H -Allyl 474.0 474.2, 441, 413.2 4.43 591 -Benzyl -Cl -H -Allyl 474.0 474.2, 441.2, 413 4.45 592 -Benzyl -Cl -H -nPr 476.0 476.2, 443.2, 415 4.50 593 -Benzyl -OMe -H -Et 457.6 458.2, 425, 397.2 4.19 594 -Benzyl -Cl -H -Cyclohexyl 516.1 516.2, 483, 455.2 4.60 595 -Benzyl -OMe -H -CH2-C6H4-4-OMe 549.7 550.4, 517.4, 489 4.40 596 -Benzyl -OMe -H -CH2-C6H4-4-OMe 549.7 550.2, 517.4, 489 4.37 598 -Benzyl -OMe -H -Benzyl 519.6 520,4 487, 459.2 4.41 599 -Benzyl -Cl -H -Et 462.0 462.2, 429, 401.2 4.24 600 -Benzyl -Cl -H -Et 462.0 462.2, 429, 401.2 4.33 601 -Benzyl -OMe -H -(CH2)2OMe 487.6 488.2, 455, 427.2 4.07 602 -Benzyl -OMe -H -(CH2)2OMe 487.6 488.2, 455.2, 427 4.11 603 -Benzyl -OMe -H -nBu 485.6 486.2, 453, 425.2 4.37 604 -Benzyl -OMe -H -nBu 485.6 486.2, 453, 425.2 4.38 605 -Benzyl -OMe -H -nBu 485.6 486.2, 453.2, 425 4.51 606 -Benzyl -Cl -H -nPr 476.0 476.2, 443, 415.2 4.38 607 -Benzyl -Cl -H -Ph 510.0 510.2, 477, 449.0 4.65 608 -Benzyl -Cl -H -(CH2)3OMe 506.0 506.2, 473, 445.2 4.36 609 -Benzyl -Cl -H -iBu 490.0 490.2, 457, 429.2 4.56 610 -Benzyl -Cl -H -iBu 490.0 490.2, 457.2, 429 4.63 611 -Benzyl -Cl -H -(CH2)3SMe 522.1 522.4, 489, 461.2 4.56 612 -Benzyl -Cl -H -(CH2)3OMe 506.0 506.2, 473, 445.2 4.28 613 -Benzyl -Cl -H -C(Me)2OMe 506.0 506.2, 473, 445.2 4.39 614 -Benzyl -Cl -H -CH3-C6H4-4-OMe 554.1 554.2, 421, 493.4 4.60 615 -Benzyl -Cl -H -CH2-C6H$-4-OMe 554.1 554.2, 521, 493.2 4.52 616 -Benzyl -Cl -H -(CH2)3-1-(2-Me-piperidyl) 573.2 573.4 4.09 617 -Benzyl -OMe -H -4-Me-3-isoxazolyl 510.6 511.2, 478, 450.2 4.31 618 -Benzyl -OMe -H -iPentyl 499.6 500.2, 467, 439.4 4.44 619 -Benzyl -OMe -H -iPentyl 499.6 5002, 467, 439.4 4.46 620 -Benzyl -OMe -H -iPentyl 499.6 5002, 467, 439.4 4.51 621 -Benzyl -OMe -H -iPentyl 499.6 500.2, 467.4, 439 4.60 622 -Benzyl -Cl -H -C(Me)2OMe 506.0 506,2 473, 445.2 4.32 623 -Benzyl -Cl -H -iBu 490.0 490.2, 457, 429.2 4.51 624 -Benzyl -OMe -H -Et 457.6 458.2, 425, 397.2 4.13 625 -Benzyl -Cl -H -CH2-2-furyl 514.0 514.2, 481, 453.2 4.45 626 -Benzyl -Cl -H -(CH2)2OMe 492.0 492.2, 459, 431.2 4.24 627 -Benzyl -Cl -H -(CH2)2OMe 492.0 492.2, 459, 431.2 4.29 628 -Benzyl -OMe -H -4-Me-3-isoxazolyl 510.6 511.2, 478, 450.2 4.25 629 -Benzyl -Cl -H -nPr 476.0 476.2, 443, 415.4 4.46 630 -Benzyl -Cl -H -Allyl 474.0 474.2, 441, 413.2 4.35 631 -Benzyl -OMe -H -Cyclohexyl 511.6 512.4, 479, 451.2 4.47 632 -Benzyl -Cl -H -CH2-cyclopropyl 488.0 488.2, 455, 427.2 4.47 633 -Benzyl -OMe -H -CH2-2-furyl 509.6 510.2, 477, 449.2 4.40 634 -Ph -Cl -H -Et 447.9 448.0, 415, 387 4.15 635 -Ph -Cl -H -2-Py 497.0 497.2 4.14 636 -Ph -Cl -H -2-Py 497.0 497.2 4.18 637 -Ph -Cl -H -CH2-C6H4-4-Me 524.0 524.2, 491,2, 463 4.64 638 -Ph -Cl -H -(CH2)3OMe 492.0 492.2, 459.2, 431 4.26 639 -Ph -Cl -H -Allyl 460.0 460.0, 427.2, 399 4.36 640 -Benzyl -OMe -H -(CH2)3SMe 517.7 518.2, 485, 457.2 4.40 641 -Benzyl -Cl -H -CH2-3-Py 525.0 525.2, 464.2 4.02 642 -Benzyl -Cl -H -(CH2)2-2-Py 539.1 539.2, 478.2 4.02 643 -Benzyl -Cl -H -2-Py 511.0 511.2, 450.0 4.20 644 -Benzyl -Cl -H -(CH2)2-2-Py 534.6 535.2, 474.2 3.89 645 -Benzyl -Cl -H -(CH2)2-2-Py 539.1 539.2 3.94 646 -Benzyl -Cl -H -Cyclopentyl 502.0 502.2, 469, 441.2 4.50 647 -Benzyl -Cl -H -Cyclopentyl 502.0 502.2, 469, 441.2 4.60 648 -Benzyl -OMe -H -Cyclopehtyl 497.6 498.2, 465, 437.2 4.38 649 -Benzyl -OMe -H -Cyclopentyl 497.6 498.2, 464, 437.2 4.45 650 -Benzyl -OMe -H -2-Py 506.6 507.2, 446.2 4.00 651 -Benzyl -OMe -H -2-Py 506.6 507.2, 446.2 4.02 652 -Benzyl -OMe -H -(CH2)3SMe 517.7 518.2, 485, 457.2 4.38 653 -Ph -OMe -H -Cyclohexyl 497.6 498.2, 465.2, 437 4.48 654 -Ph -OMe -H -iPr 457.6 458.2, 425.2, 397 4.25 655 -Ph -OMe -H -Ph 491.6 492.2, 459.2, 431 4.47 656 -Ph -OMe -H -2-Py 492.6 493.4, 460.2 4.04 657 -Ph -OMe -H -2-Py 492.6 493.4, 460.2 4.10 658 -Ph -OMe -H -CH2-cyclopropyl 469.6 470.2, 437.2, 409 4.30 659 -Ph -OMe -H -CH2-C6H4-4-Me 519.6 520.4, 487.2, 459 4.48 660 -Ph -OMe -H -3-Isooxazolyl-5-Me 496.5 497.2, 464.2, 436 4.30 661 -Ph -OMe -H -C(Me)2OMe 487.6 488.2, 455.2, 427 4.24 662 -Ph -OMe -H -(CH2)3OMe 487.6 488.2, 455.2, 427 4.15 663 -Ph -OMe -H -(CH2)2-2-Py 520.6 521,4, 488.2 3.92 664 -Ph -OMe -H -CH2-2-furyl 495.6 496.2, 463.2, 435 3.11 665 -Ph -OMe -H -Cyclopentyl 483.6 484.2, 451.2, 423 3.18 666 -Ph -OMe -H -(CH2)2OMe 473.6 474.2, 441.4, 413 2.81 667 -Ph -OMe -H -(CH2)3SMe 503.6 504.0, 471.2, 443 3.14 668 -Ph -OMe -H -(CH2)3-Ph 533.7 534.2, 501.2, 473 3.46 669 -Ph -Cl -H -iBu 476.0 476.0, 443.2, 415 3.43 670 -Ph -Cl -H -Cyclohexyl 502.0 502.2, 469.2, 441 3.60 671 -Ph -Cl -H -iPr 462.0 462.2, 429.2, 401 3.26 672 -Ph -Cl -H -Ph 496.0 496.2, 463.2, 435 3.59 673 -Ph -Cl -H -iPentyl 490.0 490.2, 457.2, 429 3.58 674 -Ph -Cl -H -(CH2)3-1-(2-Me-piperidyl) 559.1 559.2 2.81 675 -Ph -Cl -H -(CH2)3-1-(2-Me-piperidyl) 559.1 559.2 2.89 676 -Ph -Cl -H -(CH2)2-2-Py 525.0 525.2, 492.2 2.72 677 -Ph -Cl -H -4-Py 497.0 497.2, 436.2 2.79 678 -Ph -Cl -H -Cyclopentyl 488.0 488.2, 455.2, 427 3.56 679 -Ph -Cl -H -(CH2)2OMe 478.0 478.2, 445.2, 417 3.10 680 -Ph -Cl -H -CH2-cyclopropyl 474.0 474.2, 441.2, 413 3.48 681 -Ph -Cl -H -CH2-C6H4-4-OMe 540.0 540.2, 507.2, 479 3.60 682 -Ph -Cl -H -CH2-2-furyl 500.0 500.2, 467.2, 439 3.51 683 -iBu -Cl -H -Me 413.9 414.2, 381, 353.2 2.96 684 -iBu -Cl -H -Me 413.9 414.2, 381, 353.0 3.02 685 -iBu -Cl -H -Me 413.9 414.2, 381, 353.0 3.11 686 -iBu -Cl -H -CH2-2-furyl 480.0 480.2, 447.0, 419 3.21 687 -iBu -Cl -H -CH2-2-furyl 480.0 480.2, 447.0, 419 3.28 688 -iBu -Cl -H -CH2-2-furyl 480.0 480.2, 447.2, 419 3.30 689 -iBu -F -H -CH2-2-furyl 463.5 464.2, 431, 403.2 3.06 690 -iBu -F -H -(CH2)2OMe 441.5 442.4, 409, 481.2 2.89 691 -iBu -F -H -Me 397.5 398.2, 365, 337.2 2.85 692 -iBu -F -H -H 383.4 384.2, 351, 323.2 2.75 693 -iBu -H -H -CH2-2-furyl 445.5 446.2, 413, 385.2 3.21 694 -iBu -H -H -(CH2)2OMe 423.5 424.0, 391, 363.2 2.87 695 -iBu -H -H -Me 379.5 380.2, 347, 319.2 2.82 696 -iBu -O-C6H4-4-Cl -H -Ch2-2-furyl 555.6 556.2, 523, 495.4 3.25 697 -iBu -O-C6H4-4-Cl -H -(CH2)2OMe 533.6 534.2, 501.2 2.98 698 -iBu -O-C6H4-4-Cl -H -Me 489.6 490, 457.2 2.97 699 -iBu -Cl -H -CH2-2-furyl 480.0 480.2, 447.0, 419 2.91 700 -iBu -Cl -H -Me 413.9 414.2, 381, 353.0 2.49 701 -iBu -Cl -H -H 399.9 400.2, 367, 339.0 2.52 702 -iBu -Cl -H -(CH2)2OMe 458.0 458.0, 425, 397.2 2.67 703 -iBu -O-C6H4-4-Cl -H -CH2-2-furyl 572.1 572.2, 539.2, 511 3.44 704 -iBu -O-C6H4-4-Cl -H -(CH2)2OMe 550.1 550.2, 493.4, 460.2 3.22 705 -iBu -O-C6H4-4-Cl -H -Me 506.0 506.2, 473, 445.2 3.16 Table4" ExampleRR'RRZ RR3 mol. Mass HPLC rt No. weitht (m/e) (min) 706-Benzyl-CI 531.1 531.2,470.2 3.97 _Nx J 707-Benzyl-OMe-piperidino 497.6 2,437 4.18 708-Benzyl-OMe-piperidino 497. 6 498. 2,465.2,437 4.19 709-Benzyl-OMe-piperidino 497. 6 498. 2, 465 2, 437 4.24 710-CH2-cyclohexyl-cl-morpholino 510. 1 510. 2,477.2,449 3.40 711-CH2-cyclohexyI-Cl-piperidino 508.1 2,447 3.94 712-CH2-cyclohexyl-CI-piperidino 508. 1 508. 4,475.2,447 3.77 713-CH2-cyclohexyl-CI-1-rrolidinyl 494. 1 494.4,461.2,433 3.64 714-CH2-cyclohexyl-cl-piperidino 508. 1 508. 4.475.2. 447 3.85 715-CH2-cyclohexyl-OMe-morpholino 505. 6 506. 2,473.2,445 4.32 716-CH2-cyclohexyl-OMe-morpholino 505. 6 506. 2, 473. 2, 445 4.29 717-CH2-cyclohexyl-OMe-1-pyrrolidinyl 489.6 2,439 4.46 718-CH2-cyclohexyl-OMe-1-pyrrolidinyl 489. 6 490. 4,457.2,429 4.40 7i9-CH2-cyclohexyl-OMe-pperidino 503. 7 504. 4, 471. 2, 443 4.59 72C-CH2-cvclohexvi-OMe-piperidino 503 7 504. 4,471.2,443 4.62 721-Benzyl-OMe 526.7 527.4 3.85 e1W ! 722-Benzyl-OMe 526.7527.4 3.90 F "J 723-Benzy 488.0 2,427 4.37 722-Benzyl _-Cl-1-pvrrolidinyl 488.0 427.2 4.46 72'-Benzyl-OMe-morpholino 499. 6 500. 2,467.4, 439 4.11 726-Benz I-CI-i eridino 502. 0 441.2 4.50 72,-Benzyl-Cl-piperidino 502.0502.2,469,441.4 4.60 728-Benzyl-Ci-morpholino 504.0504.0,471,443.2 4.29 729-Benzyl-OMe-l-pyrrolidinyl 483.6 484.2,451.2,423 4. 34 Example 365 OMe OMe Step 1_ Step 2.. s i i N O N O N O H H L OMeOMe cet I Step 3. a t Step 4 C t o N 0 N 0 CO, H L. NHOH 0 O
Step 1: 2H-2 (Z)- (4-Methoxybenzylidene)-1,4-benzothiazin- 3(4H)-one A mixture of 2H-1,4-benzothiazin-3 (4H)-one (5 g), p- anisaldehyde (6.6 g), and sodium methoxide (11.63 g) in 260 mL of DMF was heated to reflux for 15 hrs. The reaction mixture was cooled down to r. t., and water was added. The resulting precipitate was filtered and washed with water and ethanol to give the product.
Step 2: 2H-2 (Z)- (4-Methoxybenzylidene)-4- (N- ethoxycarbonylmethyl)-1,4-benzothiazin-3 (4H)-one To a DMF (60 mL) solution of 2H-2 (Z)- (4- methoxybenzylidene)-1,4-benzothiazin-3 (4H)-one (1.4 g), NaH (160 mg) was added at 4 °C. After 1 hr's stirring, ethyl bromoacetate (684 mg) was added and the reaction mixture was warmed to room temperature. After 2 hrs'
additional stirring, the reaction mixture was added ethyl bromoacetate (68 mg) and left at r. t. overnight. The reaction mixture was added 5% KHS04 aq. and extracted with EtOAc. The organic layer was washed with sat. NaHC03 aq. and brine, and dried over MgS04 and concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give the product.
Step 3: 2H-2 (Z)- (4-Methoxybenzylidene)-1, 4-benzothiazin- 3 (4H)-one-4-yl-acetic acid 2H-2 (Z)- (4-methoxybenzylidene)-4- (N- ethoxycarbonylmethyl)-1,4-benzothiazin-3 (4H)-one (1.4 g) was dissolved in ethanol (20 mL) and THF (20 mL). 5N NaOH aq. was added to the solution at room temperature and stirred for 3 hrs. The reaction mixture was added 5% KHS04 aq. and extracted with EtOAc. The organic layer was washed with brine, dried over MgSO4 and concentrated under reduced pressure to give the product.
Step 4: 2H-2 (Z)- (4-Methoxybenzylidene)-1,4-benzothiazin- 3 (4H)-one-4-yl-acetic acid N-hydroxylamide Isobutyl chloroformate (477 mg) was added dropwise to a THF (40 mL) solution of 2H-2 (Z)- (4-methoxybenzylidene)- 1,4-benzothiazin-3 (4H)-one-4-yl-acetic acid (1.19 g) and N-methylmorpholine (353 mg) at-15 to-20 °C. THF (10 mL) solution of O-TBDMS-hydoxylamine (565 mg) was added after additional 5 minutes'stirring. The mixture was warmed to
r. t. with stirring, and stood overnight. The reaction mixture was quenched with sat. Na2CO3 aq. and extracted with EtOAc. The organic layer was washed with 1N HC1 and brine, dried over MgS04 and concentrated under reduced pressure. The residue was purified by recrystallization from mixed solvent of THF and hexane to give 1.2 g of the hydroxamic acid as colorless solid.
H-NMR (DMSO-d6,6) 1.82 (s, 3H), 4.60 (s, 1.6H), 4.88 (s, 0.4H), 7.07 (d, J=8.8Hz, 2H), 7.04-7.11 (m, 1H), 7.27 (dt, J=1.4Hz, 8.2Hz, 1H), 7.38 (dd, J=l. lHz, 7.7Hz, 1H), 7.68 (d, J=8.8Hz, 2H), 7.73 (s, 1H), 8.98 (s. 0.8H), 9.43 (s, 0.2H), 10.3 (s, 0.2H), 10.8 (s, 0.8H) The following compounds listed in the Table 5 were prepared in a similar manner.
Table 5 Example mol. Mass RR1 RR2 RR3 No. weight (m/e) 365 -C6h4-4-OMe -H -H 356.4 357.0, 424.0, 296.2 3.@ 366 -C6H4-4-OEt -H -H 370.4 371.0, 338.0 3.@ 367 -C6H4-4-SMe -H -H 372.5 373.2, 339.8 3.@ 368 -C6H4-4-OPh -H -H 418.5 419.0, 386.0 3.@ 369 -C6H4-4-O-nBu -H -H 398.5 399.2, 366.2 3.@ 370 -C6H4-4-OMe -H -Cl 390.8 391.0, 358.0 3.2 371 -C6H4-4-OMe -CF3 -H 424.4 425.0, 392.0 3.3 372 -C6H4-4-O-benzyl -H -H 432.5 433.2, 400.2 3.5 373 -C6H4-4-O-nPr -H -H 384.5 385.2, 352.2 3.4 374 -C6H4-4-OCHF2 -H -H 392.4 393.0, 360.0 3.@ 375 -C6H4-3-OMe -H -H 356.4 357.2, 324.2 2.9 376 -C6H3-3,4-Cl2 -H -H 395.3 395.0, 362.0 3.2 377 -C6H4-2-OMe -H -H 356.4 357.2, 324.2 2.4 378 -2-Py -H -H 327.4 328.2, 267.0 1.4 379 -2-Pyrrolyl-1-(C6H3-2,6-Cl2) -H -H 460.3 459.8, 427.0 3.@ 380 -C6H3-3,5-(OMe)2 -H -H 386.4 387.0, 354.2 3.@ 381 -C6H3-2-O-benzyl,3-OMe -H -H 462.5 463.2, 430.2, 374.0 3.@ 382 -C6H2-2-F,4,5-(OMe)2 -H -H 404.4 404.5, 372.2 2.@ 383 -C6H2-2-F,3-CN,4-NMe2 -H -H 412.4 413.0, 380.2 3.@ 384 -C6H2-2,3,4-(OMe)3 -H -H 416.5 417.0, 384.0, 297.2 2.@ 385 -C6H3-3,5-(CF3)2 -H -H 462.4 462.8, 402.2 3.@ 386 -C6H4-4-F -H -H 344.4 345.0, 312.2 3.@ 387 -C6H4-4-Me -H -H 340.4 341.0, 308.2 3.@ 388 -Ph -H -H 326.4 327.0, 294.0 3.@ 389 -2-Furyl-5-(C6H4-4-Br) -H -H 471.3 471.0, 438.0, 371.2 4.@ 390 F-H-H 480.5 482.0,420.0 3.28 F -F N'N-CH 3 391 s g S-H-H 416.5417.2,384.0 3. 42 H3C CH3 392-C6H4-4-0 (3, 4-CI2-benzyl)-H-H 501. 4 501.0,470.23.73 393-C6H4-4-Ph-H-H 402. 5403.2,370.2 3.42 394 t-H-H 491.6492.2,459.2 3.72 395-C6H4-4-CF3-H-H 394.4 60 396-C6H4-4-iBu-H-H 382.5383.2,350.2 4.02 397 1 C6H4-4- (l-pyrrolidinyl)-H-H 395.5 396.2,363.2 3.68 398-2-Furvl-5-(C6H4-3-NO2)-H-H 437.(C6H4-3-NO2)-H-H 437. 4 438.2,405.0 3.35 399-2-Thienyl-3-Br-H-H 411.3413.0,380.0 3.14 400-C6H4-4- (CH=CH-Ph)-H-H 428.5 429.0,396.0 3.68 401-nPentVl-H-H 320.4 321.2 288. 2 3.38 402-C6H4-4-SCF3-H-H 426.4 0 3.55 403-C6H4-4-SO2Me-H-H 404.5 72 404-1-Naphthyl-4-OMe-H-H 406.5407.0,374.0 3.33,3.41 Example 405 OMe OMe OMe fiY Stepi, f< T Step 2 [jY"T s s "H) aN as A N O OMe CONHOH
Step 1: 2H-2-(4-Methoxybenzyl)-1, 4-benzothiazin-3 (4H)-one 2H-2 (Z)- (4-methoxybenzylidene)-1,4-benzothiazin-3 (4H)- one (142 mg) was dissolved in MeOH (5 mL) and THF (20 mL).
10% Pd/C (350 mg) was added. The reaction mixture was vigorously stirred at r. t. for 4 hours under H2. The catalyst was removed by filtration, and the filtrate was concentrated under reduced pressure. The residue was purified by preparative thin layer chromatography on silica gel (EtOAc/toluene, 1/4) to give the product as a white solid (133.5 mg).
Step 2: 2H-2- (4-methoxybenzyl)-1, 4-benzothiazin-3 (4H)- one-4-yl-acetic acid To a solution of 2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one (428 mg) in DMF (20 mL), NaH (66 mg, 60% in oil) was added. After 1 hour's stirring, ethyl bromoacetate (263 mg, 1.57 mmol) was slowly added. The
reaction mixture was stirred at r. t. overnight. The solvent was removed under reduced pressure and the residue was dissolved in EtOAc and washed with 1N HC1,5% Na2CO3 aq., and brine. The organic layer was dried over Na2SO4 and concentrated. The crude product was used in the following step without purification.
To a solution of ethyl ester (515 mg) in MeOH (10 mL), 1N NaOH (2.58 mL) was slowly added at 0 °C. After 30 minutes'stirring, the mixture was warmed to room temperature and left overnight. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in 5% Na2CO3 aq., and washed with Et20. The aqueous layer was acidified with 4N HC1, and the product was extracted with EtOAc. The organic layer was dried over Na2SO4 and concentrated to give the acetic acid (451 mg, 88%) as a white solid.
Step 3: 2H-2-(4-Methoxybenzyl)-1, 4-benzothiazin-3 (4H)- one-4-yl-acetic acid N-hydroxyamide The acetic acid (343 mg), obtained as above, was dissolved in CH2C12 (4 mL) and pyridine (4 mL) and pentafluorophenyl trifluoroacetate (560 mg) was added.
After 3 hours'stirring, O-TBDMS-hydoxylamine (736 mg) was added. The reaction mixture was stirred at r. t. overnight. The solvent was removed and the residue was dissolved in EtOAc. The organic layer was washed with 1N HC1 and brine, dried over Na2SO4 and concentrated under
reduced pressure. The residue was purified by preparative thin layer chromatography on silica gel (CHCl3/MeOH, 10/1) to give hydroxamic acid (323 mg) as a pale orange solid.
1H-NMR (DMSO-d6,8) 2.69 (1H, m), 3.16 (1H, m), 3.76 (3H, s), 3.83 (1H, m), 4.52 (2H, m), 6.87 (2H, d, J=7.0), 7.09- 7.18 (4H, m), 7.33-7.40 (2H, m), 9.06 (1H, br-s), 10.83 (1H, s).
Example 406 S S Cs O OMe N O OH CONHOH CONHOH Step 1: 2H-2- (4-Hydroxybenzyl)-1, 4-benzothiazin-3 (4H)-one- 4-yl-acetic acid N-hydroxyamide 2H-2- (4-methoxybenzyl)-1, 4-benzothiazin-3 (4H)-one-4- yl-acetic acid N-hydroxyamide (373 mg) was dissolved in CH2C12 (10 mL). BBr3 (1M solution in CH2C12,5 ml) was added and the reaction mixture was stirred at r. t. overnight. The solvent was removed under reduced pressure, and the residue was dissolved in EtOAc. The organic layer was washed with 1N HC1 and brine, dried over Na2SO4 and concentrated under reduced pressure. The residue was purified by preparative thin layer chromatography on silica gel (CHCl3/MeOH, 10/1) to give hydroxamic acid (161 mg) as a pale yellow solid.
1H-NMR (DMSO-d6,8) 2.58 (1H, m), 3.06 (1H, m), 3.75 (1H, s), 4.37-4.83 (2H, m), 6.66 (2H, d, J=7.86Hz), 6.97-7.13 (4H, m), 7.27-7.38 (2H, m), 8.99 (1H, s), 9.26 (1H, s), 10.77 (1H, s) Example 407 Me Me I I S PO (OEt) 2 SUS Step 1 Me Me N 0 N O N O C02Et QCO2Et CONHOH
Step 1: Ethyl [2H-2Z- (4-methybenzylidene)-1,4- benzothiazin-3 (4H)-one-4-yl] acetate To a stirred solution of p-tolualdehyde (48 mg) and 2H-2-diethylphosphonyl-1,4-benzothiazine-3 (4H)-one-4-yl- acetic acid ethyl ester (78 mg) in ethanol (3 mL), which was prepared by Worley's method (J. Org. Chem., 40,1731 (1975)), was added a solution of sodium ethoxide (28 mg, 0.42 mmol) in ethanol (1 mL). The reaction mixture was stirred at r. t. overnight. The solvent was removed under reduced pressure. The residue was dissolved in EtOAc and washed with sat. NaHC03 aq., IN HC1, and brine. The organic layer was dried over Na2SO4 and concentrated. The residue was purified by preparative thin layer chromatography on silica gel (CHCl3/MeOH, 15/1) to give a yellow solid (37 mg, 52%).
This compound was converted to 2H-2- (4-Methylbenzyl)-1,4- benzothiazin-3 (4H)-one-4-yl-acetic acid N-hydroxyamide by the reactions analogous to those described in Example 405. The following compounds listed in the Tables 6 and 6' were prepared in a similar manner.
