Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
IMPROVED VARIANTS OF CELLOBIOHYDROLASE 1
Document Type and Number:
WIPO Patent Application WO/2016/162587
Kind Code:
A1
Abstract:
The present invention concerns variants of cellobiohydrolase, preferably Cbh1, which have greater cellobiohydrolase activity. The invention also relates to a gene construct, a host cell and an enzyme composition comprising said variants. The invention further relates to a method for producing fermentable sugar and a method for producing a bioproduct, such as bioethanol, from cellulose material with the cellobiohydrolase variants, the host cell or the enzyme composition comprising said variants.

Inventors:
DÍEZ GARCÍA, Bruno (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
VALBUENA CRESPO, Noelia (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
REYES SOSA, Francisco Manuel (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
MORENO PÉREZ, Antonio Javier (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
PÉREZ GÓMEZ, Dolores (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
PLATERO GÓMEZ, Ana Isabel (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
MARTÍN PÉREZ, Lucía (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
GAVALDÁ MARTÍN, Sandra (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
VIÑAS DE LA CRUZ, Laura (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
SÁNCHEZ ZAMORANO, Laura (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
ÁLVAREZ NÚÑEZ, Consolación (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
BERMÚDEZ ALCÁNTARA, María de los Ángeles (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
ROCHA MARTÍN, Javier (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
LEDESMA GARCÍA, Laura (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
RAMOS MARTÍN, Juan Luis (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
BENÍTEZ CASANOVA, Laura (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
LÓPEZ MORALES, Macarena (Abengoa Bioenergía Nuevas Tecnologías, S.A.C/ Energia Solar,, Campus Palmas Altas Sevilla, 41014, ES)
Application Number:
ES2016/070243
Publication Date:
October 13, 2016
Filing Date:
April 08, 2016
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
ABENGOA BIOENERGÍA NUEVAS TECNOLOGÍAS, S.A. (C/ Energia Solar, 1Campus Palmas Altas, Sevilla, 41014, ES)
International Classes:
C12N9/24; C12P7/10
Domestic Patent References:
WO2011143632A22011-11-17
Other References:
ADNEY, W.S. ET AL.: "Probing the role of N-linked glycans in the stability and activity of fungal cellobiohydrolases by mutational analysis''.", CELLULOSE., vol. 16, no. 4, August 2009 (2009-08-01), pages 699 - 709, XP019728354
GUSAKOV, A.V. ET AL.: "N-glycosylation in Chrysosporium lucknowense enzymes''.", CARBOHYDRATE RESEARCH., vol. 343, no. 1, 14 January 2008 (2008-01-14), pages 48 - 55, XP022391965
KARNAOURI, A. ET AL.: "Genomic insights into the fungal lignocellulolytic system of Myceliophthora thermophila''.", FRONTIERS IN MICROBIOLOGY., vol. 5, no. 281, 18 June 2014 (2014-06-18), pages 1 - 22, XP055321936
VISSER, H. ET AL.: "Development of a mature fungal technology and production platform for industrial enzymes base don a Myceliophthora thermophila isolate, previously known as Chrysosporium lucknowense Cl''.", INDUSTRIAL BIOTECHNOLOGY., vol. 7, no. 3, June 2011 (2011-06-01), pages 214 - 223, XP055096629
Attorney, Agent or Firm:
PONS ARIÑO, Ángel (Glorieta de Rubén Darío 4, Madrid, 28010, ES)
Download PDF:
Claims:
REIVINDICACIONES

1. Una variante de celobiohidrolasa 1 que comprende una secuencia de aminoácidos que tiene una identidad de secuencia de al menos un 80% con la SEQ ID NO: 2 y comprende una sustitución de aminoácido en la posición N209 correspondiente a las posiciones 1 a 526 de la SEQ ID NO: 2, donde dicha sustitución es por un aminoácido ácido y donde la variante de celobiohidrolasa 1 tiene mayor actividad celobiohidrolasa en comparación con la celobiohidrolasa 1 que consiste en la SEQ ID NO: 3.

2. La variante de celobiohidrolasa 1 de acuerdo con la reivindicación 1 , donde la sustitución del aminoácido es N209D ó N209E.

3. La variante de celobiohidrolasa 1 de acuerdo con cualquiera de las reivindicaciones 1 ó 2, que comprende la secuencia de aminoácidos SEQ ID NO: 6 ó

SEQ ID NO: 9.

4. La variante de celobiohidrolasa 1 de acuerdo con la reivindicación 3, que consiste en la secuencia de aminoácidos SEQ ID NO: 6 ó SEQ ID NO: 9.

5. La variante de celobiohidrolasa 1 de acuerdo con la reivindicación 3, que consiste en la secuencia de aminoácidos SEQ ID NO: 5 ó SEQ ID NO: 8.

6. Una secuencia de ácido nucleico aislada que codifica la variante de celobiohidrolasa 1 de acuerdo con cualquiera de las reivindicaciones 1 a 5.

7. Una secuencia de ácido nucleico aislada complementaria a la secuencia de ácido nucleico de acuerdo con la reivindicación 6. 8. Una construcción génica que comprende la secuencia de ácido nucleico de acuerdo con cualquiera de las reivindicaciones 6 ó 7.

9. La construcción génica de la reivindicación 8, donde la construcción génica es un vector de expresión.

10. Una célula huésped que comprende la construcción génica de acuerdo con cualquiera de las reivindicaciones 8 ó 9.

1 1. La célula huésped de la reivindicación 10, donde dicha célula es Myceliophthora thermophila C1.

12. Una composición enzimática que comprende la variante de celobiohidrolasa 1 de acuerdo con cualquiera de las reivindicaciones 1 a 5. 13. La composición enzimática de la reivindicación 12, que además comprende otras enzimas celulolíticas.

14. La composición enzimática de acuerdo con la reivindicación 13, donde las otras enzimas celulolíticas se seleccionan de la lista que consiste en: endoglucanasas, beta- glucosidasas, celobiohidrolasas, beta-xilosidasas, xiloglucanasas, polisacárido monooxigenasas, xilanasas, arabinofuranosidasas o cualquier combinación de las mismas.

15. La composición enzimática de acuerdo con cualquiera de las reivindicaciones 12 a 14 que además comprende la célula de acuerdo con cualquiera de las reivindicaciones 10 u 11.

16. Un procedimiento para producir azucares fermentables a partir de biomasa celulósica, que comprende: a. Incubar biomasa celulósica con la variante de celobiohidrolasa 1 según cualquiera de las reivindicaciones 1 a 5, con la célula huésped de acuerdo con cualquiera de las reivindicaciones 10 u 11 o con la composición enzimática de acuerdo con cualquiera de las reivindicaciones 12 a 15, y

b. Recuperar los azucares fermentables obtenidos tras la incubación en la etapa (a).

17. Un procedimiento para producir un bioproducto a partir de biomasa celulósica que comprende: a. Incubar biomasa celulósica con la variante de celobiohidrolasa 1 según con cualquiera de las reivindicaciones 1 a 5, con la célula huésped de acuerdo con cualquiera de las reivindicaciones 10 u 1 1 o con la composición enzimática de acuerdo con cualquiera de las reivindicaciones 12 a 15,

b. Fermentar los azúcares fermentables obtenidos tras la incubación de la etapa (a) con al menos un microorganismo termentador, y

c. Recuperar el bioproducto obtenido tras la fermentación en la etapa (b).

18. El procedimiento de acuerdo con la reivindicación 17, donde el bioproducto es etanol.

Description:
VARIANTES MEJORADAS DE CELOBIOHIDROLASA 1

DESCRIPCIÓN La invención pertenece al campo de las enzimas útiles para los procesos de hidrólisis de biomasa celulósica durante la producción de bioproductos, más particularmente, a variantes de la enzima celobiohidrolasa 1 y a su uso en la producción de azúcares fermentables y de etanol a partir de material celulósico. TÉCNICA ANTERIOR

Los biocombustibles suponen una alternativa atractiva a los combustibles fósiles y se pueden obtener mediante la fermentación de azúcares monoméricos derivados del almidón o la celulosa y hemicelulosa.

La biomasa vegetal proporciona una fuente completa de energía potencial en forma de azúcares que se puede utilizar para numerosos procesos industriales y agrícolas, y es por tanto un recurso renovable significativo para la generación de azúcares fermentables que pueden dar como resultado productos finales comercialmente valiosos, tales como los biocombustibles. Sin embargo, la enorme energía potencial de estos hidratos de carbono está actualmente infrautilizada porque los azúcares están formando parte de polímeros complejos que no están fácilmente accesibles para la fermentación. Cualquier biomasa vegetal se puede considerar como materia prima para la producción de biocombustibles como pueden ser cultivos herbáceos, otros restos agrícolas o incluso residuos sólidos urbanos. Estos materiales comprenden principalmente celulosa y hemicelulosa. Una vez que la celulosa y la hemicelulosa se convierten en glucosa y xilosa, respectivamente, por medio de un proceso de hidrólisis enzimática, éstos compuestos son fácilmente fermentados por otros organismos a etanol. De esta manera, cuánta más cantidad de azúcares complejos permanezca al final del proceso hidrolítico, menor será el rendimiento de la producción de etanol al final del proceso de la fermentación. Por tanto, un área de investigación destinada a disminuir los costes y a potenciar el rendimiento de los procedimientos de producción de biocombustible se centra en la mejora de la eficiencia de las enzimas celulolíticas, así como de los cócteles enzimáticos que comprenden dichas enzimas y que se pueden utilizar para generar azúcares fermentables a partir de biomasa. Debido a la complejidad de la biomasa, su conversión en azúcares monoméricos implica la acción de diversos tipos de enzimas con diversas actividades enzimáticas, que digieren celulosa, hemicelulosa, así como otros polímeros complejos presentes en la biomasa. Después de la celulosa, la hemicelulosa es la segunda fracción más abundante disponible en la naturaleza. Tanto la celulosa como la hemicelulosa se pueden tratar previamente, de forma mecánica, química, enzimática o de otros modos, para aumentar su susceptibilidad a la hidrólisis. Tras este proceso de pretratamiento tiene lugar una etapa de sacarificación, que es un proceso enzimático por el cual los hidratos de carbono complejos se degradan en sus componentes monosacáridos. El objetivo de cualquier tecnología de sacarificación es alterar o eliminar los impedimentos estructurales y de composición para la hidrólisis con el fin de mejorar la tasa de hidrólisis enzimática y aumentar los rendimientos de azúcares fermentables a partir de la biomasa, que comprende principalmente, celulosa y hemicelulosa (N. Mosier y col., 2005, Bioresource Technology 96, 673-686). Después de esta etapa de sacarificación se realiza un proceso de fermentación.

Las enzimas individuales han demostrado digerir solo parcialmente la celulosa y la hemicelulosa y, por tanto, se necesita la acción concertada de todas o al menos varias de las enzimas denominadas "celulasas o enzimas celulolíticas" para completar la conversión de los diferentes polímeros complejos, específicamente, celulosa y hemicelulosa, a azúcares monoméricos. Las celulasas (1 ,4-beta-D-glucano-4- glucanohidrolasa, EC 3.2.1.4) comprenden al menos tres actividades enzimáticas, endo-beta-glucanasas (EC 3.2.1.4), exo-beta-glucanasas o celobiohidrolasas (EC 3.2.1.91) y beta-glucosidasas (EC 3.2.1.21), de las que se ha demostrado su actuación sinérgica en la hidrólisis de la celulosa (Woodward, J. 1991 , Bioresource Technology Vol 36, pág. 67-75). Además de estas tres actividades hoy en día se reconocen otras de igual relevancia tales como, xilanasas (E.C. 3.2.1.8), beta-xilosidasas (E.C. 3.2.1.37) y polisacárido mono-oxigenasas (también denominadas PMO, AA9, glicosil hidrolasas de la familia 61 o GH61). La eficacia hidrolítica de un complejo multienzimático, formado por una amplia diversidad de enzimas celulolíticas, en el proceso de sacarificación celulósica depende tanto de las propiedades de las enzimas individuales como de la relación de cada enzima en el complejo.