Table 6 Example RR1 NMR: 1H-NMR(DMSO-d6; #) No. 2.27(3H, s), 2.65(1H, m), 3.15(1H, m), 3.83(1H, m), 4.43(1H, d, J=16Hz), 4.51(1H, d, 407 -C6H4-4-Me 7.04-7.14(6H, m), 7.28-7.38((2H, m), 8.98(1H, s), 10.76(1H, s) 2.91(1H, m), 3.33(1H, m), 4.12(1H, m), 4.48(2H, s), 7.05-7.11(2H, m), 7.24-7.37(4H, m 408 -2-Py 7.73(1H, t, J=7.5Hz), 8.49(1H, d, J=4.05Hz), 9.03(1H, s), 10.90(1H, s) 2.72(1H, m), 3.17(1H, m), 3.87(1H, m), 4.29(2H, m), 6.90-7.65(13H, m), 9.01(1H, s), 1@ 409 -C6H4-4-OPh s) 2.70(1H, m), 3.20(1H, m), 3.88(1H, m), 4.48(2H, m), 7.05-7.38(9H, m), 8.98(1H, s), 10 410 -Ph s) 2.22(3H, s), 2.69(1H, m), 3.16(1H, m), 3.85(1H, m), 4.49(2H, s), 7.06-7.16(6H, m), 7.2 411 -C6H4-2-Me 7.40(2H, m), 9.00(1H, s), 10.78(1H, s) 2.27(3H, s), 2.65(1H, m), 3.17(1H, m), 3.85(1H, m), 4.43(1H, d, J=16Hz), 4.52(1H, d,J 412 -C6H4-3-Me 6.98-7.19(6H, m), 7.28-7.38(2H, m), 8.99(1H, s), 10.78(1H, s) 2.92(1H, m), 3.35(1H, m), 3.91(1H, m), 4.49(2H, m), 7.06-7.17(2H, m), 7.30-7.72(6H, @ 413 -C6H4-2-Me 9.02(1H, s), 10.80(1H, s) 2.67(1H, m), 3.18(1H, m), 3.76(3H, s), 3.79(1H, m), 4.42(1H, d, J=16Hz), 4.53(1H, d,J 414 -C6H4-2-OMe 6.87(1H, m), 6.96(1H, d, J=8.25Hz), 7.07-7.14(3H, m), 7.21-7.37(3H, m), 8.99(1H, s), 10.79(1H, s) 2.66(1H, m), 3.17(1H, m), 3.73(3H, s), 3.87(1H, m), 4.44(1H, d, J=16Hz), 4.51(1H, d, J 415 -C6H4-3-OMe 6.76-6.79(3H, m), 7.04-7.19(3H, m), 7.28-7.38(2H, m), 8.99(1H, s), 10.77(1H, s) 1.31(3H, m), 2.64(1H, m), 3.09(1H, m), 3.79(1H, m), 3.98(2H, m), 4.46(2H, m), 6.82(2@ 416 -C6H4-4-OEt J=6.78Hz), 7.04-7.12(4H, m), 7.27-7.37(2H, m), 8.99(1H, s), 10.77(1H, s) 2.62(1H, m), 3.12(1H, m), 3.71(3H, s), 37.2(3H, s), 3.84(1H, m), 4.47(2H, s), 6.68(1H, 417 -C6H3-3,4-(OMe)2 6.83(2H, m), 7.04-7.14(2H, m), 7.,28-7.39(2H, m), 8.98(1H, s), 10.77(1H, s) 0.89(3H, t, J=7Hz), 1.30(2H, m), 1.54(2H, m), 2.54(2H, m), 2.66(1H, m), 3.14(1H, m), 3 418 -C6H4-4-Bu m), 4.47(2H, m), 6.95-7.13(5H, m), 7.28-7.38(3H, m), 8.99(1H, s), 10.77(1H, s) 2.77(1H, m), 3.25(1H, m), 3.93(1H, m), 4.49(2H, m), 7.05-7.16(2H, m), 7.30-7.48(7H, m 419 -C6H4-4-Ph 7.58(2H, d, J=7.14Hz), 7.65(2H, d, J=8.25Hz), 8.99(1H, s), 10.78(1H, s) 1.64-1.81(m, 2H), 2.56(m, 2H), 3.61(m, 3H), 4.38(d, J=16Hz, 1H), 4.50(d, J=16Hz, 1H) 420 -(CH2)2-Ph 7.07(m, 2H), 7.07-8.18(m, 3H), 7.18-7.30(m, 3H), 7.39(m, 1H), 8.96 (s, 0.8H), 9.34(s, 0 10.3(s, 0.2H), 10.7 (s, 0.8H) 2.56(1H, m), 3.05(1H, m), 3.74(1H, m), 3.83-3.92(4H, m), 4.40(2H, m), 6.76(2H, d, J=8. 421 -C6H4-4-O(CH2)2OH 6.97-7.04(4H, m), 7.21-7.30(2H, m), 8.92(1H, s), 10.70(1H, s) 1.06(6H, t, J=7Hz), 2.54(1H, m), 3.05(1H, m), 3.26-3.34(4H, m), 3.74(1H, m), 4.47(2H, 422 -C6H4-4-NEt2 6.55(2H, d, J=8Hz), 6.97(2H, d, J=8Hz), 7.04-7.13(2H, m), 7.27-7.38(2H, m), 8.98(1H, 10.77(1H, s) 2.77(1H, m), 3.18(1H, m), 3.96(1H, m), 4.48(2H, m), 6.96-7.14(2H, m), 7.29-7.40(3H, 423 -3-Py 7.68(1H, d, J=7.71Hz), 8.42(2H, m), 9.00(1H, s), 10.78(1H, s) 2.75(1H, m), 3.20(1H, m), 4.01(1H, m), 4.47(2H, m), 7.06-7.15(2H, m), 7.28(2H, d, J=5 424 -4-Py 7.32-7.40(2H, m), 8.46(2H, d, J=5.67Hz), 9.00(1H, s), 10.78(1H, s) 2.73(1H, m), 3.16(1H, m), 3.90(1H, m), 4.47(2H, m), 7.05-7.14(2H, m), 7.24-7.38(6H, @ 425 -C6H4-4-Cl 8.99(1H, s), 10.78(1H, s) 2.72(1H, m), 3.14(1H, m), 3.90(1H, m), 4.47(2H, m), 7.05-7.14(2H, m), 7.20(2H, d, J=8 426 -C6H4-4-Br 7.29-7.39(2H, m), 7.47(2H, d, J=8.25Hz), 8.99(1H, s), 10.78(1H, s) Tablez s 7 aN W RRt CONHOH Example RR'NMR :'H-NMR (DMSO-d6; 8) No. 754-0-C6H4-4-F 2.71 (1H, dd, 3.16 (1 H, dd, 3.85 (1 H, dd, 0Hz), 4.48 (1.6H, br-s), 4.67 (0.2H, d, J=18Hz), 4.88 (0.2H, d, J=18Hz), 6.88 (2H, d, J=8.4Hz), 6.95-7.39 (10H, m), 8.98 (0.8H, s), 9.36 (0.2H, s), 10.33 (0.2H, s), 10.77 (0.8H, s) 755-F 2.73 (1H, m), 3.16 (1 H, m), 3.88 (1 H, m), 4.47 (2H, m), 6.96-7.14 (4H, m), 7.24-7.39 (4H, m), 8.99 (1 H, s), 10.78 (1 H, s) p 756-OF3 285 (1 H, m), 32711 H, m), 3.98 (1 H, m), 4.48 (2H, m), 7.06-7.16 (2H, m), 7.30-7.40 (2H, m), 7.48 (2H, J=8.07Hz), 7.64 (2H, J=8. 07Hz), 8.99 (1 H, s), 10.79 (1 H, s) l Example 427 OMe OMe I I Me s Me S mye Step 1 I ste 2 N 0 N 0 k CONHOH
Step 1: 2H-2- (4-Methoxybenzyl)-7-methyl-1, 4-benzothiazin- 3(4H)-one A mixture of 2-amino-6-methylbenzothiazole (657 mg) in 20% NaOH aq. (10 mL) was heated at 180 °C in an autoclave for 5 hours. The mixture was cooled to 80 °C and a solution of 2-bromo-3- (4-methoxyphenyl) propionic acid (1.088 g) in 10% NaOH aq. (10 mL) was added and the temperature was maintained at 80 °C for 1 hour. The mixture was cooled to r. t. and concentrated under reduced pressure. The residue was dissolved in AcOH (40 mL) and heated at 100 °C for 4 hours. The reaction mixture was cooled to r. t. and concentrated under reduced pressure.
The residue was dissolved in EtOAc and washed with water and 5% Na2CO3 aq. The organic layer was dried over Na2SO4 and concentrated. The residue was purified by recrystallization from Et20 and hexane to give a white solid (805 mg).
Step 2: 2H-2- (4-Methoxylbenzyl)-7-methyl-1,4- benzothiazin-3 (4H)-one-4-yl-acetic acid N-hydroxyamide The product of Step 1 was converted to hydroxamic acid as described in Example 405 (step 2 and 3).
The following compounds listed in the Tables 7,7'and 7"are prepared in a similar manner. Table 7 RR3 s I OM e RR 2 N 0 RR 1 CONHOH Example RR1 RR2 RR3 8) No. () 427-H-H-Me 2. 29 (3H, s), 2.68 (1H, m), 3.15 (1H, m), 3.77 (3H, s), 3.81 (1H, m), 4.45 (1H, d, J=16Hz), 4.51 (1H, d, J=16Hz), 6.88 (2H, d, J=8.07Hz), 7.04-7.22 (5H, m), 9.02 (1H, s), 10.80 (1H, s) 2. 40 (3H, s), 2.71 (1H, m), 3.21 (1H, m), 3.69 (1H, m), 3.76 (3H, s), 4.19 (2H, br-s), 6.87 (2H, d, J=7.86Hz), 7.02-7.28 (5H, m), 8.90 (1 H, bs), 10.60 (1 H, s) 429-Cl-H-H 2. 73 (1H, m), 3.19 (1H, m), 3.76 (3H, s), 3.84 (1H, m), 4.43 (2H, s), 6.87-6.90 (2H, d, J=8.61Hz), 7.13-7.19 (3H, m), 7.44-7.48 (2H, m), 8.89 (1H, bs), 10.63 (1H, s) 430-OMe-H-H 2.66 (1H, m), 3.17 (1H, m), 3.68 (1H, m), 3.72 (3H, s), 3.80 (3H, s), 4.20 (1H, d, J=15Hz), 4.40 (1H, d, J=15Hz), 6.84 (2H, d, J=8.25Hz), 6.95-7.15 (5H, m), 8.76 (1H, bs), 10.40 (1H, s) 431-H-Me-Me 2. 16 (3H, s), 2.21 (3H, s), 2.62 (1H, m), 3.08 (1H, m), 3.72 (3H, s), 3.73 (1H, m), 4.43 (2H, s), 6.83 (2H, d, J=8.61Hz), 6.93 (1H, s), 7.10-7.13 (3H, m), 8.98 (1H, s), 10.74 (1H, s) 2.70 (1 H, m), 3.16 (1 H, m), 3.77 (3H, s), 3.90 (1 H, m), 4.47 (1 H, d, J=16Hz), 4.54 (1 H, d, 432-H-H-F J=16Hz), 6.88 (2H, d, J=8.61Hz), 7.16-7.22 (4H, m), 7.36 (1H, d, J=7.68Hz), 9.05 (1H, bs), 10.821 H, s Table7'RR2 s N 0 roi N0"RR CONHOH Example RR'RR2 NMR :'H-NMR (DMSO-d6;8) No. 757-OMe-N02 2.69 (1 H, dd, J=9,14Hz), 3.08 (1 H, dd, J=6,14Hz), 3.71 (3H, s), 3.99 (1 H, dd, J=6, 9Hz), 4.5- 5.0 (2H, m), 6.82 (2H, d, J=8.6Hz), 7.13 (2H, d, J=8.6Hz), 7.34 (1 H, d, J=9Hz), 8.14 (1 H, dd, 8.24 (1 H, d, J=2.6Hz), 42 (1 H, bs), 10. 42,10.83 (1 H, b s). 758-OMe-S02Me 2.78 (1 H, dd, J=8.8Hz, 14Hz), 3.19 (1 H, dd, J=6,14Hz), 3.31 (3H, s), 3.68 (3H, s), 4.03 (1 H, dd, J= 6,8.8Hz), 4.63-5.05 (2H, m), 6.92 (2H, d, J=8.5Hz), 7.22 (2H, d, J=8.5Hz), 7.44 (1 H, d, J=8.6Hz), 7.88 (1 H, dd, J=2,8.6Hz), 7.97 (1 H, d, J=2Hz), 56 (1 H, b s), 92 (1 H, bs). 759-OCF3-S02Me 2.85 (1 H, m), 3.19 (1 H, m), 3.22 (3H, s), 4.06 (1 H, dd, 4.54-4.99 (2H, m), 7.30 (5H, m), 7.80 (1 H, d, J=8.6Hz), 7.92 (1 H, s), 9.43,9.01 (1 H, bs), 10.83,10.41 (1 H, bs). Table 7 Ru2' RR3 N 0 RR' RRSO R CONHOH Example RR'RR2 RR3 mol. Mass HPLC rt No. weitht (m/e) (min) 760-H-H-NMe2 371. 5 372.2,339.2 2.29 761-H-H-CF3 396.4 0,336 3.00 762-OCF3-H-S02Me 490.5 0 2.71 763-OCF3-H-H 412.4 11 764-OCF3-CF3-H 480.4 0 3.20 765-H-Me-Me 356.4357.0,324.2 2.97 766-OCF3-H-F 430.4431.2,398.0 2.99 767-H-H-OMe 358.4 74 768-H-H-S02Me 406.5 407.2,374.0,446 2.46 769-OCF3-Me-Me 440.4441.4,408.2 3.17 770-H-H-Me 342.4 2 2.84 771-H-H-F 346.4 347.4,314.0 3.11 772-H-H-OEt 372.4 2 3.23 773-H-H-Cl 362.8363.2,330.2 2.97 774-OCF3-H-Cl 446.8446.9, 414. 2 3.16 775-H-H-N02 373.4 0 2.76 776-H-H-Br 407.3407.0,374.0,3463. 37 Example 433 OMe OMe aSH St 1 NasxJ St 2 NaS t NH2 2HCI N O N O k cet I-- N N O OMe CONHOH
Step 1: 2H-2- (p-methoxybenzyl)-1,4-pyrido [3,4-e] thiazin-3 (4H )-one To a mixture of 3-Amino-4-mercaptopyridine2HCl (400 mg) and 2-bromo-3- (p-methoxyphenyl) propionic acid (520 mg) in DMF (8 mL) was added K2C03 (1.38 gr) and the mixture was stirred for 3 hrs at r. t. EDCHC1 (800 mg) and 1- hydroxybenzotriazole (900 mg) were added to the reaction mixture and the stirring was continued overnight. The reaction mixture was diluted with aq. NaHC03 and extracted with EtOAc 3 times. The combined organic layers were washed with aq. NaHC03, aq. NaH2PO4 and brine. Column chromatography on silica gel (eluent; CHCl3/MeOH=40/l) gave the product as a white solid (390 mg).
Step 2: 2H-2- (p-methoxybenzyl)-1,4-pyrido [3,4-e] thiazin- 3 (4H)-one-4-yl-acetic acid ethyl ester To a THF (15 mL) solution of 2H-2- (p-methoxybenzyl)-1,4- pyrido [3,4-e] thiazin-3 (4H)-one (385 mg) was added NaH (60%
in oil, 39 mg) at O °C, and the mixture was stirred for 30 min. at the same temperature and for 30 min at r. t. After the reaction mixture was cooled to O°C, ethyl bromoacetate (164 ZL) was added and the reaction mixture was stirred for 3 hrs at r. t. The reaction was quenched by the addition of aq. NaH2PO4 and extracted with EtOAc several times. Column chromatography on silica gel (eluent; CHC13/EtOAc=5/1) gave the product almost quantitatively as a colorless oil.
Step 3: 2H-2- (p-methoxybenzyl)-1,4-pyrido [3,4-e] thiazin- 3 (4H)-one-4-yl-acetic acid N-hydroxyamide The compound obtained above was treated with 5N NaOH (0.8 mL) in MeOH (8 mL) for 1 hr at r. t. The reaction mixture was concentrated tn vaouo, diluted with water and the pH was adjusted to 5.2 by 1N HC1. Lyophilization gave the corresponding carboxylic acid as a white powder.
The white powder in CH2C12 (15 mL) and pyridine (0.8 mL) was treated with pentafluorophenyl trifluoroacetate (400 RL) for 3 hrs at r. t., and the resulting mixture was treated with O-TMS-hydroxylamine (320 liL) and stirred overnight at r. t. The reaction mixture was concentrated in vacuo and the residue was dispersed in water and cyclohexane. The white precipitate was filtered and purified on silica gel (eluent: CHCl3/MeOH=20/l), affording the product as a white solid. (315 mg) NMR (d6-DMSO, 8): 2.70 (lH, dd, J=14.3,9.0), 3.11 (1H, dd, J=14.3,
6.1), 3.72 (3H, s), 3.99 (lH, dd, J=9.0,6.1), 4.57 (2H, s), 6.83 (2H, d, J=8.6), 7.13 (2H, d, J=8.6), 7.42 (lH, d, J=5.1), 8.18 (lH, d, J=5.1), 8.35 (lH, s), 9.00 (lH, s), 10.81 (lH, s) Example 434 OMe OMe OMe I I I s s s COOH/CONHCOOEt/ Br Br N O Step Br ~/vNAO Stop 3 N OOMe CONHOH Step 1: Ethyl (2S)-2- [2'- (2-bromophenyl) thio-3'- (4- methoxyphenyl)propanoyl] amino-4-methylpentanoate To a solution of 2- (2-bromophenyl) thio-3- (4- methoxyphenyl) propanoic acid (1.102 g) and L-leucine ethyl ester'HC (704 mg) in DMF (10 mL), HOBt (551 mg) and EDC HC1 (690 mg) were added. The reaction mixture was stirred at r. t. overnight. The solvent was removed under reduced pressure. The residue was dissolved in EtOAc and washed with 1N HC1,5% Na2CO3 aq. and brine. The organic layer was dried over Na2SO4 and concentrated to give the pure product as a pale yellow oil (1.561 g, quant.).
Step 2: Ethyl (2S)-2- [2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3(4H)-one-4-yl]-4-methylpentanoate
The product obtained in Step 1 (763 mg), Pd2 (dba) 3 CHCl3 (78 mg), P (o-tolyl) 3 (92 mg), and Cs2CO3 (977 mg) in toluene (12 mL) were heated to 100°C in a culture tube (PYREXPLUS) under nitrogen for 40 hrs. The reaction mixture was then cooled to r. t., diluted with EtOAc, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by preparative thin layer chromatography on silica gel (toluene/EtOAc, 20/1) to give the product as a pale yellow oil (274 mg).
Step 3: (2S)-2-[2H-2-(4-Methoxybenzyl)-1, 4-benzothiazin- 3 (4H)-one-4-yl]-4-methylpentanoic acid N-hydroxyamide To a solution of the compound obtained in Step 2 (274 mg) in ethanol (5 mL) and THF (5 mL), IN NaOH (2.56 mL) was slowly added at 0 °C. After 30 minutes'stirring, the mixture was warmed to room temperature and left over 1 day. The reaction mixture was concentrated under reduced pressure and the residue was dissolved in EtOAc and washed with IN HC1. The organic layer was dried over Na2SO4 and concentrated. The crude acid was used in the following step. The acid (204 mg) was dissolved in CH2C12 (3 mL) and pyridine (3 mL) and pentafluorophenyl trifluoroacetate (716 mg) was added. After 3 hours' stirring, O-TBDMS-hydoxylamine (452 mg) was added. The reaction mixture was stirred at r. t. overnight. The solvent was removed under reduced pressure, and the residue was dissolved in EtOAc. The organic layer was
washed with 1N HC1 and brine, and dried over Na2SO4 and concentrated under reduced pressure. The residue was purified by preparative thin layer chromatography on silica gel (toluene/EtOAc=1/1) to give the hydroxamic acid (208 mg) as a pale orange solid.
The following compounds listed in the Table 8 were prepared in a similar manner.
Table 8 Example RR1 NMR: 1H-NMR(DMSO-d6; #) No. 434 (S) -iBu 0.57-0.77(6H, m), 1.00(1H, m), 1.70(1.5H, m), 2.02(0.5H, m), 2,58( 3.02(0.5H, m), 3.35(0.5H, m), 3.72(1.5H, s), 3.73(1.5H, s), 3.78(1H 5.56(0.5H, m), 6.82-6.88(2H, m), 7.03-7.46(6H, m), 8.94(0.5H, s), @ 10.79(0.5H, s) 435 (R) -iBu 0.57-0.77(6H,m), 1.00(1H, m), 1.73(1.5H, m), 2.02(0.5H, m), 2.59(@ 3.02(0.5H, m), 3.42(0.5H, m), 3.72(1.5H, s), 3.73(1.5H, s), 3.78(1H 5.56(0.5H, m), 6.82-6.88(2H, m), 7.06-7.46(6H, m), 8.94(0.5H, s), @ 10.79(0.5H, s) 436 (S) -iPr 0.43(3H, m), 0.96(3H, m), 2.26(0.5H, m), 2.45(0.5H, m), 2.80(1H, n s), 3.73(1.5H, s), 3.80(1H, m), 4.77(0.5H, d, J=10.9Hz), 4.94(0.5H, m), 6.94-7.42(6H, m), 9.05(1H, bs), 10.81(1H, m) 437 (S)-Me 1.27(1.5H, d, J=7.32Hz), 1.39(1.5H, d, J=6.96Hz), 2.59(0.5H, m), 2 3.34(0.5H. m). 3.72(1.5H. s). 3.73(1.5H. s). 3.82(1H. m). 5.08(0.5H 6.82-6.88(2H, m), 7.03-7.41(6H, m), 8.86(0.5H, s), 8.95(0.5H, s), 1@ 438 (R) -Me 1.27(1.5H, d, J=7.32Hz), 1.39(1.5H, d. J=6.9Hz), 2.59(0.5H, m), 2 3.34(0.5H. m). 3.72(1.5H. s). 3.73(1.5H. s). 3.78(1H. m). 5.08(0.5H 6.82-6.88(2H, m), 7.03-7.41(6H, m), 8.86(0.5H, s), 8.95(0.5H, s), 1@ Example 439 I w S I w st I w S I w st >N O OMe N O OMe H COOH' O COOBu' f'Yfl +ffTT1 Step 3 OMe OMe COOBut COOBut 0 0 0 O Step 4 N COOBu' O OMe COOH CONHOH
Step 1: 2H-2- (4-Methoxybenzyl)-1,4-benzothiazin-3 (4H)- one-4-yl-acetic acid t-butyl ester To a solution of 2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one (2 g) in THF (20 mL), NaH (304 mg) and subsequently t-butyl bromoacetate (1.13 mL) were added at 0-5 °C. The mixture was stirred at the same temperature for 5 minutes and at r. t. for 30 minutes. The reaction was quenched by adding 150 mL of water, and extracted with EtOAc. The organic layer was washed with brine, and dried over MgS04 and concentrated under the reduced pressure, and residue was purified by silica gel column chromatography (Eluent: Hexane: EtOAc=10: 1) to give 3.0 g of the product as oil.
Step 2: 2H-2- (4-Methoxybenzyl)-1,4-benzothiazin-3 (4H)- one-4-yl-acetic acid t-butyl ester 1-oxide and 1,1-
dioxide Product in Step 1 (500 mg) was dissolved in MeOH (10 mL) and m-CPBA (432 mg) was added at 0-5 °C. The mixture was stirred at the same temperature for 5 min. and warmed to r. t. After stirred for 1 hour, 100 mL of water was added and extracted with EtOAc. The organic layer was washed with sat. NaHC03 aq. and brine, and dried over MgS04 and concentrated under the reduced pressure, and the residue was purified with silica gel column chromatography (Eluent: Hexane: EtOAc=5: 1) to give 270 mg of 1,1-dioxide and 370 mg of 1-oxide as oil.
Step 3: 2H-2- (4-Methoxybenzyl)-1,4-benzothiazin-3 (4H)- one-4-yl-acetic acid 1,1-dioxide To the sulfone of Step 2 (270 mg), was added TFA (2 mL) at 0-5 °C. The mixture was warmed to r. t. and stirred for 2 hrs. 100 mL of Et20 was added and the resulting precipitate was filtered and washed with Et20, giving 245 mg of the corresponding acid.
Step 4: 2H-2- (4-Methoxybenzyl)-1,4-benzothiazin-3 (4H)- one-4-yl-acetic acid N-hydroxyamide 1,1-dioxide The product of Step 3 was converted to hydroxamic acid by the method described in Example 405, giving 95.6 mg of the product as colorless solid.
1H-NMR (DMSO-d6,8) 3.06 (lH, dd, J=8.6Hz, 14.6Hz), 3.21 (lH, dd, J=4.0Hz, 14.6Hz), 3.70 (3H, s),
4.51 (lH, d, J=17Hz), 4.57 (lH, d, J=17Hz), 4.99 (lH, dd, J=4.0Hz, 8.6Hz), 6.80 (2H, d, J=8.4Hz), 7.20 (2H, d, J=8.4Hz), 7.38 (2H, m), 7.78 (lH, t, J=7.3Hz), 7.88 (2H, d, J=7.1Hz), 9.03 (0.8H, bs), 9.42 (0.2H, bs), 10.43 (0.2H, bs), 10.79 (0.8H, bs).
Example 440 OMe OMe OMe I o u II II s s s _ Step 1 Step 2 I s -'// N O N O N O COOBut COOH CONHOH Step 1: 2H-2- (4-Methoxybenzyl)-1, 4-benzothiazln-3 (4H)- one-4-yl-acetic acid 1-oxide The product (290 mg) was obtained as colorless precipitate from the sulfoxide (370 mg) of Example 439 (Step 2) by the method described in Example 439 (Step 3).
Step 2: 2H-2- (4-Methoxybenzyl)-1,4-benzothiazin-3 (4H)- one-4-yl-acetic acid N-hydroxyamide 1-oxide The product of Step 1 was converted to hydroxamic acid as described in Example 439 to give 95 mg of the product.
1H-NMR (DMSO-d6,6) 3.09 (lH, m), 3.49 (lH, b), 3.76 (3H, m), 4.40-5.00 (3H, m), 6.30-6.50 (2H, m), 7.00-7.50 (4H, m), 7.60- 7.90 (2H, m), 9.04-9.45 (lH, m), 10.78-10.87 (lH, m).
Example 441 OMe COOEt Step 1 I S COOEt H O y 0/ COOBu O NH H 0 0 N H COOH' /.\// 0 OMe N 0 COOBu'CONHOH
Stepl: 2H-2-(Ethoxycarbonylmethyl)-1, 4-benzothiazin- 3 (4H)-one-4-yl-acetic acid t-butyl ester To a solution of 2H-2- (ethoxycarbonylmethyl)-1,4- benzothiazin-3 (4H)-one (2 g) in THF (20 mL) was added sodium hydride (335 mg), and t-butyl bromoacetate (1.23 mL) was added dropwise at 0-5 °C. The mixture was stirred for 5 min. at the same temperature and for 30 minutes at r. t. 150 mL of water was added and extracted with EtOAc. The organic layer was washed with brine, and dried over MgSO4 and concentrated under the reduced pressure to give 3.1 g of the product as oil.
Step2: 2H-2- [N'- (4-methoxyphenyl) carbamoylmethyl]-1,4- benzothiazin-3 (4H)-one-4-yl-acetic acid t-butyl ester To a solution of the product of stepl in MeOH (20 ml), IN NaOH (7.96 ml) was added at 0 °C. Stirring was continued for 3 hrs. The reaction mixture was diluted with water, and washed with Et20. The aqueous layer was acidified with IN HC1 and the product was extracted with EtOAc. The organic layer was dried over Na2SO4 and concentrated to give the corresponding acetic acid (2.79
g) as oil.
To the solution of the acetic acid (200 mg) in DMF (20 ml), 4-anisidine (77 mg) and EDCHC1 (119 mg) were added at 0 °C. Stirring was continued for 5 hours. The reaction mixture was diluted with water and extracted with EtOAc. The organic layer was washed with 1N HC1, sat.
NaHC03 and brine, dried over MgS04 and concentrated under the reduced pressure. The residue was purified with silica gel column chromatography (Eluent: Hexane: EtOAc=3: 1) to give the product (220 mg).
Step3: 2H-2- [N'- (4-Methoxyphenyl)-carbamoylmethyl]-1,4- benzothiazin-3 (4H)-one-4-yl-acetic acid N-hydroxylamide The product of Step 2 was converted to the hydroxamic acid as described in Example 439 to give 141mg of the product.
The following compounds listed in the Table 9 were prepared in a similar manner.
Table 9 Example RR1 NMR: 1H-NMR(DMSO-d6; #) No 2.55(1H,dd,J=15Hz,8.8Hz), 2.94(1H,dd,J-15Hz,5.5Hz), 3.7@ 4.01Hz(1H,dd,J=8.6Hz,5.5Hz), 4.34-4.76(2H,m), 6.86(2H,d,@ 441 -C6H4-4-OMe 7.08(2H,m), 7.31(1H,m), 7.43(3H,m), 8.97,9.37(1H,s), 9.91,@ 10.34, 10.79(1H,s). 2.42(1H,dd,(J=9.0Hz, 15Hz), 2.81(1H,dd,J=5.0Hz, 15Hz), 3.7 442 -CH2-C6H4-4-OMe 3.95(1H,m),4.17(2H,m), 4.33-4.76(2H,m), 6.87(2H,d,J=8.6H 7.41 (6H,m), 8.46(1H,t,J=5.6Hz), 8.97,9.39(1H,s), 10.33, 10.7 2.30(1H,dd,J=9.5Hz, 15Hz), 2.64(3H,m), 3.22(2H,m), 3.70(31 443 -(CH2)2-C6H4-4-OMe 4.33-4.74(2H,m), 6.83(2H,d,J=8.4Hz), 7.07-4.41(6H,m),8.0@ 8.97,9.37(1H,s), 10.34, 10.79(1H,s).
Example 444 oH St o st w ° ruza N Me N 2 H CONHOH
Step 1: 2H-2- (4-Methoxybenzyl)-1,4-benzoxazin-3 (4H)-one To a solution of 2-bromo-3- (4-methoxyphenyl) propionic acid (1.6 g) in DMF (10 ml), 2-aminophenol (731 mg), EDCHC1 (1.54 g), and HOBt (500 mg) were added at 0 °C.
Stirring was continued for 2 hrs. The reaction mixture was diluted with water and extracted with EtOAc. The organic layer was washed with 1N HC1, sat. NaHC03 and brine, dried over MgSO4 and concentrated under reduced pressure. The residue was purified with silica gel column chromatography (Eluent: Hexane: EtOAc=5: 1).
To a solution of the obtained crystal (547 mg) in DMF (3 ml), R2CO3 (300 mg) was added at 0 °C. Stirring was continued at room temperature for 2 hrs. The reaction mixture was diluted with water and extracted with EtOAc.
The organic layer was washed with brine, dried over MgSO4 and concentrated under reduced pressure. The residue was purified with silica gel column chromatography (Eluent: Toluene: EtOAc=6: 1). 266 mg of the product was obtained as oil.
Step 2: 2H-2- (4-Methoxybenzyl)-1,4-benzoxazin-3 (4H)-one- 4-yl-acetic acid N-hydroxyamide The compound obtained in Step 1 (266 mg) was converted
to the hydroxamic acid derivative by the method described above and 152 mg of the product was obtained as colorless precipitate.
1H-NMR (DMSO-d6,8) 2.90 (lH, dd, J=9. OHz, 14Hz), 3.06 (lH, dd, J=4.2Hz, 14Hz), 3.71 (3H, s), 4.41 (lH, d, J=16Hz), 4.47 (lH, d, J=16Hz), 4.83 (lH, dd, J=4.2Hz, 9.0Hz), 6.89 (2H, d, J=8.6Hz), (4H, m), 7.15 (2H, d, J=8.6 Hz), 8.98, (0.8H, bs), 9.40 (0.2H, bs), 10.35 (0.2H, bs), bs).
Example 445 OMe OMe OMe Step 1 I S Step % In"'0 H H 4oCOOEt CCONHOH Step 1: 3- [2H-2- (4-Methoxybenzyl)-1, 4-benzothiazin-3 (4H)- one-4-yllpropanoic acid To a solution of 2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one (570 mg) in THF (20 mL), NaOH powder (84 mg) was added. After 10 minutes'stirring, ethyl acrylate (600 mg) was slowly added. The reaction mixture was stirred at room temperature for 5 hours. The solvent was removed under reduced pressure and the residue was acidified with 4N HC1. The product was extracted with EtOAc and the organic layer was dried over Na2SO4 and concentrated. The crude product was used in the following
step without purification.
To a solution of the ethyl ester in MeOH (20 mL), 1N NaOH (2.0 mL) was slowly added. The mixture was stirred at r. t. overnight and concentrated under reduced pressure. The residue was dissolved in water, and the aqueous solution was washed with Et20 and acidified with 4N HC1. The product was extracted with EtOAc. The organic layer was dried over Na2SO4 and concentrated to give the propanoic acid (618 mg) as a white solid.
Step 2: The product of Step 1 was converted to hydroxamic acid by the method described in example 405 (step 3 and 4).
1H-NMR (DMSO-d6,6) 2.30 (2H, m), 2.63 (1H, m), 3.03 (1H, m), 3.72 (3H, s), 3.77 (1H, m), 4.11 (2H, m), 6.84 (2H, d, J=8.04Hz), 7.06-7.11 (3H, m), 7.32-7.42 (3H, m), 8.82 (1H, s), 10.53 (1H, s) Example 446 OMe OMe OMe Step 1 I S St N O N O/N O H ! ! COOET CONHOH 3- [2H-2- (4-Methoxybenzylidene)-1,4-benzothiazin-3(4H)-one- 4-yl] propanoic acid N-hyroxylamide The reaction procedure of Step 1 and 2 were similar to
the example 445 (Step 1 and 2).
LC-MS: MS (m/e) 371.0,338.0,296.2 (M. W. =370.4); Retention Time= 3.07 min.
Example 730 CHO O'\ stem1 MeO N S Step1 Me0 N S ci 0 0 0 \ cl HO N S HO NS step 2 + Step w w ci 60/40 Ci 0 0 0 0 HO N S Step 4 HOHN N S=0 ci ci Step 1: 4-Methyl-2- (S)- [2- (RS)- (4-chlorophenyl)-4-oxo- thiazolidin-3-yl]-pentanoic acid methyl ester A suspension of (L)-leucine methyl ester (10 g, 55 mmol) and triethylamine (7.7 ml, 55 mmol) in 120 ml of dioxane was stirred at room temperature for 5 minutes. 3 A
molecular sieves were added followed by p- chlorobenzaldehyde (17 g, 121 mmol). The mixture was heated at 80 °C for 4 hrs. Mercaptoacetic acid (14.2 ml, 203.5 mmol) was added to the mixture and the heating was continued for an additional 12 hrs. The reaction mixture was cooled to room temperature, and diluted with ethyl acetate (40 ml) and water (30 ml). The reaction mixture was filtered to remove the molecular sieves. The organic layer was diluted with ethyl acetate (100 ml), washed twice with 60 ml of saturated solution of sodium carbonate, twice with aqueous 1N HC1 and once with water. The organic layer was dried with MgSO4 and evaporated to give a residue that was carried out to the next step without further purification.
Step 2: 4-Methyl-2- (S)- [2- (RS)- (4-chlorophenyl)-4-oxo-thiazo lidin-3-yll-pentanoic acid The residue obtained in step 1 was dissolved in dioxane (50 ml). 30 ml of saturated solution of LiOH were added and the mixture was stirred at room temperature for 3h (analytical LC/MS showed no traces of starting material). The mixture was acidified with conc. HC1 until acidic pH and diluted with ethyl acetate (50 ml). The 2 layers were separated and the aqueous layer was extracted 3 times with ethyl acetate (30 ml). The organic layers were combined, dried with MgSO4, filtered and evaporated to give an oil that solidified upon standing. The reaction mixture was further purified column by
chromathography with hexane-ethyl acetate (from 95: 5 to 1: 1) to give 14.4 g (yield for 2 steps: 80%) of the desired product as a 60: 40 mixture of diastereoisomers.
Step 3: Separation of Diastereoisomers The mixture of pure acids obtained in Step 2 was dissolved in refluxing toluene. Upon cooling 2g of the minor isomer crystallized out of the mixture and were used for further transformations.
Step 4: 4-Methyl-2- (S)- [2- (S)- (4-chlorophenyl)-1, 4-dioxo-thi azolidin-3-yl]-pentanoic acid N-hydroxyamide The crystal obtained in Step 3 (500 mg, 1.52 mmol) was dissolved in methanol (200ml). A solution of sodium periodate (326 mg, 1.5 mmol) in 25 ml of water was added and the heterogeneous mixture was stirred at room temperature for 3 days. When no starting material was observed by LC/MS, the reaction mixture was concentrated to 80% of its volume, acidified with acetic acid (2 ml) and diluted with water (10 ml) and ethyl acetate (25 ml).
The 2 layers were separated and the water layer extracted 2 additionnal times with ethyl acetate (2X 20 ml). The organic layers were combined, dried with MgSO4, evaporated under dryness to give the product as a white solid that was taken to the next step without purification.
To a solution of the product in 5 ml of CH2C12 (DCM) and 2 ml of pyridine was added pentafluorophenol trifluoroacetate (914 ml, 5.32 mmol). The solution was
stirred at room temperature for 1 h. O- (tert- Butyldimethylsilyl)-hydroxylamine (1.2 g, 7.6 mmol) in 2 ml of CH2C12 was added to the activated ester and the mixture was stirred at room temperature for an additional 12 h. The reaction mixture was acidified with HC1 (to cleave the TBDMS protective group) and stirred at room temperature for lh. After dilution with DCM (4ml) and water (2ml), the 2 layers were separated, the organic layer dried with MgSO4, filtered and evaporated to give an oil that was dissolved in DMSO (3 ml) and purified by reverse phase HPLC. The Product (141 mg, 26%) was obtained with 98% purity.
The following compounds listed in the Table 13 were prepared in a similar manner.
Table13 mol. Mass HPHC r@ Example RR1 RR2 RR3 No. weitht (m/e) (min) 730 -iBu -Cl -H 358.8 359.2, 326.0, 298 1.99 731 -iBu -O-C6H4-4-Cl -CH2CONH(CH2)2OMe 566.1 566.2, 508.2, 475.2 3.05 732 -iBu -F -H 342.4 343.0, 310.2, 282 1.98 733 -iBu -O-C6H4-4-F -H 434.5 435.2, 402.2, 374 2.76 734 -iBu -O-C6H4-4-F -H 434.5 435.2, 402.2, 374 2.75 735 -iBu -Cl -h 358.8 359.2, 326.0, 298 2.24 736 -iBu -O-C6H4-4-Cl -H 450.9 451.0, 418.0 3.21 737 -iBu -H -H 324.4 325.2, 292.2, 264 1.91 738 -iBu -O-C6H4-4-Cl -CH2CONHCH2-2-furyl 588.1 588.2, 509.2 3.12 739 -iBu -O-C6H4-4-Cl -CH2CONHCH2-2-furyl 588.1 588.2 3.14 740 -iBu -O-C6H4-4-Cl -CH2CONH(CH2)2OMe 566.1 566.2, 509.2, 476.0 2.88 741 -iBu -O-C6H4-4-Cl -CH2CONH(CH2)2OMe 566.1 566.2, 509.2, 476.0 3.15 742 -iBu -Cl -CH2CONHCH2-2-furyl 496.0 496.2 3.10 743 -iBu -Cl -CH2CONHMe 429.9 430.2 2.81 744 -iBu -Cl -CH2CONHMe 429.9 430.2 2.43 745 -iBu -Cl -CH2CONH(CH2)2OMe 474.0 474.2, 417.2 2.86 746 -iBu -Cl -CH2CONH2 415.9 416.2, 483.0 2.35 747 -iBu -Cl -CH2CONH2 415.9 416.2 2.61 Example 748 o Ng 0 0 Cl Cl HO N S Step I HOHN N s 6 ci cul
Step 1: 4-Methyl-2- (S)- [2- (S)- (4-chlorophenyl)-1, 1,4-trioxo- thiazolidin-3-yl]-pentanoic acid N-hydroxyamide The crystal obtained from Example 730, Step 3 (100 mg, 0.30 mmol) was dissolved in acetic acid (2ml). A solution of potassium permanganate (66.4 mg, 0.42 mmol) in 2 ml of water was added dropwise during a period of 1 hour at 0 °C. The mixture was stirred at room temperature and followed by LC/MS. After lh, no starting material was observed; the color of the reaction was removed with NaHS203, diluted with water and extracted with EtOAc. The 2 layers were separated and the water layer extracted 2 additional times with ethyl acetate (2X 20 ml). The organic layers were combined, dried with MgSO4, evaporated under dryness to give the product as a white solid that was taken to the next step without purification.
To a solution of this solid in 1 ml of DCM and 0.5 ml of pyridine was added pentafluorophenol trifluoroacetate (231 ml, 1.34 mmol). The solution was stirred at room temperature for 1 h. O-(tert-Butyldimethylsilyl)-
hydroxylamine (270 mg, 1.83 mmol) in 1 ml of DCM was added to the activated ester and the mixture was stirred at room temperature for an additional 12 h. The reaction was acidified with HC1 (to cleave the TBDMS protective group) and stirred at room temperature for lh. After dilution with DCM (4ml) and water (2ml), the 2 layers were separated, the organic layer dried with MgS04, filtered and evaporated to give an oil that was dissolved in DMSO (2 ml) and purified by reverse phase HPLC to yield the hydroxamic acid as a white solid.
The following compounds listed in the Table 14 were prepared in a similar manner.
Table 14 Example RR1 RR2 RR3 mol @ No. weitht (@ 748 -iBu -Cl -H 374.8 3 749 -iBu -O-C6H4-4-Cl -CH2CONH2 524.0 5 750 -iBu -O-C6H4-4-Cl -CH2CONH(CH2)2OMe 582.1 5 751 -iBu -Cl -CH2CONH(CH2)2OMe 490.0 4 752 -iBu -O-C6H4-4-F -H 450.5 4 753 -iBu -O-C6H4-4-Cl -H 466.9 4 Example 777 t-Bu02C N°2 t-Bu02C N O OMe H Zens S m,, t-Bu02C N O OMe HOOC N O OMe COOEt CONHOH
Step 1: t-Butyl 2H-2- (4-methoxybenzyl)-1,4-benzo-thiazin-3 (4 H)-one-6-carboxylate To 2-mercapto-3- (4-methoxyphenyl) propionic acid (14g) in ethanol (lOOml), t-butyl 4-chloro-3-nitro- benzoate (17g), and potassium fluoride (3.8g) were added at 0 °C. Potassium carbonate (9.1g) was slowly added at 0°C and the mixture was heated under reflux for 7 hrs. The solvent was removed under the reduced pressure and the residue was diluted with water. The solution was washed with Et20 and extracted with EtOAc. The organic layer was washed with brine, and dried over MgSO4 and concentrated under the reduced pressure. The solution of the residue in MeOH (120ml) was added dropwise to the suspension of Fe powder (11.4g) in MeOH (50ml)-NH4Claq. (17.6g/80ml of water) at r. t. The mixture was stirred at 80°C for 3 hrs.
AcOH (50ml) was added to the reaction mixture, and the stirring was continued for 3 hrs at 80°C. The reaction mixture was cooled to room temperature, poored into ice- water, and extracted with EtOAc. The organic layer was washed with brine, dried over MgSO4 and concentrated under
the reduced pressure. The residue was purified with silica gel column chromatography (eluent: hexane/EtOAc, 8/1,5/1,3/1) to give the product as oil. This was crystalized from EtOAc-Hexane to give a colorless crystal(12.7g).
Step 2: Ethyl 6-t-butoxycarbonyl-2H-2- (4-methoxy-benzyl)-1,4 -benzothiazin-3 (4H)-one-4-yl-acetate To sodium hydride (3.32g) suspended with THF (30 mL) was added a solution of the product of Step 1 (30.5 g) in THF (240 mL), and ethyl bromoacetate (13.1 mL) were added dropwise at 0-5 °C. The mixture was warmed to r. t. and left at r. t. overnight. Saturated aqueous ammonium chloride was added and extracted with EtOAc. The organic layer was washed with water and brine, dried over MgS04, and concentrated under the reduced pressure to give 37 g of the product as oil.
Step 3: 6-Carboxyl-2H-2- (4-methoxybenzyl)-1, 4-benzo-thiazin- 3 (4H)-one-4-yl-acetic acid N-hydroxyamide To a solution of ethyl 6-t-butoxycarbonyl-2H-2- (4- methoxy-benzyl)-1,4-benzothiazin-3 (4H)-one-4-yl-acetate (3g) was added 5N-aqueous sodium hydroxide (1.44mL) at r. t. and stirred for 4hr at r. t. The reaction mixture was concentrated under reduced pressure. 5% KHS04 aq. was added, and extracted with EtOAc. The organic layer was washed with brine, and dried over MgS04 and concentrated under reduced
pressure to give 6-t-butoxycarbonyl-2H-2- (4-methoxy- benzyl)-1,4-benzothiazin-3 (4H)-one-4-yl acetic acid as oil.
Isobutyl chloroformate (1.04 g) was added dropwise to a THF (30 mL) solution of 6-t-butoxycarbonyl-2H-2- (4-Methoxy- benzyl)-1,4-benzo-thiazin-3 (4H)-one-4-yl acetic acid and N- methylmorpholine (769 mg) at-15 to-20 °C. O-TMS- hydoxylamine (1.09 g) was added after additional 15 minutes'stirring. The mixture was warmed to r. t. with stirring, and stood overnight. The reaction mixture was quenched with sat. NaHC03 aq. and extracted with EtOAc. The organic layer was washed with 1N HC1, sat. NaHC03 aq. and brine, dried over MgSO4 and concentrated under reduced pressure to give 2.25 g of 6-t-butoxycarboxyl-2H-2- (4- methoxybenzyl)-1,4-benzo-thiazin-3 (4H)-one-4-ylacetic acid N-hydroxyamide as pale yellow oil. 5%-ethanedithiol in TFA (lOmL) was added to dissolve 6-t-butoxycarboxyl-2H-2- (4- methoxybenzyl)-1,4-benzo-thiazin-3 (4H)-one-4-ylacetic acid N-hydroxyamide, and stood at r. t. for 2hrs. Toluene (lOmL) was added and concentrated under reduced pressure. The residue was purified by recrystallization from mixed solvent of THF and hexane to give 1.2 g of the hydroxamic acid as colorless solid.
The following compounds listed in the Tables 15, and 15' were prepared in a similar manner.
Table 15 Example RR1 RR2 RR3 RR4 NMR: 1H-H-NMR (DMSO-d6; #) No. 777 -OMe -COOH -H -H 2.68(1H, dd. J=9.0, 14Hz), 3.13(1H, dd, J=6.2, 14Hz), 3.7 J=6.2, 9.0Hz), 4.50(1.6H, br-s), 4,69(0.2H, d, J=19Hz), 4. 6.83(2H, d, J=8.4Hz), 7.13(2H, d, J=8.4Hz), 7.48(1H, d, J=7.9Hz), 7.61(1H, dd, J=1.3, 7.9Hz), 7.66(1H 9.04(0.8H, s), 9.44(0.2H, s), 10.39(0.2H, s), 10.80(0.8H, s@ 778 -Cl -CH2CO2H -H -H 2.73(1H, dd,J=9.2,14.5Hz),3.17(1H,dd,J=6,14.5Hz),3.57(2H z),4.38-4.81(2H,m),6.98(1H,d,J=8Hz),7.06(1H,s),7.2-7.5(5 9.7(1H,bs),10.78,10.34(1H,bs). 779 -C6H4-4-Cl -H -H -H 2.76(1H,m),3.23(1H,m),3.91(1H,m),4.4- 5.0(2H,m),7.12(2H,m),7.35(4H,m),7.50(2H,d,J=8.7Hz),7.59 d,J=8.7Hz),8.98,9.38(1H,bs), 10.35,10.78(1H,bs). 780 -C6H4-4-F -H -H -H 2.76(1H,dd,J=9.2,14.3Hz),3.23(1H,dd,J=6.0,14.3Hz),3.93(1 5.0(2H,m),7.0-7.4(8H,m),7.56(2H,d,J=8.1Hz),7.70(2H,m),8. 9.38(1H,bs),10.34,10.78(1H,bs). 781 -O-C6H4-4-Cl -H -H -H 2.72(1H, dd, J=9.1, 14Hz), 3.17(1H, dd, J=5.9, 14Hz0, 3.8 4.45(0.8H, d, J=16Hz), 4.50(0.8H, d, J=16Hz), 4.68(0.2H, d, J=18Hz), 6.94(2H, d, J=8.5Hz), 7.01(2H, d, J=8.5Hz), 7.07(1H, td, J=0.9, 7.6Hz), 7.13(1H, d, J=8.5Hz), 7.31(1H, td, J=1.3, 8.0Hz), 7.38(1H, dd, J=1@ J=8.9Hz), 8.99(0.8H, s), 9.40(0.2H, s), 10.34(0.2H, s), 10.@ 782 -H -CO2H -H -H 273(1H, m), 3.20(1H, m), 3.98(1H, m), 4.46(2H, m), 7.21- d, J=8.07Hz), 7.62(1H, d, J=8.04Hz), 7.67(1H, s), 9.06(1@ 783 -O-C6H4-4-Cl -COO-tBu -H -H 1.55(9H, s), 2.75(1H, dd, J=8.8, 14Hz), 3.15(1H, dd, J=6. J=6.1, 8.8Hz), 4.48(0.8H, d, J=17Hz), 4.56(0.8H, d, J=171 J=18Hz), 4.96(0.2H, d, J=18Hz), 6.93(2H, d, J=8.4Hz), 7.00(2H, d, J=9.0Hz), 7.25(2H, d, J=8.4Hz), 7.42(2H, d, J J=8.1Hz), 7.58(1H, dd, J=1.5, 8.1Hz), 7.64(1H, br-s), 9.0@ s), 10.42(0.2H, s), 10.85(0.8H, s) 784 -O-C6H4-4-Cl -CO2H -H -H 2.77(1H, dd, J=9.0, 14Hz), 3.19(1H, dd, J=5.9, 14Hz), 3.9 br-s), 4.69(0.2H, d, J=18Hz), 4.95(0.2H, d, J=18Hz), 6.92 7.00(2H, d, J=9.0Hz), 7.25(2H, d, J=8.4Hz), 7.40(2H, d, J=9.0Hz), 7.48(1H, d, J=8.1Hz), 7.62(1H, dd, J=1.7, 8.1H; 9.05(0.8H, s), 9.44(0.2H, s), 10.39(0.2H, s), 10.84(0.8H, s@ 786 -H -COONa -H -H 2.73(1H, m), 3.20(1H, m), 3.98(1H, m), 4.46(2H, m), 7.21- d, J=8.07Hz), 7.62(1H, d, J=8.04hz), 7.67(1H, s), 9.06(1H 787 -Cl -CO2H -H -H 2.75(1H, dd, J=14.1, 9.0 Hz), 3.14 (1H, dd, J=14.3Hz, 6.2 J=8.6Hz, 6.2Hz), [4.49 (S), 4.67 (d, J=17.9Hz), 4.90 (d, J@ d, J=8.6Hz), 7.32 (2H, d, J=8.6Hz), 7.48 (1H, d, J=8.0Hz). 7.60 (1H, dd, J=8.1Hz, 1.5Hz), 7.65 (1H, d, J=1.5Hz), 9.4@ 10.38 (s)] 1H, 13.02 (1H, br) 788 -OCF3 -CO2H -H -H2.81(1H,dd,J=8.8,14.5Hz),320(1H,dd,J-6.4,14.5Hz),4.04(1 4.9(2H,m),7.26(2H,d,J=8Hz),7.36(2H,d,J=8Hz),7.52(1H,m), 7.61(1H,dd,J=1.5,8Hz),7.66(1H,d,J=1.5Hz),9.46,9.06(1H,bs 3.19(1H,bs). 789 -OMe -NO2 -H -H 2.722(1H,m),3089(1H,dd,J=6.4,14.4Hz),3.716(3H,s),4.032@ 5.02(2H,m),6.82(2H,d,J=8.6Hz),7.12(2H,d,J=8.6Hz),7.68(1@ d,J=8.4,2Hz),7.99(1H,d,J=2Hz),9.09,9.48(1H,bs),10.48,10.@ 790 -OMe -CN -H -H 2.68(1H,dd,J=9.2,14.3Hz),3.09(1H,dd,J=6.4,14.3Hz),3.72(@ 2Hz),4.5-5.0(2H,m), 6.82(2H,d,J=8.7Hz), 7.12(2H,d,J=8.7 (1H,d,J=8.3Hz),7.59(2H,m),9.01,9.37(1H,bs),10.38,10.86(1 791 -H -NO2 -H -H 2.75(1H,dd,J=9.2, 14Hz),3.17(1H,dd,J=6.2,14Hz),4.08(1H,@ 5.0(2H,m),7.10-7.30(5H,m), 7.75(1H,d,J=8.6Hz), 7.90(1H, 8.00(1H,d,J=2.2Hz),9.05,9.47(1H,bs),10.45,10.89(1H,bs). 792 -H -H -COONa 2.68(1H, dd, J=8.3, 14Hz), 3.16(1H, dd, J=10, 14Hz), 3.4 J=16Hz), 4.55(0.8H, d, J=17Hz), 4.65(0.2H, d, J=18hz),@ 6.99(1H, d, J=8.1Hz), 7.00-7.30(6H, m), 7.40(1H, d, J=7.5Hz), 9.02(0.6H, s), 9.48(0.1H, s), 10.29(0.2H, s), 1 793 -OMe -N(SO2Me)COO-iBu -H -H 0.75(6H,d,J=8.4Hz),1.81(1H,m),2.61(1H,dd,J=9.5,14.5Hz), z),3.57(3H,s),3.71(3H,s),3.78(3H,m),4.41-4.90(2H,m), 6.83 (2H,d,J=8.3Hz),7.10(3H,m),7.20(1H,m),7.44(1H,d,J=8.3Hz@ 10.75(1H,bs). 794 -OMe -SO2Me -H -1h 2.70(1H, dd, J=9.4, 14Hz), 3.12(1H, dd, J=6.2, 14Hz), 3.2 3.96(1H, dd, J=6.2, 9.4Hz), 4.58(1.6H, br-s), 4.79(0.2H, d J=18Hz), 6.83(2H, d, J=8.6Hz), 7.13(2H, d, J=8.6Hz), 7.63-7.68(2H, m), 7.73(1H, dd, J=1.5, 8.1Hz), 9 s), 10.41(0.3H, s), 10.86(0.7H, s) 795 -H -O-CH2CONHOH -H -H 2.67(1H,dd,J=9.5Hz,14.5Hz),3.17(1H,dd,J=4,14.5Hz),3.81( 4.85(4H,m),6.80(2H,m),7.30(6H,m),8.95,9.35(2H,bs), 10.28 796 -OMe -H -O-CH2OMe -H 2.64(1H,m),3.1291H,dd,J=5.5,14Hz),3.35(3H,s),3.71(3H,s),@ 4.76(2H,m),5.15a(2H,s),6.82(2H,d,J=8.6hz),6.88-7.13(5H,m 8.95(1H,bs),10.30,10.73(1H,bs). 797 -OMe -H -O-CH2COOH -H 2.59(1H,dd,J=9.3,14hz),3.11(1H,dd,J=6.14Hz),3.14(3H,s),@ 30-4.80(2H,m),4.66(2H,s),6.88(4H,m),7.04(1H.d,J=9Hz), 7.12(2H,d,J=8.4Hz),9.34,8.96(1H,bs),10.73,10.30(1H,bs). Table 15' Example Structure NMR :'H-NMR (DMSO-d6; 8) No. 988 s 2.3.14 H, m), J=6.3, 11 (1 H, 1 4.39-4. m), 4. 7.24 (2H, d, J=8.4Hz), 7.34 (2H, d, J=8.4Hz), 7.55 (lH, s), 35 (lH, bs), 10. 36,10.78 (l H, bs), 1 HOOC3. 44 (l H, bs). Nci CONHOH Example 798 W step 1 ¢> X step2 EtOOCEtOOC"asNo aOMe I w S I w St I w S I w EtOOC N OOMe EtOOC N O v OMe COOtBu CONHOH
Step 1: Ethyl 2H-2- (4-methoxybenzyl)-1,4-benzothiazin-3 (4H)- one-6-carboxylate Ethyl 4-chloro-3-nitrobenzoate (8g) was dissolved in ethanol (lOOmL) and potassium carbonate (9.67g) was added.