Las celulasas microbianas se han convertido en el centro de atención como biocatalizadores enzimáticos debido a su naturaleza compleja y a sus extensas aplicaciones industriales. Hoy en día se presta una considerable atención a los conocimientos actuales sobre la producción de celulasas y los retos en la investigación sobre celulasas, especialmente en la dirección de la mejora de la economía de varios procesos industriales, con el fin de obtener celulasas con mayor actividad y mejores propiedades.

Específicamente, la celobiohidrolasa es una enzima que cataliza la hidrólisis de celulosa en celobiosa mediante una actividad exoglucanasa, liberando secuencialmente moléculas de celobiosa a partir de los extremos, reductores o no, de la celulosa o los celooligosacáridos, dejando así la celobiosa accesible para que siga hidrolizándose por betaglucosidasas hasta glucosa. Por ello, se usa ampliamente junto con otras celulasas en procesos para la conversión de la biomasa celulósica en azúcares fermentables.

Existen dos tipos de celobiohidrolasas, la celobiohidrolasa 1 (Cbh1 o Cbhla) y la celobiohidrolasa 2 (Cbh2 o Cbhlla). La primera hidroliza a partir del extremo reductor de la cadena de celulosa. La segunda hidroliza a partir del extremo no reductor de la cadena de celulosa.

Según lo anterior, existe la necesidad de desarrollar nuevas y mejoradas celobiohidrolasas con mayor productividad que mantengan su capacidad hidrolítica durante el curso del proceso de sacarificación, para su uso en la conversión de celulosa en azúcares fermentables. En este sentido, se han diseñado celobiohidrolasas con mejor actividad hidrolítica debido a su menor inhibición por producto (WO2012048171A2, WO2012051055A2).

Sería, por tanto, de utilidad disponer de una celobiohidrolasa con actividad celulolítica mejorada, capaz de producir azúcares fermentables de forma más eficiente, mejorándose así a su vez el rendimiento hidrolítico global de las mezclas enzimáticas que la contuvieran.

DESCRIPCIÓN DE LA INVENCIÓN

La presente invención describe variantes de la enzima celobiohidrolasa 1 (Cbh1), el uso de dichas variantes para la hidrólisis de material celulósico en azúcares fermentables, así como un procedimiento para producir azúcares fermentables y un procedimiento para producir bioproductos, tales como etanol, en los que se emplean dichas variantes.

Por tanto, la presente invención representa una solución a la necesidad de proporcionar variantes de celobiohidrolasa con actividad celulolítica mejorada, útiles para la optimización de la etapa de hidrólisis de material celulósico en azúcares fermentables.

Los inventores han demostrado que las variantes de celobiohidrolasa de la presente invención presentan una mayor actividad celulolítica que la celobiohidrolasa parental a partir de la cual se han obtenido. Así, dichas variantes permiten obtener una mayor cantidad de glucosa liberada al final del proceso hidrolítico por parte de los cócteles enzimáticos que las comprenden, en comparación con los mismos cócteles comprendiendo, en lugar de la variante de la invención, la celobiohidrolasa parental (nativa). Por tanto, su uso dentro de este tipo de composiciones enzimáticas aumenta significativamente el rendimiento de la etapa de hidrólisis, al producirse un aumento de los azúcares monosacáridos liberados al final de la hidrólisis (fundamentalmente glucosa) y con ello un aumento en la producción del bioproducto final, preferiblemente etanol.

Como se muestra en los ejemplos descritos más adelante, las variantes de Cbh1 de la presente invención se expresaron en una célula fúngica hospedadora y la mezcla enzimática producida por la cepa resultante se evaluó en experimentos de sacarificación de biomasa pretratada (PCS), comprobándose un aumento en el rendimiento del proceso de sacarificación, concretamente un aumento en la concentración de azúcares fermentables (glucosa) liberados al final del proceso, en comparación con la misma mezcla enzimática producida por la cepa control no transformada (Fig. 10 y 17).

Por tanto, un primer aspecto de la presente invención se refiere a una variante de celobiohidrolasa 1 (Cbh1 o Cbhla) aislada que comprende una secuencia de aminoácidos que tiene una identidad de secuencia de al menos un 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98% o 99% con la SEQ ID NO: 2 y comprende una sustitución de aminoácido en la posición N209 correspondiente a las posiciones 1 a 526 de la SEQ ID NO: 2, donde dicha sustitución es por un aminoácido ácido y donde la variante de Cbh1 tiene una mayor actividad celobiohidrolasa en comparación con la Cbh1 nativa que consiste en la SEQ ID NO: 3. En lo sucesivo, esta variante será denominada "variante de Cbh1 de la invención".

La "mayor actividad celobiohidrolasa" en comparación con la Cbh1 nativa se mide, preferiblemente, por medio de ensayos de liberación de glucosa a partir de biomasa lignocelulósica tratada con una mezcla enzimática que comprende la variante de Cbh1 de la invención frente a la misma mezcla enzimática que no comprende esta enzima sino la Cbh1 nativa que consiste en la SEQ ID NO: 3 y bajo las mismas condiciones de hidrólisis. Preferiblemente, estos ensayos se llevan a cabo como se explica posteriormente en los ejemplos mostrados más adelante, es decir, en presencia del sustrato Avicel (celulosa microcristalina, el cual es un producto comercialmente disponible) o de paja de maíz, preferiblemente pretratada con ácido diluido y explosión con vapor, como biomasa lignocelulósica de partida y en presencia de un cóctel enzimático secretado por la cepa C1 de Myceliophthora thermophila.

El término "variante", como se usa aquí, se refiere a una enzima que procede de una enzima nativa mediante una o más deleciones, inserciones y/o sustituciones de uno o más aminoácidos y, por tanto, tiene una secuencia diferente a la de la enzima nativa. Como se usa aquí, la expresión "variante de Cbh1 " significa un polipéptido que tiene actividad celobiohidrolasa producido, preferiblemente, por un organismo que expresa una secuencia de nucleótidos codificante para una Cbh1 nativa que ha sido modificada para codificar dicha variante de Cbh1. Dicha secuencia de nucleótidos modificada se obtiene mediante intervención humana mediante modificación de la secuencia de nucleótidos que codifica una Cbh1 nativa. El término "modificación" significa en el presente documento cualquier modificación química de la secuencia de aminoácidos o de ácido nucleico de una Cbh1 nativa.

La expresión "Cbh1 nativa" se refiere a una enzima Cbh1 o su preproteína, expresada por un microorganismo con su secuencia natural sin modificar. Preferentemente, la enzima Cbh1 nativa a la que se hace referencia en la presente invención es expresada por un hongo filamentoso, más preferiblemente por un hongo que pertenece al género Myceliophthora, aún más preferiblemente por Myceliophthora thermophila, aún más preferiblemente la enzima Cbh1 nativa es la enzima de SEQ ID NO: 2 o SEQ ID NO: 3. La SEQ ID NO: 2 es la preproteína de la SEQ ID NO: 3 y contiene un péptido señal correspondiente a los aminoácidos 1 a 17 de la SEQ ID NO: 2 unido a la SEQ ID NO: 3.

Las variantes de la Cbh1 de la invención pueden derivar bien de una librería de mutantes o bien se pueden diseñar por medio de cualquier procedimiento conocido por los expertos en la materia para generar una librería de mutantes de una enzima. Los mutantes que constituyen dicha librería pueden comprender sustituciones, deleciones y/o inserciones de uno o más aminoácidos en sus secuencias de aminoácidos.

La sustitución de aminoácido en la posición N209, correspondiente a las posiciones 1 a 526 de la SEQ ID NO: 2, es por un aminoácido con propiedades ácidas, por ejemplo, Ácido Aspártico, D, o Ácido Glutámico, E. Por tanto, la sustitución de la Asparragina en la posición N209, correspondiente a las posiciones 1 a 526 de la SEQ ID NO: 2, es por aminoácidos que tienen las mismas propiedades, sobre, por ejemplo, las propiedades acidez, hidrofobicidad o aromaticidad, que el aminoácido E (Ácido Glutámico), por ejemplo Ácido Aspártico (D).

Se entiende por "aminoácido ácido" los aminoácidos con cadenas laterales de naturaleza ácida, cargadas negativamente a pH fisiológico. La sustitución de aminoácido de la variante de la invención en la Asparragina de la posición 209 (N209) de la SEQ ID NO: 2 es por un aminoácido ácido, preferiblemente, por Aspártico (D) o Glutámico (E), más preferiblemente Glutámico. Así, una realización preferida se refiere a la variante de Cbh1 de la invención donde la sustitución del aminoácido es N209D ó N209E. Las sustituciones en N209 por otros aminoácidos ácidos distintos a D y E deben permitir que las variantes de Cbh1 de la invención mantengan la misma función que las variantes preferidas N209D y N209E, incluyendo la mejora de su actividad celobiohidrolasa en comparación con la Cbh1 nativa que comprende una N en la posición 209 correspondiente a la SEQ ID NO: 2.

El término "identidad", como se usa aquí, en el contexto de describir dos o más secuencias polipeptídicas, hace referencia a un porcentaje especificado de coincidencias de residuos de aminoácidos en las posiciones desde un alineamiento de dos secuencias de aminoácidos. Los procedimientos de alineamiento de secuencias para comparar son bien conocidos en la técnica. El grado de identidad se puede determinar mediante el método de Clustal (Higgins, 1989, CABIOS 5: 151-153), el método de Wilbur-Lipman (Wilbur y Lipman, 1983, Proceedings of the National Academy of Science USA 80: 726-730), el programa GAG, incluyendo GAP (Devereux et al. 1984, Nucleic Acids Research 12: 287 Genetics Computer Group University of Wisconsin, Madison, (Wl)); BLAST o BLASTN, EMBOSS Needle y FASTA (Altschul et al. 1999, J. Mol. Biol. 215: 403-410). Además, se puede usar el algoritmo de Smith Waterman con el fin de determinar el grado de identidad entre dos secuencias.