Ethanol (50mL) solution of 3- (4-methoxyphenyl)-2- mercaptopropanoic acid (7.43g) was added at 4°C, and potassium fluoride (2. Og) was added. The reaction mixture was heated under reflux for 3 hrs, and concentrated under reduced pressure. lN-hydrochloric acid was added and extracted with EtOAc. The organic layer was washed with brine, dried over MgS04 and concentrated under reduced pressure. The residue was dissolved in AcOH (lOOmL), and added to the suspension of Fe (6.1g) in AcOH (50mL) at 60- 70°C. The reaction mixture was filtered and precipitate was washed with AcOH. Filtrate was added to water, and precipitate was collected and washed with mixed solvent of THF and hexane to give 5.9g of the product as white solid.
Step 2: t-Butyl 6-ethoxycarboxyl-2H-2- (4-Methoxy-benzyl)-1,4 -benzothiazin-3(4H)-one-4-yl-acetate To sodium hydride (3.3g) suspended in THF (30 mL) was
added a solution of ethyl 2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one-6-carboxylate (3g) in THF (250 mL), and t-butyl bromoacetate (1.7 mL) was added dropwise at 0- 5 °C. The mixture was warmed to r. t. and left at r. t. overnight. Saturated aqueous ammonium chloride was added and extracted with EtOAc. The organic layer was washed with water and brine, and dried over MgSO4 and concentrated under the reduced pressure. The residue was purified by silica gel column chromatography to give 3.9 g of the product as oil.
Step 3: 6-Carboxy-2H-2- (4-methoxybenzyl)-1,4-benzo-thiazin-3 (4H)-one-4-yl-acetic acid N-hydroxyamide The product of Step 2 was converted to hydroxamic acid by the method described in example 777 (step 3).
The following compounds listed in the Tables 16 and 16'w ere prepared in a similar manner. Table16 RR4 RR4 Ru3 s RR2 N p RR1 CONHOH Example RR'RR2 RR3 RR4 NMR :'H-NMR (DMSO-d6; 8) No. 798-OMe-C02Et-H-H 1.32 (3H, t, J=7. OHz), 2.68 (1 H, dd, 3.11 (1 H, dd, 3.72 (3H, s), 3.91 (1 H, m), 4.32 (2H, q, J=7. OHz), 4.55 (1.6H, br-s), 4.70 (0.2H, d, J=18Hz), 4.93 (0.2H, d, J=18Hz), 6.83 (2H, d, J=8.4Hz), 7.13 (2H, d, J=8.4Hz), 7.51 (1 H, d, J=7.9Hz), 7.63 (1 H, dd, 9Hz), 7.66 (1 H, br-s), 9.06 (0.8H, s), 9.46 (0.2H, s), 10.42 (0.2H, s), 10.86 (0.8H, s) 799-H-H-H-C02Et 1. 30 (3H, t, J=7.2Hz), 2.69 (1 H, dd, 3.16 (1 H, dd, 3.74 (1 H, dd, 4Hz), 4.24-4.64 (2H, m), 4.44 (0.8H, d, J=16Hz), 4.52 (0.8H, d, J=17Hz), 4.71 (0.2H, d, J=17Hz), 4.87 (0.2H, d, J=18Hz), 7.16-7.28 (5H, m), 7.37-7.41 (2H, m), 7.64 (1 H, m), 9.00 (0.8H, s), 9.38 (0.2H, s), 10.35 (0.2H, s), 10.80 (0.8H, s) 800-H-C02Et-H-H 1. 31 (3H, t, J=7Hz), 2.71 (1 H, m), 3.18 (1 H, m), 3.97 (1 H, m), 4.31 (2H, dd, J=7.14, 14.1 OHz), 4.51 (2H, m), 7.19-7.30 (5H, m), 7.51 (1 H, d, J=8.07Hz), 7.62 (1 H, d, J=8.04Hz), 7.68 (1 H, s), 9.05 (1 H, br-s), 10.84 (1 H, s) Table 16' Example RR'RR2 NMR : H-NMR (DMSO-d6; 8) No. 1 989-OH-C02Et 1. 32 (3H, t, J=7.1 Hz), 2.61 (1 H, dd, J=9.3Hz, 14Hz), 3.05 (1 H, dd, J=6. OHz, 14Hz), 3.86 (1 H, dd, J=6. OHz, 9.3Hz), 4.32 (2H, q, J=7.1 Hz), 4.50 (1.6H, br-s), 4.69 (0.2H, d, J=l9Hz), 4.93 (0.2H, d, J=l9Hz), 6.65 (2H, d, J=8.4Hz), 6.99 (2H, d, J=8.4Hz), 7.52 (1 H, d, J=8.1 Hz), 7.63 (1 H, dd, 1.6Hz, 8.1 Hz), 7.69 (1 H, d, J=1.6Hz), 9.05 (0.8H, s), 9.26 (1 H, s), 9.45 (0.2H, s), 10.41 (0.2H, s), 10.85 (0.8H, s) 990-Ci-C (CH3) 2-COOEt 1. 12 (3H, t, J=7.2Hz), 1.48 (6H, s), 2.74 (1 H, m), 3.18 (1 H, dd, m), 3.90 (1 H, m), 4.06 (2H, q, J=7.2Hz), 4.38-4.90 (2H, m), 6.83-7.15 (2H, m), 7.26 (2H, d, J=8.4Hz), 7.32 (3H, m), 42 (1 H, bs), 10. 37,10.81 (1 H, bs) 991-OCF3-C02Et 1.32 (3H, t, J=7. OHz), 2.81 (1 H, dd, J=8.8Hz, 14Hz), 3.19 (1 H, dd, J=6.2Hz, 14Hz), 4.04 (1 H, dd, J=6.2Hz, 8.8Hz), 4.32 (2H, q, J=7. OHz), 4.49 (0.8H, d, J=17Hz), 4.55 (0.8H, d, J=17Hz), 4.70 (0.2H, d, J=18Hz), 4.94 (0.2H, d, J=18Hz), 7.25 (2H, d, J=8. OHz), 7.36 (2H, d, J=8.0Hz), 7.53 (1 H, d, J=8.1Hz), 7.63 (1 H, dd, 1.3Hz, 8. 1 Hz), 7.69 (1 H, br-s), 9.06 (0.8H, s), 9.46 (0.2H, s), 10.44 (0.2H, s), 10.87 (0.8H, s) 992-OMe-COO-iPr 1.31 (6H, t, J=6.2Hz), 2.66 (1 H, dd, J=9.2Hz, 14Hz), 3.08 (1 H, dd. J=5.9Hz, 14Hz), 3.71 (3H, s), 3.90 (1 H, dd, J=5.9Hz, 9.2Hz), 4.48 (0.8H, d, J=17Hz), 4.53 (0.8H, d, J=17Hz), 4.68 (0.2H, d, J=18Hz), 4.96 (0.2H, d. J=18Hz), 5.11 (1 H, m), 6.82 (2H, d, J=8.6Hz), 7.11 (2H, d, J=8.6Hz), 7.50 (1 H, d, J=8.1Hz), 7.60 (1 H, dd, 1.5Hz, 8.1 Hz), 7.66 (1 H, d, J=1.5Hz), 9.04 (0.8H, s), 9.45 (0.2H, s), 10.41 (0.2H, s), 10.85 (0.8H, s) 993-OMe 1.20-1.45 (6H, m), 1.58 (3H, d, J=5.3Hz), 1.58-1.68 (2H, m). 1.75-1.88 (2H, m), 2.67 (1 H, 1°l 1 Jk m), 3.12 (1 H, m), 3.72 (3H, s), 3.92 (1 H, m), 4.51-4.80 (2.8H, m), 4.95 (0.2H, d, J=18Hz), 0 0 6.75-6.89 (3H, m), 7.12 (2H, d, J=8.2Hz), 7.53 (1 H, m), 7.61 (1 H, m), 7.73 (1 H, nr-s), 9.06 (0.8H, s), 9.46 (0.2H, s), 10.41 (0.2H, s), 10.86 (0.8H, s) Example 801 I CI Et00C v N02 EtOOC H O S PO (OEt) N S Step 3 j j Step 4 EtOOC N O EtOOC N O OPh k COOBu' I w S I w i HOOC N O OPh EtOOC N O OPh CONHOBu'CONHOH
Step 1: 6-Ethoxycarbonyl-2ff-1,4-benzothiazin-3 (4H)-one To a mixture of thioglycolic acid (10.75 g) and R2CO3 (65.00 g) in DMF (300 mL), a solution of ethyl 4-chloro-3- nitrobenzoate (28.12 g) in DMF (100 mL) was added and heated at 80 °C. The mixture was stirred at 80 °C for 6 hrs.
The solid of R2C03 was filtered off, and the filtrate was concentrated under reduced pressure. To the residue, diethyl ether (50 mL) and water (100 mL) was added and the yellow solid product was collected by filtration. The product was acidified with 4N HC1 and extracted with ethyl acetate. The organic layer was dried over Na2SO4 and concentrated. The product (27.634 g, 83%) was used in the following step.
To a solution of the product (12.956 g) in THF (300 mL), 10% Pd/C (13.00 g) was added. The reaction mixture was vigorously stirred at r. t. for 9 hrs under H2. The catalyst was removed by filtration, and the filtrate was
concentrated under reduced pressure. To a solution of the crude product (9.345 g) and HOBt (5.88 g) in DMF (200 mL), EDC'HCl (7.37 g) was added. The reaction mixture was stirred at r. t. overnight. The solvent was removed under reduced pressure. The residue was dissolved in ethyl acetate and washed with 1N HC1,5% Na2CO3 aq., and brine.
The organic layer was dried over Na2SO4 and concentrated.
The residue was purified by recrystallization from diethyl ether and hexane to give the product (8.502 g, 79% in 2 steps) as a white solid.
Step 2: 6-Ethoxycarbonyl-2H-2-diethylphosphoryl-1,4- benzothiazin-3(4H)-one To a solution of the 6-ethoxycarbonyl-2H-1,4- benzothiazin-3 (4H)-one (8.432 g) in dichloromethane (80 mL), sulfuryl chloride (4.79 g) was added dropwise. The reaction mixture was stirred at r. t. for 6 hours. The solvent was removed under reduced pressure. The residue was purified by recrystallization from chloroform and hexane to give the product (8.80 g, 91%) as a white solid.
A mixture of 6-ethoxycarbonyl-2H-2-chloro-1,4- benzothiazin-3 (4H)-one (8.724 g) and triethyl phosphite (11.74 g) was heated at 120 °C and stirred for 10 hrs. The solvent was removed under reduced pressure. The residue was purified by recrystallization from THF and diethyl ether to give the product (10.534 g, 88%) as a pale yellow solid.
Step 3: t-Butyl 6-ethoxycarbonyl-2H-2- (4-phenoxybenzyl)-
1,4-benzothiazin-3 (4H)-one-4-ylacetate To a stirred solution of p-phenoxybenzaldehyde (796 mg) and 6-ethoxycarbonyl 2H-2-diethylphosphoryl-1,4- benzothiazine-3 (4H)-one (1.00 g) in 80 % ethanol aq. (10 mL) and THF (10 mL), a solution of sodium ethoxide (400 mg) in ethanol (5 mL) was added dropwise. The reaction mixture was stirred at r. t. overnight. The solvent was removed under reduced pressure. To the residue, ethyl acetate (5 ml) and water (10 ml) was added and the solid product was collected by filtration. After drying under reduced pressure, the product (980 mg, 88%) was given as a yellow solid.
To a solution of 6-ethoxycarbonyl-2H-2- (4- phenoxybenzylidene)-1,4-benzothiazin-3 (4H)-one (980 mg) was dissolved in methanol (40 mL) and THF (40 mL), 10% Pd/C (1.00 g) was added. The reaction mixture was vigorously stirred at r. t. for 4 hrs under H2. The catalyst was removed by filtration, and the filtrate was concentrated under reduced pressure. The product (936 mg, 95%) was used in the following step without purification.
To a solution of 6-ethoxycarbonyl-2H-2- (4- phenoxybenzyl)-1,4-benzothiazin-3 (4H)-one (925 mg) in DMF (15 mL), potassium t-butoxide (495 mg) was added at r. t..
After 20 minutes'stirring, t-buthyl bromoacetate (645 mg) was slowly added. The reaction mixture was stirred at r. t. overnight. The solvent was removed under reduced pressure and the residue was dissolved in ethyl acetate and washed
with water. The organic layer was dried over Na2SO4 and concentrated. The residue was purified with silica gel column chromatography (eluent: toluene/ethyl acetate, 30/1) to give the product (677 mg, 58%).
Step 4: 6-Ethoxycarbonyl-2H-2- (4-phenoxybenzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetic acid N-t-butoxyamide t-Butyl 6-ethoxycarbonyl-2H-2- (4-phenoxybenzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetate (677 mg) was dissolved in TFA (10 mL). The mixture was stirred r. t. for 2 hrs.
The solvent was removed under reduced pressure. The residue was purified with silica gel column chromatography (eluent: chloroform/methanol, 10/1) to give the product (428 mg, 71%).
Isobutyl chloroformate (133 mg) was added dropwise to a THF (10 mL) solution of 6-ethoxycarbonyl-2H-2 (Z)- (4- phethoxybenzylidene)-1,4-benzothiazin-3 (4H)-one-4-yl-acetic acid (422 mg) and N-methylmorpholine (98 mg) at-5 °C. A solution of 0-t-butyl-hydoxylamine hydrochloride (133 mg) and N-methylmorpholine (107 mg) in THF (2 mL) was added dropwise after additional 20 minutes'stirring. The mixture was warmed to r. t. with stirring, and stood overnight. The reaction mixture was concentrated under reduced pressure, acidified with 0.5N citric acid, and extracted with ethyl acetate. The organic layer was dried over Na2SO4 and concentrated under reduced pressure. The residue was purified with silica gel column chromatography (eluent: chloroform/methanol, 5/1) to give the product (260 mg, 54%).
Step 5: 6-carboxy-2H-2- (4-phenoxybenzyl)-1,4-benzo-thiazin- 3 (4H)-one-4-ylacetic acid N-hydroxyamide To a solution of 6-ethoxycarbonyl-2H-2- (4- phenoxybenzyl)-1,4-benzothiazin-3 (4H)-one-4-ylacetic acid N-t-butoxyamide (256 mg) in ethanol (5 mL) and THF (5 mL), IN NaOH (560 uL) was slowly added at 0 °C. After 30 minutes'stirring, the mixture was warmed to room temperature and left overnight. The reaction mixture was concentrated under reduced pressure and acidified with IN citric acid, and the product was extracted with ethyl acetate. The organic layer was dried over Na2SO4 and concentrated. The crude product (241 mg) was used in the following step without purification.
6-Carboxy-2N-2- (4-phenoxybenzyl)-1,4-benzothiazin- 3 (4H)-one-4-ylacetic acid N-t-butoxyamide (124 mg) was dissolved in TFA (10 mL). The mixture was stirred at r. t. for 2 days. The solvent was removed under reduced pressure.
The residue was purified by preparative thin layer chromatography on silica gel (eluent: chloroform/methanol, 5/1) to give the hydroxamic acid (99 mg, 46% in 2 steps).
The following compounds listed in the Tables 17,17', and 17''were prepared in a similar manner. Table 17 s HOOCE n RR CONHOH Example RR'NMR :'H-NMR (DMSO-d6; 8) No. 801-OPh 2.75 (1 H, m), 3.16 (1 H, m), 3.96 (1 H, m), 4.51 (2H, m), 6.90 (2H, d, J=8.25Hz), 6.99 (2H, d, J=8.61Hz), 7.15 (1 H, m), 7.24 (2H, d, J=8.43Hz), 7.36-7.42 (2H, m), 7.49 (1 H, d, J=8.04Hz), 7.60-7.66 (2H, m), 9.06 (1 H, br-s), 10.84 (1 H, s) 802-0-Pentyl 0.89 (3H, t, J=7Hz), 1.36 (4H, m), 1.68 (2H, m), 2.68 (1 H, m), 3.13 (1 H, m), 3.90- 3.94 (3H, m), 4.51 (2H, m), 6.82 (2H, d, J=8.43Hz), 7.11 (2H, d, J=8.40Hz), 7.49 (1 H, d, J=8.04Hz), 7.61 (1 H, d, J=8.04Hz), 7.66 (1 H, s), 9.05 (1 H, s), 10.83 (1 H, s) 803-F 2.77 (1 H, m), 3.17 (1 H, m), 4.00 (1 H, m), 4.51 (2H, m), 7.10 (2H, t, J=8.79Hz), 7.27 (2H, m), 7.50 (1 H, d, J=8.07Hz), 7.62 (1 H, d, J=8.07Hz), 7.67 (1 H, s), 9.05 (1 H, s), 10.84 (1 H, s) Table17' s % i RRi EtO N 0 RR' CONHOH Example RR'NMR : 1H-NMR (CDC13 ; a) No. 994-C6H3-3, 4-methylenedioxy 1. 41 (t, J=7.2Hz, 3H), 2.81 (m, 1 H), 3.14 (m, 1 H), 3.70 (m, 1 H), 4.40 (q, J=7.2Hz, 2H) 4.48 (d, J=l 6Hz , 1 H), 4.73 (d, J=l 6Hz, l H), 5.97 (s, 2H), 6.49 (dd, 4Hz, 1 H), 6.57 (d, J=2.4Hz, 1 H), 6.76 (d, J =8.4Hz, 1 H), 6.88 (m, 2H), 7.05 (m, 2H), 7.44 (d, J=8.0Hz, 1 H), 7.78 (m, 1 H), 8.10 (m, 1 H), 9. OObr, 1 H) 995-C6H4-3-F 1.41 (t, J=6.9Hz, 3H), 2.84 (m, 1 H), 3.18 (m, 1 H), 3.73 (m, 1 H), 4.40 (q, J=6.9Hz, 2H) 4.50 (d, J=15.6 Hz, 1H), 4.73 (d, J=15.6Hz, 1H), 6.70 (m, l H), 6.76-6.82 (m, 2H), 6.96 (m, 2H), 7.11 (m, 2H), 7.28 (m, 1H), 7.45 (d, J=8. OHz, lH), 7.78 (m, 1H), 8.09 (br, 1H), 9.10 (br, 1 H) 996-C6H4-3-OMe 1.41 (t. J=7.2Hz, 3H), 2.81 (m, 1 H), 3.18 (m, 1 H), 3.71 (m, l H), 3.78 (s, 3H), 4.39 (q, J=7.2Hz, 2H) 4.51 (d, J=16Hz, 1 H), 4.72 (d, J=16Hz, 1 H), 6.56-6.60 (m, 2H), 6.65 (m, 1 H), 6.94 (m, 2H), 7.08 (m, 2H), 7.22 (m, 1 H), 7.43 (d, J=8.0Hz, 1 H), 7.49 (br, 1 H), 7.76 (d, J=8.0Hz, 1 H), 8.06 (br 1 H), 9.1 5 (br, 1 H) 997-C6H4-4-S02Me 1.41 (t, J=7.2Hz, 3H), 2.88 (m, 1 H), 3.06 (m, 3H), 3.20 (m, 1 H), 3.75 (m, 1 H), 4.40 (q, J=7.2Hz, 2H) 4.5 0 (d, J=16Hz, 1 H), 4.74 (d, J=l6Hz, 1 H), 7.00 (m, 2H), 7.08 (m, 1 H), 7.18 (m, 2H), 7.45 (d, J=8.0Hz, 1 H), 7.78 (d, J=8. OHz, 1 H), 7.89 (m, 2H) 8.09 (m, 1 H), 9.03 (br, 1 H) Table 17" Example RR1 NMR: 1H-NMR (DMSO-d6; #) No. 998 -O-4-pyridyl 2.82(1H,dd,J=14.2, 8.8Hz,benzylic C-H), 3.22(1H,dd,J=14.2, 6.1Hz,another benzylic C-H), 4.02(1H,dd,J=8.8, 6.1Hz,H-C-S), 4.52(2H,s,CH2CO0, 6.88 & 8.45(2H+2H,dd,J=4.7, 1.5, 3,5- & 2,6-H's of pyridine), 7.08 & 7.34(2H+2H,d,J=8.5), 7.51(1H,d,J=8.0), 7.63(1H,dd,J=8.0, 1.4), 7.68(1H,d,J=1.4), 9.06 & 10.86(1H+1H,s,NH-OH), 13.2(1H, br s,CO2H) 999 -O-C6H3-3,4-methylenedioxy 2.72(m,1H),3.14(m,1H),3.95(m,1H),4.51+4.69+4.92(2H,NCH2CO),6 .03(s,2H),6.4 7(dd,J=2.4,8.2Hz,1H),6.71(d,J=2.4Hz,1H),6.83(m,2H),6.91(d,J= 8.2Hz,1H0,7.20( M,2H),7.49(d,J=8.0Hz,1H),7.61(dd,J=1.6,8.OHz,1H),7.65(d.J=1. 6Hz,1H),9.05+9. 45(s,1H),10.40+10.84(s,1H) 13.14(br,1H) 1000 -O-C6H4-3-CF32.78(m,1H),3.19(m,1H),4.00(m,1H),4.52+4.71+4.92 (2H,NCH2CO),7.05(m,2H),7. 23-7.33(m,4H),7.43-7.53(m,2H),7.59-7.64(m,2H),7.67(m,1H), 9.05+9.46(s,1H),10.41+10.85(s,1H),13.17(br,1H) 1001 -O-C6H4-3-F 2.77(m,1H),3.18(m,1H),3.99(m,1H),4.15+4.70+4.9292H,NCH2CO),6 .79(m,1H),6. 84(m,1H),6.94-7.01(m,3H),7,27(m,2H),7.41(m,1H), 7.51 (d,J=8.0Hz,1H), 7.62(dd,J=1.6,8.0Hz,1H),7.66(d,J=1.6Hz,1H), 9.05+ 9.46 (s,1H),10.41+10.84(s,1H),13.14(BR,1H) 1002 -SO2-C6H4-4-OMe 2.84(m,1H),3.23(m,1H),3.82(s,3H),4.06(m,1H),4.49+4.78+4.90(2 H,NCH2CO),7.1 0-7.14(m,2H),7.46-7.51(m,3H),7.59(m,1H),7.66(m,1H), 7.81-7.90(m,4H), 9.06+9.46 (s,1H),10.42+10.84(s,1H),13.10(br,1H) 1003 -O-C6H4-3-OMe 2.75(m,1H),3.16(m,1H),3.74(s,3H),3.98(m,1H),4.52+4.70+4.92(2 H,NCH2CO),6.5 2(m,1H),6.57(m,1H),6.72(m,1H),6.92(m,2H),7.22-7.31(m,3H), 7.51 (d,J=8Hz,1H),7.62(dd,J=4,8Hz,1H),7.66(m,1H),9.05+9.45 (s,1H),10.41 +10.85(s,1H),13.18(br,1H) 1004 -O-C6H4-4-SO2Me 2.81(m,1H),3.19(S.3H),3.40(m,1H),4.02(m,1H),4.52+4.73+4.95(2 H,NCH2CO),7. 06(m,2H),7.13(m,2H),7.33(m,2H),7.51(d,J=8Hz,1H),7.62(dd,J=1. 6,8Hz,1H),7.67( d,J=1.6Hz,1H),7.91(m,2H),9.05+9.46 (s,1H),10.41+10.85(s,1H), 13.19(br,1H) Example 804 S S st t-BU02C N 0 OMe HOOG 0 OMe COOH COOL SOYA S N N OZONE N OZONE O O COOEi CONHOH
Step 1: Ethyl 6-carboxy-2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3(4H)-one-4-ylacetate Ethyl 6-t-butoxycarbonyl-2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetate (32.9 g) was dissolved in 5%-ethanedithiol in TFA (lOOmL) and stood at r. t. for 1.5hrs. Toluene (lOOmL) was added and concentrated under reduced pressure. The residue was washed with mixed solvent of ether and hexane to give 30.2 g of ethyl 6-carboxy-2H-2- (4-methoxybenzyl)-1,4-benzothiazin-3 (4H)-one-4-ylacetate as pale yellow solid.