Para la comparación de secuencias, típicamente una de las secuencias actúa como secuencia de referencia con la cual se comparan las secuencias "problema". Cuando se usa un algoritmo de comparación de secuencias para determinar su identidad, la secuencia de referencia y la/s secuencia/s problema se introducen en el programa, y se configuran los parámetros del mismo. Se pueden usar los parámetros del programa que aparecen por defecto o bien ser configurados, preferiblemente dichos parámetros serán los que aparecen por defecto. Así, el algoritmo de comparación de secuencias calcula el porcentaje de identidad entre la/s secuencia/s problema y la secuencia de referencia en base a los parámetros del programa. Dos ejemplos de algoritmos que son útiles para determinar el porcentaje de identidad de secuencia son BLAST y BLAST 2.0, descritos en Altschul eí al. (1997) Nucleic Acids Res 25(17):3389-3402 y Altschul et al. (1990) J. Mol Biol 215(3)-403-410, respectivamente. Preferiblemente, el grado de identidad al que se refiere la presente invención se calcula mediante BLAST. El software para llevar a cabo el análisis BLAST se encuentra disponible públicamente en el National Center for Biotechnology Information (NCBI). La variante de Cbh1 de la invención puede exhibir cambios limitados en su secuencia de aminoácidos. Estos cambios deben permitir el mantenimiento de la actividad celobiohidrolasa de la variante de Cbh1 preferida de la invención (la cual comprende la SEQ ID NO: 6 ó la SEQ ID NO: 9) en comparación con la Cbh1 nativa. Estos cambios pueden ser sustituciones, deleciones y/o adiciones. Las sustituciones son por aminoácidos conservados que son aminoácidos con cadenas laterales y propiedades similares con respecto a, por ejemplo, propiedades hidrofóbicas o aromáticas. Estas sustituciones incluyen, pero no se limitan a, sustituciones entre Glu y Asp, Lys y Arg, Asn y Gln, Ser y Thr, y/o entre los aminoácidos incluidos en la lista siguiente: Ala, Leu, Val e lie. Los cambios no conducen a modificaciones relevantes en las características o propiedades esenciales de la variante Cbh1 de la invención.

En una realización más preferida, la variante de Cbh1 de la invención comprende la secuencia de aminoácidos SEQ ID NO: 6 ó SEQ I D NO: 9. Un ejemplo de variante de Cbh1 de la invención que comprende la secuencia de aminoácidos SEQ ID NO: 6 es el polipéptido de SEQ ID NO: 5, que es la preproteína de SEQ ID NO: 6, la cual consiste en un péptido señal correspondiente a los aminoácidos 1 a 17 de la SEQ ID NO: 5 unido a la SEQ ID NO: 6. Un ejemplo de variante de Cbh1 de la invención que comprende la secuencia de aminoácidos SEQ ID NO: 9 es el polipéptido de SEQ ID NO: 8, que es la preproteína de SEQ ID NO: 9, la cual consiste en un péptido señal correspondiente a los aminoácidos 1 a 17 de la SEQ ID NO: 8 unido a la SEQ I D NO: 9. Por tanto, en una realización más preferida, la variante de Cbh1 de la invención consiste en la secuencia de aminoácidos SEQ ID NO: 6 ó SEQ ID NO: 9. Esta SEQ ID NO: 6 corresponde a la Cbh1 madura (sin el péptido señal) de la SEQ ID NO: 5. Dicha secuencia SEQ ID NO: 6 también se denominará en lo sucesivo proteína madura de Cbh1 N209D. La SEQ ID NO: 9 corresponde a la Cbh1 madura (sin el péptido señal) de la SEQ ID NO: 8. Dicha secuencia SEQ ID NO: 9 también se denominará en lo sucesivo proteína madura de Cbh1 N209E. En una realización más preferida, la variante de Cbh1 de la invención consiste en la secuencia de aminoácidos SEQ ID NO: 5 ó SEQ ID NO: 8. Esta SEQ ID NO: 5 corresponde a la Cbh1 nativa de SEQ ID NO: 2 que comprende la sustitución de aminoácido N209D. Como se muestra en los ejemplos más abajo, la sustitución N209D aumenta la actividad hidrolítica de la Cbh1 a lo largo del proceso de sacarificación, aumentando así concentración final de azúcares fermentables en el proceso hidrolítico a partir de material celulósico. Dicha secuencia SEQ ID NO: 5 también se denominará en lo sucesivo preproteína Cbh1 N209D. La SEQ ID NO: 8 corresponde a la Cbh1 nativa de SEQ ID NO: 2 que comprende la sustitución de aminoácido N209E. Como se muestra en los ejemplos más abajo, la sustitución N209E aumenta la actividad hidrolítica de la Cbh1 a lo largo del proceso de sacarificación, aumentando así concentración final de azúcares fermentables en el proceso hidrolítico a partir de material celulósico. Dicha secuencia SEQ ID NO: 8 también se denominará en lo sucesivo preproteína Cbh1 N209E.

El término "pre-proteína" se refiere a un polipéptido que incluye un péptido señal (o secuencia líder) en su extremo amino terminal. Dicho péptido señal es escindido de la pre-proteína por una peptidasa, secretándose así la proteína madura. La porción secretada del polipéptido se denomina "proteína madura" o "proteína secretada". El "péptido señal" es aquel que dirige al polipéptido dentro de la célula hacia su vía de secreción.

La variante de Cbh1 de la invención puede sintetizarse, por ejemplo, pero sin limitaciones, in vitro. Por ejemplo, por medio de la síntesis de péptidos en fase sólida o abordajes de ADN recombinante. La variante de Cbh1 de la invención puede producirse de forma recombinante, incluida su producción como péptido maduro o como una preproteína que incluye un péptido señal.

La preparación de la variante Cbh1 de la invención se puede realizar por cualquier medio conocido en la técnica, tales como modificación de una secuencia de ADN que codifica una Cbh1 nativa, tal como, por ejemplo, pero sin limitarnos, la SEQ ID NO: 1 , que codifica la preproteína de SEQ ID NO: 2, transformación de la secuencia de ADN modificada en una célula huésped adecuada y la expresión de la secuencia de ADN modificada para obtener la variante enzimática. Debido a la degeneración del código genético, varias secuencias de nucleótidos pueden codificar la misma secuencia de aminoácidos. Por tanto, en otro aspecto, la invención proporciona una secuencia de ácido nucleico aislada que codifica la variante de Cbh1 de la invención, en lo sucesivo "secuencia de ácido nucleico de la invención", y la secuencia de ácido nucleico complementaria a la misma. De acuerdo con la presente invención, una "molécula de ácido nucleico aislada", "secuencia de nucleótidos", "secuencia de ácido nucleico" o "polinucleótido" es una molécula de ácido nucleico (polinucleótido) que se ha extraído de su medio natural (es decir, que se ha sometido a manipulación humana) y puede incluir ADN, ARN o derivados de ADN o ARN, incluyendo ADNc. La secuencia de nucleótidos de la presente invención puede estar o no química o bioquímicamente modificada, y se puede obtener artificialmente por medio de clonación, amplificación y procedimientos de selección o síntesis. La secuencia de ácido nucleico de la invención puede codificar el polipéptido maduro o una preproteína que consiste en un péptido señal unido a la enzima madura que tendrá que procesarse después.

La secuencia de nucleótidos de la presente invención también puede comprender otros elementos, tales como intrones, secuencias no codificantes en los extremos 3' y/o 5', sitios de unión al ribosoma, etc. Esta secuencia de nucleótidos también puede incluir secuencias codificantes para aminoácidos adicionales que son útiles para la purificación o estabilidad del péptido codificado.

En una realización preferida, la secuencia de ácido nucleico de la invención es la SEQ ID NO: 4, que es la secuencia de ácido nucleico que codifica la secuencia de aminoácidos de SEQ ID NO: 5 (preproteína de SEQ ID NO: 6). En otra realización preferida, la secuencia de ácido nucleico de la invención es la SEQ ID NO: 7, que es la secuencia de ácido nucleico que codifica la secuencia de aminoácidos de SEQ ID NO: 8 (preproteína de SEQ ID NO: 9). La expresión, "secuencia de ácido nucleico complementaria" de una secuencia de ácido nucleico que codifica la variante de Cbh1 de la invención hace referencia a la secuencia de ácido nucleico de la hebra complementaria a la que codifica la variante de Cbh1 de la invención. Se apreciará que un ADN bicatenario que codifica una secuencia de aminoácidos dada comprende un ADN monocatenario y su hebra complementaria, que tiene una secuencia que es complementaria al ADN monocatenario.

La Tabla 1 muestra una descripción detallada de algunas de las secuencias mencionadas a lo largo de la presente invención. Secuencia DESCRIPCION

SEQ ID NO: 1 Polinucleótido que codifica para la preproteína Cbh1 nativa

SEQ ID NO: 2 Preproteína de la Cbh1 nativa (incluye los 17 aminoácidos correspondientes al péptido señal)

SEQ ID NO: 3 Proteína madura Cbh1 nativa

SEQ ID NO: 4 Polinucleótido que codifica para la preproteína muíante

Cbh1 N209D

SEQ ID NO: 5 Preproteína de la Cbh1 muíante Cbh1 N209D (incluye los 17 aminoácidos correspondieníe al pépíido señal)

SEQ ID NO: 6 Proíeína madura Cbh1 N209D

SEQ ID NO: 7 Polinucleóíido que codifica para la preproíeína muíaníe

Cbh1 N209E

SEQ ID NO: 8 Preproíeína de la Cbh1 muíaníe Cbh1 N209E (incluye los 17 aminoácidos correspondieníe al pépíido señal)

SEQ ID NO: 9 Proíeína madura Cbh1 N209E

Tabla 1. Descripción de algunas de las secuencias mencionadas en la preseníe invención.

La secuencia de ácido nucleico de la invención se puede incluir en una consírucción genéíica, preferiblemeníe en un vecíor de expresión. Dicha consírucción genéíica puede comprender además una o más secuencias reguladoras de la expresión génica, íales como promoíores, íerminadores, eíc. Por íanío, en oíro aspecío, la invención proporciona una consírucción genéíica que comprende la secuencia de ácido nucleico de la invención o la secuencia de ácido nucleico complemeníaria a la misma, en lo sucesivo "consírucción génica de la invención". En una forma de realización preferida, dicha consírucción génica es un vecíor de expresión.

La expresión "consírucción génica" o "consírucción de ácido nucleico" como se usa aquí hace referencia a una unidad funcional necesaria para la íransferencia o la expresión de un gen de iníerés, en el preseníe documenío, la secuencia de ácido nucleico de la invención como se ha descriío, y secuencias reguladoras, incluyendo, por ejemplo, un promoíor, operaíivameníe unidas a la secuencia que codifica la proíeína. Se refiere a una molécula de ácido nucleico bicaíenario, que se encueníra aislada de un ácido nucleico natural o que se modifica artificialmente para que contenga segmentos de ácidos nucleicos. La expresión construcción de ácido nucleico es sinónima a la expresión "cásete de expresión", cuando la construcción de ácido nucleico contiene las secuencias control requeridas para la expresión de la secuencia codificante.

El término "vector de expresión", también conocido como "construcción de expresión" o "plásmido", hace referencia a una molécula de ADN, lineal o circular, que comprende la secuencia de ácido nucleico de la invención y que está operativamente unida a segmentos adicionales que permiten la transcripción del péptido codificado. Generalmente, un plásmido se usa para introducir un gen específico en una célula diana. Una vez que el vector de expresión está en el interior de la célula, la proteína que está codificada por el gen es producida mediante los complejos ribosómicos de la maquinaria de transcripción y traducción celular. Con frecuencia el plásmido se somete a ingeniería genética para que contenga secuencias reguladoras que actúan como regiones potenciadoras y promotoras y que conducen a una transcripción eficiente del gen portado en el vector de expresión. El objetivo de un vector de expresión bien diseñado es la producción de grandes cantidades de ARN mensajero estable y, por tanto, de proteínas. Los vectores de expresión son herramientas básicas de biotecnología y de la producción de proteínas, tales como enzimas. El vector de expresión de la invención se introduce en una célula huésped de modo que el vector se mantiene como integrante cromosómico o como vector autoreplicante extracromosómico. Ejemplos de vectores de expresión son fagos, cósmidos, fagémidos, cromosomas artificiales de levaduras (YAC), cromosomas artificiales bacterianos (BAC), cromosomas artificiales humanos (HAC) o vectores virales, tales como adenovirus, retrovirus o lentivirus. Las construcciones génicas de la presente invención abarcan un vector de expresión, donde el vector de expresión se puede usar para transformar una célula huésped u hospedadora adecuada para que el huésped pueda expresar la variante de Cbh1 de la invención. Los procedimientos para la expresión recombinante de proteínas en hongos y otros organismos son bien conocidos en la técnica y se dispone de numerosos vectores de expresión o se pueden construir usando procedimientos de rutina.

La expresión "secuencias control" se define aquí para incluir todos los componentes que son necesarios o ventajosos para la expresión de la secuencia de ácido nucleico de la presente invención. Dichas secuencias control incluyen, pero sin limitarse, un líder, una secuencia de poliadenilación, una secuencia propéptido, un promotor, una secuencia de péptido señal y un terminador de la transcripción. Como mínimo, las secuencias control incluyen un promotor y señales de terminación de la transcripción y de la traducción. Las secuencias control se pueden proporcionar con ligadores con el fin de introducir sitios de restricción específicos que facilitan la unión de las secuencias control con la región codificante de la secuencia de ácido nucleico de la presente invención. La expresión "operativamente unido" indica en el presente documento una configuración en la que una secuencia control se coloca en una posición adecuada respecto a la secuencia de ácido nucleico de la presente invención, de un modo tal que la secuencia control dirige la expresión de la secuencia de ácido nucleico de la presente invención.

El vector de expresión de la invención puede ser un vector de replicación autónoma, es decir un vector que existe como entidad extracromosómica, cuya replicación es independiente de la replicación del cromosoma, por ejemplo un plásmido, un elemento extracromosómico, un minicromosoma o un cromosoma artificial. El vector puede contener cualquier medio para garantizar la autoreplicación. Como alternativa, el vector puede ser uno que, cuando se introduce en la célula huésped, se integra en el genoma y se replica junto con el(los) cromosoma(s) en el(los) que se ha integrado.

Además se puede usar un único vector o plásmido o dos o más vectores o plásmidos que juntos contienen el ADN total que se va a introducir en el genoma de la célula huésped, o un transposón. Los vectores usados en la presente invención contienen, preferiblemente, uno o más marcadores seleccionares que permitan la fácil selección de las células transformadas, transfectadas, transducidas o similares. Un marcador seleccionare es un producto génico que proporciona resistencia a un biocida o a un virus, a metales pesados, prototrofía a los auxótrofos y similares. Los marcadores seleccionares para usar en una célula huésped de un hongo filamentoso incluyen, pero sin limitarse, AmdS (acetamidasa), ArgB (ornitina carbamoiltransferasa), Bar (fosfinotricina acetiltransferasa), Hph (higromicina fosfotransferasa), NiaD (nitrato reductasa), PyrG (orotidina-5'-fosfato descarboxilasa), CysC (sulfato adeniltransferasa), y TrpC (antranilato sintasa), así como equivalentes de los mismos.

Los vectores usados en la presente invención contienen, preferiblemente, uno o más elementos que permiten la integración del vector en el genoma de la célula huésped o la replicación autónoma del vector en la célula con independencia del genoma. Para la integración en el genoma de la célula huésped, el vector puede depender de la secuencia de ácido nucleico de la presente invención o de cualquier otro elemento del vector para la integración en el genoma mediante recombinación homologa o no homologa. Como alternativa, el vector puede contener secuencias adicionales de nucleótidos para dirigir la integración mediante recombinación homologa en el genoma de la célula huésped en una o más localización(es) precisas en el(los) cromosoma(s).

Para la replicación autónoma, el vector puede comprender además un origen de replicación que permite que el vector se replique de forma autónoma en la célula huésped en cuestión. El origen de replicación puede ser cualquier replicador plasmídico que participe en la replicación autónoma que funciona en una célula. La expresión "origen de replicación" o "replicador plasmídico" se define aquí como una secuencia de nucleótidos que permite que un plásmido o vector se replique in vivo. Ejemplos de orígenes de replicación útiles en una célula fúngica filamentosa son AMA1 y ANS1 (Verdoes et al., 2007, Ind. Biotechnol., 3 (1)).

En la célula huésped se puede insertar más de una copia de la secuencia de ácido nucleico de la presente invención para aumentar la producción del producto génico. Se puede obtener un incremento del número de copias del polinucleótido mediante integración de al menos una copia adicional de la secuencia en el genoma de la célula huésped o incluyendo un gen marcador seleccionare amplificable con el polinucleótido, donde las células que contienen copias amplificadas del gen marcador seleccionare y, por consiguiente, copias adicionales del polinucleótido, se pueden seleccionar cultivando las células en presencia del agente seleccionare adecuado. Los procedimientos usados para ligar los elementos descritos anteriormente para construir los vectores de expresión recombinante a los que se hace referencia en la presente invención son bien conocidos por un experto en la técnica.

En otro aspecto, la invención proporciona una célula huésped que comprende la construcción génica de la invención, en adelante denominada "célula huésped de la invención". Por tanto, dicha célula huésped expresa la variante de Cbh1 de la invención. La "célula huésped", como se usa aquí, incluye cualquier tipo celular que es susceptible de transformación, transfección, transducción y similar con la construcción génica de la invención. La célula huésped puede ser eucariota, tal como una célula de mamífero, insecto, vegetal o fúngica. En una realización preferida, la célula huésped es una célula de hongo filamentoso. Los hongos filamentosos generalmente se caracterizan por una pared miceliar compuesta por quitina, celulosa, glucano, quitosano, mañano y otros polisacáridos complejos. En una realización más preferida, la célula huésped de hongo filamentoso es una célula de Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Gibberella, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, o Trichoderma. En una realización más preferida, la célula huésped de hongo filamentoso es una célula de Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger o Aspergillus oryzae. En otra realización más preferida, la célula huésped de hongo filamentoso es una célula de Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Coprinus cinereus, Coriolus hirsutus, Gibberella zeae, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes vil losa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei o Trichoderma viride. En otra realización aún más preferida, la célula huésped de la invención es cualquier cepa de la especie Myceliophthora thermophila. En una realización aún más preferida, la célula huésped de la invención es la cepa C1 de la especie Myceliophthora thermophila. Se entenderá que, para las especies mencionadas anteriormente, la invención abarca estados tanto perfectos como imperfectos y otros equivalentes taxonómicos, por ejemplo anamorfos, con independencia del nombre de la especie por el que se conocen. Los expertos en la técnica reconocerán fácilmente la identidad de los equivalentes adecuados. Por ejemplo, Myceliophthora thermophila es equivalente a Chrysosporium lucknowense.

El término "expresión" incluye cualquier etapa implicada en la producción de la variante de Cbh1 de la invención, que incluye, pero no se limita a, transcripción, modificación post-transcripcional, traducción, modificación post-traduccional, y secreción.

La variante de Cbh1 de la invención presenta una mayor actividad celobiohidrolasa, por lo que su uso en una composición enzimática para la etapa de hidrólisis del material celulósico en azúcares fermentables en los procesos para la producción de un bioproducto, preferiblemente etanol, es interesante para mejorar la actividad y rendimiento de toda la composición enzimática.

Por tanto, en otro aspecto de la invención se proporciona una composición enzimática que comprende la variante de Cbh1 de la invención, de ahora en adelante conocida como "composición enzimática de la invención". En una realización preferida, la composición enzimática de la invención comprende además otras enzimas celulolíticas. Se debe entender que la variante de Cbh1 de la invención se puede combinar con una o más de las enzimas celulolíticas descritas en el presente documento o con cualquier otra enzima disponible y adecuada para producir una composición multienzimática destinada a la sacarificación de biomasa celulósica. Uno o más componentes de la composición multienzimática (aparte de las enzimas descritas en la presente invención) se pueden obtener o derivar de una fuente microbiana, vegetal o de otro tipo o combinación de las mismas, y contendrán enzimas capaces de degradar el material celulósico. Esta composición de la invención puede comprender además otras actividades enzimáticas, tales como aminopeptidasa, amilasa, carbohidrasa, carboxipeptidasa, catalasa, celulasas tales como endoglucanasas, beta-glucosidasas y/o celobiohidrolasas; quitinasa, cutinasa, ciclodextrina glucosiltransferasa, desoxirribonucleasa, esterasa, alfa-galactosidasa, beta-galactosidasa, glucoamilasa, alfa-glucosidasa, haloperoxidasa, invertasa, lacasa, lipasa, manosidasa, oxidasa, reductasa, enzima pectinolítica, peptidoglutaminasa, peroxidasa, fitasa, polifenoloxidasa, proteasa, ribonucleasa, transglutaminasa, o xilanasa, o cualquiera de sus combinaciones. La(s) enzima(s) adicional(es) se puede(n) producir, por ejemplo, mediante un microorganismo que pertenece al género Aspergillus, tal como Aspergillus aculeatus, Aspergillus awamori, Aspergillus fumigatus, Aspergillus foetidus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, o Aspergillus oryzae; Fusarium, tal como Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium pseudograminearum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sulphureum, Fusarium toruloseum, Fusarium trichothecioides, o Fusarium venenatum; Gibberella, tal como Gibberella zeae; Humicola, tal como Humicola insolens o Humicola lanuginosa; Trichoderma, tal como Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, o Trichoderma viride; Penicilium, tal como Penicillium brasilianum, Penicillium canescens, Penicillium chrysogenum, Penicillium decumbens, Penicillium ethinulatum, Penicillium funiculosum, Penicillium janthinellum, Penicillium pinophilum o Penicillium purpurogenum o Myceliophthora, tal como Myceliophthora thermophila.

La expresión "enzimas celulolíticas", también conocidas como "celulasas" hace referencia a una categoría de enzimas capaces de hidrolizar la celulosa (enlaces β- 1 ,4-glucano o β-D-glucosídico) en oligosacáridos más cortos, como por ejemplo, aunque sin limitarnos, celobiosa y/o glucosa. Ejemplos de enzimas celulolíticas son, pero sin limitarnos, endoglucanasas, beta-glucosidasas, celobiohidrolasas, beta- xilosidasas, alfa-xilosidasas, xiloglucanasas, polisacárido monooxigenasas, xilanasas o arabinofuranosidasas. Por tanto, en una realización más preferida, estas enzimas celulolíticas se seleccionan de la lista que consiste en: endoglucanasas, beta- glucosidasas, celobiohidrolasas, beta-xilosidasas, xiloglucanasas, polisacárido monooxigenasas, xilanasas, arabinofuranosidasas o cualquier combinación de las mismas. Estas enzimas celulolíticas pueden derivar de la célula huésped de la invención u otros microorganismos productores de enzimas celulolíticas distintos a la célula huésped de la invención. Asimismo, se pueden producir de forma natural o recombinante y pueden ser nativas o modificadas para presentar alguna propiedad ventajosa.

El término "endoglucanasa" o "EG" hace referencia a un grupo de enzimas celulasas clasificadas como E.C. 3.2.1.4. Estas enzimas hidrolizan los enlaces β-1 ,4 glucosídicos de la celulosa.

El término "beta-glucosidasa" (E.C. 3.2.1.21), como se usa aquí, se refiere a una enzima que cataliza la hidrólisis de un dímero de azúcar, incluyendo, pero sin limitarnos, celobiosa, con la liberación de un monómero de azúcar correspondiente, la cual se usa, pero sin limitación, para la síntesis de etanol. La enzima beta-glucosidasa actúa sobre los enlaces β1-> 4 que unen dos glucosas o moléculas sustituidas con glucosa (es decir, el disacárido celobiosa). Es una exocelulasa con especificidad por una variedad de sustratos beta-D-glucósido. Cataliza la hidrólisis de residuos terminales no reductores en los beta-D-glucósidos con liberación de glucosa.