Step 2: Ethyl 6-isopropylcarbamoyl-2H-2- (4-methoxy-benzyl)- 1,4-benzothiazin-3(M)-one-4-ylacetate Ethyl 6-carboxyl-2H-2-(4-methoxybenzyl)-1,4-benzo-thiazin- 3 (4H)-one-4-ylacete (2 g) was dissolved in dichloromethane (20mL), and oxalyl chloride (1.22 g) was added at 4°C. 1 drop of DMF was added and warmed to r. t., and stirred for 3hrs. Toluene (20mL) was added and concentrated under reduced pressure. This acid chloride was dissolved in
dichloromethane (15mL), and added to dichloromethane (lOmL) solution of diisopropylamine (299mg) and triethylamine (511mg) at 4°C. The reaction mixture was stirred for 4hrs at r. t., diluted with 5% RHS04 aq., and extracted with ethyl acetate. The organic layer was washed with sat. NaHC03 aq. and brine, and dried over MgS04. The solution was concentrated under reduced pressure. The residue was purified by silica gel column chromatography to give 1.47g of ethyl 6-isopropylcarbamoyl-2H-2- (4-methoxy-benzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetate as pale yellow oil.
Step 3: 6-Isopropylcarbamoyl-2ht-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetic acid N-hydroxy-amide The product of Step 2 was converted to hydroxamic acid by the method described in example 777 (step 3).
The following compounds listed in the Table 18 were prepared in a similar manner.
Table18 Example RR'RR2 NMR:'H-NMR (DMSO-d6; 6) No. 1 804-OMe-NHiPr 1.17 (6H, d, J=6.6Hz), 2.65 (1H, dd, 3.10 (1H, dd, 3.73 (3H, s), 3.85 (1 H, dd, 4Hz), 4.09 (1 H, m), 4.53 (1.6H, br-s), 4.70 (0.2H, d, J=18Hz), 4.93 (0.2H, d, J=18Hz), 6.83 (2H, d, J=8.6Hz), 7.12 (2H, d, J=8.3Hz), 7.44 (1 H, d, J=8.1 Hz), 7.53-7.56 (2H, m), 8.27 (1 H, d, J=7.7Hz), 9.02 (0.8H, s), 9.44 (0.2H, s), 10.34 (0.2H, s), 0. 0. H s 805-H 1.88 (3H, m), 2.27 (1 H, m), 2.74 (1 H, m), 3.19 (1 H, m), 3.56 (2H, m), 3.67 (3H, s) 3.94 (1 H, m), 4.49 (3H, m), 7.24-7.29 (7H, m), 7.46 (l H, d, J=8.04Hz), 9.04 (1 H. s), 10.82 (1 H, s) COOMe 806-H 1. 91 (3H, m), 2.26 (1 H, m), 2.74 (1 H, m), 3.21 (1 H, m), 3.53 (2H, m), 3.94 (1 H, m), ND 4. 39 (1H, m), 4.50 (2H, m) 7.23-7.28 (7H, m), 7.45 (l H, d, J=7.68Hz), 9.00 (1H, bm s), 10.81 (1H, s) COOH 807-H-Piperadino-4-COO-tBu 1.41 (9H, s), 2.74 (1H, m), 3.23 (1H, m), 3.31-3.39 (8H, m), 3.94 (1H, m), 4.51 (2H, m), 7.09-7.29 (7H, m), 7.44 (1 H, d. J=8.04Hz), 9.02 (1 H, s), 10.79 (1 H, s) 808-H-Piperadino 2. 74 (1 H, m), 3.15-3.26 (5H, m), 3.68 (4H, m), 3.94 (1 H, m), 4.53 (2H, m), 7.14- 7.29 (7H, m), 7.46 (1 H, d, J=7.86Hz). 9.03 (1 H, s), 10.87 (1 H, s) 809-H-NH2 2. 66 (1H, dd, 3.14 (1 H, dd, 3.88 (1 H, dd, J=5.7, 9.5Hz), 4.48 (1.6H, br-s), 4.68 (0.2H, d, J=l8Hz), 4.87 (0.2H, d, J=l8Hz), 7.14- 7.25 (5H, m), 7.25-7.41 (2H. m), 7.50 (1 H, d, J= 7.9Hz), 7.56 (1H, br-s), 8.00 (1H, br-s), 8.06 (0.8H, s), 9.37 (0.2H, s), 10.29 (0.2H, s), 10.72 (0.8H, s) 810-OMe-NH2 2.63 (l H, dd, 3.12 (1 H, dd, 3.72 (3H, s). 3.86 (1 H, dd, 3Hz), 4.53 (1.4H, br-s), 4.72 (0.3H, d, J=17Hz), 4.93 (0.3H. d, J=17Hz), 6. 84 (2H, d, J=8.6Hz), 7.12 (2H, d, J=8.6Hz), 7.42-7.45 (2H, m), 7.54-7.61(2H,m), 8.05(1H, br-s), 9.01(0.7H, s), 9.42(0.3H, s), 10.34(0.3H, s), 10.78(0.7H, s) 811 -H -NH-(S)-CH(Me)COOH 1.40(3H, d, J=7.3Hz), 2.70(1H,m), 3.18(1H, m), 3.93(1H, m), 4.41(1H, m), 4.52(0.8H, d, J=18Hz), 4.57(0.8H, d, J=18Hz), 4.73(0.2H, dd, J=18Hz), 4.94(0.2H, dd, J=18Hz), 7.20-7.25(3H, m), 7.25-7.31(2H, m), 7.46-7.64(3H, m), 8.76(1H, dd, J=1.8Hz, 7.3Hz), 9.04(0.8H, s), 9.45(0.2H, s), 10.36(0.2H, s), 10.80(0.8H, s), 12.6(1H, s) 812 -OMe -(S)-NHCH(Me)COO-t-Bu 1.38(3H, d, J=8.1Hz), 1.42(9H, s), 2.61(1H,m), 3.10(1H, m), 3.72(3H, s), 3.87(1H, dd, J=6.2, 9.2Hz), 4.34(1H, m), 4.53(1.6H, br-s), 4.69(0.2H, m), 4.94(0.2H, dd, J=18Hz), 6.84(2H, d, J=8.3Hz), 7.12(2H, d, J=8.3Hz), 7.43-7.59(3H, m), 8.73(1H, d, J=6.4Hz), 9.02(0.8H, s), 9.44(0.2H, s), 10.34(0.2H. s), 10.79(0.8H, s) 813 -OMe -NH-(S)-CH(Me)COOH 1.40(3H, d, J=7.3Hz), 2.58-2.69(1H, m), 3.04-3.14(1H, m), 3.72(3H. s), 3.87(1H, dd, J=6.1, 9.1Hz), 4.41(1H, m), 4.53(1.6H, br-s), 4.69(0.2H, dd, J=13, 18Hz), 4.94(0.2H, dd, J=13, 18Hz), 6.84(2H, d, J=8.6Hz), 7.1292H, dd, J=1.9, 8.3Hz), 7.45-7.60(3H, m), 8.74(1H, d, J=7.1Hz), 9.03(0.8H, s), 9.44(0.sH, s), 10.36(0.sH, s), 10.80(0.8H, s), 12.58(1H, s) 814 -OMe -NH-cylopentyl 1.53(4H, br-s), 1.70(2H, br-s), 1.89(2H, br-s), 2.65(1H, dd, J=9.4, 14Hz), 3.10(1H, dd, J=5.9, 14Hz), 3.73(3H, s), 3.85(1H, dd, J=5.9 9.4Hz), 4.21(1H, m), 4.53(1.6H, br-s), 4.71(0.2H, d, J=18Hz), 4.94(0.2H, d, J=18Hz), 6.84(2H, d, J=8.4Hz), 7.12(2H, d, J=8.4Hz), 7.40- 7.55(3H, m), 8.33(1H, d, J=7.3Hz), 9.03(0.8H, s), 9.46(0.2H, s), 10.36(0.2H, s), 10.81(0.8H, s) 815 -OMe -NH-cyclopropyl 0.53-0.59(2H, m), 0.68-0.74(2H, m), 2.65(1H, dd, J=9.4, 14Hz), 2.71(1H, m), 3.10(1H, dd, J=5.7, 14Hz), 3.72(3H, s), 3.86(1H, dd, J=5.7, 9.4Hz), 4.52(1.6H, br-s), 4.71(0.2H, d, J=17Hz), 4.92(0.2H, d, J=17Hz), 6.83(2H, d, J=8.6Hz), 7.1292H, d, J=8.6Hz), 7.40-7.54(3H, m), 8.50(1H, d, J=3.9Hz), 9.02(0.8H, s), 9.45(0.2H, s), 10.36(0.2H, s), 10.79(0.8H, s) 804 -H -NHEt 1.1293H, t, J=7.14Hz), 2.71(1H, m), 3.15-3.33(3H, m), 3.93(1H, m), 4.53(2H, m), 7.20-7.31(5H, m), 7.44-7.58(3H, m), 8.55(1H, m), 9.03(1H, s), 10.80(1H, s) 817 -OMe -NHC(Me) 2CH2OH 1.31(6H, s), 3.65(1H, dd, J=9.4, 14Hz), 3.09(1H, dd, J=5.7, 14Hz), 3.73(3H, s), 3.74-3.90(3H, m), 4.53(1.4H, br-s), 4.67(0.3H, d, J=18Hz), 4.91(0.3H, d, J=18Hz), 6.84(2H, d, J=8.6Hz), 7.11(2H, d, J=8.6Hz), 7.43(1H, d, J=8.4Hz), 7.53(1H, d, J=8.4Hz), 7.61(1H, br-s), 9.03(0.7H, s), 9.45(0.3h, s), 10.36(0.3H, s), 10.81(0.7H, s) 818 -OMe -(S)-NHCH(iPr)CH2OH 0.87-0.96(6H, m), 1.57(1H, m), 2.65(1H, m), 3.08(1H, m). 3.52(2H, br-2). 3.72(3H, s), 3.81(1H, m), 4.54(1.6H, br-s), 4.74(0.2H, dd, J=6.8, 18Hz), 4.95(0.2H, dd, J=12, 18Hz), 6.84(2H, d, J=7.8Hz), 6.87(1H, s), 7.13(2H, m). 7.45(1H, d, J=7.7Hz), 7.59(1H, br-s), 7.60(1H, d, J=8.4Hz). 8.07(1H, d, J=8.7Hz), 9.03(0.8H, s), 9.49(0.2H, s0, 10.37(0.2H, s), 10.81(0.8H, s) 819 -OMe -NHMe 2.64(1H,dd,J=9,14Hz),2.77(3H,d,J=4.4Hz),3.09(1H,dd,J=5.8,14H z),3.71(3H,s).38.8 6(1H,dd,J=5.8,9Hz),4.50-4.93(2H,m),6.82(2H,d,J=8.6Hz),7.11 (2H,J=8.6Hz),7.46(2H,m),7.55(1H,s),8.5)(1H,m),9.44,9.01(1H,b s),10.78,10.34(1H, bs). 820 -Cl -NH-cyclopropyl 0.51-0.56 (2H, m), 0.66-0.73 (2H, m), 2.72 (1H, dd, J=14.3Hz, 9.3Hz), 2.76- 2.84 (1H, m), 3.12 (1H, dd, J=14.4Hz, 6.4Hz), 3.93 (1H, dd, J=5.9Hz, 6.4Hz), [4.50 (S), 4.62 (d, J=17.7Hz), 4.84 (d. J=17.7Hz)] 2H, 7.23 (2H, d, J=8.4Hz), 7.32 (2H, d, J=8.4Hz), 7.43 (1H, d, J=8.1Hz), 7.48 (1H, dd, J=8.2Hz, 1.8Hz), 7.53 (1H, d, J=1.8Hz,), 8.49 (1H, d, J=4.1Hz), [9.01 (br), 9.43 9s)] 1H, [10.78 (br), 10.35 (s)] 1H. 821 -Cl -NHCH2-2-furyl 2.73 (1H, dd, J=14.4, 8,8 Hz), 3.14 (1H, dd, J=14.3Hz, 6.6Hz,0, 3.94 (1H, dd, J=8.9Hz, 6.4Hz), 4.46 (2H, d, J=5.4Hz), [4.51 (S), 4.72 (d, J=17.9Hz), 4.95 (d, J=17.9Hz)] 2H, 6.27 (1H, dd, J=3.1Hz, 0.5Hz). 6.39 (1H, dd, J=3.1Hz, 1.8Hz), 7.23 (2H, d, J=8.4Hz), 7.32 (2H, d, J=8.4Hz), 7.45 (1H, d, J=7.9Hz), 7.55 (1H, dd, J=8.9Hz, 1.5Hz), 7.57(1H, d, J=1.8Hz), 7.60(1H,m),[9.01 (br), 9.42 (s)] 1H, 9.04 (1H, t, J=5.4Hz), [10.78 (br), 10.35(s)] 1H. 822 -Cl -NHCH2CF3 2.74 (dd, J=14.4, 9.1 Hz, 1H), 3.12 (dd, J=14.3Hz, 6.6Hz, 1H), 3.96 (dd, J=8.9Hz, 6.4Hz, 1H), 4.10 (dd, J=10.5Hz, 6.4Hz, 2H), [4.52 (S), 4.72 (d, J=17.9Hz), 4.95 (d, J=17.9Hz)] 2H, 7.23 (d, J=8.4Hz, 2H), 7.32 (d, J=8.2Hz, 2H), 7.49 (d, J=8.0Hz, 1H), 7.57 (dd, J=8.0Hz, 1.0Hz, 1H), 7.63 (d, J=1.0Hz, 1H), [9.01 (br), 9.44 (s)] 1H, 9.15 (5, J=6.4Hz, 1H), [10.79 (br), 10.36 (s)] 1H. 823 -Cl -NH(CH2)2OH 2.72 (dd, J=14.1, 9.1 Hz, 1H), 3.12 (dd, J=13.9Hz, 6.2Hz, 1H), 3.46- 3.50(m,2H),3.28-3.32(m,2H), 3.94 (dd, J=8.7Hz, 6.2Hz, 1H), [4.51 (S), 4.72 (d, J=17.9Hz), 4.95 (d, J=17.9Hz)] 2H, 4.88 (br. 1H), 7.28 (d, J=8.4Hz, 2H), 7.32 (d, J=8.4Hz, 2H), 7.44 (d, J=8.0Hz, 1H), 7.53 (dd, J=8.0Hz, 1.4Hz, 1H), 7.58 (d, J=1.0Hz, 1H), 8.54 (5, J=5.6Hz, 1H), [9.00 (br), 9.42 (s)] 1H., [10.78 (br), 10.34 (s)] 1H. 824 -Cl -NH2 2.73 (dd, J=13.9, 8.9 Hz, 1H), 3.13 (dd, J=14.1Hz, 6.1Hz, 1H), 3.94 (dd, J=8.9Hz, 6.2Hz, 1H), [4.51 (s), 4.72 (d, J=17.9Hz), 4.90 (d, J=17.9Hz)] 2H, 7.23 (d, J=8.4Hz, 2H), 7.32 9d, J=8.4Hz, 2H), 7.44 (d, J=8.0Hzl, 1H), 7.54 (dd, J=8.0Hz, 1.5Hz, 1H), 7.59 (d, J=1.0Hz, 1H), 8.04 (br,2H), [8.99 (br), 9.41 (s)] 1H. [10.76 (br), 10.34 (s)] 1H. 825-Cl-NH (CH2) 2NEt2 1.21 (t, J=7.1Hz, 6H), 2.74 (dd, J=14. 1,9.1 Hz, 1H), 3.13 (dd. J=14. 6Hz, 6.7Hz, 1 H), 3.17-3.27 (m, 6H), 3.50-3.70 (m, 2H), 3.97 (dd, J=8.7Hz, 6.4Hz, 1 H), [4.51 (S), 4.69 (d, J=17. 3Hz), 4.93 (d, J=17.3Hz)] 2H, 7.24 (d, J=8.4Hz, 2H). 7.34 (d, J=8.3Hz, 2H), 7.51 (d, J=8. OHz, 1 H), 7.55 (d. J=8.0Hz, 1H), 7.61 (s, 1H), 8.84 (t. J=5.1Hz, 1H), 9.39 (br, 1H). [10.84 (br). 10.37 (s)] 1 H. 826-Cl 1.11 (t, J=7.1Hz, 3H). 1.50-2.20 (m, 2H), 2.73 (dd, J=14. 1,8.8 Hz, 1 H), 3.06- 3. 17 (m, 2H), 3.45-3.52 (m, 1 H), 3.54-3.64 (m, 2H), 4.10-4.40 (m, 5H), 3.95 (t, Eto J=6.4Hz, 1 H), [4.49 (S), 4.72 (d, J=17. 3Hz), 4.92 (d, J=17.3Hz)] 2H. Et 7.23 (d, J=8.2Hz, 2H). 7.32 (d. J=8.4Hz, 2H), 7.51 (d, J=8. OHz, 1 H), 7.55 (d, J=8. OHz, 1H), 7.60 (s, 1H), 8.90 (br, 1 H), 9.20 (br, l HY, [10.82 (br), 10.36 (s)] 1H. 8270"1. 59 (s. 6H). 2. (s. 6H), 8.73 (dd, J=14. 1,3.11 Hz, 1H), 3.92 (m, 2H), J=6.92 (t, 1 H), [4.51 (S), 4.72 (d, J=17. 3Hz), 4.92 (d, J=17. 3Hz)] 2H, 7.23 (d, J=8.2Hz, H 2H), H 7.32 (d, J=8.4Hz, 2H), 7.44 (d, J=7.8Hz, 2H), 7.53 (s, 1 H), 7.54 (d, J=8. OHz, 1 H), 8.30 (br, 1H), 10.79 (br, 1H). 828-Cl-NH (CH2) 3NMe2 1.80-1.90 (m, 2H), 2.73 (dd, J=14. 1,8.8 Hz, 1H), 2.77 (s, 6H), 3.05-3.10 (m, 2H), 3.12 (dd, J=13.9Hz, 6.4Hz, 1H), 3.27-3.36, (m, 2H), 3.94 (dd, J=8.8Hz. 6.4Hz, 1 H). [4.50 (S), 4.68 (d. J=17. 2Hz), 4.92 (d, J=17.4Hz)] 2H, 7.23 (d, J=8.2Hz, 2H), 7.32 (d, J=8.4Hz, 2H), 7.50 (d, J=8. OHz, 1 H), 7.53 (d, J=8. OHz, 1 H), 7.58 (s, 1 H), 8.70 (t. J=5.6 Hz, 1 H). 9.46 (br, 1H), [10.82 (br), 10.35 (s)] 1 H. 829-Cl-NH (CH2) 3-1-imidazolyl 2.04-2.10 (m, 2H), 2.73 (dd, J=14. 1,8.8 Hz, 1H), 3.12 (dd, J=13. 9Hz 6.3Hz, 1 H), 3.26-3.31, (m, 2H), 3.93 (dd, J=8.8Hz, 6.4Hz, 1 H), 4.21-4.26 (m. 2H), [4.50 (S), 4.68 (d, J=17.3Hz), 4.91 (d, J=17.3Hz)] 2H, 7.23 (d, J=8.2Hz, 2H), 7.32 (d, J=8.4Hz, 2H), 7.47 (d, J=8. OHz, 1 H), 7.55 (d, J=8. OHz, 1 H), 7.57 (s, 1H), 7.69 (dd, J=1.65Hz, J=1.65Hz, 1H), 7.81 (dd, J=1.65Hz, J=1.65Hz, 1 H), 8.64 (t, J=5Hz, 1H), 9.13 (s. 1H), [10.81 (br), 10.35(s) l I H. 830-Cl-NH- (S)-CH (Me) COOH 1.38 (d, J=7.5Hz, 3H), 2.66-2.75 (m, 1H), 3.04-3.18 (m, 1H)"3.95 (dd, J=8.8Hz, 6.6Hz, 1 H), 4.40 (dd, J=6.9Hz, 6.4Hz, 1 H), [4.52 (S), 4.66-4.84 (m), 4.88-4.96 (m)] 2H, 7.23 (d, J=8.2Hz, 2H), 7.32 (d, J=8.3Hz, 2H), 7.47 (d, J=8.4Hz. 1 H), 7.58-7.63 (m 2H), 8.75 (d. J=6.4Hz, 1 H), 9.45 (br. 1H), [10.78 (br), 10.35 (s)] 1H. 831-Cl-NH<R » CH (Me) COOH 1.38 (d, J=7.3Hz, 3H), 2.72 (dd, J=14. 6Hz, 8.4Hz, 1 H), 3.06-3.18 (m, 1H)"3. 95 (dd, J=8.9Hz, 6.4Hz, 1 H), 4.36-4.45 (m, 1 H), [4.52 (S), 4.66-4.84 (m), 4.88- 4.96 (m)] 2H, 7.23 (d, J=8.2Hz, 2H), 7.32 (d, J=8.3Hz, 2H), 7.47 (d, J=8.2Hz, 1 H), 7.58-7.63 (m 2H), 8.75 (d, J=6.4Hz, 1 H), 9.44 (br, 1 H), [10.79 (br), 10.35 (s)] 1H. 832-Cl 2.30-2.46 (m, 2H), 2.70 (dd, J=13.9Hz, 9.3Hz, 1H), 3.08 (dd, J=13.7Hz, 6.2Hz, 1 H H), 3.95 (dd, J=8.9Hz, 6.4Hz, 1 H), 4.23 (dd, J=16Hz, 9.8Hz, 1 H), 4.39 (dd, -*-NH J=17Hz, 9.9Hz, 1 H), [4.47 (S), 4.62-4.73 (m), o 4.85-4.93 (m)] 2H, 4.65-4.71 (m, 1 H), 7.19 (d, J=8.2Hz, 2H), 7.28 (d, J=8.2Hz, 2H), 7.48 (d, J=7.9Hz, 1 H), 7.50 (d, J=8.6Hz, 1 H), 7.56 (s, 1 H), 9.03-9.06 (m, 2H), 9.40 (br, 1H), [10.75 (br), 10.32 (s)] 1H. 833-Cl 0.938 (d, J=3.6Hz, 2H), 1.31 (d, J=3.6Hz, 2H), 2.71 (dd, J=13. 9Hz, 8.2Hz, 1H), JY N 3.06-3.16 (m, 1H), 3.87-3.96 (m, 1H), [4.44 (d, J=16Hz), 4.53 (d, J=16Hz), 4. 60-4.73 (m), (m)] 2H, o 7.23 (d, J=8.4Hz, 2H), 7.32 (d, J=8.3Hz, 2H), 7.42 (d, J=7Hz, 1 H), 7.47 (d, J=7Hz, 1H), 7.60 (s, 1 H), 8.88 (s, 1H) 8.89 (br, 1H), 9.44 (br, lH), [10.77 (br), 10. 34 (br)] 1 H, [10.62 (br), 11.28 (br)] 1 H.
Example 835 S S Step 1 \ \ Step 2 ---- Ho- HOOC"'ANCOOMe CORME COOMe Step 3 TBDMSO HO 0 N O OMe N O OMe COOMe CONHOH
Step 1: Methyl 6-hydroxymethyl-2H-2- (4-methoxy-benzyl)-1,4- benzothiazin-3(4H)-one-4-ylacetate Ethyl chloroformate (3.475 g) was added dropwise to a THF (30 mL) solution of methyl 6-carboxy-2H-2- (4- methoxybenzyl)-1,4-benzothiazin-3 (4H)-one-4-ylacetate (2.795 g) and triethylamine (3.241 g) at 0 °C. A solution of sodium borohydride (3.160 g) in water (5 mL) was added dropwise after additional 1 hour's stirring. The reaction mixture was stirred at 0 °C for 1 hr. The reaction mixture was quenched with acetic acid and concentrated under reduced pressure. The residue was dissolved in ethyl acetate and washed with water. The organic layer was dried over Na2SO4 and concentrated. The residue was purified with silica gel column chromatography (eluent: toluene/EtOAc, 4/1) to give the product (2.294 g, 79%).
Step 2: Methyl 6-t-butyldimethylsiloxymethyl-2H-2- (4- methoxybenzyl)-1,4-benzothiazin-3 (4H)-one-4-ylacetate To a solution of methyl 6-hydroxymethyl-2H-2- (4- methoxybenzyl)-1,4-benzothiazin-3 (4H)-one-4-ylacetate
(2.294 g) and imidazole (1.612 g) in DMF (30 mL), a solution of TBDMSC1 (2.665 g) in DMF (5 ml) was slowly added. The reaction mixture was stirred at r. t. for 2 days and quenched with water. The solvent was removed under reduced pressure, and the residue was dissolved in chloroform, dried over Na2SO4, and concentrated. The residue was purified with silica gel column chromatography (eluent: toluene/EtOAc, 50/1) to give the product (2.966 g, quant.).
Step 3: 6-Hydroxymethyl-2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetic acid N-hydroxyamide To a solution of the methyl ester (2.966 g) in methanol (20 mL), 1N NaOH (8.86 mL) was slowly added at 0 °C. After 30 minutes'stirring, the mixture was warmed to room temperature and left overnight. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in ethyl acetate and water. After the pH was adjusted to 6 with acetic acid, the product was extracted with EtOAc. The organic layer was dried over Na2SO4 and concentrated to give the product (1.208 g, 42%) as a white solid.
Isobutyl chloroformate (373 mg) was added dropwise to a THF (10 mL) solution of 6-t-butyldimethylsiloxymethyl-2H- 2- (4-methoxybenzyl)-1,4-benzothiazin-3(4H)-one-4-ylacetic acid (1.208g) and N-methylmorpholine (276 mg) at-5 °C. THF (1 mL) solution of O-TMS-hydoxylamine (313 mg) was added after additional 20 minutes'stirring. The mixture was
stirred at-5 °C for 2 hrs, gradually warmed to r. t. with stirring, and stood overnight. The reaction mixture was quenched with water and extracted with EtOAc. The organic layer was washed with IN HC1 and brine, dried over Na2SO4 and concentrated under reduced pressure. The residue was purified with silica gel column chromatography (eluent: chloroform/methanol, 10/1) to give the hydroxamic acid (645 mg, 70%) as a white powder.