El término "beta-xilosidasa" (E.C. 3.2.1.37), se refiere a una proteína que hidroliza los 1 ,4^-D-xilooligómeros cortos en xilosa.

El término "alfa-xilosidasa" (E.C. 3.2.1.177) se refiere a la enzima que facilita la degradación de los residuos no reductores de xiloglucano a xilosa y glucosa.

El término "xilanasa" o "endoxilanasa" (E. C. 3.2.1.8), se refiere a la enzima que cataliza la endohidrólisis de enlaces 1 ,4- β-D-xilosídicos en xilanos. El término "arabinofuranosidasa" (EC 3.2.1.55) se refiere a la enzima que cataliza la hidrólisis de los residuos Alfa-L-arabinofuranosa no reductores terminales en alfa-L- arabinósidos. El término "polisacárido monooxigenasa", "PMO", "Glicosil-hidrolasa de la familia 61" o "GH61" se refiere a una enzima que rompe las cadenas de celulosa por oxidación de sus monómeros de glucosa en los carbonos 1 , 4 y/o 6, la cual al ser incluida en una reacción de sacarificación (por ejemplo, aquella en la que se emplean endoglucanasas, beta-glucosidasas y celobiohidrolasas) resulta en una mayor cantidad (mayor rendimiento) de uno o más azúcares solubles (por ejemplo, glucosa) en comparación con la reacción de sacarificación llevada a cabo bajo las mismas condiciones pero en ausencia de la proteína GH61 o PMO. La actividad PMO puede determinarse mediante, por ejemplo, ensayos oxidativos indirectos que evidencian colorimétricamente el fenómeno de transferencia de electrones utilizando distintos compuestos donadores y aceptores de electrones (Kitt et al., 2012, Biotechnology for Biofuels Vol. 5:79, pág. 1-13). Por otro lado, la eficiencia sobre biomasa se puede medir, por ejemplo, combinando el polipéptido PMO con enzimas celulasas en una reacción de sacarificación y determinando si existe un incremento en el rendimiento de glucosa comparado con la misma reacción de sacarificación llevada a cabo en ausencia de dicho polipéptido.

El término "xiloglucanasa" (EC 3.2.1.151) se refiere a la enzima que hidroliza los enlaces 1 ,4-beta-D-glucosídicos en el xiloglucano.

En una realización preferida, la composición enzimática de la invención comprende además la célula huésped de la invención.

La composición de la invención se puede preparar de acuerdo con los procedimientos conocidos en la técnica y puede estar en forma líquida o tratarse de una composición seca. Las enzimas que se van a incluir en la composición pueden estabilizarse de acuerdo con los procedimientos conocidos en la técnica.

Otro aspecto descrito en la invención se refiere al uso de la célula hospedadora de la invención o de la composición de la invención, para la degradación de biomasa.

La célula hospedadora o la composición de la presente invención, se pueden utilizar para producir, a partir de biomasa vegetal, monosacáridos, disacáridos y polisacáridos como materias primas químicas o de la fermentación para la producción de etanol, plásticos, u otros productos o intermedios.

La célula hospedadora de la presente invención se puede utilizar como fuente de la variante de Cbh1 de la invención y de otros polipéptidos que tienen actividad celulasa, en procesos de sacarificación o degradación o hidrólisis y fermentación de material lignocelulósico.

Por tanto, en una realización preferida, la composición enzimática de la invención es una composición enzimática obtenida (secretada) mediante la célula huésped de la invención. Esta composición puede obtenerse mediante el cultivo de la célula huésped de la invención en condiciones adecuadas para la producción y secreción de enzimas celulolíticas.

Se puede cultivar la célula hospedadora en un medio nutritivo adecuado, sólido o líquido, para la producción de la variante de Cbh1 de la invención, y de toda la composición enzimática de la invención, utilizando procedimientos bien conocidos en la técnica. Por ejemplo, la célula se puede cultivar mediante cultivo en matraz con agitación, y fermentación a pequeña escala o a gran escala (que incluye las fermentaciones continua, discontinua o batch, de alimentación discontinua o fed-batch, o en estado sólido) llevada a cabo en un biorreactor de laboratorio o industrial en un medio adecuado y en condiciones que permitan expresar y/o aislar la variante o la composición. El cultivo tiene lugar en un medio nutritivo adecuado que comprende fuentes de carbono y nitrógeno y sales inorgánicas, utilizando los procedimientos conocidos en la técnica. Si se secreta la variante, junto con otras enzimas celulolíticas en el medio nutritivo, éstas se pueden recuperar directamente del medio.

La variante de Cbh1 de la invención expresada, junto con otras enzimas celulolíticas expresadas, se pueden detectar utilizando procedimientos conocidos en la técnica específicos para polipéptidos. Estos procedimientos de detección pueden incluir el uso de anticuerpos específicos, la formación de un producto de la enzima, o la desaparición de un sustrato de la enzima.

La variante de Cbh1 de la invención resultante, junto con el resto de enzimas celulolíticas secretadas por la célula huésped, se pueden recuperar utilizando procedimientos conocidos en la técnica. Por ejemplo, se pueden recuperar a partir del medio nutritivo mediante procedimientos convencionales que incluyen, pero no se limitan a, centrifugación, filtración, extracción, secado mediante pulverización, evaporación, o precipitación. Las variantes de Cbh1 producidas en la presente invención, junto con otras enzimas celulolíticas secretadas por la célula huésped, se pueden purificar mediante una variedad de procedimientos conocidos en la técnica que incluyen, pero no se limitan a, cromatografía (por ejemplo, intercambio iónico, afinidad, hidrófoba, cromatoenfoque, y exclusión por tamaño molecular), procedimientos electroforéticos (por ejemplo, focalización isoeléctrica preparativa), solubilidad diferencial (por ejemplo, precipitación en sulfato de amonio), SDS-PAGE, o extracción, con el fin de obtener las enzimas sustancialmente puras que se puedan incluir en una composición enzimática.

La degradación o hidrólisis del material celulósico en azúcares fermentables, proceso también conocido como "sacarificación", por medio de la variante de Cbh1 de la invención, la célula huésped de la invención o la composición de la invención, puede acompañarse después de un proceso de fermentación en el que los azúcares fermentables obtenidos se usan con el fin de obtener finalmente un bioproducto tal como bioetanol.

Por tanto, en otro aspecto, la presente invención se refiere a un procedimiento para producir azúcares fermentables a partir de biomasa celulósica, en lo sucesivo "primer procedimiento de la invención", que comprende: a) Incubar la biomasa celulósica con la variante de Cbh1 de la invención, la célula huésped de la invención o la composición enzimática de la invención, y b) Recuperar los azucares fermentables obtenidos tras la incubación en la etapa (a). La expresión "azúcar fermentable", como se usa en el presente documento, se refiere a azúcares simples, tales como glucosa, xilosa, arabinosa, galactosa, mañosa, ramnosa, sacarosa o fructosa.

En otro aspecto, la presente invención se refiere a un procedimiento de producir un bioproducto a partir de biomasa celulósica, en lo sucesivo "segundo procedimiento de la invención", que comprende: a) Incubar la biomasa celulósica con la variante de Cbh1 de la invención, la célula huésped de la invención o la composición enzimática de la invención, b) Fermentar los azúcares fermentables obtenidos tras la incubación de la etapa (a) con al menos un microorganismo termentador, y

c) Recuperar el bioproducto obtenido tras la fermentación en la etapa (b). La expresión "biomasa celulósica" significa la fracción biodegradable de productos, residuos y desechos de origen biológico de la agricultura (incluidos vegetales, tales como residuos de cosechas y sustancias animales), forestales (como recursos madereros) e industrias relacionadas, incluidas pescaderías y acuicultura, así como la fracción biodegradable de residuos industriales y municipales, tales como residuos sólidos municipales o papeleras. En una realización preferida, el material celulósico es paja o fracción orgánica de residuos sólidos municipales. En una realización más preferida, el material celulósico es biomasa vegetal, más preferiblemente seleccionada de la lista que consiste en: biomasa rica en azúcares fermentables, tales como caña de azúcar, biomasa de almidón, por ejemplo, grano de trigo o paja de maíz. Aún más preferentemente, la biomasa vegetal es grano de cereales, tales como almidón, trigo, cebada o mezclas de los mismos.

En algunas realizaciones, el primer y/o segundo procedimiento de la invención comprende, preferiblemente, un proceso de pretratamiento antes de la etapa (a). En general, un proceso de pretratamiento dará como resultado que los componentes de la biomasa celulósica sean más accesibles para las etapas posteriores o sean más digeribles por las enzimas tras el tratamiento en ausencia de hidrólisis. El pretratamiento utiliza diversas técnicas, que incluyen, pero no se limitan a tratamiento químico (por ejemplo, explosión de la fibra con amonio o exposición a un solvente), tratamiento físico (por ejemplo, explosión con vapor a elevadas temperaturas), tratamiento mecánico (por ejemplo, trituración o molienda), tratamiento biológico, o cualquiera de sus combinaciones, para alterar la estructura de la biomasa celulósica y volver la celulosa más accesible. El término "recuperación", como se usa aquí, se refiere a la recuperación de los azúcares fermentables obtenidos tras la incubación en la etapa (a) del primer procedimiento de la invención o del bioproducto obtenido tras la fermentación de la etapa (b) del segundo procedimiento de la invención. La recuperación se puede producir por cualquier procedimiento conocido en la técnica, incluidos mecánicos o manuales.

El término 'termentador o fermentación" tal como se usa aquí, se refiere a un proceso de transformación biológica producido por la actividad de algunos microorganismos en los que los azúcares tales como glucosa, fructosa, y sacarosa se convierten en etanol. Los microorganismos usados de este modo son microorganismos fermentadores que tienen capacidad de fermentación, tales como levaduras de los géneros Saccharomyces, Pichia o Kluyveromyces, preferiblemente Saccharomyces cerevisiae, tanto estirpes naturales fermentadoras de hexosas como modificadas genéticamente para la conversión de pentosas.

En otra realización preferida, las etapas (a) y (b) del segundo procedimiento de la invención se pueden realizar simultáneamente. El término "bioproducto" o "productos biológicos" se refiere a los materiales, químicos y derivados de energía de recursos biológicos renovables. Ejemplos de estos bioproductos son, pero sin limitarnos, compuestos de hidrocarburos en sus diferentes formas, tales como hidrocarburos alifáticos (saturados, insaturados, cíclicos) o aromáticos, como alcanos, alquenos, alquinos, formas cíclicas de estos compuestos o hidrocarburos aromáticos; sustancias oxigenadas como alcoholes, éteres, aldehidos, cetonas o ácidos carboxílicos; sustancias nitrogenadas como aminas, amidas, compuestos de nitrógeno o nitrilos; sustancias halogenadas como haluros. El término "bioproductos" también incluye cualquier combinación de los compuestos descritos arriba, compuestos que además derivan de los compuestos descritos arriba mediante cualquier tipo de tratamiento físico, químico o biológico, polímeros de los compuestos descritos arriba, compuestos descritos anteriormente sustituidos por cualquier grupo o elemento funcional en uno o más de sus enlaces y formas ramificadas de los compuestos descritos arriba. El etanol se puede producir mediante degradación enzimática del material celulósico y la conversión de los sacáridos liberados en etanol. Este tipo de etanol a menudo se denomina bioetanol. Se puede usar como aditivo de combustible o como expansor en mezclas de menos de 1 % y de hasta 100% (un sustituto del combustible).

Por tanto, en una forma de realización más preferida, el bioproducto es biocombustible. El término "biocombustible", como se usa aquí, hace referencia a un hidrocarburo, o una mezcla de los mismos, que se puede usar como combustible y se obtiene usando material celulósico fermentable como material de partida. Ejemplos de biocombustibles incluyen, pero sin limitarse, etanol o bioetanol y biodiésel. En una forma de realización preferida, el biocombustible es bioetanol.

El término "bioetanol" o "etanol" hace referencia a un alcohol realizado mediante fermentación, principalmente a partir de material celulósico fermentable tal como hidratos de carbono producido mediante la variante de Cbh1 de la invención, o cultivos de almidón tales como maíz o caña de azúcar.

Antes (es decir en la etapa (a)) y/o simultáneamente con la fermentación de la etapa (b) del segundo método de la invención, la biomasa, preferiblemente biomasa pretratada, se hidroliza para degradar la celulosa y la hemicelulosa en azúcares y/u oligosacáridos. El contenido en sólidos durante la hidrólisis puede estar, pero sin limitación, comprendido entre el 10-30% del peso total, preferiblemente entre el 15- 25% del peso total, más preferiblemente entre el 18-22% del peso total. La hidrólisis se realiza como un proceso en el que la biomasa, preferiblemente biomasa pretratada, se incuba con la variante de Cbh1 de la invención, con la célula hospedadora de la invención o con la composición de la invención y forman así la solución de hidrólisis. El tiempo de proceso adecuado, la temperatura y las condiciones de pH pueden determinarse fácilmente por un experto en la técnica. Preferiblemente, dicha hidrólisis se realiza a una temperatura entre 25 °C y 60 °C, preferiblemente entre 40 °C y 60 °C, específicamente alrededor de 50 °C. El proceso se realiza preferiblemente a un pH en el intervalo de 4-6,5, preferiblemente pH 4,5-5,5, especialmente alrededor de pH 5,2. Preferiblemente, la hidrólisis se realiza en un tiempo comprendido entre 12 y 144 horas, preferiblemente entre 16 y 120 horas, más preferiblemente entre 24 y 96 horas, incluso más preferiblemente entre 32 y 72 horas. La hidrólisis (etapa (a)) y la fermentación (etapa (b) del segundo método de la invención) pueden realizarse simultáneamente (proceso SSF) o secuencialmente (proceso SHF). De acuerdo con la invención, la biomasa hidrolizada, y preferiblemente pretratada, se fermenta por al menos un microorganismo fermentador capaz de fermentar azúcares fermentables, tales como glucosa, xilosa, mañosa y galactosa directa o indirectamente en el producto de fermentación deseado. La fermentación se lleva a cabo preferiblemente en un tiempo comprendido entre 8 y 96 horas, preferiblemente entre 12 y 72, más preferiblemente entre 24 y 48 horas. En otra realización preferida, la fermentación se realiza a una temperatura entre 20 °C y 40 °C, preferiblemente de 26 °C a 34 °C, en particular alrededor de 32 °C. En otra realización preferida, el pH es de 3 a 6 unidades, preferiblemente de 4 a 5. Se prefiere para la fermentación etanólica una levadura de la especie Saccharomyces cerevisiae, preferiblemente cepas que sean resistentes a altos niveles de etanol, hasta, por ejemplo, el 5 o el 7% en vol. de etanol o más, tal como el 10-15% en vol. de etanol.

A menos que se defina otra cosa, todos los términos técnicos y científicos usados en el presente documento tienen el mismo significado que el que les daría un experto en la técnica a la que esta invención pertenece. En la práctica de la presente invención se pueden usar procedimientos y materiales similares o equivalentes a los descritos en el presente documento. A lo largo de la descripción y las reivindicaciones, con la palabra "comprende" y sus variaciones no se pretende excluir otras características técnicas, aditivos, componentes o etapas. Otros objetos, ventajas y características adicionales de la invención serán obvias para los expertos en la técnica a partir del análisis de la descripción o se pueden aprender mediante la práctica de la invención. Los ejemplos y dibujos siguientes y el listado de secuencias se proporcionan a modo de ilustración y no se pretende que sean limitantes de la presente invención.

BREVE DESCRIPCIÓN DE LAS FIGURAS Fig. 1. Esquema del plásmido 1 que permite clonar los extremos flanqueantes del gen que se pretende delecionar. Incluye como marcador de selección el gen amdS que confiere resistencia a acetamida. El marcador de selección incluye su región promotora (PamdS) y terminadora (JamdS). A ambos lados del gen amdS se encuentran dos regiones REP (repetidas) que permiten, una vez integrado el vector en el genoma y mediante recombinación homologa entre ellas, la eliminación del marcador de selección amdS.

Fig. 2. Esquema del plásmido 2 utilizado para delecionar el gen cbhl. Las regiones aguas arriba (región 5 ' ) y aguas abajo (región 3 ' ) del gen cbhl se han clonado en el plásmido 1.

Fig. 3. Comprobación genética de la deleción del gen cbhl. Amplificación mediante PCR de un fragmento interno de 360pb del gen cbhl. Carril 1 : Marcador, Carril 2: Cepa parental, Carril 3: Cepa Acbhl.

Fig. 4. Electroforesis en gel de poliacrilamida (SDS-PAGE 12 %) del cóctel enzimático de una cepa parental y de la cepa que carece de la enzima celobiohidrolasa. Carril 1 : composición enzimática de la cepa parental, carril 2: marcador de peso molecular y carril 3: composición enzimática de la cepa Acbhl. La flecha indica la altura a la que migra la banda de proteína correspondiente a la enzima Cbhl

Fig. 5. Medida de actividad avicelasa de la enzima Cbhl . Ensayo de actividad avicelasa de los cócteles enzimáticos de la cepa parental de M. thermophila, y otra que carece de dicha enzima (Cepa Acbhl). Todas las mediciones se analizaron por triplicado y las barras de error corresponden a la desviación estándar.

Fig. 6. Ensayo de hidrólisis sobre biomasa lignocelulósica (paja de maíz). Análisis de la liberación de glucosa a partir de biomasa sometida a una composición enzimática celulolítica obtenida a partir de una cepa de M. thermophila que no expresa el gen cbhl (Acbhl), con respecto a la cepa parental de M. thermophila . Todas las mediciones se analizaron por duplicado y las barras de error corresponden a la desviación estándar. Fig. 7. Esquema del plásmido 3 utilizado para expresar el gen cbhl en M. thermophila. Este plásmido contiene el promotor y terminador del gen cbhl, Pcbhl y Jcbhl, respectivamente. Y contiene además el marcador pyr4 para su selección.

Fig. 8. Esquema del plásmido 4 utilizado como base para el banco de mutantes de cbhl. El gen cbhl se clonó en el plásmido 3 aguas abajo de su propio promotor (Pcbhl).

Fig. 9. Ejemplo de los resultados del screening en una placa de microtitulación. En cada placa del screening se representan cada uno de los transformantes frente a la cantidad de glucosa liberada en unidades g/l. Como control, la cepa parental de M. thermophila que expresa el gen cbhl y la cepa delecionada de este gen (Acbhl). Todas las mediciones se analizaron por duplicado y las barras de error corresponden a la desviación estándar.

Fig. 10. Ensayo de hidrólisis sobre biomasa lignocelulósica (paja de maíz) de la cepa de M. thermophila con la enzima Cbhl mutante. Análisis de la liberación de glucosa a partir de biomasa sometida a una composición enzimática celulolítica obtenida a partir de una cepa de M. thermophila que expresa el gen de la Cbhl mutante (Cbhl Mutante), con respecto a la cepa parental de M. thermophila, y a la cepa que no la expresa (Acbhl). Todas las mediciones se analizaron por duplicado y las barras de error corresponden a la desviación estándar.

Fig. 11. Electroforesis en gel de poliacrilamida (SDS-PAGE 12 %) del cóctel enzimático de la cepa parental (Carril 1 ), la cepa Acbhl (carril 2) y la cepa que contiene la enzima mutada (carril 3).

Fig. 12. Representación esquemática del plásmido 5. Plásmido que contiene el gen cbhl mutante en el residuo 209.

Fig. 13. Electroforesis en gel de poliacrilamida (SDS-PAGE 7,5 %) donde se muestran las enzimas Cbhl nativa y el mutante Cbh1 N209D purificadas. Carril 1 : Marcador de peso molecular; Carril 2: enzima Cbhl nativa; Carril 3: enzima mutante Cbh1 N209D.

Fig. 14. Estudio de pH óptimo de la proteína madura Cbh1 N209D frente a la proteína nativa Cbhl . Los tampones empleados para cada pH fueron: pH 4-6 Acetato sódico 200 mM, y pH 6,5-7 Fosfato sódico 200 mM. Todas las mediciones se analizaron por duplicado y las barras de error corresponden a la desviación estándar. Fig. 15. Estudio de estabilidad de la proteína madura Cbh1 N209D frente a la proteína nativa Cbh1. Actividad avicelasa de las muestras Cbh1 nativa y Cbh1 N209D en las condiciones del proceso de hidrólisis expresada en porcentajes. Todas las mediciones se analizaron por duplicado y las barras de error corresponden a la desviación estándar.

Fig. 16. Estudio de estabilidad de la proteína madura Cbh1 N209D frente a la proteína nativa Cbh1 visualizadas en SDS-PAGE desnaturalizante al 7,5 % de poliacrilamida (Carril 1 : Marcador de peso molecular; Carriles 2, 3, 4 y 5: Proteína Cbh1 nativa sin incubar, e incubada durante 24, 48 o 72 h respectivamente; Carriles 6, 7, 8 y 9: Proteína mutante Cbh1 N209D sin incubar, e incubada durante 24, 48 o 72 h respectivamente).

Fig. 17. Liberación de glucosa por cócteles producidos por M. thermophila Acbhl suplementados con proteína Cbh1 nativa o con proteína Cbh1 mutante del residuo N209. De izquierda a derecha se muestra la liberación de glucosa por una cepa parental de M. thermophila, cepa de M. thermophila Acbhl, la cepa anterior suplementada con (1) la Cbh1 purificada de una cepa parental, (2) suplementada con la Cbh1 N209D, (3) o con el mutante N209E. Todas las mediciones se analizaron por duplicado y las barras de error corresponden a la desviación estándar.

EJEMPLOS

Ejemplo 1. Deleción del gen cbhl en Myceliophthora thermophila C1.

Para la construcción de una cepa Acbhl en M. thermophila C1 , lo primero fue la construcción de un plásmido para delecionar el gen cbhl (SEQ ID NO: 1). Dicho plásmido contiene fragmentos aguas arriba y aguas abajo del gen cbhl de tal forma que mediante recombinación homologa con el genoma de M. thermophila C1 , se sustituya el gen cbhl por el marcador de selección clonado entre ambos fragmentos. El fragmento aguas arriba del gen cbhl se amplificó a partir de ADN genómico de M. thermophila C1 (obtenido usando el kit DNeasy Plant Mini Kit de Qiagen) con ADN polimerasa ¡Proof High-Fidelity (BioRad) usando los oligonucleótidos 1 y 2 (SEQ ID NO: 10 y 1 1 respectivamente). Oligonucleótido 1 :

CCGCGGTGGCGGCCGCTCTAGACGCTGCACTGTGGCACGACTACCAGTGATC

(SEQ ID NO: 10)

Oligonucleótido 2:

GCTGCAGCCCGGGGGATCCCCAGGCTAATTGTCGCGTCGCTTCGGACGGACA

(SEQ ID NO: 11) Estos oligos incluyen las secuencias de reconocimiento para las enzimas de restricción Xba\ y BamH\. De la misma forma se amplificó el fragmento aguas abajo del gen cbhl con los oligonucleótidos 3 y 4 (SEQ ID NO: 12 y 13 respectivamente).