The following compounds listed in the Table 19 were prepared in a similar manner. Table19 1 3 s 21 i i 1 RRXN XRR1 CONHOH Example RR'RR2 RR3 NMR :'H-NMR (DMSO-d6; 8) No. 835-OMe-CH20H-H 2.63 (1 H, m), 3.10 (1 H, m), 3.72 (3H, s), 3.77 (1 H, m), 4.45-4.49 (4H, m), 5.28 (1 H, m), 6.84 (2H, d, J=8.43Hz), 7.02 (1 H, d, J=8.07Hz), 7.10-7.13 (3H, m), 7.31 (1 H, d, J=7.89Hz), 8.99 (1 H, s), 10.76 (1 H, s) 836-OMe-H-CH20H 2.65 (1 H, m), 3.10 (1 H, m), 3.72 (3H, s), 3.78 (1 H, m), 4.42-4.45 (4H, m), 5.21 (1H, m), 6.84 (2H, d, J=8.25Hz), 7.07-7.14 (3H, m), 7.23 (1 H, d, J=8.43Hz), 7.28 (1 H, s), 8.97 (1 H, s), 10.75 (1 H, s) 837-OPh-H-CH20H 2.71 (1 H, m), 3.16 (1 H, m), 3.85 (1 H, m), 4.43-4.46 (4H, m), 6.91 (2H, d, J=8.61 Hz), 7.00 (2H, d, J=7.71 Hz), 7.07-7.16 (2H, m), 7.22-7.25 (3H, m), 7.30 (1 H, s), 7.37-7.42 (2H, m), 8.98 (1 H, s), 10.76 (1 H, s) 838-Cl-CH20H-H 2. 72 (1H, dd, J=9.0,14Hz), 3.14 (1 H, dd, 3.85 (1 H, dd, J=6.2, 9. OHz), 4.44 (1.6H, br-s), 4.49 (2H, d, J=5.2Hz), 4.63 (0.2H, d, J=18Hz). 4.87 (0.2H, d, J=18Hz), 7.03 (2H, d, J=7.8Hz), 7.11 (1 H, br-s), 7.24 (2H, d, J=8.4Hz), 7.30-7.34 (3H, m), 9.01 (0.8H, s), 9.45 (0.2H, s), 10.35 (0.2H, s), 10.80 (0.8H, s) 839-OH-CH20H-H 2. 58 (1 H, dd, J=9.5Hz, 14Hz), 3.07 (1 H, dd, J=5.7Hz, 14Hz), 3.79 (1 H, dd, J=5.7Hz, 9.5Hz), 4.69 (3.8H, br-s), 4.84 (0.2H, d, J=18Hz), 6.65 (2H, d, J=8.4Hz), 6.98 (2H, d, J=8.4Hz), 7.15 (1 H, dd, J=1.3Hz, 8. OHz), 7.25 (br-s, 1 H), 7.35 (1 H, d, J=8. OHz), 9.01 (s, 1 H), 9.26 (0.8H, s), 9.40 (0.2H, s), 10.35 (0.2H, s), 10.79 (0.8H, s) Example 840 s s St Meo I/I, Step ho N 0 OMe N O OMe COOH COOH fYYn MeO< kt sIIZZ I N O 'OMe CONHOH
Step 1: 6-Methoxymethyl-2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetic acid To a solution of methyl 6-hydroxymethyl-2H-2- (4- methoxybenzyl)-1,4-benzothiazin-3 (4H)-one-4-yl-acetate (335 mg) and tetra-n-buthylammonium iodide (133 mg) in toluene (10 mL), 50% NaOH aq. (5 mL) was added. After 30 minutes' stirring, dimethyl sulfate (1.47 g) was slowly added. The reaction mixture was vigorously stirred at r. t. overnight.
The solvent was removed under reduced pressure, and the residue was acidified with 4N HC1 and extracted with ethyl acetate. The organic layer was dried over Na2SO4 and concentrated. The crude product (346 mg) was used in the following step without purification.
Step 2: 6-Methoxymethyl-2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetic acid N-hydroxyamide The crude product (305 mg) of step 1 was dissolved in dichloromethane (4 mL) and pyridine (3 mL) and penta- fluorophenyl trifluoroacetate (664 mg) was added. After 3 hours stirring, O-TBDMS-hydoxylamine (465 mg) was slowly
added. The reaction mixture was stirred at r. t. overnight.
The solvent was removed and the residue was dissolved in EtOAc. The organic layer was washed with 1N HC1 and water, dried over Na2SO4 and concentrated under reduced pressure.
The residue was purified with preparative thin layer chromatography on silica gel (EtOAc) to give the hydroxamic acid (190 mg, 60% in 2 steps) as a pale orange solid.
H-NMR (DMSO-d6,8); 2.65 (1H, m), 3.10 (1H, m), 3.30 (3H, s), 3.72 (3H, m), 3.80 (1H, m), 4.39 (2H, m), 4.46 (2H, m), 6.84 (2H, d, J=8.61Hz), 7.02 (1H, d, J=8.25Hz), 7.12 (3H, m), 7.34 (1H, d, J=7.89Hz), 9.00 (1H, s), 10.77 (1H, s) Example 841 MeOOC . < MeOOC c . MeOOC step 1 nC/5=0-C s NH,-CCN H NH H I'Io-""'CC 0 1 OMe i i- i i N O OMe N O OMe vCOOBut CONHOH Step 1: 6-Methoxycarbonyl-3H-1,2,3-benzodithiazole-2-oxide To sulphur monochloride (170 mL), a solution of methyl 4- aminobenzoate in acetic acid (200 mL) was slowly added at 0 to 10 °C. The reaction mixture was stirred at 65°C for 4 hrs. To the cooled mixture, toluene (300 mL) was added, the solid product was collected by filtration and washed with toluene three times. After drying under reduced pressure,
this solid (30.888 g, 94 %) was dissolved in 5% sodium acetate aq. and the solution was stirred at r. t. for 2 hrs.
The solid product was collected by filtration and washed with water and toluene. After drying under reduced pressure, the product (28.028 g, 98%) was obtained.
: Sawhney's procedure (Indian J. chem. 33B, 280 (1994)).
Step 2: t-Butyl 7-methoxycarbonyl-2ff-2-(4-methoxy-benzyl)- 1,4-benzothiazin-3(4H)-one-4-ylacetate To a Solution of 6-methoxycarbonyl-3H-1,2,3- benzodithiazole-2-oxide (11.46 g) and 2-bromo-3- (4- methoxyphenyl) propionic acid (12.96 g) in 50% MeOH aq. (100 mL), triethylamine (50 mL) was slowly added at 70°C. The reaction mixture was stirred at 70 °C for 2 hrs. The mixture was cooled to r. t. and concentrated under reduced pressure. The residue was dissolved in EtOAc and washed with 5% Na2C03 aq. and 1N HC1. The organic layer was dried over Na2SO4 and concentrated. The residue was purified by recrystallization from Et20 and hexane to give the product (15.131 g, 88%) as a white powder.
To a solution of 7-methoxycarbonyl-2H-2- (4- methoxybenzyl)-1,4-benzothiazin-3 (4H)-one (7.00 g) in DMF (40 mL), NaH (1.47 g, 60% in oil) was added at r. t.. After 20 minutes'stirring, t-buthyl bromoacetate (5.56 g) was slowly added. The reaction mixture was stirred at r. t. overnight. The solvent was removed under reduced pressure and the residue was dissolved in EtOAc and washed with
water. The organic layer was dried over Na2SO4 and concentrated. The residue was purified with silica gel column chromatography (eluent: toluene/EtOAc, 20/1) to give the product (6.994 g, 64%).
Step 3: 7-Carboxy-2H-2- (4-methoxybenzyl)-1,4-benzo-thiazin- 3 (4H)-one-4-ylacetic acid N-hydroxamide t-Butyl 7-methoxycarbonyl-2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetate (4.81 g) was dissolved in TFA (19 mL) and ethanedithiol (l mL). The mixture was stirred at r. t. for 2 hrs. The solvent was removed under reduced pressure, and the residue was diluted with 5% Na2CO3, washed with Et20. The aquaous layer was acidified with 4N HC1 and extracted with EtOAc. The organic layer was dried over Na2SO4 and concentrated. The residue was purified with silica gel column chromatography (eluent: EtOAc) to give the product (3.522 g, 83%).
Isobutyl chloroformate (1.304 g) was added dropwise to a THF (20 mL) solution of 7-methoxycarbonyl-2H-2- (4- methoxybenzyl)-1,4-benzothiazin-3 (4H)-one-4-ylacetic acid (3.484 g) and N-methylmorpholine (0.966 g) at-5 °C. THF (1 mL) solution of O-TMS-hydoxylamine (1.096 g) was added after additional 20 minutes'stirring. The mixture was stirred at-5 °C for 2 hrs, gradually warmed to r. t. with stirring, and stood overnight. The reaction mixture was quenched with water and extracted with EtOAc. The organic layer was washed with 1N HC1 and water, dried over Na2SO4
and concentrated under reduced pressure. The residue was purified with silica gel column chromatography (eluent: toluene/EtOAc, 3/1) to give the hydroxamic acid (2.943 g, 81%) as a white powder.
To a solution of 7-methoxycarbonyl-2H-2- (4- methoxybenzyl)-1,4-benzothiazin-3 (4H)-one-4-ylacetic acid N-hydroxamide (2.827 g) in methanol (10 mL) and THF (10 mL), 1N NaOH (13.6 mL) was slowly added at 0 °C. After 30 minutes'stirring, the mixture was warmed to room temperature and left overnight. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in 5% Na2CO3 aq., and washed with Et20. The aqueous layer was acidified with 4N HC1, and the product was extracted with EtOAc. The organic layer was dried over Na2S04 and concentrated. The residue was purified by recrystallization from EtOAc to give the hydroxamic acid (1.234 g, 45%) as a white solid.
The following compounds listed in the Tables 20, and 20' were prepared in a similar manner. Table20 1 RR+rSox Nô art N O RR CONHOH Example RR'RR2 NMR:'H-NMR (DMSO-d6; 8) No. 841-OMe-C02H 2.67 (1 H, m), 3.09 (1 H, m), 3.72 (3H, s), 3.89 (1 H, m), 4.52 (2H, m), 6.84 (2H, d, J=8.07Hz), 7.13 (2H, d, J=8.25Hz), 7.22 (1 H, d, J=10.26Hz), 7.85 (2H, s), 9.00 (1 H, s), 10.80 (1H, s) 842-OMe-C02Me 2.67 (1 H, m), 3.08 (1 H, m), 3.73 (3H, s), 3.84 (3H, s), 3.92 (1 H, m), 4.53 (2H, m), 6.84 (2H, d, J=8.43Hz), 7.13 (2H, d, J=8.61 Hz), 7.25 (1 H, m), 7.84-7.90 (2H, m), 9.01 (1 H, br-s), 10.81 (1H, s) 843-OMe-COONa 2. 67 (1 H, m), 3.09 (1 H, m), 3.72 (3H, s), 3.89 (1 H, m), 4.52 (2H, m), 6.84 (2H, d, J=8.07Hz), 7.13 (2H, d, J=8.25Hz), 7.22 (1 H, d, J=10. 26Hz), 7.85 (2H, s), 9.00 (1 H, s), 10. 80 (1 H, s) 844-Cl-C02H 1 H-NMR 2. 75 (1 H, dd, J=13. 9,8.8 Hz), 3.12 (1 H, dd, J=14. 3Hz, 6.2Hz), 3.98 (1 H, dd, J=8.6Hz, 6.6Hz), [4.50 (S), 4.69 (d, J=17. 7Hz), 4.91 (d, J=17.7Hz)] 2H, [7.22 (d, J=8.6Hz), 7.02 (d, J=8.4Hz)] 1 H, 7.24 (2H, d, J=8.6Hz), 7.32 (2H, d, J=8.6Hz), 7.83 (1 H, dd, J=8.4Hz, 1.8Hz), 7.86 (1 H, d, J=1.8Hz), [8.99 (br), 9.39 (s)] 1 H, [10.80 (br), 10.38 (s)] 1H, 13.02 (1H, br). 845-OPh-C02H 2.76 (1 H, m), 3.13 (1 H, m), 4.02 (1 H, m), 4.53 (2H, m), 6.91 (2H, d, J=8.43Hz), 6.99 (2H, d, J=7.50Hz), 7.14 (1H, m), 7.22-7.25 (3H, m), 7.39 (2H, m), 7.85 (1H, m), 7.88 (1 H, d, J=2.01 Hz), 9.02 (1 H, s), 10.82 (1 H, s) Table 20' Example RR1 NMR: 1H-NMR (DMSO-d6; #) No. 1005 -Cl 1.31(3H, t, J=7Hz), 2.77(1H, m), 3.14(1H, m), 4.00(1H, m), 4.29(2H, dd, J=7, 13Hz), 4.52(2H, m), 7.25-7.35(5H, m), 7.84-7.90(2H, m), 9.03(1H, br-s), 10.86(1H, br-s) 1006 -OPh 1.31(3H, t, J=7.14Hz), 2.75(1H, m), 3.13(1H, m), 3.97(1H, m), 4.29(2H, dd, J=7, 13Hz), 4.5492H, m), 6.91(2H, d, J=8.43Hz), 6.99(2H, d, J=7.68Hz), 7.14(1H, m), 7.22-7.27(3H, m), 7.37-7.42(2H, m), 7.85(1H, dd, J=2.0, 8.6Hz), 7.91(1H, d, J=1.86Hz) 9.03(1H, br-s), 10.83(1H, br-s) Example 846 MeOOC S HOOC S ,, st I \ I \ N O OMe N O OMe CONHOAllyl CONHOAllyl o S --- H I N O v _OMe CONHOH
Step 1: 7-Carboxy-2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetic acid N-allyloxyamide To a solution of 7-methoxycarbonyl-2H-2- (4- methoxybenzyl)-1,4-benzothiazin-3 (4H)-one-4-ylacetic acid N-allyloxyamide (5.067 g) in methanol (15 mL) and THF (15 mL), 1N NaOH (16.65 mL) was slowly added at 0 °C. After 30 minutes'stirring, the mixture was warmed to room temperature and left overnight. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in 5% Na2C03 aq., and washed with Et20. The aqueous layer was acidified with 4N HC1, and the product was extracted with EtOAc. The organic layer was dried over Na2SO4 and concentrated to give the product (4.748 g, 97%) as a white solid.
Step 2: 7-Isopropylcarbamoyl-2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetic acid N-hydroxyamide To a solution of 7-carboxy-2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetic acid N-allyl-oxyamide (221 mg) and isopropylamine (36 mg) in DMF (10 mL), HOBt
(552 mg) and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide- HCl (EDC'HCl) (690 mg) were added. The reaction mixture was stirred at r. t. overnight. The solvent was removed under reduced pressure. The residue was dissolved in EtOAc and washed with 1N HC1,5% Na2C03 aq. and brine. The organic layer was dried over Na2SO4 and concentrated. The crude product was used in the following step without purification.
To a solution of the crude product of 7- isopropylcarbamoyl-2H-2- (4-methoxybenzyl)-1,4-benzo- thiazin-3 (4H)-one-4-ylacetic acid N-allyloxyamide in 80% ethanol aq. (8 mL), Pd (OAc) 2 (12 mg), PPh3 (53 mg), and formic acid (69 mg) were added. The reaction mixture was heated at 80 °C under nitrogen for 1 hr. The solvent was removed and the residue was dissolved in EtOAc. The organic layer was washed with water, dried over Na2SO4 and concentrated under reduced pressure. The residue was purified by preparative thin layer chromatography on silica gel (chloroform/methanol, 8/1) to give the hydroxamic acid (207 mg, 93 % in 2 steps) as a pale orange solid.
The following compounds listed in the Tables 21 were prepared in a similar manner. 854-OMe-NHCH2COOH 2.67 (1 H, m), 3.09 (1 H, m), 3.73 (3H, s), 3.87-3.92 (3H, m), 4.53 (2H, m), 6.84 (2H, d, J=8.43Hz), 7.14 (2H, d, J=8.58Hz), 7.22 (1 H, d, J=8.61 Hz), 7.79 (1 H, dd, 61 Hz), 7.89 (1 H, d, J=2.04Hz), 8.85 (1 H, m), 9.00 (1 H, s), 10.80 (1 H, s), 12. 63 (1 H, br-s) 855-OMe-NHC (CH3) 2COOH 1.43 (6H, s), 2.67 (1 H, m), 3.11 (1 H, m), 3.73 (3H, s), 3.87 (1 H, m), 4.51 (2H, m), 6.85 (2H, d, J=8.61 Hz), 7.15 (2H, d, J=8.61 Hz), 7.20 (1 H, d, J=8.61 Hz), 7.76 (1 H, d, J=8.43Hz), 7.91 (1 H, d, J=1.83Hz), 8.44 (1 H, s), 9.00 (1 H, s), 10.79 (1 H, s), 12.11 (1 H, br-s) 856-OMe-NH- (S)-CH (iBu) COOH 0.90 (6H, m), 1.57-1.76 (3H, m), 2.69 (1 H, m), 3.11 (1 H, m), 3.73 (3H, s), 3.89 (1 H, m), 4.43 (1 H, m), 4.52 (2H, m), 6.84 (2H, d, J=8.43Hz), 7.15 (2H, d, J=8.61 Hz), 7.22 (1 H, d, J=8.61 Hz), 7.80 (1 H, m), 7.94 (1 H, m), 8.57 (1 H, m), 9.00 (1 H, s), 10.80 (1 H, s) 857-OMe/1.85-1.98 (3H, m), 2.26 (1 H, m), 2.67 (1 H, m), 3.10 (1 H, m), 3.55 (2H, m), 3.72 (3H, vN \ s), 3.86 (1 H, m), 4.39 (1 H, m), 4.50 (2H, m), 6.84 (2H, d, J=8.43Hz), 7.13 (2H, d, J=8.43Hz), 7.18 (1 H, d, J=8.22Hz), 7.47-7.50 (2H, m), 9.01 (1 H, s), 10.80 (1 H, s) COOH 858-OMe-NH (CH2) 2CH (CH3) 2 0.88 (6H, d, 6.60Hz), 1.39 (2H, m), 1.58 (1 H, m), 2.66 (1 H, m), 3.09 (1 H, m), 3.25 (2H, m), 3.71 (3H, s), 3.85 (1 H, m), 4.50 (2H, m), 6.83 (2H, d, J=8.61 Hz), 7.12 (2H, d, J=8.58Hz), 7.18 (2H, d, J=8.61Hz), 7.74 (1 H, m), 7.83 (1 H, d, J=1.83Hz), 8.39 (1 H, m), 9.00 (1 H, s), 10.79 (1 H, s) 859-OMe-NH (CH2) 2N (CH3) 2 2.42 (6H, s), 2.63-2.72 (3H, m), 3.10 (1 H, m), 3.37 (2H, m), 3.73 (3H, s), 3.87 (1 H, m), 4.52 (2H, m), 6.84 (2H, d, J=8.61 Hz), 7.14 (2H, d, J=8.58Hz), 7.21 (2H, d, J=8.61 Hz), 7.78 (1 H, dd, J=2.01,8.61 Hz), 7.87 (1 H, d, J=2.01 Hz), 8.15 (1 H, s), 8.55 (1 H, m), 10.82 (1 H, br-s) 860-OMe-NH (CH2) 2NEt2 0.99 (6H, t, J=7.14Hz), 2.55-2.70 (7H, m), 3.10 (1 H, m), 3.35 (2H, m), 3.73 (3H, s), 3.88 (1 H, m), 4.52 (2H, m), 6.84 (2H, d, J=8.61 Hz), 7.13 (2H, d, J=8.43Hz), 7.20 (2H, d, J=8.58Hz), 7.76 (1 H, d, 43Hz), 7.84 (1 H, s), 8.20 (1 H, s), 8.45 (1H, m), 10.81 (1 H, br-s) 861-OPh-NH (CH2) 2CH (CH3) 2 0.89 (6H, d, 6.60Hz), 1.39 (2H, m), 1.60 (1H, m), 2.74 (1 H, m), 3.17 (1H, m), 3.26 (2H, m), 3.93 (1 H, m), 4.52 (2H, m), 6.91 (2H, d, J=8.43Hz), 6.99 (2H, d, J=7.50Hz), 7.11-7.26 (4H, m), 7.40 (2H, m), 7.76 (1 H, d, J=8.40Hz), 7.87 (1 H, s), 8.41 (1 H, m), 9.01 (1 H, s), 10.80 (1 H, s) 862-OPh-NH (CH2) 20Me 2.74 (1 H, m), 3.15 (1 H, m), 3.26 (3H, s), 3.33-3.44 (4H, m), 3.93 (1 H, m), 4.52 (2H, m), 6.91 (2H, d, J=8.61 Hz), 7.00 (2H, d, J=8.79Hz), 7.16-7.26 (4H, m), 7.37- 7.42 (2H, m), 7.78 (1 H, d, J=8.61 Hz), 7.89 (1 H, d, J=1.83Hz), 8.54 (1 H, m), 9.01 (1 H, s), 10.81 (1 H, s) Table 21 Example RR1 RR2 NMR: 1H-NMR (DMSO-d6; #) No. 846 -OMe -NHiPr 1.14(6H,m),2.67(1H, m), 3.11(1H, m), 3.73(3H, s), 3.86(1H, m), 4.09(1H, m), 4.51(2H, m), 6.85(2H, d, J=8.61Hz), 7.14(2H, d, J=8.40Hz), 7.18(1H, d, J=8.97Hz), 7.76(1H, d, J=8.61Hz), 7.87(1H, s), 8.20(1H, d, J=7.68Hz), 9.00(1H, s), 10.79(1H,s) 847 -OMe -NH2 2.65(1H, m), 3.12(1H, m), 3.71(3H, s), 3.86(1H, m), 4.50(2H, m), 6.83(2H, d, J=8.43Hz), 7.13(2H, d, J=8.43Hz), 7.17(1H, d, J=8.79Hz), 7.36(1H, s), 7.78(1H, m), 7.86(1H, d, J=1.65Hz), 7.95(1H, s), 8.99(1H, br-s), 10.79(1H, br-s) 848 -OMe -NH-cyclopropyl 0.56(2H, m), 0.67(2H, m), 2.65(1H, m), 2.8391H,m),3.11(1H,m), 3.73(3H, s), 3.86(1H, m), 4.51(2H, m), 6.84(2H, d, J=8.43hz), 7.13(2H, d, J=8.43Hz), 7.18(1H, m), 7.74(1H, m), 7.82(1H, d, J=1.83Hz), 8.41(1H, d, J=4.05Hz), 9.0091H, s), 10.79(1H, s) 849 -OMe -morpholino 2.67(1H, m), 3.1291H, m), 3.32-3.60(8H, m), 3.72(3H, s), 3.87(1H, m), 4.50(2H, m), 6.84(2H, d, J=8.61Hz), 7.13(2H, d, J=8.58Hz), 7.17(1H, m), 7.35(1H, m), 7.41(1H, d, J=1.65Hz), 9.00(1H, s), 10.80(1H, s) 850 -OMe -Piperadino-4-CHO 2.68(1H, m), 3.15(1H, m), 3.17-3.44(8H, m), 3.72(3H, s), 3.87(1H, m), 4.51(2H, m), 6.84(2H, d, J=8.40Hz), 7.14(2H, d, J=8.04Hz), 7.18(1H, d, J=8.61Hz), 7.37(1H, d, J=8.22Hz), 7.44(1H, s), 8.06(1H, s), 9.01(1H, s), 10.81(1H, s) 851 -OMe -NHCH(CH2OH)2 2.66(1H, m), 3.10(1H, m), 3.48(4H, m), 3.71(3H, s), 3.83-3.9492H, m), 4.50(2H, m), 4.63(2H, m), 6.83(2H, d, J=8.43Hz), 7.13(2H, d, J=8.61Hz), 7.18(1H, d, J=8.43Hz), 7.76(1H, d, J=6.78Hz), 7.90(1H, s), 7.98(1H, d, J=8.25Hz), 8.98(1H, s), 10.78(1H, s) 852 -OMe -N((CH2)2OH)2 2.65(1H, m), 3.09(1H, m), 3.36-3.57(8H, m), 3.71(3H, s), 3.85(1H, m), 4.48(2H, m), 4.80(2H, m), 6.83(2H, d, J=8.61Hz), 7.10-7.15(3H, m), 7.33(1H, d, J=8.25hz), 7.41(1H, s), 9.00(1H, br-s), 10.78(1H, br-s) 853 -OMe -NHC(Me)2CH2OH 1.28(6H,s), 2.66(1H, m), 3.11(1H, m), 3.48(2H, d, J=6.03Hz), 8.71(3H, s), 3.84(1H, m), 4.49(2H, m), 4.85(1H, m), 6.83(2H, d, J=8.61Hz), 7.12-7.17(3H, m), 7.54(1h, s), 7.70(1H, d, J=8.58Hz), 7.83(1H, d, J=1.83Hz), 8.98(1H, s), 10.78(1H, s) 863-OPh-NH (CH2) 20Et 1.10 (3H, t, J=6.96Hz), 2.74 (1 H, m), 3.14 (1 H, m), 3.31-3.42 (6H, m), 3.93 (1 H, m), 4.52 (2H, m), 6.91 (2H, d, J=8.61Hz), 6.99 (2H, d, J=7.50Hz), 7.11-7.25 (4H, m), 7.37-7.42 (2H, m), 7.78 (1 H, d, J=8.61 Hz), 7.88 (1 H, s), 8.54 (1 H, m). 9.01 (1 H, s), 10.81 (1 H, s) 864-OMe o 0.88 (6H, m), 1.30 (2H, m), 1.51 (1 H, m), 1.97 (3H, s), 2.69 (1 H, m), 3.12 (1 H, m), 3. 73 (3H, s), 3.88-3.92 (2H, m), 4.07 (1 H, m), 4.27 (1 H, m), 4.52 (2H, m), 6.85 (2H, d, J=7.50Hz), 7.15 (2H, d, J=8.79Hz), 7.22 (1 H, m), CH, 7. 76 (1 H, d, J=8.61 Hz), 7.86 (1 H, s), 8.20 (1H, d, J=8.61Hz), 9.00 (lH, s), 10.79 (1 H, s) CH, 865-OMe 87 (6H, m), 1.39 (2H, m), 1.58 (1H, m), 2.68 (1 H, m), 3.11 (1 H, m), 3.39 (2H, m), 3.73 (3H, s), 3.87 (1 H, m), 4.03 (1 H, m), 4.52 (3H, m), 6.84 (2H, d, YCH, J=8.07Hz), 7.13-7.21 (3H, m), 7.78 (1 H, m), 7.89 (1 H, m), 8.00 (1 H, d, J=8.61 Hz), OH, 9.00 (1 H, br-s), 10.80 (1 H, s) 866-Cl-NHCH2-2-furyl 2.73 (1 H, dd, J=13.9Hz, 9.3Hz), 3.13 (1 H, d, J=l 4.4Hz, 6.6Hz), 3.94 (1 H, dd, J=8.8Hz, 6.4Hz), 4.46 (2H, d, J=5.4Hz), [4.50 (S), 4.72 (d, J=17.9Hz), 4.95 (d, J=1 7. 9Hz)] 2H, 6.26 (1 H, d, J=2.7Hz), 6.38 (1 H, dd, J=3. OHz, l. 6Hz), 7.20 (1 H, d, J=8.6Hz), 7.24 (2H, d, J=8.4Hz), 7.32 (2H, d, J=8.4Hz), 7.56 (1 H, t, J=0.9Hz), 7.79 (1 H, dd, J=8.4Hz, 2. OHz), 7.87 (1 H, d, J=2.2Hz), 8.95 (1 H, t, J=5.4Hz), [8.99 (br), 9.42 (s)] 1 H, [10.78 (br), 10.35 (s)] 1 H.
Example 867 02N step S S st N O OMe N 0 OMe CONHOH CONHOH
Step 1: 7-Amino-2H-2- (4-methoxybenzyl)-1,4-benzo-thiazin- 3 (4H)-one-4-ylacetic acid N-hydroxyamide The product in Example 757 (400mg) was dissolved in MeOH (lOmL) and AcOH (1 mL). 10% Pd/C (200 mg) was added and the reaction mixture was vigorously stirred at r. t. for 5hrs under H2. The catalyst was removed by filtration, and the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography (chloroform/MeOH, 30/1,10/1) to give the product as a pale yellow solid (162mg).
The following compounds listed in the Table 22 were prepared in a similar manner. Table22 1 RR3 S RR; N X RR CONHOH Example RR'RR2 RR3 NMR:'H-NMR (DMSO-d6; 6) No. 867-OMe-H-NH2 2.62 (1 H, m), 3.10 (1 H, m), 3.70 (4H, m), 4.25- 4.80 (2H, m), 5.10 (2H, bs), 6.46 (2H, m), 6.82 (3H, m), 7.11 (2H, d, J=7.5Hz), 8.93,9.32 (1 H , bs), 10.24,10.66 (1 H, bs). 868-OMe-NH2-H 2.60 (1 H, dd, 2Hz), 3.09 (1 H, dd, 5Hz), 3.63 (1 H, J=5.5,9.5Hz), 3.72 (3 H, s), 4.25-4.40 (2H, m), 5.29,5.31 (2H, bs), 6.20- 6.36 (2H, m), 6.83 (2H, m), 6.95 (1 H, m), 7.11 (2H, d, J=8.6Hz), 37 (1 H, bs), l 0. 30,1 0.71 (1 H, bs).
Example 869 rYYYp rYTn HO N O v OMe N3/N 0 v OMe COOEt COOEt step 2 CtSE) 3 step 3 BocHN N O OMe N O v OMe COOEt Step 4 BocHNHan N O OMe CONHOH CONHOH
Step 1: Ethyl 6-azidomethyl-2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3(4H)-one-4-ylacetate Ethyl 6-hydroxymethyl-2N-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetate (1.75 g), prepared by the procedure described in Example 835 (Step 1), was dissolved in THF (16mL), and triethylamine (O. 93ml) and methanesulfonyl chloride (O. 51ml) were slowly added at 0 °C.
The reaction mixture was stirred at 0°C for 2 hrs. The reaction mixture was concentrated under reduced pressure.
The residue was dissolved in DMF (30ml), and sodium azide (636mg) was added at 0 °C. Stirring was continued for lhr at 0 °C and for 2hrs at r. t.. The reaction mixture was diluted with water and extracted with EtOAc. The organic layer was washed with brine, dried over MgS04 and concentrated under reduced pressure. The residue was purified with silica gel column chromatography (eluent: hexane: EtOAc = 5: 1,3: 1). 1.83g of the product was obtained
as oil.
Step 2: Ethyl 6-N-t-butoxycarbonylaminomethyl-2H-2- (4- methoxybenzyl)-1,4-benzothiazin-3 (4H)-one-4-ylacetate The compound obtained in Step 1 (1.07 g) was dissolved in methanol (20 mL) and EtOAc (5 mL). 10% Pd/C (300 mg) was added, and the reaction mixture was vigorously stirred at r. t. for 2hrs under H2. The catalyst was removed by filtration, and the filtrate was concentrated under reduced pressure. The residue was dissolved in MeOH (20 ml), di-t- butyldicarbonate (0.74 g) and NaHC03 (0.21 g) were added at 0 °C. The reaction mixture was stirred at r. t. overnight.
The reaction mixture was diluted with water and extracted with EtOAc. The organic layer was washed with brine, dried over MgS04 and concentrated under reduced pressure. The residue was purified with silica gel column chromatography (Eluent: Hexane/EtOAc, 5/1,3/1,2/1). 0.67g of the product was obtained as oil.
Step 3: 6-N-t-Butoxycarbonylaminomethyl-2H-2- (4- methoxybenzyl)-1,4-benzothiazin-3 (4H)-one-4-ylacetic acid N-hydroxyamide The compound in step 2 was converted to 600mg of the hydroxamic acid by the reactions analogous to those described in Example 777.
Step 4: 6-Aminomethyl-2N-2- (4-methoxybenzyl)-1,4- benzothiazin-3 (4H)-one-4-ylacetic acid N-hydroxyamide hydrochloride To a solution of the compound in step 3 (485 mg) in 4N HCl/dioxane (3 mL) was stirred for lhr at 0 °C. The reaction mixture was diluted with Et20 and the precipitate was filtered and washed with Et20.300mg of the product was obtained as pale yellow solid.
The following compounds listed in the Table 23 were prepared in a similar manner. Table23 1 1 Ru3 s RR2 N 0 RRI CONHOH Example RR'RR2 RR3 NMR :'H-NMR (DMSO-d6; 8) No. 869-OMe-CH2NH2-H 2.62 (1 H, dd, J=9Hz, 14Hz), 3.06 (1 H, dd, J=6,14Hz), 3.71 (3H, s), 3.80 (1 H, dd, J=6, 9Hz), 4.01 (2H, m), 4.48- 5.00 (2H, m), 6.83 (2H, d, J=8.6Hz), 7.09 (2H, d, J=8.6Hz), 7.19 (1 H, m), 7.39 (2H, m), 8.32 (3H, b s), 43 (1 H, bs), 10.30,10.83 (1 H, bs). 870-OMe-CH2NHBoc-H 1.33 (9H, s), 2.57 (1 H, m), 3.06 (1 H, m), 3.66 (3H, s), 3.70 (1 H, dd, J=6,9Hz), 4.05 (2H, bd, J=5.7 Hz),4.3- 4.9 (2H, m), 6.76 (2H, d, J=8.5Hz), 6.88 (1 H, d, J=8Hz), 6.97 (1 H, s), 7.05 (2H, d, J=8.5Hz), 7.25 ( 1 H, d, J=8Hz), 7.34 (1 H, t, J=5.7Hz) m, 33 (1 H, bs), 10. 24,10.69 (1 H, bs). 871-H-CH2NH2-H 2.62 (1 H, dd, 2Hz), 3.09 (1H, dd, 2Hz), 3.81 (1 H, m), 96 (2H, s), 4.44 -4.88 (2H, m), 7.10- 7.24 (6H, m), 7.35 (2H, m), 8.33 (3H, bs), 40 (1 H, bs), 81 (1 H, bs). 872-OMe-H-CH2NH2 2. 59 (1 H, m), 3.09 (1 H, dd, 3.72 (3H, s), 3.83 (1 H, m), 3.96 (2H, s), 6.83 (2H, d, J=8. 5Hz),4.48- 5.00 (2H, m), 7.13 (2H, d, J=8.5Hz), 7.17 (1 H, d, J=8.5Hz), 7.37 (1 H, d, J=8.5), 7.49 (1 H, s), 8.19 (3H, bs), 97 (1 H, bs), 10. 80,10.32 (1 H, bs).
Example 873 Stepw S NC N O OMe \\ <N O oOMe \\-nu COOEt N_NH QCOOEt Step2 N O v-OMe N) ! NH L ""CONHOH
Step 1: Ethyl 6-tetrazolyl-2H-2- (4-methoxybenzyl)-1,4- benzothiazin-3(4H)-one-4-ylacetate Ethyl 6-cyano-2H-2- (4-methoxybenzyl)-1, 4-benzo-thiazln- 3 (4H)-one-4-ylacetate (700 mg) was dissolved in DMF (5 mL), and sodium azide (573 mg), ammonium chloride (641 mg) were added at r. t.. The reaction mixture was stirred at 90°C for 24 hrs, diluted with water (50 ml) and 1N HC1 (5 ml), and extracted with EtOAc. The organic layer was washed with brine, dried over MgS04, and concentrated under reduced pressure. The residue was purified with silica gel column chromatography (Eluent: chloroform/MeOH, 30/1,20/1, chloroform/MeOH/AcOH=20/1/0.1). 800mg of the product was obtained as oil.
Step 2: 6-Tetrazolyl-2H-2-benzyl-1,4-benzothiazin-3 (4H)- one-4-ylacetic acid N-hydroxyamide The compound in step 1 was converted to 594mg of the product by the procedure analogous to Example 777.
The following compounds listed in the Table 24 were prepared in a similar manner. L i ab i e 2 4 RR340 S a ; Q3s RRTable 24 Ru s COOH Example RR'RR2 RR3 NMR: 1H-NMR (DMSO-d6; 8) No. 873-OMe-5-Tetrazolyl-H 2.70 (1 H, dd, 3.11 (1 H, dd, 3.05 (3H, s), 3.94 (dd, 1 H, J=5. 9,9.1 Hz), 4.50-4.97 (2H, m), 6.84 (2H, d, J=8.6Hz), 7.14 (2H, d, J=8.6Hz), 7.60- 7.82 (3H, m), 49 (1 H, bs), 10. 42,10.86 (1 H, bs). 874-H-5-Tetrazolyl-H 2.75 (1 H, dd, J=8Hz, 14Hz), 3.20 (1 H, m), 3.98 (1 H, m), 4.50- 5.10 (2H, m), 7.30 (5H, m), 7.70 (2H, m), 7.82 (1 H, s), 55 (1 H, bs), 10.. 40,10.85 (1 H, bs). 875-OMe-H-5-Tetrazolyl 2.69 (1 H, dd, J=9.2,14Hz), 3.11 (1 H, dd, J=6,14Hz), 3.72 (3H, s), 3.94 (1 H, dd, J=6,9.2Hz ),4.50- 4.98 (2H, m), 6.84 (2H, d, J=8.5Hz), 7.14 (2H, d, J=8.5Hz), 7.35 (1 H, d, J=8.8Hz), 7.94 (1 H, dd, J=2,8.8Hz), 8.07 (1 H, d, J=2Hz), 03 (1 H, bs), l 0. 83,10.40 (1 H, bs),.
Example 876 Stop 1 BocHN I/'B°cHN N N 0 v-OMe 0 OMe NBoc COOEt COOEt Step2 f"T'"T""f"1 -- H2NN/ 1 0 OMe NH L NH CONHOH
Step 1: Ethyl 6- (2,3-di-t-butoxycarbonylguanidino)-methyl- 2H-2- (4-methoxybenzyl)-1,4-benzothiazin-3(4H)-one-4- ylacetate The compound, obtained in Example 869 (Step 2), was dissolved in THF (2 mL) and H20 (0.04 mL). The N, N'-di-t- butoxycarbonyl-S-methylisothiourea (369 mg) and triethylamine (89 ul) were added at r. t. and the stirring was continued for 2hrs at 50 °C. The reaction mixture was concentrated under reduced pressure, and the residue was purified with silica gel column chromatography (Eluent: hexane/EtOAc, 8/1,6/1). 200 mg of the product was obtained as oil.
Step 2: 6-(2, 3-Di-t-butoxycarbonylguanidino) methyl-2H-2-(4- methoxybenzyl)-1,4-benzothiazin-3 (4H)-one-4-yl-acetic acid N-hydroxyamide The compound in step 1 was converted to 510 mg of the hydroxamic acid by the procedure analogous to Example 777.
Step 3: 6-Guanidinomethyl-2N-2- (4-methoxybenzyl)-1,4-
benzothiazin-3 (4H)-one-4-ylacetic acid hydroxyamide The compound in Step 2 (110 mg) was dissolved in TFA (3 ml)-ethanedithiol (100 ul) at 0°C, and stirred at r. t. for lhr. The reaction mixture was diluted with Et20-Toluene (4: 1) and, the product (29mg) was obtained as precipitate.
1H-NMR 62 (lH, dd, J=9Hz, 14Hz), 3.08 (lH, dd, J=6,14Hz), 3.78 (3H, s), 3.78 (lH, dd, J=6Hz, 9Hz), 4.34 (2H, d, J=6Hz) , 4.45-4.90 (2H, m), 6.83 (2H, d, J=8.4Hz), 6.98 (lH, d, J=8Hz), 7.10 (2H, d, J=8.4Hz), 7.16 (lH, s), 7.30 (4H, bs), 7.38 (lH, d, J=8Hz), 8.00 (lH, t, J=6Hz), 8.97,9.42 (lH, bs), 10.31,10.80 (lH, bs) Examplem 877 Step 1 S \ Step 2 S-CI-N \ CI N O N N S S CI St-N N/ CI N O N O COOBu'CONHOH Step 1: 2-Methyl-5H-5- (4-chlorobenzyl)-pyrazolo [4,3- b] thiazin-6 (7H)-one A solution of 5-methylpyrazolo [3, 4-ddithiazolium chloride (930 mg), which was prepared by Chenard's procedure (J. Org. Chem. 49,1224 (1984)), in 20% NaOH aq.
(15 mL) was heated at 80 °C for 1 hr. A solution of 2-bromo- 3- (4-chlorophenyl) propionic acid (1.05 g) in 20% NaOH aq.
(10 mL) was added at 80 °C and the temperature was
maintained at 80 °C for 1.5 hrs. The mixture was cooled to r. t. and concentrated under reduced pressure. The residue was dissolved in acetic acid (50 mL) and heated at 80 °C for 2.5 hours. The reaction mixture was cooled to r. t. and concentrated under reduced pressure. The residue was dissolved in EtOAc and washed with water, 5% Na2C03 aq. and brine. The organic layer was dried over Na2SO4 and concentrated. The residue was purified by recrystallization from Et20 to give the product (512 mg, 44%).
Step 2: t-Butyl 2-methyl-5H-5- (4-chlorobenzyl)- pyrazolo [4,3-b] thiazin-6 (7H)-one-7-ylacetate To a solution of the product of Step 1 (235 mg) in DMF (10 mL), NaH (52 mg, 60% in oil) was added. After 30 minutes'stirring, t-buthyl bromoacetate (203 mg) was slowly added. The reaction mixture was stirred at r. t. overnight. The solvent was removed under reduced pressure and the residue was dissolved in EtOAc and washed with 1N HC1,5% Na2CO3 aq., and brine. The organic layer was dried over Na2SO4 and concentrated. The residue was purified with silica gel column chromatography (eluent: toluene/EtOAc, 20/1) to give the product (O. 33 g, quant.).
Step 3: 2-Methyl-5H-5- (4-chlorobenzyl)-pyrazolo [4,3- b] thiazin-6 (7H)-one-7-ylacetic acid N-hydroxyamide The product of Step 2 (0.32 g) was solved in TFA (15 mL) at r. t.. The mixture was stirred for 2 hours. The
solvent was removed under reduced pressure. The crude product (O. 28 g) was used in the following step without purification.
Isobutyl chloroformate (120 mg) was added dropwise to a THF (10 mL) solution of 2-methyl-5H-5- (4-chlorobenzyl)- pyrazolo [4, 3-b] thiazin-6 (7H)-one-7-ylacetic acid (0.28 g) and N-methylmorpholine (170 mg) at-5 °C. THF (1 mL) solution of O-TMS-hydoxylamine (101 mg) was added after additional 20 minutes'stirring. The mixture was stirred at -5 °C for 2 hrs, gradually warmed to r. t. with stirring, and stood overnight. The reaction mixture was quenched with water and extracted with EtOAc. The organic layer was washed with saturated NaHC03,1N HC1, and brine, dried over Na2S04 and concentrated under reduced pressure. The residue was purified by recrystallization from Et20 to give the hydroxamic acid (221.3 mg, 77% in 2 steps) as a white powder.
The following compounds listed in the Table 25 were prepared in a similar manner. Table 25 s N N N 0 RRi CONHOH Example RR1 NMR :'H-NMR (DMSO-d6; 6) No. 877-Cl 2.79 (1 H, m), 3.17 (1 H, m), 3.74 (3H, s), 3.92 (1 H, m), 4.33 (2H, m), 7.25 (2H, d, J=8.40Hz), 7.34 (2H, d, J=8.25Hz), 7.61 (1 H, s), 8.88 (1 H, s), 10.62 (1 H, s) 878-OPh 2. 77 (1 H, m), 3.17 (1 H, m), 3.74 (3H, s), 3.90 (1 H, m), 4.34 (2H, m), 6.92 (2H, d, J=8.48Hz), 6.99 (2H, d, J=8.60Hz), 7.14 (1 H, m), 7.23 (2H, d, J=8.56Hz), 7.37- 7.42 (2H, m), 7.62 (1 H, s), 8.90 (1 H, s), 10.64 (1 H, s) Example 879 Step 1. Step ci-----------0- N coob cl N-//\N N NH, s Step s But ci 0 S COOH St NvNi CI N O N CONHOH
Step 1: t-Butyl 2- (3-amino-l-methyl-4-pyrazolylthio)-3- (4- chlorophenyl) propanoate A solution of 5-methylpyrazolo [3, 4-d] dithiazolium chloride (880 mg), which was prepared by Chenard's procedure (J. Org. Chem. 49,1224 (1984)), in 20% NaOH aq.
(15 mL) was heated at 90 °C for 1.5 hrs. The mixture was cooled to r. t. and the pH was adjusted to 6.0 with AcOH, and adjusted to 10 by Na2CO3 sat.. To a mixture of the crude product and Na2CO3 (1.20 g), a solution of t-buthyl 2- bromo-3- (4-chlorophenyl) propionate (1.21 g) in DMF (20 mL) was added. The mixture was stirred at r. t. overnight and concentrated under reduced pressure. The residue was dissolved in EtOAc and washed with water and brine. The organic layer was dried over Na2SO4 and concentrated. The residue was purified with silica gel column chromatography (eluent: toluene/EtOAc, 2/1) to give the product (820 mg, 59%).
Step 2: t-Butyl 2- (3-iodo-1-methyl-4-pyrazolylthio)-3- (4- chlorophenyl) propanoate To a solution of isoamyl nitrite (605 mg) in diiodomethane (5 mL) at 100 °C, a solution of the product of Step 1 (380 mg) in dichloromethane (2 mL) were added dropwise. The reaction mixture was stirred at 100 °C for 1 hr. The solvent was removed under reduced pressure. The residue was purified with silica gel column chromatography (eluent: toluene/EtOAc, 20/1) to give the product (417 mg, 84%).
Step 3: Methyl 2- (S)- [2-methyl-5H-5- (4-chlorobenzyl)- pyrazolo [4, 3-b] thiazin-6 (7H)-one-7-yl]-propanoate The product of Step 2 (335 mg) was dissolved in TFA (10 mL). The mixture was stirred at r. t. for 2 hrs. The solvent was removed under reduced pressure. To the solution of the residue (347 mg) and L-alanine methyl esterHCl (215 mg) in DMF (10 mL), Et3N (290 uL), HOBt (235 mg) and EDC HCl (295 mg) were added. The reaction mixture was stirred at r. t. for 2days. The solvent was removed under reduced pressure. The residue was dissolved in EtOAc and washed with 1N HC1,5% Na2C03 aq. And brine. The organic layer was dried over Na2S04 and concentrated. The residue was purified with silica gel column chromatography (eluent: toluene/EtOAc, 2/1) to give the alanine derivative (316 mg, 89% in 2 steps).
To a solution of the alanine derivative (205 mg) and in
DMF (10 mL), K2C03 (112 mg), Cu powder (128 mg) were added.
The reaction mixture was heated to 140 °C and stirred for 3 hrs. The mixture was diluted with EtOAc and filtered. The solvent was removed under reduced pressure. The residue was purified with silica gel column chromatography (eluent: toluene/EtOAc, 10/1) to give the product (128 mg, 83%).
Step 4: 2- (S)-12-Methyl-5H-5- (4-chlorobenzyl)-pyrazolo [4,3- b] thiazin-6 (7H)-one-7-yl]-propanoic acid N-hydroxyamide To a solution of the product of Step 3 (141 mg) in methanol (10 mL), 1N NaOH (2.0 mL) was slowly added at 0 °C. After 30 minutes'stirring, the mixture was warmed to r. t. and left overnight. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in EtOAc and water, washed with 1N HC1 and water. The organic layer was dried over Na2S04 and concentrated. To a THF (10 mL) solution of the crude product (151 mg) and N-methylmorpholine (45 mg), isobutyl chloroformate (61 mg) was added dropwise at-5 °C. THF (0.5 mL) solution of O-TMS-hydoxylamine (51 mg) was added after additional 30 minutes'stirring. The mixture was stirred at-5 °C for 2 hrs, gradually warmed to r. t. with stirring, and stood overnight. The reaction mixture was quenched with water, concentrated under reduced pressure, and dissolved in EtOAc. The organic layer was washed with 1N HC1 and brine, dried over Na2SO4 and concentrated under reduced pressure. The residue was purified by recrystallization from chloroform, Et20, and
hexane to give the hydroxamic acid (110 mg, 78% in 2 steps) as a white powder.
The following compounds listed in the Table 33 were prepared in a similar manner.
Table 33 Example RR1 NMR: 1H-NMR (DMSO-d6; #) No. 1007 (S) -Me 1.45(3H, m), 2.76(1H, m), 3.14(0.5H, m), 3.26(0.5H, m), 3.73(1.5H, s), m), 3.96(0.5H, m), 5.01(0.5H, m), 5.21(0.5H, m), 7.25(2H, d, J=8.43H@ 7.32-7.37(2H, m), 7.59(0.5H, s), 7.62(0.5H, s), 8.76(0.5H, s), 8.78(0.5 1008 (R) -Me 1.45(3H, m), 2.76(1H, m), 3.14(0.5H, m), 3.25(0.5H, m), 3.73(1.5H, s), m), 3.96(0.5H, m), 5.01(0.5H, m), 5.21(0.5H, m), 7.25(2H, d, J=8.43H@ 7.33(2H, m), 7.59(0.5H, s), 7.61(0.5H, s), 8.76(0.5H, s), 8.78(0.5H, s), 1009 (R) -iPr 0.67(3H, m), 1.02(3H, m), 2.72-2.80(2H, m), 3.23(1H, m), 3.74(1.5H,@ m), 4.62(0.5H, d, J=10.62Hz), 4.75(0.5H, d, J=10.62Hz), 7.25(2H, m), 7.35(2H, m), 7.61(0.5H, s), 7.63(0.5H, s), 8.78(0.5H, s), 8.81(0.5H, s), Example 880 OvOvS Step S S Step 1 N O OMe N O OMe H H AlIylO S Step 2 I//Step N O OMe CONHOH HO S 0 oye CONHOH
Step 1: 7-Allyloxy-2H-2- (4-methoxybenzyl)-1, 4-benzothiazin- 3(4H)-one To a solution of 7-metoxymethyloxy-2H-2- (4-methoxy benzyl)-1,4-benzothiazin-3 (4H)-one (1 g) in MeOH (20 ml), 4N HCl-dioxane (2 ml) was added at r. t. and stirring was continued for 24hrs. The reaction mixture was concentrated and Et20 was added. The colorless crystal (800mg) was filtered.
The product was dissolved in DMF (5 mL), and allyl bromide (252 ul) and R2C03 (366 mg) were added at 0 °C. The reaction mixture was stirred at r. t. for 24hrs, diluted with water, and extracted with EtOAc. The organic layer was washed with brine, dried over MgSO4 and concentrated under reduced pressure. The residue was purified with silica gel column chromatography (Eluent: hexane/EtOAc, 4/1,3/1).
560mg of the product was obtained as oil.
Step 2: 7-Allyloxy-2H-2- (4-methoxybenzyl)-1,4-benzothiazin-
3 (4H)-one-4-ylacetic acid N-allyloxyamide The product of Step 1 (560 mg) was converted to 7- allyloxy-2H-2- (4-methoxybenzyl)-1,4-benzothiazin-3 (4H)-one- 4-ylacetic acid N-allyloxyamide as described in Example 777.
The product (650 mg) was obtained as oil.
Step 3: 7-Hydroxy-225r-2-(4-methoxybenzyl)-1,4-benzo-thiazin- 3 (4H)-one-4-ylacetic acid N-hydroxylamide To a solution of the product of Step 2 (650 mg) was dissolved in EtOH (8 ml) and H20 (2 ml), tetrakis- triphenylphosphine palladium (175 mg) and formic acid (108 ul) were added at r. t. The mixture was stirred under reflux for 2hrs. The reaction mixture was diluted with water and extracted with EtOAc. The organic layer was washed with sat. NaHC03, brine, 1N HC1, and brine, dried over MgS04 and concentrated under reduced pressure. The residue was purified with silica gel column chromatography (Eluent: chloroform/MeOH, 50/1,30/1). The oily residue was crystalized in toluene-Et20, and the product (345 mg) was obtained as pale yellow crystal.
The following compounds listed in the Table 26 were prepared in a similar manner. Table 26 1 1 1 Ru3 s RR2> RR CONHOH Example RR'RR2 RR3 NMR :'H-NMR (DMSO-d6;8) No. 880-OMe-H-OH 2.62 (1 H, dd, J=9.3,14Hz), 3.09 (1 H, dd, J=6,14Hz), 3.73 (3H, s), 3.74 (1 H, m), 4.30- 4.74 (2H, m), 6.67 (2H, m), 6.82 (2H, d, J=8.5Hz), 6.94 (1 H, d, J=9Hz), 7.10 (2H, d, J=8.5H z), 95 (1 H, bs), 9.55 (1 H, bs), l 0. 71,10.28 (1 H, bs). 881-OMe-OH-H 2.58 (1 H, dd, J=9.6,14. 5Hz), 3.06 (1 H, dd, 5Hz), 3.69 (3H, s), 3.69 (1 H, m), 4.2- 4.9 (2H, m), 6.47 (1 H, dd, J=2,8.4Hz), 6.53 (1 H, d, J=2Hz), 6.53 (2H, d, J=8.8Hz), 7.09 (3 H, m), 8.97 (1 H, bs), 72 (1 H, s), l 0. 73,10.32 (1 H, bs).
Example 882 F I S 1 N W step l SNS W step 2 N O N O COOMe COOH Step 3 F I S I \ N O N O COOH CONHOH
Step 1: Methyl 7-fluoro-2H-2-benzyl-2-methyl-1,4- benzothiazin-3 (4H)-one-4-yl-acetate Methyl 7-fluoro-2H-2-benzyl-1,4-benzothiazin-3 (4H)- one-4-yl-acetate (100 mg, 0.29 mmol) was dissolved in THF (5 mL) at-78 ° C and lithium hexamethyl disilazane 1M solution in THF (0.64 mmol, 0.64 ml) was added. The mixture was stirred for 1 hr and methyl iodide (39.7 ml, 0.64 mmol) was added. The mixture was allowed to warm to r. t., then poured into saturated solution of sodium carbonate (5 ml), diluted with EtOAc. The 2 layers were separated and the water layer extracted 2 additional times with ethyl acetate. The combined organic layers were dried with MgS04, evaporated and carried out to the next step with no further purification.