Oligonucleótido 3:

CATGGTCATAGAATTCGATATCAACCTCTCTGAAGGAGGTTCTGAGACACGC

(SEQ ID NO: 12)

Oligonucleótido 4:

TGGGTACCGGGCCCCCCCTCGAGCTAGAAGAAGGGCGTAAATAAGAAGCTATAA TAGCTT (SEQ ID NO: 13)

Estos oligonucleótidos incluyen las secuencias de reconocimiento de las enzimas de restricción EcoftV y Xho\. Las condiciones de amplificación para ambos fragmentos fueron un ciclo a 98 °C durante 30 segundos y 35 ciclos de 98 °C durante 10 segundos, 64 °C durante 30 segundos, 72 °C durante 45 segundos y 72 °C durante 10 minutos. Una vez amplificados los fragmentos aguas arriba y aguas abajo del gen cbhl de tamaños correspondientes a 1400 pb cada fragmento, se clonaron en el vector plásmido 1 (Figura 1). Este vector contiene como marcador de selección el gen amdS que confiere capacidad de utilizar la acetamida como fuente de nitrógeno. En primer lugar, el fragmento amplificado correspondiente al extremo 3 ' del gen (situado aguas abajo del mismo) se digirió con las enzimas de restricción EcoR\/-Xho\ y se clonó en el vector plásmido 1 digerido previamente con las mismas enzimas de restricción. La mezcla de ligación se transformó en células electrocompetentes de Escherichia coli XLI Blue MRF siguiendo el protocolo proporcionado por el fabricante (Stratagene). Una vez obtenido este plásmido se continuó clonando el extremo situado aguas arriba del gen cbhl. Para ello el fragmento correspondiente se digirió con las enzimas de restricción Xba\-BamH\ y se clonó en el plásmido donde previamente se había clonado el extremo aguas abajo. La mezcla de ligación se transformó en células electrocompetentes de Escherichia coli XLI Blue MRF siguiendo el protocolo proporcionado por el fabricante (Stratagene). El plásmido obtenido (plásmido 2) se muestra en la Figura 2. El ADN plasmídico para delecionar el gen cbhl se linealizó mediante digestión con las enzimas de restricción Sac\ y Xho\ y se utilizó para transformar células de la cepa M. thermophila C1 (Verdoes et al., 2007, Ind. Biotechnol., 3 (1)). Este ADN se introdujo en la cepa huésped usando un método de transformación en protoplastos (US7399627B2). Los transformantes se sembraron en placas de agar conteniendo 0,6 g/l de acetamida (Merck). Tras 5 días de incubación a 35 °C se analizaron una centena de transformantes que expresaban el gen amdS, y por tanto eran capaces de crecer en presencia de acetamida como única fuente de nitrógeno. Los transformantes obtenidos fueron analizados genéticamente para comprobar si el gen cbhl había sido sustituido por el marcador de selección. Para ello se obtuvo ADN genómico de los transformantes obtenidos (obtenido usando el kit DNeasy Plant Mini20 Kit de Qiagen) y se realizaron distintas PCR de comprobación. La primera PCR se realizó la ADN polimerasa ¡Proof High-Fidelity (BioRad) usando los oligonucleótidos 5 y 6 (SEQ ID NO: 14 y 15 respectivamente) para amplificar un fragmento interno de cbhl de 360 pb. Oligonucleótido 5 AACAAGTGGGATACTTCGTACT (SEQ ID NO: 14)

Oligonucleótido 6 ATCCATGGACACGAAGTAGAG (SEQ ID NO: 15)

Las condiciones de amplificación fueron un ciclo a 95 °C durante 4 minutos y 30 ciclos de 95 °C durante 30 segundos, 55 °C durante 30 segundos, 72 °C durante 30 segundos y 72 °C durante 10 minutos. En este ejemplo se identifican aquellas células huésped que han sido transformadas y que no expresan el gen cbhl (amplificación negativa) frente a aquellas células huésped que expresan dicho gen (amplificación positiva). Estos resultados de amplificación se muestran en la Figura 3. Ejemplo 2. Evaluación de la cepa M. thermophila C1 Acbhl.

Producción de cócteles enzimáticos La producción de cócteles enzimáticos de la cepa parental y la cepa Acbhl se realizó siguiendo la metodología descrita por Verdoes y col. 2007 y Visser y col., 2011 , Ind. Biotechnol. (3). Se produjeron dos cócteles enzimáticos diferentes; un cóctel control y un cóctel Acbhl. El cóctel control consistió en la mezcla de enzimas extracelulares producidas por la cepa M. thermophila C1 no modificada en las condiciones de producción descritas en las referencias proporcionadas anteriormente. En la Figura 4 se muestra la electroforesis en gel de acrilamida en condiciones desnaturalizantes (SDS-PAGE) de las composiciones enzimáticas con y sin Cbh1 , en el que se observa la ausencia de una banda de aproximadamente 66 KDa correspondiente a la enzima Cbh1 glicosilada.

Medida de actividad celobiohidrolasa de un cóctel enzimático producido por M. thermophila C1 Acbhl y su cepa parental

Las celobiohidrolasas (EC 3.2.1.9.1) catalizan la rotura de una molécula de celobiosa en dos moléculas de glucosa. La actividad celobiohidrolasa de los cócteles parental y Acbhl se midió usando el sustrato Avicel (celulosa microcristalina). Para este ensayo de avicelasa las mezclas de la reacción enzimática (1 mi volumen final) contienen 200 L de tampón acetato sódico (pH 5,0, 200 mM), 10 mg de Avicel, y 50 μg del cóctel enzimático. A esta mezcla se le añadió 100 μg de enzima β-glucosidasa para la producción de glucosa a partir de la celobiosa generada por la actividad de las celobiohidrolasas presentes en ambos cócteles enzimáticos. Esta mezcla se incubó a 50 °C durante 120 minutos a 1400 rpm de agitación. La reacción fue detenida incubando la mezcla 10 min a 99 °C. Posteriormente se procedió al centrifugado de las muestras durante 5 min a 4000xg. Para una correcta medida de la concentración de glucosa producida en la reacción enzimática se empleó el método enzimático GOPOD (Glucosa oxidasa/peroxidasa) (Kit de determinación enzimática de glucosa por el kit GOPOD, Megazyme) según especificaciones del fabricante (Figura 5) Una unidad de actividad de hidrólisis sobre Avicel se definió como la cantidad de enzima equivalente a la liberación de 1 μηιοΙ de celobiosa por minuto. La concentración proteica de los cócteles parental y Acbhl fue cuantificada mediante el kit BCA AppliChem (Ref. A7787), previo tratamiento de la muestra con el kit "Compat-Able Protein Assay Preparation Reagent Set (Thermo Scientific Ref. 23215)", ambos según especificaciones del fabricante. Como se observa en la figura 5, la cepa Acbhl muestra menos actividad avicelasa que la cepa parental, la actividad que mantiene es debida a otras celobiohidrolasas presentes en el cóctel.

Evaluación de cepas huésped de M. thermophila que carecen de la celulasa Cbh1 frente a las cepas parentales que sí la contienen

Se comparó la liberación de azúcares fermentables de la cepa de M. thermophila C1 Acbhl con su cepa parental. Como sustrato para la hidrólisis enzimática se empleó biomasa pretratada de maíz ("pretreated corn stover", o PCS). El pretratamiento se realizó mediante un sistema de explosión de vapor (Nguyen et al., 1998, Appl. Biochem. Biotechnol. 70-72), y su análisis composicional se efectuó de acuerdo los procedimientos descritos por NREL en "Standard Biomass AnalyticalProcedures". Con objeto de su uso en la hidrólisis, la biomasa fue previamente neutralizada ajustándose a un pH de 5,5. Para el proceso de hidrólisis enzimática se usaron frascos ISO de 100 mi con 20 g de la mezcla de reacción al 20 % (p/p) de sólidos totales y suplementada con 12 mg de proteína por gramo de glucano del cóctel procedente de las cepas parental y Acbh^ , respectivamente. Los frascos con la mezcla se incubaron durante 72 h a 50 °C con una agitación de 150 rpm en un incubador orbital de 25 mm de diámetro (Infors HT). Una vez realizado el proceso, el contenido de glucosa en las muestras resultantes del hidrolizado (slurry) se analizó mediante HPLC (Agilent Technologies, 1200 Series) usando un detector del índice de refracción (DIR) y una columna Aminex HPX-87 H).

Los resultados obtenidos se muestran en la Figura 6, donde se puede apreciar que la deleción de la Cbh1 provoca un descenso en la capacidad de sacarificación de aproximadamente 20 %, con respecto al control que sí expresa la Cbh1.

Ejemplo 3. Mutaqénesis de cbhl. Construcción de un vector de expresión mutaqénesis, amplificación de los bancos con mutaciones en cbhl. El gen cbhl se amplificó desde ADN genómico con los oligonucleótidos 7 y 8 (SEQ ID NO: 16 y 17 respectivamente), en los que se incluyen secuencias de las enzimas de restricción Ndel y EcoRI en los extremos (Ndel en el extremo 5 ' y EcoRI en el extremo 3 ' ) para clonarse posteriormente en el vector de expresión plásmido 3.

Oligonucleótido 7: (SEQ ID NO: 16) :

CCGACATATGAAGCAGTACCTCCAGTACCTCGC

Oligonucleótido 8: (SEQ ID NO: 17) :

GCTGAATTCTTAGACGTTGACAGTCGAGCCGATGG

Este vector de expresión, contiene aguas arriba la secuencia del promotor de cbhl (Pcbhl, 1796 pb) y aguas abajo la secuencia terminadora del mismo gen (Jcbhl, 1009 pb) además del gen pyr4 (número de acceso en el NCBI XP_003666633.1) de la misma cepa como marcador de selección. El gen pyr4 codifica una orotidina-5 ' - fosfato-decarboxilasa funcional y su vector de expresión permite la complementacion de la auxotrofía de uridina en la correspondiente cepa huésped M. thermophila C1 auxotrófica (pyr4). El vector de expresión (plásmido 3) se muestra en la Figura 7.