Step 2: 7-Fluoro-2H-2-benzyl-2-methyl-1,4-benzo-thiazin- 3 (4H)-one-4-yl-acetic acid Compound in step 1 was dissolved in dioxane (2 ml) and
saturated solution of lithium hydroxide (2 ml). The mixture was stirred at room temperature for 12 hours, then acidified with conc. HC1 and extracted with ethyl acetate, dried with MgS04 and evaporated to give product 3 as a solid.
Step 3: 7-Fluoro-2H-2-benzyl-2-methyl-1,4-benzo-thiazin- 3 (4H)-one-4-yl-acetic acid N-hydroxyamide Acid obtained obtained in step 2 was dissolved in 1 ml of DCM and 1 ml of pyridine. Pentafluorophenol trifluoroacetate (74.7 ml, 0.43 mmol) was added and the mixture stirred at room temperature for 1 hour. Then, O- TBDMSNH2OH (129 mg, 0.87 mmol) was added, the mixture stirred for an additional 12 hours then acidified until pH = 1 with cHCl, diluted with DCM (3 ml) and water (2 ml).
The organic layer was separated and then evaporated, the solid obtained re-dissolved in DMSO and purified using reverse phase HPLC.
Retention time of HPLC analysis: 2.69min Mass: 361.2,328.0 (M. W. =360) Example 883 S S a Step 1 Hz HOOC N O OMe MeHNOC N 0 OMe COOMe COOMe s Stop 2 MeHNOCXS XOMe CONHOH
Step 1: Methyl [2H-2-benzyl-6-N-methylcarbamoyl-3 (4H)-oxo- 1,4-benzothiazine-4-yl]-acetate Methyl [2H-2-benzyl-6-carboxyl-3 (4H)-oxo-1,4- benzothiazine-4-yl] acetate (62mg, 0.17mmol), diisopropyl- ethylamine (45 ml, 0.25 mmol), HOBT (35 mg, 0.25 mmol) and EDC. HC1 (50 mg, 0.25 mmol) were dissolved in DCM (2 ml) and the reaction mixture was stirred at room temperature for 1 hour. Methylamine (64 ml, 0.51 mmol) (8.03 M in ethanol) was added to the mixture and stirring was continued for an additional 12 hours. The reaction mixture was diluted in DCM (5 ml) and washed with 1N HC1 (2 x 2 ml), water (2 ml) and brine (2 ml). The organic layer was concentrated in vaouo and the crude amide was used directly in the next step.
Step 2: [2H-2-Benzyl-6-N-methylcarbamoyl-3 (4H)-oxo-1,4- benzothiazine-4-yll-acetic acid N-hydroxyamide Potassium hydroxide (109 mg, 1.93 mmol) and hydroxylamine hydrochloride (85 mg, 1.22 mmol) were dissolved in methanol (0.53 ml and 0.9 ml respectively) at room temperature. Once a solution was obtained the potassium hydroxide solution was poured into the hydroxylamine solution at 0 °C and the mixture was maintained at this temperature for 1 hour. The precipitate (potassium chloride) was filtered off, the liquid added into the solution of the methyl ester, obtained in step 1,
(in methanol (1 ml) and stirring was continued for an additional 3 hours. Acetic acid (0.5 ml) was added to the mixture and the solvent was evaporated to dryness. The residue was then re-dissolved in water and extracted with ethyl acetate (2 x 3ml). The combined organic extracts were evaporated to dryness, re-dissolved in DMSO and purified vça reverse phase chromatography to yield the major product of the reaction together with small amount of the sulfoxide.
The following compounds listed in the Table 27 and 28 were prepared in a similar manner. Table 27 s N9 0 k I O CONHOH Example RR'RR2 mol. Mass HPLC rt No. weitht (m/e) (min) 883-OMe-NHMe 415.5 2 2.88 884-H-NH (CH2) 20Me 429.5 62 885-H-morpholino 441.5 442.2,409.2 2.71 886-H-NHCH2-cyclopropyl 425.5 2 2.91 887-H-NHCH2-2-furyl 451.5 452.2,419.2 2.93 888-H-NMe2 399.5 8 2.71 889-H-NHiPr 413.5414. 2,381.0 3.85 890-H-NH-cyclopentyl 439.5 2,379 3.99 891-H-NH-3-isoxazolyl-5-Me 452. 5453.2,420.2 3.86 892-H-piperidino 439.5 2 3.96 893-H-NH-3-pyrazolyl 437.5 77 894-H-NHCH2CF3 453.4 0 3.97 895-H-NH (CH2) 20H 415.5 0 3.70 896-H-NHMe 385.4386.2,353.0 3.77 897-H-NH-2-pyridyl 448.5 449.0 2.25 898-H-NH2 371.4372.5,339.0 3.55 899-H-NH-cyclopropyl 411.5 2 3.83 900-OMe-NH-3-pyrazolyI 467. 5 468. 4, 435. 2 2.97 901-OMe-NHPh 477.5 2 3.01 902-OMe-NHCH2CF3 483.5484.3,451.0 2.84 Table 28 RR 3 t o RR 2 N pRR CONHOH Example RR'RR2 RR3 mol. Mass HPLC rt No. weitht (m/e) (min) 903-H-NPr2 455.6 2 2.86 904-H-piperidino 439.5 2 4.02 905-H-piperidino. ° 455.5 9,422.9,405.2 3.95 906-H-NMe2 O 415.5 2,383.2,365.2 3.74 907-H-NMe2 399. 5400.400.367.2 3.73 908-H-NH-cyclopropyl O 427.5 2,395.2 3.72 909-H-NH-cyclopropyl 411. 5 0 3.82 910-H-NHMe 385.4 0 2.88 911-H-NHiPr 413.5 2 3.97 912-H-NH-cyclopentyl O 455.5 2,422.9 3.90 913-H-NH-3-pyrazolyl 0 453.5 4,421.4 3.78 914-H-NH-3-pyrazolyl 437. 5438.438.405.2 3.80 915-H-NH2 371. 4 372.372.339.339. 0 3.62 916-H-NHiPr O 429.5 2,397.5 3.84 917-H-morpholino O 457.5 2,425.2 3.59 918-H-morpholino 441. 5442.442.409.2 3.72 919-H-NHPh O 463.5 2 4. 03 920-H-NHPh 447.5448.0,415.2 4. 10 921-H-NH-2-pyridyl 448. 5 2 3.80 922-H-NHCH2-2-furyl O 467.5 0,434.9,417.0 3.95 923-H-NHCH2-2-furyl 451. 5 2 4.04 924-H-NH-3-isoxazolyl-5-Me O 468.5 469.3,451.0,436.4 2.43 925-H-NH-3-isoxazolyl-5-Me 452. 5 453. 0,420.2 2.56 926 -H -NH-cyclopentyl - 439.5 440.2, 407.2 3.97 927 -H -NHCH2CF3 O 469.4 470.1, 452.0, 437.1 2.43 928 -H -NHCH2CF3 - 453.4 454.2, 421.0 2.54 929 -H -NHCH2-cyclopropyl O 441.5 442.4, 424.0, 409.4 2.39 930 -H -NHCH2-cyclopropyl - 425.5 426.2, 393.2 2.50 931 -H -NH(CH2)2OH O 431.5 432.2, 414.2, 399.0 1.89 932 -H -NH(CH2) - 415.5 416.2, 383,2 2.01 933 -H -OH - 372.4 373.5, 340.0 2.23 934 -H -NH-(R)-2-butyl O 443.5 443.9, 426.2, 410.9 2.46 935 -H -NH-(R)-2-butyl - 427.5 428.2, 395.2 2.59 936 -H -NH-(S)-CH(Me)COOH - 443.5 444.2, 411.2 2.16 937 -H -NH-(S)-ch(iBu)COOH - 485.6 486.2, 453.2 2.56 Example 938 H2N ACHN s Step 1 N O OMe N O OMe COOMe COOMe o Step 2 AcHN S AcHN S N O OMe N O OMe N O OMe N O OYE CONHOH CONHOH
Step 1: Methyl 7-acetoamino-2H-2- (4-methoxybenzyl)-3 (4H)- oxo-1,4-benzothiazine-4-yl-acetate Methyl 7-amino-2H-2- (4-methoxybenzyl)-3 (4H)-oxo-1,4- benzothiazine-4-yl-acetate (63 mg, 0.17 mmol), was dissolved in DCM (2 ml). Triethylamine (24 ml, 0.17 mmol) was added followed by acetyl chloride (12 ml, 0.17 mmol), and the reaction mixture was stirred at room temperature for 1 hour. The reaction mixture was diluted in DCM (5 ml) and washed with saturated Na2CO3 (2 x 2 ml), water (2 ml) and brine (2 ml). The organic layer was concentrated in vacuo and the crude amide was used directly in the next step.
Step 2: [7-Acetoamino-2H-2-benzyl-3 (4H)-oxo-1,4- benzothiazine-4-yl]-acetic acid N-hydroxyamide Potassium hydroxide (109 mg, 1.93 mmol) and hydroxylamine hydrochloride (85 mg, 1.22 mmol) were dissolved in methanol (0.53 ml and 0.9 ml respectively) at room temperature. Once a solution was obtained the potassium hydroxide solution was poured into the
hydroxylamine solution at 0 °C and the mixture was maintained at this temperature for 1 hour. The precipitate (potassium chloride) was filtered off, the liquid added into the solution of the methyl ester obtained in step 1 in methanol (1 ml) and stirring was continued for an additional 3 hours. Acetic acid (0.5 ml) was added to the mixture and the solvent was evaporated to dryness. The residue was then re-dissolved in water and extracted with ethyl acetate (2 x 3ml). The combined organic extracts were evaporated to dryness, dissolved in DMSO and purified by reverse phase chromatography to yield the major product of the reaction together with small amount of the sulfoxide.
The following compounds listed in the Table 29 were prepared in a similar manner. Table 29 RR 4 RR3 I \ S I. RRZ RR CONHOH RRNO k CONHOH ExampleRR'RR2 RR3 RR4 mol. Mass HPLC rt No. weitht (m/e) (min) 938-OMe-H-NHCOCH3 O 431. 5 431.9,414.2,399.02. 60 939-OMe-NHCOEt-H 429. 5 0 2.88 940-H-NHCOtBu-H 427. 5 2 2.98 941-H-NHCOEt-H 0 415.5 2,383.2 2.31 942-H-NHCO-2-pyrazinyl-H O 465.5 2 2.40 943-H-NHCO-2-pyrazinyl-H 449. 5 450. 2,417.2 2.53 944-H-NHCOCH2-C6H4-4-CI-H 496. 0 496.2,463.2 2.95 945-H-NHAc-H 0 401.4 2 2.17 946-H-NHAc-H 385. 4 386. 2,353.0 2.33 947-H-NHBz-H O 463.5 2,431.2 2.62 948-H-NHBz-H 447. 5 448. 0,415.2 2.75 949-H-NHCO-CH2-2-thiophenyl-H 467. 6 468. 2,435.2 2.72 950-H I-NHCOCH2-C6H4-4-OMe-H-491. 6 492. 2,459.2 2.76 951-H-NHCO-2-fu l-H 437. 5 438. 2,405.2 2.60 952-H-NHCOCH2Ph-H O 477.5 2,445.4,427.2 2.65 953-H-NHCOCH2Ph-H 461. 5 462. 2,429.2 2.77 954-H-NHCOEt-H 399.5 2 2.46 955-H-NHCO-4-pyridyl-H O 464.5 9 2.10 956-OMe-H-NHCOtBu 457. 6 458. 2,425.2 3. 48 957-OMe-H-NHCOCH3 415. 5 416. 2, 383. 2 2. 33 958-OMe-H-NHCO-2-pyrazinyl _ 479.5 2 2. 57
Example 959 s I s st Me0 SHN N O OMe MeO2SHN N O OMe COOMe COOMe step2 MeO2SHN N O OMe CONHOH Step 1: Methyl 2H-2- (4-methoxybenzyl)-6-methyl- sulfonylamino-3 (4H)-oxo-l, 4-benzothiazine-4-yl-acetate Methyl 6-amino-2H-2- (4-methoxybenzyl)-3 (4H)-oxo-1,4- benzothiazine-4-yl-acetate (63 mg, 0.16 mmol), was dissolved in DCM (2 ml) and pyridine (0.5 ml). Methyl sulfonylchloride (20 ml, 0.26 mmol) was added and the reaction mixture was stirred at room temperature for 3 hour.
The reaction mixture was diluted in DCM (5 ml) and washed with 1N HC1 (2 x 2 ml), water (2 ml) and brine (2 ml). The organic layer was concentrated in vacuo and the crude sulfonamide was used directly in the next step.
Step 2: 2H-2- (4-methoxybenzyl)-6-methylsulfonylamino-3 (4H)- oxo-1,4-benzothiazine-4-yl-acetic acid N-hydroxyamide Potassium hydroxide (109 mg, 1.93 mmol) and hydroxylamine hydrochloride (85 mg, 1.22 mmol) were dissolved in methanol (0.53 ml and 0.9 ml respectively) at room temperature. Once a solution was obtained the potassium hydroxide solution was poured into the hydroxylamine solution at 0 °C and the mixture was
maintained at this temperature for 1 hour. The precipitate (potassium chloride) was filtered off, the liquid added into the solution of the methyl ester in methanol (1 ml) and stirring was continued for an additional 3 hours.
Acetic acid (0.5 ml) was added to the mixture and the solvent was evaporated to dryness. The residue was then dissolved in water and extracted with ethyl acetate (2 x 3ml). The combined organic extracts were evaporated to dryness, re-dissolved in DMSO and purified by reverse phase chromatography.
The following compounds listed in the Table 30 were prepared in a similar manner. Table30 RR 4 Ru 4 RR ! AS RR2 N ° RR t CONHOH ExampleRR'RR2 RR3 RR mol. Mass HPLC rt No. weitht (m/e) (min) 959-OMe-NHMs-H 451. 5 452. 0,419.02.67 960-OMe-NHTs-H-527.6528.2,495.2 3.09 961-H-NHS02-C6H4-4-CI-H ° 5340 534. 5 5 2.81 w6503.2,470.2 2.48962-H-NHS02-4-isoxazolyl-3, 5-Me2-H-502. 963-H-NHMs-H-421.5422.2,389.2 2.40 964-H-NHS02Ph-H ° 499.6 2,467.1 2.59 965-H-NHS02Ph-H-483.6 0 2.93 966-H-NHS02-C6H4-4-F-H-501.6 2 2.80 967-H-NHS02-C6H4-4-OMe-H 0 529.6530.0,512.2,497.1 2.64 968-H-NHS02-C6H4-4-OMe-H-513.6 2 2.76 969-H-NHS02-2-thiophenyl-H 0 505.6 2,473.1,455.2 2.56 970-H-NHS02iPr-H-449. 6 450. 2,417.2 2.83 971-OMe-H-NHMs 451.5452.1,419.2 2.47
Example 972 HO \NN \ Stem 1y N O OMe N O OMe COOMe COOMe H H Step 2NN N O OMe CONHOH Step 1: Methyl 2H-2- (4-methoxybenzyl)-7- (N'-methylureido)- 3(4H)-oxo-1,4-benzothiazine-4-yl-acetate Methyl 7-amino-2H-2- (4-methoxybenzyl)-3 (4H)-oxo-1,4- benzothiazine-4-yl-acetate (63 mg, 0.16 mmol) was dissolved in DCM (2 ml) and pyridine (0.5 ml). Methyl isocyanate (15 mg, 0.26 mmol) was added and the reaction mixture was stirred at room temperature for 3 hour. The reaction mixture was diluted in DCM (5 ml) and washed with saturated Na2CO3 (2 x 2 ml), water (2 ml) and brine (2 ml). The organic layer was concentrated in vacuo and the crude urea was carried directly to the next step.
Step 2: 2H-2- (4-methoxybenzyl)-7- (N'-methylureido)-3 (4H)- oxo-1,4-benzothiazine-4-yl-acetic acid N-hydroxyamide Potassium hydroxide (109 mg, 1.93 mmol) and hydroxylamine hydrochloride (85 mg, 1.22 mmol) were dissolved in methanol (0.53 ml and 0.9 ml respectively) at room temperature. Once a solution was obtained the potassium hydroxide solution was poured into the
hydroxylamine solution at 0 °C and the mixture was maintained at this temperature for 1 hour. The precipitate (potassium chloride) was filtered off, the liquid added into the solution of the methyl ester, obtained in Step 1, in methanol (1 ml) and stirring was continued for an additional 3 hours. Acetic acid (0.5 ml) was added to the mixture and the solvent was evaporated to dryness. The residue was then dissolved in water and extracted with ethyl acetate (2 x 3ml). The combined organic extracts were evaporated to dryness, re-dissolved in DMSO and purified by reverse phase chromatography.
The following compounds listed in the Table 31 were prepared in a similar manner. Table31 ru 4 f 3 RR22 N : co aRR' CONHOH ExampleRRi RR2 RR3 RR4 mol. Mass HPLC rt No. weitht (m/e) (min) 972-OMe-H-NHCONHMe 430. 5 431. 2,398.2 2.68 973-OMe-NHCONHPh-H 493. 5 9 2.53 974-H-NHCONH-C6H4-4-OMe-H O 508.6 2,476.1 2.61 975-H-NHCONH-C6H4-4-OMe-H 492. 6493.493.460.460. 2 2.73 976-H-NHCONHCH2-C6H4-4-F-H 0 510.5 511. 3,493.4,478.3,460.2 2.66 977-H-NHCONHCH2-C6H4-4-F-H 494. 5 2 2.77 978-H-NHCONH- (R)-CH (Me) Ph-H 490.6 2 2.80 979-H-NHCONHBzl-H 0 492.6 2,460.4,442.2 2.61 980-H-NHCONHBzl-H-476. 6477.477.444.2 2.74 981-H-NHCONH- (R)-CH (Me) Ph-H O 506.6 507.5,489.2,474.6 2.68 982-H-NHCONHMe-H 400.5 2 2.32 983-H H-H O 518.6 2 2.73 ----NH\/N, Ph o 984-OMe-H-NHCONHBu 0 488.6 489.6,471.2,456.6 3.25 985-OMe-H-NHCONHBu 472. 6 473. 2,440.4 2.82
Example 986 HZN S N S UNXn step 1 laNXaOMe N O OMe N O OMe QCOOMe COOMe Ste 2 N s N O OMe CONHOH Step 1: Methyl 7-benzylamino-2H-2- (4-methoxybenzyl)-3 (4H)- oxo-1,4-benzothiazine-4-yl-acetate Methyl 7-amino-2H-2- (4-methoxybenzyl)-3 (4H)-oxo-1,4- benzothiazine-4-yl-acetate (63 mg, 0.17 mmol) and diisopropylethylamine (45.5 ml, 0.27mmol) were dissolved in DCM (2 ml. Benzaldehyde (27 ml, 0.26 mmol) and sodium triacetoxyborohydride (58 mg, 0.26 mmol) were added to the solution resulting in a suspension that was stirred at room temperature for 3 hour. The reaction mixture was diluted in DCM (5 ml) and washed with saturated Na2CO3 (2 x 2 ml), water (2 ml) and brine (2 ml). The organic layer was concentrated In vaouo and the crude amine was used directly in the next step.
Step 2: 7-Benzylamino-2H-2- (4-methoxybenzyl)-3 (4H)-oxo-1,4- benzothiazine-4-yl-acetic acid N-hydroxyamide Potassium hydroxide (109 mg, 1.93 mmol) and hydroxylamine hydrochloride (85 mg, 1.22 mmol) were dissolved in methanol (0.53 ml and 0.9 ml respectively) at
room temperature. Once a solution was obtained the potassium hydroxide solution was poured into the hydroxylamine solution at 0 °C and the mixture was maintained at this temperature for 1 hour. The precipitate (potassium chloride) was filtered off, the liquid added into the solution of the methyl ester, obtained in Step 1, in methanol (1 ml) and stirring was continued for an additional 3 hours. Acetic acid (0.5 ml) was added to the mixture and the solvent was evaporated to dryness. The residue was then dissolved in water and extracted with ethyl acetate (2 x 3ml). The combined organic extracts were evaporated to dryness, re-dissolved in DMSO and purified by reverse phase chromatography.
The following compounds listed in the Table 32 were prepared in a similar manner. Table32 RR3 s RR2 N 0 RRi RR2-kk R CONHOH Example RR'RR2 RR3 mol. Mass HPLC rt No. weitht (m/e) (min) 986-OMe-H-NHBzI 463. 6 464.2,431.2 3.03 987-H-NHBzl-H 433. 5 434.2,401.2 2.90
The results of biological testing of some compounds are described below.
Biological Data Metallo-proteinases used and inhibition assay protocols are described below.
MMP-2 and MMP-9 Both enzymes were commercially available as active forms (Yagai-Cosmobio) and were used for inhibition assays.
MMP-3 (Matrix metalloproteinase-3. Stromelysin-1) C-terminal truncated form of human prostromelysin cDNA (proMMP-3, cDNA sequence in Nature, 348,699-704 (1990)) was subcloned, expressed in E. ooli and purified as described previously (Biochemistry 30,6476-6483 (1991)).
Activation of proMMP-3 was achieved by treatment with 1 mM 4-aminophenylmercuric acetate at 37°C for 60 min.
MMP-13 (Matrix metalloproteinase-13. Collagenase-3) To subclone C-terminal truncated form of procollagenase- 3 (proMMP-13) cDNA (J. Biol. Chem., 269 (24), 16766-16773 (1994)), two synthetic oligonucleotide primer (5'- GGAATTCCATATGCTGCCGCTGCCGAGTGGTGGTGATGAAGATG-3'and 5'- TTTGGATCCTTAGCCGTACAGGCTTTGAATACCTTGTACATCGTCATCAGG- 3' : the former incorporates sequences for a unique NdeI site (underlined) including initial methionine, and the latter has sequences for a stop codon and BamHI site
(underlined)) were used with human chondrocyte cDNA library (CLONTECH) in PCR. With these primers and Peu DNA polymerase (STRATAGENE) in PCR, 767 bp fragment was generated, which encodes 84 amino acid prosequence and 164 amino acids of mature MMP-13. The fragment was digested with NdeI and BamHI, ligated into the NdeI and BamHI sites of pETlla (STRATAGENE), transformed in E. ooli BL21 (DE3) and cultured. The crude cell extract was prepared as described inBioohemistry. Theextractwas dialyzed against 20 mM Tris-HC1 (pH7.2)/5mM CaCl2/0.02% NaN3 and applied to a SP- Sepharose HP column (1.6 x 10 cm, Amersham-Pharmacia Biotech), and elution was performed with 50 mL linear gradient of 0 to 0.3 M NaCl (partially purified proMMP-13 was eluted at 0.2 M approximately). The fraction was dialyzed against 20 mM Tris-HCl (pH7.9)/5mM Cal2,/200 mu (NH4) 2SO4/0.02% NaN3 and applied to a Phenyl Sepharose HP column (1.6 x 5cm, Amersham-Pharmacia Biotech), and elution was performed with 20 mL linear gradient of 0.2 to 0 M (NH4) 2SO4 (pure proMMP-13 was eluted at 50 mM approximately).
The fraction was concentrated by YM-5 ultrafiltration membrane and activated with 4-aminophenylmercuric acetate and active MMP-13 was separated from propeptide fragments by gel filtration chromatography as described in <BR> <BR> <BR> <BR> <BR> Bioohemistly.<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> ibitionassaysagainst^WPs Enzymatic assays were performed in accordance with C. G.
Knight's method (FEBS Lett., 296 (3), 263-266 (1992)). The fluorescent MCA-labeled substrate, (7-methoxyoumaline-4- yl)-Pro-Leu-Gly-Leu-L- [N- (2,4-dinitrophenyl)-L-2,3- diaminopropionyl]-Ala-Arg-NH2 (Peptide Institute. Inc.) was used for measuring the kinetics of inhibition for each tested compound.
The substrate was incubated at 37 °C for 1.5 hours (MMP- 1; for 24 hours) with active MMP (at 20 nM, except MMP-13 at 5 nM) and a test compound in assay buffer containing 100 mM Tris-HCl (pH7.5), 10 mM CaCl2,100 mM NaCl and 0.05% Brij-35. After the mixture was plated at 100 RL/well onto a 96-well microtiter plate and incubated at 37°C, enzymatic activity in the presence of the compound was estimated by measuring the fluorescence intensity (Aw 320nm, X 405nm) and IC50 was determined.
Inhibition against MMP-3 and MMP-13 IC50(µM)Table10 Example MMP3 MMP13 No. 10 31.6 5.3 13.213>50 >50191 42 >10-0.759 0.134460.894 0.249719.071 0.062883.798 92 0.794 0.048 0.2311056.717 109 0. 599 0.043 121 2. 547 0.128 0.0561301.141 143 1. 268 0.064 175 1. 140 0.112 176 1.057 0.100 195 1. 892 0. 119 211 0.895 0.108 2180.4220.056 239 0.274 0.035 255 1.203 0.106 257 0.267 0.023 262 0.850 0. 066 283 0. 614 0.037 306 0. 987 0.122 316 0.442 0.026 324 0. 733 0.063 3290.011 330 0.745 0.066 333 0.794 0.070 361 0. 446 0.053 368 1. 5 0.036 370 1.2 0.035 371 0.88 0.036 378 >50 16 388 23 1.6 389 >50 29 406 3.228 0.257 407 0. 433 0.024 409 0. 279 0. 01'2 0.0634190.514 422 >10 4.815 1.2164235.134 426 0. 375 0. 038 429 5. 616 3.601 0.0134310.238 4360. 9380. 671 0.3754381.665 0.1184412.959 Table(µM)IC50 Example MMP3MMP13 No. 740 0. 459 0.012 0.0194790.27 739 0. 301 0. 017 0.0017850.026 865 0.0049 Table 11 IC50 (RM) Example MMP-2 MMP-9 No. 21 1.0 >1 365 0.32 0.11 368 0.30 <0. 01 369 >1 0. 20
forTumorNecrosisFactor-α(TNF-α)InhibitionELISA <BR> <BR> <BR> <BR> <BR> <BR> <BR> release RAW 267.4 (derived from mouse monocytes) was seeded in RPMI1640 containing 10% of FBS (GIBCO BRL) at 100 ZL/well (5 x 105 cells/mL) onto 96-well microplates and cultured at 37°C, 5% CO2. After culturing for 4 hours, each test compound diluted in RPMI1640 was added at 50 FL/well. 15 minutes later, 4 Rg/RL LPS (DIFCO) diluted in RPMI1640 was added at 50 RL/well and cultured for 24 hours.
TNF-a produced was measured by ELISA as usual. (For example; J. Cellular Physiol. 154,479 (1993)) Absorbance at 450 nm (normalized at 620 nm) was measured and percentage of the amount of TNF-a release for each tested compound (n=2) was determined (0% for untreated control (n=4), and 100% for LPS stimulation (n=4)).
Table 12 Inhibition of TNF production 5µMExampleat No. (%) 36520 36768 36830 38768