El fragmento que contiene el gen cbhl se digirió con las enzimas de restricción Nde\ y EcoRI y se clonó en el plásmido 3 digerido previamente con las mismas enzimas de restricción. El vector de expresión y el gen se ligaron y el producto de la unión se transformó en células electrocompetentes de Escherichia coli XLI Blue MRF. El plásmido final se muestra en la Figura 8. El gen cbhl clonado en plásmido 3 se sometió a mutagénesis al azar mediante amplificación con PCR usando el kit de mutagénesis GeneMorph II EZClone Domain Mutagénesis Kit (Agilent Technologies Inc.). La amplificación mutagénica se realizó usando los oligonucleótidos 9 y 10 (SEQ ID NO: 18 y 19 respectivamente). Oligonucleótido 9 (SEQ ID NO: 18): GTGCTGATCCTCTTCCGTCCCATATG

Oligonucleótido 10 (SEQ ID NO: 19): CTCGAGGTCGACGGTATCGATAAG

El sistema GeneMorph II EZClone Domain Mutagénesis permite diferentes tasas de mutación dependiendo de la cantidad de ADN diana y los ciclos de amplificación usados durante el proceso. Con estas premisas se generó un banco de mutantes a una frecuencia de mutación entre 1 y 4,5 mutaciones/kb. La cantidad de ADN molde inicial fue 0,5 μg del plásmido 4. Las condiciones para la reacción de amplificación fueron un ciclo de 95 °C durante un minuto, seguido de 25 ciclos de 95 °C durante 30 segundos, 60 °C durante 30 segundos y 72 °C durante 1 ,45 minutos. El termociclador se mantuvo a 72 °C durante 10 minutos, seguido de un ciclo de 12 °C. Los productos de PCR correspondiente a versiones mutadas de cbhl se purificaron en gel de agarosa con un kit de extracción de gel QIAquick (Qiagen) y se usaron como megacebadores en una segunda PCR para amplificar el plásmido 4 completo usando las condiciones siguientes: un ciclo a 95 °C durante 1 minuto y 25 ciclos de 95 °C durante 50 segundos, 60 °C durante 50 segundos y 68 °C durante 24 minutos. Se realizó una digestión de las reacciones de amplificación con Dpn\ (10 U/μΙ) durante 2 horas a 37 °C para eliminar el plásmido de expresión parental usado como diana ya que Dpn\ solo reconoce ADN metilado. Por tanto, solo los plásmidos amplificados durante esta segunda reacción de PCR permanecen tras la digestión con Dpn\.

Ambos bancos de mutaciones se transformaron en células ultracompetentes Escherichia coli XL-10 Gold siguiendo el protocolo proporcionado por el fabricante (Agilent Technologies Inc.) y se extrajo el ADN plásmídico con el kit Plasmid Maxi (Omega bio-tek, Inc.) a partir de un total de 7000 colonias transformadas con ambos bancos de mutantes.

Ejemplo 4. Transformación de los bancos de mutantes de cbhl en Myceliophthora thermophila C1 y selección de una versión mejorada de cbhl.

El ADN plásmídico de los bancos de mutantes de cbhl se introdujo en la cepa huésped M. thermophila pyr4 usando un método de transformación en protoplastos (US7399627B2). Los transformantes se sembraron en placas de agar sin suplemento de uridina. Tras 5 días de incubación a 35 °C se analizaron los transformantes prototróficos resultantes mediante ensayos de sacarificación en formato de alto rendimiento o high throughput screening (US7794962B2) en placas de 96 pocilios.

El objetivo de la selección o screening era identificar las versiones mutadas de cbhl con alta liberación de glucosa. En la Figura 9 se muestra un ejemplo de los resultados de liberación de glucosa en una placa de microtitulación obtenida durante la selección. Todos los transformantes que liberaban de media una cantidad de glucosa mayor que dos veces la desviación estándar, con respecto a la producida por el control, se confirmaron en un segundo ensayo en placas de microtitulación.

Algunos de los transformantes positivos se confirmaron mediante fermentación a escala de matraz, y la producción de los cóctel enzimáticos de interés y su evaluación por sacarificación de biomasa pretratada fueron realizados tal y como se ha indicado previamente.

La Figura 10 muestra los resultados de liberación de glucosa a partir de biomasa sometida a la composición enzimática obtenida a partir de la célula de M. thermophila que exprexa el gen de la Cbh1 muíante con respecto a la cepa parental y a la cepa de que no expresa la enzima (Acbhl), donde puede apreciarse un mayor rendimiento de sacarificación por parte de la mezcla conteniendo la Cbh1 muíante. Las electroforesis en condiciones desnaíuralizaníes (SDS-PAGE) de los cócíeles producidos por la cepa pareníal, la cepa que no expresa la enzima y la cepa que expresa la Cbh1 muíaníe pueden verse en la Figura 1 1. Para deíerminar la secuencia del gen cbhl expresado, se amplificó el fragmenío de ADN correspondieníe al gen cbhl muíaníe a partir del ADN genómico usando los oligonucleóíidos 9 y 10 (SEQ ID NO: 18 y 19 respecíivameníe).

Los oligonucleóíidos 9 y 10 se usaron para amplificar el caseíe Pcbh1-cbh1 usando ADN genómico de los íransformaníes seleccionados por su mayor acíividad en sacarificación (obíenido usando el kií DNeasy Plañí Mini Kií de Qiagen) con la ADN polimerasa ¡Proof High-Fideliíy (BioRad). La amplificación se realizó medianíe un ciclo a 98 °C duraníe 2 minuíos y 35 ciclos de 98 °C duraníe 10 segundos, 60 °C duraníe 30 segundos y 72 °C duraníe 2, 15 minuíos. El íermociclador se maníuvo a 72 °C duraníe 10 minuíos, seguido de un ciclo de maníenimienío a 12 °C. El fragmenío de ADN amplificado se digirió con las enzimas de resíricción Nde\ y EcoR\ y se clonó en plásmido 3 digerido previameníe con las mismas enzimas de resíricción. La mezcla de ligación se íransformó en células elecírocompeíeníes de Escherichia coli XLI Blue MRF siguiendo el proíocolo proporcionado por el fabricaníe (Síraíagene). Ambas cadenas de las versiones del gen cbhl mutadas se secuenciaron por el método Sanger. El gen mutado mostró la mutación puntual que implicada el cambio de una adenina (en la posición +692) de la secuencia de nucleótidos de cbhl nativo SEQ ID NO: 1 , por una guanina, resultando la secuencia de nucleótidos de SEQ ID NO: 4. Esa secuencia codifica para una proteína SEQ ID NO: 5 en la que la asparragina (N) en el residuo 209 de la proteína nativa de SEQ ID NO: 2 se había intercambiado por ácido aspártico (D). El plásmido 5 (Figura 12) se transformó en M. thermophila C1 con el fin de confirmar el fenotipo de mejora de liberación de glucosa. Ejemplo 5. Análisis comparativo de la proteína purificada Cbh1 N209D frente a la proteína nativa Cbhl

Purificación de las enzimas Cbhl nativa y del mutante Cbh1 N209D Tanto la enzima nativa Cbhl madura (SEQ ID NO: 3) como la proteína madura de Cbh1 N209D (SEQ ID NO: 6) se purificaron usando una cromatografía de intercambio iónico. Las muestras se prepararon centrifugando los caldos extracelulares a 21.000xg durante 45 minutos. Los sedimentos se descartaron y los sobrenadantes se filtraron a través de un filtro de nylon de 0,45 μηι (VWR). Las preparaciones enzimáticas resultantes y diluidas 1 :2 en H 2 0 desionizada tipo I (muestras de 5 g) se introdujeron en una columna HiLoad 26/10 Q-Sepharose HP (GE Healthcare) equilibrada con el tampón Tris-HCI 50 mM, a pH 7,0. La columna se lavó con el tampón de partida y las proteínas unidas eluyeron con un gradiente de NaCI a un caudal de 5 mi min "1 usando un perfil de elución lineal de 0 a 30 %. Las distintas muestras obtenidas durante la elución fueron analizadas en geles de poliacrilamida desnaturalizantes. Se seleccionaron aquellas fracciones enriquecidas en la banda esperada de 66 KDa, y que mostraron actividad avicelasa. A las fracciones anteriormente escogidas se les añadió sulfato amónico al 30 % y fueron introducidas en una columna de interacción hidrofóbica HiLoad 26/10 Phenyl-Sepharose HP (GE Healthcare), previamente equilibrada con el tampón Fosfato sódico 100 mM, 1 M sulfato amónico, a pH 7,0. La columna se lavó con el tampón de partida y las proteínas unidas eluyeron con un gradiente descendente de Sulfato amónico a un caudal de 5 mi min "1 usando un perfil de elución lineal de 0 a 100 %. Se obtuvieron muestras de las proteínas Cbhl parental y mutante Cbhl N209D con un grado de pureza > 95 %. Como se muestra en la figura 13, tras una electroforesis en condiciones desnaturalizantes (SDS-PAGE) tanto la proteína Cbh1 parental como la muíante Cbh1 N209D muestran la misma masa molecular. Caracterización de pH óptimo de la enzima Cbh1 N209D

Para la determinación del pH óptimo de la proteína Cbh1 N209D frente a la proteína Cbh1 nativa, se utilizó el ensayo avicelasa variando el tampón para cambiar el pH de la reacción. En este caso, se emplearon tampones similares para el estudio de la actividad de dichas enzimas en una franja de pH de 4-7. Los valores de actividad avicelasa fueron representados como porcentaje relativo en comparación con la mayor actividad obtenida en cada caso.

Como se observa en la figura 14, ambas proteínas mostraron una franja de pH óptimo similar en presencia de avicel y un máximo de actividad a pH 4,5-5.

Caracterización de la estabilidad de la enzima Cbh1 N209D durante el proceso de sacarificación de biomasa La estabilidad de las enzimas Cbh1 y de Cbh1 N209D purificadas se analizó en condiciones del proceso de hidrólisis mediante el ensayo de avicel. Para la determinación de la estabilidad a lo largo de este proceso, las enzimas purificadas se diluyeron a la misma concentración en tampón acetato sódico 200 mM pH 5, y fueron incubadas con una agitación de 150 rpm en un incubador orbital de 25 mm de diámetro (Infors HT) durante 72 h a 50 °C, tomándose muestras a 0, 24, 48 y 72 h.

Posteriormente se realizaron ensayos de avicelasa, y la actividad se representó como porcentaje relativo en comparación con la actividad de la muestra inicial. Las muestras de los distintos tiempos del proceso fueron también analizadas mediante gel desnaturalizante SDS-PAGE. Como se observa en la figura 15, ambas proteínas retuvieron el 100 % de su actividad durante todo este proceso descrito, lo que coincide con el patrón observado en el gel de poliacrilamida (figura 16) en el que se confirma que ninguna de las dos proteínas sufre aparentemente ninguna variación. Ejemplo 6. Evaluación de la enzima mutante Cbh1 N209D en comparación con la enzima Cbh1 silvestre de M. thermophila C1.

Se comparó la liberación de azúcares fermentables de la cepa de M. thermophila C1 Acbhl suplementada con la enzima mutante Cbh1 N209D, frente a la misma cepa suplementada con la proteína Cbh1 parental. Como se indica anteriormente, se empleó biomasa pretratada de maíz ("pretreated corn stover", o PCS) como sustrato para la hidrólisis enzimática, y se realizó el proceso de hidrólisis usándose una mezcla de reacción al 20 % (p/p) de sólidos totales y suplementada con 12 mg de proteína/g glucano en el caso de los cócteles procedentes de las cepas parental y Acbhl, y con 9,6 mg/g glucano más 2,4 mg/g glucano de la proteína purificada correspondiente en cada caso. Los tubos con la mezcla se incubaron durante 72 h a 50 °C con una agitación de 150 rpm en un incubador orbital de 25 mm de diámetro (Infors HT). Una vez finalizado el proceso, el contenido de glucosa en las muestras resultantes del hidrolizado (slurry) se analizó mediante HPLC como se ha indicado previamente.

Los resultados obtenidos se muestran en la figura 17, donde se puede apreciar que la adición de la proteína Cbh1 N209D libera aproximadamente 4 % más de glucosa que la proteína parental. La adición de una proteína en la que el cambio de aminoácido N209 se realizó por otro aminoácido ácido (N209E), produjo un aumento en la liberación de glucosa de 7 % con respecto a la proteína parental.